Linker
A linker with multiple puromycin-like substances facilitates the linkage of multiple translation products to mRNA, improving peptide recovery and selection efficiency through multivalent interactions.
Patent Information
- Application Number
- JP2025130592
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-04-28
- Filing Date
- 2025-08-05
- Publication Date
- 2025-10-28
AI Technical Summary
Existing puromycin-like substance-mediated display methods can only link one translation product to one nucleic acid, limiting the efficiency and versatility of peptide selection and recovery.
A linker structure capable of binding to genetic information material and containing multiple puromycin-like substances, allowing multiple translation products to be linked to one mRNA, which is synthesized through a cell-free translation system.
Enables multivalent interactions with target substances, enhancing the efficiency of peptide recovery and selection by conferring avidity effects, particularly in cell-free translation system display methods and affinity selection processes.
Smart Images

Figure 2025163190000008 
Figure 2025163190000009 
Figure 2025163190000010
Abstract
Description
[Technical Field]
[0001] The present invention relates to a linker comprising a binding moiety having a structure capable of binding to a desired genetic information material; and at least two or more puromycin-like substances, use of the linker, a genetic information material-linker conjugate comprising the linker, a genetic information material-linker-peptide conjugate comprising the linker, etc. [Background technology]
[0002] 1. Display method Genotype-phenotype matching techniques, which emerged as tools for evolutionary molecular engineering, are also called display methods, and include phage display, ribosome display, microbead droplet display, STABLE (non-covalent DNA display), mRNA display ("In vitro virus", Nemoto N, et al. FEBS Lett. 414, 405-408 (1997) (Non-Patent Document 1), WO98 / 016636 (Patent Document 1); or "RNA-peptide fusions", Roberts, RW & Szostak, JW, Proc. Natl. Acad. Sci. USA., 94, 12297-12302 (1997) (Non-Patent Document 2), WO1998 / 31700 (Patent Document 12)), cDNA display, photocrosslinking cDNA display (WO2016 / 159211 (Patent Document 6)), and TRAP (transcription-translation coupled with Known methods include the TRAP display method (T. Ishizuka et al., TRAP display: a high-speed selection method for the generation of functional polypeptides., Am. Chem. Soc. 2013, 135, 14, 5433-5440 (Non-Patent Document 3)) and the cDNA TRAP display method (T. Kondo et al., cDNA TRAP display for rapid and stable in vitro selection of antibody-like proteins., Chem. Commun., 2021, 572416-572419 (Non-Patent Document 4)).
[0003] In the display method, when functional peptide or protein molecules are selected from a library, the corresponding gene is linked, so the sequence can be easily read, which is useful for selecting the genetic information of polypeptides with specific functions. By combining the display method of a cell-free translation system (in vitro protein synthesis system) with genetic code reprogramming, it becomes possible to synthesize peptides containing unnatural amino acid residues (unnatural peptides).
[0004] 2. Puromycin-mediated display The display method is a technology that uses a cell-free translation system (in vitro protein synthesis system) to link mRNA as a genotype with a peptide molecule as a phenotype, thereby integrating genotype and phenotype. A representative method is to link a synthesized peptide molecule to the mRNA that encodes it via puromycin, an analog of the 3'-terminal portion of tyrosyl-tRNA. It has also been reported that substances other than puromycin, such as puromycin derivatives, can also be used to link peptides to mRNA (WO2011 / 049157 (Patent Document 2)).
[0005] In such puromycin-like substance-mediated display methods, puromycin is linked to mRNA via a suitable linker. This is then introduced into a cell-free translation system to synthesize a peptide from the mRNA. The puromycin-like substance acts as a substrate for the transpeptidation reaction in the ribosome and is attached to the C-terminus of the growing peptide chain, resulting in the translation product, a peptide molecule, being linked to the mRNA via the puromycin-like substance. In puromycin-like substance-mediated display methods, the mRNA and the puromycin-like substance are linked covalently using RNA ligase or noncovalently by nucleic acid hybridization. These methods, known as mRNA display (in vitro virus method), cDNA display, photocrosslinking cDNA display (WO 2016 / 159211 (Patent Document 6)), and TRAP (transcription-translation coupled with association of puromycin linker) display, can covalently or noncovalently link various nucleic acid substances to the puromycin-like substance.
[0006] In the above-mentioned techniques, a puromycin-like substance acts as a substrate for a transpeptidation reaction in the ribosome. However, only known conjugates of a nucleic acid and its translation product mediated by a puromycin-like substance have one translation product bound to one nucleic acid (e.g., WO1998 / 016636 (Patent Document 1), WO2011 / 049157 (Patent Document 2), WO2006 / 041194 (Patent Document 3), JP2011-528912 (Patent Document 4), etc.). In display methods mediated by puromycin-like substances, only monovalent translation products (peptides) bound to one nucleic acid have been used. [Prior art documents] [Patent documents]
[0007] [Patent Document 1] WO1998 / 016636 [Patent Document 2] WO2011 / 049157 [License 3] WO2006 / 041194 [License 4] Special form 2011-528912 [Patent Document 5] Special lottery number 2008-125396 [License 6] WO2016 / 159211 [License 7] WO2012 / 026566 [License 8] Special lottery number 2008-125396 [License 9] WO2007 / 066627 [License 10] WO2019 / 077887 [License 11] WO2023 / 234425 [License 12] WO1998 / 31700 [Non-licensed literature]
[0008] [Non-licensed Document 1] N Nemoto,et al.,FEBS Lett.,1997,414,405-408 [Non-licensed Document 2] Roberts,RW,et al.,Proc.Natl.Acad.Sci.USA.,1997,94,12297-12302 [Non-licensed Document 3] T.Ishizuka et al.,Am.Chem.Soc.2013,135,14,5433-5440 [Non-licensed Document 4] T.Kondo et al.,Chem.Commun.,2021,572416-572419 [Non-licensed Document 5] Liu et al.,Proc.Natl.Acad.Sci.USA.2012,109(2),413-418 [Non-licensed Document 6] Ko et al.,J.Am.Chem.Soc.2022,144,47,21494-21501
Non-licensed Document 7
Non-licensed literature 9
Non-licensed literature 10
Non-licensed Document 11
Non-licensed Document 12
Non-licensed Document 13
Non-licensed Document 14
Non-licensed Document 15
Non-licensed Document 16
Non-licensed Document 17
Non-licensed Document 18
Non-licensed Document 19
Non-licensed Document 20
Non-licensed Document 21
Non-licensed Document 22
Non-licensed Document 23
Non-licensed Document 24
Non-licensed Document 25
Non-licensed Document 26
Non-licensed Document 27
Non-licensed Document 28
[0009] One aspect of the present invention aims to provide a linker comprising a binding moiety having a structure capable of binding to a desired genetic information material; and at least two or more puromycin-like substances; use of the linker; a genetic information material-linker conjugate comprising the linker; a genetic information material-linker-peptide conjugate comprising the linker; etc. [Means for solving the problem]
[0010] The present inventors surprisingly discovered that by ribosome translation of a target mRNA-linker conjugate in which a target mRNA is linked to linkers containing a puromycin-like substance bound at each of multiple branched positions, a conjugate in which multiple translation products are linked to one mRNA can be obtained, and further, that by repeating this step, such conjugates can be efficiently obtained, leading to the present invention. Because multiple puromycin-like substances are bound to the linker of the present invention, a conjugate of a nucleic acid and a translation product can be obtained by introducing the mRNA-linker conjugate of the present invention into a cell-free translation system and synthesizing a peptide from the mRNA.
[0011] The present invention includes, but is not limited to, the following aspects. [Aspect 1] a binding moiety having a structure capable of binding to a desired genetic information material; and At least two puromycin-like substances A linker comprising: The puromycin-like substance can be covalently linked to the C-terminus of a desired peptide. The linker. [Aspect 2] the binding moiety having a structure capable of binding to the desired genetic information material comprises a nucleic acid capable of binding to the desired genetic information material; A linker according to embodiment 1. [Aspect 3] 3. A linker according to embodiment 1 or 2 for linking said genetic information material to a peptide encoded by said genetic information material. [Aspect 4] 4. The linker according to any one of embodiments 1 to 3, wherein the genetic information material is a nucleic acid. [Aspect 5] A linker according to any one of aspects 1 to 3, wherein the puromycin-like substance is puromycin. [Aspect 6] a binding moiety having a structure capable of binding to a desired genetic information material; and At least two puromycin-like substances A linker comprising: The puromycin-like substance can be covalently linked to the C-terminus of a desired peptide. Use of the linker, The use for linking the genetic information material to a peptide encoded by the genetic information material. [Aspect 7] (a) a linker according to any one of embodiments 1 to 3; and (b) the genetic information material bound to the linker of (a); A genetic information material-linker conjugate comprising: [Aspect 8] (a) a linker according to any one of embodiments 1 to 3; (b) the genetic information material attached to the linker bond of (a); and (c) a peptide encoded by the genetic information material linked to at least two or more puromycin-like substances of the linker of (a); A genetic information material-linker-peptide conjugate comprising: [Aspect 9] (1) subjecting the genetic information material-linker conjugate according to embodiment 7 to a cell-free translation system to translate the genetic information material, wherein the puromycin-like substance in the linker binds to the translated peptide to obtain a genetic information material-linker-peptide conjugate; A method for producing a genetic information material-linker-peptide conjugate, comprising: [Aspect 10] A method for producing a genetic information material according to embodiment 9, which comprises, prior to step (1), a step (0) of binding a linker according to any one of embodiments 1 to 3 to a desired genetic information material to obtain a genetic information material-linker conjugate. [Aspect 11] (2) repeating step (1) two or more times. [Aspect 12] A library comprising at least two of the information material-linker-peptide conjugates according to embodiment 8. [Aspect 13] A method for screening a peptide that binds to a desired target substance, comprising: contacting the target substance with a library containing at least two genetic information material-linker-peptide conjugates according to embodiment 8; The screening method comprises: [Aspect 14] A method for evaluating the binding ability of a peptide to a desired target substance, comprising: a step of contacting the genetic information material-linker-peptide conjugate according to aspect 8 with the target substance. The evaluation method comprising: [Aspect 15] (1-i) a step of subjecting a genetic information substance-linker conjugate, in which a linker containing at least one or more puromycin-like substances is bound to a desired genetic information substance, to a cell-free translation system to translate the genetic information substance, in which the puromycin-like substance in the linker binds to the translated peptide, thereby obtaining a genetic information substance-linker-peptide conjugate; and (2-i) Step (1-i) is repeated two or more times. A method for producing a genetic information material-linker-peptide conjugate, comprising: [Aspect 16] (1-ii) subjecting a genetic information substance-linker conjugate, in which a linker containing at least two or more puromycin-like substances is bound to a desired genetic information substance, to a cell-free translation system to translate the genetic information substance, in which the puromycin-like substance in the linker binds to the translated peptide, thereby obtaining a genetic information substance-linker-peptide conjugate; A method for producing a genetic information material-linker-peptide conjugate, comprising: [Aspect 17] A method for displaying two or more peptides encoded by a desired genetic information material from the genetic information material, comprising: The method, wherein each of the peptides is linked to the genetic information material via a functional group capable of covalently bonding to the C-terminus of the peptide. [Aspect 18] A display method according to Aspect 17, comprising the step of subjecting the genetic information material-linker conjugate according to Aspect 7 to a cell-free translation system to translate the peptide from the genetic information material, wherein the puromycin-like substance binds to the translated peptide. [Effects of the Invention]
[0012] The "conjugate in which multiple translation products are bound to one genetic information substance via a puromycin-like substance" can recognize the target substance through the multiple translation products when the translation products have target binding ability. This can confer multivalent interactions (avidity effect) with the target to the translation products. Therefore, by using such a conjugate of the present invention in, for example, cell-free translation system display methods (such as puromycin-like substance-mediated display methods) and affinity selection (in vitro selection methods), it becomes possible to more efficiently recover peptide-genetic information substance conjugates that bind to the target substance. [Brief explanation of the drawings]
[0013] [Figure 1-1] Figure 1 shows the structures of each of the linkers 1 to 15 used in the examples. In the structures, "cccgcctcccgccccccgtcc" (SEQ ID NO: 1) and "ctcccgccccccgtcc" (SEQ ID NO: 60), the "c," "g," and "t" refer to nucleotides containing cytosine, guanine, and thymine, respectively, and "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" refer to DNAs linked to these nucleotides. The carbon atom at the 3' position of the ribose at the 3' end of the DNA is linked to PEG or an alkyl structure via a phosphodiester bond. The structures and subscripts in parentheses indicate the repeating structure and the number of repeats, respectively. [Figure 1-2] Figure 1 shows the structures of each of the linkers 1 to 15 used in the examples. The c, g, and t in "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" in the structures refer to nucleotides containing cytosine, guanine, and thymine, respectively, and "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" refer to DNAs linked to these nucleotides. The carbon atom at the 3' position of the ribose at the 3' end of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscripts in parentheses indicate the repeating structure and the number of repeats, respectively. [Figure 1-3] Figure 1 shows the structures of each of the linkers 1 to 15 used in the examples. The c, g, and t in "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" in the structures refer to nucleotides containing cytosine, guanine, and thymine, respectively, and "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" refer to DNAs linked to these nucleotides. The carbon atom at the 3' position of the ribose at the 3' end of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscripts in parentheses indicate the repeating structure and the number of repeats, respectively. [Figure 1-4] Figure 1 shows the structures of each of the linkers 1 to 15 used in the examples. The c, g, and t in "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" in the structures refer to nucleotides containing cytosine, guanine, and thymine, respectively, and "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" refer to DNAs linked to these nucleotides. The carbon atom at the 3' position of the ribose at the 3' end of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscripts in parentheses indicate the repeating structure and the number of repeats, respectively. [Figure 1-5] Figure 1 shows the structures of each of the linkers 1 to 15 used in the examples. The c, g, and t in "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" in the structures refer to nucleotides containing cytosine, guanine, and thymine, respectively, and "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" refer to DNAs linked to these nucleotides. The carbon atom at the 3' position of the ribose at the 3' end of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscripts in parentheses indicate the repeating structure and the number of repeats, respectively. [Figure 1-6] Figure 1 shows the structures of each of the linkers 1 to 15 used in the examples. The c, g, and t in "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" in the structures refer to nucleotides containing cytosine, guanine, and thymine, respectively, and "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" refer to DNAs linked to these nucleotides. The carbon atom at the 3' position of the ribose at the 3' end of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscripts in parentheses indicate the repeating structure and the number of repeats, respectively. [Figure 1-7]Figure 1 shows the structures of each of the linkers 1 to 15 used in the examples. The c, g, and t in "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" in the structures refer to nucleotides containing cytosine, guanine, and thymine, respectively, and "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" refer to DNAs linked to these nucleotides. The carbon atom at the 3' position of the ribose at the 3' end of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscripts in parentheses indicate the repeating structure and the number of repeats, respectively. [Figure 1-8] Figure 1 shows the structures of each of the linkers 1 to 15 used in the examples. The c, g, and t in "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" in the structures refer to nucleotides containing cytosine, guanine, and thymine, respectively, and "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" refer to DNAs linked to these nucleotides. The carbon atom at the 3' position of the ribose at the 3' end of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscripts in parentheses indicate the repeating structure and the number of repeats, respectively. [Figure 1-9] Figure 1 shows the structures of each of the linkers 1 to 15 used in the examples. The c, g, and t in "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" in the structures refer to nucleotides containing cytosine, guanine, and thymine, respectively, and "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" refer to DNAs linked to these nucleotides. The carbon atom at the 3' position of the ribose at the 3' end of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscripts in parentheses indicate the repeating structure and the number of repeats, respectively. [Figure 1-10]Figure 1 shows the structures of each of the linkers 1 to 15 used in the examples. The c, g, and t in "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" in the structures refer to nucleotides containing cytosine, guanine, and thymine, respectively, and "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" refer to DNAs linked to these nucleotides. The carbon atom at the 3' position of the ribose at the 3' end of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscripts in parentheses indicate the repeating structure and the number of repeats, respectively. [Figure 2-1] Figure 2 shows the structures of the precursors used in the synthesis of linkers 2 to 15. The c, g, and t in "cccgcctcccgccccccgtcc" (SEQ ID NO: 1) and "ctcccgccccccgtcc" (SEQ ID NO: 60) in the structures refer to nucleotides containing cytosine, guanine, and thymine, respectively, while "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" refer to DNAs containing these nucleotides. The carbon atom at the 3' position of the ribose at the 3' end of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscripts in parentheses indicate the repeating structure and the number of repeats, respectively. The alkyne puromycin was used in the synthesis of linkers 4 to 6, 8, and 11 to 15. [Figure 2-2]Figure 2 shows the structures of the precursors used in the synthesis of linkers 2 to 15. The c, g, and t in "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" in the structures refer to nucleotides containing cytosine, guanine, and thymine, respectively, while "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" refer to DNAs containing these nucleotides. The carbon atom at the 3' position of the ribose at the 3' end of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscripts in parentheses indicate the repeating structure and the number of repeats, respectively. The alkyne puromycin was used in the synthesis of linkers 4 to 6, 8, and 11 to 15. [Figure 2-3] Figure 2 shows the structures of the precursors used in the synthesis of linkers 2 to 15. The c, g, and t in "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" in the structures refer to nucleotides containing cytosine, guanine, and thymine, respectively, while "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" refer to DNAs containing these nucleotides. The carbon atom at the 3' position of the ribose at the 3' end of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscripts in parentheses indicate the repeating structure and the number of repeats, respectively. The alkyne puromycin was used in the synthesis of linkers 4 to 6, 8, and 11 to 15. [Figure 2-4]Figure 2 shows the structures of the precursors used in the synthesis of linkers 2 to 15. The c, g, and t in "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" in the structures refer to nucleotides containing cytosine, guanine, and thymine, respectively, while "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" refer to DNAs containing these nucleotides. The carbon atom at the 3' position of the ribose at the 3' end of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscripts in parentheses indicate the repeating structure and the number of repeats, respectively. The alkyne puromycin was used in the synthesis of linkers 4 to 6, 8, and 11 to 15. [Figure 2-5] Figure 2 shows the structures of the precursors used in the synthesis of linkers 2 to 15. The c, g, and t in "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" in the structures refer to nucleotides containing cytosine, guanine, and thymine, respectively, while "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" refer to DNAs containing these nucleotides. The carbon atom at the 3' position of the ribose at the 3' end of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscripts in parentheses indicate the repeating structure and the number of repeats, respectively. The alkyne puromycin was used in the synthesis of linkers 4 to 6, 8, and 11 to 15. [Figure 2-6]Figure 2 shows the structures of the precursors used in the synthesis of linkers 2 to 15. The c, g, and t in "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" in the structures refer to nucleotides containing cytosine, guanine, and thymine, respectively, while "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" refer to DNAs containing these nucleotides. The carbon atom at the 3' position of the ribose at the 3' end of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscripts in parentheses indicate the repeating structure and the number of repeats, respectively. The alkyne puromycin was used in the synthesis of linkers 4 to 6, 8, and 11 to 15. [Figure 2-7] Figure 2 shows the structures of the precursors used in the synthesis of linkers 2 to 15. The c, g, and t in "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" in the structures refer to nucleotides containing cytosine, guanine, and thymine, respectively, while "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" refer to DNAs containing these nucleotides. The carbon atom at the 3' position of the ribose at the 3' end of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscripts in parentheses indicate the repeating structure and the number of repeats, respectively. The alkyne puromycin was used in the synthesis of linkers 4 to 6, 8, and 11 to 15. [Figure 2-8]Figure 2 shows the structures of the precursors used in the synthesis of linkers 2 to 15. The c, g, and t in "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" in the structures refer to nucleotides containing cytosine, guanine, and thymine, respectively, while "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" refer to DNAs containing these nucleotides. The carbon atom at the 3' position of the ribose at the 3' end of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscripts in parentheses indicate the repeating structure and the number of repeats, respectively. The alkyne puromycin was used in the synthesis of linkers 4 to 6, 8, and 11 to 15. [Figure 2-9] Figure 2 shows the structures of the precursors used in the synthesis of linkers 2 to 15. The c, g, and t in "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" in the structures refer to nucleotides containing cytosine, guanine, and thymine, respectively, while "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" refer to DNAs containing these nucleotides. The carbon atom at the 3' position of the ribose at the 3' end of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscripts in parentheses indicate the repeating structure and the number of repeats, respectively. The alkyne puromycin was used in the synthesis of linkers 4 to 6, 8, and 11 to 15. [Figure 2-10]Figure 2 shows the structures of the precursors used in the synthesis of linkers 2 to 15. The c, g, and t in "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" in the structures refer to nucleotides containing cytosine, guanine, and thymine, respectively, while "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" refer to DNAs containing these nucleotides. The carbon atom at the 3' position of the ribose at the 3' end of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscripts in parentheses indicate the repeating structure and the number of repeats, respectively. The alkyne puromycin was used in the synthesis of linkers 4 to 6, 8, and 11 to 15. [Figure 2-11] Figure 2 shows the structures of the precursors used in the synthesis of linkers 2 to 15. The c, g, and t in "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" in the structures refer to nucleotides containing cytosine, guanine, and thymine, respectively, while "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" refer to DNAs containing these nucleotides. The carbon atom at the 3' position of the ribose at the 3' end of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscripts in parentheses indicate the repeating structure and the number of repeats, respectively. The alkyne puromycin was used in the synthesis of linkers 4 to 6, 8, and 11 to 15. [Figure 2-12]Figure 2 shows the structures of the precursors used in the synthesis of linkers 2 to 15. The c, g, and t in "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" in the structures refer to nucleotides containing cytosine, guanine, and thymine, respectively, while "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" refer to DNAs containing these nucleotides. The carbon atom at the 3' position of the ribose at the 3' end of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscripts in parentheses indicate the repeating structure and the number of repeats, respectively. The alkyne puromycin was used in the synthesis of linkers 4 to 6, 8, and 11 to 15. [Figure 2-13] Figure 2 shows the structures of the precursors used in the synthesis of linkers 2 to 15. The c, g, and t in "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" in the structures refer to nucleotides containing cytosine, guanine, and thymine, respectively, while "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" refer to DNAs containing these nucleotides. The carbon atom at the 3' position of the ribose at the 3' end of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscripts in parentheses indicate the repeating structure and the number of repeats, respectively. The alkyne puromycin was used in the synthesis of linkers 4 to 6, 8, and 11 to 15. [Figure 2-14]Figure 2 shows the structures of the precursors used in the synthesis of linkers 2 to 15. The c, g, and t in "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" in the structures refer to nucleotides containing cytosine, guanine, and thymine, respectively, while "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" refer to DNAs containing these nucleotides. The carbon atom at the 3' position of the ribose at the 3' end of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscripts in parentheses indicate the repeating structure and the number of repeats, respectively. The alkyne puromycin was used in the synthesis of linkers 4 to 6, 8, and 11 to 15. [Figure 2-15] Figure 2 shows the structures of the precursors used in the synthesis of linkers 2 to 15. The c, g, and t in "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" in the structures refer to nucleotides containing cytosine, guanine, and thymine, respectively, while "cccgcctcccgccccccgtcc" and "ctcccgccccccgtcc" refer to DNAs containing these nucleotides. The carbon atom at the 3' position of the ribose at the 3' end of the DNA is linked to a PEG or alkyl structure via a phosphodiester bond. The structures and subscripts in parentheses indicate the repeating structure and the number of repeats, respectively. The alkyne puromycin was used in the synthesis of linkers 4 to 6, 8, and 11 to 15. [Figure 3]Figure 3 shows the results of evaluating the formation of mRNA-linker conjugates by gel electrophoresis and fluorescence imaging. Figures 3a and 3b show the results of analysis demonstrating that a bivalent linker (Linker 4) can be ligated to several mRNAs with different total base numbers, in which portions of the translated region have been randomized with deoxynucleotides containing adenine, guanine, cytosine, or uracil. Figure 3c shows the results of analysis demonstrating that a linker can be ligated to mRNAs with different total base numbers, in which portions of the translated region have been randomized with deoxynucleotides containing adenine, guanine, cytosine, or uracil, regardless of the branched chain structure or the number of puromycin residues in the linker. Figure 3d shows the results of analysis demonstrating that a bivalent linker (Linker 8), which has a phosphate group at the 5' end and can form a covalent bond with the 3' end of the mRNA by ligation, can be ligated to several mRNAs with different total base numbers, in which portions of the translated region have been randomized with deoxynucleotides containing adenine, guanine, cytosine, or uracil. [Figure 4] Figure 4 shows the results of an analysis demonstrating that an mRNA-linker conjugate having two puromycins at its termini can be produced by introducing an alkyne puromycin via the CuAAC reaction (AAC: Azide-Alkyne-cycloaddition) into a conjugate formed by binding mRNA to a linker (Linker 4 Precursor 2) that has an azide group at each end of two branched chain structures. [Figure 5] Figure 5 shows the results of evaluating the peptide binding reaction to the mRNA-linker conjugate by gel electrophoresis and fluorescence imaging. Figure 5a shows an image obtained by detecting Cy5 fluorescence, and Figure 5b shows an image obtained by detecting fluorescein fluorescence. These results demonstrate that artificial recycling translation using a bivalent linker (Linker 3) enables efficient presentation of multiple peptides via puromycin in the linker. [Figure 6]Figure 6a shows the results of gel electrophoresis and fluorescence imaging analysis demonstrating that artificial recycling translation using a bivalent linker (Linker 3) enables multiple peptide display via puromycin in the linker. Figure 6b shows that artificial recycling translation increases the amount of linker displaying multiple peptides. Figures 6c and 6d show the results of analysis demonstrating that artificial recycling translation increases the amount of peptide display using a monovalent linker (Linker 2). [Figure 7] FIG. 7 shows the results of analysis by gel electrophoresis and fluorescent imaging, demonstrating that reverse transcription reaction can be carried out even with mRNA hybridized with a bivalent linker (Linker 3). [Figure 8] Figure 8 shows the results of gel electrophoresis and fluorescence imaging analysis demonstrating that bivalent linkers with different linker lengths are capable of displaying multiple peptides. [Figure 9] Figure 9a shows the results of gel electrophoresis and fluorescence imaging analysis of linker 12, which is modified with biotin at the 5' end and a guanine-containing deoxynucleotide just before the branching point in the linker, demonstrating that it can be specifically cleaved by RNase T1. Figure 9b shows the results of gel electrophoresis and fluorescence imaging analysis of the peptide binding reaction to the mRNA-linker 12 conjugate. This demonstrates that artificial recycling translation using a bivalent linker (linker 12) enables efficient presentation of multiple peptides via puromycin in the linker. [Figure 10]Figure 10a shows that the use of a bivalent linker (linker 3) improves the recovery rate of DNA resulting from binding to the target protein in a binding assay using Strep-tag II and streptavidin as model peptides and model target proteins. It also shows that artificial recycling translation improves the recovery rate of DNA resulting from binding to the target protein. The recovery rates (%) shown in the graph are mean values, and the error bars indicate standard deviations (n = 3). Figure 10b shows that the use of bivalent linkers (linkers 3–6) enhances the recovery rate of DNA resulting from binding to the target protein in a binding assay using Strep-tag II and streptavidin as model peptides and model target proteins, and that the enhancement rate varies depending on the branch chain length. The recovery rates (%) shown in the graph are mean values, and the error bars indicate standard deviations (n = 3). [Figure 11] Figure 11 shows that the recovery rate of DNA resulting from binding to the target protein was improved when artificial recycling translation was performed using a bivalent linker (Linker 3) in an assay using a human IgG Fc protein-binding peptide. The recovery rate (%) in the graph in the figure is the average, and the error bars indicate the standard deviation (n = 3). [Figure 12] Figure 12 shows that the recovery rate of DNA derived from binding to the target protein is improved by using a bivalent linker (Linker 3) in a recovery rate evaluation using a hemagglutinin (HA)-binding peptide. It also shows that artificial recycling translation improves the recovery rate of DNA derived from binding to the target protein. The recovery rates (%) in the graphs in the figure are average values, and error bars indicate standard deviations (n = 3). [Figure 13]Figure 13 shows that the recovery rate of DNA derived from binding to the target protein can be enhanced by using bivalent linkers (linkers 3 to 6) in a recovery evaluation using a neonatal Fc receptor (FcRn)-binding peptide, and the enhancement rate increases with the shortening of the branched chain length. The recovery rate (%) in the graph in the figure is the average, and the error bars indicate the standard deviation (n = 3). [Figure 14] Figure 14 shows that when a bivalent linker (Linker 4) was used in the evaluation of the recovery rate in each round of Fc-binding peptide selection using a random peptide library, the recovery rate of DNA derived from binding to the target protein was significantly higher with each selection round compared to the recovery rate of DNA derived from nonspecific binding (obtained in negative selection). [Figure 15] Figure 15 shows that in the evaluation of recovery rates using sequences obtained by gene sequence analysis of Fc-binding peptide selection, the peptide sequences obtained from selection using a bivalent linker (Linker 4) yield a higher recovery rate of DNA derived from binding to the target protein than the recovery rate of DNA derived from non-specific binding. [Figure 16] Figure 16 shows that in a binding assay using Strep-tag II and streptavidin as model peptides and model target proteins, the recovery rate of DNA derived from binding to the target protein was improved by using a bivalent linker (Linker 8) compared to a monovalent linker (Linker 7), even when the linker and mRNA were covalently bound. The recovery rates (%) in the graphs in the figure represent the average values, and the error bars represent the standard deviation (n = 3). [Figure 17]Figure 17a shows the results of gel electrophoresis and fluorescence imaging analysis of the acylation of an amino acid at the 3' end of a monovalent linker (Linker 9) and a bivalent linker (Linker 10). Figure 17b shows the structure of a puromycin-like substance prepared by acylation of an amino acid at the 3' end of the linker. Figure 17c shows the structure of a bivalent linker prepared by acylation of an amino acid at the 3' end of the linker. The c, g, and t in "cccgcctcccgccccccgtcc" in the structure refer to nucleotides containing cytosine, guanine, and thymine, respectively, and "cccgcctcccgccccccgtcc" refers to DNA to which these nucleotides are linked. The carbon atom at the 3' position of the ribose at the 3' end of the DNA is linked to a PEG structure via a phosphodiester bond. The structure and subscripts in parentheses indicate the repeat structure and the number of repeats, respectively. [Figure 18] Figure 18 shows that in a binding assay using Strep-tag II and streptavidin as model peptides and model target proteins, the use of a bivalent linker (Linker 10) improved the DNA recovery rate derived from binding to the target protein compared to the use of a monovalent linker (Linker 9), even when an amino acid was covalently bound via an ester bond to the ribose at the 3' end of the bivalent linker (Linker 10), giving it properties similar to a puromycin-like substance. The recovery rates (%) shown in the graphs in the figure are average values, and the error bars indicate the standard deviation (n = 3). [Figure 19] Figure 19 shows that in a binding assay using Strep-tag II and streptavidin as model peptides and model target proteins, the use of a trivalent linker (Linker 11) improves the recovery rate of DNA resulting from binding to the target protein compared to using a monovalent linker. It also shows that artificial recycling translation improves the recovery rate of DNA resulting from binding to the target protein in a manner dependent on the number of artificial recycling translations. The recovery rates (%) in the graphs in the figure represent the average values, and the error bars represent the standard deviation (n = 3). [Figure 20] Figure 20 shows that the use of a trivalent linker (Linker 15) improved the DNA recovery rate from binding to the target protein compared to when a monovalent linker was used, in an evaluation of binding ability using Strep-tag II and streptavidin as model peptides and model target proteins. The recovery rates (%) shown in the graph are average values (n = 2). DETAILED DESCRIPTION OF THE INVENTION
[0014] The present invention includes, but is not limited to, the following embodiments. Unless otherwise specified herein, technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. The substances, materials, and examples disclosed herein are merely illustrative and are not intended to be limiting. When referring to "in one embodiment" in this specification, it means that the embodiment is not limited, i.e., is not limited.
[0015] 1. Linker In one aspect, the present invention relates to a linker. The linker of the present invention comprises: a binding moiety having a structure capable of binding to a desired genetic information material; and At least two puromycin-like substances Including, The puromycin-like substance is the linker, which can be covalently bonded to the C-terminus of a desired peptide, the covalent bond being preferably an amide bond.
[0016] "Genetic information material" is the information-containing material that is translated into peptides in the ribosomes.
[0017] In one embodiment, the "genetic information material" is a nucleic acid. The nucleic acid serving as the genetic information material may be natural or non-natural. Natural nucleic acids include naturally occurring modified nucleic acids, while non-natural nucleic acids include nucleic acids modified or partially substituted with non-natural substances. Types of nucleic acids include RNA, RNA-DNA hybrids, and the like. While not limited thereto, RNA is a preferred nucleic acid. The base sequence of the genetic information material may be known or unknown. The sequence may be based on a sequence present in nature or may be an artificially designed sequence. For example, the genetic information material may have a sequence randomly synthesized by organic synthesis, or may encode a protein with an unknown sequence as a result of random mutation insertion using PCR.
[0018] As described above, the "genetic information material" encodes a peptide, and the amino acid sequence of this peptide may be known or unknown. Furthermore, there is no particular limitation on the length of this peptide. In one embodiment, the length of the peptide encoded by the "genetic information material" may be composed of one or more amino acids, preferably two or more, and there is no particular upper limit, but it may be 1000 or less, 500 or less, 100 or less, 50 or less, 30 or less, or 20 or less.
[0019] Therefore, in one embodiment, the length of the "genetic information material" may be 3 bases or more, preferably 6 bases or more, and there is no particular upper limit, but it may be 3000 bases or less, 1500 bases or less, 300 bases or less, 150 bases or less, 90 bases or less, or 60 bases or less.
[0020] Furthermore, the type of peptide encoded by the "genetic information material" is not particularly limited. The peptide may include a molecule to which tRNA can be linked and which can be condensed by a ribosome. It is known that ribosomes can translate a variety of molecules whose structures differ from those of common amino acids (see, for example, "Translation initiation with exotic amino acids using EF-P-responsive artificial initiator tRNA," KATO T, et al., Nucleic Acids Res. 51, 8169-8180, 2023 (Non-Patent Document 15) and "Translation Initiation with Initiator tRNA Charged with Exotic Peptides," Goto Y, et al., J. Am. Chem. Soc. 131, 14, 5040-5041, 2009 (Non-Patent Document 16); "Cell-Free Approach for Non-canonical Amino Acids Incorporation Into Polypeptides," Zhenling Cui, et al., Front Bioeng Biotechnol. 8, 1031, 2020 (Non-Patent Document 17)). Therefore, even if a molecule has a structure different from that of an amino acid, it can be translated by a ribosome and is therefore applicable to the present invention. That is, in this specification, a peptide to be translated by ribosomes may be any molecule that can be linked to tRNA and translated by ribosomes.
[0021] The peptide may be a molecule containing natural amino acid residues, unnatural amino acid residues, or other structures that can be linked to tRNA and translated by ribosomes. The unnatural amino acid may be any compound that can be linked to tRNA and condensed by ribosomes. Non-limiting examples of unnatural amino acids include β-amino acids, γ-amino acids, L-amino acids, D-amino acids (also referred to as D-amino acids), N-alkyl amino acids such as N-methyl amino acids and N-ethyl amino acids, peptoids, α-substituted amino acids, α-α-disubstituted amino acids, cyclic α-amino acids, amino acid variants, and chemically modified amino acids such as amino acid derivatives. The peptide may also contain a hydroxy acid that can be linked to RNA and condensed by ribosomes. The peptide translated from the "genetic information material" by ribosomes is not limited in its shape and may take any shape after translation, such as a single-chain peptide, a cyclic peptide (including a peptide with a cyclic portion), or a shape with a specific secondary structure. In one embodiment, the translated peptide is cyclic.
[0022] In one embodiment, the peptide is a peptide that binds to a target substance. In one embodiment, the peptide is a fragment or the full length of a protein. In one embodiment, the peptide is an antagonist or agonist of a target substance. In one embodiment, the peptide is an antigen or an antibody against the antigen. Without limitation, the peptide may be a peptide being extended in a ribosome as a substrate for a transpeptidation reaction. As used herein, "peptides encoded by genetic information material" includes those that have been completely translated from genetic information material as well as those that are being extended during translation.
[0023] The term "structure capable of binding to a desired genetic information material" refers to a structure capable of binding directly or indirectly to a desired genetic information material.
[0024] One embodiment of the "structure capable of indirectly binding to a desired genetic information material" refers to a structure capable of binding to a desired genetic information material via a suitable linker. The suitable linker is a linker capable of connecting the desired genetic information material to the linker of the present invention. The suitable linker includes a substance capable of directly binding to the desired genetic information material and a substance capable of directly binding to the linker of the present invention. A nucleic acid capable of binding to the desired genetic information material can be used as the substance capable of directly binding to the desired genetic information material.
[0025] Furthermore, one embodiment of a substance capable of indirectly binding to the linker of the present invention is one of a pair of functional groups capable of binding to each other. The appropriate linker and the linker of the present invention can be bound by selecting a pair of functional groups capable of binding to each other and using one functional group in the appropriate linker and the other functional group in the linker of the present invention. In this case, the "pair of functional groups capable of binding to each other" can be appropriately selected based on the technical common sense of those skilled in the art. Non-limiting examples of reactions for binding using such a pair of functional groups include click chemistry or bioconjugation reactions, typified by azide-alkyne pairs, and nucleophilic substitution or nucleophilic addition reactions using nucleophilic functional group-electrophilic functional group pairs. Specific examples of these include a pair of azide and acyclic strained alkyne, a pair of azide and cyclic strained alkyne, a pair of thiol and maleimide, and a pair of thiol and haloacetyl. The structure of the appropriate linker is not particularly limited as long as it achieves the above-mentioned purpose. In view of the above-mentioned purpose, a suitable structure can be selected based on the technical common sense of a person skilled in the art.
[0026] As described above, one aspect of the "binding portion having a structure capable of indirectly binding to a desired genetic information material" of the linker of the present invention is a binding portion having a structure containing a functional group that can bind to "one of a pair of functional groups capable of binding to each other" possessed by an appropriate linker when binding to the desired genetic information material via the appropriate linker.
[0027] Another embodiment of the "binding moiety having a structure capable of binding to a desired genetic information material" is a binding moiety containing a nucleic acid capable of binding to the desired genetic information material. When the "binding moiety having a structure capable of binding to a desired genetic information material" contains a nucleic acid capable of binding to the desired genetic information material, the nucleic acid portion of the linker of the present invention can directly bind to the desired genetic information material.
[0028] The nucleic acid of the "nucleic acid capable of binding to a genetic information material" may be natural or non-natural, or may be a mixture of natural and non-natural nucleic acids. While not limited to, DNA can be used as such a nucleic acid. Furthermore, in this specification, the "non-natural nucleic acid" that can constitute the nucleic acid of the "nucleic acid capable of binding to a genetic information material" also includes peptide nucleic acids. Peptide nucleic acids are molecules with a structure similar to DNA or RNA, but with a peptide structure in the backbone, and are sometimes referred to as PNA. Peptide nucleic acids have a backbone in which N-(2-aminoethyl)glycine is bonded via an amide bond instead of sugar (deoxyribose or ribose). Purine rings or pyrimidine rings corresponding to the nucleic acid bases are bonded to the backbone via methylene and carbonyl groups. Similar to natural nucleic acids, peptide nucleic acids can also be used as components of the linker, as long as they are capable of binding to the desired genetic information material.
[0029] The nucleic acid can be selected from an appropriate structure that "can bind to the desired genetic information material" based on the purpose of the linker and common technical knowledge. Preferably, the structure is capable of covalent or non-covalent binding. The base sequence of the nucleic acid is not particularly limited. The length of the base sequence of the nucleic acid is also not particularly limited, as long as it is long enough to bind to the desired genetic information material, and may be appropriately determined according to the length of the desired genetic information material. In one embodiment, the length of the base sequence of the nucleic acid is a length that allows specific hybridization with the desired genetic information material. In one embodiment, the length of the base sequence of the nucleic acid is 2 or more bases, 3 or more bases, 5 or more bases, 10 or more bases, 11 or more bases, 12 or more bases, 13 or more bases, 14 or more bases, 15 or more bases, 16 or more bases, 17 or more bases, 18 or more bases, 19 or more bases, 20 or more bases, or 22 or more bases. From the viewpoint of maintaining the binding between the nucleic acid and the desired genetic information material, when the base sequence of the nucleic acid to be hybridized is 9 bases or less, it is preferable to covalently bind the nucleic acid to the desired genetic information material using the method described below in addition to hybridization. In one embodiment, the length of the base sequence of the nucleic acid is 200 bases or less, 150 bases or less, 100 bases or less, 80 bases or less, 70 bases or less, 60 bases or less, 55 bases or less, 50 bases or less, 45 bases or less, 40 bases or less, 35 bases or less, 30 bases or less, or 25 bases or less. In one embodiment, the length of the base sequence of the nucleic acid is within any combination of lengths greater than or equal to the above-mentioned lengths and lengths less than or equal to the above-mentioned lengths. All or part of the base sequence of the nucleic acid can bind to the genetic information material.
[0030] The nucleic acid and genetic information material can be linked by a non-covalent bond and / or a covalent bond. Specific embodiments of the binding between the nucleic acid and genetic information material are not limited, but preferably involve non-covalent binding via single-stranded DNA capable of specifically hybridizing with a target RNA (preferably, a target mRNA). Other embodiments include irradiating single-stranded DNA containing a photocrosslinkable non-natural nucleic acid hybridized with the target RNA at a specific site with UV light to photocrosslink the target RNA and the single-stranded DNA, and enzymatically covalently binding the ends of the target RNA and the single-stranded DNA using RNA ligase or DNA ligase.
[0031] In one embodiment, a "nucleic acid capable of binding to genetic information material" is a single-stranded DNA capable of specifically hybridizing to a target RNA. Without limitation, such DNA may include non-naturally occurring nucleic acids.
[0032] The linker contains at least two or more puromycin-like substances. Herein, a linker containing two puromycin-like substances is also referred to as a "bivalent linker," and a linker containing n puromycin-like substances is also referred to as an "n-valent linker."
[0033] As used herein, the term "puromycin-like substance" refers to a substance that has a site capable of linking to a linker-constituting substance and that can be covalently bonded to the C-terminus of a peptide on a ribosome. Such substances are not limited to puromycin or its derivatives, as described below, but may also include, for example, a molecule in which puromycin and a suppressor tRNA bind together and are recognized by the ribosome, as described in Patent Document 1. In one embodiment, the "puromycin-like substance" is a substance that reacts with a peptidyl tRNA bound to the P site of a ribosome to form a complex with an elongated peptide, and is not particularly limited as long as it is such a substance. Here, the "peptidyl tRNA" may be a peptidyl tRNA generated during the translation process of a peptide encoded by the genetic information material. In one embodiment, the puromycin-like substance can form a covalent bond, preferably an amide bond, with such a peptidyl tRNA on the ribosome.
[0034] One embodiment of a "puromycin-like substance" is a substance that has a structure in which a nucleoside or nucleic acid, or a substance having a chemical structural skeleton similar to these, or a sequence thereof, is chemically bonded to an amino acid or a substance having a chemical structural skeleton similar to that of an amino acid, and that has the function of reacting with peptidyl-tRNA bound to the P site of a ribosome to form a complex with an elongated peptide.
[0035] In one embodiment, the puromycin-like agent is puromycin.
[0036] In one embodiment, the puromycin-like substance is a puromycin derivative. Puromycin derivatives are not limited to those that completely retain the puromycin structure, but also include those in which a portion of the puromycin structure is missing or partially substituted with another structure. Non-limiting examples of puromycin derivatives include 3'-N-aminoacyl puromycin aminonucleosides (PANS-amino acids) and 3'-N-aminoacyladenosine aminonucleosides (AANS-amino acids) in which the amino group of 3'-aminoadenosine is linked to the carboxyl group of an amino acid via an amide bond formed by dehydration condensation. Examples of PANS-amino acids include PANS-Gly (glycine), PANS-Val (valine), and PANS-Ala (alanine), as well as PANS-amino acid mixtures in which the amino acid moiety corresponds to all of the amino acids. Examples of AANS-amino acids include AANS-Gly (glycine), AANS-Val (valine), AANS-Ala (alanine), and AANS-amino acid mixtures (all amino acids) containing a corresponding amino acid. Nucleosides or nucleosides and amino acids linked via an ester bond can also be used (WO2011 / 049157 (Patent Document 2)). Further, non-limiting examples of puromycin derivatives include an alkyne analog of puromycin (“Imaging protein synthesis in cells and tissues with an alkyne analog of puromycin” Liu et al., Proc. Natl. Acad. Sci. USA. 2012, 109(2), 413-418 (Non-Patent Document 5)) and a Puroswitch that can control translation with light (“Optical Control of Translation with a Puromycin Photoswitch” Ko et al., J. Am. Chem. Soc. 2022, 144, 47, 21494-21501 (Non-Patent Document 6)).
[0037] In one embodiment, the puromycin-like substance may be a substance consisting of puromycin or a derivative thereof and one or two deoxyribonucleotide or ribonucleotide residues. Non-limiting examples of such substances include ribocytidyl puromycin (rCpPur), deoxydyl puromycin (dCpPur), and deoxyuridyl puromycin (dUpPur).
[0038] In one embodiment, the puromycin-like substance may be one in which the adenine-like structure bonded to position 1 of the sugar skeleton in puromycin is replaced with a substance having a different chemical structure. Non-limiting examples include those in which the adenine-like structure bonded to position 1 of the sugar skeleton in puromycin is replaced with adenine, a thieno[3,4-d]pyrimidine skeleton and an azetidine structure, or a thieno[3,4-d]pyrimidine skeleton and a 3,3-difluoroazetidine structure ("Inherently Emissive Puromycin Analogues for Live Cell Labeling," Hadidi et al., Angew Chem Int Ed Engl., 2023, 62, 23, e202216784, Non-Patent Document 20).
[0039] In one embodiment, the puromycin-like substance may be one in which the amino acid-like structure attached to the 3-position of the sugar backbone in puromycin is substituted with a natural amino acid residue, an unnatural amino acid residue, or a residue having a hydroxyl group, such as a hydroxy acid or a hydroxy acid derivative, and which forms an amide or ester bond with the C-terminus of a peptide on the ribosome. Non-limiting examples include those in which the amino acid-like structure attached to the 3-position of the sugar backbone in puromycin is substituted with β-alanine or (2r)-3-hydroxy-2-methylpropanoic acid ("Synthesis of puromycin derivatives with backbone-elongated substrates and associated translation inhibitory activities," Mizusawa et al., Bioorg. Med. Chem., 2009, 17, 6, 2381-2387, Non-Patent Document 18).
[0040] In one embodiment, the puromycin-like substance may have one or more nucleic acids, a small molecule, or various molecules such as PEG linked to the 5-position of the sugar backbone of puromycin. Non-limiting examples include puromycins having 1 to 30 nucleic acids linked to the 5-position of the sugar backbone, biotin linked, or fluorescein linked to the 5-position of the sugar backbone of puromycin ("Puromycin oligonucleotides reveal steric restrictions for ribosome entry and multiple modes of translation inhibition," Starck et al., RNA, 2002, 8, 7, 890-903, Non-Patent Document 21).
[0041] Furthermore, puromycin is an analogue of the 3'-terminus of tyrosyl-tRNA, and the substitution of nucleic acid structures as described below can be applied. It is known that the sugar backbone or phosphate moiety of RNA or DNA can be replaced with various unnatural sugar backbones or amide bond backbones (Bao T Le et al., Antisense Oligonucleotides Targeting Angiogenic Factors as Potential Cancer Therapeutics., Mol Ther Nucleic Acids., 2019, 1, 14, 142-157, Non-Patent Document 22 and Irina Anosova et al., The structural diversity of artificial genetic polymers., Nucleic Acids Res., 2016, Feb. 18, 44, 3, 1007-1021, Non-Patent Document 23). Non-limiting examples of such unnatural backbones include PNA, LNA, PS, 2'-F, 2'OMe, 2'-O-OMe, PMO, NP, UNA, 4'Thio, FANA, CeNA, HNA, tcDNA, ENA, ANA, hDNA, FRNA, GNA, TNA, XyNA, dXyNA, etc. Substances in which an alternative unnatural sugar backbone or phosphate backbone is used to replace the sugar backbone or phosphate backbone of puromycin or a puromycin analog are also an embodiment of puromycin-like substances. Furthermore, RNA or DNA molecules with unnatural bases are known to have the ability to hybridize with DNA or RNA (Michiko Kimoto et al., Genetic Code Engineering by Natural and Unnatural Base Pair Systems for the Site-Specific Incorporation of Non-Standard Amino Acids Into Proteins., Front Mol Biosci, 2022, May 24, 2022, 9, 851646. Non-Patent Document 24). Non-limiting examples of such unnatural backbones include isoG, isoC, P, Z, s, y, Ds, Pa, Ds, Px, 5SICS, NaM, TPT3, NaM, CNMO, TAT1, NaM, 5FM, and the like. Substances in which the base moiety of puromycin or a puromycin analog is substituted with an unnatural base backbone are also embodiments of puromycin-like substances.
[0042] It is also widely known that naturally occurring modified RNA molecules retain or possess some of the functions of natural RNA (Naho Akiyama et al., Structural insights into the decoding capability of isoleucine tRNAs with lysidine and agmatidine., Nat Struct Mol Biol., 2024, Mar. 27 (Non-Patent Document 25) and Valerie de Crecy-Lagard., Functions of bacterial tRNA modifications: from ubiquity to diversity., Trends Microbiol., 2021, Jan. 29, 1, 41-53 (Non-Patent Document 26)). A substance in which the sugar backbone, phosphate backbone, or base moiety of puromycin or a puromycin analog is replaced with a naturally occurring modified RNA backbone is also an embodiment of a puromycin-like substance.
[0043] The number of puromycin-like substances contained in the linker is at least 2 or more, and there is no particular upper limit. Without limitation, the number is preferably 2 to 8, 2 to 7, 2 to 6, 2 to 5, 2 to 4, or 2 to 3. In one embodiment, the number of puromycin-like substances contained in the linker is 2, 3, 4, 5, or 6.
[0044] The nucleic acid capable of binding to the desired genetic information material may be present at either the end or the middle of the linker. The linker is assumed to be a copolymer prepared by linking two or more types of monomer compounds, and the detailed structure of each monomer constituting the copolymer is omitted. The structure of the linker is simply represented by a line connecting the linking portions of adjacent monomers. In this specification, the ends of the linker represented by the line are referred to as the end of the linker, and the portion of the line having linking portions at both ends is referred to as the middle portion of the linker.
[0045] At least two or more puromycin-like substances may be present at either the ends or the middle of the linker. In one embodiment, the linker may be branched (branched linker), with a puromycin-like substance bound to each branch. In this specification, "branched" refers to a state in which, when the linker is depicted as a line as described above, a branched line is obtained. Furthermore, the lengths of the branched chains of the branched linker may be the same or different. In one embodiment, the lengths of the branched chains of the branched linker are the same.
[0046] The structure of the linker is not particularly limited as long as it can be linked to the C-terminus of the peptide being elongated during the translation process. Those skilled in the art can select an appropriate structure based on the purpose of the linker and common technical knowledge.
[0047] Although not limited thereto, the linker may be, as a whole, moderately flexible, based on a simple linear structure with few side chains, include at least one branch, and have a linear structure with few side chains that branches into at least three at the branch (hereinafter, each chain structure bonded at a branch is referred to as a "branched chain"). Note that, in this specification, "branched into three at the branch" refers to a state in which three chain structures are bonded at each end at the branch. For example, linker 1 described in the Examples has no branch, while linker 3 has one branch and three branched chains. The branched chain may further include a branch. Furthermore, although not limited thereto, the linker may be hydrophilic as a whole. Furthermore, to form the linker, for example, oligonucleotides such as single-stranded or double-stranded DNA or RNA, polyalkylenes such as polyethylene, polyalkylene glycols such as polyethylene glycol (PEG), polystyrene, linear polysaccharides, linear peptides, or a combination thereof can be appropriately selected and used. When these linear substances are used in combination, they can be appropriately linked to an appropriate linking group (-NH-, -CO-, -O-, -NHCO-, -CONH-, -NHNH-, -O-POH-O-, -(CH) n -[n is, for example, 1 to 10, preferably 1 to 3], -S-, -SO-, etc.) can be used for chemical linking.
[0048] In a non-limiting embodiment, the linker includes the following structures (1) to (4):
[0049] (1) a linkage to the genetic information material via a phosphodiester bond and a linkage to puromycin via a phosphodiester bond; (2) a branch where three branched chains are joined; (3) A linear portion linked to the genetic information material, which is composed of PEG, a linear portion composed of PEG alone, alkylene alone, or a combination of PEG and alkylene; and (4) A linking portion in the linear portion formed by a phosphodiester bond and / or an amide bond, and / or a linking portion bonded via a CuAAC reaction (AAC: Azide-Alkyne-cycloaddition) or a SPAAC reaction (strain-promoted Azide-Alkyne-cycloaddition).
[0050] Alternatively, in a non-limiting embodiment, the linker includes any of the following structures (1) to (4):
[0051] (1) a linkage to the genetic information material via a phosphodiester bond and a linkage to puromycin via a phosphodiester bond; (2) a branched section where four branched chains are joined; (3) A linear portion linked to the genetic information material, which is composed of PEG, a linear portion composed of PEG alone, alkylene alone, or a combination of PEG and alkylene; and (4) A linking portion in the linear portion formed by a phosphodiester bond and / or an amide bond, and / or a linking portion bonded via a CuAAC reaction (AAC: Azide-Alkyne-cycloaddition) or a SPAAC reaction (strain-promoted Azide-Alkyne-cycloaddition).
[0052] The length of the linker is not particularly limited as long as it has a structure that allows it to be linked to the C-terminus of the peptide being elongated during the translation process. It is known that the overall length of the linker does not significantly affect the display efficiency of the linker ("cDNA TRAP display for rapid and stable in vitro selection of antibody-like proteins" T. Kondo et al., Chem. Commun., 2021, 572416-572419 (Non-Patent Document 4)). Those skilled in the art can appropriately select an appropriate length based on common technical knowledge, taking into account the purpose of the linker of the present application.
[0053] The linker can be synthesized using known methods. For example, but not limited to, a puromycin-like substance can be introduced into a branched linear substance bound to a nucleic acid using the CuAAC reaction (AAC: Azide-Alkyne cycloaddition) or the SPAAC reaction (strain-promoted Azide-Alkyne cycloaddition).
[0054] The phrase "the puromycin-like substance is capable of covalently bonding to the C-terminus of a desired peptide" means that the puromycin-like substance is present in (the end or middle of) a linker in a state capable of covalently bonding to the C-terminus of the desired peptide. A puromycin-like substance in this state is considered to be capable of covalently bonding to the C-terminus of an elongating peptide as a substrate for transpeptidation in a ribosome. A preferred embodiment of the covalent bond is an amide bond. Those skilled in the art can appropriately design a linker to achieve this state based on conventional techniques. In one embodiment, a nucleoside (containing a chemical structural backbone similar to that of a nucleoside) contained in the puromycin-like substance is capable of covalently bonding to an amino acid (including a substance having a chemical structural backbone similar to that of an amino acid) located at the C-terminus of the desired peptide. In one embodiment, at least one, preferably two or more, and more preferably all, of the puromycin-like substances are bound to the end of one of the branched chains constituting the linker that is not bound to the branched portion. In one embodiment, the puromycin-like substance is bound to a side chain of a branched chain present in the middle of the linker.
[0055] Therefore, the type and size (length) of the peptide to which the puromycin-like substance can bind are not particularly limited. One embodiment of the desired peptide is a linear peptide, preferably a peptide whose C-terminus is linear. The peptide may contain not only natural amino acid residues but also unnatural amino acid residues. Non-limiting examples of such peptides include the fluorescent model peptide (amino acid sequence: SEQ ID NO: 19), streptavidin-binding peptide (amino acid sequence: SEQ ID NO: 21), human neonatal Fc receptor (FcRn)-binding peptide (amino acid sequence: SEQ ID NO: 23), hemagglutinin (HA)-binding peptide (amino acid sequence: SEQ ID NO: 25), and human IgG Fc protein (Fc)-binding peptide (amino acid sequence: SEQ ID NO: 27) described in the Examples, and the peptide may be at least one or more peptides selected from these.
[0056] Furthermore, the peptide may be, but is not limited to, a peptide being elongated in a ribosome as a substrate for transpeptidation. As used herein, the term "peptide" includes not only those peptides that have been completely translated from genetic information material, but also those that are being elongated during translation.
[0057] In one embodiment, the linker is used to link the genetic information material and the peptide encoded by the genetic information material.
[0058] The linker may be modified as appropriate depending on the intended use. Known modification methods can be used, but are not limited to these. For example, by modifying the linker with a binding substance such as biotin, a FLAG tag, an HA tag, or a His tag, or a color-developing protein such as a fluorescent molecule, a fluorescent protein, a chemiluminescent protein, peroxidase, or alkaline phosphatase, the genetic information material-linker-peptide conjugate described in 4 below can be suitably used in "8. Method for evaluating binding ability" below. Furthermore, there is no particular limitation on the number of modifying substances for the linker, and it may be single or multiple.
[0059] 2. Using a Linker In one aspect, the present invention relates to the use of said linker for linking genetic information material and a peptide encoded by said genetic information material.
[0060] In one aspect, the present invention provides a method for producing a pharmaceutical composition comprising: a binding moiety having a structure capable of binding to a desired genetic information material; and At least two puromycin-like substances A linker comprising: The puromycin-like substance can be covalently linked to the C-terminus of a desired peptide. Use of the linker, The present invention relates to the above-mentioned use for linking said genetic information material to a peptide encoded by said genetic information material.
[0061] The "linker" and the components of the linker are as explained in "1. Linker." The "binding portion having a structure capable of binding to a desired genetic information material" in the linker binds to the genetic information material. The puromycin-like substance can be covalently bonded to the C-terminus of a desired peptide. Therefore, it is possible to link the genetic information material to a peptide encoded by the genetic information material via the linker. Since at least two or more puromycin-like substances are present in the linker, it is possible to link two or more peptides to the genetic information material.
[0062] The present invention relates to a linker used to link the genetic information material and the peptide encoded by the genetic information material.
[0063] The present invention relates to a kit or composition (e.g., an experimental composition) containing the linker. The kit or composition is used, for example, to link a genetic information material to a peptide encoded by the genetic information material. Alternatively, the kit or composition is used in the following sections, "7. Screening method," "8. Method for evaluating binding ability," "10. Method for displaying peptides," etc.
[0064] 3. Genetic information material-linker conjugate In one aspect, the present invention relates to a genetic information material-linker conjugate. The genetic information material-linker conjugate of the present invention is (a) the linker; and (b) the genetic information material bound to the linker of (a); Includes.
[0065] The "linker" and components of the linker, the "genetic information material", etc. are as explained in "1. Linker" or "2. Use of Linker".
[0066] The conjugate is in a form in which the genetic information material is linked to a "binding portion having a structure capable of binding to a desired genetic information material" in the linker.
[0067] As explained in "1. Linker," one embodiment of the linker is a linker comprising a binding moiety having a structure capable of indirectly binding to a desired genetic information material. In this embodiment, the conjugate may further comprise the suitable linker, and may be a conjugate of genetic information material-the suitable linker-the linker of the present invention. The suitable linker is a linker capable of connecting the desired genetic information material and the linker of the present invention. The suitable linker includes a substance capable of directly binding to the desired genetic information material and a substance capable of directly binding to the linker of the present invention.
[0068] Furthermore, the conjugate may contain the components (a) and (b), and the linker does not necessarily have to be used in the production process of the conjugate; a "linker precursor" may be used instead. The "linker precursor" is an intermediate for producing the linker, and examples thereof include intermediates prior to the binding of a puromycin-like substance to the linker. One embodiment of such a linker precursor has two or more reactive groups for binding a puromycin-like substance, and is characterized in that it becomes the linker by binding a puromycin-like substance to each of the reactive groups. Such a linker precursor also constitutes one embodiment of the present invention.
[0069] For example, as described in Example 3-2, a genetic information material-linker conjugate obtained by conjugating a desired genetic information material with a linker precursor and then conjugating a puromycin-like substance also contains the above-mentioned (a) and (b) as its components, and is therefore one embodiment of the above-mentioned "genetic information material-linker conjugate."
[0070] Also, in one aspect, the present invention provides a desired genetic information material; Contains at least two or more puromycin-like substances, the desired genetic information substance is linked to at least two or more puromycin-like substances, At least two of the puromycin-like substances are capable of covalently binding to the C-terminus of a desired peptide. and a conjugate of a desired genetic information material and a puromycin-like substance. The linker comprises at least two or more puromycin-like substances, and the puromycin-like substances can be covalently bonded to the C-terminus of the desired peptide. As used herein, "a conjugate of a genetic information material and a puromycin-like substance" may include the "genetic information material-linker conjugate" as long as there is no particular technical inconvenience.
[0071] The genetic information material-linker conjugate can link the genetic information material to a peptide encoded by the genetic information material via the linker that constitutes the conjugate. In one aspect, the present invention relates to use of the conjugate for linking the genetic information material to a peptide encoded by the genetic information material.
[0072] The conjugate can also be suitably used in "6. Library preparation," "7. Screening method," "8. Method for evaluating binding ability," "10. Method for displaying peptides," etc. In one aspect, the present invention relates to the use of the conjugate of the linker and the genetic information material in the library preparation, screening method, or method for evaluating binding ability.
[0073] In one aspect, the present invention also relates to a conjugate of the linker and the genetic information material, which is used to link the genetic information material to a peptide encoded by the genetic information material, and in another aspect, the present invention also relates to a conjugate of the linker and the genetic information material, which is used in library preparation, screening methods, or methods for evaluating binding ability.
[0074] The present invention relates to a kit or composition (e.g., an experimental composition) comprising a conjugate of the linker and the genetic information material. The kit or composition is used, for example, to link a genetic information material to a peptide encoded by the genetic information material. Alternatively, the kit or composition is used in the following "6. Library preparation," "7. Screening method," "8. Method for evaluating binding ability," "10. Peptide display method," etc.
[0075] 4. Genetic information material-linker-peptide conjugate In one aspect, the present invention relates to a genetic information material-linker-peptide conjugate, which is (a) the linker; (b) the genetic information material attached to the linker bond of (a); and (c) a peptide encoded by said genetic information material bound to at least one of the puromycin-like substances of the linker of (a). Includes.
[0076] The "linker" and components of the linker, "genetic information material", "peptide", etc. are as explained in "1. Linkers", "2. Use of Linkers", or "3. Genetic information material-linker conjugates".
[0077] The peptide (c) is linked to at least one, preferably two or more, puromycin-like substances of the linker. Preferably, the peptide (c) is linked to all or some (two or more) of the puromycin-like substances of the linker. In one embodiment, the peptide (c) is linked to all of the puromycin-like substances of the linker. That is, the upper limit of the number of peptides (c) is the number of puromycin-like substances contained in the linker. In one embodiment, the peptide (c) is linked to all of the puromycin-like substances of the linker. The number of peptides linked is not limited to two or more, and preferably 2 to 8, 2 to 7, 2 to 6, 2 to 5, 2 to 4, or 2 to 3 peptides. In one embodiment, two peptides are linked.
[0078] The "genetic information material-linker-peptide conjugate" can be suitably used, for example, in "6. Library" preparation, "7. Screening method," "8. Method for evaluating binding ability," "10. Method for displaying peptides," etc. In one aspect, the present invention relates to the use of the genetic information material-linker-peptide conjugate in a library preparation method, a screening method, or a method for evaluating binding ability. In one aspect, the present invention relates to the genetic information material-linker-peptide conjugate used in a library preparation method, a screening method, or a method for evaluating binding ability.
[0079] Also, in one aspect, the present invention provides (d) a conjugate of a desired genetic information material and a puromycin-like substance; (e) a peptide encoded by the desired genetic information material bound to a puromycin-like substance carried by the conjugate of (d); The present invention also includes a genetic information substance-puromycin-like substance-peptide conjugate comprising the above-mentioned compound.
[0080] The "conjugate of a desired genetic information substance and a puromycin-like substance", "peptide", etc. are as described above in 3. Genetic information substance-linker conjugate.
[0081] The present invention relates to a kit or composition (e.g., a composition for experiments) comprising the genetic information material-linker-peptide conjugate. The present invention relates to a kit or composition (e.g., a composition for experiments) comprising the genetic information material-puromycin-like substance-peptide conjugate. The kit or composition is used, for example, in the following "6. Preparation of library," "7. Screening method," "8. Method for evaluating binding ability," "10. Method for displaying peptides," etc.
[0082] 5. Method for producing genetic information material-linker-peptide conjugate (1) In one aspect, the present invention relates to a method for producing a genetic information material-linker-peptide conjugate, the method comprising the steps of: (1) A step of subjecting the genetic information material-linker conjugate of the present invention to a cell-free translation system to translate the genetic information material, in which the puromycin-like substance in the linker binds to the translated peptide to obtain a genetic information material-linker-peptide conjugate; Includes.
[0083] Non-limiting examples include, prior to step (1), a step (0) of binding the linker to a desired genetic information material to obtain a genetic information material-linker conjugate.
[0084] The "linker" and its components, "genetic information material," "peptide," etc. are as described in "1. Linkers," "2. Use of Linkers," "3. Genetic information material-linker conjugates," or "4. Genetic information material-linker-peptide conjugates."
[0085] In step (0), the method for binding the linker and genetic information material is not particularly limited, and any known method can be used depending on the binding mode. "Hybridization" can be performed by subjecting the linker and genetic information material to conditions (temperature, salt concentration, etc.) suitable for nucleic acid hybridization. Furthermore, other methods can be performed using known materials and conditions, such as irradiating single-stranded DNA hybridized with target mRNA at a specific site with UV light to bind by photocrosslinking, or enzymatically covalently binding the ends of the target mRNA and single-stranded DNA using RNA ligase or DNA ligase.
[0086] In step (1), the genetic information substance is translated in a ribosome based on the genetic information substance-linker conjugate obtained in step (0). The puromycin-like substance in the linker binds to the translated peptide, yielding a genetic information substance-linker-peptide conjugate.
[0087] The method for translating the genetic information material is not particularly limited, and can be carried out using any known translation method. The peptide may be a peptide that has completed the translation process and binds to the puromycin-like substance, or a peptide that is being elongated in a ribosome as a substrate for transpeptidation reaction.
[0088] The production method (particularly the translation step (1)) uses a cell-free translation system, but is not limited thereto. The cell-free translation system is a combination of ribosomes extracted from cells, protein factors involved in translation, tRNA, amino acids, an energy source such as ATP, and a regeneration system thereof, and is not particularly limited as long as it is capable of translating mRNA into protein. The cell-free translation system may also include, but is not limited to, an initiation factor, an elongation factor, a release factor, an aminoacyl-tRNA synthetase, and the like. These factors can be obtained by purification from extracts of various cells. Examples of cells for purifying factors include prokaryotic cells and eukaryotic cells. Examples of prokaryotic cells include Escherichia coli cells, extreme thermophilic bacteria cells, and Bacillus subtilis cells. Known eukaryotic cells include yeast cells, wheat germ, rabbit reticulocytes, plant cells, insect cells, and animal cells. In addition to naturally occurring tRNAs and aminoacyl-tRNA synthetases (ARSs), artificial tRNAs and artificial aminoacyl-tRNA synthetases that recognize unnatural amino acids can also be used. Chemically synthesized tRNAs and tRNAs linked by RNA ligases can also be used.
[0089] Furthermore, the cell-free translation system is, but is not limited to, a reconstituted cell-free translation system. An example of a reconstituted cell-free translation system is a system in which components unrelated to translation are removed by fractionating an Escherichia coli extract and reconstituting each factor. A reconstituted cell-free translation system requires purified ribosomes, translation initiation factors, translation elongation factors, mRNA, aminoacyl-tRNA, and substrates such as ATP and GTP (M.H. Schreier, B. Erni, and T. Staehelin (1977), "Initiation of mammalian protein synthesis. I. Purification and characterization of seven initiation factors," Journal of Molecular Biology, Vol. 116, No. 4, 727-753 (Non-Patent Document 27); H. Trachsel, B. Emi, M.H. Schreier, and T. Staehelin (1977), "Initiation of mammalian protein synthesis. II. The assembly of the initiation complex with purified initiation factors," Journal of Molecular Biology, Vol. 116, No. 4, 755-767 (Non-Patent Document 28)). Among these, aminoacyl-tRNA can be substituted by adding tRNA, aminoacyl-tRNA synthetase, and its substrate to the same reaction mixture.Furthermore, as is done in general cell-free translation systems, proteins and enzymes such as translation termination factors, ribosome recycling factors, creatine kinase, myokinase, nucleotide diphosphate kinase, and pyrophosphatase, as well as their substrates, can be added to increase the efficiency and fidelity of the translation reaction (PC Jelenc and CG Kurland (1979) "Nucleoside triphosphate regeneration decreases the frequency of translation errors" Proceedings of the Natural Academy Science of the United States of America Vol. 76, No. 7, 3174-3178 (Non-Patent Document 29)).
[0090] The reconstituted cell-free translation system can more easily prevent contamination with inhibitors such as nucleases and proteases than conventional cell-free translation systems that use cell extracts.
[0091] Furthermore, when synthesizing a peptide containing a non-standard amino acid, the FIT system (WO2012 / 026566 (Patent Document 7)) can be used, but is not limited to this.
[0092] As shown in Figure 5(b) of Example 5 and Figures 6(a) and (b) of Example 6, even when a single translation reaction was performed, a genetic information material-linker-peptide conjugate was obtained, in which each puromycin-like substance in the linker was bound to the translated peptide, although the amount was smaller than when artificial recycling translation was performed. Without being bound by theory, one possible explanation for this is that after the translation reaction, the ribosome spontaneously dissociates from the peptide and begins translation of the second or subsequent peptide, with the translated and synthesized peptide binding to each puromycin-like substance in the linker. Alternatively, it is assumed that multiple ribosomes bind to the genetic information material being translated to form a polysome, and the peptide translated by each ribosome binds to each puromycin-like substance in the linker.
[0093] The genetic information material-linker-peptide conjugate is desirably dissociated from the ribosome after its production, i.e., after completion of peptide synthesis (including during peptide synthesis). Dissociation of the conjugate from the ribosome, i.e., dissociation of the peptide from the ribosome, can be achieved by known methods. Ribosomes must maintain an appropriate three-dimensional structure to function, which requires Mg ions. Therefore, adding a substance capable of binding to Mg ions, such as EDTA, removes the Mg ions, denaturing the ribosome and causing it to lose its function. Therefore, by denaturing the ribosome by, for example, adding EDTA, the conjugate dissociated from the ribosome can be efficiently obtained. Alternatively, a substance capable of denaturing the ribosome may be added instead of EDTA.
[0094] In one embodiment, the production method includes repeating step (1) two or more times (step (2)). The production method including repeating step (1) two or more times is sometimes referred to herein as "artificial recycling translation (method)." The number of times step (1) is repeated is not particularly limited. In one embodiment, it is repeated 2 to 8 times, 2 to 7 times, 2 to 6 times, 2 to 5 times, 2 to 4 times, or 2 to 3 times. In one embodiment, step (1) is repeated two times. In another embodiment, step (1) is repeated three times.
[0095] When an n-valent linker is used as the linker, artificial recycling translation may be performed two or more times. However, from the viewpoint of the binding efficiency of the peptide to the puromycin-like substance, the more times it is repeated, the more preferable, and n or more times is more preferable. In order to repeat translation of the genetic information substance two or more times, it is desirable to first dissociate the ribosome from the peptide after translation has been completed or is in the middle of translation. In other words, it is desirable to perform a ribosome dissociation step after the translation step of the genetic information substance. The method for dissociating the ribosome is as described above. Even without artificially dissociating the ribosome, the ribosome may naturally dissociate from the peptide and start translating the second or subsequent peptides.
[0096] When ribosomes are dissociated by the above-mentioned method of adding a substance capable of binding to Mg ions, it is preferable to create ribosome-non-denaturing conditions and then add additional native ribosomes when performing the next translation step.
[0097] For example, by adding Mg(OAc)2 (for example, at a concentration of about 9 to 20 mM), Mg ions can be added, making the ribosomes ready for translation.
[0098] Alternatively, the genetic information material-linker-peptide conjugate can be immobilized on a solid phase such as magnetic beads, and after removing the liquid phase portion under ribosome-denaturing conditions, a solution under ribosome-non-denaturing conditions can be added to render the ribosome translatable.
[0099] In one embodiment, the genetic information material-linker-peptide conjugate may be treated after production to improve the stability of the mRNA portion of the mRNA-linker-peptide conjugate. For example, the stabilization treatment may involve performing a reverse transcription reaction using the conjugate as a template to form an RNA-DNA hybrid chain. A reverse transcription reaction solution may be added to a reaction solution containing the genetic information material-linker-peptide conjugate obtained by a translation reaction, and then the reverse transcription reaction is carried out.
[0100] Without limitation, the genetic information material-linker-peptide conjugate has a higher recovery rate when recovered using a peptide-binding substance than when a linker containing only one puromycin-like substance is used. In one embodiment, by using the genetic information material-linker-peptide conjugate, it is possible to obtain a peptide-binding substance (target substance) at a recovery rate when recovered using a peptide-binding substance that is 1.5-fold, 2-fold or more, 3-fold or more, 5-fold or more, 10-fold or more, 20-fold or more, 100-fold or more, or 600-fold or more than that when a linker containing only one puromycin-like substance is used.
[0101] The type of peptide-binding substance (target substance) is not particularly limited as long as it is a substance that can bind to a peptide. Non-limiting examples of the target substance include proteins, nucleic acids, sugar chains, low-molecular-weight compounds, and cells. In one embodiment, the target substance is a protein.
[0102] In one aspect, the present invention provides a method for producing a pharmaceutical composition comprising: (1) binding the linker to a desired genetic information material to obtain a genetic information material-linker conjugate; and (2) subjecting the genetic information material-linker conjugate obtained in step (1) to a cell-free translation system to translate the genetic information material, in which the puromycin-like substance in the linker binds to the translated peptide to obtain a genetic information material-linker-peptide conjugate; The present invention relates to a genetic information material-linker-peptide conjugate produced by a method comprising the steps of:
[0103] Such "genetic information material-linker-peptide conjugates" can also be suitably used, for example, in "6. Preparation of libraries," "7. Screening methods," "8. Methods for evaluating binding ability," "10. Methods for displaying peptides," etc.
[0104] 6. Library In one embodiment, the present invention relates to a library comprising at least two information material-linker-peptide conjugates of the present invention.
[0105] The "linker" and its components, "genetic information material," "peptide," etc. are as described in "1. Linkers," "2. Use of Linkers," "3. Genetic information material-linker conjugates," or "4. Genetic information material-linker-peptide conjugates."
[0106] The library is characterized by containing at least two of the genetic information material-linker-peptide conjugates, and can otherwise be prepared by known methods. For example, as shown in Examples 10, 11, 12, 13, 15, and 16, the linker showed high recovery rates in all of the different display methods, and therefore can be used in known display methods using puromycin-like substances and their libraries.
[0107] The library may be prepared by combining a display method in which the linker is covalently or non-covalently linked to the genetic information material in a cell-free translation system, such as an mRNA display method, a TRAP display method, or a RAPID display method.
[0108] Alternatively, the library may be a random peptide library, for example, by using randomized nucleic acids as the genetic information material, a library of genetic information material-linker-peptide conjugates containing various peptides encoded by the randomized nucleic acids can be obtained.
[0109] The genetic information material-linker-peptide conjugate contains at least two or more desired peptides, each peptide bound to a puromycin-like substance in the linker, and the two or more peptides may be located in close proximity to each other (depending on the length of the linker, etc.) and may potentially interact with each other. This makes it possible to screen for peptide-binding substances with weaker binding affinity to the peptide. Furthermore, by using the library of the present invention, genetic information material-peptide conjugates that bind to target substances can be recovered with higher efficiency.
[0110] 7. Screening Method In one aspect, the present invention relates to a method for screening peptides that bind to a desired target substance, the method comprising the step of contacting the target substance with a library containing at least two of the genetic information material-linker-peptide conjugates.
[0111] The "linker" and its components, "genetic information material," "peptide," "library," etc. are as explained in "1. Linkers," "2. Use of Linkers," "3. Genetic information material-linker conjugates," "4. Genetic information material-linker-peptide conjugates," or "6. Libraries."
[0112] Non-limiting examples of the target substance include proteins, nucleic acids, sugar chains, low molecular weight compounds, cells, etc. In one embodiment, the target substance is a protein.
[0113] The screening method is characterized by using the library containing at least two of the genetic information material-linker-peptide conjugates, in other words, by using a known screening method in other respects. The screening method makes it possible to screen for peptide-binding substances with weaker binding affinity to the peptide. Furthermore, the screening method of the present invention enables more efficient recovery of genetic information material-peptide conjugates that bind to a target substance.
[0114] 8. Method for assessing binding ability In one aspect, the present invention relates to a method for evaluating the binding ability of a peptide to a desired target substance, the method comprising the step of contacting the genetic information material-linker-peptide conjugate of the invention with the target substance.
[0115] The "linker" and its components, "genetic information material," "peptide," etc. are as described in "1. Linkers," "2. Use of Linkers," "3. Genetic information material-linker conjugates," or "4. Genetic information material-linker-peptide conjugates."
[0116] The evaluation method is characterized by contacting the genetic information material-linker-peptide conjugate of the present invention with the target substance, but is not otherwise particularly limited. In one embodiment, the evaluation method includes the steps of contacting the genetic information material-linker-peptide conjugate with the target substance and measuring the binding affinity between the peptide in the conjugate and the target substance. The method for evaluating binding affinity is not particularly limited, and known methods for evaluating binding affinity can be used. The target substance may be present in solution, immobilized on a carrier such as beads, a chip, or a plate, or expressed on cells, viruses, etc. Alternatively, the genetic information material-linker-peptide conjugate of the present invention can be immobilized on beads, a sensor chip, or the like to evaluate its interaction with the target substance. The binding affinity to the target substance can be evaluated by known methods. Non-limiting examples of such methods for evaluating binding affinity include mass-difference-based detection methods, such as surface plasmon resonance and biolayer interferometry, ELISA, qPCR quantification, flow cytometry, dye staining, chemichromogenic detection, chemiluminescent detection, and fluorescent detection.
[0117] The genetic information material-linker-peptide conjugates of the present invention can be modified with known affinity tags and modifying substances, for example, binding substances such as FLAG tags, HA tags, and His tags, fluorescent molecules, fluorescent proteins, chemiluminescent proteins, and color-developing proteins such as peroxidase and alkaline phosphatase. Furthermore, as described in the Examples, they can also be labeled with biotin. Genetic information material-linker-peptide conjugates modified in this manner can be used appropriately for immobilization, purification, evaluation of binding ability, and the like.
[0118] Furthermore, the modified genetic information material-linker-peptide conjugate can be reacted with a target substance immobilized on beads, chips, or plates, or with a target substance expressed in cells, viruses, etc., and its binding ability can be identified by known labeling and detection techniques.
[0119] The binding ability of the modified genetic information material-linker-peptide conjugate can be evaluated by known techniques, including, but not limited to, mass difference-based detection techniques such as surface plasmon resonance and biolayer interferometry, ELISA, qPCR quantification, flow cytometry, dye staining, chemichromogenic detection, chemiluminescent detection, and fluorescent detection.
[0120] As shown in the examples, the evaluation method uses the genetic information material-linker-peptide conjugate of the present invention, and therefore the binding ability to the target substance is improved, making it possible to more accurately evaluate the binding ability of even peptide-binding substances that have weaker binding ability to peptides.
[0121] 9. Method for producing genetic information material-linker-peptide conjugate (2) In one aspect, the present invention provides a method for producing a pharmaceutical composition comprising: (1-i) a step of subjecting a genetic information substance-linker conjugate, in which a linker containing at least one or more puromycin-like substances is bound to a desired genetic information substance, to a cell-free translation system to translate the genetic information substance, in which the puromycin-like substance in the linker binds to the translated peptide, thereby obtaining a genetic information substance-linker-peptide conjugate; and (2-i) Step (1-i) is repeated two or more times. Includes.
[0122] In one aspect, the present invention includes, prior to step (1-i), a step (0-i) of binding a linker comprising a binding moiety having a structure capable of binding to a desired genetic information material and at least one or more puromycin-like substances, wherein the puromycin-like substances are capable of covalently binding to the C-terminus of a desired peptide, to the desired genetic information material to obtain a genetic information material-linker conjugate. The present invention relates to a method for producing a genetic information material-linker-peptide conjugate, comprising:
[0123] In one aspect, the present invention provides a method for producing a pharmaceutical composition comprising: (1-ii) subjecting a genetic information substance-linker conjugate, in which a linker containing at least two or more puromycin-like substances is bound to a desired genetic information substance, to a cell-free translation system to translate the genetic information substance, in which the puromycin-like substance in the linker binds to the translated peptide, thereby obtaining a genetic information substance-linker-peptide conjugate; The present invention relates to a method for producing a genetic information material-linker-peptide conjugate, comprising:
[0124] In one aspect, the present invention includes a step (0-ii) preceding step (1-ii): binding a linker comprising a linker having a binding moiety capable of binding to a desired genetic information material and at least two or more puromycin-like substances, wherein the puromycin-like substances are capable of covalently binding to the C-terminus of a desired peptide, to the desired genetic information material to obtain a genetic information material-linker conjugate. Here, the components of the linker, such as "genetic information material" and "peptide," are as described in "1. Linker," "2. Use of Linker," "3. Genetic Information Material-Linker Conjugate," or "4. Genetic Information Material-Linker-Peptide Conjugate." Steps (1) and (2) are as described above.
[0125] The production method described in "5. Production Method of Genetic Information Substance-Linker-Peptide Conjugate (1)" includes an artificial recycling translation step. The present inventors have found that the method including an artificial recycling translation step is effective not only when a linker "containing two or more puromycin-like substances" is used, but also when a linker "containing one puromycin-like substance" (also referred to as a "monovalent linker" herein) is used. This is shown, for example, in Figure 10 of Example 10, Figure 11 of Example 11, and Figure 12 of Example 12. In all of these Examples, when a monovalent linker was used, the recovery rate was significantly improved when a single translation step was performed compared to a double translation step. Without being bound by theory, this is thought to be because when a linker containing one puromycin-like substance is used in the translation step, a large amount of linker not bound to a peptide remains in the reaction solution after a single translation step, whereas repeating the translation step two or more times increases the amount of linker bound to a peptide in the reaction solution.
[0126] The genetic information material-linker-peptide conjugate obtained by the above-mentioned production method can be suitably used in a method for screening peptides that bind to a desired target substance, or in a method for evaluating the binding ability between a desired target substance and a peptide. The screening method and the method for evaluating the binding ability are not particularly limited, and known methods can be used for each.
[0127] The matters described in "5. Method for producing genetic information material-linker-peptide conjugate (1)" also apply to "9. Method for producing genetic information material-linker-peptide conjugate (2)" unless there is a technical contradiction.
[0128] 10. Peptide presentation method In one aspect, the present invention provides a method for producing a pharmaceutical composition comprising: A method for displaying two or more peptides encoded by a desired genetic information material from the genetic information material, comprising: The method relates to a method in which each of the peptides is linked to the genetic information material via a functional group capable of covalently bonding to the C-terminus of the peptide.
[0129] The terms "genetic information material," "peptide," etc. are as explained in "1. Linker," "2. Use of Linkers," "3. Genetic information material-linker conjugate," or "4. Genetic information material-linker-peptide conjugate."
[0130] In one aspect, the presentation method includes: The method includes a step of subjecting the genetic information substance-linker conjugate to a cell-free translation system to translate the peptide from the genetic information substance, wherein the puromycin-like substance binds to the translated peptide.
[0131] The "step of binding the linker to the genetic information material," the "cell-free translation system," the "step of translating the peptide," and the like are as explained in "5. Method for producing a genetic information material-linker-peptide conjugate (1)."
[0132] The display method of the present invention can display multiple peptides encoding a desired genetic information substance from the desired genetic information substance, thereby improving avidity and enabling more efficient recovery of genetic information substance-peptide conjugates that bind to the target substance. [Example]
[0133] The present invention will be described in detail below with reference to examples, but the present invention is not limited to these examples. Those skilled in the art can easily make modifications and variations to the present invention based on the description in this specification, and such modifications and variations are within the technical scope of the present invention.
[0134] [Example 1: Synthesis of various linkers] The linkers were designed to contain "cccgcctcccgccccccgtcc" (SEQ ID NO: 1) or "ctcccgccccccgtcc" (SEQ ID NO: 60) as the mRNA hybridization region. Linkers 1, 2, 7, and 9 each contained one puromycin moiety capable of forming an amide bond with the C-terminus of the desired peptide. Linkers 3 to 6, 8, 10, and 12 contained two puromycin moieties, linkers 11 and 15 contained three puromycin moieties, linker 13 contained four puromycin moieties, and linker 14 contained six puromycin moieties (Figures 1-1, 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, and 1-10). The linkers were designed and synthesized as follows:
[0135] Linkers 1, 7, 9, and 10: See the corresponding non-patent literature below. Linker 1 (Non-Patent Document 3), linker 7 ("In Vitro Selection of Anti-Akt2 Thioether-Macrocyclic Peptides Leading to Isoform-Selective Inhibitors" Hayashi et al., ACS Chem. Biol., 2012, 7, 3, 607-613, Non-Patent Document 19), linkers 9 and 10 (Patent Document 2), synthesized by a general phosphoramidite method and purified by high-performance liquid chromatography (HPLC).
[0136] Linker 2: A linker 2 precursor (Figure 2-1) having a thiol at the 3' end was synthesized using the general phosphoramidite method, and then modified with Cy5 via Michael addition of the thiol to maleimide, followed by purification by HPLC.
[0137] Linker 3: Linker 3 precursor 1 (Figure 2-1), which has two primary amines at the 5' end, is synthesized using the standard phosphoramidite method. This is then reacted with 4-azidobutan-1-enoic acid NHS ester, which has an amine-reactive N-hydroxysuccinimide (NHS) ester at one end, to synthesize linker 3 precursor 2 (Figure 2-2), which is then purified by HPLC. Next, linker 3 precursor 3 (Figure 2-2) is synthesized using the standard phosphoramidite method. This is then combined with linker 3 precursor 2 via the SPAAC reaction to synthesize linker 3, which is then purified by HPLC.
[0138] Linkers 4-6, 8, 11-15: Precursor 1 (Figures 2-3, 2-4, 2-5, 2-7, 2-8, 2-10, 2-11, 2-13, 2-15) of linkers 4-6, 8, 11-15, which have multiple primary amines at the 5' end, was synthesized using the general phosphoramidite method. This was then reacted with 4-azidobutan-1-enoic acid NHS ester, which has an amine-reactive NHS ester at one end, to synthesize precursor 2 (Figures 2-3, 2-4, 2-5, 2-7, 2-9, 2-10, 2-12, 2-14, 2-15) of linkers 4-6, 8, 11-15. These precursors were then purified by HPLC. Next, alkyne puromycin (Figure 2-6) was synthesized using the general phosphoramidite method, and then linked to linker 4-6, 8, 11-15 precursor 2 via CuAAC reaction to synthesize linkers 4-6, 8, 11-15, and then purified by HPLC.
[0139] Based on the synthesis method designed above, the synthesis of linkers 1 and 3 was outsourced to BEX Co., Ltd. (Japan), and the synthesis of linkers 2, 4 to 15 was outsourced to Gene Design Co., Ltd. (Japan). Linker 12 was synthesized using linker 12 precursor 2, which was outsourced to Gene Design Co., Ltd. (Japan), and alkyne puromycin. Linkers 4 to 12, 15, and linker 12 precursor 2 were analyzed by GeneDesign using HPLC (BioAccord™ SYSTEM, Waters) (column used: XBridge C18 Column 130 Å 2.5 μm 4.6 mm × 75 mm; column temperature: 60°C; solvent A: 100 mM hexafluoroisopropanol (HFIP) 8 mM triethylamine; solvent B: methanol; gradient of solvent B: 5-40% (5-30% for linkers 4, 9, 10, and linker 12 precursor 2, 5-50% for linker 8, and 5-60% for linkers 11 and 13 to 15) for 20 minutes, flow rate: 1 mL / min). The purities of the linkers obtained by the analysis were as follows:
[0140] Linker 4: 96.3% Linker 5: 95.6% Linker 6: 91.6% Linker 7: 97.6% Linker 8: 95.54% Linker 9: 98.75% Linker 10: 98.18% Linker 11: 90.3% Linker 12 precursor 2: 97.68% Linker 13: 92.65% Linker 14: 89.38% Linker 15: 96.17%
[0141] In addition, an electrospray ionization time-of-flight mass spectrometer (ESI-TOF-MS, BioAccord) was used. TM The results of mass spectrometry using the Waters SYSTEM were as follows:
[0142] Linker 4: ESI-TOF-MS, [M - H] - Calculated 10808.12; Measured 10807.00 (after deconvolution). Linker 5: ESI-TOF-MS, [M - H] - Calculated 11496.72; Measured 11496.00 (after deconvolution). Linker 6: ESI-TOF-MS, [M - H] - Calculated 12185.32; Measured 12184.00 (after deconvolution). Linker 7: ESI-TOF-MS, [M - H] - Calculated 7587.33; Measured 7588.0 (after deconvolution). Linker 8: ESI-TOF-MS, [M - H] - Calculated 9398.84; Measured 9400.30 (after deconvolution). Linker 9: ESI-TOF-MS, [M - H] - Calculated 9150.22; Measured 9150.90 (after deconvolution). Linker 10: ESI-TOF-MS, [M - H] - Calculated 1115.62; Measured 11115.00 (after deconvolution). Linker 11: ESI-TOF-MS, [M - H] - Calculated value 13659.18; Measured value 13662.00 (after deconvolution). Linker 12 precursor: ESI-TOF-MS, [M - H] - Calculated 9303.66; Measured 9302.00 (after deconvolution). Linker 13: ESI-TOF-MS, [M - H] - Calculated 16493.59; Measured 16493.00 (after deconvolution). Linker 14: ESI-TOF-MS, [M - H] - Calculated 22880.98; Measured 22880.60 (after deconvolution). Linker 15: ESI-TOF-MS, [M - H] - Calculated 12281.98; Measured 12284.80 (after deconvolution).
[0143] 3-Hydroxypicolinic acid (final concentration: 50% (v / v), saturated solution, 50% acetonitrile, 0.1% trifluoroacetic acid, 10 mg / mL diammonium hydrogen citrate) was added to each of the outsourced synthesis linkers 1 to 12 (final concentration: 20 μM), and the mixture was crystallized on an MTP 384 TARGET PLATE POLISHED STEEL BC (Bruker) at RT. The crystallized samples were analyzed by mass spectrometry (linear mode, positive ion mode) using a matrix-assisted laser desorption / ionization time-of-flight mass spectrometer (MALDI-TOF-MS, autoflex® maX, Bruker) with the following results:
[0144] Linker 1: MALDI-TOF-MS (m / z), [M+H] + Calculated value 8995.34; measured value 8994.27. Linker 2: MALDI-TOF-MS (m / z), [M+H] + Calculated value 9956.42; measured value 9956.17. Linker 3: MALDI-TOF-MS (m / z), [M+H] + Calculated value 13782.77; measured value 13782.73. Linker 4: MALDI-TOF-MS (m / z), [M+H] + Calculated value 10810.13; measured value 10808.55. Linker 5: MALDI-TOF-MS (m / z), [M+H] + Calculated value 11498.73; measured value 11496.18. Linker 6: MALDI-TOF-MS (m / z), [M+H] + Calculated value 12187.33; measured value 12185.45. Linker 7: MALDI-TOF-MS (m / z), [M+H] +Calculated value 7589.35; measured value 7589.90. Linker 8: MALDI-TOF-MS (m / z), [M+H] + Calculated value 9400.86; measured value 9400.68. Linker 9: MALDI-TOF-MS (m / z), [M+H] + Calculated value 9152.24; measured value 9152.58. Linker 10: MALDI-TOF-MS (m / z), [M+H] + Calculated value 11117.64; measured value 11117.02. Linker 11: MALDI-TOF-MS (m / z), [M+H] + Calculated value 13661.20; measured value 13661.66. Linker 12: MALDI-TOF-MS (m / z), [M+H] + Calculated value 11725.66; measured value 11724.23.
[0145] These results confirmed that the substance obtained above was the desired linker.
[0146] [Example 2: Synthesis of DNA used in the examples] A template DNA was synthesized to prepare mRNA to be linked to the linker.
[0147] Template DNA was prepared by ligating synthetic single-stranded DNA and primers by polymerase chain reaction (PCR). Tables 1-1 and 1-2 show the base sequences of the synthetic single-stranded DNAs used in PCR to prepare template DNA. Table 1-3 shows the sequences of the primers used in the examples described herein. Table 2 shows the combinations of synthetic single-stranded DNA and primers used in the synthesis of each template DNA in this example.
[0148] [Table 1-1]
[0149] [Table 1-2]
[0150] [Table 1-3]
[0151] [Table 2]
[0152] Table 3 shows the template DNAs obtained by the above PCR and the amino acid sequences of the peptides encoded by the translation regions of the template DNAs in the translation reactions in the following Examples. The template DNAs consist of a T7 promoter sequence, a ribosome binding sequence, an initiation codon, a peptide sequence, a spacer peptide sequence, an amber codon, and a linker hybridization sequence.
[0153] [Table 3-1]
[0154] [Table 3-2]
[0155] In Tables 3-1 and 3-2, lowercase letters indicate DNA, uppercase letters indicate commonly used amino acid abbreviations, Fph indicates N-(3',6'-dihydroxy-3-oxo-3-H-spiro[isobenzenefuran-1,9'-xanthene]-5-carboxyl)-L-phenylalanine, MeA indicates N-methyl-L-alanine, and ClAcY indicates N-2-chloroacetyl-L-tyrosine. The underlined regions indicate the translated regions in the template DNA.
[0156] The template DNA (SEQ ID NO: 18) prepared by "synthetic single-stranded DNA for model sequence" in the table is an oligonucleotide encoding a fluorescent model peptide (SEQ ID NO: 19) containing a fluorescein structure. The template DNA (SEQ ID NO: 20) prepared by "synthetic single-stranded DNA for Strep-tag II" is an oligonucleotide encoding a streptavidin-binding peptide (SEQ ID NO: 21, "Improved affinity of engineered streptavidin for the Strep-tag II peptide is due to a fixed open conformation of the lid-like loop at the binding site," I. P. Korndorefer and A. Skerra, Protein Sci., 2002, 11, 4, 883-893 (Non-Patent Document 7)). The template DNA (SEQ ID NO: 22) prepared by "synthetic single-stranded DNA for FcRn binder" is an oligonucleotide encoding a human neonatal Fc receptor (FcRn)-binding peptide (SEQ ID NO: 23, "Synthesis and Structure-Activity Relationships of Dimeric Peptide Antagonists of the Human Immunoglobulin G-Human Neonatal A template DNA (SEQ ID NO: 24) prepared by "synthetic single-stranded DNA for HA binder" was used to encode an oligonucleotide encoding a hemagglutinin (HA)-binding peptide (SEQ ID NO: 25, "Inhibition of H1 and H5 Influenza A Virus Entry by Diverse Macrocyclic Peptides Targeting the Hemagglutinin Stem Region" M.N. Pascha et al., ACS Chem. Biol. 2010, 53, 4, 1587-1596).The template DNA (SEQ ID NO: 26) prepared by "synthetic single-stranded DNA for Fc binder" contains an oligonucleotide encoding a human IgG Fc protein (Fc) binding peptide (SEQ ID NO: 27, "Kinetics-Based Structural Requirements of Human Immunoglobulin G Binding Peptides," K. Muguruma et al., ACS Omega, 2019, 4, 11, 14390-14397 (Non-Patent Document 10)).
[0157] A 100 μL PCR reaction mixture (final concentrations: 1× Phusion HF buffer, 200 μM dNTPs, 3% dimethyl sulfoxide (DMSO), 2 units Phusion DNA polymerase) containing synthetic single-stranded DNA (excluding the random region-containing synthetic single-stranded DNA for mRNAs A-L) and the corresponding primers (final concentration: 500 nM) was prepared according to Table 2. The PCR reaction was performed using a thermal cycler (T100 Thermal Cycler, BioRad) at 98°C for 60 seconds, followed by 25 cycles of 98°C for 10 seconds, 61°C for 30 seconds, and 72°C for 30 seconds. The reaction product was purified using AMPure XP (Beckman Coulter).
[0158] In addition, according to Table 2, an extension PCR reaction solution (final concentration: 1 μM of the corresponding reverse primer, 1× buffer for KOD-Plus-ver. 2 (Toyobo Co., Ltd.), 200 μM dNTPs, 1.5 mM MgSO4, 0.02 U / μL KOD plus (Toyobo Co., Ltd.)) containing synthetic single-stranded DNA containing random regions for mRNAs A to L (final concentration: 1 μM, SEQ ID NOs: 32 to 43, respectively) was prepared, and the reaction was carried out using a thermal cycler (T100 Thermal Cycler, BioRad) at 94°C for 2 minutes, followed by 5 cycles of (60°C for 40 seconds, 68°C for 60 seconds), followed by 68°C for 60 seconds. The resulting PCR mixture was diluted 40-fold with PCR reaction buffer (final concentrations: 10 mM Tris-HCl (pH 8.5), 50 mM KCl, 0.1% (v / v) Triton X-100, 2 mM MgCl, 250 μM dNTPs, 250 nM of the corresponding forward primer, 250 nM of the corresponding reverse primer, and 0.02 U / μL Taq DNA Polymerase (NEB)). The PCR mixture was then subjected to a thermal cycler (T100 Thermal Cycler, BioRad) at 95°C for 40 seconds, followed by four cycles of 95°C for 40 seconds, 50°C for 40 seconds, and 72°C for 60 seconds. The PCR product was then purified by phenol-chloroform extraction and ethanol precipitation. The resulting pellet was then redissolved in ultrapure water.
[0159] [Example 3: Preparation of mRNA-linker conjugate] Example 3-1 Preparation of mRNA and construction of mRNA-linker conjugate Template DNA prepared in Example 2 (templates for mRNA A to L containing random regions) (excluding DNA) Based on this, mRNA was synthesized by transcription reaction using T7 RNA polymerase, and the resulting reaction product was purified using RNAClean XP (Beckman Coulter). After purification, the mRNA concentration was determined from UV absorption at 260 nm and diluted to 20 μM.
[0160] Template DNA for mRNAs A to L containing random regions was diluted 5-fold with transcription mix (final concentrations: 40 mM Tris-HCl (pH 8.0), 1 mM spermidine, 0.01% (v / v) Triton X-100, 10 mM DTT, 20 mM MgCl2, 25 mM KOH, 3.75 mM NTPs, 0.24 μM T7 RNA polymerase) and incubated at 37°C for 6 hours. After incubation, DNase reaction solution (final concentrations: 40 mM Tris-HCl (pH 8.0), 10 mM MgSO4, 1 mM CaCl2, 0.025 U / μL RQ1 RNase-Free DNase (Promega)) was added, and the mixture was incubated at 37°C for 1 hour. Finally, the reaction solution was purified by phenol-chloroform extraction, and the mRNA concentration was determined from UV absorption at 260 nm and diluted to 20 μM.
[0161] Each of the mRNAs prepared in this manner (excluding mRNAs prepared based on template DNA of mRNAs I to L containing random regions) (final concentration: 5 μM) and each of the linkers prepared in Example 1 (final concentration: 5.5 μM) were heated (95°C, 3 minutes) in 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES)-KOH (final concentration: 62.5 mM, pH 7.6) and KOAc (final concentration: 375 mM, pH 7.6), and then left to stand at room temperature to allow hybridization, thereby producing 5 μM mRNA-linker conjugates. Of the mRNA-linker conjugates prepared in this manner, those using mRNAs A to H containing random regions were dissolved in a 5-fold volume of loading buffer (final concentration: 7 M urea, 10 mM EDTA, 1 mM Tris-HCl (pH 7.6)) and heated at 95°C for 1 minute. After 8% denaturing urea polyacrylamide gel electrophoresis and SYBR Green II staining, fluorescent imaging was performed using PharosFX (Biorad).
[0162] For mRNAs prepared using template DNA of mRNAs I–L containing random regions, each mRNA (final concentration: 1 μM) was mixed with linker 8 (final concentration: 1.5 μM), 1x Ligation buffer (Takara), and DMSO (final concentration: 10% (v / v), T4 RNA ligase (Takara, final concentration: 5 U / μL)) and ligated at 37°C for 1 hour. A portion of the prepared mRNA-linker conjugates was dissolved in 5x loading buffer (final concentrations: 7 M urea, 10 mM EDTA, 1 mM Tris-HCl (pH 7.6)) and heated at 95°C for 1 minute. After electrophoresis on 8% denaturing urea polyacrylamide gel and staining with SYBR Green II, the conjugates were subjected to fluorescent imaging using a PharosFX (Biorad).
[0163] The analysis results for the mRNA-linker conjugates are shown in Figure 3. For all mRNA-linker conjugates, a fluorescent band derived from the mRNA-linker conjugate was observed at the higher molecular weight side relative to the mRNA. This demonstrates that various linkers can be used for a variety of genetic information materials.
[0164] Example 3-2 Binding of puromycin-like substance to mRNA-linker 4 precursor 2 conjugate The mRNA (final concentration: 5 μM) prepared from the template DNA of the model sequence in Example 3-1 and linker 4 precursor 2 (final concentration: 10 μM) were heated (95°C, 3 minutes) in HEPES-KOH (final concentration: 62.5 mM, pH 7.6) and KOAc (final concentration: 375 mM, pH 7.6), and then left to stand at room temperature to allow hybridization, thereby producing a 5 μM mRNA-linker 4 precursor 2 conjugate. Next, the conjugate (final concentration: 3.3 μM) was added to the alkyne puromycin (final concentration: 53.4 μM), DMSO (final concentration: 10% (v / v)), tris(3-hydroxypropyltriazolylmethyl)amine (THPTA) / copper(II) sulfate solution (final concentrations: THPTA = 10 mM, copper(II) sulfate = 5 mM), and sodium ascorbate (final concentration: 10 mM) for CuAAC (Azide-Alkyne Cycloaddition) reaction at room temperature for 2 h. After the CuAAC reaction, the fragment was purified by ethanol precipitation, dissolved in 5 volumes of loading buffer (final concentrations: 7 M urea, 10 mM EDTA, 1 mM Tris-HCl (pH 7.6)), heated at 95 °C for 1 min, and then subjected to 8% denaturing urea polyacrylamide gel electrophoresis. After SYBR Green I staining, the fragment was subjected to fluorescence imaging using a PharosFX (Biorad).
[0165] Figure 4 shows the results of fluorescence imaging. The fluorescence band derived from the mRNA-linker 4 precursor 2 conjugate was completely shifted to a higher molecular weight after the CuAAC reaction. This is thought to be due to the reaction of the alkyne puromycin with each of the two azide groups contained in the linker. This demonstrates that mRNA-linker conjugates containing two puromycin groups can be indirectly prepared by introducing one of a pair of mutually bondable functional groups, such as an azide-alkyne, into mRNA and reacting it with puromycin containing the other functional group.
[0166] Example 4: Preparation of aminoacyl-tRNA Aminoacyl-tRNA to be subjected to the translation reaction in the cell-free translation system was prepared as follows.
[0167] The amino acid activated esters used for aminoacylation of tRNA by catalytic acylating RNA (ARS ribozyme) were (3',6'-dihydroxy-3-oxo-3-H-spiro[isobenzenefuran-1,9'-xanthene]-5-carboxyl)-L-phenylalanine cyanomethyl ester (Fph-CME, "An orthogonal ribosome-tRNA pair via engineering of the peptidyl transferase center" N. Terasaka et al., Nat. Chem. Biol., 2014, 10, 7, 555-557) and L-tryptophan cyanomethyl ester (W-CME, "A highly flexible tRNA acylation method for non-natural polypeptide synthesis" H. Murakami et al. al., Nat. Methods, 2006, 3, 5, 357-359 (Non-Patent Document 12)), N-methyl-L-alanine dinitrobenzyl ester (MeA-DBE, “Messenger RNA-programmed incorporation of multiple N-methyl-amino acids into linear and cyclic peptides” T. Kawakami et al., Chem. Biol., 2008, 15, 1, 32-42 (Non-Patent Document 13)), and N-2-chloroacetyl-L-tyrosine cyanomethyl ester (ClAcY-CME, “Macrocyclic peptides exhibit antiviral effects against influenza virus HA and prevent pneumonia in animal models” M. Saito et al., Nat. Commun., 2021, 12, 1, 2654 (Non-Patent Document 14)) were prepared (prepared by the method disclosed in JP 2008-125396 A (Patent Document 8)).
[0168] To link Fph-CME, W-CME, or ClAcY-CME to tRNA, enhanced flexizyme (eFx, Table 4, WO2007 / 066627 (Patent Document 9)) was used as the ARS ribozyme. For MeA-DBE, dinitrobenzyl flexizyme (dFx, Table 4, WO2007 / 066627 (Patent Document 9)) was used.
[0169] In this case, in order to assign Fph, W, and ClAcY to the AUG codon and MeA to the UGC codon, Ini-tRNA (Table 4, WO2012 / 026566 (Patent Document 7)) having CAU in the anticodon portion, tRNA having GCA GCA (Table 4, WO2019 / 077887 (Patent Document 10)) were used.
[0170] For Fph-CME, W-CME, and ClAcY-CME (final concentration: 5 mM), eFx (final concentration: 25 μM), Ini-tRNA (final concentration: 25 μM), HEPES-KOH (final concentration: 100 mM, pH 7.5), MgCl2 (final concentration: 50 mM), and DMSO (final concentration: 20%) were added and the aminoacylation reaction was carried out at 0°C overnight. For MeA-DBE (final concentration: 5 mM), dFx (final concentration: 25 μM), tRNA GCA (final concentration: 25 μM), HEPES-KOH (final concentration: 100 mM, pH 7.5), MgCl (final concentration: 50 mM), and DMSO (final concentration: 20%) were added, and the aminoacylation reaction was carried out overnight at 0° C. After the aminoacylation, an equal volume of 3 M NaOAc (pH 5.2) was added to the sample, followed by ethanol precipitation.
[0171] The pellet was then redissolved in 0.3 M NaOAc (pH 5.2) and subjected to another ethanol precipitation. Finally, the pellet was washed once with 70% ethanol containing 0.1 M NaOAc (pH 5.2) and once with 70% ethanol. The resulting aminoacyl-tRNA pellet was dissolved in 0.2% acetic acid.
[0172] [Table 4]
[0173] Table 4 shows a list of the ARS ribozymes and tRNA sequences used in the examples (SEQ ID NOs: 28-31). Capital letters refer to commonly used abbreviations for each RNA.
[0174] [Example 5: Translation reaction using mRNA-linker conjugate (1)] The mRNA-linker conjugate prepared in Example 3 was used to carry out a translation reaction.
[0175] The cell-free translation system used for translation was constructed as follows.
[0176] 50 mM HEPES-KOH [pH 7.6], 100 mM KOAc, 20 mM creatine phosphate, 12.5 mM Mg(OAc)2, 2 mM guanosine triphosphate (GTP), 2 mM adenosine triphosphate (ATP), 1 mM cytidine triphosphate (CTP), 1 mM uridine triphosphate (UTP), 2 mM spermidine, 1 mM dithiothreitol (DTT), 1.5 mg / mL E. coli total tRNA (Roche), 1.2 μM ribosomes, 2.7 μM initiation factor 1 (IF1), 0.4 μM initiation factor 2 (IF2), 1.5 μM initiation factor 3 (IF3), 0.25 μM release factor 2 (RF2), 0.17 μM release factor 3 (RF3), 0.5 μM Ribosomal release factor (RRF), 10 μM elongation factor thermolabile (EF-Tu), 10 μM elongation factor thermostable (EF-Ts), 0.26 μM elongation factor G (EF-G), 5 μM elongation factor P (EF-P), 0.6 μM methionine transformylase, 4 μg / mL creatine kinase (Roche), 3 μg / mL myokinase (Sigma), 0.1 μM pyrophosphatase, 0.1 μM nucleotide diphosphatase kinase.
[0177] These were added with a conjugate of model sequence mRNA encoding a fluorescent model peptide containing a fluorescein structure prepared in Example 3 and linker 2 or 3 (final concentration: 1 μM), two types of aminoacyl-tRNA (final concentration: 10 μM Fph-Ini tRNA, 10 μM MeA-tRNA GCA ), 15 amino acids (final concentration: 2 mM Ala, Arg, Asn, Gly, His, Ile, Leu, Phe, Pro, Ser, Thr, Trp, Val, Asp, Tyr), and 15 aminoacyl-tRNA synthetases (final concentrations: 0.73 μM AlaRS, 0.03 μM ArgRS, 0.38 μM AsnRS, 0.09 μM GlyRS, 0.02 μM HisRS, 0.4 μM IleRS, 0.04 μM LeuRS, 0.68 μM PheRS, 0.16 μM ProRS, 0.04 μM SerRS, 0.09 μM ThrRS, 0.03 μM TrpRS, 0.02 μM ValRS, 0.13 μM AspRS, and 0.02 μM TyrRS) were added to the 500-kDa ... After the reaction, ethylenediaminetetraacetic acid (EDTA, final concentration: 12.5 mM) was added and the mixture was left standing on an ice bath for 10 minutes to denature the ribosomes.
[0178] Next, a second translation reaction was carried out to perform artificial recycling translation. The mixture contained Mg(OAc) (final concentration: 12.5 mM), translation-associated solution (final concentrations: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM phosphocreatine, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL E. coli total tRNA (Roche), 0.47 mM DTT, and aminoacyl-tRNA (final concentrations: 10 μM Fph-Ini tRNA, 10 μM MeA-tRNA). GCA ) and ribosomes (final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37° C. for 30 minutes (second translation reaction). After the reaction, EDTA (final concentration: 16.7 mM) was added to stop the translation reaction.
[0179] An equal volume of Novex™ Tricin SDS Sample Buffer (2x, Thermo) was added to the post-translation reaction solution, and the mixture was separated by 16% Tricine-denaturing polyacrylamide gel electrophoresis (1x Novex™ Tricin SDS Running buffer). The electrophoretic gel was then fluorescently imaged using a PharosFX (Biorad) (excitation: fluorescein or Cy5 mode, filter: fluorescein or Cy5).
[0180] The results are shown in Figure 5. Figure 5a shows the image obtained when detecting fluorescence derived from Cy5, and Figure 5b shows the image obtained when detecting fluorescence derived from fluorescein. Linker 2 is a linker labeled with Cy5 at the 5' end. When it is bound to a fluorescent model peptide containing a fluorescein structure, the fluorescent bands derived from Cy5 and fluorescein are overlapped. When the conjugate of mRNA and linker 2 is translated under conditions containing the amino acids necessary for translation, a fluorescent band derived from Cy5 and fluorescein overlapped at the high molecular weight side of the conjugate. The above results demonstrate that the use of fluorescein-labeled peptides makes it possible to confirm the bond between the peptide and linker by molecular weight shift.
[0181] When the conjugate of mRNA and linker 3 was translated, a fluorescent band was only obtained under conditions containing the amino acids necessary for translation. In addition, the obtained fluorescent band derived from fluorescein was located on the high molecular weight side relative to linker 2, which suggests that this fluorescent band is derived from the mRNA-linker 3-peptide conjugate. Furthermore, when translation was performed using the conjugate of mRNA and linker 3, two fluorescent bands derived from peptides were obtained, which is thought to be due to the difference in molecular weight resulting from the difference in the number of peptides bound to the end of linker 3.
[0182] Furthermore, by using a bivalent linker (linker 3), two fluorescent bands were obtained even without artificial recycling translation. However, by performing artificial recycling translation, the intensity of the fluorescent band on the higher molecular weight side of the two fluorescent bands was enhanced. This is thought to be due to the addition of an additional peptide to the linker to which one peptide was bound in the first translation, resulting in an increase in the fluorescent intensity of the same fluorescent band.
[0183] These results demonstrate that mRNA-linker-peptide conjugates with multiple peptides linked together can be obtained by translating mRNA-linker conjugates in a cell-free translation system, and that mRNA-linker-peptide conjugates can be efficiently displayed by performing artificial recycling translation.
[0184] [Example 6: Translation reaction using mRNA-linker conjugate (2)] As the mRNA-linker conjugate, an mRNA-linker conjugate in which linkers 2 and 3 were hybridized to a model sequence mRNA encoding a fluorescent model peptide containing a fluorescein structure was used. Artificial recycling translation was carried out under the same conditions as in Example 5, and finally, EDTA (final concentration: 5 mM) was added to terminate the translation reaction.
[0185] In this example, to improve the resolution in electrophoresis, nuclease treatment was performed in addition to the procedures of Example 5. Specifically, RNase H (NEB, 2.5 units) and RNase T1 (Thermo, 200 units) were added to the translation solution, and nuclease treatment was performed at 37°C for 2 hours. After nuclease treatment, tricine-modified polyacrylamide electrophoresis and fluorescence imaging were performed under the same conditions as in Example 5.
[0186] The results are shown in Figure 6. Figures 6a and 6c are images obtained when detecting fluorescein-derived fluorescence. In the mRNA-linker conjugates subjected to artificial recycling translation using a bivalent linker (Linker 3), nuclease treatment resulted in two fluorescent bands that were significantly separated compared to before treatment (Figure 6a). On the other hand, in the mRNA-linker conjugates subjected to artificial recycling translation using a monovalent linker (Linker 2), even after nuclease treatment, only one fluorescent band derived from the peptide was observed (Figure 6c). This indicates that multiple peptides are linked in the mRNA-linker conjugates subjected to artificial recycling translation using a bivalent linker (Linker 3).
[0187] Furthermore, artificial recycling translation enhanced the intensity of the fluorescent band derived from the peptide (Fig. 6b, d), indicating that repeated translation reactions can increase the proportion of mRNA-linker conjugates that form covalent bonds with the peptide.
[0188] [Example 7: Translation reaction using mRNA-linker conjugate (3)] Using mRNA-linker conjugates in which linkers 2 and 3 were hybridized to model sequence mRNA encoding a fluorescent model peptide containing a fluorescein structure, artificial recycling translation was carried out under the same conditions as in Example 5. In this example, in addition to the procedures of Example 5, a reverse transcription treatment was carried out in a reaction solution containing the translation product.
[0189] Specifically, a reverse transcription reaction solution (final concentrations: 49.5 mM Tris-HCl, 74.2 mM KCl, 18.4 mM MgCl, 1 mM DTT, 0.3 mM deoxynucleotide triphosphates (dNTPs), 20 units / μL MLV reverse transcriptase, and 12 μM TGG-ssG4S2.R23RT (SEQ ID NO: 9)) was added to the reaction solution containing the translation product obtained above, and reverse transcription was carried out at 42°C for 30 minutes. After reverse transcription, tricine-modified polyacrylamide gel electrophoresis and fluorescence imaging were performed under the same conditions as in Example 5.
[0190] The results are shown in Figure 7. Figure 7 shows an image obtained when detecting fluorescence derived from fluorescein. Hybridization of TGG-ssG4S2.R23RT to the mRNA-linker2-peptide conjugate shifted the fluorescence band derived from the conjugate toward higher molecular weights. Furthermore, the mRNA-linker-peptide conjugate hybridized with TGG-ssG4S2.R23RT further shifted toward higher molecular weights after reverse transcription.
[0191] In the mRNA-linker 3-peptide conjugate, multiple fluorescent bands were observed, unlike in the case of linker 2. This indicated that multiple peptides were linked in the bivalent linker, making it possible to carry out a reverse transcription reaction.
[0192] [Example 8: Translation reaction using mRNA-linker conjugate (4)] Artificial recycling translation was carried out under the same conditions as in Example 6 using mRNA-linker conjugates in which linkers 2, 3, 4, 5, and 6 were hybridized to model sequence mRNA encoding a fluorescent model peptide containing a fluorescein structure.
[0193] The results are shown in Figure 8. Figure 8 is a merged image obtained when detecting the fluorescence from Cy5 and fluorescein. In the mRNA-linker conjugate using a monovalent linker (linker 2), one fluorescent band was observed, which was derived from the peptide. In contrast, in the mRNA-linker conjugates using linkers 3, 4, 5, and 6, which each have two puromycin units, two fluorescent bands derived from the peptide were observed. From the above, it was demonstrated that the bivalent linker can produce an mRNA-linker-peptide conjugate in which multiple peptides are linked, even if the linker length between each puromycin varies.
[0194] [Example 9: Translation reaction using mRNA-linker conjugate (5)] Example 9-1 Specific cleavage of linker 12 by RNase T1 Linker 4 and linker 12 were each treated with an RNase T1 solution (200 U RNase T1 (Thermo), 50 mM Tris-HCl (pH 7.5), 2 mM EDTA) at 37°C overnight. After treatment, the samples were subjected to denaturing urea polyacrylamide gel electrophoresis and stained with SYBR Green II, followed by fluorescent imaging using a PharosFX (Biorad).
[0195] The results are shown in Figure 9a. Linker 4, which does not contain a guanine-based deoxynucleotide, showed no change in the fluorescent band position even after enzymatic treatment. However, linker 12, which was modified with a guanine-based deoxynucleotide just before the branch, showed a shift in the fluorescent band toward lower molecular weights after enzymatic treatment. This indicates that specific cleavage is possible by using such modifications.
[0196] Example 9-2 Analysis of Display Peptides by Tricin PAGE Artificial recycling translation was carried out under the same conditions as in Example 5 using an mRNA-linker conjugate in which linker 12 was hybridized to a model sequence mRNA encoding a fluorescent model peptide containing a fluorescein structure, and finally, EDTA (final concentration: 5 mM) was added to terminate the translation reaction.
[0197] In this example, to improve the resolution in electrophoresis, nuclease treatment was performed in addition to the procedures of Example 5. Specifically, RNase T1 (Thermo, 200 units) was added to the translation solution, and nuclease treatment was performed at 37°C for 2 hours. After nuclease treatment, tricine-modified polyacrylamide electrophoresis and fluorescence imaging were performed under the same conditions as in Example 5.
[0198] The results are shown in Figure 9b. Figure 9b shows an image obtained by detecting and overlaying the fluorescence from Cy5 and fluorescein. Nuclease treatment of the mRNA-linker conjugates artificially recycled using a bivalent linker (Linker 12) resulted in two fluorescent bands that were significantly separated compared to before treatment (Figure 9b). On the other hand, even after nuclease treatment, the mRNA-linker conjugates artificially recycled using a monovalent linker (Linker 2) only yielded a single fluorescent band derived from the peptide (Figure 9b). This indicates that multiple peptides are linked in the mRNA-linker conjugates artificially recycled using a bivalent linker (Linker 12).
[0199] Example 10: Display assay using mRNA-linker-peptide conjugates with Strep-tagII as a model peptide Using mRNA-linker-peptide conjugates with Strep-tagII as a model peptide, a display assay was performed to evaluate the recovery rate associated with binding to streptavidin.
[0200] The following experiment was carried out using the mRNA-linker conjugates prepared in Example 3, in which linker 1 or linkers 3 to 6 were hybridized to mRNA encoding Strep-tagII.
[0201] To the cell-free translation system constructed in Example 5, the mRNA-linker conjugate (final concentration: 1 μM), one type of aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA), nine types of amino acids (final concentration: 2 mM, Gly, His, Phe, Pro, Ser, Gln, Glu, Lys, Trp), and nine types of aminoacyl-tRNA synthetases (final concentrations: 0.09 μM GlyRS, 0.02 μM HisRS, 0.68 μM PheRS, 0.16 μM ProRS, 0.04 μM SerRS, 0.06 μM GlnRS, 0.23 μM GluRS, 0.11 μM LysRS, 0.03 μM TrpRS) were added, and a translation reaction was carried out at 37°C for 30 minutes (first translation reaction). After the reaction, EDTA was added to the samples that did not undergo artificial recycling translation to a final concentration of 16.7 mM, and to the samples that did undergo artificial recycling translation, EDTA was added to a final concentration of 12.5 mM, and the samples were left to stand on an ice bath for 10 minutes to denature the ribosomes.
[0202] Furthermore, a second translation reaction was carried out on the samples subjected to artificial recycling translation.
[0203] To the reaction mixture from the first translation reaction described above, Mg(OAc)2 (final concentration: 12.5 mM), translation-related solution (final concentrations: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL E. coli total tRNA (Roche), 0.47 mM DTT, aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA), and ribosomes (final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37°C for 30 minutes (second translation reaction). After the translation reaction, EDTA (final concentration: 16.7 mM) was added to terminate the reaction.
[0204] Next, a reverse transcription reaction solution (final concentrations: 49.5 mM Tris-HCl, 74.2 mM KCl, 18.4 mM MgCl, 1 mM DTT, 0.30 mM dNTPs, 20 units / μL MLV reverse transcriptase, 12 μM RT_Strep-tag II (SEQ ID NO: 14)) was added to the reaction solution containing the translation product obtained above, and the reverse transcription reaction was carried out at 42°C for 30 minutes.
[0205] After the reverse transcription reaction, EDTA (final concentration: 16.7 mM) and HEPES (final concentration: 53.4 mM) were added, and the mixture was desalted using a Bio-Gel P30 Gel (Biorad) desalting column substituted with HBS-T (0.05% (v / v) Tween 20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).
[0206] After desalting, streptavidin-immobilized magnetic beads (final concentration: 1 mg / mL, Dynabeads™ M-280 Streptavidin, Thermo) were added as the target protein, and a binding reaction was carried out at 4°C for 1 hour. At this time, the desalted sample was added to Protein G-immobilized magnetic beads (final concentration: 1 mg / mL, Dynabeads™ Protein G for Immunoprecipitation, Thermo) as a negative control, and the mixture was mixed at 4°C for 1 hour to carry out a binding reaction. After the binding reaction, the magnetic beads were magnetically separated, and the supernatant was removed. Next, the magnetic beads were resuspended in HBS-T (0.5 mg / mL), transferred to a new sample tube, and mixed at 4°C for 5 minutes. The same magnetic separation, supernatant removal, resuspension in HBS-T, and 5-minute mixing at 4°C were repeated twice. Finally, after magnetic separation and removal of the supernatant, the fragments were resuspended (2 mg / mL) in PCR solution (10 mM Tris-HCl (pH 8.5), 50 mM KCl, 0.1% Triton X-100) and heated at 95°C for 5 minutes. After heating, magnetic separation was performed and the supernatant was collected.
[0207] The amount of DNA in the desalted solution before addition of the target protein and after recovery from the magnetic beads was quantified by real-time PCR. Real-time PCR measurements were performed using a LightCycler 96 (Roche Applied Science). The PCR solution was supplemented with Taq polymerase, SYBR Green I (1:100,000, Invitrogen), dNTPs (final concentration: 0.25 mM), MgCl (final concentration: 2 mM), T7g10M.F52 (0.25 μM), RV_Strep-tag II (SEQ ID NO: 10) (0.25 μM), and the measurement sample solution.
[0208] The results of three trials of the display assay are shown in Figure 10. Here, the recovery rate (%) indicates the ratio of the amount of DNA recovered from the magnetic beads to the amount of DNA in the solution before the addition of the target protein. In a binding assay using Strep-tag II and streptavidin as model peptides and model target proteins, respectively, the use of a bivalent linker (Linker 3) significantly enhanced the DNA recovery rate resulting from binding to the target protein compared to a monovalent linker (Linker 1). Furthermore, the enhanced recovery rate was also confirmed in artificial recycling translation (Figure 10a). Furthermore, when comparing bivalent linkers with different branching lengths (Linkers 3–6), the recovery rate showed different enhancement rates depending on the branching length of the linker (Figure 10b). These results suggest that the avidity effect resulting from multiple peptides linked to the linker improved the binding ability to the target protein.
[0209] Example 11: Display assay using mRNA-linker-peptide conjugates with Fc binder as a model peptide Example 11-1 Biotinylation of Fc Recombinant human IgG1 Fc protein (final concentration: 29 μM, 110-HG, R&D Systems) and EZ-Link NHS-PEG4-Biotin (final concentration: 290 μM, Thermo) were reacted in 1x phosphate buffered saline (PBS) overnight at 4°C. After the reaction, purification was performed using Bio-Gel P30 Gel (Biorad) with the medium replaced with 1x PBS.
[0210] Example 11-2 Immobilization of biotinylated Fc on magnetic beads The biotinylated Fc (2.8 μM) prepared above was mixed with magnetic beads (final concentration: 31 mg / mL, Dynabeads™ M-280 Streptavidin, Thermo) at 4°C for 20 minutes. After mixing, the magnetic beads were magnetically separated, the supernatant was removed, and the beads were resuspended in HBS-T. The above-mentioned process of magnetic separation, supernatant removal, and resuspension in HBS-T was repeated twice. Finally, after magnetic separation and supernatant removal, the beads were resuspended in HBS-T (final concentration: 10 mg / mL).
[0211] Example 11-3 Display assay using mRNA-linker-peptide conjugates with Fc binder as a model peptide The following experiment was carried out using the mRNA-linker conjugates prepared in Example 3 in which linker 1 or linker 3 was hybridized to mRNA encoding an Fc binder.
[0212] The cell-free translation system constructed in Example 5 was supplemented with the mRNA-linker conjugate (final concentration: 1 μM), 15 types of amino acids (2 mM Leu, Met, Val, Ser, Pro, Thr, Ala, Tyr, His, Lys, Asp, Glu, Cys, Trp, Gly), and 15 types of aminoacyl-tRNA synthetases (0.04 μM LeuRS, 0.03 μM MetRS, 0.02 μM ValRS, 0.04 μM SerRS, 0.16 μM ProRS, 0.09 μM ThrRS, 0.73 μM AlaRS, 0.02 μM TyrRS, 0.02 μM HisRS, 0.11 μM LysRS, 0.13 μM AspRS, 0.23 μM GluRS, 0.02 μM CysRS, 0.03 μM TrpRS, 0.09 μM GlyRS) was added and the translation reaction was carried out at 37°C for 30 minutes. After the reaction, EDTA was added to the sample without artificial recycling translation to a final concentration of 16.7 mM, and to the sample with artificial recycling translation, EDTA was added to a final concentration of 12.5 mM, and the mixture was left to stand on an ice bath for 10 minutes to denature the ribosomes.
[0213] Furthermore, a second translation reaction was carried out on the samples subjected to artificial recycling translation.
[0214] To the reaction mixture from the first translation reaction described above, Mg(OAc)2 (final concentration: 12.5 mM), translation-related solution (final concentrations: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL E. coli total tRNA (Roche), 0.47 mM DTT), and ribosomes (final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37°C for 30 minutes. After the reaction, EDTA (final concentration: 16.7 mM) was added to stop the translation reaction.
[0215] Next, a reverse transcription reaction solution (final concentrations: 49.5 mM Tris-HCl, 74.2 mM KCl, 18.4 mM MgCl, 1 mM DTT, 0.30 mM dNTPs, 20 units / μL MLV reverse transcriptase, and 12 μM RT_Fc binder (SEQ ID NO: 17)) was added to the reaction solution containing the translation product obtained above, and the reverse transcription reaction was carried out at 42°C for 30 minutes.
[0216] After the reverse transcription reaction, EDTA (final concentration: 16.7 mM) and oxidized glutathione (final concentration: 1 mM, Nacalai) were added, and the reaction was carried out at 37°C for 1 hour.
[0217] After adding HEPES (final concentration: 53.4 mM), the sample was desalted using a Bio-Gel P30 Gel (Biorad) desalting column substituted with HBS-T (0.05% (v / v) Tween 20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).
[0218] The desalted sample was mixed with the Fc-immobilized magnetic beads (final concentration: 6.2 mg / mL) or non-Fc-immobilized magnetic beads (final concentration: 6.2 mg / mL, Dynabeads™ M-280 Streptavidin, Thermo Biosciences) and allowed to mix for 1 hour at 4°C for a binding reaction. After the binding reaction, the magnetic beads were magnetically separated and the supernatant was removed. Next, the magnetic beads were resuspended (1.5 mg / mL) in HBS-T and transferred to a new sample tube, followed by mixing for 5 minutes at 4°C. The same cycle of magnetic separation, supernatant removal, resuspension in HBS-T, and 5 minutes of mixing at 4°C was repeated twice. Finally, after magnetic separation and supernatant removal, the sample was resuspended (12.4 mg / mL) in PCR solution (10 mM Tris-HCl (pH 8.5), 50 mM KCl, 0.1% Triton X-100) and heated at 95°C for 5 minutes. After heating, magnetic separation was performed and the supernatant was collected.
[0219] The amount of DNA in the desalted solution before addition of the target protein and after recovery from the magnetic beads was quantified by real-time PCR. Real-time PCR measurements were performed using a LightCycler 96 (Roche Applied Science). The PCR solution was supplemented with Taq polymerase, SYBR Green I (1:100,000, Invitrogen), dNTPs (final concentration: 0.25 mM), MgCl (final concentration: 2 mM), T7g10M.F52 (0.25 μM), RV_Fc binder (SEQ ID NO: 13) (0.25 μM), and the measurement sample solution.
[0220] The results of three trials of the display assay are shown in Figure 11. Here, the recovery rate (%) indicates the ratio of the amount of DNA recovered from the magnetic beads to the amount of DNA in the solution before the addition of the target protein. In the recovery rate evaluation using Fc binder and Fc as model peptides and model target proteins, high DNA recovery was achieved only when the bivalent linker (Linker 3) was used, indicating that high recovery rates could be achieved by using the target bivalent linker. Furthermore, artificial recycling translation achieved a higher recovery rate than when it was not performed, demonstrating that artificial recycling translation is effective for recovering target-bound conjugates in high yields. These results suggest that the avidity effect derived from multiple peptides linked to the linker improved the binding ability to the target protein.
[0221] Example 12: Display assay using mRNA-linker-peptide conjugates with HA binder as a model peptide Example 12-1 Immobilization of HA on magnetic beads Influenza A H5N1 (A / Indonesia / 5 / 2005) hemagglutinin / HA protein-HIS-tag (final concentration: 4.5 μM, 11060-V08B, Shino Biological) and magnetic beads (final concentration: 4 mg / mL, Dynabeads™ His-tag Isolation and Pulldown, Thermo) were mixed at 4°C for 20 minutes. After mixing, the magnetic beads were magnetically separated, the supernatant was removed, and the beads were resuspended in HBS-T. The above-mentioned magnetic separation, supernatant removal, and resuspension in HBS-T were repeated twice. Finally, after magnetic separation and supernatant removal, the beads were resuspended in HBS-T (final concentration: 10 mg / mL).
[0222] Example 12-2 Display assay using mRNA-linker-peptide conjugates with HA binder as a model peptide The following experiment was carried out using the mRNA-linker conjugates prepared in Example 3, in which linker 1 or linker 3 was separately hybridized to mRNA encoding HA binder.
[0223] The cell-free translation system constructed in Example 5 was supplemented with the mRNA-linker conjugate (final concentration: 1 μM), one aminoacyl-tRNA (10 μM ClAcY Ini-tRNA), 13 types of amino acids (2 mM Phe, Leu, Val, Ser, Thr, Ala, Tyr, His, Asn, Lys, Cys, Trp, Gly), and 12 types of aminoacyl-tRNA synthetases (0.68 μM PheRS, 0.04 μM LeuRS, 0.02 μM ValRS, 0.04 μM SerRS, 0.09 μM ThrRS, 0.73 μM AlaRS, 0.02 μM TyrRS, 0.02 μM HisRS, 0.38 μM AsnRS, 0.11 μM LysRS, 0.02 μM CysRS, 0.03 μM TrpRS, 0.09 μM GlyRS) was added and the translation reaction was carried out at 37°C for 30 minutes. After the reaction, EDTA was added to the sample without artificial recycling translation to a final concentration of 16.7 mM, and to the sample with artificial recycling translation, EDTA was added to a final concentration of 12.5 mM, and the mixture was left to stand on an ice bath for 10 minutes to denature the ribosomes.
[0224] To the reaction mixture from the first translation reaction, Mg(OAc) (final concentration: 12.5 mM), translation-related solution (final concentrations: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL E. coli total tRNA (Roche), 0.47 mM DTT), aminoacyl-tRNA (final concentration: 10 μM ClAcY Ini-tRNA), and ribosomes (final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37°C for 30 minutes. After the reaction, EDTA (final concentration: 16.7 mM) was added to stop the translation reaction.
[0225] Next, a reverse transcription reaction solution (final concentrations: 49.5 mM Tris-HCl, 74.2 mM KCl, 18.4 mM MgCl, 1 mM DTT, 0.30 mM dNTPs, 20 units / μL MLV reverse transcriptase, 12 μM RT_HA binder (SEQ ID NO: 16)) was added to the reaction solution containing the translation product obtained above, and the reverse transcription reaction was carried out at 42°C for 30 minutes.
[0226] After the reverse transcription reaction, EDTA (final concentration: 16.7 mM) and HEPES (final concentration: 53.4 mM) were added, and the mixture was desalted using a Bio-Gel P30 Gel (Biorad) desalting column substituted with HBS-T (0.05% (v / v) Tween 20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).
[0227] The desalted sample was mixed with either the HA-immobilized magnetic beads (final concentration: 4 mg / mL) or non-HA-immobilized magnetic beads (final concentration: 4 mg / mL, Dynabeads™ His-tag Isolation and Pulldown, Thermo Biosciences) and allowed to mix for 1 hour at 4°C for a binding reaction. After the binding reaction, the magnetic beads were magnetically separated and the supernatant was removed. Next, the magnetic beads were resuspended (2 mg / mL) in HBS-T and transferred to a new sample tube, followed by mixing for 5 minutes at 4°C. The same cycle of magnetic separation, supernatant removal, resuspension in HBS-T, and 5 minutes of mixing at 4°C was repeated twice. Finally, after magnetic separation and supernatant removal, the sample was resuspended (8 mg / mL) in PCR solution (10 mM Tris-HCl (pH 8.5), 50 mM KCl, 0.1% Triton X-100) and heated at 95°C for 5 minutes. After heating, magnetic separation was performed, and the supernatant was collected.
[0228] The amount of DNA in the desalted solution before addition of the target protein and after recovery from the magnetic beads was quantified by real-time PCR. Real-time PCR measurements were performed using a LightCycler 96 (Roche Applied Science). The PCR solution was supplemented with Taq polymerase, SYBR Green I (1:100,000, Invitrogen), dNTPs (final concentration: 0.25 mM), MgCl (final concentration: 2 mM), T7g10M.F52 (0.25 μM), RV_HA binder (SEQ ID NO: 12) (0.25 μM), and the measurement sample solution.
[0229] The results of three trials of the display assay are shown in Figure 12. Here, recovery (%) indicates the ratio of the amount of DNA recovered from the magnetic beads to the amount of DNA in the solution before the addition of the target protein. In binding assays using HA binder and HA as model peptides and model target proteins, the use of a bivalent linker (Linker 3) resulted in a higher recovery rate of DNA derived from binding to the target protein compared to a monovalent linker (Linker 1). The use of the target linker resulted in a high recovery rate of mRNA-linker-peptide conjugates bound to the target protein. Furthermore, the recovery rate was enhanced by performing artificial recycling translation, demonstrating that artificial recycling translation enables highly efficient recovery of target-bound mRNA-linker-peptide conjugates. These results suggest that the avidity effect of multiple peptides linked to the linker improved the binding ability to the target protein.
[0230] Example 13: Display assay using mRNA-linker-peptide conjugates with FcRn binder as a model peptide Example 13-1 Preparation of FcRn-immobilized beads Magnetic beads (final concentration: 9.3 mg / mL, Dynabeads™ M-280 Streptavidin, Thermo) and biotinylated FcRn (0.7 μM, FCM-H82W7, ACRobiosystems) were mixed at 4°C for 20 minutes. After mixing, the magnetic beads were magnetically separated, the supernatant was removed, and the beads were resuspended in HBS-T. The above-mentioned process of magnetic separation, supernatant removal, and resuspension in HBS-T was repeated twice. Finally, after magnetic separation and supernatant removal, the beads were resuspended in HBS-T (final concentration: 10 mg / mL).
[0231] Example 13-2 Display assay using mRNA-linker-peptide conjugates with FcRn binder as a model peptide The following experiment was carried out using the mRNA-linker conjugates prepared in Example 3, in which linker 1 or linkers 3 to 6 were separately hybridized to mRNA encoding FcRn binder.
[0232] To the cell-free translation system constructed in Example 5, the mRNA-linker conjugate (final concentration: 1 μM), 12 types of amino acids (2 mM Phe, Leu, Met, Ser, Pro, Thr, Tyr, His, Asn, Cys, Arg, Gly), and 12 types of aminoacyl-tRNA synthetases (0.68 μM PheRS, 0.04 μM LeuRS, 0.03 μM MetRS, 0.04 μM SerRS, 0.16 μM ProRS, 0.09 μM ThrRS, 0.02 μM TyrRS, 0.02 μM HisRS, 0.38 μM AsnRS, 0.02 μM CysRS, 0.03 μM ArgRS, 0.09 μM GlyRS) were added, and the translation reaction was carried out at 37°C for 30 minutes. After the reaction, EDTA was added to a final concentration of 12.5 mM, and the mixture was left standing on an ice bath for 10 minutes to denature the ribosomes. To the reaction mixture from the first translation reaction, Mg(OAc)2 (final concentration: 12.5 mM), translation-related solution (final concentrations: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL E. coli total tRNA (Roche), 0.47 mM DTT), and ribosomes (final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37°C for 30 minutes. After the reaction, EDTA (final concentration: 16.7 mM) was added to stop the translation reaction.
[0233] Next, a reverse transcription reaction solution (final concentrations: 49.5 mM Tris-HCl, 74.2 mM KCl, 18.4 mM MgCl, 1 mM DTT, 0.30 mM dNTPs, 20 units / μL MLV reverse transcriptase, and 12 μM RT_FcRn binder (SEQ ID NO: 15)) was added to the reaction solution containing the translation product obtained above, and the reverse transcription reaction was carried out at 42°C for 30 minutes.
[0234] After the reverse transcription reaction, EDTA (final concentration: 16.7 mM) and oxidized glutathione (final concentration: 1 mM, Nacalai) were added, and the reaction was carried out at 37°C for 1 hour.
[0235] After adding HEPES (final concentration: 53.4 mM), the sample was desalted using a Bio-Gel P30 Gel (Biorad) desalting column substituted with HBS-T (0.05% (v / v) Tween 20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).
[0236] The desalted sample was mixed with the FcRn-immobilized magnetic beads (final concentration: 3.2 mg / mL) and mixed at 4°C for 1 hour to allow for a binding reaction. After the binding reaction, the magnetic beads were magnetically separated and the supernatant was removed. Next, the magnetic beads were resuspended in HBS-T (1.6 mg / mL) and transferred to a new sample tube, followed by mixing at 4°C for 5 minutes. Furthermore, the same cycle of magnetic separation, supernatant removal, resuspension in HBS-T, and mixing at 4°C for 5 minutes was repeated twice. Finally, after magnetic separation and supernatant removal, the sample was resuspended in PCR solution (10 mM Tris-HCl (pH 8.5), 50 mM KCl, 0.1% Triton X-100) (3.2 mg / mL) and heated at 95°C for 5 minutes. After heating, magnetic separation was performed, and the supernatant was collected.
[0237] The amount of DNA in the desalted solution before addition of the target protein and after recovery from the magnetic beads was quantified by real-time PCR. Real-time PCR measurements were performed using a LightCycler 96 (Roche Applied Science). The PCR solution was supplemented with Taq polymerase, SYBR Green I (1:100,000, Invitrogen), dNTPs (final concentration: 0.25 mM), MgCl (final concentration: 2 mM), T7g10M.F52 (0.25 μM), RV_FcRn binder (SEQ ID NO: 11) (0.25 μM), and the measurement sample solution.
[0238] The results of three trials of the display assay are shown in Figure 13. Here, recovery (%) indicates the ratio of the amount of DNA recovered from the magnetic beads to the amount of DNA in the solution before the addition of the target protein. In a binding assay using FcRn binder and FcRn as model peptides and model target proteins, the recovery rate of DNA from binding to the target protein was enhanced with all bivalent linkers (Linkers 3–6) compared to a monovalent linker (Linker 1). The use of the target linkers improved the recovery rate of mRNA-linker-peptide conjugates bound to the target protein. Furthermore, the recovery rate increased with the shortening of the linker branching length, indicating that selecting an appropriate linker branching length improved the recovery rate of mRNA-linker-peptide conjugates bound to the target protein. This suggests that the avidity effect of multiple peptides linked to the linker improved the binding ability to the target protein.
[0239] Example 14: Screening of target-binding peptides using a randomized peptide library Example 14-1 Preparation of aminoacyl-tRNA Aminoacyl-tRNA to be subjected to the translation reaction in the cell-free translation system was prepared as follows.
[0240] The amino acid activated esters used in the aminoacylation of tRNA by catalytic acylation RNA (ARS ribozyme) include (2,6-dichloropyridin-4-yl)methyl methyl-L-alaninate hydrochloride (MeA-DCPE), (2,6-dichloropyridin-4-yl)methyl-L-cysteinate hydrochloride (Cys-DCPE), 2,2,2-trifluoroethyl methyl-L-phenylalaninate hydrochloride (MeF-TEE), (2,6-dichloropyridin-4-yl)methyl N-methylglycinate hydrochloride (MeG-DCPE), 2,2,2-trifluoroethyl (2-chloroacetyl)-L-phenylalaninate (ClAc-F-TEE), (2,6-dichloropyridin-4-yl)methyl (S)-2-(methylamino)hexanoate hydrochloride (MeNle-DCPE), and 2,2,2-trifluoroethyl L-tryptophanate hydrochloride (Trp-TEE) was prepared (prepared by the method disclosed in WO2023 / 234425 (Patent Document 11)).
[0241] To link MeF-TEE, ClAc-F-TEE, and Trp-TEE to tRNA, enhanced flexizyme (Table 4, eFx, WO2007 / 066627 (Patent Document 9)) was used as the ARS ribozyme. For MeA-DCPE, Cys-DCPE, MeG-DCPE, and MeNle-DCPE, dinitrobenzyl flexizyme (Table 4, dFx, WO2007 / 066627 (Patent Document 9)) was used.
[0242] In this case, ClAc-F is assigned to the AUG codon, MeA to the GCC codon, Cys to the TGG codon, MeF to the UUC codon, MeG to the AUC codon, MeNle to the ACC codon, and Trp to the TGC codon. Therefore, Ini-tRNA (Table 4, WO2012 / 026566 (Patent Document 7)) having CAU in the anticodon portion, tRNA having GGC GGC tRNA with CCA CCA tRNA with GAA GAA , tRNA with GAU GAU , tRNA with GGU GGU , tRNA with GCAGCA (Table 4, WO2019 / 077887 (Patent Document 10)) were used.
[0243] For ClAc-F-TEE (final concentration: 5 mM), the corresponding ARS ribozyme (final concentration: 25 μM), Ini-tRNA (final concentration: 25 μM), bicine (final concentration: 50 mM, pH 9.0), MgCl2 (final concentration: 50 mM), and DMSO (final concentration: 20%) were added and aminoacylated overnight at 0°C. For Cys-DCPE (final concentration: 5 mM), the corresponding ARS ribozyme (final concentration: 25 μM), the corresponding tRNA (final concentration: 25 μM), HEPES-KOH (final concentration: 50 mM, pH 7.5), MgCl2 (final concentration: 20 mM), DMSO (final concentration: 20%), and DTT (final concentration: 5 mM) were added and aminoacylated overnight at 0°C. For other activated amino acid esters (final concentration: 5 mM), the corresponding ARS ribozyme (final concentration: 25 μM), the corresponding tRNA (final concentration: 25 μM), HEPES-KOH (final concentration: 50 mM, pH 7.5), MgCl (final concentration: 50 mM), and DMSO (final concentration: 20%) were added and aminoacylated overnight at 0°C. After aminoacylation, an equal volume of 3 M NaOAc (pH 5.2) was added to the sample, followed by ethanol precipitation.
[0244] The pellet was then redissolved in 0.3 M NaOAc (pH 5.2) and subjected to another ethanol precipitation. Finally, the pellet was washed once with 70% ethanol containing 0.1 M NaOAc (pH 5.2) and once with 70% ethanol. The resulting aminoacyl-tRNA pellet was dissolved in 0.2% acetic acid.
[0245] Table 4 shows a list of the ARS ribozyme and tRNA sequences used in the examples (SEQ ID NOs: 28-31, 53-59). Capital letters refer to commonly used abbreviations for each RNA.
[0246] Example 14-2 Construction of mRNA-linker-peptide conjugate library The following experiment was carried out using the mRNA-linker conjugates prepared in Example 3, in which linker 1 or linker 4 was separately hybridized to mRNA G containing a random region.
[0247] The cell-free translation system constructed in Example 5 was treated with the mRNA-linker conjugate (final concentration: 1 μM), seven aminoacyl-tRNAs (final concentration 10 μM ClAc-F Ini-tRNA, MeF tRNA GAA , MeG tRNA GAU , MeNle tRNA GGU , MeA tRNA GGC , W tRNA GCA , C-tRNA CCA ), 10 amino acids (final concentration: 0.2 mM Leu, Val, Ser, Pro, Tyr, His, Asn, Asp, Arg, Gly), and 10 aminoacyl-tRNA synthetases (final concentrations: 0.04 μM LeuRS, 0.02 μM ValRS, 0.04 μM SerRS, 0.16 μM ProRS, 0.02 μM TyrRS, 0.02 μM HisRS, 0.38 μM AsnRS, 0.13 μM AspRS, 0.03 μM ArgRS, and 0.09 μM GlyRS), and Mg(OAc)2 (final concentration: 1 mM) were added and the translation reaction was carried out at 37°C for 30 minutes. After the reaction, EDTA was added to a final concentration of 12.5 mM, and the mixture was left on an ice bath for 10 minutes to denature the ribosomes.
[0248] Furthermore, the reaction mixture used in the first translation reaction was supplemented with Mg(OAc)2 (final concentration: 13.5 mM), translation-related solution (final concentrations: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM phosphocreatine, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL E. coli total tRNA (Roche), 0.47 mM DTT), aminoacyl-tRNA (final concentration: 10 μM ClAc-F Ini-tRNA, MeF tRNA), and 10 μM ATP. GAA , MeG tRNA GAU , MeNle tRNAGGU , MeA tRNA GGC , W tRNA GCA , C-tRNA CCA ) and ribosomes (final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37° C. for 30 minutes. After the reaction, EDTA (final concentration: 16.7 mM) was added to stop the translation reaction.
[0249] Next, a reverse transcription reaction solution (final concentrations: 50 mM Tris-HCl, 75 mM KCl, 18.4 mM MgCl, 1 mM DTT, 0.30 mM dNTPs, 5 units / μL MLV reverse transcriptase, 3 μM TGG-ssG4S2.R23RT (SEQ ID NO: 9)) was added to the reaction solution containing the translation product obtained above, and the reverse transcription reaction was carried out at 42°C for 30 minutes.
[0250] After the reverse transcription reaction, EDTA (final concentration: 16.7 mM) was added, and the mixture was desalted using a Bio-Gel P30 Gel (Biorad) desalting column substituted with HBS-T (0.05% (v / v) Tween 20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).
[0251] Example 14-3 Selection of target-binding peptides using a library of mRNA-linker-peptide conjugates The desalted sample obtained in step 2 above was mixed with recombinant human IgG1 Fc protein (final concentration: 250 nM, 110-HG, R&D Systems) and magnetic beads (final concentration: 3 mg / mL, Dynabeads Protein G, Thermo), and the mixture was allowed to mix at 4°C for 60 minutes to allow a binding reaction. After the binding reaction, the mixture was magnetically separated and the supernatant was removed. The magnetic beads were then resuspended (1.5 mg / mL) in HBS-T and transferred to a new sample tube, followed by mixing at 4°C for 1 minute. The same process of magnetic separation, supernatant removal, resuspension in HBS-T, and mixing at 4°C for 1 minute was repeated twice. Finally, after magnetic separation and removal of the supernatant, the fragments were resuspended (3.0 mg / mL) in PCR mix solution (10 mM Tris-HCl (pH 8.5), 50 mM KCl, 0.1% Triton X-100, dNTP (final concentration: 0.25 mM), MgCl2 (final concentration: 2 mM), T7g10M.F52 (0.25 μM), TGG-ssG4S2.R44 (SEQ ID NO: 8) (0.25 μM)) and heated at 95°C for 5 minutes. After heating, magnetic separation was performed and the supernatant was collected. Hereafter, the above process is referred to as positive selection.
[0252] The amount of DNA in the desalted solution before the addition of the target protein and after recovery from the magnetic beads (positive selection) was quantified by real-time PCR. A LightCycler 96 (Roche Applied Science) was used as a real-time PCR measurement device. The PCR mix solution was prepared by adding Taq polymerase, SYBR Green I (100,000-fold dilution, Invitrogen), and the measurement sample solution. Furthermore, DNA recovered from the magnetic beads was amplified by PCR (T100 Thermal Cycler, BioRad, 94°C for 60 seconds, {94°C for 40 seconds, 61°C for 40 seconds, 72°C for 40 seconds}) based on the threshold cycle (Cq value) obtained from the real-time PCR. The reaction product was purified using AMPure XP (Beckman Coulter). The purified DNA was used to synthesize mRNA by transcription using T7 RNA polymerase, and the resulting reaction product was purified using RNAClean XP (Beckman Coulter). After purification, the mRNA concentration was determined from UV absorption at 260 nm and diluted to 20 μM.
[0253] A peptide library was constructed using the mRNA obtained above using the same method as in Example 13-2. The desalted sample was mixed with magnetic beads (final concentration: 3 mg / mL, Dynabeads Protein G, Thermo) and mixed at 4°C for 10 minutes to allow a binding reaction. After the binding reaction, the magnetic beads were removed by magnetic separation. The above mixing with the magnetic beads and removal of the magnetic beads by magnetic separation were repeated twice. This process was referred to as negative selection. The magnetic beads after magnetic separation were resuspended in HBS-T (3.0 mg / mL) and heated at 95°C for 5 minutes. After heating, magnetic separation was performed, and the supernatant was collected and used as a sample for negative selection in real-time PCR. The supernatant after magnetic separation was further subjected to positive selection as described above, and the DNA content of the resulting sample was quantified by real-time PCR as described above. Based on the threshold cycle (Cq value) obtained from real-time PCR, DNA amplification and mRNA preparation were performed by PCR as described above only for the sample after positive selection. Furthermore, the above-mentioned negative selection, positive selection, real-time PCR, PCR-based DNA amplification, and mRNA production were performed three times in total.
[0254] The results of the above selection process are shown in Figure 14. Here, recovery (%) indicates the ratio of the amount of DNA recovered from the magnetic beads to the amount of DNA in the solution before the addition of the target protein. In the selection of target-binding peptides using Fc as a model target protein, when selection was performed using a monovalent linker (Linker 1), no significant difference was observed between the recovery rate of DNA derived from target protein binding (obtained in positive selection) and the recovery rate of DNA derived from nonspecific binding (obtained in negative selection). On the other hand, when selection was performed using a bivalent linker (Linker 4), the recovery rate of DNA derived from target protein binding was significantly higher than the recovery rate of DNA derived from nonspecific binding. This is thought to be because, with the monovalent linker (Linker 1), the bond between the target-binding peptide and the Fc protein was not maintained during the washing procedure in the selection process due to its weak binding ability, whereas with the bivalent linker (Linker 4), the avidity effect derived from multiple peptides linked to the linker improved the binding ability to the target protein, and the bond between the target-binding peptide and the Fc protein was maintained during the washing procedure.
[0255] Example 14-4 Gene sequence analysis by next-generation sequencing (NGS) The DNA from each round was subjected to PCR to add the desired sequence, followed by NGS analysis. The specific test method is shown below.
[0256] To add hybridization and index regions for the forward and reverse primers that initiate sequencing in NGS analysis to the samples after the final round of PCR, 50 μL of the post-PCR sample (final concentration: 2% (v / v)) and the 1st PCR reaction solution (final concentrations: 1× Phusion HF buffer, 200 μM dNTPs, 250 nM forward primer (F70-ID12-07-4 (SEQ ID NO: 46) for the selection sample using a monovalent linker, and F70-ID12-07-5 (SEQ ID NO: 47) for the selection sample using a bivalent linker), 250 nM R38-3UTR-SBS-R (SEQ ID NO: 48), 20 U / mL Phusion DNA polymerase) were prepared and then cycled in a thermal cycler (T100 Thermal Cycler, BioRad) at 95°C for 120 seconds, 95°C for 20 seconds, 61°C for 30 seconds, and 72°C for 10 seconds. Next, to add a hybridization region to the post-PCR sample for the nucleic acid sequence immobilized on the flow cell for NGS analysis, 50 μL of the post-PCR sample (final concentration: 2% (v / v)) and a second PCR reaction solution (final concentrations: 1× Phusion HF buffer, 200 μM dNTPs, 250 nM F63-P5-SBS-F (SEQ ID NO: 49), 250 nM R58-SBSR-P7 (SEQ ID NO: 50), 20 U / mL Phusion DNA polymerase) were prepared, and a reaction was carried out using a thermal cycler (T100 Thermal Cycler, BioRad) at 95°C for 120 seconds, followed by 6 cycles of {95°C for 20 seconds, 61°C for 30 seconds, 72°C for 30 seconds}. The reaction product was purified using AMPure XP (Beckman Coulter). The purified samples were subjected to gene sequencing analysis using the Miseq (registered trademark) System and Miseq Regent Micro Kit v2.
[0257] Example 14-5 Evaluation of binding ability by display assay In the NGS analysis of the selections using the monovalent linker and the bivalent linker, the peptide sequences translated from the read genetic information were analyzed, and only sequences that maintained the fixed peptide sequence and randomized peptide number designed through the genetic information were extracted. Furthermore, the top 15 sequences with the highest frequency of appearance were selected from the extracted peptide sequences, and mRNA was prepared according to Example 2. After preparation, the mRNAs of the top 15 sequences with the highest frequency of appearance selected from the selections using the monovalent linker and the bivalent linker were hybridized with linker 1 or linker 4 separately to prepare mRNA-linker conjugates.
[0258] The cell-free translation system constructed in Example 5 was treated with the mRNA-linker conjugate (final concentration: 1 μM), seven aminoacyl-tRNAs (final concentration 10 μM ClAc-F Ini-tRNA, MeF tRNA GAA , MeG tRNA GAU , MeNle tRNA GGU , MeA tRNA GGC , W tRNA GCA , C-tRNA CCA ), 10 amino acids (final concentration: 0.2 mM Leu, Val, Ser, Pro, Tyr, His, Asn, Asp, Arg, Gly), and 10 aminoacyl-tRNA synthetases (final concentrations: 0.04 μM LeuRS, 0.02 μM ValRS, 0.04 μM SerRS, 0.16 μM ProRS, 0.02 μM TyrRS, 0.02 μM HisRS, 0.38 μM AsnRS, 0.13 μM AspRS, 0.03 μM ArgRS, and 0.09 μM GlyRS), and Mg(OAc)2 (final concentration: 1 mM) were added and the translation reaction was carried out at 37°C for 30 minutes. After the reaction, EDTA was added to a final concentration of 12.5 mM, and the mixture was left on an ice bath for 10 minutes to denature the ribosomes.
[0259] Furthermore, the reaction mixture used in the first translation reaction was supplemented with Mg(OAc)2 (final concentration: 13.5 mM), translation-related solution (final concentrations: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM phosphocreatine, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL E. coli total tRNA (Roche), 0.47 mM DTT), aminoacyl-tRNA (final concentration: 10 μM ClAc-F Ini-tRNA, MeF tRNA), and 10 μM ATP. GAA , MeG tRNA GAU , MeNle tRNA GGU , MeA tRNA GGC , W tRNA GCA , C-tRNA CCA ) and ribosomes (final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37° C. for 30 minutes. After the reaction, EDTA (final concentration: 16.7 mM) was added to stop the translation reaction.
[0260] Next, a reverse transcription reaction solution (final concentrations: 50 mM Tris-HCl, 75 mM KCl, 18.4 mM MgCl, 1 mM DTT, 0.30 mM dNTPs, 5 units / μL MLV reverse transcriptase, 3 μM TGG-ssG4S2.R23RT (SEQ ID NO: 9)) was added to the reaction solution containing the translation product obtained above, and the reverse transcription reaction was carried out at 42°C for 30 minutes.
[0261] After the reverse transcription reaction, EDTA (final concentration: 16.7 mM) was added, and the mixture was desalted using a Bio-Gel P30 Gel (Biorad) desalting column substituted with HBS-T (0.05% (v / v) Tween 20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl). The desalted sample was mixed with recombinant human IgG1 Fc protein (final concentration: 250 nM, 110-HG, R&D Systems) and magnetic beads (final concentration: 3 mg / mL, Dynabeads Protein G, Thermo) or magnetic beads (final concentration: 3 mg / mL, Dynabeads Protein G, Thermo) alone at 4°C for 30 minutes to allow for binding. After the binding reaction, the sample was magnetically separated and the supernatant was removed. The magnetic beads were then resuspended (1.5 mg / mL) in HBS-T and transferred to a new sample tube. This process of magnetic separation, supernatant removal, and resuspension in HBS-T was repeated three times. Finally, after magnetic separation and supernatant removal, the sample was resuspended (3.0 mg / mL) in HBS-T and heated at 95°C for 5 minutes. After heating, magnetic separation was performed and the supernatant was collected.
[0262] The amount of DNA in the desalted solution before the addition of the target protein and the amount of DNA recovered from the magnetic beads were quantified by real-time PCR. Real-time PCR measurements were performed using a LightCycler 96 (Roche Applied Science) using the PCR mix solution described above, to which Taq polymerase, SYBR Green I (100,000-fold diluted, Invitrogen), and the measurement sample solution were added.
[0263] The results of the display assay are shown in Figure 15. Here, recovery (%) indicates the ratio of the amount of DNA recovered from magnetic beads to the amount of DNA in the solution before addition of the target protein. In a selection of target-binding peptides using Fc as a model target protein, the top 15 sequences selected from the selection using a monovalent linker (Linker 1) showed no significant difference between the DNA recovery rate derived from target protein binding and the DNA recovery rate derived from nonspecific binding, regardless of whether a monovalent or bivalent linker was used in the display assay. On the other hand, in the top 15 sequences selected from the selection using a bivalent linker (Linker 4), many sequences showed significantly higher DNA recovery rates derived from target protein binding than from nonspecific binding in the display assay using a bivalent linker. This is thought to be because when a bivalent linker (linker 4) was used in selection using a randomized peptide library, the avidity effect derived from multiple peptides linked to the linker maintained binding to Fc, and sequences with target binding ability were selected as the most frequently occurring sequences.
[0264] [Example 15: Display assay using mRNA-linker conjugate (covalent conjugate)] Example 15-1 Preparation of mRNA-linker conjugate (covalent conjugate) by ligation In Example 2, each mRNA (final concentration: 1.0 μM) prepared from the template DNA of the mRNA display format Strep-tag II was reacted with linker 7 or linker 8 (final concentration: 1.5 μM) prepared in Example 1 in a ligation solution (10% DMSO (v / v), 1× ligation buffer (TAKARA), 5 U / μL T4 RNA ligase) at 37°C for 1 hour. After the reaction, the reaction was stopped by adding NaCl (final concentration: 0.3 M) and EDTA (5 mM), followed by phenol / chloroform extraction, ethanol precipitation, drying, and dissolution in ultrapure water to prepare 5 μM mRNA-linker conjugates (covalent conjugates).
[0265] Example 15-2 Display assay using mRNA-linker-peptide conjugates with Strep-tagII as a model peptide The mRNA-linker-peptide conjugate (covalent conjugate) obtained by the ligation reaction in 1 above was used to carry out the display assay described below, which evaluated the recovery rate associated with binding to streptavidin.
[0266] To the cell-free translation system constructed in Example 5, the above mRNA-linker conjugate (final concentration: 1 μM), one type of aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA), nine types of amino acids (final concentration: 0.2 mM, Gly, His, Phe, Pro, Ser, Gln, Glu, Lys, Trp), and nine types of aminoacyl-tRNA synthetases (final concentrations: 0.09 μM GlyRS, 0.02 μM HisRS, 0.68 μM PheRS, 0.16 μM ProRS, 0.04 μM SerRS, 0.06 μM GlnRS, 0.23 μM GluRS, 0.11 μM LysRS, 0.03 μM TrpRS) were added, and a translation reaction was carried out at 37°C for 30 minutes (first translation reaction). After the reaction, EDTA was added to the sample for artificial recycling translation to a final concentration of 12.5 mM, and the mixture was left standing on an ice bath for 10 minutes to denature the ribosomes.
[0267] To the reaction mixture from the first translation reaction described above, Mg(OAc)2 (final concentration: 12.5 mM), translation-related solution (final concentrations: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL E. coli total tRNA (Roche), 0.47 mM DTT, aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA), and ribosomes (final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37°C for 30 minutes (second translation reaction). After the translation reaction, EDTA (final concentration: 16.7 mM) was added to terminate the reaction.
[0268] Next, a reverse transcription reaction solution (final concentrations: 50 mM Tris-HCl, 75 mM KCl, 18.4 mM MgCl, 1 mM DTT, 0.30 mM dNTPs, 5 units / μL MLV reverse transcriptase, 3 μM RT_Strep-tag II (SEQ ID NO: 14)) was added to the reaction solution containing the translation product obtained above, and the reverse transcription reaction was carried out at 42°C for 30 minutes.
[0269] After the reverse transcription reaction, EDTA (final concentration: 16.7 mM) was added, and the mixture was desalted using a Bio-Gel P30 Gel (Biorad) desalting column substituted with HBS-T (0.05% (v / v) Tween 20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).
[0270] After desalting, streptavidin-immobilized magnetic beads (final concentration: 1 mg / mL, Dynabeads™ M-280 Streptavidin, Thermo) were added as the target protein, and a binding reaction was carried out at 4°C for 1 hour. At this time, the desalted sample was added to Protein G-immobilized magnetic beads (final concentration: 1 mg / mL, Dynabeads™ Protein G for Immunoprecipitation, Thermo) as a negative control, and the mixture was mixed at 4°C for 1 hour to carry out a binding reaction. After the binding reaction, the magnetic beads were magnetically separated, and the supernatant was removed. Next, the magnetic beads were resuspended in HBS-T (0.5 mg / mL), transferred to a new sample tube, and mixed at 4°C for 5 minutes. The same magnetic separation, supernatant removal, resuspension in HBS-T, and 5-minute mixing at 4°C were repeated twice. Finally, after magnetic separation and removal of the supernatant, the fragments were resuspended (2 mg / mL) in PCR solution (10 mM Tris-HCl (pH 8.5), 50 mM KCl, 0.1% Triton X-100) and heated at 95°C for 5 minutes. After heating, magnetic separation was performed and the supernatant was collected.
[0271] The amount of DNA in the desalted solution before addition of the target protein and after recovery from the magnetic beads was quantified by real-time PCR. Real-time PCR measurements were performed using a LightCycler 96 (Roche Applied Science). The PCR solution was supplemented with Taq polymerase, SYBR Green I (1:100,000, Invitrogen), dNTPs (final concentration: 0.25 mM), MgCl (final concentration: 2 mM), T7g10M.F52 (0.25 μM), RV_mRNA display_Strep-tag II (SEQ ID NO: 45) (0.25 μM), and the assay sample solution.
[0272] The results of three trials of the display assay are shown in Figure 16. Here, the recovery rate (%) indicates the ratio of the amount of DNA recovered from the magnetic beads to the amount of DNA in the solution before the addition of the target protein. In a binding ability evaluation using Strep-tag II and streptavidin as model peptides and model target proteins, respectively, the use of a bivalent linker (Linker 8) significantly enhanced the DNA recovery rate resulting from binding to the target protein compared to a monovalent linker (Linker 7). Furthermore, the enhanced recovery rate was also confirmed in artificial recycling translation. These results, as in Example 10, suggest that the avidity effect resulting from multiple peptides linked to the linker improved the binding ability to the target protein.
[0273] The results of Examples 10 and 15-2 above demonstrated that, regardless of the method of linking the mRNA and the linker, it is possible to display multiple peptides by using a bivalent linker, and that the avidity effect improves the binding ability to the target protein.
[0274] [Example 16: Construction of a linker (RAPID linker) in which an amino acid is covalently bound to the 3'-terminal ribose via an ester bond, and display assay using the same] Example 16-1 Acylation of the 3' ends of linkers 9 and 10 by ARS ribozyme 2,2,2-Trifluoroethyl methyl-L-phenylalaninate hydrochloride (NMe-Phe-TEE) was prepared as the activated amino acid ester used for the aminoacylation of the 3'-ends of linkers 9 and 10 by the ARS ribozyme (prepared by the method disclosed in WO 2023 / 234425 (Patent Document 11)). To separately link the 3'-ends of linkers 9 and 10 to each activated amino acid ester, eFx was used as the ARS ribozyme. NMe-Phe-TEE (final concentration: 5 mM) was added to eFx (final concentration: 25 μM), linker 9 or linker 10 (final concentration: 25 μM), HEPES-KOH (final concentration: 50 mM, pH 7.5), MgCl (final concentration: 50 mM), and DMSO (final concentration: 20%), and the aminoacylation reaction was carried out at 0°C overnight. After the aminoacylation, an equal volume of 3 M NaOAc (pH 5.2) was added to the sample, followed by ethanol precipitation.
[0275] The pellet was then redissolved in 0.3M NaOAc (pH 5.2) and ethanol precipitated again. Finally, the pellet was washed once with 70% ethanol containing 0.1M NaOAc (pH 5.2) and once with 70% ethanol. The resulting aminoacylated sample pellet was dissolved in 0.2% acetic acid. The aminoacylated sample was dissolved in 2.64 volumes of loading buffer (final concentrations: 41 mM sodium acetate, 23% formamide, 2.7 mM EDTA) and separated by electrophoresis on a 20% denaturing polyacrylamide gel (50 mM sodium acetate (pH 5.2), 6 M urea) under acidic conditions (electrophoresis solution: 50 mM sodium acetate (pH 5.2)). The gel was analyzed by fluorescent staining with SYBR Green II (Invitrogen, SYBR, Molecular Probes Inc.).
[0276] The results are shown in Figure 17a. Figure 17a shows an image obtained by detecting fluorescence derived from SYBR Green I (Invitrogen, SYBR, Molecular Probes Inc.). When acylation was performed using a monovalent linker (Linker 9), one band shifted to a higher molecular weight compared to the band position before acylation appeared. This band shift is thought to be due to an increase in molecular weight caused by the acylation of one amino acid to the linker. When a bivalent linker (Linker 10) was used, two bands shifted to a higher molecular weight compared to the band position before acylation appeared. This is thought to be due to an increase in molecular weight caused by the acylation of one or two amino acids to the bivalent linker (Linker 10), which has two CCAs at its termini, the nucleic acid recognition sites of the ARS ribozyme, resulting in these band shifts.
[0277] Example 16-2 Display assay using mRNA-linker-peptide conjugates with Strep-tagII as a model peptide Using mRNA-linker-peptide conjugates with Strep-tagII as a model peptide, a display assay was performed to evaluate the recovery rate associated with binding to streptavidin.
[0278] The following experiment was carried out by hybridizing the linker 9 or linker 10 acylated with MePhe in Example 16-1 to the mRNA encoding Strep-tagII prepared in Example 3 in a 1 mM sodium acetate solution.
[0279] To the cell-free translation system constructed in Example 5, the above mRNA-linker conjugate (final concentration: 1 μM), one type of aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA), nine types of amino acids (final concentration: 0.2 mM, Gly, His, Phe, Pro, Ser, Gln, Glu, Lys, Trp), and nine types of aminoacyl-tRNA synthetases (final concentrations: 0.09 μM GlyRS, 0.02 μM HisRS, 0.68 μM PheRS, 0.16 μM ProRS, 0.04 μM SerRS, 0.06 μM GlnRS, 0.23 μM GluRS, 0.11 μM LysRS, 0.03 μM TrpRS) were added, and a translation reaction was carried out at 37°C for 30 minutes (first translation reaction). After the reaction, EDTA was added to the sample for artificial recycling translation to a final concentration of 12.5 mM, and the mixture was left standing on an ice bath for 10 minutes to denature the ribosomes.
[0280] To the reaction mixture from the first translation reaction described above, Mg(OAc)2 (final concentration: 12.5 mM), translation-related solution (final concentrations: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL E. coli total tRNA (Roche), 0.47 mM DTT, aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA), and ribosomes (final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37°C for 30 minutes (second translation reaction). After the translation reaction, EDTA (final concentration: 16.7 mM) was added to terminate the reaction.
[0281] Next, a reverse transcription reaction solution (final concentrations: 50 mM Tris-HCl, 75 mM KCl, 18.4 mM MgCl, 1 mM DTT, 0.30 mM dNTPs, 5 units / μL MLV reverse transcriptase, 3 μM RT_Strep-tag II (SEQ ID NO: 14)) was added to the reaction solution containing the translation product obtained above, and the reverse transcription reaction was carried out at 42°C for 15 minutes.
[0282] After the reverse transcription reaction, EDTA (final concentration: 16.7 mM) was added, and the mixture was desalted using a Bio-Gel P30 Gel (Biorad) desalting column substituted with HBS-T (0.05% (v / v) Tween 20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).
[0283] After desalting, streptavidin-immobilized magnetic beads (final concentration: 1 mg / mL, Dynabeads™ M-280 Streptavidin, Thermo) were added as the target protein, and a binding reaction was carried out at 4°C for 1 hour. At this time, the desalted sample was added to Protein G-immobilized magnetic beads (final concentration: 1 mg / mL, Dynabeads™ Protein G for Immunoprecipitation, Thermo) as a negative control, and the mixture was mixed at 4°C for 1 hour to carry out a binding reaction. After the binding reaction, the magnetic beads were magnetically separated, and the supernatant was removed. Next, the magnetic beads were resuspended in HBS-T (0.5 mg / mL), transferred to a new sample tube, and mixed at 4°C for 5 minutes. The same magnetic separation, supernatant removal, resuspension in HBS-T, and 5-minute mixing at 4°C were repeated twice. Finally, after magnetic separation and removal of the supernatant, the fragments were resuspended (2 mg / mL) in PCR solution (10 mM Tris-HCl (pH 8.5), 50 mM KCl, 0.1% Triton X-100) and heated at 95°C for 5 minutes. After heating, magnetic separation was performed and the supernatant was collected.
[0284] The amount of DNA in the desalted solution before addition of the target protein and after recovery from the magnetic beads was quantified by real-time PCR. Real-time PCR measurements were performed using a LightCycler 96 (Roche Applied Science). The PCR solution was supplemented with Taq polymerase, SYBR Green I (1:100,000, Invitrogen), dNTPs (final concentration: 0.25 mM), MgCl (final concentration: 2 mM), T7g10M.F52 (0.25 μM), RV_Strep-tag II (SEQ ID NO: 10) (0.25 μM), and the measurement sample solution.
[0285] The results of three trials of the display assay are shown in Figure 18. Here, the recovery rate (%) indicates the ratio of the amount of DNA recovered from the magnetic beads to the amount of DNA in the solution before the addition of the target protein. In a binding ability evaluation using Strep-tag II and streptavidin as model peptides and model target proteins, respectively, the use of a bivalent linker (Linker 10) significantly enhanced the DNA recovery rate resulting from binding to the target protein compared to a monovalent linker (Linker 9). Furthermore, the enhanced recovery rate was also confirmed in artificial recycling translation. From these results, as in Example 10, it was considered that the avidity effect resulting from multiple peptides linked to the linker improved the binding ability to the target protein.
[0286] From the results of Examples 10, 16-1 and 16-2 above, it was considered that even when an amino acid is covalently bound to the ribose at the 3' end of the linker via an ester bond, resulting in the properties of a puromycin-like substance, it is possible to present multiple peptides by using a bivalent linker, and that the avidity effect improves the binding ability to the target protein.
[0287] Example 17: Display assay using trivalent linkers Example 17-1 Display assay 1 using mRNA-linker-peptide conjugates with Strep-tagII as a model peptide Using mRNA-linker-peptide conjugates with Strep-tagII as a model peptide, a display assay was performed to evaluate the recovery rate associated with binding to streptavidin.
[0288] The following experiment was carried out using the mRNA-linker conjugates prepared in Example 3, in which linker 1 and linker 11 were hybridized to mRNA encoding Strep-tagII.
[0289] To the cell-free translation system constructed in Example 5, the mRNA-linker conjugate (final concentration: 1 μM), one type of aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA), nine types of amino acids (final concentration: 0.2 mM, Gly, His, Phe, Pro, Ser, Gln, Glu, Lys, Trp), and nine types of aminoacyl-tRNA synthetases (final concentrations: 0.09 μM GlyRS, 0.02 μM HisRS, 0.68 μM PheRS, 0.16 μM ProRS, 0.04 μM SerRS, 0.06 μM GlnRS, 0.23 μM GluRS, 0.11 μM LysRS, 0.03 μM TrpRS) were added, and a translation reaction was carried out at 37°C for 30 minutes (first translation reaction). After the reaction, EDTA was added to the samples that did not undergo artificial recycling translation to a final concentration of 16.7 mM, and to the samples that underwent a second translation by artificial recycling translation, EDTA was added to a final concentration of 12.5 mM, and the samples were left to stand on an ice bath for 10 minutes to denature the ribosomes.
[0290] Furthermore, a second translation reaction was carried out on the samples subjected to artificial recycling translation.
[0291] The reaction mixture from the first translation reaction described above was supplemented with Mg(OAc)2 (final concentration: 12.5 mM), translation-related solution (final concentrations: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM phosphocreatine, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL E. coli total tRNA (Roche), 0.47 mM DTT, and aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA) and ribosomes (final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37°C for 30 minutes (second translation reaction). After the reaction, EDTA was added to a final concentration of 16.7 mM for samples that did not undergo a third translation by artificial recycling translation, and EDTA was added to a final concentration of 12.5 mM for samples that did undergo a third translation by artificial recycling translation. The samples were then left to stand on an ice bath for 10 minutes to denature the ribosomes. Furthermore, a third translation reaction was carried out on the samples subjected to artificial recycling translation.
[0292] To the reaction mixture from the second translation reaction described above, Mg(OAc)2 (final concentration: 12.5 mM), translation-related solution (final concentrations: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL E. coli total tRNA (Roche), 0.47 mM DTT, aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA), and ribosomes (final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37°C for 30 minutes (third translation reaction). After the translation reaction, EDTA (final concentration: 16.7 mM) was added to terminate the reaction.
[0293] Next, a reverse transcription reaction solution (final concentrations: 50 mM Tris-HCl, 75 mM KCl, 18.4 mM MgCl, 1 mM DTT, 0.30 mM dNTPs, 5 units / μL MLV reverse transcriptase, 3 μM RT_Strep-tag II (SEQ ID NO: 14)) was added to the reaction solution containing the translation product obtained above, and the reverse transcription reaction was carried out at 42°C for 30 minutes.
[0294] After the reverse transcription reaction, EDTA (final concentration: 16.7 mM) was added, and the mixture was desalted using a Bio-Gel P30 Gel (Biorad) desalting column substituted with HBS-T (0.05% (v / v) Tween 20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).
[0295] After desalting, streptavidin-immobilized magnetic beads (final concentration: 1 mg / mL, Dynabeads™ M-280 Streptavidin, Thermo) were added as the target protein, and a binding reaction was carried out at 4°C for 1 hour. At this time, the desalted sample was added to Protein G-immobilized magnetic beads (final concentration: 1 mg / mL, Dynabeads™ Protein G for Immunoprecipitation, Thermo) as a negative control, and the mixture was mixed at 4°C for 1 hour to carry out a binding reaction. After the binding reaction, the magnetic beads were magnetically separated, and the supernatant was removed. The magnetic beads were then resuspended in HBS-T (0.5 mg / mL), transferred to a new sample tube, and mixed at 4°C for 30 minutes. The same magnetic separation, supernatant removal, resuspension in HBS-T, and 30-minute mixing at 4°C were repeated twice. Finally, after magnetic separation and removal of the supernatant, the fragments were resuspended (2 mg / mL) in PCR solution (10 mM Tris-HCl (pH 8.5), 50 mM KCl, 0.1% Triton X-100) and heated at 95°C for 5 minutes. After heating, magnetic separation was performed and the supernatant was collected.
[0296] The amount of DNA in the desalted solution before addition of the target protein and after recovery from the magnetic beads was quantified by real-time PCR. Real-time PCR measurements were performed using a LightCycler 96 (Roche Applied Science). The PCR solution was supplemented with Taq polymerase, SYBR Green I (1:100,000, Invitrogen), dNTPs (final concentration: 0.25 mM), MgCl (final concentration: 2 mM), T7g10M.F52 (0.25 μM), RV_Strep-tag II (SEQ ID NO: 10) (0.25 μM), and the measurement sample solution.
[0297] The results of three trials of the display assay are shown in Figure 19. Here, the recovery rate (%) indicates the ratio of the amount of DNA recovered from the magnetic beads to the amount of DNA in the solution before the addition of the target protein. In a binding ability evaluation using Strep-tag II and streptavidin as model peptides and model target proteins, respectively, the use of a trivalent linker (Linker 11) significantly enhanced the DNA recovery rate derived from binding to the target protein compared to a monovalent linker (Linker 1), depending on the number of artificial recycling translations. This is thought to be due to the avidity effect derived from multiple peptides linked to the linker, which improved the binding ability to the target protein.
[0298] Example 17-2 Display assay 2 using mRNA-linker-peptide conjugates with Strep-tagII as a model peptide Using mRNA-linker-peptide conjugates with Strep-tagII as a model peptide, a display assay was performed to evaluate the recovery rate associated with binding to streptavidin.
[0299] The following experiment was carried out using the mRNA-linker conjugates prepared in Example 3, in which linker 1 and linker 15 were hybridized to mRNA encoding Strep-tagII.
[0300] To the cell-free translation system constructed in Example 5, the mRNA-linker conjugate (final concentration: 1 μM), one type of aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA), nine types of amino acids (final concentration: 0.2 mM, Gly, His, Phe, Pro, Ser, Gln, Glu, Lys, Trp), and nine types of aminoacyl-tRNA synthetases (final concentrations: 0.09 μM GlyRS, 0.02 μM HisRS, 0.68 μM PheRS, 0.16 μM ProRS, 0.04 μM SerRS, 0.06 μM GlnRS, 0.23 μM GluRS, 0.11 μM LysRS, 0.03 μM TrpRS) were added, and a translation reaction was carried out at 37°C for 30 minutes (first translation reaction). After the reaction, EDTA was added to the sample for artificial recycling translation to a final concentration of 12.5 mM, and the mixture was left standing on an ice bath for 10 minutes to denature the ribosomes.
[0301] To the reaction mixture from the first translation reaction described above, Mg(OAc)2 (final concentration: 12.5 mM), translation-related solution (final concentrations: 23.5 mM HEPES-KOH (pH 7.6), 0.94 mM ATP, 0.94 mM GTP, 0.47 mM CTP, 0.47 mM UTP, 9.4 mM creatine phosphate, 47.0 mM potassium acetate, 0.94 mM spermidine, 0.7 mg / mL E. coli total tRNA (Roche), 0.47 mM DTT, aminoacyl-tRNA (final concentration: 10 μM W Ini-tRNA), and ribosomes (final concentration: 1.2 μM) were added, and the translation reaction was carried out at 37°C for 30 minutes (second translation reaction). After the translation reaction, EDTA (final concentration: 16.7 mM) was added to terminate the reaction.
[0302] Next, a reverse transcription reaction solution (final concentrations: 50 mM Tris-HCl, 75 mM KCl, 18.4 mM MgCl, 1 mM DTT, 0.30 mM dNTPs, 5 units / μL MLV reverse transcriptase, 3 μM RT_Strep-tag II (SEQ ID NO: 14)) was added to the reaction solution containing the translation product obtained above, and the reverse transcription reaction was carried out at 42°C for 30 minutes.
[0303] After the reverse transcription reaction, EDTA (final concentration: 16.7 mM) was added, and the mixture was desalted using a Bio-Gel P30 Gel (Biorad) desalting column substituted with HBS-T (0.05% (v / v) Tween 20, 25 mM HEPES-NaOH (pH 7.4), 150 mM NaCl).
[0304] After desalting, streptavidin-immobilized magnetic beads (final concentration: 1 mg / mL, Dynabeads™ M-280 Streptavidin, Thermo) were added as the target protein, and a binding reaction was carried out at 4°C for 1 hour. At this time, the desalted sample was added to Protein G-immobilized magnetic beads (final concentration: 1 mg / mL, Dynabeads™ Protein G for Immunoprecipitation, Thermo) as a negative control, and the mixture was mixed at 4°C for 1 hour to carry out a binding reaction. After the binding reaction, the magnetic beads were magnetically separated, and the supernatant was removed. The magnetic beads were then resuspended in HBS-T (0.5 mg / mL), transferred to a new sample tube, and mixed at 4°C for 30 minutes. The same magnetic separation, supernatant removal, resuspension in HBS-T, and 30-minute mixing at 4°C were repeated twice. Finally, after magnetic separation and removal of the supernatant, the fragments were resuspended (2 mg / mL) in PCR solution (10 mM Tris-HCl (pH 8.5), 50 mM KCl, 0.1% Triton X-100) and heated at 95°C for 5 minutes. After heating, magnetic separation was performed and the supernatant was collected.
[0305] The amount of DNA in the desalted solution before addition of the target protein and after recovery from the magnetic beads was quantified by real-time PCR. Real-time PCR measurements were performed using a LightCycler 96 (Roche Applied Science). The PCR solution was supplemented with Taq polymerase, SYBR Green I (1:100,000, Invitrogen), dNTPs (final concentration: 0.25 mM), MgCl (final concentration: 2 mM), T7g10M.F52 (0.25 μM), RV_Strep-tag II (SEQ ID NO: 10) (0.25 μM), and the measurement sample solution.
[0306] The results of two trials of the display assay are shown in Figure 20. Here, the recovery rate (%) indicates the ratio of the amount of DNA recovered from the magnetic beads to the amount of DNA in the solution before the addition of the target protein. In a binding ability evaluation using Strep-tag II and streptavidin as model peptides and model target proteins, respectively, the use of a trivalent linker (Linker 15) significantly enhanced the DNA recovery rate derived from binding to the target protein compared to a monovalent linker (Linker 1). This is thought to be due to the avidity effect derived from multiple peptides linked to the linker, which improved the binding ability to the target protein. [Industrial Applicability]
[0307] The "conjugate in which multiple translation products are bound to one genetic information material via a puromycin-like substance" of the present invention can recognize a target protein through the multiple translation products. Therefore, for example, by using it in a cell-free translation system display (e.g., mRNA display), it is possible to significantly improve the recovery rate of peptide-nucleic acid conjugates that bind to target proteins and to obtain peptide-binding substances that have weaker binding affinity to the peptide. The provision of such a novel display is expected to lead to, for example, the development of superior peptide drugs.
Claims
1. a binding moiety having a structure capable of binding to a desired genetic information material; and At least two puromycin-like substances A linker comprising: The puromycin-like substance can be covalently linked to the C-terminus of a desired peptide. The linker.
2. the binding moiety having a structure capable of binding to the desired genetic information material comprises a nucleic acid capable of binding to the desired genetic information material; The linker of claim 1.
3. 3. The linker according to claim 1 or 2, for linking the genetic information material and a peptide encoded by the genetic information material.
4. 4. The linker according to claim 1, wherein the genetic information material is a nucleic acid.
5. The linker according to any one of claims 1 to 3, wherein the puromycin-like substance is puromycin.
6. a binding moiety having a structure capable of binding to a desired genetic information material; and At least two puromycin-like substances A linker comprising: The puromycin-like substance can be covalently linked to the C-terminus of a desired peptide. Use of the linker, The use for linking the genetic information material to a peptide encoded by the genetic information material.
7. (a) a linker according to claims 1 to 3; and (b) the genetic information material bound to the linker binding site of (a); A genetic information material-linker conjugate comprising:
8. (a) a linker according to claims 1 to 3; (b) the genetic information material attached to the linker bond of (a); and (c) a peptide encoded by the genetic information material of (a) linked to at least two or more puromycin-like substances of the linker; A genetic information material-linker-peptide conjugate comprising:
9. (1) A step of subjecting the genetic information material-linker conjugate according to claim 7 to a cell-free translation system to translate the genetic information material, in which the puromycin-like substance in the linker binds to the translated peptide to obtain a genetic information material-linker-peptide conjugate. A method for producing a genetic information material-linker-peptide conjugate, comprising:
10. Before the process of (1), (0) 10. The method according to claim 9, comprising the step of binding the linker according to any one of claims 1 to 3 to a desired genetic information material to obtain a genetic information material-linker conjugate.
11. The method according to claim 9 or 10, further comprising: (2) repeating step (1) two or more times.
12. A library comprising at least two genetic information material-linker-peptide conjugates according to claim 8.
13. A method for screening a peptide that binds to a desired target substance, comprising: a step of contacting the target substance with a library containing at least two genetic information material-linker-peptide conjugates according to claim 8; The screening method comprising:
14. A method for evaluating the binding ability of a peptide to a desired target substance, comprising: A step of contacting the genetic information material-linker-peptide conjugate according to claim 8 with the target substance. The evaluation method comprising:
15. (1-i) a step of subjecting a genetic information substance-linker conjugate, in which a linker containing at least one or more puromycin-like substances is bound to a desired genetic information substance, to a cell-free translation system to translate the genetic information substance, in which the puromycin-like substance in the linker binds to the translated peptide, thereby obtaining a genetic information substance-linker-peptide conjugate; and (2-i) Step (1-i) is repeated two or more times. A method for producing a genetic information material-linker-peptide conjugate, comprising:
16. (1-ii) a step of subjecting a genetic information substance-linker conjugate, in which a linker containing at least two or more puromycin-like substances is bound to a desired genetic information substance, to a cell-free translation system to translate the genetic information substance, in which the puromycin-like substances in the linker bind to the translated peptide to obtain a genetic information substance-linker-peptide conjugate; A method for producing a genetic information material-linker-peptide conjugate, comprising:
17. A method for displaying two or more peptides encoded by a desired genetic information material from the genetic information material, comprising: The method, wherein each of the peptides is linked to the genetic information material via a functional group capable of covalently bonding to the C-terminus of the peptide.
18. The presentation method according to claim 17, comprising a step of subjecting the genetic information material-linker conjugate according to claim 7 to a cell-free translation system to translate the peptide from the genetic information material, wherein the puromycin-like substance binds to the translated peptide.
Citation Information
Patent Citations
Translation synthesis of polypeptide having n-terminal non-natural backbone and application thereof
JP2008125396A
Protein screening methods
JP2011528912A
Molecule that homologizes genotype and phenotype and utilization thereof
WO1998016636A1
Selection of proteins using RNA-protein fusions
WO1998031700A1
LINKER FOR CONSTRUCTING mRNA-PUROMYCIN-PROTEIN CONJUGATE
WO2006041194A1