External skin preparation and internal preparation

Abstract

To provide a material excellent in cell proliferation-promoting activity, hyaluronic acid production-promoting activity, MMP inhibitory activity, and collagen production-promoting activity.SOLUTION: An extract of Kochia scoparia is excellent in cell proliferation-promoting activity, hyaluronic acid production-promoting activity, MMP inhibitory activity, and collagen production-promoting activity, and also has excellent stability. The extract of Kochia scoparia of the present invention can be used not only in the field of beauty, such as in preventing skin aging, but also in the medical field, such as in suppressing functional decline due to aging, and is expected to be applicable to cosmetics, foods, quasi-drugs, pharmaceuticals, and the like.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to an external and internal skin preparation for promoting cell proliferation, promoting hyaluronic acid production, inhibiting MMP, and promoting collagen production. [Background technology]

[0002] The dermis contains fibroblasts and collagen, with type I collagen accounting for 80% of the total. In addition to type I collagen, types III, V, XII, and XIV collagen are known to exist. One of the causes of wrinkles and sagging is a decrease in type I collagen. Therefore, promoting the production of type I collagen is thought to be effective in preventing and improving wrinkles and sagging. In addition, promoting the production of type I collagen is also effective in improving wound healing in the skin.

[0003] In addition to the dermis, collagen is also found in high concentrations in membranous tissues such as blood vessels, fascia, and pericardium, as well as bones, tendons, and ligaments. Promotion of type I collagen production increases the strength of ligaments, tendons, and bones, and is effective in preventing damage to these tissues. Furthermore, promotion of type I collagen production is also effective in repairing damaged tissues, such as promoting repair of damaged ligaments, promoting repair of fractures, and inducing angiogenesis.

[0004] On the other hand, skin is exposed daily to various physical and chemical stressors, including ultraviolet rays, dryness, cold, heat, and drugs. As a result, skin function declines, and various skin aging phenomena become apparent. One of the skin aging phenomena is wrinkles. Two types of wrinkles are known: epidermal wrinkles and dermal wrinkles. Epidermal wrinkles, also known as fine lines, are temporary wrinkles that occur when the moisture content in the epidermal stratum corneum decreases due to dry skin. Dermal wrinkles, on the other hand, are wrinkles that are formed by ultraviolet rays contained in sunlight and aging. Possible mechanisms of their formation include a decrease in collagen synthesis ability in dermal fibroblasts due to ultraviolet rays and aging, and accelerated collagen degradation due to an increase in matrix metalloproteinases (MMPs).

[0005] Epidermal wrinkles caused by dryness and dermal wrinkles differ in their histological morphology, onset mechanism, and treatment methods, and dermal wrinkles caused by ultraviolet rays and aging are difficult to improve by using cosmetics with moisturizing effects.

[0006] To date, agents that aim to improve dermal wrinkles caused by ultraviolet rays have been reported, including an agent for preventing and improving skin wrinkle formation, which contains hydrolyzed almonds as an active ingredient (Patent Document 1), and an agent for improving wrinkles caused by ultraviolet radiation, which contains extracts of Atractylodes macrocarpa, Atractylodes chinensis, and Atractylodes xanthan gum as active ingredients (Patent Document 2).

[0007] Collagenase (MMP-1), a member of the MMP family, is an enzyme produced by fibroblasts and chondrocytes, and is significantly involved in promoting collagen degradation. Collagen is the major structural protein, accounting for approximately one-third of mammalian tissues, and is an essential component of many matrix tissues, including cartilage, bone, tendon, gums, and skin. When cleaved at a single site by collagenase, collagen molecules, which are stable within normal tissues, are denatured into single-chain gelatin, which is then degraded by various other proteases. This results in the loss of structural integrity of matrix tissues, leading to wrinkles, cancer, ulcer formation, osteoporosis, periodontitis, and other conditions.

[0008] Materials that have been proposed as having collagenase inhibitory activity include, for example, cocoa husk extract (Patent Document 3), which is the skin of the cocoa bean, Rubus nigra extract (Patent Document 4), lactoferrin (Patent Document 5), etc. With increasing interest in skin aging and oral hygiene, there is a demand for materials that are safe, have no side effects, and have excellent collagenase inhibitory activity.

[0009] MMPs play a major role in cancer cell infiltration into the interstitium, invasion into blood vessels, and angiogenesis. The interstitium is primarily composed of type I collagen, and cancer cell migration requires destruction of the matrix by interstitial collagenases, etc. Completion of metastasis requires destruction of the vascular endothelial basement membrane and migration within the interstitium, and MMPs are also involved in this stage (Non-Patent Document 1). Therefore, substances with MMP inhibitory activity are expected to suppress angiogenesis and cancer metastasis in cancer tissues and are considered useful for the prevention and treatment of cancer diseases. Furthermore, MMP inhibition is useful for the prevention, treatment, and amelioration of various diseases caused by increased MMP activity, such as ulcer formation, arteriosclerosis, rheumatoid arthritis, osteoporosis, and periodontitis.

[0010] Gelatinase (MMP-2), which belongs to the MMP family, is an enzyme produced by fibroblasts, endothelial cells, cancer cells, etc., and breaks down substrates such as collagen, gelatin, and elastin (structural proteins that are specific components of elastic tissues such as arteries, tendons, and skin). Therefore, when elastin is broken down by gelatinase, the risk of diseases such as cancer, arteriosclerosis, and rheumatoid arthritis, as well as injuries such as ligament rupture, increases.

[0011] Fibroblasts also produce proteins such as collagen and glycosaminoglycans such as hyaluronic acid to form dermal connective tissue, which maintains skin firmness. It is believed that wrinkles and sagging skin occur when this connective tissue loses its contractile force and elasticity.

[0012] In particular, hyaluronic acid is known as a high molecular weight polysaccharide widely distributed in connective tissue, and it takes on a gel-like form in the dermis, maintaining the elasticity of the skin. Therefore, the deterioration and decrease of hyaluronic acid are considered to be important in skin aging. Therefore, until now, a topical skin preparation that can activate fibroblasts and promote the cells' own production of collagen and hyaluronic acid has been sought (Patent Document 6).

[0013] Hyaluronic acid is also present in joints, where it is known to cushion the impact of joint loads and smooth joint movement. Hyaluronic acid is produced in the synovial membrane of joints and is a major component of synovial fluid, as well as a constituent of articular cartilage aggrecan. Hyaluronic acid plays important roles in water retention, lubrication of articular cartilage, intercellular adhesion, and immunomodulatory activity. Hyaluronic acid interacts with aggrecan monomers to increase the elasticity of the cartilage matrix, penetrates damaged cartilage to maintain matrix elasticity, and has been suggested to exert biological effects on chondrocytes, synovial cells, inflammatory cells, vascular cells, etc., such as inhibiting the release and degradation of aggrecan and matrix molecules from the cartilage matrix, and suppressing MMP production, COX activity, and superoxide formation (Non-Patent Documents 2 and 3).

[0014] The hyaluronic acid concentration in normal human synovial fluid is approximately 2.3 mg / mL. However, in patients with rheumatoid arthritis, the concentration drops to approximately 1.2 mg / mL, and the viscosity of the synovial fluid also drops significantly (Non-Patent Document 4). It is also known that septic arthritis, gouty arthritis, and other conditions also experience a decrease in hyaluronic acid content, similar to that seen in rheumatoid arthritis (Non-Patent Document 5). Increasing the amount of hyaluronic acid in synovial fluid is considered to improve lubrication, protect and coat articular cartilage, suppress pain, and improve pathological synovial fluid in these diseases. For example, intra-articular injection of sodium hyaluronate in patients with rheumatoid arthritis has been shown to improve the symptoms described above (Non-Patent Document 6). However, treatment for these diseases is long-term. Therefore, there is a need for topical skin preparations, foods, and pharmaceuticals containing hyaluronic acid production promoters that can be easily used in daily life to prevent and treat various diseases caused by a decrease in hyaluronic acid content.

[0015] Floaters are a condition characterized by the appearance of thin shadows resembling lint or mosquitoes in the field of vision. They occur when opacities in the vitreous, which fills the interior of the eye, cast a shadow on the retina. Floaters can be broadly divided into two types: physiological floaters, which are caused by aging, ultraviolet light, active oxygen, etc., and pathological floaters, which appear as a symptom of diseases such as retinal detachment, retinal tears, vitreous hemorrhage, and uveitis. Physiological floaters occur when the vitreous becomes opaque due to the liquefaction caused by a decrease in hyaluronic acid, a major component of the vitreous, and the resulting breakdown of collagen fibers. Treatment options include vitrectomy and laser therapy, but these procedures are not commonly performed in Japan due to safety concerns, and treatment overseas is expensive. Therefore, to prevent and improve physiological floaters, foods and medicines containing hyaluronic acid production promoters that can be used on a daily basis are needed.

[0016] In general, the proliferation and division ability of epidermal keratinocytes declines with age, resulting in thinner epidermal layers (Non-Patent Document 7). Biological factors such as epidermal growth factor (EGF) and female hormones (estrogen) stimulate epidermal keratinocyte proliferation, but their secretion declines with age. This age-related decline in the metabolic function of epidermal keratinocytes slows skin turnover, leading to rough skin and skin aging. Furthermore, retention of keratinocytes that shed from the stratum corneum inhibits the smooth excretion of melanin within the epidermis, resulting in pigmentation and dull skin. It is also known to slow epidermal wound healing. To prevent or ameliorate these phenomena, researchers have sought to identify ingredients that promote epidermal keratinocyte proliferation, and many topical skin preparations have been proposed.

[0017] Bassia scoparia (scientific name: Bassia scoparia) is an annual plant belonging to the genus Bassia in the family Amaranthaceae. It has been known that extracts of Bassia scoparia have an inhibitory effect on melanin production (Patent Document 7) and an inhibitory effect on the induction of differentiation of preadipocytes (Patent Document 8). [Prior art documents] [Patent documents]

[0018] [Patent Document 1] Japanese Patent Application Laid-Open No. 2000-119125 [Patent Document 2] Japanese Patent Application Laid-Open No. 2006-199611 [Patent Document 3] Japanese Patent Application Publication No. 3-44331 [Patent Document 4] Japanese Patent Application Laid-Open No. 2003-137801 [Patent Document 5] Japanese Patent Application Publication No. 5-186368 [Patent Document 6] Japanese Patent Application Laid-Open No. 2007-1924 [Patent Document 7] Japanese Patent Application Publication No. 7-25746 [Patent Document 8] Japanese Patent Application Laid-Open No. 2002-138044 [Non-patent literature]

[0019] [Non-Patent Document 1] "Matrix Metalloproteinases in Digestive Cancer", Japanese Society of Gastroenterology, Vol. 100, p. 152, 2003 [Non-patent document 2] Mari Ogura et al., “Glycative Stress Research”, 2018, Vol.5(1), pp.012-020 [Non-patent document 3] Yukio Kato et al., “Clin Rheumatol”, 2013, Vol.25, pp.174-184 [Non-patent document 4] “Arthritis Rheumatism”, Vol.10,pp 357,1967 [Non-Patent Document 5] "Bonding Composition", Kanehara Publishing, 481 pages, 1984 [Non-patent document 6] "Inflammation", Japanese Society of Inflammation, Vol. 11, p. 16, 1991 [Non-Patent Document 7] Varani J et al., J Invest Dermatol, Vol.3,pp 57-60,1998 Summary of the Invention [Problem to be solved by the invention]

[0020] There is a demand for safe, stable materials that are excellent in promoting cell proliferation, promoting hyaluronic acid production, inhibiting MMP, and promoting collagen production, but at present, no fully satisfactory materials have been provided. [Means for solving the problem]

[0021] Under these circumstances, the present inventors conducted extensive research and found that extracts from Kochia japonica have excellent cell proliferation promoting effects, hyaluronic acid production promoting effects, MMP inhibitory effects, and collagen production promoting effects, and are also highly stable. In particular, they discovered that extracts from Kochia japonica that had been dry-heat treated had unexpectedly significant effects on hyaluronic acid production promoting effects, MMP inhibitory effects, and collagen production promoting effects. Furthermore, they discovered that topical or internal preparations containing these extracts are safe and stable, and have excellent cell proliferation promoting effects, hyaluronic acid production promoting effects, MMP inhibitory effects, and collagen production promoting effects, and can be used as multifunctional beauty and health materials and pharmaceuticals, leading to the completion of the present invention.

[0022] That is, the present invention includes the following inventions. (1) A topical skin preparation containing as an active ingredient an extract obtained from Kochia japonica that has been dry-heated at a temperature of 80°C or higher, the topical skin preparation being characterized by being used for one or more purposes selected from the group consisting of promoting hyaluronic acid production, inhibiting MMP, and promoting collagen production. (2) A pharmaceutical product containing as its active ingredient an extract obtained from Kochia japonica that has been dry-heated at a temperature of 80°C or higher, for preventing and / or improving one or more diseases or symptoms selected from the group consisting of various diseases or symptoms caused by a decrease in hyaluronic acid content, various diseases or symptoms caused by increased MMP, and various diseases or symptoms caused by a decrease in collagen production ability. (3) A food product containing as an active ingredient an extract obtained from Kochia that has been dry-heated at a temperature of 80°C or higher, for preventing and / or improving one or more diseases or symptoms selected from the group consisting of various diseases or symptoms caused by a decrease in hyaluronic acid content, various diseases or symptoms caused by increased MMP, and various diseases or symptoms caused by a decrease in collagen production ability. (4) A topical skin preparation containing an extract of Kochia japonica as an active ingredient, characterized in that it is used for one or more purposes selected from the group consisting of promoting cell proliferation, promoting hyaluronic acid production, inhibiting MMP, and promoting collagen production. (5) A pharmaceutical product containing an extract of Kochia japonica as an active ingredient, for preventing and / or improving one or more diseases or symptoms selected from the group consisting of various diseases or symptoms caused by decreased cell proliferation ability, various diseases or symptoms caused by decreased hyaluronic acid content, various diseases or symptoms caused by increased MMP, and various diseases or symptoms caused by decreased collagen production ability. (6) A food product containing an extract of Kochia japonica as an active ingredient, for preventing and / or improving one or more diseases or symptoms selected from the group consisting of various diseases or symptoms caused by decreased cell proliferation ability, various diseases or symptoms caused by decreased hyaluronic acid content, various diseases or symptoms caused by increased MMP, and various diseases or symptoms caused by decreased collagen production ability. [Effects of the Invention]

[0023] According to the present invention, there are provided topical and internal skin preparations containing an extract of Kochia scoparia as an active ingredient for promoting cell proliferation, promoting hyaluronic acid production, inhibiting MMP, and promoting collagen production. When Kochia scoparia is subjected to dry heat treatment, it can exhibit particularly excellent effects of promoting hyaluronic acid production, inhibiting MMP, and promoting collagen production. DETAILED DESCRIPTION OF THE INVENTION

[0024] The Kochia scoparia (scientific name: Bassia scoparia) used in the present invention is an annual plant belonging to the Bassia genus of the Amaranthaceae family. It is characterized by its fine, broom-like stems, which also turn red when the leaves turn red in autumn. The fruit is used for medicinal and edible purposes, and the dried fruit is used as a herbal medicine called jifushi. Kochia scoparia is a synonym of Bassia scoparia. In the present invention, Kochia extract refers to an extract of parts of the plant, such as the flowers, fruits, seeds, leaves, stems, and roots, or the entire plant (whole plant), or a mixture thereof. In terms of efficacy, the fruit is preferred as the part used as the extraction material in the present invention. For extraction, the plant may be used as is, or may be processed by drying, crushing, shredding, or other processes.

[0025] It is even better to treat the plant body by dry heat treatment. Unlike typical drying of herbal medicines (usually below 60°C), the temperature for dry heat treatment is preferably 80°C or higher, more preferably 100 to 280°C. Furthermore, 120 to 280°C is most preferred. Temperatures above 280°C tend to carbonize the plant, making it unsuitable for extraction. The duration of dry heat treatment varies depending on the temperature, but is preferably 10 minutes or more, more preferably 15 to 60 minutes. Furthermore, 15 to 30 minutes is most preferred. Heating for more than 60 minutes tends to carbonize the plant, making it unsuitable for extraction. Furthermore, these treatments may be performed in separate sessions, such as 2 to 5 sessions. The total duration in this case is preferably the time mentioned above.

[0026] The solvent extraction method is not particularly limited, and can be performed by, for example, heated extraction (e.g., 40 to 100°C), room temperature extraction (e.g., 15 to 25°C), low temperature extraction (e.g., 0 to 15°C), stirring extraction, or column extraction. Examples of extraction solvents include water, lower alcohols (e.g., methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (e.g., 1,3-butylene glycol, propylene glycol, glycerin, etc.), ketones (e.g., acetone, methyl ethyl ketone, etc.), acetonitrile, esters (e.g., ethyl acetate, butyl acetate, etc.), hydrocarbons (e.g., hexane, heptane, liquid paraffin, etc.), and ethers (e.g., ethyl ether, tetrahydrofuran, propyl ether, etc.). Polar solvents such as water, lower alcohols, and liquid polyhydric alcohols are preferred, with water, ethanol, 1,3-butylene glycol, and propylene glycol being particularly preferred. These solvents may be used alone or in combination. The most preferred extraction solvents are water, a mixed polar solvent of water and ethanol, or a mixed polar solvent of water and 1,3-butylene glycol. Among these, solvents containing 20 to 100% by weight of ethanol or 1,3-butylene glycol are preferred, and those containing 50 to 100% by weight are most preferred. Furthermore, the pH of the above extraction solvents can be adjusted by adding an acid or alkali.

[0027] The amount of solvent used is not particularly limited, and may be, for example, 5 times or more, preferably 10 times or more, the dry weight of the Kochia fruit. However, for convenience of operations such as concentration and isolation after extraction, it is preferable that the amount be 100 times or less. The extraction temperature and time can be appropriately selected depending on the type of solvent used, the pressure during extraction, etc.

[0028] The extract may be used as the extracted solution as it is, or, if necessary, may be subjected to treatment such as concentration (vacuum concentration, membrane concentration, etc.), dilution, filtration, decolorization with activated carbon or the like, deodorization, ethanol precipitation, etc., within the scope of the effects of the present invention. Furthermore, the extracted solution may be subjected to treatment such as concentration to dryness, spray drying, freeze drying, etc., and used as a dried product.

[0029] In the present invention, the extract may be used as is, or may contain ingredients such as oils and fats, waxes, hydrocarbons, fatty acids, alcohols, esters, surfactants, metal soaps, pH adjusters, preservatives, fragrances, moisturizers, powders, UV absorbers, thickeners, pigments, antioxidants, whitening agents, chelating agents, excipients, coating agents, sweeteners, and acidulants, which are used in cosmetics, quasi-drugs, pharmaceuticals, foods, etc., within a range that does not impair the effects of the extract.

[0030] The present invention can be used for any of cosmetics, quasi-drugs, pharmaceuticals, and foods, and examples of dosage forms thereof include lotions, creams, emulsions, gels, aerosols, essences, packs, cleansers, bath additives, foundations, dusting powders, lipsticks, ointments, poultices, candy tablets, chocolates, gums, candies, beverages, powders, granules, tablets, sugar-coated tablets, capsules, syrups, pills, suspensions, liquids, emulsions, suppositories, and solutions for injection.

[0031] For external use, the content of the extract used in the present invention is preferably 0.000001% by weight or more, more preferably 0.00001 to 5% by weight, calculated as solid matter. Furthermore, 0.0001 to 1% by weight is most preferable. If it is less than 0.000001% by weight, it is difficult to expect a sufficient effect. If it exceeds 5% by weight, it is difficult to see an enhancement of the effect, which is uneconomical.

[0032] For internal use, the dosage varies depending on age, body weight, symptoms, therapeutic effect, administration method, treatment time, etc. Generally, the daily dosage per adult is preferably 5 mg or more, more preferably 10 mg to 5 g, and most preferably 20 mg to 2 g.

[0033] In the following, in order to explain the present invention in detail, production examples, formulation examples, and experimental examples of the extract used in the present invention are given as examples, but the present invention is not limited to these. In the production examples, % means % by weight, and in the formulation examples, parts of the content means parts by weight. [Example]

[0034] Example of manufacturing Kochia extract An extract of Kochia scoparia was produced as follows: In Production Examples 1 to 8, Kochia scoparia fruit was used as the extraction material.

[0035] (Production Example 1) Preparation of hot water extract of Kochia 200 mL of water was added to 10 g of dried Kochia angustifolium, and extraction was carried out for 2 hours at 90 to 100° C. The resulting extract was filtered, and the filtrate was concentrated and freeze-dried to obtain 1.5 g of a hot water extract of Kochia angustifolium.

[0036] (Production Example 2) Preparation of 50% ethanol extract of Kochia 10 g of dried Kochia serrata was soaked in 200 mL of 50% ethanol solution at room temperature for 7 days for extraction. The resulting extract was filtered and then concentrated to dryness using an evaporator to obtain 1.3 g of 50% ethanol extract of Kochia serrata.

[0037] (Production Example 3) Preparation of ethanol extract of Kochia 10 g of dried Kochia japonica was soaked in 200 mL of ethanol at room temperature for 7 days for extraction. The resulting extract was filtered and then concentrated to dryness using an evaporator to obtain 0.076 g of ethanol extract of Kochia japonica.

[0038] (Production Example 4) Preparation of 1,3-butylene glycol extract of Kochia 10 g of dried Kochia serrata was soaked in 200 mL of 1,3-butylene glycol at room temperature for 7 days for extraction. The resulting extract was filtered to obtain 193 g of 1,3-butylene glycol extract of Kochia serrata.

[0039] (Production Example 5) Preparation of a hot water extract of dry-heat-treated Kochia The Kochia scoparia were evenly arranged on a stainless steel tray and dry-heated at 180°C for 15 minutes under a fan. 200 mL of water was added to 10 g of the dry-heat-treated Kochia scoparia, and the mixture was extracted at 90-100°C for 2 hours. The resulting extract was filtered, and the filtrate was concentrated and freeze-dried to obtain 1.5 g of a hot water extract of dry-heat-treated Kochia scoparia.

[0040] (Production Example 6) Preparation of 50% ethanol extract of dry-heat-treated Kochia 10 g of Kochia sieboldii that had been dry-heated in the same manner as in Production Example 5 was immersed in 200 mL of 50% aqueous ethanol solution at room temperature for 7 days to perform extraction. The resulting extract was filtered and then concentrated to dryness using an evaporator to obtain 0.9 g of a 50% ethanol extract of Kochia sieboldii that had been dry-heated.

[0041] (Production Example 7) Preparation of ethanol extract of dry-heat-treated Kochia 10 g of Kochia sieboldii that had been dry-heated in the same manner as in Production Example 5 was immersed in 200 mL of ethanol at room temperature for 7 days to perform extraction. The resulting extract was filtered and then concentrated to dryness using an evaporator to obtain 0.067 g of an ethanol extract of Kochia sieboldii that had been dry-heated.

[0042] (Production Example 8) Preparation of 1,3-butylene glycol extract of dry-heat-treated Kochia 10 g of Kochia sieboldii that had been dry-heated in the same manner as in Production Example 5 was immersed in 200 mL of 1,3-butylene glycol at room temperature for 7 days to perform extraction. The resulting extract was filtered to obtain 192 g of a 1,3-butylene glycol extract of Kochia sieboldii that had been dry-heated. [Example]

[0043] (Formulation example 1) Lotion Prescription Content (parts) 1. Hot water extract of Kochia japonica (Production Example 1) 0.1 2.1,3-Butylene Glycol 8.0 3. Glycerin 2.0 4. Xanthan gum 0.02 5. Citric acid 0.01 6. Sodium citrate 0.1 7. Ethanol 5.0 8. Methyl parahydroxybenzoate 0.1 9. Polyoxyethylene hydrogenated castor oil (40E.O.) 0.1 10.Fragrance (appropriate amount) 11. Add purified water to make the total volume 100 [Manufacturing method] Components 1 to 6 and 11 are dissolved uniformly, and components 7 to 10 are dissolved uniformly. The mixture is then mixed and filtered to obtain the product.

[0044] (Comparative Formulation Example 1) Conventional lotion A conventional lotion was prepared by replacing the hot water extract of Kochia spp. in Formulation Example 1 with purified water.

[0045] (Formulation example 2) Cream Prescription Content (parts) 1. Dry-heat treated broom tree 50% ethanol extract (Production Example 6) 1.0 2. Squalane 5.5 3. Olive Oil 3.0 4. Stearic Acid 2.0 5. Beeswax 2.0 6. Octyldodecyl myristate 3.5 7. Polyoxyethylene cetyl ether (20E.O.) 3.0 8. Behenyl alcohol 1.5 9. Glyceryl monostearate 2.5 10.Fragrance 0.1 11. Methyl parahydroxybenzoate 0.2 12.1,3-butylene glycol 8.5 13. Add purified water to make the total volume 100 [Manufacturing Method] Heat, dissolve, and mix ingredients 2-9, then maintain at 70°C to form the oil phase. Heat, dissolve, and mix ingredients 1 and 11-13, then maintain at 75°C to form the water phase. Add the water phase to the oil phase and emulsify, then cool with stirring. Add ingredient 10 at 45°C, then cool further to 30°C to form the final product.

[0046] (Formulation Example 3) Emulsion Prescription Content (parts) 1. Ethanol extract of Kochia japonica (Production Example 3) 0.01 2. Squalane 5.0 3. Olive oil 5.0 4. Jojoba oil 5.0 5. Cetyl alcohol 1.5 6. Glyceryl Monostearate 2.0 7. Polyoxyethylene cetyl ether (20E.O.) 3.0 8. Polyoxyethylene sorbitan monooleate (20E.O.) 2.0 9.Fragrance 0.1 10. Propylene Glycol 1.0 11. Glycerin 2.0 12. Methyl parahydroxybenzoate 0.2 13. Add purified water to make the total volume 100 [Manufacturing Method] Heat, dissolve, and mix ingredients 1-8, then maintain at 70°C to form the oil phase. Heat, dissolve, and mix ingredients 10-13, then maintain at 75°C to form the water phase. Add the water phase to the oil phase and emulsify, then cool with stirring. Add ingredient 9 at 45°C, then cool to 30°C to form the final product.

[0047] (Formulation Example 4) Gel Prescription Content (parts) 1. Dry-heat treated broom tree 1,3-butylene glycol extract (Production Example 8) 1.0 2. Ethanol 5.0 3. Methyl parahydroxybenzoate 0.1 4. Polyoxyethylene hydrogenated castor oil (60E.O.) 0.1 5.Fragrance (appropriate amount) 6. 1,3-Butylene Glycol 5.0 7. Glycerin 5.0 8. Xanthan gum 0.1 9. Carboxyvinyl polymer 0.2 10. Potassium hydroxide 0.2 11. Add purified water to make the total volume 100 [Manufacturing method] Components 2 to 5, 1, and 6 to 11 are each dissolved uniformly, and then mixed to form the product.

[0048] (Prescription Example 5) Pack Prescription Content (parts) 1. Hot water extract of dry-heat-treated Kochia japonica (Production Example 5) 1.0 2. 1,3-butylene glycol extract of Kochia serrata (Production Example 4) 5.0 3. Polyvinyl alcohol 12.0 4. Ethanol 5.0 5. 1,3-Butylene Glycol 8.0 6. Methyl parahydroxybenzoate 0.2 7. Polyoxyethylene hydrogenated castor oil (20E.O.) 0.5 8. Citric acid 0.1 9. Sodium citrate 0.3 10.Fragrance (appropriate amount) 11. Add purified water to make the total volume 100 [Manufacturing method] Components 1 to 11 are dissolved uniformly to produce the product.

[0049] (Formulation Example 6) Foundation Prescription Content (parts) 1. 50% ethanol extract of Kochia japonica (Production Example 2) 1.0 2. Stearic acid 2.4 3. Polyoxyethylene sorbitan monostearate (20E.O.) 1.0 4. Polyoxyethylene cetyl ether (20E.O.) 2.0 5. Cetyl alcohol 1.0 6. Liquid Lanolin 2.0 7. Liquid Paraffin 3.0 8. Isopropyl myristate 6.5 9. Sodium carboxymethylcellulose 0.1 10. Bentonite 0.5 11. Propylene Glycol 4.0 12. Triethanolamine 1.1 13. Methyl parahydroxybenzoate 0.2 14. Titanium dioxide 8.0 15. Talc 4.0 16. Bengala 1.0 17. Yellow Iron Oxide 2.0 18.Fragrance (appropriate amount) 19. Add purified water to make the total volume 100 [Manufacturing Method] Heat and dissolve ingredients 2-8 and maintain at 80°C to form the oil phase. Ingredient 9 is thoroughly swelled in ingredient 19, and then ingredients 1 and 10-13 are added and mixed uniformly. To this, ingredients 14-17, which have been pulverized and mixed in a grinder, are added, and the mixture is stirred in a homomixer and maintained at 75°C to form the water phase. The water phase is added to the oil phase while stirring, and emulsified. After that, cool, add ingredient 18 at 45°C, and cool to 30°C while stirring to form the final product.

[0050] (Formulation Example 7) Bath additive Prescription Content (parts) 1. Dry-heat treated broom tree Ethanol extract (Production Example 7) 1.0 2. Sodium bicarbonate 50.0 3. Yellow No. 202 (1) appropriate amount 4.Fragrance (appropriate amount) 5. Add sodium sulfate to make the total volume 100 [Manufacturing method] Mix ingredients 1 to 5 uniformly to make the product.

[0051] (Prescription Example 8) Ointment Prescription Content (parts) 1. Hot water extract of Kochia japonica (Production Example 1) 5.0 2. Dry-heat-treated broom tree 1,3-butylene glycol extract (Production Example 8) 1.0 3. Polyoxyethylene cetyl ether (30E.O.) 2.0 4. Glyceryl monostearate 10.0 5. Liquid Paraffin 5.0 6. Cetyl alcohol 6.0 7. Methyl parahydroxybenzoate 0.1 8. Propylene Glycol 10.0 9. Add purified water to make the total volume 100 [Manufacturing Method] Heat, dissolve, and mix ingredients 3-6, then maintain at 70°C to form the oil phase. Heat, dissolve, and mix ingredients 1, 2, and 7-9, then maintain at 75°C to form the water phase. Add the water phase to the oil phase and emulsify, then cool to 30°C while stirring to form the final product.

[0052] (Prescription Example 9) Powder Prescription Content (parts) 1. Hot water extract of dry-heat-treated Kochia japonica (Production Example 1) 1.0 2.Dry cornstarch 39.0 3. Microcrystalline cellulose 60.0 [Manufacturing method] Mix ingredients 1 to 3 to form a powder.

[0053] (Prescription Example 10) Tablets Prescription Content (parts) 1. Ethanol extract of Kochia japonica (Production Example 3) 5.0 2.Dry cornstarch 25.0 3. Calcium carboxymethylcellulose 20.0 4. Microcrystalline cellulose 40.0 5. Polyvinylpyrrolidone 7.0 6. Talc 3.0 [Manufacturing Method] Components 1 to 4 are mixed, and then an aqueous solution of component 5 is added as a binder to form granules. Component 6 is added to the formed granules and compressed into tablets. Each tablet weighs 0.52 g.

[0054] (Prescription Example 11) Tablets Prescription Content (parts) 1. Dry-heat treated broom tree Ethanol extract (Production Example 7) 2.0 2. Dry cornstarch 49.8 3. Erythritol 40.0 4. Citric acid 5.0 5. Sucrose fatty acid ester 3.0 6.Fragrance 0.1 7.Purified water 0.1 [Manufacturing method] Mix ingredients 1 to 4 and 7 and form into granules. Add ingredients 5 and 6 to the formed granules and compress into tablets. Each tablet weighs 1.0 g.

[0055] (Formulation Example 12) Beverage Prescription Content (parts) 1. Hot water extract of Kochia japonica (Production Example 1) 0.05 2. Stevia 0.05 3. Malic acid 5.0 4.Fragrance 0.1 5. Add purified water to make the total volume 100 [Manufacturing Method] Dissolve ingredients 1 to 3 in a small amount of water. Then add ingredients 4 and 5 and mix.

[0056] Next, experimental examples will be given to explain the effects of the present invention in detail. [Example]

[0057] Experimental Example 1 Measurement of mRNA expression levels of MMP-1, MMP-2, hyaluronic acid synthase 2 (HAS2), and type I collagen (COL1A1) The mRNA expression levels of MMP-1, MMP-2, HAS2, and COL1A1 were measured. Human dermal fibroblasts were cultured in a 60 mm dish at 1 × 10 5Cells were seeded and cultured in DMEM medium containing 10% FBS at 37°C under 5% CO2 conditions. When the cells reached confluence, they were cultured in DMEM(-) medium supplemented with each sample at a final concentration of 1, 10, or 100 μg / mL for 24 hours, after which total RNA was extracted. Total RNA was extracted from the cells using RNAiso Plus (Takara Bio), and total RNA content was determined by absorbance at 260 nm using a Nanodrop spectrophotometer. mRNA expression levels were measured by real-time RT-PCR using the total RNA extracted from the cells. For real-time RT-PCR, a High Capacity RNA-to-cDNA Kit (Applied Biosystems) and SYBR Select Master Mix (Applied Biosystems) were used. 500 ng of total RNA was reverse transcribed and then subjected to PCR (95°C for 15 seconds, 60°C for 60 seconds, 40 cycles). Other procedures were performed according to established methods, and the expression levels of MMP-1, MMP-2, HAS2, and COL1A1 mRNA were calculated as a percentage of the expression level of GAPDH mRNA, an internal standard. The MMP-1 expression inhibition rate was calculated as the ratio of the MMP-1 mRNA expression level in the sample-added group to the MMP-1 mRNA expression level in the control (no sample added) group. The MMP-2 expression inhibition rate, HAS2 expression promotion rate, and COL1A1 expression promotion rate were calculated in the same way. The primers used to measure the expression level of each gene are as follows.

[0058] Primer set for MMP-1 GGGAGATCATCGGGACAACTC (SEQ ID NO: 1) TGAGCATCCCCTCCAATACC (SEQ ID NO: 2) Primer set for MMP-2 CCGTCGCCCATCATCAA (SEQ ID NO: 3) CTTCTGCATCTTCTTTAGTGTGTCCTT (SEQ ID NO: 4) Primer set for HAS2 TGGATGACCTACGAAGCGATTA (SEQ ID NO: 5) GCTGGATTACTGTGGCAATGAG (SEQ ID NO: 6) Primer set for COL1A1 AGGACAAGAGGCATGTCTGGTT (SEQ ID NO: 7) TTGCAGTGGTAGGTGATGTTCTG (SEQ ID NO: 8) Primer set for GAPDH TGCACCACCAACTGCTTAGC (SEQ ID NO: 9) TCTTCTGGGTGGCAGTGATG (SEQ ID NO: 10)

[0059] The results of these experiments are shown in Tables 1 to 4. As a result, the Kochia angustifolium extract of the present invention was found to have excellent MMP-1 expression inhibitory effects (MMP-1 inhibitory effect), MMP-2 expression inhibitory effects (MMP-2 inhibitory effect), HAS2 expression promoting effects (hyaluronic acid production promoting effect), and COL1A1 expression promoting effects (collagen production promoting effect). In particular, the 50% ethanol extract of Kochia angustifolium (Production Example 2) was significantly more effective in promoting HAS2 expression. Furthermore, the hot water extract of Kochia angustifolium that had been dry-heat-treated (Production Example 5) and the 50% ethanol extract of Kochia angustifolium that had been dry-heat-treated (Production Example 6) were found to have significantly enhanced HAS2 expression promoting effects compared to the extract of Kochia angustifolium that had not been dry-heat-treated.

[0060] [Table 1]

[0061] [Table 2]

[0062] [Table 3]

[0063] [Table 4]

[0064] Experimental Example 2 Cell proliferation promotion test Human keratinocytes were cultured in DMEM culture medium containing 0.1% FBS at 1 × 10 per well in a 96-well plate. 3 After seeding, each sample was added to a final concentration of 0.01 μg / mL and cultured for 5 days at 37°C under 5% CO2. Cell counts were measured using a staining method. After culture, the culture medium was removed and the cells were fixed with methanol. Next, 0.1% methylene blue was added and the cells were stained for 1 hour. After drying, 100 μL of 0.1 N HCl was added to each well and mixed well. The absorbance at 650 nm was measured using a microplate reader. The cell proliferation rate was calculated as the ratio of the cell mass in the sample-added group to the cell mass in the control (no sample added) group.

[0065] The results of these experiments are shown in Table 5. As a result, the Kochia angustifolium extract of the present invention exhibited an excellent cell proliferation promoting effect.

[0066] [Table 5]

[0067] Experimental Example 3: Usage test The feel of the lotion when used with Formulation Example 1 of the present invention and Comparative Formulation Example 1 was evaluated.

[0068] Each sample was used blindly by a group of five panelists, and the sensation of use of Formulation Example 1 and Comparative Formulation Example 1 was compared, and the presence or absence of skin troubles was also evaluated.

[0069] As a result, the lotion obtained from Formulation Example 1 had a better feel when used than Comparative Formulation Example 1 and could be used safely without causing any skin troubles. There were also no problems with deterioration of the formulation ingredients. [Industrial Applicability]

[0070] From the above, it can be seen that the Kochia spp. extract of the present invention has excellent cell proliferation promoting effects, hyaluronic acid production promoting effects, MMP inhibitory effects, and collagen production promoting effects. In particular, the Kochia spp. extract subjected to dry heat treatment had unexpectedly remarkable effects on hyaluronic acid production promoting effects, MMP inhibitory effects, and collagen production promoting effects. Furthermore, these extracts also had excellent stability. Therefore, the Kochia spp. extract of the present invention can be used not only in the cosmetic field, such as skin aging, but also in the medical field, such as suppressing functional decline due to aging, preventing and treating cancer, and is expected to be applied to cosmetics, foods, quasi-drugs, pharmaceuticals, etc.

Claims

1. A topical skin preparation containing, as an active ingredient, an extract obtained from Kochia japonica that has been dry-heated at a temperature of 80°C or higher, characterized in that the topical skin preparation is used for one or more purposes selected from the group consisting of promoting hyaluronic acid production, inhibiting MMP, and promoting collagen production.

2. A pharmaceutical product containing as its active ingredient an extract obtained from Kochia japonica that has been dry-heated at a temperature of 80°C or higher, said pharmaceutical product being used to prevent and / or improve one or more diseases or symptoms selected from the group consisting of various diseases or symptoms caused by a decrease in hyaluronic acid content, various diseases or symptoms caused by increased MMP, and various diseases or symptoms caused by a decrease in collagen production ability.

3. This food contains as an active ingredient an extract obtained from Kochia that has been dry-heated at a temperature of 80°C or higher, and is used to prevent and / or improve one or more diseases or symptoms selected from the group consisting of various diseases or symptoms caused by a decrease in hyaluronic acid content, various diseases or symptoms caused by increased MMP, and various diseases or symptoms caused by a decrease in collagen production ability.

4. A topical skin preparation containing an extract of Kochia japonica as an active ingredient, characterized in that the topical skin preparation is used for one or more purposes selected from the group consisting of promoting cell proliferation, promoting hyaluronic acid production, inhibiting MMP, and promoting collagen production.

5. A pharmaceutical containing an extract of Kochia japonica as an active ingredient, for preventing and / or improving one or more diseases or symptoms selected from the group consisting of various diseases or symptoms caused by decreased cell proliferation ability, various diseases or symptoms caused by decreased hyaluronic acid content, various diseases or symptoms caused by increased MMP, and various diseases or symptoms caused by decreased collagen production ability.

6. This food contains an extract of Kochia japonica as an active ingredient, and is used to prevent and / or improve one or more diseases or symptoms selected from the group consisting of various diseases or symptoms caused by a decrease in cell proliferation ability, various diseases or symptoms caused by a decrease in hyaluronic acid content, various diseases or symptoms caused by an increase in MMP, and various diseases or symptoms caused by a decrease in collagen production ability.

Images