Detection method for testing using vesicles derived from klebsiella pneumoniae as indicator, composition for testing, test kit, pharmaceutical composition, and screening method

The method and composition utilize Klebsiella pneumoniae-derived vesicles as markers for diagnosing and treating immune and cancer-related conditions, addressing the lack of diagnostic markers and enhancing immune activation and disease treatment.

JP2025173499APending Publication Date: 2025-11-27KEIO UNIV +2
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
JP2025080852
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-05-14
Filing Date
2025-05-14
Publication Date
2025-11-27

AI Technical Summary

Technical Problem

Existing technologies do not effectively utilize Klebsiella pneumoniae-derived extracellular vesicles (bEVs) as markers for diagnosing innate immune function, infectious diseases, or cancer, and there is a lack of understanding about their relationship with disease progression.

Method used

A method and composition for detecting vesicles derived from Klebsiella pneumoniae using specific biomarkers, such as small RNA (SEQ ID NO: 1), to assess innate immune function, infectious diseases, or cancer, and a pharmaceutical composition with antibacterial agents to activate immune function or treat diseases.

Benefits of technology

Enables accurate testing and treatment of innate immune function, infectious diseases, and cancer by using Klebsiella pneumoniae-derived vesicles as indicators, and enhances immune activation and disease prevention or treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025173499000001_ABST
    Figure 2025173499000001_ABST
Patent Text Reader

Abstract

To provide a novel technique for testing innate immune function, an infectious disease, or cancer.SOLUTION: A detection method comprising analyzing a sample obtained from an animal serving as a test subject and detecting vesicles derived from Klebsiella pneumoniae, the vesicles being used as an indicator for examining innate immune function, an infectious disease, cancer, or a liver disease in the animal.SELECTED DRAWING: Figure 5
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a technique for detecting bacterial-derived extracellular vesicles as markers for the examination of disease or health conditions. [Background technology]

[0002] As the close relationship between the human intestinal microbiota and disease has become clear, metagenomic analysis techniques have been used extensively to study the human intestinal microbiota. For example, in addition to colon-related diseases, associations between the human intestinal microbiota and lifestyle- and diet-related conditions such as obesity, diabetes, various autoimmune diseases, colon cancer, liver cancer, renal failure, heart failure, neurological disorders, and mental and brain functions such as autism have been reported. Recent research has revealed that the structure of the intestinal microbiota is involved in the function of the entire body, regardless of the organ. Focusing on the relationship between the intestinal microbiota and disease is expected to lead to new and innovative treatments and prevention strategies for various diseases.

[0003] In this context, it has become clear that bacteria secrete extracellular vesicles (EVs) composed of lipid bilayer membranes, which can be detected in the blood and urine of their human hosts. These EVs are known as membrane vesicles (MVs) or bacterial extracellular vesicles (bEVs) (collectively referred to as "bEVs" in this specification). Recently, technologies have been proposed to diagnose human health and disease using MVs as indicators.

[0004] For example, Patent Document 1 discloses a technology for diagnosing gastric cancer, colon cancer, pancreatic cancer, bile duct cancer, breast cancer, ovarian cancer, bladder cancer, prostate cancer, head and neck cancer, lymphoma, cardiomyopathy, atrial fibrillation, variant angina, chronic obstructive pulmonary disease, stroke, diabetes, renal failure, dementia, Parkinson's disease, or depression by extracting DNA from bEV isolated from a subject sample and performing 16S rDNA analysis.

[0005] Klebsiella pneumoniae is a commensal bacterium that colonizes human mucosal surfaces, the gastrointestinal tract, and the oropharynx. However, in elderly patients, it can cause severe infections, such as pneumonia, urinary tract infections, and liver abscesses. Recent studies have shown that an age-related decrease in intestinal gas6 secretion allows Klebsiella pneumoniae to invade the intestinal epithelium and subsequently migrate to the liver (Non-Patent Document 1). However, whether Klebsiella pneumoniae can be pathogenic in individuals with intact intestinal mucosa and the relationship between the bEVs released by Klebsiella pneumoniae and disease or health status remain unknown.

[0006] Various techniques for testing the immunity of a subject have been proposed. Patent Document 2 discloses a technique for detecting Candidamannan antigen contained in saliva by immunoassay to test the strength of immunity. Patent Document 3 discloses a method for evaluating immunity based on immune cell markers such as T cell count, T cell proliferation index, CD4 T cell / CD8 T cell ratio, naive T cell count, naive T cell / memory T cell ratio, IL-2 cytokine production ability, IFN-γ cytokine production ability, IL-4 cytokine production ability, B cell count, and NK cell count.

[0007] Various liver disease testing techniques have also been proposed. Tests using AST, ALT, and γ-GTP, which are released into the blood when liver cells are destroyed, as indicators, are commonly performed in health checkups and the like. Patent Document 4 also discloses a liver disease testing method for determining the stage of liver fibrosis based on the measured value of AGP bound to a lectin selected from AOL and MAL. [Prior art documents] [Patent documents]

[0008] [Patent Document 1] Patent Publication No. 2021-168683 [Patent Document 2] Japanese Patent Application Laid-Open No. 2017-129456 [Patent Document 3] Re-tabled publication No. 2007 / 145333 [Patent Document 4] Japanese Patent Application Laid-Open No. 2012-185172 [Non-patent literature]

[0009] [Non-Patent Document 1] PLoS Pathog 19(6):e1011139.https: / / doi.org / 10.1371 / journal.ppat.1011139 Summary of the Invention [Problem to be solved by the invention]

[0010] An object of the present invention is to provide a novel technique for examining innate immune function, infectious diseases, or cancer. [Means for solving the problem]

[0011] As a result of the intensive research efforts of the present inventors, it has been revealed that extracellular vesicles secreted by Klebsiella pneumoniae affect innate immune function and promote the progression of cancer. Based on this finding, the present inventors have completed the following inventions.

[0012] [Item 1] To examine innate immune function, infectious diseases, or cancer in animals using vesicles derived from Klebsiella pneumoniae as an indicator, and analyzing a sample obtained from the test subject to detect the vesicles.

[0013] [Item 2] The detection method according to Item 1, wherein the detection of the vesicles is carried out by detecting a biomolecule derived from Klebsiella pneumoniae.

[0014] [Item 3] The detection method according to Item 2, wherein the biomolecule is a small RNA represented by SEQ ID NO: 1. SEQ ID NO: 1: agucccugcggauggagcugagaccagucgaag

[0015] [Item 4] The detection method according to Item 1, wherein the sample is a blood sample.

[0016] [Item 5] The innate immune function is a pathogen elimination function by macrophages, the infectious disease is an infection in the lungs, liver, spine, or kidneys; Item 2. The method for detecting cancer according to Item 1, wherein the cancer is liver cancer.

[0017] [Item 6] A method of analyzing a sample obtained from a test subject to detect vesicles derived from Klebsiella pneumoniae and comparing the result with one or more criteria selected from the group consisting of (a) to (c) below. (a) If vesicles derived from Klebsiella pneumoniae are detected, innate immune function is weakened. (b) If vesicles derived from Klebsiella pneumoniae are detected, the subject has an infectious disease, is at high risk of having an infectious disease, or has a high severity of an infectious disease. (c) If vesicles derived from Klebsiella pneumoniae are detected, the patient has cancer, is at high risk of having cancer, or has a high severity of cancer.

[0018] [Item 7] A testing composition for testing innate immune function, infectious diseases, or cancer, comprising a detection reagent for detecting vesicles derived from Klebsiella pneumoniae.

[0019] [Item 8] The testing composition according to Item 7, wherein the detection reagent detects a biomolecule derived from Klebsiella pneumoniae.

[0020] [Item 9] The composition for testing according to Item 8, wherein the biomolecule is a small RNA represented by SEQ ID NO: 1. SEQ ID NO: 1: agucccugcggauggagcugagaccagucgaag

[0021] [Item 10] An instrument or reagent for separating extracellular vesicles from a sample obtained from a test subject; a detection reagent for detecting vesicles derived from Klebsiella pneumoniae; A test kit including:

[0022] [Item 11] A pharmaceutical composition containing an antibacterial agent against Klebsiella pneumoniae as an active ingredient, which is used for activating innate immune function, preventing or treating infectious diseases, or preventing or treating cancer.

[0023] [Item 12] The pharmaceutical composition according to Item 11, wherein the antibacterial agent is a third-generation cephalosporin, cefepime, a carbapenem, a fluoroquinolone, piperacillin / tazobactam, or an aminoglycoside.

[0024] [Item 13] The pharmaceutical composition according to Item 12, which is administered to a subject in whose body vesicles derived from Klebsiella pneumoniae have been detected.

[0025] [Item 14] A method for screening an active ingredient of a pharmaceutical composition used for activating natural immune function, preventing or treating infectious diseases, or preventing or treating cancer, comprising: A screening method comprising applying a candidate substance to Klebsiella pneumoniae and determining that the candidate substance is effective when it exhibits a growth inhibitory effect, a bactericidal effect, or a vesicle secretion inhibitory effect against the bacterium. [Effects of the Invention]

[0026] The detection methods, comparison methods, testing compositions, and testing kits of the present invention enable testing of innate immune function, infectious diseases, or cancer in animals as test subjects. The pharmaceutical compositions of the present invention can achieve activation of innate immune function, prevention or treatment of infectious diseases, or prevention or treatment of cancer. Furthermore, the screening methods of the present invention can screen for active ingredients of pharmaceutical compositions used for activation of innate immune function, prevention or treatment of infectious diseases, or prevention or treatment of cancer. [Brief explanation of the drawings]

[0027] [Figure 1] Macrophages cultured under Kp-bEV(-) or Kp-bEV(+) conditions were co-stained with CD206 and Ki67, and photographs taken with a fluorescence microscope are shown. [Figure 2] The graph shows the results of flow cytometry analysis of macrophages cultured under Kp-bEV(-) or Kp-bEV(+) conditions, stained with anti-CD206 antibody as the primary antibody and fluorescently labeled antibody as the secondary antibody. [Figure 3] The graph shows the results of flow cytometry analysis of macrophages cultured under Kp-bEV(-) or Kp-bEV(+) conditions, stained with anti-CD206 antibody as the primary antibody and fluorescently labeled antibody as the secondary antibody. [Figure 4] 1 shows a graph showing the phagocytic activity of macrophages cultured under Kp-bEV(-) or Kp-bEV(+) conditions. [Figure 5] 1 is a graph showing the amount of IL-1β produced in macrophages cultured in a Kp-bEV(-) or Kp-bEV(+) environment under Klebsiella pneumoniae infection or non-infection. [Figure 6] This is a graph showing the evaluation of cell death in macrophages cultured in a Kp-bEV(-) or Kp-bEV(+) environment, with or without infection with Klebsiella pneumoniae, based on the amount of LDH released. [Figure 7]1 is a graph showing the expression level of iNOS in macrophages cultured in a Kp-bEV(-) or Kp-bEV(+) environment under Klebsiella pneumoniae infection or non-infection. [Figure 8] This is an in vivo imaging image visualizing the accumulation of Kp-bEVs. [Figure 9] This is an image visualizing the accumulation of Kp-bEV in the liver. [Figure 10] This is an imaging image visualizing the accumulation of Kp-bEV in embryos. [Figure 11] This is an imaging image visualizing the accumulation of Kp-bEV in the spine. [Figure 12] This is an imaging image visualizing the accumulation of Kp-bEV in the kidney. [Figure 13] 1 is a graph showing the viable cell count of Klebsiella pneumoniae in the cecal mucosa in the presence or absence of Kp-bEV. [Figure 14] 1 is a graph showing the viable cell count of Klebsiella pneumoniae in the liver in the presence or absence of Kp-bEV. [Figure 15] 1 is a graph showing the number of viable Klebsiella pneumoniae bacteria in the lungs in the presence or absence of Kp-bEV. [Figure 16] The data show an evaluation of the state of cancer in livers excised from untreated (NC) and model mice intravenously administered Kp-bEV. The top row is a photograph of a liver excised from a liver disease model mouse. The bottom left is a graph showing the number of tumors in the excised liver, and the bottom right is a graph showing the maximum diameter of the tumors. DETAILED DESCRIPTION OF THE INVENTION

[0028] The present invention will be described in detail below by way of example. In the embodiments of the present invention, A (or numerical value) to B (numerical value) means A or more and B or less. Furthermore, the preferred embodiments and more preferred embodiments exemplified below can be used in appropriate combinations with each other, regardless of expressions such as "for example," "one," "preferably," and "more preferable." Furthermore, the descriptions of numerical ranges are merely examples, and ranges obtained by appropriately combining the upper and lower limits of each range and the numerical values ​​of the examples can also be preferably used (for example, when A to B or C to D is described, the combinations A to D or C to B can be used). Furthermore, terms such as "contain" or "comprise" may be interpreted as "essentially consisting of" or "consisting only of."

[0029] 1. Detection Method Section 1 describes the detection method of the present invention. The detection method of the present invention involves analyzing a sample obtained from a test animal to detect vesicles derived from Klebsiella pneumoniae. The detection method of the present invention is carried out to examine innate immune function, infectious diseases, or cancer in a test animal using vesicles derived from Klebsiella pneumoniae as an indicator.

[0030] In this specification, vesicles secreted by bacteria are sometimes referred to as "bEVs," and vesicles derived from Klebsiella pneumoniae are sometimes referred to as "Kp-bEVs."

[0031] The animals to be tested may be any animals, including humans, dogs, cats, cows, pigs, mice, and rats.

[0032] Examples of specimens include blood, urine, sweat, tears, and feces. Because bEVs circulate in the body via blood, a preferred embodiment involves analyzing a blood specimen. A preferred embodiment includes a sample preparation step in which the specimen is subjected to any treatment to prepare a sample suitable for analysis.

[0033] The specific embodiment of the sample preparation step can be appropriately set depending on the analysis method in the analysis step described below. When analyzing a blood specimen, the sample prepared in the sample preparation step includes whole blood, serum, plasma, and samples prepared by treating these by any treatment method.

[0034] In one embodiment, the sample preparation step includes removing cellular components by centrifugation and / or filtration. When performing filtration, it is preferable to use, for example, a 0.22 μm filter. Samples subjected to such treatment are substantially free of cellular components, such as host blood cell components and bacterial cells. Therefore, Kp-bEV can be detected with high accuracy.

[0035] bEVs encapsulate biomolecules, such as nucleic acids and proteins, from the bacteria they originate from. Therefore, Kp-bEVs can be detected by detecting biomolecules derived from Klebsiella pneumoniae.

[0036] When Kp-bEV is detected based on a protein derived from Klebsiella pneumoniae, an embodiment can be used in which the detection is performed by an immunological method using an antibody specific to the protein.

[0037] When detecting Kp-bEV based on nucleic acids derived from Klebsiella pneumoniae, an embodiment may involve analysis based on the base sequence of the nucleic acid. Specifically, as described above, an extracellular vesicle fraction is obtained by centrifugation or filtration, and DNA or RNA is extracted by standard methods. Kp-bEV can be detected by performing PCR or reverse transcription PCR on this DNA or RNA using primers for base sequences unique to the Klebsiella pneumoniae genome. Alternatively, Kp-bEV can be detected by analyzing the extracted DNA with a next-generation sequencer and performing mapping using the Klebsiella pneumoniae genome as a reference.

[0038] It is known that bEV contains fragmented RNA. Therefore, in the sample preparation process, small RNA fractionation and purification may be performed. By analyzing such a sample, it becomes possible to efficiently detect small RNA.

[0039] Fractionation and purification of small RNAs can be easily performed using commercially available kits, such as ISOSPIN Liquid Sample miRNA (Nippon Gene Co., Ltd.) and PureLink™ miRNA Isolation Kit (Thermo Fisher Scientific).

[0040] This section describes in detail the analysis of small RNAs derived from Klebsiella pneumoniae. Sample analysis methods are not particularly limited as long as they can detect small RNAs derived from Klebsiella pneumoniae. Examples include RT-PCR (qualitative, quantitative, or non-quantitative), microarrays, and Northern blotting. Next-generation sequencing is preferred because it allows simultaneous detection of multiple small RNAs.

[0041] Examples of sequencing technologies include ion semiconductor sequencing, pyrosequencing, sequencing-by-synthesis using reversible dye terminators, sequencing-by-ligation, and oligonucleotide probe ligation sequencing, which are based on sequencing principles other than the Sanger method and can generate a large number of reads per run.

[0042] When RT-PCR is used to detect small RNAs derived from Klebsiella pneumoniae, primers capable of specifically detecting the small RNAs can be used. When a microarray is used to detect small RNAs derived from Klebsiella pneumoniae, a chip on which a nucleic acid having a sequence complementary to the small RNA is immobilized can be used. When Northern blotting is used to detect small RNAs derived from Klebsiella pneumoniae, a probe capable of specifically detecting the small RNA can be used. When a next-generation sequencer is used to detect small RNAs derived from Klebsiella pneumoniae, the bacterial genome may be used as a reference to map the base-called reads.

[0043] The genome information of Klebsiella pneumoniae, which is used as a reference for mapping, can be easily obtained from publicly known databases.

[0044] In this specification, the term "small RNA" refers to RNA of less than 200 bp.

[0045] Small RNA sequencing of RNA extracted from extracellular vesicles obtained from human specimens identified a partial sequence of 23S ribosomal RNA of Klebsiella pneumoniae (SEQ ID NO: 1) as a sequence specific to Klebsiella pneumoniae. SEQ ID NO: 1: agucccugcggauggagcugagaccagucgaag

[0046] The base sequence of SEQ ID NO: 1 has been confirmed to exist in other bacterial species. However, it is highly unlikely that these sequences exist in the human body, or they are extremely rare. Therefore, if the sequence of SEQ ID NO: 1 is detected in the human body (in serum or tissue), it can be said to be derived from Klebsiella pneumoniae.

[0047] As described above, by detecting the small RNA according to SEQ ID NO: 1 by any of the methods described above, Kp-bEV can be specifically detected.

[0048] The detection method of the present invention is carried out to obtain information for testing or diagnosing innate immune function or liver cancer.

[0049] In innate immunity, macrophages are functionally divided into two types: M1 and M2. M1 macrophages are activated by bacterial components such as IFN-γ and LPS upon pathogen infection, strongly express proinflammatory cytokines, and play a role in killing pathogens. On the other hand, M2 macrophages are induced by stimulation with IL-4 and IL-13, similar to Th2 differentiation, and are thought to be involved in suppressing inflammatory responses and tissue repair.

[0050] As described in the experimental example below, Kp-bEV acts on macrophages, increasing the expression of CD206, a marker of M2 phenotype, while also promoting enhanced production of inflammatory cytokines (IL-1β) and improved phagocytic activity, characteristics of M1 phenotype. IL-1β normally induces neutrophils and induces inflammation-induced cell death of macrophages. However, in the presence of Kp-bEV, although enhanced IL-1β production by macrophages is observed, the subsequent inflammation-induced cell death of macrophages is not induced. Furthermore, Kp-bEV suppresses the expression of iNOS by macrophages, even under pathogen infection, thereby weakening the defense mechanism against pathogen infection. In other words, in the presence of Kp-bEV, macrophages exhibit abnormal characteristics that are neither M1 nor M2, and pathogens such as bacteria, viruses, or protozoa that are engulfed by phagocytosis are able to survive and proliferate within the macrophages.

[0051] Based on the above, Kp-bEV can be used as an indicator for testing or diagnosing innate immune function, more specifically, for testing or diagnosing pathogen clearance, including clearance of one or more types of pathogens selected from bacteria, viruses, and protozoa.

[0052] As described in the test examples below, Kp-bEV has the function of increasing the infection efficiency of pathogens in various tissues. Therefore, Kp-bEV can be used as an indicator for testing or diagnosing infectious diseases. That is, Kp-bEV can be used as a marker to test or diagnose the presence or absence of infectious diseases, the risk of contracting infectious diseases, or the severity of infectious diseases.

[0053] The infectious diseases to be tested or diagnosed include one or more selected from bacterial infections, viral infections, and protozoan infections.

[0054] Examples of bacterial infections include respiratory tract infections, urinary tract infections, respiratory tract infections, intraperitoneal infections, sepsis, nephritis, cholecystitis, oral infections, endocarditis, infective endocarditis, pneumonia, osteomyelitis, otitis media, enteritis, empyema, wound infections, opportunistic infections, deep skin infections, lymphangitis and lymphadenitis, secondary infections from trauma, burns, and surgical wounds, osteomyelitis, arthritis, pharyngitis and laryngitis, tonsillitis (peritonsillitis, tonsillitis), and other infections. These include peripyelonephritis (including peripyelonephritis), lung tumors, empyema, secondary infections of chronic respiratory diseases, complicated cystitis, pyelonephritis, prostatitis (acute and chronic), epididymitis, peritonitis, intraperitoneal tumors, cholangitis, liver tumors, intrauterine infections, uterine adnexitis, parametritis, purulent meningitis, orbital infections, keratitis (including corneal ulcers), endophthalmitis (including protophthalmitis), cellulitis around the jawbone, and jaw inflammation.

[0055] Examples of bacterial species that can cause infectious diseases include Escherichia coli, Klebsiella, Serratia, Enterobacter, Citrobacter, Morganella, Providencia, Proteus, Haemophilus, Moraxella, Pseudomonas, Stenotrophomonas, Burkholderia, and Acinetobacter. Another preferred embodiment includes a bacterial infection caused by a bacterial species selected from the group consisting of Klebsiella pneumoniae, Escherichia coli, Enterobacter cloacae, Enterobacter cloacae complex, Enterobacter aerogenes, Citrobacter freundii, Citrobacter freundii complex, Serratia marcescens, Pseudomonas aeruginosa, and Acinetobacter baumannii.

[0056] In one embodiment, Kp-bEV is used as a marker to examine or diagnose infectious diseases of the lungs, liver, spine, and kidneys, including pneumonia as an infectious disease of the lung, liver abscess as an infectious disease of the liver, pyogenic spondylitis as an infectious disease of the spine, and pyelonephritis as an infectious disease of the kidney.

[0057] As shown in the test examples below, Kp-bEV has the function of promoting carcinogenesis. Therefore, Kp-bEV can be used as a marker for cancer testing or diagnosis. That is, Kp-bEV can be used as a marker to test or diagnose the presence or absence of cancer, the risk of developing cancer, or the severity of cancer.

[0058] The type of cancer to be tested or diagnosed is one or more selected from liver cancer, lung cancer, kidney cancer, spinal tumor, chondrosarcoma, esophageal cancer, gastric cancer, biliary tract cancer, pancreatic cancer, colon cancer, breast cancer, prostate cancer, bladder cancer, testicular cancer, renal pelvis and ureter cancer, penile cancer, retroperitoneal tumor, adrenal cancer, head and neck cancer, thyroid cancer, uterine cancer, ovarian cancer, skin cancer, lymphoma, multiple myeloma, and leukemia.

[0059] In a preferred embodiment, the type of cancer to be examined or diagnosed is one or more types selected from liver cancer, lung cancer, kidney cancer, and spinal tumors.

[0060] Furthermore, as described in the test examples below, Kp-bEV is strongly involved in the increase in the number and diameter of liver cancer tumors. Therefore, Kp-bEV can be used as an indicator for examining or diagnosing liver cancer. That is, Kp-bEV can be used as a marker to examine or diagnose the risk of liver cancer or the severity of liver cancer.

[0061] The type of liver cancer to be tested or diagnosed is not particularly limited, but liver cancer that develops as a result of progression from non-alcoholic steatohepatitis (NASH) / non-alcoholic fatty liver disease (NAFLD) is particularly preferred.

[0062] The present invention may be embodied in such a way that the detection result of Kp-bEV is compared with a certain standard. Specifically, a sample obtained from a test subject is analyzed to detect Kp-bEV, and the result is compared with one or more standards selected from the group consisting of the following (a) to (c): (a) If vesicles derived from Klebsiella pneumoniae are detected, innate immune function is weakened. (b) If vesicles derived from Klebsiella pneumoniae are detected, the subject has an infectious disease, is at high risk of having an infectious disease, or has a high severity of an infectious disease. (c) If vesicles derived from Klebsiella pneumoniae are detected, the patient has cancer, is at high risk of having cancer, or has a high severity of cancer.

[0063] 2. Testing composition and testing kit Section 2 describes the testing composition and testing kit of the present invention. The testing composition of the present invention is a testing composition for testing innate immune function, infectious diseases, or cancer, which comprises a detection reagent for detecting Kp-bEV.

[0064] The detection reagent can be one substance or a combination of two or more substances for detecting Kp-bEV. Specifically, the detection reagent detects a biomolecule derived from Klebsiella pneumoniae.

[0065] When the biomolecule to be detected is a protein, an example of the detection reagent is an antibody that specifically binds to the protein.

[0066] When the biomolecule to be detected is a nucleic acid, examples of the detection reagent include a primer set capable of specifically amplifying the nucleic acid, and a combination of the primer set and a polymerase. The nucleic acid to be detected includes a small RNA according to SEQ ID NO: 1.

[0067] When analysis is performed using a next-generation sequencer, the detection reagents may be reagents for preparing a library for sequencing, including primers and polymerase for reverse transcription, and primers and polymerase for library amplification and addition of tags or adapters.

[0068] The use of the composition for testing of the present invention is to test for innate immune function, infectious diseases, cancer, or liver diseases. The details of the innate immune function, infectious diseases, or cancer to be tested can be applied mutatis mutandis to the contents explained in Section 1.

[0069] The present invention can be in the form of a testing kit including the above-mentioned testing composition and an instrument or reagent for separating extracellular vesicles from a specimen obtained from a test subject. Examples of instruments for separating extracellular vesicles include filters with pore sizes capable of removing cellular components and bacterial cells contained in the specimen. Examples of reagents for separating extracellular vesicles include beads on which antibodies that specifically recognize surface antigens (membrane proteins, lipids, etc.) of extracellular vesicles are immobilized.

[0070] The test kit may also include, as components, reagents or tools used to extract biomolecules from extracellular vesicles. For example, the test kit may include a lysate buffer for dissolving extracellular vesicles composed of lipid bilayer membranes to extract biomolecules, and a column and elution buffer for separating biomolecules.

[0071] 3. Pharmaceutical Compositions Section 3 describes the pharmaceutical composition of the present invention. The pharmaceutical composition of the present invention is a pharmaceutical composition that contains an antibacterial agent against Klebsiella pneumoniae as an active ingredient and is used for activating innate immune function, preventing or treating infectious diseases, or preventing or treating cancer.

[0072] Examples of the antibacterial agent that is the active ingredient include third-generation cephalosporins, cefepime, carbapenems, fluoroquinolones, piperacillin / tazobactam, and aminoglycosides.

[0073] In one embodiment, the pharmaceutical composition of the present invention is used to activate innate immune function. As used herein, "activation" also includes suppressing a decline in innate immune function.

[0074] In one embodiment, the pharmaceutical composition of the present invention is used to activate the pathogen elimination function, which can include the elimination function of one or more pathogens selected from bacteria, viruses, and protozoa.

[0075] In one embodiment, the pharmaceutical composition of the present invention can be used for the prevention or treatment of an infectious disease. Details of the infectious disease to be prevented or treated can be applied mutatis mutandis to the contents described in Section 1.

[0076] In one embodiment, the pharmaceutical composition of the present invention can be used for the prevention or treatment of cancer. The details of the cancer to be prevented or treated can be applied mutatis mutandis to the contents explained in Section 1.

[0077] In one embodiment, the pharmaceutical composition of the present invention can be used for the prevention or treatment of liver cancer. The details of liver cancer to be prevented or treated can be applied mutatis mutandis to the contents described in Section 1.

[0078] In one embodiment, the pharmaceutical composition of the present invention is administered to a carrier of Klebsiella pneumoniae.

[0079] In one embodiment, the pharmaceutical composition of the present invention is administered to a subject in which Kp-bEV has been detected, more specifically, a subject in which Kp-bEV has been detected in the blood.

[0080] In organisms with compromised intestinal mucosal barrier function, Klebsiella pneumoniae that invades the intestinal epithelium can migrate to the liver. On the other hand, even if the intestinal mucosal barrier function is intact, Kp-bEV can leak into the bloodstream, migrate to various tissues, and cause disease or promote the progression of disease. Therefore, in one embodiment, the pharmaceutical composition of the present invention is administered to a subject whose intestinal mucosal barrier function is intact.

[0081] The dosage form of the pharmaceutical composition of the present invention is not particularly limited and may be appropriately selected depending on the purpose from oral preparations such as tablets, powders, granules, capsules, fine granules, and liquid preparations (such as liquid medicines); and parenteral preparations such as inhalants, suppositories, injections, patches, sprays, and ointments. All of these pharmaceutical compositions can be produced by known methods.

[0082] When the pharmaceutical composition is formulated into a dosage form such as an oral preparation, various additives commonly used in the manufacture of such preparations may be blended in. Examples of such additives include excipients, lubricants, plasticizers, surfactants, binders, disintegrants, wetting agents, stabilizers, flavoring agents, colorants, and fragrances. The additives may be used singly or in combination of two or more. When two or more types are used in combination, the combination and ratio may be appropriately selected depending on the purpose.

[0083] Examples of the excipient include lactose, glucose, D-mannitol, fructose, dextrin, starch, salt, sodium bicarbonate, calcium carbonate, sodium alginate, ethyl cellulose, sodium carboxymethyl cellulose, hydroxypropyl cellulose, silicic anhydride, and kaolin.

[0084] Examples of the lubricant include magnesium stearate, calcium stearate, stearic acid, talc, corn starch, macrogol, and the like.

[0085] Examples of the plasticizer include polyethylene glycol, propylene glycol, glycerins, triacetin, medium-chain fatty acid triglycerides, acetylglycerin fatty acid esters, and triethyl citrate.

[0086] Examples of the binder include gelatin, gum arabic, cellulose ester, polyvinylpyrrolidone, starch syrup, licorice extract, tragacanth, simple syrup, and the like. Examples of the disintegrant include starch, agar, carmellose calcium, carmellose, and crystalline cellulose. Examples of the wetting agent include gum arabic, polyvinylpyrrolidone, methylcellulose, carmellose sodium, and hydroxypropylcellulose.

[0087] Examples of the flavoring agent include sucrose, honey, saccharin sodium, peppermint, eucalyptus oil, and cinnamon oil. Examples of the coloring agent include iron oxide, β-carotene, chlorophyll, and water-soluble food tar dyes. Examples of the flavoring agent include lemon oil, orange oil, dl- or l-menthol, and the like.

[0088] When the pharmaceutical composition is formulated as a parenteral preparation such as an inhalant, injection, patch, spray, or ointment, examples of the solvent that can be used include distilled water for injection, sterile non-aqueous solvents, and suspensions. Preferred examples of the base for the non-aqueous solvent or suspension include propylene glycol, polyethylene glycol, glycerin, olive oil, corn oil, ethyl oleate, and the like.

[0089] The pharmaceutical composition of the present invention may contain optional pharmaceutically acceptable ingredients other than those described above, as needed, within the scope of not interfering with the effects of the present invention. Examples of optional ingredients include buffering agents, preservatives, antioxidants, etc.

[0090] 4. Screening Method Section 4 describes in detail the screening method of the present invention. The screening method of the present invention is a method for screening active ingredients of pharmaceutical compositions used for activating innate immune function, preventing or treating infectious diseases, or preventing or treating cancer. The details of liver cancer, which is the target of prevention or treatment, can be applied mutatis mutandis to the contents explained in Section 1.

[0091] The screening method of the present invention comprises applying a candidate substance to Klebsiella pneumoniae, and determining that the candidate substance is effective when it exhibits a growth inhibitory effect, bactericidal effect, or vesicle secretion inhibitory effect against the bacterium.

[0092] Specifically, an embodiment may involve culturing Klebsiella pneumoniae and adding a candidate substance to the culture environment. The method for culturing Klebsiella pneumoniae is not particularly limited, and examples include suspension culture in any liquid medium such as LB medium or DMEM medium.

[0093] The growth inhibitory effect, bactericidal effect, or vesicle secretion inhibitory effect on Klebsiella pneumoniae when a candidate substance is added can be evaluated by comparing with Klebsiella pneumoniae cultured without the addition of the candidate substance.

[0094] The growth inhibitory or bactericidal effect can be evaluated by counting the number of Klebsiella pneumoniae cells in the collected medium. The number of cells in the medium can be calculated using a counting chamber or by measuring the turbidity using a spectrophotometer.

[0095] The inhibitory effect on vesicle secretion can be evaluated by measuring the amount of Kp-bEV contained in the collected medium. For example, the collected medium can be centrifuged to remove bacterial pellets, and the supernatant can be filtered using a 0.22 μm filter to obtain a filtrate containing Kp-bEV. This filtrate can then be analyzed using an assay targeting Klebsiella pneumoniae biomolecules, as described in Section 1. The measured values ​​from this assay can be considered to reflect the amount of Kp-bEV. The inhibitory effect of a candidate substance on Klebsiella pneumoniae vesicle secretion can be evaluated by comparing the measured values ​​with those obtained from an assay of a Klebsiella pneumoniae culture supernatant cultured without the addition of the candidate substance.

[0096] In one embodiment, the screening method of the present invention can be applied to screening for active ingredients of pharmaceutical compositions used to activate innate immune functions.

[0097] In one embodiment, the screening method of the present invention can be applied to screening for active ingredients of pharmaceutical compositions used to activate pathogen elimination functions, such as elimination functions for one or more pathogens selected from bacteria, viruses, and protozoa.

[0098] In one embodiment, the screening method of the present invention can be applied to screening for active ingredients of pharmaceutical compositions used for the prevention or treatment of infectious diseases. Details of the infectious diseases to be prevented or treated can be applied mutatis mutandis to the contents described in Section 1.

[0099] In one embodiment, the screening method of the present invention can be applied to screening for active ingredients of pharmaceutical compositions used for the prevention or treatment of cancer. The details of the cancer to be prevented or treated can be applied mutatis mutandis to the contents described in Section 1.

[0100] In one embodiment, the screening method of the present invention can be applied to screening for active ingredients of pharmaceutical compositions used for the prevention or treatment of liver cancer. Details of liver cancer, which is the target of prevention or treatment, can be applied mutatis mutandis to the contents described in Section 1.

[0101] The screening method of the present invention can be applied to screening for active ingredients of pharmaceutical compositions that are administered to subjects in which Kp-bEV has been detected, more specifically, subjects in which Kp-bEV has been detected in the blood.

[0102] The screening method of the present invention can be applied to screening for active ingredients of pharmaceutical compositions to be administered to patients whose intestinal mucosal barrier function is not disrupted. [Example]

[0103] <Test Example 1> Macrophage polarization by Klebsiella pneumoniae-derived bEV Klebsiella pneumoniae (ATCC 43816 strain) was cultured in LB medium at 37°C for 48 hours with shaking at 140 rpm. The culture was then centrifuged at 8500 × g for 60 minutes at 4°C and filtered through a 0.22 μm filter. The filtrate was centrifuged at 140,000 × g for 90 minutes at 4°C. The sediment was resuspended in PBS, and 2 M sucrose was added. The culture was centrifuged at 140,000 × g for 3 hours at 4°C (sucrose cushion method). The sediment was then resuspended in PBS to prepare the Kp-bEV solution. The number of Kp-bEV particles in the solution was measured using a Zetasizer particle count. In a separate study, the presence of Kp-bEV was confirmed by electron microscopy in a solution prepared under similar conditions.

[0104] Femurs were collected from 20-30 week-old C57BL / 6J mice, and bone marrow cells were collected from the collected femurs. The collected bone marrow cells were cultured in DMEM medium supplemented with 40 ng / mL M-CSF at 37°C and 5% CO2 for 1 week to induce differentiation into macrophages (bone marrow-derived macrophages, BMDM). 2 × 10 cells were collected using a cell scraper and cultured at 37°C and 5% CO2 for 1 week. 5 BMDMs adjusted to cells / well were seeded in 12-well or 24-well plates and cultured overnight. Kp-bEVs prepared as described above were added to the plates at 2 × 10 7 The cells were added and cultured at 37°C in a 5% CO2 environment for 17 hours.

[0105] In addition, BMDMs cultured in 24-well plates were added with Kp-bEV, and then 2 × 10 cells of K. pneumoniae (ATCC43816 strain) cultured in LB medium at 37°C for 3–4 hours were added. 7 The cells were infected for 1.5 hours, and then the medium was replaced with BMDM containing 400 μg / mL gentamicin and cultured for 6 or 17 hours.

[0106] BMDMs and culture supernatants cultured in the absence / presence of Kp-bEV and in the absence / infection of K. pneumoniae were collected and subjected to immunostaining with an antibody against CD206, a marker for M2 macrophages (Figure 1), flow cytometry analysis (Figures 2 and 3), a phagocytic activity assay using fluorescent beads (Figure 4), evaluation of IL-1b production relative to the total amount of protein (Figure 5), evaluation of cell death based on the amount of LDH (lactate dehydrogenase) released into the culture supernatant (Figure 6), and measurement of iNOS expression levels by RT-qPCR (Figure 7).

[0107] As shown in Figures 1 to 3, macrophages exposed to Kp-bEV highly expressed CD206 and exhibited characteristics of anti-inflammatory M2 macrophages.

[0108] However, as shown in Figure 4, macrophages exposed to Kp-bEV exhibit improved phagocytic activity. Furthermore, as shown in Figure 5, Kp-bEV enhances the production of IL-β, a pro-inflammatory cytokine, under K. pneumoniae infection. Enhanced phagocytic activity of foreign substances and enhanced production of pro-inflammatory cytokines such as IL-β are seen in inflammatory M1 macrophages.

[0109] The results shown in Figures 1 to 5 suggest that macrophages exposed to Kp-bEV exhibit abnormal characteristics that are neither M1 nor M2 type.

[0110] Normally, IL-1β induces neutrophils and induces inflammatory cell death in macrophages. However, in the presence of Kp-bEV, although IL-1β production by macrophages was enhanced (Fig. 5), the subsequent inflammatory cell death of macrophages was not induced (Fig. 6).

[0111] Furthermore, as shown in Figure 7, macrophages exposed to Kp-bEV exhibited suppressed iNOS expression despite being infected with K. pneumoniae, thereby weakening their defense mechanisms against pathogen infection.

[0112] These results indicate that in the presence of Kp-bEV, macrophages exhibit abnormal characteristics that are neither M1 nor M2, and that pathogens such as bacteria, viruses, or protozoa that are engulfed by phagocytosis are maintained alive and proliferating within the macrophages. In other words, it has become clear that Kp-bEV has the ability to attenuate the host's innate immune function, more specifically, its pathogen clearance function.

[0113] In other words, the results of Test Example 1 indicate that Kp-bEV can be used as a marker for examining the state of the innate immune function of the animal being tested, specifically, the weakening of innate immune function, and more specifically, the weakening of pathogen elimination function.

[0114] <Test Example 2> Orientation of K. pneumoniae-derived bEV K-bEVs were prepared using the same procedure as in Test Example 1. 1 × 10 10 Kp-bEVs were administered to mice via tail vein injection or orally using a probe. 24 hours after administration, fluorescence was detected in vivo or in excised organs using iVIS or NEWTON7, and organs with Dir-stained Kp-bEV accumulation were identified. Antibiotics were administered (drinking water containing 1 g / mL ampicillin, 1 g / mL metronidazole, 0.5 g / mL vancomycin, and 1 g / mL neomycin) to 56-week-old mice. 1 x 10 Kp-bEVs were administered to the tail vein of the mice. 10 5 × 10 Kp-bEVs were injected. 24 hours after injection, 7 Mice were orally infected with K. pneumoniae, and 48 hours later, the cecum, liver, and lungs were removed and homogenates were plated on LB agar medium to calculate the number of K. pneumoniae bacteria that had established infection in each organ.

[0115] As shown in Figures 8 to 12, it was found that Kp-bEVs were highly oriented to the liver, lungs, spine, and kidneys.

[0116] Furthermore, as shown in Figure 13, there was no significant difference in the infection efficiency of the cecal mucosa regardless of the presence or absence of Kp-bEV. On the other hand, as shown in Figures 14 and 15, the presence of Kp-bEV increased the infection efficiency of orally infected K. pneumoniae in the liver, lungs, spine, and kidneys. This suggests that Kp-bEV has the effect of promoting the transfer of the pathogen from the digestive tract to tissues other than the digestive tract and the establishment of infection.

[0117] Taking the results of Test Examples 1 and 2 together, it was found that Kp-bEV is transported to various tissues via the blood circulation and improves infection efficiency by attenuating the innate immune function of the tissues to which it is transported. This result indicates that Kp-bEV can be used as a diagnostic marker for infectious diseases in animals.

[0118] <Test Example 3> Promotion of liver disease progression by K. pneumoniae-derived bEV K-bEV prepared by the same procedure as in Test Example 1 was administered to nonalcoholic steatohepatitis (NASH) model mice (STAM R A test was conducted in which the drug was administered to mice. R The mice are a model mouse with a diabetic background that shows pathological findings similar to the progression and prognosis of human NASH, with fatty liver at 6 weeks of age, steatohepatitis at 8 weeks of age, liver fibrosis at 9 weeks of age, and then liver cancer at 20 weeks of age. In this study, we aimed to examine the carcinogenic effect of Kp-bEV, and used STAM R The mice were administered intravenously into the tail vein once a week at 12, 13, 14, and 15 weeks of age, and sacrificed at 16 weeks of age, and their livers were excised and observed (FIG. 16).

[0119] As shown in Figure 16, an increase in the number and size of tumors was observed in the livers of model mice administered Kp-bEV compared to controls, indicating that Kp-bEV promotes carcinogenesis. The results of Test Example 3 indicate that Kp-bEV can be a marker for diagnosing the liver condition of the animal being tested, more specifically, liver cancer.

[0120] <Test Example 4> Detection of K. pneumoniae-derived RNA fragments from blood samples Serum was prepared from blood samples collected from liver cancer patients and healthy controls, and then centrifuged to prepare samples containing extracellular vesicles. Small RNA fractions were obtained from these samples and analyzed using a next-generation sequencer. The resulting reads were mapped using the K. pneumoniae genome as a reference. Small RNAs aligned to the K. pneumoniae genome were found to be significantly more abundant in liver cancer patients. These results demonstrate that analysis of small RNAs prepared from blood samples can detect Kp-bEV and can be used as a diagnostic marker.

[0121] In addition, the obtained reads were mapped and analyzed using a number of bacterial genomes, including K. pneumoniae, as references. As a result, the small RNA represented by sequence number 1 was identified as a small RNA sequence effective for the specific detection of Kp-EVs. SEQ ID NO: 1: agucccugcggauggagcugagaccagucgaag

[0122] The bacteria listed below were found to conserve the base sequence according to SEQ ID NO: 1. ·Catenulispora yoronensis strain JCM 16014: Soil actinomycete ·Cryptosporangium minutisporangium strain JCM 9458: Soil actinomycete ·Kitasatospora arboriphila strain JCM 13002: Soil actinomycete ·Luedemannella flava strain JCM 13250: Soil actinomycete Brachybacterium tyrofermentans strain JCM 11610: cheese surface Streptomyces thermogriseus strain JCM 11269: Hot spring area in China Arthrobacter mobilis strain E918: an actinomycete from the Cholistan Desert, Pakistan Kribbella ginsengisoli: an actinomycete found in Korean ginseng fields Klebsiella variicola subsp. variicola strain F2R9T: a new species of Klebsiella (human) in 2004 Klebsiella quasivariicola strain 08A119: a new species of Klebsiella (human) in 2017 Klebsiella quasipneumoniae: Like K. pneumoniae, it can cause urinary tract infections, intraperitoneal infections, and sepsis. Klebsiella pneumoniae

[0123] Among the bacteria listed above, bacteria other than K. pneumoniae are unlikely to be present in the human body or are extremely rare. Therefore, if a sequence according to SEQ ID NO: 1 is detected in the human body (in serum or tissue), it can be said that the sequence is derived from Klebsiella pneumoniae.

[0124] The above results demonstrated that the small RNA represented by SEQ ID NO: 1 is effective as a diagnostic marker. [Industrial Applicability]

[0125] The present invention can be applied for the diagnosis of immune function, infectious diseases, or cancer.

Claims

1. In order to examine innate immune function, infectious diseases, or cancer in an animal subject using vesicles derived from Klebsiella pneumoniae as an indicator, and analyzing a sample obtained from the test subject to detect the vesicles.

2. 2. The method of claim 1, wherein the detection of the vesicles is carried out by detecting a biomolecule derived from Klebsiella pneumoniae.

3. The detection method according to claim 2 , wherein the biomolecule is a small RNA represented by SEQ ID NO:

1. SEQ ID NO: 1: agucccugcggauggagcugagaccagucgaag

4. The detection method according to claim 1 , wherein the sample is a blood sample.

5. the innate immune function is a pathogen elimination function by macrophages, the infectious disease is an infection in the lungs, liver, spine, or kidneys; The detection method according to claim 1 , wherein the cancer is liver cancer.

6. A method for detecting vesicles derived from Klebsiella pneumoniae by analyzing a sample obtained from a test subject, and comparing the detected vesicles with one or more criteria selected from the group consisting of the following (a) to (c): (a) If vesicles derived from Klebsiella pneumoniae are detected, innate immune function is weakened. (b) if vesicles derived from Klebsiella pneumoniae are detected, the subject has an infectious disease, is at high risk of having an infectious disease, or has a high severity of an infectious disease; (c) If vesicles derived from Klebsiella pneumoniae are detected, the subject is affected by cancer, is at high risk of developing cancer, or has a high severity of cancer.

7. A testing composition for testing innate immune function, infectious diseases, or cancer, comprising a detection reagent for detecting vesicles derived from Klebsiella pneumoniae.

8. The testing composition according to claim 7, wherein the detection reagent detects a biomolecule derived from Klebsiella pneumoniae.

9. The composition for testing according to claim 8 , wherein the biomolecule is a small RNA represented by SEQ ID NO:

1. SEQ ID NO: 1: agucccugcggauggagcugagaccagucgaag

10. An instrument or reagent for separating extracellular vesicles from a sample obtained from a test subject; a detection reagent for detecting vesicles derived from Klebsiella pneumoniae; A test kit including:

11. A pharmaceutical composition for use in activating innate immune function, preventing or treating infectious diseases, or preventing or treating cancer, comprising an antibacterial agent against Klebsiella pneumoniae as an active ingredient.

12. 12. The pharmaceutical composition of claim 11, wherein the antibacterial agent is a third-generation cephalosporin, cefepime, a carbapenem, a fluoroquinolone, piperacillin / tazobactam, or an aminoglycoside.

13. The pharmaceutical composition according to claim 12, which is administered to a subject in whose body vesicles derived from Klebsiella pneumoniae have been detected.

14. A method for screening an active ingredient of a pharmaceutical composition used for activating natural immune function, preventing or treating infectious diseases, or preventing or treating cancer, comprising: A screening method comprising applying a candidate substance to Klebsiella pneumoniae and determining that the candidate substance is effective when it exhibits a growth inhibitory effect, a bactericidal effect, or a vesicle secretion inhibitory effect against the bacterium.

Citation Information

Patent Citations

  • Method for measuring glycoprotein, method for inspecting liver disease and reagent for quantification of glycoprotein

    JP2012185172A

  • Immune strength inspection method and immune strength inspection kit

    JP2017129456A

  • Nano-vesicles derived from genus cupriavidus bacteria and use thereof

    JP2021168683A