RNAi AGENTS FOR INHIBITING EXPRESSION OF 17β-HSD TYPE 13 (HSD17B13), COMPOSITIONS THEREOF, AND METHODS OF USE

HSD17B13 gene-specific RNAi agents, linked to targeting ligands, address the lack of treatments for NAFLD and NASH by effectively inhibiting HSD17B13 gene expression, offering therapeutic benefits for liver diseases.

JP2025186315APending Publication Date: 2025-12-23ARROWHEAD PHARMACEUTICALS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025147403
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2019-08-22
Filing Date
2025-09-05
Publication Date
2025-12-23

Smart Images

  • Figure 2025186315000001_ABST
    Figure 2025186315000001_ABST
Patent Text Reader

Abstract

To provide RNAi agents for inhibiting HSD17B13 gene expression.SOLUTION: The present disclosure provides RNAi agents, e.g., double stranded RNAi agents, which can inhibit 17β-hydroxy steroid dehydrogenase type 13 (HSD17B13 or 17β-HSD13) gene expression. Also provided are pharmaceutical compositions that include HSD17B13 RNAi agents and methods of use thereof. The HSD17B13 RNAi agents disclosed herein may be conjugated to targeting ligands to facilitate delivery to cells, including delivery to hepatocytes. The delivery of the HSD17B13 RNAi agents in vivo provides inhibition of HSD17B13 gene expression. The RNAi agents can be used in methods of treatment of HSD17B13-related diseases and disorders, including non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), hepatic fibrosis, and alcoholic or non-alcoholic fatty liver diseases, including cirrhosis.SELECTED DRAWING: Figure 11A
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Related Applications This application claims priority to U.S. Provisional Patent Application No. 62 / 890,220, filed August 22, 2019, U.S. Provisional Patent Application No. 62 / 773,707, filed November 30, 2018, and U.S. Provisional Patent Application No. 62 / 773,320, filed September 19, 2018, the contents of each of which are incorporated herein by reference in their entirety.

[0002] Sequence Listing This application contains a Sequence Listing which has been submitted in ASCII format and is hereby incorporated by reference in its entirety. The ASCII copy has the filename 30667-WO_SEQLIST.txt and is 75 kb in size.

[0003] Technical Field The present disclosure relates to RNA interference (RNAi) agents, such as double-stranded RNAi agents for inhibiting 17β-hydroxysteroid dehydrogenase type 13 gene expression, compositions comprising 17β-hydroxysteroid dehydrogenase type 13 RNAi agents, and methods of use thereof. [Background technology]

[0004] The hepatic lipid droplet protein 17β-hydroxysteroid dehydrogenase type 13 (commonly referred to as HSD17B13, 17β-HSD13, HSD17β13, 17β-HSD13, 17β-HSD13, or 17β-HSD13) is a member of the 17β-hydroxysteroid dehydrogenase (17β-HSD) family. The 17β-HSD family consists of 14 enzymes involved in the reduction or oxidation of sex hormones, fatty acids, and bile acids. Tissue distribution, subcellular localization, and enzyme selectivity differ among various family members. The 17β-HSD family exhibits diverse substrate specificities, including steroids, lipids, and retinoids.

[0005] The 17β-HSD13 protein is distributed throughout a wide range of tissues in the body and is encoded by the HSD17B13 gene (also referred to as the 17β-HSD13 gene). Its highest expression level is found in hepatic parenchymal cells in the liver, while lower levels can be detected in the ovaries, bone marrow, kidney, brain, lung, skeletal muscle, bladder, and testis. Although the function of 17β-HSD13 is not fully understood, several 17β-HSD family members, including 17β-HSD-4, -7, -10, and -12, have been shown to be involved in carbohydrate and fatty acid metabolism. This suggests that 17β-HSD13 may also be involved in lipid metabolism pathways. Upregulation of hepatic 17β-HSD13 has been reported in patients with fatty liver, supporting a role for this enzyme in the pathogenesis of nonalcoholic fatty liver disease (NAFLD).

[0006] Wen Su et al. previously identified 17β-HSD13 as a lipid droplet (LD)-associated protein in patients with NAFLD and reported that 17β-HSD13 was one of the most abundant LD proteins specifically localized on the surface of LDs (Wen Su et al., Comparative proteomic study reveals 17β-HSD13 as a pathogenic protein in nonalcoholic fatty liver disease, 111 PNAS 11437-11442 (2014)). Furthermore, 17β-HSD13 levels were found to be upregulated in the livers of patients with NAFLD and mice. Overexpression of HSD17B13 resulted in an increase in the number and size of LDs, whereas gene silencing of HSD17B13 attenuated oleic acid-induced LD formation in cultured hepatocytes. Hepatic overexpression of 17β-HSD13 protein in C57BL / 6 mice was shown to significantly increase hepatic lipid synthesis and triglyceride (TG) content, leading to a fatty liver phenotype.

[0007] Further evidence implicating HSD17B13 gene expression in the pathogenesis of NAFLD and nonalcoholic steatohepatitis (NASH) was provided by NSAbul-Husn et al., A Protein-Truncating HSD17B13 Variant and Protection from Chronic Liver Disease, 378 N. Eng. J. Med. 1096-1106 (2018). This group conducted a genome-wide association study and found a splice variant (rs72613567:TA) in HSD17B13 that was associated with reduced levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST), indicating less liver damage and hepatitis in patients with fatty liver. The splice variant causes a truncated deletion of the functional protein, suggesting that HSD17B13 normally generates a product that may promote hepatocellular injury.

[0008] NAFLD is a major global health problem. It is an umbrella term encompassing a continuum of liver conditions and resulting fibrosis, varying in severity. Among these, hepatic steatosis (fatty liver) alone is commonly referred to as NAFL, while NASH is typically defined as a more severe process involving inflammation and liver parenchymal cell injury (steatohepatitis). NASH is commonly associated with fibrosis and often progresses to cirrhosis. While patients with NAFL alone have a lower risk of adverse outcomes, the presence of NASH increases the risk of liver and non-liver-related outcomes. Adverse liver outcomes associated with NASH include liver failure, cirrhosis, and hepatocellular carcinoma. Non-liver-related adverse outcomes are typically associated with cardiovascular disease and increased malignancy.

[0009] Globally, the prevalence of NAFLD is estimated at approximately 25%. In the United States, the number of NAFLD cases is projected to increase from 83.1 million (approximately 25% of the population) in 2015 to 100.9 million by 2030. NASH is expected to account for an increasing proportion of these cases, increasing from 20% to 27% of adults with NAFLD. This increasing disease prevalence will undoubtedly pose an economic burden and will coincide with both an increase in the number of patients with end-stage liver disease requiring liver transplantation and a dramatic increase in hepatocellular carcinoma (HCC). Compared with the incidence rates of other liver diseases, a larger percentage (approximately 35–50%) of HCC cases arise in NASH before patients develop cirrhosis and undergo regular cancer screening. This often results in tumors that are larger and less responsive to curative treatment than those of other causes.

[0010] Alcohol-related liver disease (ARLD) is also prevalent worldwide and represents a progressive liver disease caused by excessive and persistent alcohol use. There are various disease states of ARLD, including alcoholic fatty liver (alcoholic steatosis), alcoholic hepatitis, and cirrhosis.

[0011] Currently, there are no approved medications for the treatment of NASH or other diseases and conditions that fall under NAFLD or ARLD. Summary of the Invention

[0012] There is a need for novel HSD17B13 gene-specific RNA interference (RNAi) agents (also referred to herein as RNAi agents, RNAi triggers, or triggers), such as double-stranded RNAi agents that can selectively and effectively inhibit the expression of the HSD17B13 gene. Furthermore, there is a need for compositions containing novel HSD17B13-specific RNAi agents for treating diseases such as alcoholic or non-alcoholic liver disease, including NAFLD, NASH, liver fibrosis, and cirrhosis, among others.

[0013] Generally, the present disclosure features novel HSD17B13 gene-specific RNAi agent, composition comprising HSD17B13 RNAi agent, and the method for inhibiting the expression of HSD17B13 gene in vitro and / or in vivo using HSD17B13 RNAi agent and composition comprising HSD17B13 RNAi agent as described herein.The HSD17B13 RNAi agent described herein can selectively and effectively reduce, inhibit or silence the expression of HSD17B13 gene in subjects, for example, human or animal subjects.

[0014] The described HSD17B13 RNAi agents can be used in methods for the therapeutic treatment (including prophylactic and preventative treatment) of symptoms and diseases associated with alcoholic or non-alcoholic liver disease, including NAFLD, NASH, liver fibrosis, and cirrhosis. The methods disclosed herein include administering one or more HSD17B13 RNAi agents to a subject, e.g., a human or animal subject, using any suitable method known in the art, such as subcutaneous injection or intravenous administration.

[0015] In one aspect, the disclosure features an RNAi agent for inhibiting expression of the HSD17B13 gene, the RNAi agent including a sense strand (also referred to as a passenger strand) and an antisense strand (also referred to as a guide strand). The sense strand and antisense strand can be partially, substantially, or fully complementary to each other. The length of the sense strand and antisense strand of an RNAi agent described herein can each be 16 to 49 nucleotides in length. In some embodiments, the sense strand and antisense strand are independently 17 to 26 nucleotides in length. The sense strand and antisense strand can be the same length or different lengths. In some embodiments, the sense strand and antisense strand are independently 21 to 26 nucleotides in length. In some embodiments, the sense strand and antisense strand are independently 21 to 24 nucleotides in length. In some embodiments, both the sense strand and the antisense strand are 21 nucleotides in length. In some embodiments, the antisense strands are independently 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the sense strands are independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides in length. The RNAi agents described herein inhibit the expression of one or more HSD17B13 genes in vivo or in vitro upon delivery to a cell that expresses HSD17B13.

[0016] The HSD17B13 RNAi agents disclosed herein target the human HSD17B13 gene (see, e.g., SEQ ID NO: 1). In some embodiments, the HSD17B13 RNAi agents disclosed herein target a portion of the HSD17B13 gene having any of the sequences disclosed in Table 1.

[0017] Examples of HSD17B13 RNAi agent sense and antisense strands that can be included in the HSD17B13 RNAi agents disclosed herein are provided in Tables 3 and 4. Examples of HSD17B13 RNAi agent duplexes are provided in Table 5, and chemical structures and schematics of particular HSD17B13 RNAi agents shown linked to targeting ligands comprising N-acetyl-galactosamine are illustrated in Figures 1A-10D and 11A-11E. Examples of 19-nucleotide core stretch sequences consisting of or included in the sense and antisense strands of HSD17B13 RNAi agents disclosed herein are shown in Table 2.

[0018] In another aspect, the disclosure features methods for delivering an HSD17B13 RNAi agent to liver cells in a subject, such as a mammal, in vivo. Also described herein are compositions for use in such methods.

[0019] One or more HSD17B13 RNAi agents can be delivered to cells or tissues using any oligonucleotide delivery technology known in the art. In some embodiments, the HSD17B13 RNAi agent is delivered to cells or tissues by covalently linking or binding the RNAi agent to a targeting group, such as an asialoglycoprotein receptor ligand (i.e., a ligand comprising a compound with affinity for the asialoglycoprotein receptor, which is abundantly expressed in hepatocytes in the liver). In some embodiments, the asialoglycoprotein receptor ligand comprises, consists of, or consists essentially of galactose or a galactose derivative cluster. In some embodiments, the HSD17B13 RNAi agent is linked to a targeting group or targeting ligand comprising the galactose derivative N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster comprises or consists of an N-acetyl-galactosamine trimer or an N-acetyl-galactosamine tetramer.

[0020] In some embodiments, the HSD17B13 RNAi agents disclosed herein that are linked to a targeting group or targeting ligand that comprises N-acetyl-galactosamine are selectively internalized by hepatocytes, and hepatic parenchymal cells in particular, by receptor-mediated endocytosis or other means.

[0021] In some embodiments, the targeting group is linked to the 3' or 5' end of the sense strand of the HSD17B13 RNAi agent disclosed herein. In some embodiments, the targeting group is linked to the 5' end of the sense strand.

[0022] Targeting ligands and targeting groups useful for delivering the HSD17B13 RNAi agents disclosed herein to hepatocytes are disclosed, for example, in International Publication Nos. 2018 / 044350 and 2017 / 156012, which are incorporated herein by reference in their entireties. In some embodiments, the HSD17B13 RNAi agents disclosed herein are administered to hepatocytes using the targeting ligands and targeting groups (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG33), (NAG34), (NAG35), (NAG36), (NAG37), (NAG38), (NAG39), (NAG40), (NAG41), (NAG42), (NAG43), (NAG44), (NAG45), (NAG46), (NAG47), (NAG48), (NAG49), (NAG50), (NAG51), (NAG52), (NAG53), (NAG54), (NAG55), (NAG56), (NAG57), (NAG58), (NAG59), (NAG60), (NAG61), (NAG62), (NAG63), (NAG64), (NAG65), (NAG66), (NAG67), (NAG68), (NAG69), (NAG70), (NAG71), (NAG72), (NAG73), (NAG74), (NAG75), (NAG76), (NAG77), (NAG78), (NAG79), (NAG80), (NAG81), ( The targeting ligands may be linked to one or more targeting ligands having the structure: (NAG32), (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s.

[0023] In some embodiments, an HSD17B13 RNAi agent disclosed herein is conjugated to a targeting ligand comprising three N-acetyl-galactosamine moieties at the 5' end of the sense strand, wherein the targeting ligand is selected from the group consisting of (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29 ... NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s.

[0024] In some embodiments, described herein are compositions comprising one or more HSD17B13 RNAi agents having a double-stranded structure disclosed in Table 5.

[0025] In another aspect, the disclosure features a method of inhibiting expression of the HSD17B13 gene, the method comprising administering to a subject or a cell of the subject an amount of an HSD17B13 RNAi agent capable of inhibiting expression of the HSD17B13 gene, the HSD17B13 RNAi agent comprising a sense strand and an antisense strand, wherein the antisense strand comprises any one of the antisense strand nucleotide sequences in Table 2 or Table 3. In some embodiments, disclosed herein is a method of inhibiting expression of the HSD17B13 gene, the method comprising administering to a subject or a cell of the subject an amount of an HSD17B13 RNAi agent capable of inhibiting expression of the HSD17B13 gene, the HSD17B13 RNAi agent comprising a sense strand and an antisense strand, wherein the sense strand comprises any one of the sense strand nucleotide sequences in Table 2 or Table 4. In some embodiments, disclosed herein is a method for inhibiting the expression of the HSD17B13 gene in a cell or a subject, the method comprising administering to the cell or subject an HSD17B13 RNAi agent, the sense strand of which comprises any of the sequences in Table 4, and the antisense strand of which comprises any of the sequences in Table 3. Also disclosed herein are compositions for use in such methods.

[0026] In a further aspect, the disclosure features methods for treating (including prophylactic and preventative treatment) diseases or symptoms caused by alcoholic or non-alcoholic liver disease, including NAFLD, NASH, liver fibrosis, and / or cirrhosis, comprising administering to a subject in need thereof an HSD17B13 RNAi agent having an antisense strand comprising any of the sequences in Table 2 or 3. In some embodiments, described herein are methods for treating (including preventative treatment) diseases or symptoms caused by alcoholic or non-alcoholic liver disease, including NAFLD, NASH, liver fibrosis, and / or cirrhosis, comprising administering to a subject in need thereof an HSD17B13 RNAi agent having a sense strand comprising any of the sequences in Table 2 or 3. Also described herein are compositions for use in such methods.

[0027] In some embodiments, the composition described is for delivering HSD17B13 RNAi agent to liver cell, particularly liver parenchymal cell in vivo, and the composition comprises: HSD17B13 RNAi agent linked or bound with targeting group.In some embodiments, the targeting group is N-acetyl-galactosamine.

[0028] In some embodiments, an HSD17B13 RNAi agent disclosed herein comprises an antisense strand consisting essentially of or comprising the nucleotide sequence (5'→3')UCAUCUAUCAGACUUCUUACG (SEQ ID NO: 3) and a nucleobase sequence that differs by zero or one nucleotide. In some embodiments, an HSD17B13 RNAi agent disclosed herein comprises an antisense strand consisting essentially of or comprising the nucleotide sequence (5'→3')UCAUCUAUCAGACUUCUUACG (SEQ ID NO: 3) and a nucleobase sequence that differs by no more than one nucleotide. In some embodiments, an HSD17B13 RNAi agent disclosed herein comprises an antisense strand consisting essentially of or comprising the nucleobase sequence (5'→3')UCAUCUAUCAGACUUCUUACG (SEQ ID NO: 3) and a nucleobase sequence that differs by zero or one nucleotide, wherein SEQ ID NO: 3 is located at positions 1-21 (5'→3') of the antisense strand.

[0029] In some embodiments, the HSD17B13 RNAi agents disclosed herein include an antisense strand consisting essentially of, or including, the nucleotide sequence (5'→3')usCfsasUfcUfaUfcAfgAfcUfuCfuUfaCfsg (SEQ ID NO: 2), and a modified nucleotide sequence differing by no more than one nucleotide, wherein a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand. As those skilled in the art will readily appreciate, the inclusion of phosphorothioate linkages found in the modified nucleotide sequences disclosed herein replaces the phosphodiester linkages normally present in oligonucleotides (see, e.g., Figures 11A-11E, which show all internucleoside linkages). In some embodiments, an HSD17B13 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the nucleotide sequence (5'→3')usCfsasUfcUfaUfcAfgAfcUfuCfuUfaCfsg (SEQ ID NO: 2), wherein a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0030] In some embodiments, the HSD17B13 RNAi agents disclosed herein include an antisense strand consisting essentially of, or including, the nucleotide sequence (5'→3')usCfsasUfcUfaucagAfcUfuCfuUfaCfsg (SEQ ID NO: 4) and a modified nucleotide sequence differing by no more than one nucleotide, wherein a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand. As those skilled in the art will readily appreciate, the inclusion of phosphorothioate linkages found in the modified nucleotide sequences disclosed herein replaces the phosphodiester linkages normally present in oligonucleotides (see, e.g., Figures 11A-11E, which show all internucleoside linkages). In some embodiments, an HSD17B13 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the nucleotide sequence (5'→3')usCfsasUfcUfaucagAfcUfuCfuUfaCfsg (SEQ ID NO: 4), wherein a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0031] In some embodiments, an HSD17B13 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising, a nucleobase sequence that differs by zero or one nucleotide from the nucleotide sequence (5'→3')UGAUCCAAAAAUGUCCUAGGC (SEQ ID NO: 6). In some embodiments, an HSD17B13 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising, a nucleobase sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')UGAUCCAAAAAUGUCCUAGGC (SEQ ID NO: 6). In some embodiments, an HSD17B13 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising, a nucleobase sequence that differs by zero or one nucleotide from the nucleotide sequence (5'→3')UGAUCCAAAAAUGUCCUAGGC (SEQ ID NO: 6), wherein SEQ ID NO: 6 is located at positions 1-21 (5'→3') of the antisense strand.

[0032] In some embodiments, the HSD17B13 RNAi agents disclosed herein include an antisense strand consisting essentially of, or including, the nucleotide sequence (5'→3')usGfsasUfcCfaAfaAfaUfgUfcCfuAfgGfsc (SEQ ID NO: 5) and a modified nucleotide sequence differing by no more than one nucleotide, wherein a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand. As those skilled in the art will readily appreciate, the inclusion of phosphorothioate linkages found in the modified nucleotide sequences disclosed herein replaces the phosphodiester linkages normally present in oligonucleotides (see, e.g., Figures 11A-11E, which show all internucleoside linkages). In some embodiments, an HSD17B13 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the nucleotide sequence (5'→3')usGfsasUfcCfaAfaAfaUfgUfcCfuAfgGfsc (SEQ ID NO: 5), wherein a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0033] In some embodiments, the HSD17B13 RNAi agents disclosed herein include an antisense strand consisting essentially of, or including, the nucleotide sequence (5'→3')usGfsasUfcCfaaaaaUfgUfcCfuAfgGfsc (SEQ ID NO: 7) and a modified nucleotide sequence differing by no more than one nucleotide, wherein a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand. As those skilled in the art will readily appreciate, the inclusion of phosphorothioate linkages found in the modified nucleotide sequences disclosed herein replaces the phosphodiester linkages normally present in oligonucleotides (see, e.g., Figures 11A-11E, which show all internucleoside linkages). In some embodiments, an HSD17B13 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the nucleotide sequence (5'→3')usGfsasUfcCfaaaaaUfgUfcCfuAfgGfsc (SEQ ID NO: 7), wherein a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0034] In some embodiments, an HSD17B13 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising the nucleobase sequence differing by zero or one nucleobase from the nucleotide sequence (5'→3')UCAUCUAUCAGACUUCUUACG (SEQ ID NO: 3), and a sense strand consisting essentially of, or comprising the nucleobase sequence differing by zero or one nucleobase from the nucleotide sequence (5'→3')CGUAAGAAGUCUGAUAGAUGA (SEQ ID NO: 8). In some embodiments, an HSD17B13 RNAi agent disclosed herein comprises an antisense strand consisting essentially of or comprising the nucleotide sequence (5'→3')UCAUCUAUCAGACUUCUUACG (SEQ ID NO: 3), which differs by no more than one nucleobase, wherein all or substantially all nucleotides are modified nucleotides, and a sense strand consisting essentially of or comprising the nucleotide sequence (5'→3')CGUAAGAAGUCUGAUAGAUGA (SEQ ID NO: 8), which differs by no more than one nucleobase, wherein all or substantially all nucleotides are modified nucleotides.

[0035] In some embodiments, an HSD17B13 RNAi agent disclosed herein comprises an antisense strand consisting essentially of, or comprising, the nucleobase sequence differing by 0 or 1 nucleobase from the nucleotide sequence (5'→3')UGAUCCAAAAAUGUCCUAGGC (SEQ ID NO: 6), and a sense strand consisting essentially of, or comprising, the nucleobase sequence differing by 0 or 1 nucleobase from the nucleotide sequence (5'→3')GCCUAGGACAUUUUUGIAUCA (SEQ ID NO: 11), where I is an inosine (hypoxanthine) nucleotide. In some embodiments, an HSD17B13 RNAi agent disclosed herein comprises an antisense strand consisting essentially of or comprising the nucleotide sequence (5'→3')UGAUCCAAAAAUGUCCUAGGC (SEQ ID NO: 6), which differs by no more than one nucleobase, wherein all or substantially all nucleotides are modified nucleotides, and a sense strand consisting essentially of or comprising the nucleotide sequence (5'→3')GCCUAGGACAUUUUUGIAUCA (SEQ ID NO: 11), which differs by no more than one nucleobase, wherein I is an inosine (hypoxanthine) nucleotide, and all or substantially all nucleotides are modified nucleotides.

[0036] In some embodiments, an HSD17B13 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usCfsasUfcUfaUfcAfgAfcUfuCfuUfaCfsg (SEQ ID NO: 2), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3')cguaagaaGfUfCfugauagauga (SEQ ID NO: 9), wherein a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage. In some embodiments, an HSD17B13 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usCfsasUfcUfaUfcAfgAfcUfuCfuUfaCfsg (SEQ ID NO: 2), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3')cguaagaaGfUfCfugauagauga (SEQ ID NO: 9), wherein the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequences, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0037] In some embodiments, an HSD17B13 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usCfsasUfcUfaucagAfcUfuCfuUfaCfsg (SEQ ID NO: 4), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3')cguaagaaGfuCfuGfauagauga (SEQ ID NO: 10), wherein a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage. In some embodiments, an HSD17B13 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usCfsasUfcUfaucagAfcUfuCfuUfaCfsg (SEQ ID NO: 4), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3')cguaagaaGfuCfuGfauagauga (SEQ ID NO: 10), wherein the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequences, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0038] In some embodiments, an HSD17B13 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usGfsasUfcCfaAfaAfaUfgUfcCfuAfgGfsc (SEQ ID NO: 5), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gccuaggaCfAfUfuuuugiauca (SEQ ID NO: 12), wherein a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage. In some embodiments, an HSD17B13 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usGfsasUfcCfaAfaAfaUfgUfcCfuAfgGfsc (SEQ ID NO: 5), and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gccuaggaCfAfUfuuuugiauca (SEQ ID NO: 12), wherein the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequences, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0039] In some embodiments, an HSD17B13 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usGfsasUfcCfaAfaAfaUfgUfcCfuAfgGfsc (SEQ ID NO: 5), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gccuaggaCfaUfuUfuugiauca (SEQ ID NO: 13), wherein a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage. In some embodiments, an HSD17B13 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usGfsasUfcCfaAfaAfaUfgUfcCfuAfgGfsc (SEQ ID NO: 5), and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gccuaggaCfaUfuUfuugiauca (SEQ ID NO: 13), wherein the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequences, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0040] In some embodiments, an HSD17B13 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usGfsasUfcCfaaaaaUfgUfcCfuAfgGfsc (SEQ ID NO: 7), and a sense strand consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gccuaggaCfaUfuUfuugiauca (SEQ ID NO: 13), wherein a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage. In some embodiments, an HSD17B13 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')usGfsasUfcCfaaaaaUfgUfcCfuAfgGfsc (SEQ ID NO: 7), and a sense strand consisting of, consisting essentially of, or comprising the modified nucleotide sequence (5'→3')gccuaggaCfaUfuUfuugiauca (SEQ ID NO: 13), wherein the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequences, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0041] In some embodiments, the HSD17B13 RNAi agents disclosed herein have the following nucleotide sequence (5' to 3'): UCAUCUAUCAGACUUCUUACG (SEQ ID NO: 3); or UGAUCCAAAAAUGUCCUAGGC (SEQ ID NO: 6) and an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from one of by 0 or 1 nucleotides, and the HSD17B13 RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; and all or substantially all of the nucleotides in both the antisense strand and the sense strand are modified nucleotides.

[0042] In some embodiments, the HSD17B13 RNAi agents disclosed herein have the following nucleotide sequence (5' to 3'): UCAUCUAUCAGACUUCUUACG (SEQ ID NO: 3); or UGAUCCAAAAAUGUCCUAGGC (SEQ ID NO: 6) wherein the HSD17B13 RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; all or substantially all of the nucleotides in both the antisense strand and the sense strand are modified nucleotides; the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0043] In some embodiments, the HSD17B13 RNAi agents disclosed herein have the following nucleotide sequence (5' to 3'): UCAUCUAUCAGACUUCUUACG (SEQ ID NO: 3); or UGAUCCAAAAAUGUCCUAGGC (SEQ ID NO: 6) wherein the HSD17B13 RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; all or substantially all of the nucleotides in both the antisense strand and the sense strand are modified nucleotides; the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, the targeting ligand comprising N-acetyl-galactosamine; and each antisense strand sequence is located at positions 1 to 21 of the antisense strand.

[0044] In some embodiments, the HSD17B13 RNAi agents disclosed herein comprise an antisense strand and a sense strand, wherein the antisense strand and the sense strand have the following nucleotide sequence (5'→3') pair: UCAUCUAUCAGACUUCUUACG (SEQ ID NO: 3) and CGUAAGAAGUCUGAUAGAUGA (SEQ ID NO: 8); or UGAUCCAAAAAUGUCCUAGGC (SEQ ID NO: 6) and In the sequence, I is an inosine (hypoxanthine) nucleotide, GCCUAGGACAUUUUUGIAUCA (SEQ ID NO: 11). and the antisense strand, wherein all or substantially all of the nucleotides in both the antisense and sense strands are modified nucleotides.

[0045] In some embodiments, the HSD17B13 RNAi agents disclosed herein comprise an antisense strand and a sense strand, wherein the antisense strand and the sense strand have the following nucleotide sequence (5'→3') pair: UCAUCUAUCAGACUUCUUACG (SEQ ID NO: 3) and CGUAAGAAGUCUGAUAGAUGA (SEQ ID NO: 8); or UGAUCCAAAAAUGUCCUAGGC (SEQ ID NO: 6) and In the sequence, I is an inosine (hypoxanthine) nucleotide, GCCUAGGACAUUUUUGIAUCA (SEQ ID NO: 11). and wherein all or substantially all of the nucleotides in both the antisense strand and the sense strand are modified nucleotides; the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0046] In some embodiments, the HSD17B13 RNAi agents disclosed herein have the following nucleotide sequence (5' to 3'): usCfsasUfcUfaUfcAfgAfcUfuCfuUfaCfsg (SEQ ID NO: 2); usCfsasUfcUfaucagAfcUfuCfuUfaCfsg (SEQ ID NO: 4); usGfsasUfcCfaAfaAfaUfgUfcCfuAfgGfsc (SEQ ID NO: 5); usGfsasUfcCfaaaaaUfgUfcCfuAfgGfsc (SEQ ID NO: 7) wherein a, c, g, and u are 2'-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage; the HSD17B13 RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; and all or substantially all of the nucleotides on the sense strand are modified nucleotides.

[0047] In some embodiments, the HSD17B13 RNAi agents disclosed herein have the following nucleotide sequence (5' to 3'): usCfsasUfcUfaUfcAfgAfcUfuCfuUfaCfsg (SEQ ID NO: 2); usCfsasUfcUfaucagAfcUfuCfuUfaCfsg (SEQ ID NO: 4); usGfsasUfcCfaAfaAfaUfgUfcCfuAfgGfsc (SEQ ID NO: 5); usGfsasUfcCfaaaaaUfgUfcCfuAfgGfsc (SEQ ID NO: 7) wherein the HSD17B13 RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; all or substantially all of the nucleotides in the sense strand are modified nucleotides; all or substantially all of the nucleotides in both the antisense strand and the sense strand are modified nucleotides; the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0048] In some embodiments, the HSD17B13 RNAi agents disclosed herein comprise the following nucleotide sequence pair (5'→3'): usCfsasUfcUfaUfcAfgAfcUfuCfuUfaCfsg (SEQ ID NO: 2) and cguaagaaGfUfCfugauagauga (SEQ ID NO: 9); usCfsasUfcUfaucagAfcUfuCfuUfaCfsg (SEQ ID NO: 4) and cguaagaaGfuCfuGfauagauga(SEQ ID NO:10); usGfsasUfcCfaAfaAfaUfgUfcCfuAfgGfsc (SEQ ID NO: 5) and gccuaggaCfAfUfuuuugiauca (SEQ ID NO: 12); usGfsasUfcCfaAfaAfaUfgUfcCfuAfgGfsc (SEQ ID NO: 5) and gccuaggaCfaUfuUfuugiauca (SEQ ID NO: 13); or usGfsasUfcCfaaaaaUfgUfcCfuAfgGfsc (SEQ ID NO: 7) and gccuaggaCfaUfuUfuugiauca (SEQ ID NO: 13) wherein a, c, g, i, and u are 2'-O-methyladenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage.

[0049] In some embodiments, the HSD17B13 RNAi agents disclosed herein comprise the following nucleotide sequence pair (5'→3'): usCfsasUfcUfaUfcAfgAfcUfuCfuUfaCfsg (SEQ ID NO: 2) and cguaagaaGfUfCfugauagauga (SEQ ID NO: 9); usCfsasUfcUfaucagAfcUfuCfuUfaCfsg (SEQ ID NO: 4) and cguaagaaGfuCfuGfauagauga(SEQ ID NO:10); usGfsasUfcCfaAfaAfaUfgUfcCfuAfgGfsc (SEQ ID NO: 5) and gccuaggaCfAfUfuuuugiauca (SEQ ID NO: 12); usGfsasUfcCfaAfaAfaUfgUfcCfuAfgGfsc (SEQ ID NO: 5) and gccuaggaCfaUfuUfuugiauca (SEQ ID NO: 13); or usGfsasUfcCfaaaaaUfgUfcCfuAfgGfsc (SEQ ID NO: 7) and gccuaggaCfaUfuUfuugiauca (SEQ ID NO: 13) wherein a, c, g, i, and u are 2'-O-methyladenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s is a phosphorothioate linkage; the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0050] In some embodiments, the HSD17B13 RNAi agents disclosed herein comprise (5'→3'): UCAUCUAUCAGACUUCUUA (SEQ ID NO: 26); or UGAUCCAAAAAUGUCCUAG (SEQ ID NO: 41) and an antisense strand comprising a nucleotide sequence selected from the group consisting of: and a nucleobase sequence that differs by 0 or 1 nucleobase.

[0051] In some embodiments, the HSD17B13 RNAi agents disclosed herein comprise (5'→3'): UCAUCUAUCAGACUUCUUA (SEQ ID NO: 26); and UGAUCCAAAAAUGUCCUAG (SEQ ID NO: 41) and an antisense strand comprising a nucleobase sequence that differs by 0 or 1 nucleobase from a nucleotide sequence selected from the group consisting of:

[0052] In some embodiments, the HSD17B13 RNAi agents disclosed herein comprise (5'→3'): UCAUCUAUCAGACUUCUUA (SEQ ID NO: 26); or UGAUCCAAAAAUGUCCUAG (SEQ ID NO: 41); and an antisense strand comprising a nucleotide sequence selected from the group consisting of: and a nucleobase sequence that differs by 0 or 1 nucleobase, wherein all or substantially all of the modified nucleotides are modified nucleotides, and SEQ ID NO: 26 or SEQ ID NO: 41, respectively, are located at nucleotide positions 1 to 19 (5'→3') of the antisense strand.

[0053] In some embodiments, the HSD17B13 RNAi agents disclosed herein comprise (5'→3'): UCAUCUAUCAGACUUCUUA (SEQ ID NO: 26); and UAAGAAGUCUGAUAGAUGA (SEQ ID NO: 67); UGAUCCAAAAAUGUCCUAG (SEQ ID NO: 41) and In the sequence, I is an inosine nucleotide, CUAGGACAUUUUUGIAUCA (SEQ ID NO: 86). and an antisense strand and a sense strand each comprising a nucleobase sequence that differs by 0 or 1 nucleobase.

[0054] In some embodiments, the HSD17B13 RNAi agents disclosed herein comprise (5'→3'): UCAUCUAUCAGACUUCUUA (SEQ ID NO: 26); and UAAGAAGUCUGAUAGAUGA (SEQ ID NO: 67); UGAUCCAAAAAUGUCCUAG (SEQ ID NO: 41) and In the sequence, I is an inosine nucleotide, CUAGGACAUUUUUGIAUCA (SEQ ID NO: 86). and an antisense strand and a sense strand each comprising a nucleobase sequence that differs by zero or one nucleobase, wherein all or substantially all of said modified nucleotides are modified nucleotides.

[0055] In some embodiments, the compositions described herein, which comprise one or more HSD17B13 RNAi agents, are packaged in kits, containers, packs, dispensers, pre-filled syringes or vials.In some embodiments, the compositions described herein are administered parenterally, for example, by subcutaneous injection.

[0056] As used herein, the terms "oligonucleotide" and "polynucleotide" refer to a polymer of linked nucleotides, each of which may or may not be independently modified.

[0057] As used herein, "RNAi agent" (also referred to as RNAi trigger) refers to a composition comprising an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that can degrade or inhibit (e.g., under appropriate conditions) translation of a messenger RNA (mRNA) transcript of a target mRNA in a sequence-specific manner. As used herein, an RNAi agent may function via the RNA interference mechanism (i.e., inducing RNA interference by interacting with the RNA interference pathway machinery (RNA-induced silencing complex or RISC) in mammalian cells) or any alternative mechanism or pathway. As used herein, RNAi agents are believed to function primarily via the RNA interference mechanism, although the disclosed RNAi agents are not constrained or limited to any particular pathway or mechanism of action. The RNAi agents disclosed herein consist of a sense strand and an antisense strand and include, but are not limited to, short (or small) interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and Dicer substrates. The antisense strand of the RNAi agent described herein is at least partially complementary to the mRNA being targeted (i.e., HSD17B13 mRNA). The RNAi agent can contain one or more modified nucleotides and / or one or more non-phosphodiester linkages.

[0058] As used herein, the terms "silence," "reduce," "inhibit," "down-regulate," or "knock down," when referring to the expression of a given gene, mean that expression of the gene is reduced when a cell, group of cells, tissue, organ, or subject is treated with an RNAi agent as described herein, as compared to a second cell, group of cells, tissue, organ, or subject that is not so treated, as measured by the level of RNA transcribed from the gene or the level of a polypeptide, protein, or protein subunit translated from mRNA in a cell, group of cells, tissue, organ, or subject in which the gene is transcribed.

[0059] As used herein, the terms "sequence" and "nucleotide sequence" mean a sequence or order of nucleic acid bases or nucleotides written as a sequence of letters using standard terminology.

[0060] As used herein, a "base," "nucleotide base," or "nucleobase" refers to a heterocyclic pyrimidine or purine compound that is a component of a nucleotide, including the major purine bases adenine and guanine, and the major pyrimidine bases cytosine, thymine, and uracil. Nucleobases may be further modified, including, but not limited to, universal bases, hydrophobic bases, promiscuous bases, expanded-size bases, and fluorinated bases. (See, for example, Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008). The synthesis of such modified nucleotides (including phosphoramidite compounds containing modified nucleotides) is known in the art.

[0061] As used herein, unless otherwise specified, the term "complementary," when used to describe a first nucleobase or nucleotide sequence (e.g., an RNAi agent sense strand or a targeting mRNA) related to a second nucleobase or nucleotide sequence (e.g., an RNAi agent antisense strand or a single-stranded antisense oligonucleotide), refers to the ability of an oligonucleotide or polynucleotide comprising a first nucleotide sequence to hydrolyze (generate base-pair hydrogen bonds under mammalian physiological conditions (or otherwise under appropriate in vivo or in vitro conditions)) and form a duplex or double-helical structure with an oligonucleotide comprising a second nucleotide sequence under specific standard conditions. Those skilled in the art will be able to select the most appropriate set of conditions for a hybridization test. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs, and include natural or modified nucleotides or nucleotide mimics, at least to the extent that they meet the above hybridization requirements. Sequencing or complementarity is independent of modifications. For example, a and Af, as defined herein, are complementary to U (or T) and equal to A for purposes of determining identity or complementarity.

[0062] As used herein, "perfectly complementary" or "fully complementary" means that in a hybridized pair of nucleic acid base or nucleotide sequence molecules, all (100%) of the bases in a contiguous sequence of a first oligonucleotide hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may include all or a portion of the first or second nucleotide sequence.

[0063] As used herein, "partially complementary" means that in a hybridized pair of nucleic acid base or nucleotide sequence molecules, at least 70%, but not all, of the bases in a contiguous sequence of a first oligonucleotide hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may include all or a portion of the first or second nucleotide sequence.

[0064] As used herein, "substantially complementary" means that in a hybridized pair of nucleic acid or nucleotide sequence molecules, at least 85%, but not all, of the bases in a contiguous sequence of a first oligonucleotide hybridize to the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may include all or a portion of the first or second nucleotide sequence.

[0065] As used herein, the terms "complementary," "fully complementary," "partially complementary," and "substantially complementary" are used in reference to nucleobase or nucleotide matching between the sense and antisense strands of an RNAi agent, or between the antisense strand of an RNAi agent and the sequence of HSD17B13 mRNA.

[0066] As used herein, the term "substantially identical" or "substantial identity" when applied to nucleic acids means that a nucleotide sequence (or a portion of a nucleotide sequence) has at least about 85% or more sequence identity compared to a reference sequence, for example, at least 90%, at least 95%, or at least 99% identity. The percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window. The percentage is calculated by determining the number of positions where the same nucleobase exists in both sequences to obtain the number of corresponding positions, dividing the number of corresponding positions by the total number of positions within the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. The invention disclosed herein encompasses nucleotide sequences that are substantially identical to the nucleotide sequences disclosed herein.

[0067] As used herein, the terms "treat," "treatment," and similar terms refer to methods or steps taken to reduce or alleviate the number, severity, and / or frequency of one or more symptoms of a disease in a subject. As used herein, "treat" and "treatment" can include preventing, managing, prophylactically treating, and / or inhibiting or reducing the number, severity, and / or frequency of one or more symptoms of a disease in a subject.

[0068] As used herein, the phrase "introducing into a cell," when referring to an RNAi agent, means functionally delivering the RNAi agent to a cell. The phrase "functional delivery" means delivering the RNAi agent to a cell in a manner that allows the RNAi agent to have a desired biological activity, e.g., sequence-specific inhibition of gene expression.

[0069] Unless otherwise noted, as used herein, the symbols [ka] The use of means that any group or groups according to the scope of the invention described herein can be linked.

[0070] As used herein, the term "isomers" refers to compounds that have the same molecular formula but differ in the nature or sequence of bonding of their atoms or in the spatial arrangement of their atoms. Isomers that differ in the spatial arrangement of their atoms are called "stereoisomers." Stereoisomers that are not mirror images of one another are called "diastereomers," and stereoisomers that are non-superimposable mirror images are called "enantiomers," or sometimes optical isomers. A carbon atom bonded to four non-identical substituents is called a "chiral center."

[0071] As used herein, unless specifically identified in a structure as having a particular configuration, for each structure in which asymmetric centers exist and which therefore give rise to enantiomers, diastereomers, or other stereoisomeric configurations, each structure disclosed herein is intended to represent all such possible isomers, including their optically pure forms and racemates. For example, the structures disclosed herein are intended to encompass not only single stereoisomers but also diastereomeric mixtures.

[0072] As used in the claims herein, the phrase "consisting of" excludes any element, step, or ingredient not specified in the claim. As used in the claims herein, the phrase "consisting essentially of" limits the scope of the claim to those materials or steps specified and that do not materially affect the basic and novel characteristics of the claimed invention.

[0073] Those skilled in the art will readily understand and appreciate that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state depending on the environment in which the compound or composition is placed. Thus, as used herein, the structures disclosed herein contemplate that certain functional groups, such as OH, SH, or NH, may be protonated or deprotonated. The disclosure herein encompasses the disclosed compounds and compositions regardless of their protonation state based on the environment (e.g., pH), as will be readily understood by those skilled in the art. Similarly, compounds described herein that contain reactive protons or base atoms should also be understood to represent the salt forms of the corresponding compounds. The compounds described herein may be in free acid, free base, or salt form. Pharmaceutically acceptable salts of the compounds described herein should be understood to be within the scope of the present invention.

[0074] As used herein, the terms "linked" or "conjugated," when referring to a connection between two compounds or molecules, mean that the two compounds or molecules are connected by a covalent bond. Unless otherwise indicated, as used herein, the terms "linked" and "conjugated" can refer to a connection between a first compound and a second compound, regardless of the presence or absence of an intervening atom or group of atoms.

[0075] As used herein, the term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to." The term "or" is used herein to mean, and is used interchangeably with, the term "and / or," unless context clearly indicates otherwise.

[0076] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art.Methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, and suitable methods and materials are described below.All publications, patent applications, patents and other references mentioned herein are incorporated herein by reference in their entirety.In case of conflict, the present specification, including definitions, will prevail.In addition, the materials, methods and examples are illustrative only and are not limiting.

[0077] Other objects, features, aspects, and advantages of the present invention will become apparent from the following detailed description, taken in conjunction with the drawings, and from the claims. [Brief explanation of the drawings]

[0078] [Figure 1A]1A-1D. Chemical structure diagram of HSD17B13 RNAi agent AD06214 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in free acid form. [Figure 1B] 1A-1D. Chemical structure diagram of HSD17B13 RNAi agent AD06214 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in free acid form. [Figure 1C] 1A-1D. Chemical structure diagram of HSD17B13 RNAi agent AD06214 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in free acid form. [Figure 1D] 1A-1D. Chemical structure diagram of HSD17B13 RNAi agent AD06214 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in free acid form.

[0079] [Figure 2A] 2A-2D. Chemical structure diagram of HSD17B13 RNAi agent AD06280 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in free acid form. [Figure 2B] 2A-2D. Chemical structure diagram of HSD17B13 RNAi agent AD06280 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in free acid form. [Figure 2C] 2A-2D. Chemical structure diagram of HSD17B13 RNAi agent AD06280 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in free acid form. [Figure 2D]2A-2D. Chemical structure diagram of HSD17B13 RNAi agent AD06280 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in free acid form.

[0080] [Figure 3A] Figures 3A-3D. Chemical structure diagram of HSD17B13 RNAi agent AD06187 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in free acid form. [Figure 3B] Figures 3A-3D. Chemical structure diagram of HSD17B13 RNAi agent AD06187 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in free acid form. [Figure 3C] Figures 3A-3D. Chemical structure diagram of HSD17B13 RNAi agent AD06187 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in free acid form. [Figure 3D] Figures 3A-3D. Chemical structure diagram of HSD17B13 RNAi agent AD06187 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in free acid form.

[0081] [Figure 4A] 4A-4D. Chemical structure diagram of HSD17B13 RNAi agent AD06276 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in free acid form. [Figure 4B] 4A-4D. Chemical structure diagram of HSD17B13 RNAi agent AD06276 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in free acid form. [Figure 4C]4A-4D. Chemical structure diagram of HSD17B13 RNAi agent AD06276 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in free acid form. [Figure 4D] 4A-4D. Chemical structure diagram of HSD17B13 RNAi agent AD06276 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in free acid form.

[0082] [Figure 5A] 5A-5D. Chemical structure diagram of HSD17B13 RNAi agent AD06277 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in free acid form. [Figure 5B] 5A-5D. Chemical structure diagram of HSD17B13 RNAi agent AD06277 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in free acid form. [Figure 5C] 5A-5D. Chemical structure diagram of HSD17B13 RNAi agent AD06277 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in free acid form. [Figure 5D] 5A-5D. Chemical structure diagram of HSD17B13 RNAi agent AD06277 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in free acid form.

[0083] [Figure 6A] 6A-6D. Chemical structure diagram of HSD17B13 RNAi agent AD06214 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in sodium salt form. [Figure 6B]6A-6D. Chemical structure diagram of HSD17B13 RNAi agent AD06214 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in sodium salt form. [Figure 6C] 6A-6D. Chemical structure diagram of HSD17B13 RNAi agent AD06214 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in sodium salt form. [Figure 6D] 6A-6D. Chemical structure diagram of HSD17B13 RNAi agent AD06214 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in sodium salt form.

[0084] [Figure 7A] 7A-7D. Chemical structure of HSD17B13 RNAi agent AD06280 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in sodium salt form. [Figure 7B] 7A-7D. Chemical structure of HSD17B13 RNAi agent AD06280 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in sodium salt form. [Figure 7C] 7A-7D. Chemical structure of HSD17B13 RNAi agent AD06280 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in sodium salt form. [Figure 7D] 7A-7D. Chemical structure of HSD17B13 RNAi agent AD06280 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in sodium salt form.

[0085] [Figure 8A]8A-8D. Chemical structure diagram of HSD17B13 RNAi agent AD06187 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in sodium salt form. [Figure 8B] 8A-8D. Chemical structure diagram of HSD17B13 RNAi agent AD06187 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in sodium salt form. [Figure 8C] 8A-8D. Chemical structure diagram of HSD17B13 RNAi agent AD06187 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in sodium salt form. [Figure 8D] 8A-8D. Chemical structure diagram of HSD17B13 RNAi agent AD06187 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in sodium salt form.

[0086] [Figure 9A] 9A-9D. Chemical structure of HSD17B13 RNAi agent AD06276 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in sodium salt form. [Figure 9B] 9A-9D. Chemical structure of HSD17B13 RNAi agent AD06276 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in sodium salt form. [Figure 9C] 9A-9D. Chemical structure of HSD17B13 RNAi agent AD06276 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in sodium salt form. [Figure 9D]9A-9D. Chemical structure of HSD17B13 RNAi agent AD06276 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in sodium salt form.

[0087] [Figure 10A] 10A-10D. Chemical structure of HSD17B13 RNAi agent AD06277 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in sodium salt form. [Figure 10B] 10A-10D. Chemical structure of HSD17B13 RNAi agent AD06277 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in sodium salt form. [Figure 10C] 10A-10D. Chemical structure of HSD17B13 RNAi agent AD06277 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in sodium salt form. [Figure 10D] 10A-10D. Chemical structure of HSD17B13 RNAi agent AD06277 conjugated to the (NAG37)s tridentate N-acetyl-galactosamine targeting ligand at the 5' end of the sense strand, shown in sodium salt form.

[0088] [Figure 11A]Figure 11A. Schematic diagram of modified sense and antisense strands of HSD17B13 RNAi agent AD06214 (see Tables 3-5) bound to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (Table 6; see Figures 1 and 6). The following abbreviations are used in Figures 11A-11E: a, c, g, i, and u are 2'-O-methyl modified nucleotides; Af, Cf, Gf, and Uf are 2'-fluoro modified nucleotides; o is a phosphodiester bond; s is a phosphorothioate bond; invAb is an inverted abasic residue; and (NAG37)s is a tridentate N-acetyl-galactosamine targeting ligand having the structure depicted in Table 6. Figure 11A discloses SEQ ID NOs: 2 and 14.

[0089] [Figure 11B] Figure 11B. Schematic of modified sense and antisense strands of HSD17B13 RNAi agent AD06280 (see Tables 3-5) bound to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6). Figure 11B discloses SEQ ID NOs: 4 and 15.

[0090] [Figure 11C] Figure 11C. Schematic of the modified sense and antisense strands of HSD17B13 RNAi agent AD06187 (see Tables 3-5) bound to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6). Figure 11C discloses SEQ ID NOs: 5 and 16.

[0091] [Figure 11D] Figure 11D. Schematic of modified sense and antisense strands of HSD17B13 RNAi agent AD06276 (see Tables 3-5) bound to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6). Figure 11D discloses SEQ ID NOs: 5 and 17.

[0092] [Figure 11E]Figure 11E. Schematic of modified sense and antisense strands of HSD17B13 RNAi agent AD06277 (see Tables 3-5) bound to an N-acetyl-galactosamine tridentate ligand having the structure of (NAG37)s (see Table 6). Figure 11D discloses SEQ ID NOs: 7 and 17. DETAILED DESCRIPTION OF THE INVENTION

[0093] RNAi agents Described herein are RNAi agents for inhibiting expression of the HSD17B13 gene (also referred to herein as HSD17B13 or 17β-HSD13 RNAi agents or HSD17B13 or 17β-HSD13 RNAi triggers). Each HSD17B13 RNAi agent includes a sense strand and an antisense strand. The sense strand and antisense strand can each be 16 to 49 nucleotides in length. The sense strand and antisense strand can be the same length or different lengths. In some embodiments, the sense strand and antisense strand are each independently 17 to 27 nucleotides in length. In some embodiments, the sense strand and antisense strand are each independently 19 to 21 nucleotides in length. In some embodiments, both the sense strand and antisense strand are each 21 to 26 nucleotides in length. In some embodiments, the sense strand and antisense strand are each 21 to 24 nucleotides in length. In some embodiments, the sense strand is approximately 19 nucleotides in length, while the antisense strand is approximately 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides long, while the antisense strand is about 23 nucleotides long. In some embodiments, the sense strand is 23 nucleotides long, while the antisense strand is 21 nucleotides long. In some embodiments, both the sense strand and the antisense strand are each 21 nucleotides long. In some embodiments, the RNAi agent sense strand and the antisense strand are each independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27 nucleotides long. In some embodiments, the double-stranded RNAi agent has a duplex length of about 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides.

[0094] Examples of nucleotide sequences used in generating HSD17B13 RNAi agents are shown in Tables 2, 3, and 4. Examples of RNAi agent duplexes comprising the sense and antisense strand sequences of Tables 2, 3, and 4 are shown in Table 5 and illustrated in Figures 1A-10D and 11A-11E.

[0095] In some embodiments, the region of complete, substantial, or partial complementarity between the sense strand and the antisense strand is 16 to 26 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and is located at or near the 5' end of the antisense strand (e.g., this region can be separated from the 5' end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not complete, substantial, or partial complementarity).

[0096] The sense strand of the HSD17B13 RNAi agent described herein comprises at least 16 contiguous nucleotides that are at least 85% identical to a core stretch sequence of the same number of nucleotides in HSD17B13 mRNA (also referred to herein as a "core stretch" or "core sequence"). In some embodiments, the sense strand core stretch sequence is 100% (fully) complementary or at least about 85% (substantially) complementary to the core stretch sequence in the antisense strand. Thus, the sense strand core stretch sequence is typically completely identical or at least about 85% identical to a nucleotide sequence of the same length present in the HSD17B13 mRNA target (e.g., sometimes referred to as a target sequence). In some embodiments, the sense strand core stretch is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the sense strand core stretch is 17 nucleotides in length. In some embodiments, the sense strand core stretch is 19 nucleotides in length.

[0097] The antisense strand of the HSD17B13 RNAi agent described herein comprises at least 16 contiguous nucleotides that are at least 85% complementary to a core stretch of the same number of nucleotides in the HSD17B13 mRNA and to a core stretch of the same number of nucleotides in the corresponding sense strand. In some embodiments, the antisense strand core stretch is 100% (fully) complementary or at least about 85% (substantially) complementary to a nucleotide sequence of the same length present in the HSD17B13 mRNA target (e.g., target sequence). In some embodiments, the antisense strand core stretch is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the antisense strand core stretch is 19 nucleotides in length. In some embodiments, the antisense strand core stretch is 17 nucleotides in length. The sense strand core stretch sequence may be the same length as the corresponding antisense core sequence, or may be a different length.

[0098] The sense strand and antisense strand of HSD17B13 RNAi agent anneal to form a double strand.The sense strand and antisense strand of HSD17B13 RNAi agent can be partially, substantially, or completely complementary to each other.In the complementary double-stranded region, the core stretch sequence of the sense strand and the antisense core stretch sequence are at least 85% complementary or 100% complementary. In some embodiments, the sense strand core stretch sequence comprises a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% or 100% complementary to a corresponding 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide sequence of the antisense strand core stretch sequence (i.e., the sense and antisense core stretch sequences of an HSD17B13 RNAi agent have a region of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that are at least 85% basepaired or 100% basepaired).

[0099] In some embodiments, the antisense strand of an HSD17B13 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the sense strand of an HSD17B13 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2 or Table 4.

[0100] In some embodiments, the sense strand and / or antisense strand optionally and independently comprise an additional 1, 2, 3, 4, 5, or 6 nucleotides (extension) at the 3'-end, 5'-end, or both the 3'-end and 5'-end of the core stretch sequence.If present, the additional nucleotides in the antisense strand may or may not be complementary to the corresponding sequence in HSD17B13 mRNA.If present, the additional nucleotides in the sense strand may or may not be identical to the corresponding sequence in HSD17B13 mRNA.If present, the additional nucleotides in the antisense strand may or may not be complementary to the additional nucleotides in the corresponding sense strand.

[0101] As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5'-end and / or 3'-end of the sense strand core stretch sequence and / or the antisense strand core stretch sequence. The extension nucleotides of the sense strand may or may not be complementary to the nucleotides in the corresponding antisense strand, either as core stretch sequence nucleotides or extension nucleotides. Conversely, the extension nucleotides of the antisense strand may or may not be complementary to the nucleotides in the corresponding sense strand, either as core stretch nucleotides or extension nucleotides. In some embodiments, both the sense and antisense strands of an RNAi agent comprise 3' and 5' extensions. In some embodiments, one or more of the 3' extension nucleotides of one strand are base-paired with one or more 5' extension nucleotides of the other strand. In other embodiments, one or more of the 3' extension nucleotides of one strand are not base-paired with one or more 5' extension nucleotides of the other strand. In some embodiments, HSD17B13 RNAi agent has an antisense strand with a 3' extension and a sense strand with a 5' extension.In some embodiments, the extension nucleotide is unpaired and forms an overhang.As used herein, " overhang " refers to the stretch of one or more unpaired nucleotides located at either end of the sense strand or the antisense strand, which do not form part of the hybridized or double-stranded part of the RNAi agent disclosed herein.

[0102] In some embodiments, the HSD17B13 RNAi agent comprises an antisense strand with a 3' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, the HSD17B13 RNAi agent comprises an antisense strand with a 3' extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprise nucleotides that are complementary to the corresponding HSD17B13 mRNA sequence. In some embodiments, one or more of the antisense strand extension nucleotides comprise nucleotides that are not complementary to the corresponding HSD17B13 mRNA sequence.

[0103] In some embodiments, the HSD17B13 RNAi agent comprises a sense strand having a 3' extension of 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprises an adenosine, uracil, or thymidine nucleotide, an AT dinucleotide, or a nucleotide that corresponds to or is identical to a nucleotide in the HSD17B13 mRNA sequence. In some embodiments, the 3' sense strand extension comprises or consists of one of the following sequences, including but not limited to: T, UT, TT, UU, UUT, TTT, or TTTT (each listed 5' to 3').

[0104] The sense strand can have a 3' extension and / or a 5' extension. In some embodiments, the HSD17B13 RNAi agent comprises a sense strand having a 5' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprise nucleotides that correspond to or are identical to nucleotides in the HSD17B13 mRNA sequence. In some embodiments, the sense strand 5' extension is one of the following sequences, including but not limited to: CA, AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, UCA, UAU, U, UU (each listed from 5' to 3').

[0105] Examples of sequences used in generating HSD17B13 RNAi agents are shown in Tables 2, 3, and 4. In some embodiments, the HSD17B13 RNAi agent antisense strand comprises any of the sequences in Table 2 or 3. In certain embodiments, the HSD17B13 RNAi agent antisense strand comprises or consists of any one of the modified sequences in Table 3. In some embodiments, the HSD17B13 RNAi agent antisense strand comprises the nucleotide sequence (5' to 3') 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21 of any of the sequences in Table 2 or 3. In some embodiments, the HSD17B13 RNAi agent sense strand comprises any of the sequences in Table 2 or 4. In some embodiments, the HSD17B13 RNAi agent sense strand comprises the nucleotide sequence (5' to 3' end) 1-18, 1-19, 1-20, 1-21, 2-19, 2-20, 2-21, 3-20, 3-21, or 4-21 of any of the sequences in Table 2 or 4. In certain embodiments, the HSD17B13 RNAi agent sense strand comprises or consists of the modified sequence of any one of the modified sequences in Table 4.

[0106] In some embodiments, the sense strand and antisense strand of an RNAi agent described herein comprise the same number of nucleotides. In some embodiments, the sense strand and antisense strand of an RNAi agent described herein comprise a different number of nucleotides. In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of an RNAi agent form a blunt end. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of an RNAi agent form a blunt end. In some embodiments, both ends of an RNAi agent form a blunt end. In some embodiments, neither end of an RNAi agent is blunt. As used herein, "blunt end" refers to the end of a double-stranded RNAi agent in which the terminal nucleotides of the two annealed strands are complementary (form complementary base pairs).

[0107] In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi agent form a frayed end. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the RNAi agent form a frayed end. In some embodiments, both ends of the RNAi agent form frayed ends. In some embodiments, neither end of the RNAi agent is a frayed end. As used herein, a frayed end refers to the end of a double-stranded RNAi agent where the terminal nucleotides of the two annealed strands are paired (i.e., do not form an overhang) but are not complementary (i.e., form a non-complementary pair). In some embodiments, one or more unpaired nucleotides at the end of one strand of the double-stranded RNAi agent form an overhang. The unpaired nucleotides may be in the sense strand or the antisense strand and create either a 3' or 5' overhang. In some embodiments, the RNAi agent comprises: a blunt end and a frayed end, a blunt end and a 5' overhanging end, a blunt end and a 3' overhanging end, a frayed end and a 5' overhanging end, a frayed end and a 3' overhanging end, two 5' overhanging ends, two 3' overhanging ends, a 5' overhanging end and a 3' overhanging end, two frayed ends, or two blunt ends. Typically, if present, the overhangs are located at the 3' end of the sense strand, the antisense strand, or both the sense and antisense strands.

[0108] The HSD17B13 RNAi agent disclosed herein can be comprised of one or more modified nucleotides.In some embodiments, substantially all nucleotides of the sense strand and substantially all nucleotides of the antisense strand of the HSD17B13 RNAi agent are modified nucleotides.The HSD17B13 RNAi agent disclosed herein can further comprise one or more modified nucleotide bonds, for example, one or more phosphorothioate bonds.In some embodiments, the HSD17B13 RNAi agent comprises one or more modified nucleotides and one or more internucleoside bonds.In some embodiments, the 2'-modified nucleotide is linked by a modified internucleoside bond.

[0109] In some embodiments, HSD17B13 RNAi agent is prepared or provided as salt, mixed salt or free acid.In some embodiments, HSD17B13 RNAi agent is prepared as sodium salt.This form that is well known in the art is within the scope of the present invention disclosed herein.

[0110] Modified Nucleotides When used in various oligonucleotide constructs, modified nucleotides can preserve the activity of the compounds intracellularly while simultaneously improving the serum stability of these compounds and can also minimize the potential for interferon activation in humans upon administration of the oligonucleotide construct.

[0111] In some embodiments, the HSD17B13 RNAi agent comprises one or more modified nucleotides. As used herein, "modified nucleotide" refers to a nucleotide other than ribonucleotide (2'-hydroxyl nucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides include, but are not limited to, deoxyribonucleotides, nucleotide mimics, abasic nucleotides, 2'-modified nucleotides, inverted nucleotides, modified nucleobase-containing nucleotides, bridged nucleotides, peptide nucleic acids (PNAs), 2',3'-seconucleotide mimics (unlocked nucleobase analogs), locked nucleotides, 3'-O-methoxy (2' internucleoside linkage) nucleotides, 2'-F-arabinonucleotides, 5'-Me,2'-fluoronucleotides, morpholino nucleotides, vinylphosphonate deoxyribonucleotides, vinylphosphonate-containing nucleotides, and cyclopropylphosphonate-containing nucleotides. 2'-modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2' position of the five-membered sugar ring) include, but are not limited to, 2'-O-methyl nucleotides, 2'-fluoro nucleotides (also referred to herein as 2'-deoxy-2'-fluoro nucleotides), 2'-deoxy nucleotides, 2'-methoxyethyl (2'-O-2-methoxyethyl) nucleotides (also referred to as 2'-MOE), 2'-amino nucleotides, and 2'-alkyl nucleotides. It is not necessary to uniformly modify all positions in a given compound. Conversely, two or more modifications can be incorporated into a single HSD17B13 RNAi agent or even into its single nucleotide. The sense strand and antisense strand of the HSD17B13 RNAi agent can be synthesized and / or modified by methods known in the art. The modification of one nucleotide is independent of the modification of another nucleotide.

[0112] Modified nucleotides include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiothiazol-1-yl, 2- ... Included are synthetic and natural nucleobases such as ocytosine, 5-halouracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3-deazaadenine.

[0113] In some embodiments, the 5' and / or 3' end of the antisense strand can contain an abasic residue (Ab), which can also be referred to as an "abasic site" or "abasic nucleotide." An abasic residue (Ab) is a nucleotide or nucleoside lacking a nucleobase at the 1' position of the sugar moiety. (See, e.g., U.S. Pat. No. 5,998,203.) In some embodiments, the abasic residue can be positioned internally in the nucleotide sequence. In some embodiments, Ab or AbAb can be added to the 3' end of the antisense strand. In some embodiments, the 5' end of the sense strand can contain one or more additional abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, UUAb, UAb, or Ab is added to the 3' end of the sense strand. In some embodiments, the abasic (deoxyribose) residue can be replaced with a ribitol (abasic ribose) residue.

[0114] In some embodiments, all or substantially all nucleotides of an RNAi agent are modified nucleotides.As used herein, an RNAi agent in which substantially all nucleotides present are modified nucleotides is an RNAi agent in which four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides in both the sense strand and the antisense strand are ribonucleotides (i.e., unmodified).As used herein, a sense strand in which substantially all nucleotides present are modified nucleotides is a sense strand in which two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand are ribonucleotides (i.e., unmodified).As used herein, an antisense strand in which substantially all nucleotides present are modified nucleotides is an antisense strand in which two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand are ribonucleotides (i.e., unmodified).In some embodiments, one or more nucleotides of an RNAi agent are unmodified ribonucleotides.

[0115] Modified internucleoside linkages In some embodiments, one or more nucleotides of an HSD17B13 RNAi agent are linked by a non-canonical bond or backbone (ie, a modified internucleoside bond or a modified backbone). Modified internucleoside linkages or backbones include, but are not limited to, phosphorothioate groups (represented herein by a lowercase "s"), chiral phosphorothioates, thiophosphates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, alkylphosphonates (e.g., methylphosphonates or 3'-alkylenephosphonates), chiral phosphonates, phosphinates, phosphoramidites (e.g., 3'-aminophosphoramidites, aminoalkylphosphoramidites, or thionophosphoramidites), thionoalkyl-phosphonates, thionoalkylphosphotriesters, morpholino linkages, boranophosphates typically having a 3'-5' linkage, 2'-5' linked analogs of boranophosphates, or boranophosphates having inverted polarity in which adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. In some embodiments, the modified internucleoside linkage or backbone lacks a phosphorus atom. Modified internucleoside linkages lacking a phosphorus atom include, but are not limited to, short-chain alkyl or cycloalkyl intersugar linkages, mixed heteroatom and alkyl or cycloalkyl intersugar linkages, or one or more short-chain heteroatom or heterocyclic intersugar linkages. In some embodiments, modified internucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones with mixed N, O, S, and CH2 moieties.

[0116] In some embodiments, the sense strand of an HSD17B13 RNAi agent can include 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, the antisense strand of an HSD17B13 RNAi agent can include 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense strand and the antisense strand can independently include 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, the sense strand of an HSD17B13 RNAi agent can include 1, 2, 3, or 4 phosphorothioate linkages, the antisense strand of an HSD17B13 RNAi agent can include 1, 2, 3, or 4 phosphorothioate linkages, or both the sense strand and the antisense strand can independently include 1, 2, 3, or 4 phosphorothioate linkages.

[0117] In some embodiments, the HSD17B13 RNAi agent sense strand contains at least two phosphorothioate internucleoside linkages. In some embodiments, the phosphorothioate internucleoside linkages are between nucleotides at positions 1-3 from the 3' end of the sense strand. In some embodiments, one phosphorothioate internucleoside linkage is at the 5' end of the sense strand nucleotide sequence, and another phosphorothioate linkage is at the 3' end of the sense strand nucleotide sequence. In some embodiments, two phosphorothioate internucleoside linkages are located at the 5' end of the sense strand, and another phosphorothioate linkage is at the 3' end of the sense strand. In some embodiments, the sense strand does not contain phosphorothioate internucleoside linkages between nucleotides, but does contain one, two, or three phosphorothioate linkages between the terminal nucleotides at both the 5' and 3' ends and an optional inverted abasic residue end cap. In some embodiments, the targeting ligand is linked to the sense strand by a phosphorothioate linkage.

[0118] In some embodiments, the HSD17B13 RNAi agent antisense strand comprises four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are between nucleotides at positions 1-3 from the 5' end of the antisense strand and between nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5' end of the antisense strand. In some embodiments, three phosphorothioate internucleoside linkages are located between positions 1-4 from the 5' end of the antisense strand, and a fourth phosphorothioate internucleoside linkage is located between positions 20-21 from the 5' end of the antisense strand. In some embodiments, the HSD17B13 RNAi agent comprises at least three or four phosphorothioate internucleoside linkages in the antisense strand.

[0119] Capping residues or moieties In some embodiments, the sense strand may include one or more capping residues or moieties, sometimes referred to as "caps," "terminal caps," or "capping residues." As used herein, a "capping residue" is a non-nucleotide compound or other moiety that can be incorporated at one or more ends of the nucleotide sequence of an RNAi agent disclosed herein. Capping residues can, in some cases, provide an RNAi agent with certain advantageous properties, such as protection against exonuclease degradation. In some embodiments, an inverted abasic residue (invAb) (also referred to in the art as an "inverted abasic site") is added as a capping residue (see Table A). (See, e.g., F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16). Capping residues are commonly known in the art and include, for example, inverted abasic residues as well as terminal C3H7 (propyl), C6H 13 (hexyl), or C 12 H 25(dododecyl) group. In some embodiments, the capping residue is present at either the 5'-end, the 3'-end, or both the 5'-end and the 3'-end of the sense strand. In some embodiments, the 5'-end and / or the 3'-end of the sense strand may contain two or more inverted abasic deoxyribose moieties as capping residues.

[0120] In some embodiments, one or more inverted abasic residues (invAb) are added to the 3'-end of the sense strand. In some embodiments, one or more inverted abasic residues (invAb) are added to the 5'-end of the sense strand. In some embodiments, one or more inverted abasic residues or inverted abasic sites are inserted into the sense strand of an RNAi agent between the targeting ligand and the nucleotide sequence. In some embodiments, the introduction of one or more inverted abasic residues or inverted abasic sites at or near the end or both ends of the sense strand of an RNAi agent allows for increased activity or other desired properties of the RNAi agent.

[0121] In some embodiments, one or more inverted abasic residues (invAb) are added to the 5'-end of the sense strand. In some embodiments, one or more inverted abasic residues can be inserted between the targeting ligand and the nucleotide sequence of the sense strand of an RNAi agent. The inverted abasic residues can be linked by phosphate, phosphorothioate (e.g., referred to herein as (invAb)s), or other internucleoside linkages. In some embodiments, the introduction of one or more inverted abasic residues at or near the terminus or both termini of the sense strand of an RNAi agent can enable increased activity or other desired properties of the RNAi agent. In some embodiments, the inverted abasic (deoxyribose) residue can be replaced with an inverted ribitol (abasic ribose) residue. In some embodiments, the 3'-end of the antisense strand core stretch sequence or the 3'-end of the antisense strand sequence can include an inverted abasic residue. The chemical structures of inverted abasic deoxyribose residues are shown in Table 6 below, as well as in the chemical structures shown in Figures 1A-10D.

[0122] HSD17B13 RNAi agent The HSD17B13 RNAi agent disclosed herein is designed to target specific position of HSD17B13 gene (SEQ ID NO: 1).As defined herein, when the 5'-end nucleobase of antisense strand matches the position that is 21 nucleotide downstream (towards the 3'-end) from the position of gene when base-pairing with gene, antisense strand sequence is designed to target the HSD17B13 gene at a given position of gene.For example, as illustrated in Table 1 and 2 herein, the antisense strand sequence designed to target the HSD17B13 gene at position 499 requires the 5'-end nucleobase of antisense strand to match the 519th position of HSD17B13 gene when base-pairing with gene.

[0123] As provided herein, an HSD17B13 RNAi agent does not require that the nucleobase at position 1 (5'→3') of the antisense strand be complementary to the gene, provided there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) of the gene across the antisense strand and a core stretch sequence of at least 16 contiguous nucleotides. For example, with respect to an HSD17B13 RNAi agent disclosed herein that is designed to target position 499 of the HSD17B13 gene, the 5'-terminal nucleobase of the antisense strand of the HSD17B13 RNAi agent must match position 519 of the gene; however, the 5'-terminal nucleobase of the antisense strand can, but need not, be complementary to position 519 of the HSD17B13 gene, provided there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) of the antisense strand and the gene across a core stretch sequence of at least 16 contiguous nucleotides. In particular, as shown in the examples disclosed herein, the specific site of binding of the antisense strand of an HSD17B13 RNAi agent to a gene (e.g., whether the HSD17B13 RNAi agent is designed to target the HSD17B13 gene at position 499, 791, 513, or some other position) is important to the level of inhibition achieved by the HSD17B13 RNAi agent.

[0124] In some embodiments, an HSD17B13 RNAi agent disclosed herein targets the HSD17B13 gene at or near the location of the HSD17B13 gene sequence shown in Table 1. In some embodiments, the antisense strand of an HSD17B13 RNAi agent disclosed herein comprises a core stretch sequence that is fully, substantially, or partially complementary to a target HSD17B13 19-mer sequence disclosed in Table 1. [Table 1]

[0125] In some embodiments, an HSD17B13 RNAi agent comprises an antisense strand in which position 19 (5'→3') of the antisense strand can base pair with position 1 of a 19-mer target sequence disclosed in Table 1. In some embodiments, an HSD17B13 RNAi agent comprises an antisense strand in which position 1 (5'→3') of the antisense strand can base pair with position 19 of a 19-mer target sequence disclosed in Table 1.

[0126] In some embodiments, an HSD17B13 RNAi agent comprises an antisense strand in which position 2 (5'→3') of the antisense strand can base pair with position 18 of a 19-mer target sequence disclosed in Table 1. In some embodiments, an HSD17B13 RNAi agent comprises an antisense strand in which positions 2-18 (5'→3') of the antisense strand can base pair with each of the respective complementary bases located at positions 18-2 of a 19-mer target sequence disclosed in Table 1.

[0127] For the RNAi agents disclosed herein, the nucleotide at position 1 (5'->3'-end) of the antisense strand may be perfectly complementary to the HSD17B13 gene, or may not be complementary to the HSD17B13 gene. In some embodiments, the nucleotide at position 1 (5'->3'-end) of the antisense strand is U, A, or dT. In some embodiments, the nucleotide at position 1 (5'->3'-end) of the antisense strand forms an A:U or U:A base pair with the sense strand.

[0128] In some embodiments, the HSD17B13 RNAi agent antisense strand comprises nucleotide sequence (5' end to 3' end) 2-18, 2-19, 2-20, or 2-21 of any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the HSD17B13 RNAi agent sense strand comprises nucleotide sequence (5' end to 3' end) 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2-19, 2-19, 2-18, or 1-18 of any of the antisense strand sequences in Table 2 or Table 4.

[0129] In some embodiments, the HSD17B13 RNAi agent consists of (i) an antisense strand comprising nucleotide sequence (5' end to 3' end) 2 to 18 or 2 to 19 of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand comprising nucleotide sequence (5' end to 3' end) 3 to 21, 2 to 21, 1 to 21, 3 to 20, 2 to 20, 1 to 20, 3 to 19, 2 to 19, 2 to 19, 2 to 18, or 1 to 18 of any of the antisense strand sequences in Table 2 or Table 4.

[0130] In some embodiments, the HSD17B13 RNAi agent comprises a core 19-mer nucleotide sequence shown in Table 2 below. [Table 2-1] [Table 2-2]

[0131] The HSD17B13 RNAi agent sense and antisense strands may comprise or consist of modified or unmodified nucleotides. In some embodiments, an HSD17B13 RNAi agent having sense and antisense strand sequences comprising or consisting of a sequence in Table 2 is all or substantially all modified nucleotides.

[0132] In some embodiments, the antisense strand of an HSD17B13 RNAi agent disclosed herein differs from any of the antisense strands in Table 2 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of an HSD17B13 RNAi agent disclosed herein differs from any of the sense strands in Table 2 by 0, 1, 2, or 3 nucleotides.

[0133] As used herein, each N set forth in the sequences disclosed in Table 2 can be independently selected from any and all nucleobases (including those found in both modified and unmodified nucleotides). In some embodiments, the N nucleotides set forth in the sequences disclosed in Table 2 have a nucleobase that is complementary to the N nucleotide at the corresponding position in the other strand. In some embodiments, the N nucleotides set forth in the sequences disclosed in Table 2 have a nucleobase that is not complementary to the N nucleotide at the corresponding position in the other strand. In some embodiments, the N nucleotides set forth in the sequences disclosed in Table 2 have a nucleobase that is the same as the N nucleotide at the corresponding position in the other strand. In some embodiments, the N nucleotides set forth in the sequences disclosed in Table 2 have a different nucleobase than the N nucleotide at the corresponding position in the other strand.

[0134] Particular modified HSD17B13 RNAi agent antisense strands, as well as their underlying unmodified nucleobase sequences, are shown in Table 3. Particular modified HSD17B13 RNAi agent sense strands, as well as their underlying unmodified nucleobase sequences, are shown in Table 4. In generating HSD17B13 RNAi agents, each of the nucleotides in each of the underlying base sequences set forth in Tables 3 and 4, above, and in Table 2, can be a modified nucleotide.

[0135] The HSD17B13 RNAi agent described herein is produced by annealing the antisense strand with the sense strand.The sense strand comprising the sequence listed in Table 2 or Table 4 can be hybridized with the antisense strand comprising the sequence listed in Table 2 or Table 3, under the condition that the two sequences have at least 85% complementary region over a continuous 16, 17, 18, 19, 20 or 21 nucleotide sequence.

[0136] In some embodiments, the HSD17B13 RNAi agent antisense strand comprises the nucleotide sequence of any of the sequences in Table 2 or Table 3.

[0137] In some embodiments, the HSD17B13 RNAi agent comprises or consists of a duplex having the sense and antisense nucleobase sequences of any of the sequences in Table 2, Table 3, or Table 4.

[0138] Examples of antisense strands containing modified nucleotides are shown in Table 3. Examples of sense strands containing modified nucleotides are shown in Table 4.

[0139] As used in Tables 3 and 4, the following symbols are used to indicate modified nucleotides and linking groups: A = adenosine-3'-phosphate; C = cytidine-3′-phosphate; G = guanosine-3′-phosphate; U = uridine-3'-phosphate I = inosine-3'-phosphate a = 2'-O-methyladenosine-3'-phosphate as = 2'-O-methyladenosine-3'-phosphorothioate c = 2'-O-methylcytidine-3'-phosphate cs = 2'-O-methylcytidine-3'-phosphorothioate g = 2'-O-methylguanosine-3'-phosphate gs = 2'-O-methylguanosine-3'-phosphorothioate t=2'-O-methyl-5-methyluridine-3'-phosphate ts = 2'-O-methyl-5-methyluridine-3'-phosphorothioate u = 2'-O-methyluridine-3'-phosphate us = 2'-O-methyluridine-3'-phosphorothioate i = 2'-O-methylinosine-3'-phosphate is = 2'-O-methylinosine-3'-phosphorothioate Af = 2'-fluoroadenosine-3'-phosphate Afs = 2'-fluoroadenosine-3'-phosphorothioate Cf = 2'-fluorocytidine-3'-phosphate Cfs = 2'-fluorocytidine-3'-phosphorothioate Gf = 2'-fluoroguanosine-3'-phosphate Gfs = 2'-fluoroguanosine-3'-phosphorothioate Tf = 2'-fluoro-5'-methyluridine-3'-phosphate Tfs = 2'-fluoro-5'-methyluridine-3'-phosphorothioate Uf = 2'-fluorouridine-3'-phosphate Ufs = 2'-fluorouridine-3'-phosphorothioate A UNA 2',3'-seco-adenosine-3'-phosphate A UNA s=2',3'-seco-cytidine-3'-phosphorothioate C UNA 2',3'-seco-cytidine-3'-phosphate C UNA s=2',3'-seco-cytidine-3'-phosphorothioate G UNA 2',3'-seco-guanosine-3'-phosphate G UNA s=2',3'-seco-guanosine-3'-phosphorothioate U UNA2',3'-seco-uridine-3'-phosphate U UNA s = 2',3'-seco-uridine-3'-phosphorothioate a_2N=See Table 6 a_2Ns=See Table 6 (invAb) = inverted abasic deoxyribonucleotide, see Table 6 (invAb)s = inverted abasic deoxyribonucleotide-5'-phosphorothioate, see Table 6

[0140] As those skilled in the art will readily understand, unless the sequence indicates otherwise (e.g., by a phosphorothioate linkage "s"), when present in an oligonucleotide, the nucleotide monomers are linked to each other by a 5'-3'-phosphodiester bond. As those skilled in the art will clearly understand, the inclusion of phosphorothioate linkages found in the modified nucleotide sequences disclosed herein replaces the phosphodiester linkages normally present in oligonucleotides (see, e.g., Figures 1A-10D, which show chemical structures, and Figures 11A-11E, which show schematics of all internucleoside linkages in specific HSD17B13 RNAi agents). Furthermore, those skilled in the art will readily understand that the terminal nucleotide at the 3' end of a given oligonucleotide sequence will typically have a hydroxyl (-OH) group at the 3' position of each of the given monomers in place of an in vitro phosphate moiety. Additionally, for the embodiments disclosed herein, when viewing each strand from 5' to 3', an inverted abasic residue is inserted such that the 3' position of the deoxyribose is linked at the 3' end of the preceding monomer in each strand (see, e.g., Figures 1A-10D and Table 6). Furthermore, as those skilled in the art will readily understand and appreciate, while the phosphorothioate chemical structures depicted herein generally show the anion of the sulfur atom, the invention disclosed herein encompasses all phosphorothioate tautomers (e.g., where the sulfur atom bears a double bond and the anion is on the oxygen atom). Unless otherwise specified herein, this understanding of those skilled in the art will be used when describing the HSD17B13 RNAi agents and compositions of HSD17B13 RNAi agents disclosed herein.

[0141] Specific examples of targeting ligands, targeting groups, and linking groups that can be used with the HSD17B13 RNAi agents disclosed herein are shown in Table 6 below. More specifically, targeting groups and linking groups (which can together form targeting ligands) include the following, the chemical structures of which are shown in Table 6 below: (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, ... (NAG39), (NAG39)s, (NAG39), (NAG40), (NAG41), (NAG42), (NAG43), (NAG44), (NAG45), (NAG46), (NAG47), (NAG48), (NAG49), (NAG50), (NAG51), (NAG52), (NAG53), (NAG54), (NAG55), (NAG56), (NAG57), (NAG58), (NAG59), (NAG51). Each sense and / or antisense strand can have any of the targeting ligands, targeting groups, or binding groups described herein, and other groups attached to the 5' and / or 3' ends of the sequence. [Table 3-1] [Table 3-2] [Table 3-3] [Table 4-1] [Table 4-2] [Table 4-3] (A 2N ) = 2-aminoadenine nucleotide

[0142] The HSD17B13 RNAi agent described herein is produced by annealing the antisense strand with the sense strand.The sense strand comprising the sequence listed in Table 2 or Table 4 can be hybridized with the antisense strand comprising the sequence listed in Table 2 or Table 3, under the condition that the two sequences have at least 85% complementary region over a continuous 16, 17, 18, 19, 20 or 21 nucleotide sequence.

[0143] In some embodiments, the antisense strand of an HSD17B13 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strands in Table 3. In some embodiments, the sense strand of an HSD17B13 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strands in Table 4.

[0144] In some embodiments, the HSD17B13 RNAi agent antisense strand comprises the nucleotide sequence of any of the sequences in Table 2 or Table 3. In some embodiments, the HSD17B13 RNAi agent antisense strand comprises the nucleotide sequence (5' to 3') 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21 of any of the sequences in Table 2 or Table 3. In certain embodiments, the HSD17B13 RNAi agent antisense strand comprises or consists of the modified sequence of any one of the modified sequences in Table 3.

[0145] In some embodiments, the HSD17B13 RNAi agent sense strand comprises the nucleotide sequence of any of the sequences in Table 2 or Table 4. In some embodiments, the HSD17B13 RNAi agent sense strand comprises the nucleotide sequence (5' to 3' end) 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, or 4-21 of any of the sequences in Table 2 or Table 4. In certain embodiments, the HSD17B13 RNAi agent sense strand comprises or consists of the modified sequence of any one of the modified sequences in Table 4.

[0146] For the RNAi agents disclosed herein, the nucleotide at position 1 (5'->3'-end) of the antisense strand may be perfectly complementary to the HSD17B13 gene, or may not be complementary to the HSD17B13 gene. In some embodiments, the nucleotide at position 1 (5'->3'-end) of the antisense strand is U, A, or dT (or modified versions thereof). In some embodiments, the nucleotide at position 1 (5'->3'-end) of the antisense strand forms an A:U or U:A base pair with the sense strand.

[0147] A sense strand comprising a sequence set forth in Table 2 or Table 4 can be hybridized to an antisense strand comprising a sequence set forth in Table 2 or Table 3, provided that the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence. In some embodiments, an HSD17B13 RNAi agent has a sense strand consisting of any of the modified sequences in Table 4, and an antisense strand consisting of any of the modified sequences in Table 3. Certain representative sequence pairings are exemplified by the duplex ID numbers shown in Table 5.

[0148] In some embodiments, the HSD17B13 RNAi agent comprises, consists of, or consists essentially of a duplex represented by any of the duplex ID numbers provided herein. In some embodiments, the HSD17B13 RNAi agent comprises the sense and antisense strand nucleotide sequences of any of the duplexes represented by any of the duplex ID numbers provided herein. In some embodiments, the HSD17B13 RNAi agent comprises the sense and antisense strand nucleotide sequences of any of the duplexes represented by any of the duplex ID numbers provided herein, and a targeting group and / or binding group, wherein the targeting group and / or binding group is covalently linked (i.e., attached) to the sense strand or the antisense strand. In some embodiments, the HSD17B13 RNAi agent comprises the sense and antisense strand modified nucleotide sequences of any of the duplex ID numbers provided herein. In some embodiments, the HSD17B13 RNAi agent comprises the sense and antisense strand modified nucleotide sequences of any of the duplex ID numbers presented herein and a targeting group and / or binding group, wherein the targeting group and / or binding group is covalently linked to the sense strand or the antisense strand.

[0149] In some embodiments, an HSD17B13 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2 or Table 5, and further comprises a targeting group or targeting ligand. In some embodiments, an HSD17B13 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2 or Table 5, and further comprises an asialoglycoprotein receptor ligand targeting group.

[0150] A targeting group, with or without a linker, can be linked to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2, 3, and 4. A linker, with or without a targeting group, can be attached to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2, 3, and 4.

[0151] In some embodiments, an HSD17B13 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2 or Table 5, each defined in Table 6: (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28). , (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s. In some embodiments, the targeting ligand is (NAG25) or (NAG25)s as defined in Table 6. In other embodiments, the targeting ligand is (NAG37) or (NAG37)s as defined in Table 6.

[0152] In some embodiments, an HSD17B13 RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand and / or sense strand nucleotide sequences in Table 3 or Table 4.

[0153] In some embodiments, an HSD17B13 RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequence of any of the duplexes in Table 5, and further comprises an asialoglycoprotein receptor ligand targeting group.

[0154] In some embodiments, the HSD17B13 RNAi agent comprises, consists of, or consists essentially of any of the duplexes in Table 5. [Table 5-1] [Table 5-2]

[0155] In some embodiments, the HSD17B13 RNAi agent is prepared or provided as a salt, mixed salt, or free acid. The RNAi agents described herein inhibit or knock down the expression of one or more HSD17B13 genes in vivo and / or in vitro upon delivery to cells expressing the HSD17B13 gene.

[0156] Targeting Ligands or Groups, Binding Groups, and Delivery Vehicles In some embodiments, the HSD17B13 RNAi agent is conjugated to one or more non-nucleotide groups, including, but not limited to, a targeting group, a linking group, a targeting ligand, a delivery polymer, or a delivery vehicle. The non-nucleotide group can facilitate targeting, delivery, or conjugation of the RNAi agent. Examples of targeting groups and linking groups are provided in Table 6. The non-nucleotide group can be covalently linked to the 3' and / or 5' end of either the sense strand and / or the antisense strand. In some embodiments, the HSD17B13 RNAi agent comprises a non-nucleotide group linked to the 3' and / or 5' end of the sense strand. In some embodiments, the non-nucleotide group is linked to the 5' end of the HSD17B13 RNAi agent sense strand. The non-nucleotide group may be linked directly or indirectly to the RNAi agent via a linker / linking group. In some embodiments, the non-nucleotide group is linked to the RNAi agent via a reactive, cleavable, or reversible bond or linker.

[0157] In some embodiments, the non-nucleotide group enhances the pharmacokinetics or biodistribution properties of the RNAi agent or conjugate to which it is attached to enhance cell-specific or tissue-specific distribution and cell-specific uptake of the RNAi agent or conjugate, hi some embodiments, the non-nucleotide group enhances endocytosis of the RNAi agent.

[0158] Targeting groups or targeting moieties enhance the pharmacokinetics or biodistribution properties of the conjugate or RNAi agent to which they are attached, thereby improving the cell-specific (including organ-specific in some cases) distribution and cell-specific (or organ-specific) absorption of the conjugate or RNAi agent. Targeting groups can be monovalent, bivalent, trivalent, tetravalent, or have higher valency with respect to the intended target. Representative targeting groups include, but are not limited to, compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity for cell surface molecules.

[0159] In some embodiments, the targeting group is linked to the RNAi agent using a linker, such as a PEG linker or one, two, or three abasic and / or ribitol (abasic ribose) residues, which can optionally serve as a linker. In some embodiments, the targeting ligand comprises a galactose derivative cluster.

[0160] The HSD17B13 RNAi agent described herein can be synthesized with a reactive group, such as an amino group (also referred to herein as an amine), at the 5'-end and / or 3'-end.The reactive group can then be used to attach a targeting moiety using methods conventional in the art.

[0161] In some embodiments, the targeting group comprises an asialoglycoprotein receptor ligand. As used herein, an asialoglycoprotein receptor ligand is a ligand comprising a compound having affinity for the asialoglycoprotein receptor. As described herein, the asialoglycoprotein receptor is highly expressed in hepatocytes. In some embodiments, the asialoglycoprotein receptor ligand comprises or consists of one or more galactose derivatives. As used herein, the term galactose derivative includes both galactose and galactose derivatives having affinity for the asialoglycoprotein receptor equal to or greater than that of galactose. Galactose derivatives include, but are not limited to, galactose, galactosamine, N-formylgalactosamine, N-acetylgalactosamine, N-propionylgalactosamine, Nn-butanoylgalactosamine, and N-isobutanoylgalactosamine (see, e.g., S.T. Iobst and K. Drickamer, JBC, 1996, 271, 6686). Galactose derivatives and clusters of galactose derivatives useful for targeting oligonucleotides and other molecules to the liver in vivo are known in the art (see, e.g., Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257, 939-945).

[0162] Galactose derivatives are used to bind to the asialoglycoprotein receptor expressed on the surface of hepatocytes, thereby targeting molecules to hepatocytes in vivo.The binding of asialoglycoprotein receptor ligands to asialoglycoprotein receptors promotes cell-specific targeting to hepatocytes and the endocytosis of molecules into hepatocytes.Asialoglycoprotein receptor ligands can be monomers (e.g., have a single galactose derivative, also referred to as monovalent or monodentate) or polymers (e.g., have multiple galactose derivatives).Galactose derivatives or galactose derivative clusters can be linked to the 3' or 5' end of the sense strand or antisense strand of RNAi agents using methods known in the art. The production of targeting ligands such as galactose derivative clusters is described, for example, in WO 2018 / 044350 (Arrowhead Pharmaceuticals, Inc.) and WO 2017 / 156012 (Arrowhead Pharmaceuticals, Inc.), the contents of both of which are incorporated herein by reference in their entirety.

[0163] As used herein, a galactose derivative cluster includes a molecule having two to four terminal galactose derivatives. The terminal galactose derivative is attached to the molecule through its C-1 carbon. In some embodiments, the galactose derivative cluster is a galactose derivative trimer (also referred to as a triantennary galactose derivative or a trivalent galactose derivative). In some embodiments, the galactose derivative cluster includes N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster includes three N-acetyl-galactosamines. In some embodiments, the galactose derivative cluster is a galactose derivative tetramer (also referred to as a tetraantennary galactose derivative or a tetravalent galactose derivative). In some embodiments, the galactose derivative cluster includes four N-acetyl-galactosamines.

[0164] As used herein, a galactose derivative trimer comprises three galactose derivatives, each linked to a central branch point. As used herein, a galactose derivative tetramer comprises four galactose derivatives, each linked to a central branch point. A galactose derivative can be linked to the central branch point through the C-1 carbon of the sugar. In some embodiments, a galactose derivative is linked to the branch point by a linker or spacer. In some embodiments, the linker or spacer is a flexible hydrophilic spacer, such as a PEG group (see, e.g., U.S. Pat. No. 5,885,968; Biessen et al. J. Med. Chem. 1995 Vol. 39 pp. 1538-1546). In some embodiments, the PEG spacer is a PEG3 spacer. The branch point can be any small molecule that allows for the attachment of three galactose derivatives and further allows for the attachment of an RNAi agent to the branch point. Examples of branch point groups are dilysine or diglutamate. The link between the branch point and the RNAi agent can be formed by a linker or spacer. In some embodiments, the linker or spacer comprises a flexible hydrophilic spacer, such as, but not limited to, a PEG spacer. In some embodiments, the linker comprises a rigid linker, such as a cyclic group. In some embodiments, the galactose derivative comprises or consists of N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster consists of a galactose derivative tetramer, which can be, for example, N-acetyl-galactosamine.

[0165] Embodiments of the present disclosure include pharmaceutical compositions for in vivo delivery of HSD17B13 RNAi agents to hepatocytes. Such pharmaceutical compositions can include, for example, HSD17B13 RNAi agents linked to galactose derivative clusters. In some embodiments, the galactose derivative clusters are composed of galactose derivative trimers, which can be, for example, N-acetyl-galactosamine trimers, or galactose derivative tetramers, which can be, for example, N-acetyl-galactosamine tetramers.

[0166] The targeting ligand or targeting group can be linked to the 3' or 5' end of the sense or antisense strand of the HSD17B13 RNAi agents disclosed herein.

[0167] Targeting ligands include (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), and (NAG30)s, as defined in Table 6. , (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), and (NAG39)s. Other targeting groups and targeting ligands, including galactose cluster targeting ligands, are known in the art.

[0168] In some embodiments, a linking group is attached to the RNAi agent. The linking group facilitates covalent attachment of the agent to a targeting group, delivery polymer, or delivery vehicle. The linking group can be attached to the 3'-end and / or 5'-end of the RNAi agent sense strand or antisense strand. In some embodiments, the linking group is attached to the RNAi agent sense strand. In some embodiments, the linking group is attached to the 5'-end or 3'-end of the RNAi agent sense strand. In some embodiments, the linking group is attached to the 5'-end of the RNAi agent sense strand. Examples of linking groups can include, but are not limited to, reactive groups such as primary amines and alkynes, alkyl groups, abasic nucleotides, ribitol (abasic ribose), and / or PEG groups.

[0169] In some embodiments, the targeting group is linked internally to a nucleotide of the sense strand and / or antisense strand of the RNAi agent. In some embodiments, the targeting group is linked to the RNAi agent by a linker.

[0170] A linker or linking group is a two-atom linkage that connects one chemical group (e.g., an RNAi agent) or segment of interest to another chemical group (e.g., a targeting group or a delivery polymer) or segment of interest by one or more covalent bonds. A reactive linkage includes a reactive bond. The linker can optionally include a spacer that increases the distance between the two connecting atoms. The spacer can further add flexibility and / or length to the linker. Spacers include, but are not limited to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, and aralkynyl groups; each of which can contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and sugars. Spacer groups are well known in the art, and the foregoing list is not intended to limit the scope of the present disclosure.

[0171] In some embodiments, when two or more RNAi agents are included in a single composition, each of the RNAi agents may be linked to the same targeting group or to two different targeting groups (i.e., targeting groups with different chemical structures). In some embodiments, the targeting group is linked to the HSD17B13 RNAi agent disclosed herein without the use of an additional linker. In some embodiments, the targeting group itself is designed with a linker or other moiety to facilitate easy existing binding. In some embodiments, when two or more HSD17B13 RNAi agents are included in a single composition, each of the RNAi agents may utilize the same linker or may utilize different linkers (i.e., linkers with different chemical structures).

[0172] Any of the HSD17B13 RNAi agent nucleotide sequences listed in Tables 2, 3, or 4, whether modified or unmodified, can include a 3' and / or 5' targeting group or linking group. Any of the HSD17B13 RNAi agent sequences listed in Tables 3 or 4 or otherwise described herein that include a 3' or 5' targeting group or linking group can alternatively include neither a 3' nor a 5' targeting group nor a linking group, or can include a different 3' or 5' targeting group or linking group, including but not limited to, those depicted in Table 6. Any of the HSD17B13 RNAi agent duplexes listed in Table 5, whether modified or unmodified, can include a targeting group or linking group, including but not limited to, those depicted in Table 6, and the targeting group or linking group can be attached to the 3' or 5' end of either the sense or antisense strand of the HSD17B13 RNAi agent duplex.

[0173] Examples of targeting groups and linking groups, which when attached can produce targeting ligands, are shown in Table 6. Table 4 shows several embodiments of HSD17B13 RNAi agent sense strands with targeting or linking groups attached to the 5' or 3' end. [Table 6-1] [Table 6-2] [Table 6-3] [Table 6-4] [Table 6-5] [Table 6-6] [Table 6-7] [Table 6-8] [Table 6-9] [Table 6-10] [Table 6-11] [Table 6-12] [Table 6-13] [Table 6-14] [Table 6-15]

[0174] In each of the above structures in Table 6, NAG comprises N-acetyl-galactosamine or another galactose derivative, as one of skill in the art would understand in light of the above structures and descriptions provided herein appended hereto. For example, in some embodiments, NAG in the provided structures is N-acetyl-galactosamine.

[0175] Each (NAGx) may be linked to the HSD17B13 RNAi agent by a phosphate group (when it is (NAG25), (NAG30), and (NAG31)), or a phosphorothioate group (when it is (NAG25)s, (NAG29)s, (NAG30)s, (NAG31)s, or (NAG37)s), or another linking group. [ka]

[0176] Other linking groups known in the art may be used. In some embodiments, RNAi agents can be delivered to cells or tissues using a delivery vehicle. A delivery vehicle is a compound that improves the delivery of RNAi agents to cells or tissues. Delivery vehicles can include, but are not limited to, polymers such as amphiphilic polymers, membrane-active polymers, peptides, melittin peptides, melittin-like peptides (MLPs), lipids, reversibly modified polymers or peptides, or reversibly modified membrane-active polyamines. In some embodiments, RNAi agents can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs, or other delivery systems available in the art. RNAi agents can also be chemically conjugated to targeting groups, lipids (including but not limited to cholesterol and cholesteryl derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (e.g., WO 2000 / 053722, WO 2008 / 0022309, WO 2011 / 104169, and WO 2012 / 083185, WO 2013 / 032829, WO 2013 / 158141, each of which is incorporated herein by reference), hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres, proteinaceous vectors, or nucleic acid or oligonucleotide delivery methods known and available in the art.

[0177] Pharmaceutical Compositions and Formulations The HSD17B13 RNAi agent disclosed herein can be formulated as a pharmaceutical composition or preparation (also referred to herein as "drug").In some embodiments, the pharmaceutical composition comprises at least one HSD17B13 RNAi agent.These pharmaceutical compositions are particularly useful for inhibiting the expression of target mRNA in target cell, cell group, tissue or organism.

[0178] The pharmaceutical composition can be used to treat a subject with a disease, disorder, or condition that would benefit from reducing the level of target HSD17B13 mRNA or inhibiting the expression of a target gene. The pharmaceutical composition can be used to treat a subject at risk of developing a disease, disorder, or condition that would benefit from reducing the level of target mRNA or inhibiting the expression of a target gene. In one embodiment, the method comprises administering to a subject to be treated an HSD17B13 RNAi agent linked to a targeting ligand described herein. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) are added to a pharmaceutical composition comprising an HSD17B13 RNAi agent, thereby producing a pharmaceutical formulation or medicament suitable for in vivo delivery to a subject, including a human.

[0179] Pharmaceutical compositions comprising HSD17B13 RNAi agents and methods disclosed herein comprise administering a therapeutically effective amount of the HSD17B13 RNAi agent described herein to a subject, thereby inhibiting HSD17B13 mRNA expression in the subject, thereby reducing the level of target mRNA in a cell, a group of cells, a group of cells, a tissue, an organ, or a subject. In some embodiments, the subject has previously been identified or diagnosed as having pathogenic upregulation of a target gene in a target cell or tissue. In some embodiments, the subject has previously been identified or diagnosed with alcoholic or non-alcoholic liver disease, such as NAFLD, NASH, liver fibrosis, and / or cirrhosis. In some embodiments, the subject suffers from symptoms associated with alcoholic or non-alcoholic liver disease, such as NAFLD, NASH, liver fibrosis, and / or cirrhosis.

[0180] In some embodiments, the described pharmaceutical compositions comprising an HSD17B13 RNAi agent are used to treat or manage alcoholic or non-alcoholic liver disease, including NAFLD, NASH, liver fibrosis, cirrhosis, and clinical conditions associated with overexpression of HSD17B13, in a subject. In some embodiments, a therapeutically (including prophylactically) effective amount of one or more pharmaceutical compositions is administered to a subject in need of such treatment. In some embodiments, administration of any of the disclosed HSD17B13 RNAi agents can be used to reduce the number, severity, and / or frequency of disease symptoms in a subject.

[0181] The pharmaceutical compositions described, comprising an HSD17B13 RNAi agent, can be used to treat at least one symptom in a subject with a disease or disorder that would benefit from reducing or inhibiting HSD17B13 mRNA expression. In some embodiments, a therapeutically effective amount of one or more pharmaceutical compositions comprising an HSD17B13 RNAi agent is administered to the subject, thereby treating the symptom. In other embodiments, a prophylactically effective amount of one or more HSD17B13 RNAi agents is administered, thereby preventing or inhibiting at least one symptom.

[0182] The administration route is the route by which HSD17B13 RNAi agent contacts with the body.Generally, the administration methods of drugs and oligonucleotides and nucleic acids for treating mammals are well known in the art and can be applied to the administration of the compositions described herein.The HSD17B13 RNAi agent disclosed herein can be administered by any suitable route, with the formulation appropriately adapted to specific route.Therefore, the pharmaceutical compositions described herein can be administered by injection, for example, intravenous, intramuscular, intradermal, subcutaneous, intraarticular or intraperitoneal injection.In some embodiments, the pharmaceutical compositions described herein are administered by subcutaneous injection.

[0183] The pharmaceutical composition comprising the HSD17B13 RNAi agent described herein can be delivered to cells, cell groups, resuscitators, or subjects using oligonucleotide delivery technology known in the art.Generally, any suitable method recognized in the art for delivering nucleic acid molecules (in vitro or in vivo) can be adapted to use the compositions described herein.For example, delivery can be by local administration (for example, direct injection, implantation, or local administration), systemic administration, or parenteral route, including subcutaneous, intravenous, intraperitoneal, or intracranial (intraventricular, intraparenchymal, and intrathecal), intramuscular, transdermal, airway (aerosol), intranasal, oral, rectal, or topical (including oral and sublingual) administration.In certain embodiments, the composition is administered by subcutaneous or intravenous infusion or injection.

[0184] In some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.

[0185] As used herein, a pharmaceutical composition or medicament comprises a pharmacologically effective amount of at least one of the therapeutic compounds described and one or more pharmaceutically acceptable excipients. A pharmaceutically acceptable excipient (excipient) is a substance other than an active pharmaceutical ingredient (API, therapeutic agent, e.g., HSD17B13 RNAi agent) that is intentionally included in a drug delivery system. The excipient does not exert, or is not intended to exert, a therapeutic effect upon intended administration. An excipient can a) aid in the processing of the drug delivery system during manufacturing; b) protect, support, or enhance the stability, bioavailability, or patient tolerability of the API; c) assist in product identification; and / or d) act to enhance other attributes of the overall safety, efficacy, or efficacy of the delivery of the API during storage or use. A pharmaceutically acceptable excipient may or may not be an inert substance.

[0186] Excipients include, but are not limited to: absorption enhancers, anti-adherents, anti-foaming agents, antioxidants, binders, buffers, carriers, coatings, colors, delivery enhancers, delivery polymers, detergents, dextran, dextrose, diluents, disintegrants, emulsifiers, bulking agents, fillers, flavorings, glidants, humectants, lubricants, oils, polymers, preservatives, saline solutions, salts, solvents, sugars, surfactants, suspending agents, sustained release matrices, sweeteners, thickeners, tonicity agents, vehicles, water repellents, and wetting agents.

[0187] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (water-soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor® EL™ (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS). Suitable carriers should be stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, the maintenance of the required particle size in the case of dispersions, and the use of surfactants. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

[0188] Sterile injection solution can be prepared by mixing active compound in the appropriate solvent with required amount, which contains one or a combination of above-mentioned components, and then optionally sterilizing by filtration.Generally, dispersion is prepared by mixing active compound in the sterile medium that contains basic dispersion medium and other necessary components from above-mentioned.For the sterile powder that is used to prepare sterile injection solution, preparation method includes vacuum drying and freeze-drying to obtain the powder of active compound plus any additional desired components from its solution that has been previously sterilized and filtered.

[0189] In some embodiments, a pharmaceutical formulation comprising an HSD17B13 RNAi agent disclosed herein suitable for subcutaneous administration can be formulated in an aqueous sodium phosphate buffer (e.g., an HSD17B13 RNAi agent formulated in 0.5 mM sodium phosphate monobasic in water, 0.5 mM sodium phosphate dibasic in water).

[0190] Formulations suitable for intra-articular administration may be in the form of a sterile aqueous preparation of the drug, which may be in microcrystalline form, for example, in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems may also be used to present the drug for both intra-articular and ophthalmic administration.

[0191] The HSD17B13 RNAi agent disclosed herein can also be formulated into a formulation suitable for oral administration.In some embodiments, the HSD17B13 RNAi agent disclosed herein is administered orally.In some embodiments, the HSD17B13 RNAi agent disclosed herein is formulated into a capsule for oral administration.

[0192] The active compound can be prepared with a carrier that will protect the compound from rapid elimination from the body, such as sustained-release formulations, including implants and microencapsulated delivery systems.Biodegradable, biocompatible polymers, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid, can be used.Methods for preparing such formulations will be clear to those skilled in the art.Liposomal suspensions can also be used as pharmaceutically acceptable carriers.Liposomal suspensions can be prepared by methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811.

[0193] HSD17B13 RNAi agent can be formulated into the composition of unit dosage form for easy administration and uniformity of dosage.Unit dosage form represents a physically separate unit suitable as a unit dosage for the subject to be treated; each unit contains a predetermined amount of active compound calculated to obtain desired therapeutic effect together with necessary pharmaceutical carrier.The specification for unit dosage form of the present disclosure is determined by and directly depends on the inherent characteristics of active compound and the therapeutic effect to be achieved, and the inherent limitations in the technical field of preparing such active compound for individual treatment.

[0194] The pharmaceutical composition may contain other additional ingredients commonly found in pharmaceutical compositions. Such additional ingredients include, but are not limited to, antipruritics, astringents, local anesthetics, analgesics, antihistamines, or anti-inflammatory drugs (e.g., acetaminophen, NSAIDs, diphenhydramine, etc.). It is also contemplated that cells, resuscitators, or isolated organs expressing or containing an RNAi agent as defined herein may be used as a "pharmaceutical composition." As used herein, "a pharmacologically effective amount of," "a therapeutically effective amount," or simply "an effective amount" refers to the amount of an RNAi agent that achieves a pharmacological, therapeutic, or preventative result.

[0195] In some embodiments, the methods disclosed herein further comprise administering a second therapeutic agent or treatment in addition to administering an RNAi agent disclosed herein. In some embodiments, the second therapeutic agent is another HSD17B13 RNAi agent (e.g., an HSD17B13 RNAi agent that targets a different sequence within the HSD17B13 target). In other embodiments, the second therapeutic agent may be a small molecule drug, an antibody, an antibody fragment, or an aptamer.

[0196] In some embodiments, the described HSD17B13 RNAi agent may be combined with one or more additional therapeutic agents, if desired. The HSD17B13 RNAi agent and the additional therapeutic agent may be administered in a single composition or separately. In some embodiments, the one or more therapeutic agents are administered separately from the RNAi agent in a different dosage form (e.g., the HSD17B13 RNAi agent is administered by subcutaneous injection, while the additional therapeutic agent(s) in the therapeutic administration regimen are administered orally). In some embodiments, the described HSD17B13 RNAi agent is administered to a subject in need thereof by subcutaneous injection, and one or more optional additional therapeutic agents are administered orally, which together provide a therapeutic regimen for diseases and conditions associated with alcoholic or non-alcoholic liver disease, including NAFLD, NASH, liver fibrosis, and / or cirrhosis. In some embodiments, the described HSD17B13 RNAi agent is administered to a subject in need thereof by subcutaneous injection, and one or more optional additional therapeutic agents are administered by separate subcutaneous injection. In some embodiments, the HSD17B13 RNAi agent and one or more additional therapeutic agents are combined in a single dosage form (e.g., a "cocktail" formulated into a single composition for subcutaneous injection).The HSD17B13 RNAi agent, with or without one or more additional therapeutic agents, can be combined with one or more excipients to produce a pharmaceutical composition.

[0197] Generally, an effective amount of an HSD17B13 RNAi agent will range from about 0.1 to about 100 mg / kg body weight per dose, e.g., from about 1.0 to about 50 mg / kg body weight per dose. In some embodiments, an effective amount of active compound will range from about 0.25 to about 5 mg / kg body weight per dose. In some embodiments, an effective amount of active ingredient will range from about 0.5 to about 4 mg / kg body weight per dose. Depending on the dose of HSD17B13 RNAi agent administered, the activity level of the particular HSD17B13 RNAi agent, and the desired level of inhibition for a particular subject, administration may be weekly, biweekly, monthly, or at other intervals. Examples herein demonstrate appropriate levels of inhibition in particular animal species. The amount administered will depend on variables such as the patient's overall health, the relative bioavailability of the compound being delivered, the formulation of the agent, the presence and type of excipients in the formulation, and the route of administration. Furthermore, it should be understood that the initial dosage administered may be increased beyond the upper level noted above to rapidly reach the desired blood or tissue level, or the initial dosage may be less than optimal.

[0198] For the treatment of a disease or for the manufacture of a medicament or composition for the treatment of a disease, the pharmaceutical compositions described herein comprising an HSD17B13 RNAi agent can be combined with an excipient or a second therapeutic agent or treatment, including, but not limited to, a second or other RNAi agent, a small molecule agent, an antibody, an antibody fragment, a peptide and / or an aptamer.

[0199] When added to pharmaceutically acceptable excipient or adjuvant, the HSD17B13 RNAi agent described can be packaged in kit, container, pack or dispenser.The pharmaceutical compositions described herein can be packaged in pre-filled syringe or vial.

[0200] Methods of Treatment and Inhibition of Expression The HSD17B13 RNAi agents disclosed herein can be used to treat subjects (e.g., humans or other mammals) with a disease or disorder that would benefit from administration of the RNAi agent. In some embodiments, the RNAi agents disclosed herein can be used to treat subjects that would benefit from reducing and / or inhibiting HSD17B13 mRNA expression and / or HSD17B13 (alternatively referred to herein as 17β-HSD13) protein levels, for example, subjects diagnosed with or suffering from a condition associated with alcoholic or non-alcoholic liver disease, including NAFLD, NASH, liver fibrosis, and cirrhosis.

[0201] In some embodiments, a therapeutically effective amount of any one or more HSD17B13 RNAi agents is administered to a subject. Treatment of a subject can include therapeutic and / or prophylactic treatment. A therapeutically effective amount of any one or more HSD17B13 RNAi agents described herein is administered to a subject. The subject can be a human, a patient, or a human patient. The subject can be an adult, an adolescent, a child, or an infant. The administration of the pharmaceutical compositions described herein can be to a human or an animal.

[0202] The HSD17B13 RNAi agents described herein can be used to treat at least one symptom in a subject with an HSD17B13-related disease or disorder or a disease or disorder mediated at least in part by HSD17B13 gene expression. In some embodiments, the HSD17B13 RNAi agents are used to treat or manage clinical symptoms in a subject with a disease or disorder that would benefit from or is at least in part mediated by a reduction in HSD17B13 mRNA. The subject is administered a therapeutically effective amount of one or more HSD17B13 RNAi agents or HSD17B13 RNAi agent-containing compositions described herein. In some embodiments, the methods disclosed herein include administering a composition containing a HSD17B13 RNAi agent described herein to a subject to be treated. In some embodiments, a prophylactically effective amount of any one or more of the HSD17B13 RNAi agents described herein is administered to the subject, thereby treating the subject by preventing or inhibiting at least one symptom.

[0203] In certain embodiments, the present disclosure provides methods for treating a disease, disorder, condition, or pathological state mediated at least in part by HSD17B13 gene expression in a patient in need thereof, the method comprising administering to the patient any of the HSD17B13 RNAi agents described herein.

[0204] In some embodiments, the gene expression level and / or mRNA level of the HSD17B13 gene in a subject administered with a described HSD17B13 RNAi agent is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to the subject before administration of the HSD17B13 RNAi agent or a subject that has not received the HSD17B13 RNAi agent. The gene expression level and / or mRNA level in a subject may be reduced in a cell, group of cells, and / or tissue of the subject.

[0205] In some embodiments, HSD17B13 protein levels in a subject administered a described HSD17B13 RNAi agent are reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to the subject before administration of the HSD17B13 RNAi agent or a subject not receiving the HSD17B13 RNAi agent. Protein levels in a subject may be reduced in the subject's cells, cell populations, tissues, blood, and / or other bodily fluids.

[0206] The reduction of HSD17B13 mRNA level and HSD17B13 protein level can be evaluated by any method known in the art.As used herein, the reduction or reduction of HSD17B13 mRNA level and / or HSD17B13 protein level is collectively referred to herein as the reduction or reduction of HSD17B13 or the inhibition or reduction of the expression of HSD17B13.The examples described herein illustrate the known method for evaluating the inhibition of HSD17B13 gene expression.Those skilled in the art will also know the suitable method for evaluating the inhibition of HSD17B13 gene expression in vivo and / or in vitro.

[0207] In some embodiments, disclosed herein are methods for treating (including prophylactic or preventative treatment) a disease, disorder, or condition caused by alcoholic or non-alcoholic liver disease, including NAFLD, NASH, liver fibrosis, and / or cirrhosis, the method comprising administering to a subject in need thereof a therapeutically effective amount of an HSD17B13 RNAi agent comprising an antisense strand that is at least partially complementary to a portion of HSD17B13 mRNA having a sequence in Table 1. In some embodiments, disclosed herein are methods for treating (including prophylactic or preventative treatment) a disease or condition caused by alcoholic or non-alcoholic liver disease, including NAFLD, NASH, liver fibrosis, and / or cirrhosis, the method comprising administering to a subject in need thereof a therapeutically effective amount of an HSD17B13 RNAi agent comprising an antisense strand that is at least partially complementary to a portion of HSD17B13 mRNA having a sequence in Table 1. In some embodiments, disclosed herein are methods for treating (including prophylactic or preventative treatment) a disease or condition caused by alcoholic or non-alcoholic liver disease, including NAFLD, NASH, liver fibrosis, and / or cirrhosis, the method comprising administering to a subject in need thereof a therapeutically effective amount of an HSD17B13 RNAi agent comprising a sense strand comprising any of the sequences in Table 2 or 4, and an antisense strand comprising any of the sequences in Table 2 or 3 that is at least partially complementary to the sense strand.

[0208] In some embodiments, disclosed herein are methods for inhibiting HSD17B13 gene expression in a cell, the method comprising administering to the cell an HSD17B13 RNAi agent comprising an antisense strand that is at least partially complementary to a portion of HSD17B13 mRNA having a sequence in Table 1. In some embodiments, disclosed herein are methods for inhibiting HSD17B13 gene expression in a cell, the method comprising administering to the cell an HSD17B13 RNAi agent comprising an antisense strand that is at least partially complementary to a portion of HSD17B13 mRNA having a sequence in Table 1. In some embodiments, disclosed herein are methods for inhibiting HSD17B13 gene expression in a cell, the method comprising administering to the cell an HSD17B13 RNAi agent comprising an antisense strand that is at least partially complementary to a portion of HSD17B13 mRNA having a sequence in Table 1.

[0209] The use of HSD17B13 RNAi agents provides methods for therapeutic (including prophylactic) treatment of diseases / disorders associated with alcoholic or non-alcoholic fatty liver disease, including NAFLD, NASH, liver fibrosis, and cirrhosis, and / or promoting or increasing HSD17B13 expression. The described HSD17B13 RNAi agents mediate RNA interference to inhibit the expression of one or more genes required for the production of HSD17B13 protein. HSD17B13 RNAi agents can also be used to treat or prevent various diseases, disorders, or conditions, including alcoholic or non-alcoholic liver disease, including NAFLD, NASH, liver fibrosis, and / or cirrhosis. Additionally, compositions for in vivo delivery of HSD17B13 RNAi agents to hepatocytes are described.

[0210] Cells, tissues, organs, and non-human organisms Contemplated herein are cells, tissues, organs, and non-human organisms that contain at least one of the HSD17B13 RNAi agents described herein. The RNAi agent is delivered to the cell, tissue, organ, or non-human organism, thereby modifying the cell, tissue, organ, or non-human organism.

[0211] The above-provided embodiments and articles will now be illustrated with the following non-limiting examples. [Example]

[0212] Example 1. Synthesis of HSD17B13 RNAi Agents The HSD17B13 RNAi agent duplexes shown in Table 5 above were synthesized according to the following general procedure.

[0213] A. Synthesis. The sense and antisense strands of the RNAi agents were synthesized according to the solid-phase phosphoramidite technique used in oligonucleotide synthesis. Such standard synthesis is commonly known in the art. Depending on the scale, either a MerMade96E® (Bioautomation), a MerMade12® (Bioautomation), or an OP Pilot100 (GE Healthcare) was used. Synthesis was performed on a controlled-pore glass solid support (CPG, 500 Å or 600 Å, obtained from Prime Synthesis (Aston, PA, USA)). The monomer located at the 3' end of each strand was attached to the solid support as the starting point for synthesis. All RNA and 2'-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA) or Hongene Biotech (Shanghai, China). 2'-O-methyl phosphoramidites included the following: (5'-O-dimethoxytrityl-N 6 -(Benzoyl)-2′-O-methyl-adenosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite, 5′-O-dimethoxy-trityl-N 4-(acetyl)-2′-O-methyl-cytidine-3′-O-(2-cyanoethyl-N,N-diisopropyl-amino)phosphoramidite, (5′-O-dimethoxytrityl-N 2 5'-(isobutyryl)-2'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite, and 5'-O-dimethoxytrityl-2'-O-methyl-uridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite. The 2'-deoxy-2'-fluorophosphoramidite possesses the same protecting groups as the 2'-O-methylamidite. 5'-(4,4'-dimethoxytrityl)-2',3'-seco-uridine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]phosphoramidite were also purchased from Thermo Fisher Scientific or Hongene Biotech. 5'-Dimethoxytrityl-2'-O-methyl-inosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was purchased from Glen Research (VA, USA) or Hongene Biotech. Inverted abasic (3'-O-dimethoxytrityl-2'-deoxyribose-5'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was purchased from ChemGenes (Wilmington, MA, USA) or SAFC (St. Louis, MO, USA). 5'-O-Dimethoxytrityl-N 2 ,N 6 -(phenoxyacetate)-2'-O-methyl-diaminopurine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was purchased from ChemGene or Hongene Biotech.

[0214] The targeting ligand-containing phosphoramidite was dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while all other amidites were dissolved in anhydrous acetonitrile (50 mM) or anhydrous dimethylformamide and molecular sieves (3 Å) were added. 5-benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as the activator solution. Coupling times were 12 min (RNA), 15 min (targeting ligand), 90 s (2'OMe), and 60 s (2'F). To introduce phosphorothioate linkages, 3-phenyl-1,2,4-dithiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used. Unless specifically specified as a "naked" RNAi agent without a targeting ligand, the HSD17B13 RNAi agent duplexes synthesized and tested in the following examples utilized N-acetyl-galactosamine as "NAG" in the targeting ligand chemical structures shown in Table 6. The chemical structures of the specific duplexes used in the examples reported herein can be seen in Figures 1A-10D.

[0215] B. Cleavage and Deprotection of Support-Bound Oligomers After solid-phase synthesis workup, the dry solid support was treated with a 1:1 volume solution of 40 wt % aqueous methylamine and 28% ammonium hydroxide solution (Aldrich) for 1.5 h at 30° C. The solution was evaporated and the solid residue was redissolved in water (see below).

[0216] C. Purification. The crude oligomer was purified by anion-exchange HPLC using a TSK Gel SuperQ-5PW 13 μm column and a Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0, containing 20% ​​acetonitrile, and buffer B was the same as buffer A but with the addition of 1.5 M sodium chloride. UV traces at 260 nm were recorded. Appropriate fractions were pooled and then injected onto a size-exclusion HPLC column packed with Sephadex G-25 fine, eluted with either filtered DI water or 100 mM ammonium bicarbonate, pH 6.7, and 20% acetonitrile.

[0217] D. Annealing. RNAi agents were prepared by combining the complementary strands in equimolar RNA solutions (sense and antisense) in 1x phosphate-buffered saline (Corning, Cellgro). Some RNAi agents were lyophilized and stored at -15 to -25°C. The duplex concentration was determined by measuring the absorbance of the solution in 1x phosphate-buffered saline using a UV-visible spectrometer. The solution absorbance at 260 nm was then multiplied by the conversion factor and dilution factor to determine the duplex concentration. The conversion factor used was 0.050 mg / (mL·cm) or calculated from the experimentally determined extinction coefficient.

[0218] Example 2. In vivo testing of HSD17B13 RNAi agents in rats. Sprague-Dawley rats were used to evaluate the in vivo activity of HSD17B13 RNAi agents designed to target different locations on the HSD17B13 gene. On day 1, each rat received a single subcutaneous injection of 500 μl / 200 g animal body weight containing 3.0 mg / kg (mpk) of HSD17B13 RNAi agent formulated in a pharmaceutically acceptable saline buffer or vehicle control (saline buffer without RNAi agent) according to the treatment groups listed in Table 7. [Table 7]

[0219] Each RNAi agent contained a modified sequence and a tridentate N-acetylgalactosamine-containing targeting ligand attached to the 5' end of the sense strand. (See Tables 3-6 for the modified sequence and targeting ligand structure.) HSD17B13 RNAi agents AD06079, AD06080, and AD06081 (groups 2, 3, and 4) each contained a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 488 of the gene; HSD17B13 RNAi agents AD06082 and AD06083 (groups 5 and 6) each contained a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 492 of the gene; and HSD17B13 RNAi agents AD06084 and AD06085 (groups 7 and 8) each contained a nucleotide sequence designed to inhibit HSD17B13 gene expression at position 499 of the gene. (See, for example, SEQ ID NO: 1 and Table 2 for the referenced HSD17B13 gene).

[0220] Injections were administered intracutaneously and intramuscularly (i.e., subcutaneously) into the loose skin over the neck and shoulders. Three rats in each group were tested (n=3). On day 15, all rats were sacrificed. Livers were harvested, and approximately 100 mg of liver samples were taken and snap-frozen in liquid nitrogen for RNA isolation. The relative expression levels of each of the HSD17B13 RNAi agents were determined by pRT-PCR by normalizing the HSD17B13 mRNA expression levels of animals from each respective treatment group to those of Group 1 (vehicle control, no RNAi agent) (ΔΔC T Analysis), the results of which are shown in Table 8 below. [Table 8]

[0221] As shown in Table 8, on day 15, each of the RNAi agents in groups 2-8 showed a reduction in HSD17B13 mRNA levels compared to the vehicle control. For example, a single subcutaneous administration of 3.0 mg / kg of the HSD17B13 RNAi agent AD06085 showed an approximately 87% (0.131) reduction in HSD17B13 mRNA on day 15.

[0222] Example 3. In vivo testing of HSD17B13 RNAi agents in rats. To evaluate the in vivo activity of additional HSD17B13 RNAi agents, Sprague-Dawley rats were used. On day 1, each rat received a single subcutaneous injection of 500 μl / 200 g animal body weight containing 3.0 mg / kg (mpk) of HSD17B13 RNAi agent formulated in a pharmaceutically acceptable saline buffer, or vehicle control (saline buffer without RNAi agent), according to the dosing groups listed in Table 9. [Table 9]

[0223] Each RNAi agent contained a modified sequence and a tridentate N-acetylgalactosamine-containing targeting ligand attached to the 5' end of the sense strand. (See Tables 3-6 for the modified sequence and targeting ligand structure.) All HSD17B13 RNAi agents tested (Groups 2-10) contained a nucleotide sequence designed to inhibit expression of the HSD17B13 gene at position 488 of the gene. (See, for example, SEQ ID NO: 1 and Table 2 for the reference HSD17B13 gene.)

[0224] Injections were administered intracutaneously and intramuscularly (i.e., subcutaneously) into the loose skin over the neck and shoulders. Four rats in each group were tested (n=4). On day 15, all rats were sacrificed. Livers were harvested, and approximately 100 mg of liver samples were taken and snap-frozen in liquid nitrogen for RNA isolation. The relative expression levels of each of the HSD17B13 RNAi agents were determined by pRT-PCR by normalizing the HSD17B13 mRNA expression levels of animals from each respective treatment group to animals in group 1 (vehicle control, no RNAi agent) (ΔΔC T Analysis), the results of which are shown in Table 10 below. [Table 10]

[0225] As shown in Table 10, each of the RNAi agents in Groups 2-10 demonstrated a reduction in HSD17B13 mRNA levels compared to the vehicle control at Day 15. Group 9 (AD06182) demonstrated only an approximately 20% (0.800) reduction in HSD17B13 mRNA at Day 15. However, each of the remaining HSD17B13 RNAi agents tested (i.e., Groups 2-8 and 10) demonstrated an approximately 65% ​​(Group 10, 0.348) to approximately 81% (Group 3, 0.196) reduction in HSD17B13 mRNA at Day 15 after a single subcutaneous administration.

[0226] Example 4. In vivo testing of HSD17B13 RNAi agents in rats. To evaluate the in vivo activity of certain additional HSD17B13 RNAi agents, Sprague-Dawley rats were used. On day 1, each rat received a single subcutaneous injection of 500 μl / 200 g animal body weight containing 3.0 mg / kg (mpk) of HSD17B13 RNAi agent formulated in a pharmaceutically acceptable saline buffer, or vehicle control (saline buffer without RNAi agent), according to the dosing groups listed in Table 11. [Table 11]

[0227] Each RNAi agent contained a modified sequence and a tridentate N-acetylgalactosamine-containing targeting ligand attached to the 5' end of the sense strand. (See Tables 3-6 for the modified sequence and targeting ligand structure.) HSD17B13 RNAi agents AD06085, AD06184, AD06185, AD06186, AD06187, AD06188, AD06189, and AD06190 (Groups 2-9) each contained a nucleotide sequence at position 499 of the gene designed to inhibit expression of the HSD17B13 gene; HSD17B13 RNAi agents AD06082 and AD06191 contained a nucleotide sequence at position 492 of the gene designed to inhibit expression of the HSD17B13 gene. (See, for example, SEQ ID NO: 1 and Table 2 for the reference HSD17B13 gene.)

[0228] Injections were administered intracutaneously and intramuscularly (i.e., subcutaneously) into the loose skin over the neck and shoulders. Four rats in each group were tested (n=4). On day 15, all rats were sacrificed. Livers were harvested, and approximately 100 mg of liver samples were taken and snap-frozen in liquid nitrogen for RNA isolation. The relative expression levels of each of the HSD17B13 RNAi agents were determined by pRT-PCR by normalizing the HSD17B13 mRNA expression levels of animals from each respective treatment group to animals in group 1 (vehicle control, no RNAi agent) (ΔΔC T The results are shown in Table 12 below. [Table 12]

[0229] As shown in Table 12, each of the RNAi agents in Groups 2-11 showed a reduction in HSD17B13 mRNA levels compared to the control at day 15. More specifically, at day 15, HSD17B13 RNAi agent AD06187 showed an approximately 90% (0.0099) reduction in HSD17B13 mRNA after a single subcutaneous administration, and HSD17B13 RNAi agent AD06085 showed an approximately 79% (0.211) reduction in HSD17B13 mRNA.

[0230] Example 5. In vivo testing of HSD17B13 RNAi agents in cynomolgus monkeys. The HSD17B13 RNAi agent AD06078 was evaluated in cynomolgus monkeys. On days 1 and 22, two cynomolgus monkey (Macaca fascicularis) primates (also referred to herein as "cynos") received a 0.4 mL / kg (approximately 3 mL volume, depending on animal mass) subcutaneous injection containing 4.0 mg / kg of HSD17B13 RNAi agent AD06078 formulated in saline. The HSD17B13 RNAi agent AD06078 contained the modified nucleotides shown in Tables 3-6 and a tridentate N-acetyl-galactosamine-containing targeting ligand ((NAG37)s) conjugated to the 5' end of the sense strand. The HSD17B13 RNAi agent AD06078 contained a nucleotide sequence designed to inhibit expression of the HSD17B13 gene at position 1501 of the gene. (See, for example, SEQ ID NO: 1 and Table 2 for the referenced HSD17B13 gene).

[0231] Liver biopsies were taken on days -8 (pre-dose), 15, 29, and 43. On each biopsy day, cynos were anesthetized, and ultrasound-guided liver biopsies were performed to extract two or three liver tissue samples approximately 1 mm x 2 mm in size. The biopsy samples were then homogenized, and HSD17B13 mRNA levels in cyno livers were measured by RT-qPCR. The results were then normalized to the pre-dose (in this case, day -8) HSD17B13 mRNA measurements. The resulting mRNA data are reflected in Tables 13 and 14 below. [Table 13] ** The day 29 biopsy sample from Sino #1 was smaller than normal and, based on its excessively pale appearance, was likely adipose tissue and not liver tissue. Therefore, analysis on day 29 was not performed. [Table 14]

[0232] Both cynos receiving AD06078 showed a reduction in liver-specific HSD17B13 mRNA compared to pre-treatment measurements through day 43. At day 43, for example, the second cyno had a reduction in HSD17B13 mRNA of approximately 67% (0.335) compared to pre-treatment levels.

[0233] Example 6. HSD17B13-SEAP mouse model. To evaluate specific additional HSD17B13 RNAi agents, the HSD17B13-SEAP mouse model was used. Six- to eight-week-old female C57BL / 6 albino mice were transiently transfected in vivo with the plasmid by hydrodynamic tail vein injection at least 29 days before administration of the HSD17B13 RNAi agent or control. The plasmid contained the HSD17B13 cDNA sequence (GenBank NM_178135.4 (SEQ ID NO: 1)) inserted into the 3'UTR of the SEAP (secreted human placental alkaline phosphatase) reporter gene. To generate the HSD17B13-SEAP model, mice were injected via the tail vein with 50 μg of the plasmid containing the HSD17B13 cDNA sequence in Ringer's solution in a total volume of 10% of the animal's body weight. The solution was injected over 5–7 seconds using a 27-gauge needle, as previously described (Zhang G et al., "High levels of foreign gene expression in hepatocytes after tail vein injection of naked plasmid DNA," Human Gene Therapy, 1999, Vol. 10, pp. 1735–1737). Inhibition of HSD17B13 expression by HSD17B13 RNAi agents resulted in a concomitant inhibition of measured SEAP expression. Before treatment administration (days −7 to 1 before administration), serum SEAP expression levels were measured using the Phospha-Light™ SEAP Reporter Gene Assay System (Invitrogen), and mice were grouped by mean SEAP levels.

[0234] Mice were anesthetized with 2-3% isoflurane, and blood samples were collected submandibularly into serum separator tubes (Sarstedt AG & Co., Nümbrecht, Germany). Blood was allowed to clot for 20 minutes at ambient temperature. Tubes were centrifuged at 8,000 × g for 3 minutes, and serum was separated and stored at 4°C. Serum was collected and measured using the Phospha-Light™ SEAP Reporter Gene Assay System (Invitrogen) according to the manufacturer's instructions. To account for untreated decreases in HSD17B13 expression in this model, serum SEAP levels for each animal can be normalized to a control group of mice injected with a vehicle control. To do so, each animal's SEAP level at a given time point was first divided by that animal's untreated level of expression (day -1) to determine a "normalized to pretreatment" expression ratio. Expression at a specific time point was then normalized to the control group by dividing the individual animal's "normalized to pretreatment" ratio by the average "normalized to pretreatment" ratio for all mice in the normal vehicle control group. Alternatively, serum SEAP levels for each animal were assessed simply by normalizing to pre-treatment levels.

[0235] Example 7. In vivo testing of HSD17B13 RNAi agents in HSD17B13-SEAP mice. The HSD17B13-SEAP mouse model described above in Example 6 was used. On day 1, each rat received a single subcutaneous dose of 200 μl / 20 g animal body weight containing either 3.0 mg / kg (mpk) of HSD17B13 RNAi agent formulated in a pharmaceutically acceptable saline buffer according to Table 15 below, or a vehicle control (saline buffer without RNAi agent). [Table 15]

[0236] Each HSD17B13 RNAi agent contained a targeting ligand containing three N-acetylgalactosamine groups (tridentate ligand) with the modified sequence described herein in the duplex structure, and a modified nucleotide attached at the 5' end of the sense strand. (See Tables 3-6 for specific modifications and structural information related to the HSD17B13 RNAi agents.) HSD17B13 RNAi agent AD06078 (Group 2) contained a nucleotide sequence designed to inhibit expression of the HSD17B13 gene at position 1501 of the gene; HSD17B13 RNAi agent AD06081 (Group 3) contained a nucleotide sequence designed to inhibit expression of the HSD17B13 gene at position 488 of the gene; and HSD17B13 RNAi agents AD06084 and AD06085 contained a nucleotide sequence designed to inhibit expression of the HSD17B13 gene at position 499 of the gene. (See SEQ ID NO: 1 and Table 2 for the reference HSD17B13 gene.)

[0237] Cutaneous and intramuscular injections (i.e., subcutaneous injections) were administered into the loose skin over the neck and shoulders. Four mice in each group were tested (n=4). Serum was collected on days -2 (before treatment), 8, 15, 22, and 29, and SEAP expression levels were determined according to the procedure described in Example 6 above. The data from the experiments are shown in Tables 16 and 17 below. [Table 16] *As noted above in Example 6, the gradual decline in SEAP in the vehicle control group (Group 1) over time is due to loss of the SEAP reporter gene in mouse cells due to natural cell replication in the animals. [Table 17]

[0238] Each of the HSD17B13 RNAi agents in each of the treatment groups (i.e., Groups 2-5) showed a reduction in SEAP compared to the vehicle control (Group 1) on days 8 and 15. Furthermore, HSD17B13 RNAi agents AD06084 and AD06085, both of which contain nucleotide sequences designed to inhibit expression at position 499 of the HSD17B13 gene, showed particularly high levels of knockdown by day 22 (comparison of Group 1 with Groups 4 and 5).

[0239] Example 8. In vivo testing of HSD17B13 RNAi agents in cynomolgus monkeys. The HSD17B13 RNAi agents AD06078, AD06187, AD06278, and AD06280 were evaluated in cynomolgus monkeys. On days 1 and 30, three cynos (n=3) from each group received a 0.3 mL / kg subcutaneous injection (approximately 3 mL volume, depending on animal mass) containing 3.0 mg / kg of each HSD17B13 RNAi agent formulated in saline. The HSD17B13 RNAi agents contained modified nucleotides shown in Tables 3-6 and a tridentate N-acetyl-galactosamine-containing targeting ligand ((NAG37)s) conjugated to the 5' end of the sense strand. HSD17B13 RNAi agent AD06078 (group 1) comprises a nucleotide sequence designed to inhibit the expression of the HSD17B13 gene at position 1501 of the gene; HSD17B13 RNAi agent AD06187 (group 2) comprises a nucleotide sequence designed to inhibit the expression of the HSD17B13 gene at position 499 of the gene; HSD17B13 RNAi agent AD06278 (group 3) comprises a nucleotide sequence designed to inhibit the expression of the HSD17B13 gene at position 513 of the gene; HSD17B13 RNAi agent AD06280 (group 4) comprises a nucleotide sequence designed to inhibit the expression of the HSD17B13 gene at position 791 of the gene. (For example, see SEQ ID NO: 1 and Table 2 for the reference HSD17B13 gene).

[0240] Liver biopsies were taken on days -7 (pre-dose), 15, 29, and 43. On each biopsy collection day, cynos were anesthetized, and two liver tissue samples, approximately 80 mg to 120 mg each, were extracted using laparoscopy. The biopsy samples were then homogenized, and HSD17B13 mRNA levels in cyno livers were measured by RT-qPCR. The results were then normalized to the pre-dose (in this case, day -7) HSD17B13 mRNA measurements. The resulting mRNA data are reflected in Table 18 below. [Table 18]

[0241] Example 9. In vivo testing of HSD17B13 RNAi agents in HSD17B13-SEAP mice. The HSD17B13-SEAP mouse model described above in Example 6 was used. On day 1, each rat received a single subcutaneous dose of 200 μl / 20 g animal body weight containing either 3.0 mg / kg (mpk) of HSD17B13 RNAi agent formulated in a pharmaceutically acceptable saline buffer according to Table 19 below, or a vehicle control (saline buffer without RNAi agent). [Table 19]

[0242] Each of the HSD17B13 RNAi agents contained a targeting ligand containing three N-acetyl-galactosamine groups (a tridentate ligand) with the modified sequence described in the duplex structure herein, and a modified nucleotide attached at the 5' end of the sense strand (see Tables 3-6 for specific modification and structural information related to the HSD17B13 RNAi agents). HSD17B13 RNAi agent AD06210 (group 2) comprises a nucleotide sequence designed to inhibit expression of the HSD17B13 gene at position 513 of the gene; HSD17B13 RNAi agent AD06211 (group 3) comprises a nucleotide sequence designed to inhibit expression of the HSD17B13 gene at position 645 of the gene; HSD17B13 RNAi agent AD06212 (group 4) comprises a nucleotide sequence designed to inhibit expression of the HSD17B13 gene at position 649 of the gene; HSD17B13 RNAi agent AD06213 (group 5) comprises a nucleotide sequence designed to inhibit expression of the HSD17B13 gene at position 759 of the gene; HSD17B13 RNAi agent AD06214 (group 6) comprises a nucleotide sequence designed to inhibit expression of the HSD17B13 gene at position 791 of the gene; HSD17B13 RNAi agent AD06217 (group 7) contained a nucleotide sequence designed to inhibit expression of the HSD17B13 gene at position 1505 of the gene; HSD17B13 RNAi agent AD06218 (group 8) contained a nucleotide sequence designed to inhibit expression of the HSD17B13 gene at position 2185 of the gene. (See SEQ ID NO: 1 and Table 2 for the reference HSD17B13 gene.)

[0243] Cutaneous and intramuscular injections (i.e., subcutaneous injections) were administered into the loose skin over the neck and shoulders. Four mice in each group were tested (n=4). Serum was collected on days -1 (before treatment), 8, 15, and 22, and SEAP expression levels were determined according to the procedure described in Example 6 above. The data from the experiment are shown in Table 20 below. [Table 20] * As noted above in Example 6, the gradual decline in SEAP in the vehicle control group (Group 1) over time is due to loss of the SEAP reporter gene in mouse cells due to natural cell replication in the animals.

[0244] Each of the HSD17B13 RNAi agents in each treatment group (i.e., Groups 2-8) demonstrated a reduction in SEAP compared to the vehicle control (Group 1) on days 15 and 22. Furthermore, HSD17B13 RNAi agents AD06210 (Group 2), which contains a nucleotide sequence designed to inhibit expression at position 513 of the HSD17B13 gene, and AD06214 (Group 6), which contains a nucleotide sequence designed to inhibit expression at position 791 of the HSD17B13 gene, demonstrated particularly high levels of knockdown compared to the other RNAi agents tested. For example, on day 15, AD06210 (Group 2) demonstrated a reduction of approximately 84% (0.157), while AD06214 (Group 6) demonstrated a reduction of approximately 85% (0.151). (For example, compared to AD06218 (Group 8), which demonstrated only slightly greater knockdown than the control group (Group 1)). At day 22, the HSD17B13 RNAi agent AD06214 (Group 6) also showed approximately 83% knockdown (0.171).

[0245] Example 10. In vivo testing of HSD17B13 RNAi agents in HSD17B13-SEAP mice. The HSD17B13-SEAP mouse model described above in Example 6 was used. On day 1, each rat received a single subcutaneous dose of 200 μl / 20 g animal body weight containing either 3.0 mg / kg (mpk) of HSD17B13 RNAi agent formulated in a pharmaceutically acceptable saline buffer according to Table 21 below, or a vehicle control (saline buffer without RNAi agent). [Table 21]

[0246] Each of the HSD17B13 RNAi agents contained a targeting ligand containing three N-acetyl-galactosamine groups (a tridentate ligand) with the modified sequence described in the duplex structure herein, and a modified nucleotide attached at the 5' end of the sense strand (see Tables 3-6 for specific modification and structural information related to the HSD17B13 RNAi agents). HSD17B13 RNAi agent AD06185 (group 2) and AD06187 (group 3) comprise a nucleotide sequence designed to inhibit the expression of the HSD17B13 gene at position 499 of the gene; HSD17B13 RNAi agent AD06210 (group 4) comprise a nucleotide sequence designed to inhibit the expression of the HSD17B13 gene at position 513 of the gene; HSD17B13 RNAi agent AD06213 (group 5) comprise a nucleotide sequence designed to inhibit the expression of the HSD17B13 gene at position 759 of the gene; HSD17B13 RNAi agent AD06214 (group 6) comprise a nucleotide sequence designed to inhibit the expression of the HSD17B13 gene at position 791 of the gene. (See SEQ ID NO: 1 and Table 2 for the reference HSD17B13 gene.)

[0247] Cutaneous and intramuscular injections (i.e., subcutaneous injections) were administered into the loose skin over the neck and shoulders. Four mice in each group were tested (n=4). Serum was collected on days -1 (before treatment), 8, 15, and 22, and SEAP expression levels were determined according to the procedure described in Example 6 above. The data from the experiment are shown in Table 22 below. [Table 22] * As noted above in Example 6, the gradual decline in SEAP in the vehicle control group (Group 1) over time is due to loss of the SEAP reporter gene in mouse cells due to natural cell replication in the animals.

[0248] Each of the HSD17B13 RNAi agents in each of the treatment groups (ie, Groups 2-6) showed a reduction in SEAP compared to the vehicle control (Group 1) at all measurement time points.

[0249] Example 11. In vivo testing of HSD17B13 RNAi agents in HSD17B13-SEAP mice. The HSD17B13-SEAP mouse model described above in Example 6 was used. On day 1, each rat received a single subcutaneous dose of 200 μl / 20 g animal body weight containing either a mg / kg (mpk) dose of HSD17B13 RNAi agent formulated in a pharmaceutically acceptable saline buffer according to Table 23 below, or a vehicle control (saline buffer without RNAi agent). [Table 23]

[0250] Both HSD17B13 RNAi agents contained a targeting ligand containing three N-acetyl-galactosamine groups (tridentate ligand) with the modified sequence described in the duplex structure herein, and a modified nucleotide attached at the 5' end of the sense strand (see Tables 3-6 for specific modifications and structural information related to HSD17B13 RNAi agents).

[0251] Cutaneous and intramuscular injections (i.e., subcutaneous injections) were administered into the loose skin over the neck and shoulders. Four mice in each group were tested (n=4), except for the vehicle control group, which had only two mice. Serum was collected on days -1 (before treatment), 8, 15, 22, and 29, and SEAP expression levels were determined according to the procedure described in Example 6 above. The data from the experiment are shown in Table 24 below. [Table 24]

[0252] Both HSD17B13 RNAi agents tested (ie, AD06280 and AD06187) showed a reduction in SEAP compared to the vehicle control (Group 1).

[0253] Example 12. In vivo testing of HSD17B13 RNAi agents in HSD17B13-SEAP mice. The HSD17B13-SEAP mouse model described above in Example 6 was used. On day 1, each rat received a single subcutaneous administration of 200 μl / 20 g animal body weight containing either a 3 mg / kg (mpk) dose of HSD17B13 RNAi agent formulated in a pharmaceutically acceptable saline buffer according to Table 25 below, or a vehicle control (saline buffer without RNAi agent). [Table 25]

[0254] All HSD17B13 RNAi agents contained a targeting ligand containing three N-acetyl-galactosamine groups (tridentate ligand) with the modified sequence described in the duplex structure herein, and a modified nucleotide attached at the 5' end of the sense strand (see Tables 3-6 for specific modification and structural information related to HSD17B13 RNAi agents). HSD17B13 RNAi agent AD06187 (group 2) comprises a nucleotide sequence designed to inhibit expression of the HSD17B13 gene at position 499 of the gene; HSD17B13 RNAi agent AD06208 (group 3) comprises a nucleotide sequence designed to inhibit expression of the HSD17B13 gene at position 92 of the gene; HSD17B13 RNAi agent AD06209 (group 4) comprises a nucleotide sequence designed to inhibit expression of the HSD17B13 gene at position 417 of the gene; HSD17B13 RNAi agent AD06215 (group 5) comprises a nucleotide sequence designed to inhibit expression of the HSD17B13 gene at position 1418 of the gene; HSD17B13 RNAi agent AD06216 (group 6) comprises a nucleotide sequence designed to inhibit expression of the HSD17B13 gene at position 1502 of the gene; HSD17B13 The RNAi agent AD06219 (Group 7) contained a nucleotide sequence designed to inhibit expression of the HSD17B13 gene at position 2195 of the gene (see SEQ ID NO: 1 and Table 2 for the referenced HSD17B13 gene).

[0255] Cutaneous and intramuscular injections (i.e., subcutaneous injections) were administered into the loose skin over the neck and shoulders. Four mice in each group were tested (n=4). Serum was collected on days -1 (before treatment), 8, 15, and 22, and SEAP expression levels were determined according to the procedure described in Example 6 above. The data from the experiment are shown in Table 26 below. [Table 26]

[0256] Other embodiments While the present invention has been described in conjunction with the detailed description thereof, it is to be understood that the foregoing description is illustrative and is not intended to limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

1. 1. An RNAi agent for inhibiting expression of the HSD17B13 gene, the RNAi agent comprising: an antisense strand comprising at least 17 contiguous nucleotides that differ by 0 or 1 nucleotide from any one of the sequences provided in Table 2 or Table 3; a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand; 10. An RNAi agent comprising:

2. 2. The RNAi agent of claim 1, wherein the antisense strand comprises nucleotides 2-18 of any one of the sequences provided in Table 2 or Table 3.

3. 3. The RNAi agent of Claim 1 or Claim 2, wherein the sense strand comprises a nucleotide sequence of at least 17 contiguous nucleotides that differs by 0 or 1 nucleotide from any one of the sense strand sequences provided in Table 2 or Table 4, and the sense strand has a region of at least 85% complementarity with the antisense strand over 17 contiguous nucleotides.

4. The RNAi agent of any one of claims 1 to 3, wherein at least one nucleotide of the RNAi agent is a modified nucleotide or comprises a modified internucleoside linkage.

5. The RNAi agent of any one of claims 1 to 3, wherein all or substantially all nucleotides of the sense strand and / or antisense strand of the RNAi agent are modified nucleotides.

6. The RNAi agent of any one of claims 4 to 5, wherein the modified nucleotide is selected from the group consisting of 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-seconucleotide mimics, locked nucleotides, 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted 2'-O-methyl nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, vinyl phosphonate deoxyribonucleotides, cyclopropyl phosphonate deoxyribonucleotides, and 3'-O-methyl nucleotides.

7. 6. The RNAi agent of claim 5, wherein all or substantially all of the modified nucleotides are 2'-O-methyl nucleotides, 2'-fluoro nucleotides, or a combination thereof.

8. 8. The RNAi agent of any one of claims 1 to 7, wherein the antisense strand comprises the nucleotide sequence of any one of the modified antisense strand sequences provided in Table 3.

9. 9. The RNAi agent of any one of claims 1 to 8, wherein the sense strand comprises the nucleotide sequence of any of the modified sense strand sequences provided in Table 4.

10. 2. The RNAi agent of claim 1, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 3, and the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 4.

11. The RNAi agent of any one of claims 1 to 10, wherein the RNAi agent is linked to a targeting ligand.

12. The RNAi agent of claim 11 , wherein the targeting ligand comprises n-acetyl-galactosamine.

13. The targeting ligands are: (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31 )s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s.

14. The RNAi agent of claim 13, wherein the targeting ligand comprises the structure (NAG37) or (NAG37)s.

15. The RNAi agent of any one of claims 11 to 14, wherein the targeting ligand is linked to the sense strand.

16. The RNAi agent of claim 15 , wherein the targeting ligand is linked to the 5′ end of the sense strand.

17. The RNAi agent of any one of claims 1 to 16, wherein the sense strand is 18 to 30 nucleotides in length and the antisense strand is 18 to 30 nucleotides in length.

18. The RNAi agent of claim 17, wherein the sense strand and the antisense strand are each 18 to 27 nucleotides in length.

19. The RNAi agent of claim 18, wherein the sense strand and the antisense strand are each 18 to 24 nucleotides in length.

20. 20. The RNAi agent of claim 19, wherein the sense strand and the antisense strand are each 21 nucleotides in length.

21. The RNAi agent of any one of claims 17 to 20, wherein the RNAi agent has two blunt ends.

22. The RNAi agent of any one of claims 1 to 21, wherein the sense strand comprises one or two terminal caps.

23. The RNAi agent of any one of claims 1 to 22, wherein the sense strand comprises one or two inverted abasic residues.

24. 2. The RNAi agent of claim 1, wherein the RNAi agent is composed of a sense strand and an antisense strand that form a duplex having the structure of any one of the duplexes in Table 5.

25. The RNAi agent has the following nucleotide sequence (5' to 3'): UCAUCUAUCAGACUUCUUACG (SEQ ID NO: 3); or UGAUCCAAAAAUGUCCUAGGC (SEQ ID NO: 6) 2. The RNAi agent of claim 1, comprising an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from one of the following by 0 or 1 nucleotides:

26. The sense strand has the following nucleotide sequence (5' to 3'): CGUAAGAAGUCUGAUAGAUGA (SEQ ID NO: 8); or GCCUAGGACAUUUUUGIAUCA (SEQ ID NO: 11) 26. The RNAi agent of claim 25, wherein I is an inosine (hypoxanthine) nucleotide, and the nucleotide sequence differs by 0 or 1 nucleotide from one of:

27. 27. The RNAi agent of claim 25 or 26, wherein all or substantially all of the modified nucleotides are modified nucleotides.

28. 27. The RNAi agent of claim 25 or 26, wherein the sense strand further comprises an inverted abasic residue at the 3' end of the nucleotide sequence, the 5' end of the nucleotide sequence, or both.

29. The RNAi agent has the following nucleotide sequence (5' to 3'): usCfsasUfcUfaUfcAfgAfcUfuCfuUfaCfsg (SEQ ID NO: 2); usCfsasUfcUfaucagAfcUfuCfuUfaCfsg (SEQ ID NO: 4); usGfsasUfcCfaAfaAfaUfgUfcCfuAfgGfsc (SEQ ID NO: 5); usGfsasUfcCfaaaaaUfgUfcCfuAfgGfsc (SEQ ID NO: 7) comprising, consisting of, or consisting essentially of a modified nucleotide sequence that differs by zero or one nucleotide from one of wherein a, c, g, and u are 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage; and all or substantially all of the nucleotides on the sense strand are modified nucleotides. The RNAi agent of claim 1.

30. The sense strand has the following nucleotide sequence (5' to 3'): cguaagaaGfUfCfugauagauga (SEQ ID NO: 9); cguaagaaGfuCfuGfauagauga (SEQ ID NO: 10); gccuaggaCfAfUfuuuugiauca (SEQ ID NO: 12); or gccuaggaCfaUfuUfuugiauca (SEQ ID NO: 13) by 0 or 1 nucleotide, wherein a, c, g, i, and u are 2'-O-methyl adenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate linkage; and all or substantially all of the nucleotides on the antisense strand are modified nucleotides. The RNAi agent of claim 1.

31. The RNAi agent of any one of claims 25 to 30, wherein the sense strand further comprises an inverted abasic residue at the 3' end of the nucleotide sequence, the 5' end of the nucleotide sequence, or both.

32. The RNAi agent of any one of claims 25 to 31, wherein the sense strand of the RNAi agent is linked to a targeting ligand.

33. 33. The RNAi agent of claim 32, wherein the targeting ligand has affinity for an asialoglycoprotein receptor.

34. 34. The RNAi agent of claim 33, wherein the targeting ligand comprises N-acetyl-galactosamine.

35. The RNAi agent of claim 1, wherein the RNAi agent has a double-stranded structure selected from the group consisting of: AD06214 (SEQ ID NOs: 2 and 16); AD06280 (SEQ ID NOs: 4 and 15); AD06187 (SEQ ID NOs: 5 and 16); AD06276 (SEQ ID NOs: 5 and 17); AD06277 (SEQ ID NOs: 7 and 17).

36. 36. The RNAi agent of claim 35, wherein the RNAi agent has a double-stranded structure selected from the group consisting of: AD06214 (SEQ ID NOs: 2 and 16) and AD06280 (SEQ ID NOs: 4 and 15).

37. The targeting ligand is: 【Chemistry 1】 【Chemistry 2】 The RNAi agent of claim 1, comprising:

38. the antisense strand consists of the modified nucleotide sequence (5'→3')usCfsasUfcUfaUfcAfgAfcUfuCfuUfaCfsg (SEQ ID NO: 2), and the sense strand consists of the modified nucleotide sequence (5'→3')(NAG37)s(invAb)scguaagaaGfUfCfugauagaugas(invAb) (SEQ ID NO: 14); In the above sequence, a, c, g, and u are 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate bond; (invAb) is an inverted abasic deoxyribose residue; and (NAG37)s has the following chemical structure: 【Transformation 3】 The RNAi agent of claim 1, having the following structure:

39. the antisense strand consists of the modified nucleotide sequence (5'→3')usCfsasUfcUfaucagAfcUfuCfuUfaCfsg (SEQ ID NO: 4), and the sense strand consists of the modified nucleotide sequence (5'→3')(NAG37)s(invAb)scguaagaaGfuCfuGfauagaugas(invAb) (SEQ ID NO: 15); In the above sequence, a, c, g, and u are 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate bond; (invAb) is an inverted abasic deoxyribose residue; and (NAG37)s has the following chemical structure: 【Chemistry 4】 The RNAi agent of claim 1, having the following structure:

40. the antisense strand consists of the modified nucleotide sequence (5'→3')usGfsasUfcCfaAfaAfaUfgUfcCfuAfgGfsc (SEQ ID NO: 5); and the sense strand consists of the modified nucleotide sequence (5'→3')(NAG37)s(invAb)sgccuaggaCfAfUfuuuuugiaucas(invAb) (SEQ ID NO: 16); In the above sequence, a, c, g, i, and u are 2'-O-methyl adenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate bond; (invAb) is an inverted abasic deoxyribose residue; and (NAG37)s has the following chemical structure: 【Transformation 5】 31. The RNAi agent of claim 30, having the following structure:

41. the antisense strand consists of the modified nucleotide sequence (5'→3')usGfsasUfcCfaAfaAfaUfgUfcCfuAfgGfsc (SEQ ID NO: 5); and the sense strand consists of the modified nucleotide sequence (5'→3')(NAG37)s(invAb)sgccuaggaCfaUfuUfuugiaucas(invAb) (SEQ ID NO: 17); In the above sequence, a, c, g, i, and u are 2'-O-methyl adenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate bond; (invAb) is an inverted abasic deoxyribose residue; and (NAG37)s has the following chemical structure: 【Transformation 6】 31. The RNAi agent of claim 30, having the following structure:

42. the antisense strand consists of the modified nucleotide sequence (5'→3')usGfsasUfcCfaaaaaUfgUfcCfuAfgGfsc (SEQ ID NO: 7), and the sense strand consists of the modified nucleotide sequence (5'→3')(NAG37)s(invAb)sgccuaggaCfaUfuUfuugiaucas(invAb) (SEQ ID NO: 17); In the above sequence, a, c, g, i, and u are 2'-O-methyl adenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s is a phosphorothioate bond; (invAb) is an inverted abasic deoxyribose residue; and (NAG37)s has the following chemical structure: 【Transformation 7】 31. The RNAi agent of claim 30, having the following structure:

43. 43. A composition comprising the RNAi agent of any one of claims 1 to 42, wherein the composition further comprises a pharmaceutically acceptable excipient.

44. 44. The composition of claim 43, wherein the composition further comprises a second RNAi agent for inhibiting expression of HSD17B13.

45. 45. The composition of claim 43 or 44, wherein the composition further comprises one or more additional therapeutic agents.

46. 46. ​​A method for inhibiting expression of the HSD17B13 gene in a cell, said method comprising introducing into the cell an effective amount of an RNAi agent according to any one of claims 1 to 42 or a composition according to any one of claims 43 to 45.

47. 47. The method of claim 46, wherein the cell is in a subject.

48. 48. The method of claim 47, wherein the subject is a human subject.

49. 49. The method of any one of claims 46 to 48, wherein the HSD17B13 gene expression is inhibited by at least about 30%.

50. A method for treating an HSD17B13-associated disease or disorder, said method comprising administering a therapeutically effective amount of a composition according to any one of claims 43 to 45 to a human subject in need thereof.

51. 51. The method of claim 50, wherein the disease is NAFLD, NASH, liver fibrosis, alcoholic fatty liver disease, or cirrhosis.

52. 52. The method of any one of claims 46-51, wherein the RNAi agent is administered at a dosage of about 0.05 mg to about 5.0 mg per kg of body weight of the human subject.

53. 53. The method of any one of claims 46-52, wherein the RNAi agent is administered in two or more doses.

54. 46. ​​Use of the RNAi agent of any one of claims 1 to 42 or the composition of any one of claims 43 to 45 for the treatment of a disease, disorder or condition mediated at least in part by HSD17B13 gene expression.

55. 55. The use of claim 54, wherein the condition is cirrhosis of the liver.

56. Use of the RNAi agent of any one of claims 1 to 42 or the composition of any one of claims 43 to 45 for the preparation of a pharmaceutical composition for the treatment of a disease, disorder or condition mediated at least in part by HSD17B13 gene expression.

57. 46. ​​Use of the composition according to any one of claims 43 to 45, wherein the disease is alcoholic or non-alcoholic fatty liver disease, such as NAFLD, NASH, liver fibrosis, or cirrhosis.

58. 46. ​​The use of the composition of any one of claims 43-45, wherein the RNAi agent is administered at a dosage of about 0.05 mg to about 5.0 mg per kg of body weight of the human subject.