Transgenic non-human animals producing modified heavy chain-only antibodies

Abstract

To provide improved methods for the production of heavy chain-only antibodies, which have less propensity for aggregation and retain high affinity for their intended target.SOLUTION: In one aspect, the present invention provides an isolated human or chimeric heavy chain-only antibody (HCAb) comprising a heavy chain variable (VH) domain, comprising complementarity determining regions (CDRs) and framework regions (FRs), having binding affinity to a target antigen in the absence of an antibody light chain, where in the VH domain the native amino acid residue at the first position of the fourth framework region (FR4) of the HCAb is substituted by a different amino acid residue that is capable of disrupting a surface-exposed hydrophobic patch comprising or associated with the native amino acid residue at that position.SELECTED DRAWING: Figure 1

Description

[Technical Field]

[0001] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The above ASCII copy, created on August 11, 2017, is named TNO-0001-WO_SL.txt and is 26,401 bytes in size.

[0002] FIELD OF THE INVENTION The present invention relates to transgenic non-human animals that produce modified heavy chain-only antibodies (HCAbs). In particular, the invention relates to transgenic non-human animals, e.g., transgenic rats or mice, that produce modified human or chimeric HCAbs that have a reduced tendency to aggregate, the antibodies so prepared, and methods of making and using the same. [Background technology]

[0003] Heavy chain-only antibodies The basic four-chain antibody unit is a heterotetrameric glycoprotein consisting of two identical light (L) chains and two identical heavy (H) chains. In the case of IgG, the four-chain unit is generally about 150,000 daltons. Each L chain is linked to an H chain by one covalent disulfide bond, while the two H chains are linked to each other by one or more disulfide bonds depending on the H chain isotype. Each H and L chain also has regularly spaced intrachain disulfide bridges. Each H chain contains a variable domain (V) at its N-terminus. H ) and three constant domains (C H ) and four C for μ and ε isotypes H Each L chain contains a variable domain (V L ) and a constant domain (C L ) followed by V L is V H Parallel to C L is the first constant domain of the heavy chain (C H1) Parallel to the V. Particular amino acid residues are believed to form an interface between the light- and heavy-chain variable domains. H and V L The pairing of V and V together forms a single antigen-binding site. IgM antibodies consist of five basic heterotetrameric units with an additional polypeptide called the J chain and therefore contain 10 antigen-binding sites, whereas secreted IgA antibodies can polymerize to form multivalent assemblies consisting of two to five basic four-chain units with the J chain. For the structure and properties of different classes of antibodies, see, for example, page 71 and chapter 6 of Basic and Clinical Immunology, 8th edition, Daniel P. Stites, Abba I. Terr and Tristram G. Parslow (eds.), Appleton & Lange, Norwalk, CT, 1994. In such antibodies, V H and V L The interaction of these domains forms the antigen-binding region, but binding occurs via the C H1 Domain and C L Facilitated by part of the domain.

[0004] L chains from any vertebrate can be assigned to one of two different types, called kappa (κ) and lambda (λ), based on the amino acid sequence of their constant domain. H Depending on the amino acid sequence of their amino acids, immunoglobulins can be assigned to different classes or isotypes. There are five classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, with heavy chains called α, δ, ε, γ, and μ, respectively. The γ and α classes are divided into C H They are further divided into subclasses based on relatively minor differences in sequence and function; for example, humans express the following subclasses: IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2.

[0005] In a typical IgG antibody, the binding of the heavy and light chains is due in part to hydrophobic interactions between the light chain constant region and the CH1 constant domain of the heavy chain. There are additional residues in the heavy chain framework 2 (FR2) and framework 4 (FR4) regions that also contribute to this hydrophobic interaction between the heavy and light chains.

[0006] However, sera from camelids (a suborder of camelids, including camels, dromedaries, and llamas) are known to contain a major type of antibody (heavy-chain-only antibody or HCAb) composed only of paired H chains. HCAb from camelids (Camelus dromedarius, Camelus bactrianus, Lama glama, Lama guanaco, Lama alpaca, and Lama vicugna) have a unique structure consisting of a single variable domain (VHH), a hinge region, and two constant domains (CH2 and CH3) that are highly homologous to the CH2 and CH3 domains of classical antibodies. These HCAb lack the first domain of the constant region (CH1), which is present in the genome but is spliced ​​out during mRNA processing. The absence of the CH1 domain explains the absence of light chains in HCAb, as this domain is where the constant domain of the light chain is anchored. Such HCAbs have naturally evolved to confer antigen-binding specificity and high affinity by three CDRs from conventional antibodies or their fragments (Muyldermans, 2001; J Biotechnol 74:277-302; Revets et al., 2005; Expert Opin Biol Ther 5:111-124).

[0007] Cartilaginous fish have also evolved a unique type of immunoglobulin, called IgNAR, that lacks light polypeptide chains and is composed entirely of heavy chains.

[0008] The ability of heavy-chain-only antibodies lacking light chains to bind antigens was established in the 1960s (Jaton et al. (1968) Biochemistry, 7, 4185-4195). Heavy-chain immunoglobulins physically separated from light chains retained 80% of the antigen-binding activity of tetrameric antibodies.

[0009] Sitia et al. (1990) Cell, 60, 781-790 demonstrated that removal of the CH1 domain from a rearranged mouse μ gene resulted in the production of heavy-chain-only antibodies lacking the light chain in mammalian cell culture, which retained VH binding specificity and effector function.

[0010] The discovery of camelid heavy-chain antibodies stimulated interest in the development of human single-domain antibodies in artificial systems such as phage display. Early human domain antibodies identified in this way were prone to aggregation and had solubility problems due to exposed hydrophobic patches within the framework regions that are usually buried at the interface with the light chain constant region. Subsequent studies establishing crystal structures of human VH domain antibodies identified surface-exposed residues in human domain antibodies. Barthelemy et al. (2008) J. Biol. Chem., 283, 3639-3654 report a comprehensive analysis of factors contributing to the stability and solubility of autonomous human VH domains.

[0011] The cloned and isolated VHH domains are stable polypeptides that retain the full antigen-binding capacity of the original HCAb. Nanobodies are the smallest available intact antigen-binding fragments (approximately 12-15 kDa) that retain the full antigen-binding capacity of the original heavy chain of an evolved heavy-chain antibody that is fully functional in the absence of light chains. These VHH domains form the basis of a new generation of therapeutic antibodies, called nanobodies, suitable for intravenous, oral, or topical administration and can be easily manufactured in monovalent or multivalent forms that exhibit high potency and binding affinity for one or more targets.

[0012] Single domain VHH antibodies, including methods for their preparation, are described, for example, in WO2004062551. Mice in which the lambda light (L) chain locus and / or the lambda and kappa light (L) chain loci have been functionally silenced, and antibodies produced from such mice, are described in U.S. Patent Nos. 7,541,513 and 8,367,888. Recombinant production of heavy chain-only antibodies in mice and rats has been reported, for example, in WO2006008548; U.S. Patent Application Publication No. 20100122358; Nguyen et al., 2003, Immunology; 109(1), 93-101; Brueggemann et al., Crit. Rev. Immunol.; 2006, 26(5):377-90; and Zou et al., 2007, J Exp Med; 204(13):3271-3283. The production of knockout rats via embryonic microinjection of zinc finger nucleases is described in Geurts et al., 2009, Science, 325(5939):433. Analysis of immunoglobulin heavy chain knockout rats is reported in Menoret et al., 2010, European Journal of Immunology, 40:2932-2941. Soluble heavy chain-only antibodies and transgenic rodents containing heterologous heavy chain loci that produce such antibodies are described in U.S. Patent No. 8,883,150. CAR-T constructs containing single-domain antibodies as binding (targeting) domains are described, for example, in Iri-Sofla et al., 2011, Experimental Cell Research 317:2630-2641, and Jamnani et al., 2014, Biochim Biophys Acta, 1840:378-386. Despite recent advances, there remains a need for improved methods for the production of heavy-chain-only antibodies that are less prone to aggregation and retain high affinity for their intended targets. [Prior art documents] [Patent documents]

[0013] [License 1] International Publication No. 2004 / 062551 [License 2] U.S. Patent No. 7,541,513 [License 3] U.S. Patent No. 8,367,888 [License 4] International Publication No. 2006 / 008548 [Patent Document 5] U.S. Patent and Trademark Publication No. 2010 / 0122358 [License 6] U.S. Patent No. 8,883,150 [Non-licensed literature]

[0014] [Non-licensed Document 1] Basic and Clinical Immunology, 8th edition, Daniel P. Stites, Abba I. Terr and Tristram G. Parslow(eds.), Appleton & Lange, Norwalk, CT, 1994 page 71 and chapter 6 [Non-licensed Document 2] Muyldermans,2001;J Biotechnol 74:277-302;Revets et al.,2005;Expert Opin Biol Ther 5:111-124 [Non-licensed Document 3] Jaton et al. (1968) Biochemistry, 7, 4185-4195 [Non-licensed Document 4] Sitia et al.(1990)Cell,60,781-790 [Non-licensed Document 5] Barthelemy et al.(2008)J. Biol. Chem.,283,3639-3654 [Non-licensed Document 6] Nguyen et al.,2003,Immunology;109(1),93-101 [Non-Patent Document 7] Brueggemann et al., Crit. Rev. Immunol.;2006,26(5):377-90 [Non-patent document 8] Zou et al.,2007,J Exp Med;204(13):3271-3283 [Non-Patent Document 9] Geurts et al.,2009,Science,325(5939):433 [Non-Patent Document 10] Menoret et al.,2010,European Journal of Immunology,40:2932-2941 [Non-Patent Document 11] Iri-Sofla et al.,2011,Experimental Cell Research 317:2630-2641 [Non-Patent Document 12] Jamnani et al.,2014,Biochim Biophys Acta,1840:378-386 Summary of the Invention

[0015] The present invention is based, at least in part, on the discovery that heavy-chain-only antibodies (HCAbs) with reduced aggregation propensity can be prepared by replacing the native amino acid residue at position 1 of the fourth framework region (FR4) of an HCAb with another amino acid residue that can disrupt a surface-exposed hydrophobic patch that includes or is associated with the native amino acid residue at that position. Such a hydrophobic patch, which is normally buried at the interface with the antibody's light-chain constant region, becomes surface-exposed in HCAbs and is, at least in part, responsible for unwanted aggregation and light-chain binding of the HCAb.

[0016] In one aspect, the present invention relates to an isolated human or chimeric heavy chain-only antibody (HCAb) comprising a heavy chain variable (VH) domain comprising complementarity determining regions (CDRs) and framework regions (FRs), and having binding affinity for a target antigen in the absence of the antibody light chain, wherein in said VH domain, the native amino acid residue at position 1 of the fourth framework region (FR4) of said HCAb is replaced by a different amino acid residue that is capable of disrupting a surface-exposed hydrophobic patch comprising or associated with the native amino acid residue at that position.

[0017] In one embodiment, the HCAb is a human antibody.

[0018] In another embodiment, in an HCAb, the native amino acid residue at position 1 of FR4 is substituted with a polar amino acid residue.

[0019] In yet another embodiment, in the HCAb, the native amino acid residue at position 1 of FR4 is substituted with a positively charged amino acid residue such as, for example, lysine (K), arginine (R), or histidine (H), preferably arginine (R).

[0020] In certain embodiments, the HCAb comprises a tryptophan (W) to arginine (R) substitution at the first amino acid residue in the fourth framework (FR4) region.

[0021] In all embodiments, the HCAb may contain one or more additional mutations in one or more framework regions.

[0022] In all embodiments, the HCAb may have a reduced tendency to aggregate compared to a corresponding antibody comprising a native amino acid residue at amino acid residue number 1 of FR4.

[0023] In all embodiments, the HCAb may have a binding affinity for the target antigen of about 1 pM to about 1 μM.

[0024] In another aspect, the present invention relates to an isolated human or chimeric heavy chain-only antibody (HCAb) that has binding affinity for a target antigen in the absence of antibody light chains and that comprises a heavy chain variable (VH) domain comprising complementarity determining regions (CDRs) and framework regions (FRs), wherein said HCAb comprises a tryptophan (T) to arginine (R) substitution at the first amino acid position in the fourth FR region (FR4) of a native human VH amino acid sequence.

[0025] In one embodiment, the HCAb comprises a heavy chain constant (CH) domain, lacks a CH1 region, and can be an IgG antibody, such as an IgG1 antibody.

[0026] In another embodiment, the HCAb comprises one or more additional mutations in one or more FR regions.

[0027] In yet another embodiment, the HCAb has a reduced tendency to aggregate compared to a corresponding antibody comprising a native amino acid residue at amino acid residue number 1 of FR4.

[0028] In another aspect, the invention relates to a chimeric antigen receptor (CAR) comprising a heavy chain-only antibody as described herein. In one embodiment, the CAR comprises a single human VH domain.

[0029] In a further aspect, the present invention relates to an isolated autonomous human antibody heavy chain variable (VH) domain comprising complementarity determining regions (CDRs) and framework regions (FRs), which has binding affinity for a target antigen and comprises a substitution of a native amino acid residue at a first amino acid residue in the fourth framework (FR4) region with a different amino acid residue that is capable of disrupting a surface-exposed hydrophobic patch comprising or associated with the native amino acid at that position.

[0030] In one embodiment, in the isolated autonomous human VH domain, the naturally occurring amino acid residue at position 1 of FR4 is substituted by a polar amino acid residue.

[0031] In another embodiment, the native amino acid residue at position 1 of FR4 is substituted with a positively charged amino acid residue such as a lysine (K), arginine (R), or histidine (H) residue, preferably an arginine (R) residue.

[0032] In a further embodiment, the isolated autonomous human VH domain comprises a tryptophan (W) to arginine (R) substitution at the first amino acid residue in the fourth framework (FR4) region.

[0033] In yet a further embodiment, the isolated autonomous human VH domain comprises one or more additional mutations in one or more framework regions.

[0034] In a further aspect, the invention relates to a multivalent binding protein having binding affinity to a target antigen, comprising multiple antigen binding domains, including at least one heavy chain variable (VH) domain comprising complementarity determining regions (CDRs) and framework regions (FRs), wherein in said VH domain, the native amino acid residue at position 1 of a fourth framework region (FR4) of said multivalent binding protein is substituted with a different amino acid residue that is capable of disrupting a surface-exposed hydrophobic patch comprising or associated with the native amino acid residue at that position.

[0035] In one embodiment, in the multivalent binding protein, the native amino acid residue at position 1 of FR4 is replaced by a polar amino acid residue.

[0036] In another embodiment, in the multivalent binding protein, the native amino acid residue at position 1 of FR4 is substituted with a positively charged amino acid residue, such as a lysine (K), arginine (R), or histidine (H) residue, preferably an arginine (R) residue.

[0037] In a further embodiment, the multivalent binding protein comprises a tryptophan (W) to arginine (R) substitution at the first amino acid residue in the fourth framework (FR4) region.

[0038] In all embodiments, the multivalent binding protein may comprise one or more additional mutations in one or more framework regions.

[0039] In a further embodiment, the invention relates to a recombinant heavy-chain-only immunoglobulin (Ig) locus comprising one or more human V gene segments, one or more human D gene segments, and one or more human J gene segments which, when recombined with each other in the genome of a non-human animal, following affinity maturation, encode a heavy chain variable (VH) region comprising complementarity-determining regions (CDRs) and framework regions (FRs), wherein at least one of the human J segments comprises a codon at position 1 of the fourth framework region (FR4) that encodes a non-naturally occurring amino acid residue that is capable of disrupting a surface-exposed hydrophobic patch that includes or is associated with a naturally occurring amino acid residue at that position.

[0040] In one embodiment, the recombinant heavy chain-only Ig locus further comprises a constant (C) region gene segment encoding an immunoglobulin constant effector region lacking CH1 functionality.

[0041] In various embodiments, the recombinant heavy chain-only IG locus comprises between 2 and 40 D gene segments and / or between 2 and 20 J gene segments.

[0042] In another embodiment, more than one human J segment comprises a codon at position 1 of the fourth framework region (FR4) that encodes a non-natural amino acid residue that can disrupt a surface-exposed hydrophobic patch that includes or is associated with a natural amino acid residue at that position.

[0043] In yet another embodiment, in a recombinant heavy chain-only Ig locus, all human J segments contain a codon at position 1 of the fourth framework region (FR4) that encodes a non-natural amino acid residue that can disrupt a surface-exposed hydrophobic patch that includes or is associated with the natural amino acid residue at that position.

[0044] In a further embodiment, in the encoded heavy chain VH region, the native amino acid residue at position 1 of FR4 is substituted with a polar amino acid residue such as lysine (K), arginine (R), or histidine (H), preferably an arginine (R) residue.

[0045] In still further embodiments, the encoded VH region comprises a tryptophan (W) to arginine (R) substitution at the first amino acid residue in the fourth framework (FR4) region.

[0046] In yet another embodiment, the recombinant heavy chain-only IG locus comprises a J4 gene segment in which the W codon is replaced by an R.

[0047] In all embodiments, the recombinant heavy chain-only Ig locus encodes a VH region that contains one or more additional mutations in one or more framework regions.

[0048] In a further embodiment, the recombinant heavy chain-only Ig locus encodes a human or humanized heavy chain-only antibody comprising a VH region as described herein above.

[0049] In another aspect, the present invention relates to a transgenic non-human animal comprising a recombinant heavy chain-only Ig locus as described herein above.

[0050] In various embodiments, the transgenic non-human animal is a non-human mammal such as a non-human vertebrate, rodent, mouse, or rat, such as, for example, UniRat™.

[0051] In a further aspect, the invention relates to transgenic non-human animals that do not express any functional immunoglobulin light chain genes and that comprise a heterologous heavy chain-only Ig locus that, when recombined with each other, following affinity maturation, comprises one or more V gene segments, one or more D gene segments, and one or more J gene segments that encode a VH domain comprising complementarity determining regions (CDRs) and framework regions (FRs), and one or more constant effector region gene segments, each of which encodes an antibody constant effector region comprising CH1 functionality, wherein the native amino acid residue at position 1 of the fourth framework region (FR4) of said VH domain is substituted with a different amino acid residue that can comprise the native amino acid residue at that position or disrupt the surface-exposed hydrophobicity associated with it, and the gene segments are arranged such that the V, D, and J gene segments and the constant region gene segments recombine to generate a rearranged, affinity-matured heavy chain-only locus that encodes a heavy chain-only antibody (HCAb).

[0052] In one embodiment, in the VH domain of the transgenic non-human animal, the naturally occurring amino acid residue at position 1 of FR4 is substituted by a polar or positively charged amino acid residue such as a lysine (K), arginine (R), or histidine (H) residue, preferably an arginine (R) residue.

[0053] In another embodiment, in the transgenic non-human animal, the VH domain comprises a tryptophan (W) to arginine (R) substitution at the first amino acid residue in the fourth framework (FR4) region.

[0054] In yet another embodiment, in the transgenic non-human animal, the heterologous heavy chain-only locus comprises a J4 segment in which the W codon is replaced with an R codon.

[0055] In all embodiments, the encoded heavy chain-only antibody contains one or more additional mutations in one or more framework regions.

[0056] In a further embodiment, the transgenic non-human animal is a mammal, a vertebrate, a rodent, such as a mouse or a rat, for example, a UniRat™.

[0057] In all aspects, in certain embodiments, the heavy chain-only antibodies herein do not contain mutations in other framework regions, including the FR1, FR2, and FR3 regions.

[0058] In all aspects, in certain embodiments, the heavy chain-only antibodies herein do not contain additional framework mutations that are typically present in camelids such as camels, llamas, dromedaries, alpacas, or guanacos.

[0059] In all aspects, in certain embodiments, the heavy chain-only antibodies herein may comprise one or more additional mutations in one or more framework regions, including the FR1, FR2, FR3, and / or FR4 regions, e.g., in the FR2 region or in the FR2 and FR4 regions.

[0060] In all aspects and embodiments, target antigens for which the HCAbs of the invention have binding affinity include, but are not limited to, cell surface receptors and tumor antigens, such as EGFR, ErbB2 (HER2), ErbB3 (HER3), ErbB4 (HER4), CTLA-4 / CD152, RANKL, TNF-α, CD20, IL-12 / IL-23, IL1-β, IL-17A, IL-17F, CD38, NGF, IGF-1, IL-12, CD20, CD30, CD39, CD73, CD40, PD-1, PDL-1, PD-L2, BCMA, BTLA, thymic stromal lymphopoietin (TSP), follicle-stimulating hormone receptor (FSHR), prostate-specific membrane antigen (PSMA), prostate stem cell antigen (PSCA), CD137, OX-40, and IL-33.

[0061] In all aspects and embodiments, the HCAb binding domain can be part of a multispecific binding protein that binds to multiple different epitopes of the same target antigen or multiple different epitopes of more than one target antigen. Specifically included are multispecific, e.g., bispecific, HCAbs that comprise bispecific HCAb structures with the following binding affinities: epithelial cell adhesion molecule (EpCam) x CD3; CD19 x CD3; EpCam x CD3; TNF-α x IL-17; IL-1α x IL-1β; CD30 x CD16A; human epidermal growth factor receptor 2 (HER2) x HER3; IL-4 x IL-13; angiopoietin 2 (Ang-2) x vascular endothelial growth factor A (VEGF-A); and factor IXa x factor IXa. Factor X; epidermal growth factor receptor (EGFR) × HER3; IL-17A × IL-17F; HER2 × HER3; carcinoembryonic antigen × CD3; CD20 × CD3; CD123 × CD3; BCMA × CD3, PSMA × PSCA × CD3, PSMA × CD3, PSCA × CD3, CD19 × CD22 × CD3, CD22 × CD3, CD38 × PD1, CD38 × PD-L1, CD38 × CD73, CD38 × CD39, PD1 × CD39 × CD73, and PD1 × CD73. In certain embodiments, for example, the following are provided: (Item 1) An isolated human or chimeric heavy chain-only antibody (HCAb) comprising a heavy chain variable (VH) domain comprising complementarity determining regions (CDRs) and framework regions (FRs), and having binding affinity for a target antigen in the absence of the antibody's light chain, wherein in said VH domain, a native amino acid residue at position 1 of a fourth framework region (FR4) of said HCAb is replaced by a different amino acid residue that is capable of disrupting a surface-exposed hydrophobic patch comprising or associated with said native amino acid residue at that position. (Item 2) 2. The heavy chain-only antibody of item 1, which is a human antibody. (Item 3) 2. The heavy chain-only antibody of item 1, wherein the native amino acid residue at position 1 of FR4 is substituted by a polar amino acid residue. (Item 4) 2. The heavy chain-only antibody of item 1, wherein the native amino acid residue at position 1 of FR4 is substituted by a positively charged amino acid residue. (Item 5) 5. The heavy chain-only antibody of item 4, wherein the positively charged amino acid residue is selected from the group consisting of lysine (K), arginine (R), and histidine (H). (Item 6) 6. The heavy chain-only antibody of item 5, wherein the positively charged amino acid residue is arginine (R). (Item 7) 7. The heavy chain-only antibody of item 6, comprising a tryptophan (W) to arginine (R) substitution at the first amino acid residue in the fourth framework (FR4) region. (Item 8) 8. The heavy chain-only antibody of any one of items 1 to 7, comprising one or more additional mutations in one or more framework regions. (Item 9) 9. The heavy chain-only antibody of any one of items 1 to 8, which has a reduced tendency to aggregate compared to a corresponding antibody comprising the native amino acid residue at the first amino acid residue of FR4. (Item 10) 10. The heavy chain-only antibody of any one of items 1 to 9, having a binding affinity of about 1 pM to about 1 μM for its target antigen. (Item 11) An isolated human or chimeric heavy chain-only antibody (HCAb) having binding affinity for a target antigen in the absence of the antibody light chain, and comprising a heavy chain variable (VH) domain comprising complementarity determining regions (CDRs) and framework regions (FRs), wherein the HCAb comprises a tryptophan (T) to arginine (R) substitution at the first amino acid in the fourth FR region (FR4) of a native human VH amino acid sequence. (Item 12) 12. The heavy chain-only antibody of item 11, further comprising a heavy chain constant (CH) domain and lacking a CH1 region. (Item 13) 13. The heavy chain-only antibody of item 12, which is an IgG1 antibody. (Item 14) 14. The heavy chain-only antibody of any one of items 11 to 13, comprising one or more additional mutations in one or more FR regions. (Item 15) 15. The heavy chain-only antibody of any one of items 11 to 14, which has a reduced tendency to aggregate compared to a corresponding antibody comprising the native amino acid residue at the first amino acid residue of FR4. (Item 16) 16. A chimeric antigen receptor (CAR) comprising the heavy chain-only antibody of any one of items 1 to 15. (Item 17) 17. The chimeric antigen receptor of item 16, comprising a single human VH domain. (Item 18) 1. The isolated autonomous human antibody heavy chain variable (VH) domain comprising complementarity determining regions (CDRs) and framework regions (FRs), having binding affinity for a target antigen, and comprising a substitution of a native amino acid residue at a first amino acid residue in the fourth framework (FR4) region with a different amino acid residue that is capable of disrupting a surface-exposed hydrophobic patch comprising or associated with the native amino acid at that position. (Item 19) 19. The isolated autonomous human VH domain of item 18, wherein the naturally occurring amino acid residue at position 1 of FR4 is substituted by a polar amino acid residue. (Item 20) 19. The isolated autonomous human VH domain of item 18, wherein the native amino acid residue at position 1 of FR4 is substituted by a positively charged amino acid residue. (Item 21) 22. The isolated autonomous human VH domain according to claim 20, wherein the positively charged amino acid residue is selected from the group consisting of lysine (K), arginine (R), and histidine (H). 22. The isolated autonomous human VH domain of item 21, wherein the positively charged amino acid residue is arginine (R). (Item 23) 23. The isolated autonomous human VH domain of item 22, comprising a tryptophan (W) to arginine (R) substitution at the first amino acid residue in the fourth framework (FR4) region. (Item 24) 24. The isolated autonomous human VH domain of any one of items 18 to 23, comprising one or more additional mutations in one or more framework regions. (Item 25) 1. A multivalent binding protein comprising multiple antigen binding domains, the multivalent binding protein comprising at least one heavy chain variable (VH) domain comprising complementarity determining regions (CDRs) and framework regions (FRs), and having binding affinity to a target antigen, wherein in said VH domain, a native amino acid residue at position 1 of a fourth framework region (FR4) of said multivalent binding protein is substituted with a different amino acid residue that is capable of disrupting a surface-exposed hydrophobic patch comprising or associated with said native amino acid residue at that position. (Item 26) 26. The multivalent binding protein of item 25, wherein the native amino acid residue at position 1 of FR4 is substituted by a polar amino acid residue. (Item 27) 27. The multivalent binding protein of claim 26, wherein the native amino acid residue at position 1 of FR4 is substituted with a positively charged amino acid residue. (Item 28) 28. The multivalent binding protein of claim 27, wherein the positively charged amino acid residue is selected from the group consisting of lysine (K), arginine (R), and histidine (H). (Item 29) 29. The multivalent binding protein of item 28, wherein the positively charged amino acid residue is arginine (R). (Item 30) 30. The multivalent binding protein of item 29, comprising a tryptophan (W) to arginine (R) substitution at the first amino acid residue in the fourth framework (FR4) region. (Item 31) 31. The multivalent binding protein of any one of items 25 to 30, comprising one or more additional mutations in one or more framework regions. (Item 32) A recombinant heavy chain-only immunoglobulin (Ig) locus comprising one or more human V gene segments, one or more human D gene segments, and one or more human J gene segments which, when recombined with each other in the genome of a non-human animal, following affinity maturation, encode a heavy chain variable (VH) region comprising complementarity determining regions (CDRs) and framework regions (FRs), wherein at least one of the human J segments comprises a codon at position 1 of its fourth framework region (FR4) encoding a non-natural amino acid residue capable of disrupting a surface-exposed hydrophobic patch comprising or associated with the natural amino acid residue at that position. (Item 33) 33. The recombinant heavy chain-only Ig locus of paragraph 32, further comprising a constant (C) region gene segment encoding an immunoglobulin constant effector region lacking CH1 functionality. (Item 34) 34. The recombinant heavy chain-only Ig locus of items 32 or 33, comprising 2 to 40 D gene segments and 2 to 20 J gene segments. (Item 35) 35. The recombinant heavy chain-only Ig locus of item 34, wherein more than one of the human J segments comprises a codon at the first position of the fourth framework region (FR4) encoding a non-natural amino acid residue capable of disrupting a surface-exposed hydrophobic patch comprising or associated with the natural amino acid residue at that position. (Item 36) 36. The recombinant heavy chain-only Ig locus of paragraph 35, wherein all of the human J segments comprise a codon at position 1 of the fourth framework region (FR4) encoding a non-natural amino acid residue capable of disrupting a surface-exposed hydrophobic patch comprising or associated with the natural amino acid residue at that position. (Item 37) 37. The recombinant heavy chain-only Ig locus of item 36, wherein in the encoded heavy chain VH region, the native amino acid residue at position 1 of FR4 is substituted by a polar amino acid residue. (Item 38) 38. The recombinant heavy chain-only Ig locus of item 37, wherein in the encoded heavy chain VH region, the positively charged amino acid residue is selected from the group consisting of lysine (K), arginine (R), and histidine (H). (Item 39) 39. The recombinant heavy chain-only Ig locus of item 38, wherein in the encoded heavy chain VH region, the positively charged amino acid residue is arginine (R). (Item 40) 40. The recombinant heavy chain-only Ig locus of paragraph 39, wherein the encoded heavy chain VH region comprises a tryptophan (W) to arginine (R) substitution at the first amino acid residue in the fourth framework (FR4) region. (Item 41) 41. The recombinant heavy chain-only Ig locus of item 40, comprising a J4 gene segment in which the W codon is replaced by R. (Item 42) 42. The recombinant heavy chain-only Ig locus of any one of items 32 to 41, wherein the encoded heavy chain VH region comprises one or more additional mutations in one or more framework regions. (Item 43) 43. The recombinant heavy chain-only Ig locus of any one of items 32 to 42, encoding a human or humanized heavy chain-only antibody comprising the VH region. (Item 44) 43. A transgenic non-human animal comprising the recombinant heavy chain-only Ig locus of any one of items 32 to 42. (Item 45) 45. The transgenic non-human animal of item 44, which is a non-human mammal. (Item 46) 46. ​​The transgenic non-human animal of item 45, which is a rodent. (Item 47) 47. The transgenic non-human animal of item 46, which is a rat or a mouse. (Item 48) 48. The transgenic non-human animal of item 47, which is a rat. (Item 49) 49. The transgenic non-human animal of item 48, which is a UniRat™. (Item 50) 1. A transgenic non-human animal comprising a heterologous heavy chain-only Ig locus that does not express any functional immunoglobulin light chain genes and that, when recombined with each other, following affinity maturation, comprises one or more V gene segments, one or more D gene segments, and one or more J gene segments encoding a VH domain comprising complementarity determining regions (CDRs) and framework regions (FRs), and one or more constant effector region gene segments each encoding an antibody constant effector region comprising CH1 functionality, wherein the native amino acid residue at position 1 of the fourth framework region (FR4) of said VH domain is replaced with a different amino acid residue that comprises said native amino acid residue at that position or that is capable of disrupting the surface-exposed hydrophobicity associated with it, and wherein said gene segments are arranged such that the V, D, and J gene segments and constant region gene segments recombine to generate a rearranged, affinity-matured heavy chain-only locus that encodes a heavy chain-only antibody (HCAb). (Item 51) 51. The transgenic non-human animal of item 50, wherein in the VH domain, the native amino acid residue at position 1 of FR4 is substituted by a polar amino acid residue. (Item 52) 52. The transgenic non-human animal of item 51, wherein in the VH domain, the positively charged amino acid residue is selected from the group consisting of lysine (K), arginine (R), and histidine (H). (Item 53) 53. The transgenic non-human animal of item 52, wherein in the VH domain, the positively charged amino acid residue is arginine (R). (Item 54) 54. The transgenic non-human animal of item 53, wherein the VH domain comprises a tryptophan (W) to arginine (R) substitution at the first amino acid residue in the fourth framework (FR4) region. (Item 55) 55. The transgenic non-human animal of item 54, wherein the heterologous heavy chain-only locus comprises a J4 segment in which a W codon is replaced with an R codon. (Item 56) 56. The heterologous heavy chain-only locus of any one of items 50 to 55, wherein the encoded heavy chain-only antibody comprises one or more additional mutations in one or more framework regions. (Item 57) 57. The transgenic non-human animal according to any one of items 50 to 56, which is a mammal. (Item 58) 58. The transgenic non-human animal of item 57, which is a rodent. (Item 59) 59. The transgenic non-human animal of item 58, which is a rat or a mouse. (Item 60) 60. The transgenic non-human animal of item 59, which is a rat. (Item 61) 61. The transgenic non-human animal of item 60, which is a UniRat™. [Brief explanation of the drawings]

[0062] [Figure 1] FIG. 1 is a diagram of a human transgene carrying a J4 gene segment (SEQ ID NO: 40) representing an R at position 101 in UniRat™ (SEQ ID NO: 41) expressing a heavy chain-only antibody, as described in the Examples. [Figure 2] FIG. 1 is a diagram of a human transgene carrying all J segments (SEQ ID NOS: 42-47, respectively, in order of appearance) that represent an R at position 101 in UniRat™, which expresses a heavy chain-only antibody, as described in the Examples. [Figure 3] We demonstrate the use of J genes in UniRat™ and OmniFlic™, the latter of which is a transgenic rat that has the same human V gene cluster as UniRat™ but expresses a fixed kappa light chain. [Figure 4] Figure 1 shows that a W→R mutation of the first amino acid residue in the fourth framework region (FR4) in a heavy-chain-only human antibody disrupts binding by the lambda light chain. [Figure 5-1] Binding of free lambda proteins to heavy chain antibodies in the same CDR3 family. The figure shows a multiple sequence alignment of 11 VH sequences from heavy chain antibodies in the same CDR3 family (SEQ ID NOS: 48-58, respectively, in order of appearance). All of these sequences contain a W at position 101. [Figure 5-2] Binding of free lambda proteins to heavy chain antibodies in the same CDR3 family. The figure shows a multiple sequence alignment of 11 VH sequences from heavy chain antibodies in the same CDR3 family (SEQ ID NOS: 48-58, respectively, in order of appearance). All of these sequences contain a W at position 101. [Figure 6] Two structures of chimeric antigen receptors using human VH extracellular binding domains are shown, including an scFV CAR-T structure (Panel A) and a CAR-T structure (Panel B) using a human heavy chain-only antibody of the invention. [Figure 7] 1 shows various multispecific HCAb constructs containing human VH binding domains. DETAILED DESCRIPTION OF THE INVENTION

[0063] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are within the skill of the art. Such techniques may be found in such publications as "Molecular Cloning: A Laboratory Manual," second edition (Sambrook et al., 1989); "Oligonucleotide Synthesis" (M.J. Gait, ed., 1984); "Animal Cell Culture" (R.I. Freshney, ed., 1987); "Methods in Enzymology" (Academic Press, Inc.); "Current Protocols in Molecular Biology" (F.M. Ausubel et al., eds., 1987, and periodic updates); "PCR: The Polymerase Chain Reaction," eds. (F.M. Ausubel et al., eds., 1987); and "PCR: The Polymerase Chain Reaction." These techniques are fully described in such publications as "Phage Display: A Laboratory Manual" (Barbas et al., 2001); "A Practical Guide to Molecular Cloning" (Perbal Bernard V., 1988); and "Phage Display: A Laboratory Manual" (Mullis et al., ed., 1994).

[0064] All references cited herein, including patent applications and publications, are incorporated by reference in their entirety.

[0065] I. Definition As used herein, a "transgenic non-human animal," as defined herein, is a non-human animal capable of producing human or humanized heavy chain-only antibodies in which the amino acid residue at position 1 of the fourth framework region (FR4) has been replaced with another residue capable of disrupting the surface-exposed hydrophobic patch containing or associated with such residue. In one embodiment, the native amino acid residue is replaced with a charged amino acid residue, such as a positively charged amino acid residue. The transgenic non-human animal is preferably a mammal, including but not limited to, rat, mouse, cow, monkey, pig, sheep, goat, rabbit, dog, cat, guinea pig, hamster, etc. Preferably, the transgenic non-human animal is a rodent, preferably a rat or mouse, most preferably a UniRat™. The choice of transgenic animal is limited only by its ability to produce human or chimeric heavy chain-only human or chimeric antibodies with the FR4 mutations described herein.

[0066] As used herein, a "genetic modification" refers to one or more modifications in the genetic sequence of a non-human animal. A non-limiting example is the insertion of a transgene into the genome of a transgenic animal.

[0067] As used herein, "transgene" refers to foreign DNA that contains a promoter, reporter gene, polyadenylation signal, and other elements that enhance expression (insulators, introns). This foreign DNA is integrated into the genome of the one-cell embryo from which the transgenic animal develops, and the transgene is maintained in the genome of the mature animal. The integrated transgene DNA can occur at a single or multiple locations in the egg or mouse genome, and from a single to multiple (hundreds) tandem copies of the transgene can be integrated at each genomic location.

[0068] A "standard antibody" is usually a heterotetrameric glycoprotein of about 150,000 daltons, composed of two identical light (L) chains and two identical heavy (H) chains. Each light chain is linked to a heavy chain by one covalent disulfide bond, although the number of disulfide linkages varies among the heavy chains of different immunoglobulin isotypes. Each heavy and light chain also has regularly spaced intrachain disulfide bridges. Each heavy chain contains at one end a variable domain (V H ) followed by several constant domains. Each light chain has a variable domain (V L the light-chain constant domain is juxtaposed to the first constant domain of the heavy chain, and the light-chain variable domain is juxtaposed to the variable domain of the heavy chain. Particular amino acid residues are believed to form an interface between the light- and heavy-chain variable domains.

[0069] Antibody residues herein are numbered according to the Kabat numbering system (e.g., Kabat et al. al., Sequences of Immunological Interest. 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991)). According to this numbering, the first amino acid residue of the FR4 region is amino acid position 101.

[0070] The term "variable" refers to the fact that certain portions of the variable domains differ extensively in sequence among antibodies and are used in the binding and specificity of each particular antibody for its particular antigen. However, the variability is not evenly distributed throughout the variable domains of antibodies. It is concentrated in three segments called complementarity-determining regions (CDRs) or hypervariable regions in both the light- and heavy-chain variable domains. The more highly conserved portions of the variable domains are called the framework (FR). Natural heavy- and light-chain variable domains each contain four FR regions that largely adopt a β-sheet structure and are connected by three CDRs that form loops connecting, and in some cases, forming part of, the β-sheet structure. The CDRs of each chain, together with the CDRs from the other chain, are brought into close proximity by the FR regions and contribute to the formation of the antigen-binding site of antibodies (Kabat et al., NIH Publ. No. 91-3242, Vol. 1, pages 115-118). 647-669 (1991). The constant domains are not involved directly in binding an antibody to an antigen, but exhibit various effector functions, such as participation of the antibody in antibody-dependent cellular cytotoxicity.

[0071] As used herein, the term "monoclonal antibody" refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible minor naturally occurring mutations. Monoclonal antibodies are highly specific, targeting a single antigenic site. Furthermore, in comparison to standard (polyclonal) antibody preparations, which typically contain different antibodies targeting different determinants (epitopes), each monoclonal antibody targets a single determinant on the antigen.

[0072] The terms "heavy chain-only antibody," "heavy chain antibody," and "HCAb" are used interchangeably and refer, in the broadest sense, to an antibody lacking the light chain of a standard antibody. Because homodimeric HCAbs lack light chains and therefore lack a VL domain, antigens are recognized by a single domain, i.e., the variable domain of the heavy chain of a heavy chain antibody (VH or VHH when referring to camelid heavy chain variable domains). This term specifically includes, but is not limited to, homodimeric antibodies comprising a VHH antigen-binding domain and CH2 and CH3 constant domains or camelid antibodies lacking the CH1 domain; functional (antigen-binding) variants of such antibodies, soluble VH variants, Ig-NARs comprising a homodimer of one variable domain (V-NAR) and five C-like constant domains (C-NARs) and functional fragments thereof; and soluble single-domain antibodies (sdAbs) or nanobodies. The heavy chain-only antibodies of the present invention comprise at least one heavy chain variable (VH) domain in which the amino acid residue at position 1 of FR4 (amino acid residue 101 according to Kabat numbering) is replaced by another residue capable of disrupting the surface-exposed hydrophobic patch containing or associated with that residue. In one embodiment, the native amino acid residue is replaced by a charged amino acid residue, such as a positively charged amino acid residue. The heavy chain-only antibodies of the present invention are preferably human or chimeric antibodies, and preferably contain a Trp (W) to Arg (R) mutation at amino acid position 101 (W101R mutation). In one embodiment, the heavy chain-only antibodies herein are used as the binding (targeting) domain of a chimeric antigen receptor (CAR).

[0073] The term "soluble single domain antibody (sdAb)" is used in the broadest sense to refer to a polypeptide comprising the heavy chain variable domain of a heavy chain antibody, or of a standard IgG, in the absence of a constant domain. The basic sdAb structure usually consists of four framework regions (FR1-FR4) interrupted by three complementarity determining regions (CDR1-CDR3). Thus, an sdAb can be represented by the following structure: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4. For further review, see, e.g., Holt et al., "Domain antibodies: proteins for therapy"Trends in Biotechnology(2003 ): Vol. 21, No. 11: 484-490.

[0074] The antibodies of the present invention include multispecific antibodies. Multispecific antibodies have more than one binding specificity. The term "multispecific" particularly includes "bispecific" and "trispecific" as well as higher order independent specific binding affinities, e.g., higher order polyepitopic specificities, and tetravalent antibodies and antibody fragments. The terms "multispecific antibody," "multispecific single-chain antibody," and "multispecific HCAb" are used herein in the broadest sense to encompass all antibodies with more than one binding specificity.

[0075] As used herein, the term "valency" refers to a designated number of binding sites on an antibody molecule.

[0076] A "multivalent" antibody has two or more binding sites. Thus, the terms "bivalent," "trivalent," and "tetravalent" refer to the presence of two binding sites, three binding sites, and four binding sites, respectively. Bispecific antibodies according to the invention are at least bivalent and may be trivalent, tetravalent, or otherwise multivalent. Multispecific, single-chain-only antibodies, e.g., bispecific antibodies, of the invention include multivalent, single-chain-only antibodies.

[0077] The term "chimeric antigen receptor" or "CAR" is used herein in the broadest sense to refer to a receptor that has been engineered by grafting a desired binding specificity (e.g., the antigen-binding region of a monoclonal antibody or other ligand) onto a transmembrane and intracellular signaling domain. Typically, receptors are used to graft the specificity of a monoclonal antibody onto T cells. J Natl Cancer Inst, 2015;108(7):dvj439; and Jackson et al., Nature Reviews Clinical Oncology, 2016;13:370-383. A representative CAR-T construct containing a human VH extracellular binding domain is shown in Figure 6.

[0078] By "recombinant immunoglobulin (Ig) locus" is meant an Ig locus that lacks a portion of an exogenous Ig locus and / or includes at least one fragment that is not endogenous to the Ig locus in the mammal of interest. Such fragments can be human or non-human, can include any Ig gene segment or portion thereof, or can constitute the entire Ig locus. A recombinant Ig locus is preferably a functional locus that is capable of performing gene rearrangements and producing a repertoire of immunoglobulins in a transgenic animal. The recombinant Ig locus includes a recombinant Ig light chain locus and a recombinant Ig heavy chain locus. Once integrated into the host genome, the artificial Ig locus can be referred to as a recombinant Ig locus.

[0079] By "transgenic antibody" is meant an antibody encoded by a recombinant Ig locus and produced by or otherwise derived from a transgenic non-human mammal comprising a recombinant Ig locus according to the invention. Transgenic antibodies derived from a subject transgenic animal include transgenic antibodies produced using isolated cells or nucleic acids obtained from the subject transgenic animal, or using cells or nucleic acids derived from isolated cells or nucleic acids obtained from the subject transgenic animal. In a preferred embodiment, the transgenic antibody comprises an amino acid sequence encoded by an integrated donor polynucleotide or portion thereof.

[0080] As used herein, the term "Ig gene segment" refers to a segment of DNA that encodes various portions of an Ig molecule that is present in the germline of non-human animals and humans and that assembles to form rearranged Ig genes in B cells. Thus, as used herein, "Ig gene segment" can refer to V gene segments, D gene segments, J gene segments, and C region genes, and portions thereof.

[0081] As used herein, the term "human Ig gene segment" includes both naturally occurring sequences of human Ig gene segments, degenerate forms of naturally occurring sequences of human Ig gene segments, and synthetic sequences that encode polypeptide sequences substantially identical to polypeptides encoded by naturally occurring sequences of human Ig gene segments. By "substantially," we mean that the degree of amino acid sequence identity is at least about 85-95%. Preferably, the degree of amino acid sequence identity is greater than 90%, more preferably greater than 95%.

[0082] As defined herein, the term "heavy chain-only antibody locus" refers to a locus encoding a VH domain in which the first amino acid residue of the FR4 region of an antibody is positively charged and which comprises one or more V gene segments, one or more D gene segments, and one or more J gene segments, optionally including one or more heavy chain effector region gene segments that each encode an antibody constant effector region lacking CH1 domain functionality. Preferably, a heavy chain-only locus comprises about 5 to about 20 V gene fragments, about 2 to about 40 D gene fragments, and about 2 to about 20 J gene fragments, and the V / D / J fragments are preferably of human origin. The terms "D gene segment" and "J gene segment" also include within their scope derivatives, homologs, and fragments thereof, and the resulting segments can rearrange with the remaining components of the heavy chain antibody locus as described herein to generate a heavy chain-only antibody. The D and J gene segments may be derived from naturally occurring sources, or they may be synthesized using methods well known to those of skill in the art and described herein. In one embodiment, in the J4 gene segment, the codon for W (TGG) is replaced by the codon for R (CGG) to encode R instead of W at the first amino acid position of FR4 (position 101 of a heavy chain-only antibody according to Kabat numbering). The D and J gene segments may incorporate codons for predetermined additional amino acid residues or predetermined amino acid substitutions or deletions to increase CDR3 diversity. The term "V gene segment" encompasses naturally occurring V gene segments from non-human animals, e.g., non-human mammals such as rodents, that have been modified to introduce a positively charged amino acid residue at the first residue of the FR4 region. A "V gene segment" should rearrange with a D gene segment, a J gene segment, and a heavy chain constant region that excludes the CH1 exon, so that a heavy chain-only antibody can be generated when the nucleic acid is expressed.

[0083] By "human idiotype" is meant a polypeptide sequence epitope present in the immunoglobulin heavy and / or light chain variable region on a human antibody. As used herein, the term "human idiotype" includes both naturally occurring sequences of human antibodies and synthetic sequences that are substantially identical to polypeptides found in naturally occurring human antibodies. By "substantially," we mean that the degree of amino acid sequence identity is at least about 85-95%. Preferably, the degree of amino acid sequence identity is greater than 90%, more preferably greater than 95%.

[0084] By "chimeric antibody" or "chimeric immunoglobulin" is meant an immunoglobulin molecule that contains amino acid sequences derived from at least two different Ig loci, e.g., a transgenic antibody that contains a portion encoded by a human Ig locus and a portion encoded by a rat Ig locus. Chimeric antibodies include antibodies with non-human or artificial Fc regions and human idiotypes. Such immunoglobulins can be isolated from animals of the invention that have been modified to produce such chimeric antibodies.

[0085] "Binding affinity" refers to the strength of the sum of noncovalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen). Unless otherwise indicated, as used herein, "binding affinity" refers to the intrinsic binding affinity, which reflects a 1:1 interaction between members of a binding pair (e.g., an antibody and an antigen). The affinity of a molecule X for its partner Y can generally be expressed by a dissociation constant (Kd). The Kd of the HCAbs of the present invention is typically about 1 μM to about 1 μM; for example, the Kd can be about 200 nM, 150 nM, 100 nM, 60 nM, 50 nM, 40 nM, 30 nM, 20 nM, 10 nM, 8 nM, 6 nM, 4 nM, 2 nM, 1 nM, or stronger. Affinity can be measured by common methods known in the art. Low affinity antibodies generally bind antigen slowly and tend to dissociate easily, whereas high affinity antibodies generally bind antigen rapidly and tend to remain bound.

[0086] As used herein, "Kd" or "Kd value" refers to the dissociation constant measured using a surface plasmon resonance assay, e.g., a BIAcore™-2000 or BIAcore™-3000 (BIAcore, Inc., Piscataway, NJ) at 25°C with a stepped antigen CM5 chip at approximately 10 response units (RU). For further details, see, e.g., Chen et al., J. Mol. Biol. 293:865-881 (1999).

[0087] An "epitope" is a site on the surface of an antigen molecule to which a single antibody molecule binds. Typically, an antigen has several or many different epitopes and will react with many different antibodies. The term specifically includes linear and conformational epitopes.

[0088] "Polyepitopic specificity" refers to the ability to specifically bind to two or more different epitopes on the same or different target(s).

[0089] When two antibodies recognize the same or sterically overlapping epitopes, the antibodies bind to "substantially the same epitope" as a reference antibody. The most widely used rapid method for determining whether two epitopes bind to the same or sterically overlapping epitopes is a competitive assay, which can be configured in a number of different formats, using either labeled or unlabeled antibodies. Typically, the antigen is immobilized on a 96-well plate, and the ability of unlabeled antibodies to block the binding of the labeled antibody is measured using a radioactive or enzyme label.

[0090] "Epitope mapping" is the process of identifying the binding site or epitope of an antibody on its target antigen. Antibody epitopes can be linear or conformational. Linear epitopes are formed by a contiguous sequence of amino acids in a protein. Conformational epitopes are formed by non-contiguous amino acids in the protein sequence that come together upon folding of the protein into its three-dimensional structure.

[0091] As used herein, "tumor" refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues. The term "tumor" includes both solid tumors and hematological cancers.

[0092] The terms "cancer" and "cancerous" refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia. More specific examples of cancer include breast cancer, gastric cancer, squamous cell carcinoma, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatic cancer, colon cancer, colorectal cancer, endometrial cancer, salivary gland cancer, kidney cancer, renal cancer, prostate cancer, vulvar cancer, thyroid cancer, liver cancer, head and neck cancer, rectal cancer, colorectal cancer, lung cancer, including small cell lung cancer, non-small cell lung cancer, lung adenocarcinoma, and lung squamous cell carcinoma, squamous cell carcinoma (e.g., epithelial cell carcinoma ... epidermal squamous cell carcinoma), prostate cancer, peritoneal cancer, hepatocellular carcinoma, gastric cancer including gastric or gastrointestinal cancer, pancreatic cancer, glioblastoma, retinoblastoma, astrocytoma, theca cell tumor, male germ cell tumor, hepatoma, hematologic malignancies including non-Hodgkin's lymphoma (NHL), multiple myeloma and acute hematologic malignancies, endometrial or uterine cancer, endometriosis, fibrosarcoma, choriocarcinoma, salivary gland cancer, vulvar cancer, thyroid cancer, esophageal cancer, liver cancer, Anal cancer, penile cancer, nasopharyngeal cancer, laryngeal cancer, Kaposi's sarcoma, melanoma, skin cancer, Schwannoma, oligodendroglioma, neuroblastoma, rhabdomyosarcoma, osteosarcoma, leiomyosarcoma, urinary tract cancer, thyroid cancer, Wilms' tumor, and B-cell lymphomas (low-grade / follicular non-Hodgkin's lymphoma (NHL); small lymphocytic (SL) NHL; intermediate-grade / follicular NHL; high-grade immunoblastic NHL; high-grade lymphoblastic NHL) ; low-grade small non-cleaved cell NHL; bulky disease NHL; mantle cell lymphoma; AIDS-related lymphoma; and Waldenstrom's macroglobulinemia); chronic lymphocytic leukemia (CLL); acute lymphoblastic leukemia (ALL); hairy cell leukemia; chronic myeloblastic leukemia; and post-transplant lymphoproliferative disorder (PTLD), as well as abnormal vascular proliferation associated with phacomatosis and Meigs syndrome.

[0093] II. Detailed Description The HCAbs of the present invention are human or chimeric, in which the native amino acid residue at position 1 of the FR4 region (amino acid position 101 according to the Kabat numbering system) has been replaced with another amino acid residue capable of disrupting the surface-exposed hydrophobic patch containing or associated with the native amino acid residue at that position. Such hydrophobic patches, which are normally buried at the interface with the antibody light chain constant region, become surface-exposed in HCAbs, and are at least partially responsible for undesired aggregation and light chain binding of the HCAb. The substituted amino acid residue is preferably charged, more preferably positively charged. The resulting HCAbs preferably have high antigen-binding affinity and high solubility under physiological conditions in the absence of aggregation.

[0094] Particularly included are heavy chain-only antibodies lacking camelid VHH frameworks and mutations, as well as functional VH regions thereof. Such heavy chain-only antibodies can be produced, for example, in transgenic rats or mice containing a complete human heavy chain-only locus, as described, for example, in WO 2006 / 008548, although other transgenic mammals such as rabbits, guinea pigs, and rats can also be used, with rats and mice being preferred. Heavy chain-only antibodies containing functional VHH or VH fragments can also be produced by recombinant DNA technology by expression of encoding nucleic acids in suitable eukaryotic or prokaryotic hosts, including E. coli or yeast.

[0095] Heavy-chain-only antibody domains combine the advantages of antibodies and small molecule drugs; they can be monovalent or multivalent, have low toxicity, and are cost-effective to produce. Due to their small size, these domains are easy to administer, including orally or topically, feature high stability, including gastrointestinal stability, and their half-lives can be tailored to the desired use or indication. Furthermore, VH and VHH domains of HCAbs can be produced cost-effectively.

[0096] In one embodiment, the domain of the HCAb is a nanobody as defined herein above.

[0097] In one embodiment, the HCAb binding domain is part of a multispecific binding protein that binds to multiple different epitopes on the same target antigen or multiple different epitopes on more than one target antigen. In one embodiment, the antibody is a bispecific antibody. Various multispecific structures comprising human VH binding domains are shown in Figure 7. Multispecific or bispecific HCAbs of the invention can bind, for example, to two or more sites on the same soluble target, two or more sites on the same cell surface (receptor), such as tumor antigens, or one or more soluble targets and one or more cell surface receptor targets. In certain embodiments, the bispecific HCAb structures herein have the following binding affinities: epithelial cell adhesion molecule (EpCam) x CD3; CD19 x CD3; EpCam x CD3; TNF-α x IL-17; IL-1α x IL-1β; CD30 x CD16A; human epidermal growth factor receptor 2 (HER2) x HER3; IL-4 x IL-13; angiopoietin 2 (Ang-2) x vascular endothelial growth factor A (VEGF-A); factor IXa x factor X; Epidermal growth factor receptor (EGFR) × HER3; IL-17A × IL-17F; HER2 × HER3; carcinoembryonic antigen × CD3; CD20 × CD3; CD123 × CD3; BCMA × CD3, PSMA × PSCA × CD3, PSMA × CD3, PSCA × CD3, CD19 × CD22 × CD3, CD22 × CD3, CD38 × PD1, CD38 × PD-L1, CD38 × CD73, CD38 × CD39, PD1 × CD39 × CD73, and PD1 × CD73.

[0098] In a preferred embodiment, the HCAbs herein are produced by transgenic animals, including transgenic mice and rats, preferably rats, in which endogenous immunoglobulin genes have been knocked out or disabled. In a preferred embodiment, the HCAbs herein are produced in UniRat™. UniRat™ mice have their endogenous immunoglobulin genes silenced and express a diverse, naturally optimized, fully human HCAb repertoire using human immunoglobulin heavy chain transgenes. Endogenous immunoglobulin loci in rats can be knocked out or silenced using a variety of techniques, but in UniRat™, zinc finger (endo)nuclease (ZNF) technology was used to inactivate the endogenous rat heavy chain J locus, light chain Cκ locus, and light chain Cλ locus. Microinjection of ZNF constructs into oocytes can produce IgH and IgL knockout (KO) strains. For more details, see, e.g., Geurts et al., 2009, Science 325:433, and an analysis of Ig heavy chain knockout rats is reported by Menoret et al., 2010, Eur. J. Immunol. 40:2932-2941. An advantage of ZNF technology is that non-homologous end joining to silence genes or loci via deletions of up to several kb also provides target sites for homologous integration (Cui et al., 2011, Nat Biotechnol 29:64-67). UniRat™ HCAbs bind epitopes that cannot be attacked by standard antibodies. Their high specificity, affinity, and small size make them ideal for monospecific and polyspecific applications.

[0099] In the heavy chain-only antibodies of the present invention, the native amino acid residue at position 1 of the fourth framework region (FR4) is replaced with a different amino acid residue that can disrupt a surface-exposed hydrophobic patch containing or associated with the native amino acid residue at that position. In one embodiment, the substituted amino acid residue is charged. In another embodiment, the substituted amino acid residue is positively charged, such as a lysine (Lys, K), arginine (Arg, R), or histidine (His, H) residue, preferably an arginine (R) residue. As can be seen in the alignment of Figure 5, VH sequences from heavy chain antibodies within the same CDR3 family all contain Trp (W) at position 101; therefore, in a preferred embodiment, the heavy chain-only antibodies derived from the transgenic animals of the present invention contain a Trp to Arg mutation at position 101.

[0100] The human or chimeric heavy chain-only antibodies of the present invention can be generated against any desired target antigen and have great potential for a variety of clinical applications. Target antigens for therapeutic applications include, but are not limited to, EGFR, ErbB2 (HER2), ErbB3 (HER3), ErbB4 (HER4), CTLA-4 / CD152, RANKL, TNF-α, CD20, IL-12 / IL-23, IL1-β, IL-17A, IL-17F, CD38, NGF, IGF-1, IL-12, CD20, CD30, CD39, CD73, CD40, PD-1, PDL-1, PD-L2, BCMA, BTLA, thymic stromal lymphopoietin (TSP), follicle-stimulating hormone receptor (FSHR), prostate-specific membrane antigen (PSMA), prostate stem cell antigen (PSCA), CD137, OX-40, and IL-33. Therapeutic indications include, but are not limited to, the treatment of solid tumors, hematologic tumors, inflammatory diseases such as rheumatoid arthritis, psoriasis, Crohn's disease, and ulcerative colitis, metabolic diseases, cardiovascular diseases, respiratory diseases, dermatological diseases, central nervous system diseases, hematological diseases, eye / ear diseases, and liver diseases.

[0101] Target tumors include, for example, breast cancer, gastric cancer, squamous cell carcinoma, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, liver cancer, colon cancer, colorectal cancer, endometrial cancer, salivary gland cancer, kidney cancer, renal cancer, prostate cancer, vulvar cancer, thyroid cancer, liver cancer, head and neck cancer, rectal cancer, colorectal cancer, lung cancer, including small cell lung cancer, non-small cell lung cancer, lung adenocarcinoma, and lung squamous cell carcinoma, squamous cell carcinoma (e.g., epithelial squamous cell carcinoma) epithelial cancer), prostate cancer, peritoneal cancer, hepatocellular carcinoma, gastric cancer including gastric or gastrointestinal cancer, pancreatic cancer, glioblastoma, retinoblastoma, astrocytoma, theca cell tumor, male germ cell tumor, hepatoma, hematologic malignancies including non-Hodgkin's lymphoma (NHL), multiple myeloma (MM) and acute hematologic malignancies, endometrial or uterine cancer, endometriosis, fibrosarcoma, choriocarcinoma, salivary gland cancer, vulvar cancer, thyroid cancer, esophageal cancer, liver cancer , anal cancer, penile cancer, nasopharyngeal cancer, laryngeal cancer, Kaposi's sarcoma, melanoma, skin cancer, Schwannoma, oligodendroglioma, neuroblastoma, rhabdomyosarcoma, osteosarcoma, leiomyosarcoma, urinary tract cancer, thyroid cancer, Wilms' tumor, and B-cell lymphomas (low-grade / follicular non-Hodgkin's lymphoma (NHL); small lymphocytic (SL) NHL; intermediate-grade / follicular NHL; high-grade immunoblastic NHL; high-grade lymphoblastic NHL) ; low-grade small non-cleaved cell NHL; bulky disease NHL; mantle cell lymphoma; AIDS-related lymphoma; and Waldenstrom's macroglobulinemia); chronic lymphocytic leukemia (CLL); acute lymphoblastic leukemia (ALL); hairy cell leukemia; chronic myeloblastic leukemia; and post-transplant lymphoproliferative disorder (PTLD), as well as abnormal vascular proliferation associated with phacomatosis and Meigs syndrome.

[0102] Further details of the invention are illustrated by the following non-limiting examples, which use the following abbreviations: BAC Bacterial Artificial Chromosome YAC yeast artificial chromosome ZFN zinc finger nuclease Heavy chain C constant region V variable region D. Diversity Segment J-connected segment [Example]

[0103] Example 1: Generation of genetically modified rats expressing heavy chain-only antibodies (HCAbs) Previously identified, analyzed, and partially modified BACs and YACs provide human heavy chain variable region genes and rat constant region genes (Osborn et al., 2013, J. Immunol. 190:1481-1490; Ma et al., 2013, J. Immunol. Methods 400-401:78-86). To enable expression of heavy chain antibodies, the rat constant region BACs have been modified by removing Cμ and replacing all Cγ residues. H The heavy chain-only expression was enhanced by silencing the endogenous heavy and light chain (kappa and lambda) loci.

[0104] Construction of modified human IgH loci on YACs and BACs A "human-rat" IgH locus was constructed and assembled in several parts. H downstream modification and ligation of rat C region genes, followed by the human V H The addition of the 6-D segment upstream of the human V H Two BACs [BAC6 and BAC3] with distinct clusters of genes are H 6-All D-All J H - Rat Cγ2a / 1 / 2b (ΔC H 1) was co-injected with a BAC called Georg that encodes the assembled and modified region.

[0105] For the introduction of modifications at precise locations in DNA sequences and for the simultaneous ligation of multiple large DNA regions, we developed a technique for assembling sequences with overlapping ends in S. cerevisiae as circular YACs (cYACs) and subsequently converting such cYACs into BACs. The advantages of YACs include their ability to carry large DNA inserts, ease of homologous modification in yeast hosts, and maintenance of sequence stability, especially in highly repetitive regions (e.g., switch regions, enhancers). On the other hand, BACs can be propagated in E. coli, offering the advantages of easy preparation and high yields. Furthermore, detailed restriction mapping and sequence analysis can be better achieved in BACs than in YACs. Two self-replicating S. cerevisiae / E. coli shuttle vectors, pBelo-CEN-URA and pCAU, were constructed. Briefly, S. cerevisiae CEN4 was excised as an AvrII fragment from pYAC-RC (Marchuk and Collins, 1988; Nucleic Acids Res. 16(15):7743) and ligated into SpeI-linearized pAP599 (Ma et al. Mol. Microbiol. 2007;66(1):14-25). The resulting plasmid contained CEN4 cloned downstream of URA3. From this, the ApaLI-BamHI URA3-CEN4 fragment was excised and ligated into ApaLI- and BamHI-digested pBACBelo11 (New England Biolabs), yielding pBelo-CEN-URA. The S. cerevisiae autonomously replicating sequence ARS209 was synthesized and cloned into the unique SexAI site of pBelo-CEN-URA, yielding pCAU.

[0106] Human J H 4. To facilitate the modification of rat Cμ and Cγ1 regions, human J HA ∼37-kb SacII fragment spanning approximately 2.2 kb upstream of the γ2b switch region to approximately 5.5 kb downstream of the rat Cγ1 coding region was excised from the BAC construct Annabel (Osborn et al., 2013; J. Immunol. 190:1481-1490) and cloned into the unique SacII site of pBelo-CEN-URA [pBelo+SacII, 37 kb]. Furthermore, to modify the rat Cγ2b region, a ∼19-kb SacII-SwaI fragment spanning approximately 6.9 kb upstream of the γ2b switch region to approximately 2.0 kb downstream of the Cγ2b coding region from Annabel was cloned into pBelo-CEN-URA doubly digested with SacII and HpaI [pBelo+SacII-SwaI, 19 kb]. Both plasmids were used as templates to amplify various human and rat genomic regions and to establish the necessary restriction fragments.

[0107] Human J H The DNA region spanning approximately 3.1 kb upstream of and including rat Cμ with some 3' region was modified and assembled into pCAU as a 16.7 kb SnaBI-FspI fragment. The modified region contained a T → C point mutation (resulting in a W → R amino acid change) at the base of J. H All authentic human J except those introduced in 4 H It is deleted along with the rest of the Cµ coding region to form C H J was precisely replaced with the rat Cγ2a sequence lacking 1 (starting from the intron immediately upstream of the hinge to the 3' end of the membrane exon). H This construct was derived from the assembly of five overlapping fragments in yeast as a cYAC, which was then converted to a BAC: human J, amplified with primers HC27-1 and -2, and the rat intergenic region from μCH1 to μCH1. H A mutated J from the upstream region of H 4( [ka] A fragment of approximately 4.3 kb spanning the mutated J fragment (the point mutation introduced via the latter primer indicated by ) was amplified using primers HC27-3 and -4. H 4( [ka] a fragment of approximately 3.4 kb covering the μ switch region (indicated by ) to the upstream of the μ switch region; a fragment of approximately 5.2 kb AflII excised from pBelo+SacII37 kb encompassing the μ switch region and adjacent sequences; and a fragment of C fused to sequences adjacent to rat Cμ amplified with long primers HC27-5 and -6. H Amplification of rat Cγ2a lacking CH1 and the pCAU vector with primers HC27-7 and -8 yielded pCAU+HuJ-rat Cγ2a(-CH1). All modified regions were sequenced to confirm accuracy.

[0108] Rat, C H Cγ1 lacking 1, and C H Cγ2b lacking 1 was independently generated by PCR. H A ∼1.7 kb fragment located immediately upstream of the Cγ1 coding region, with its 3′ end coinciding with the 5′ end of the intron between Cγ1 and the hinge, was amplified using primers HC27-9 and -10. Cγ1 was amplified using primers HC27-11 and -12. H A fragment of approximately 3.9 kb was amplified from the intron between 1 and the hinge to the 3' end of the coding region. Both the approximately 1.7 kb and approximately 3.9 kb fragments were subsequently gel purified and combined by overlap PCR using primers HC27-9 and -12 to obtain a fragment of approximately 5.6 kb. H For Cγ2b without Cγ2b, a fragment of approximately 0.3 kb upstream of the Cγ2b coding region was amplified using primers HC27-13 and -14, resulting in Cγ2b. HA 5.4 kb fragment spanning the region from the intron between 1 and the hinge to the 3' end of the coding region was amplified using primers HC27-15 and -16. These two fragments were then combined by overlap PCR using primers HC27-13 and -16 to yield a 5.7 kb fragment. pCAU+ratCγ1,2b(-CH1) was constructed containing: a 100 bp homologous region matching the 3' end of rat Cμ; both C H The Cγ1 and Cγ2b sequences were followed in the genome organization except that Cγ1 was deleted. The construct pCAU+ratCγ1,2b(-CH1) was constructed using six overlapping fragments: a 37 kb SpeI-NarI fragment excised from pBelo+SacII, spanning the 3' Cμ homology region followed by the γ1 switch region, approximately 10.2 kb, and a Cγ1-Cγ2b fragment excised from pBelo+SacII, spanning the 3' Cμ homology region followed by the γ1 switch region, as described above. H an approximately 5.6 kb PCR fragment containing Cγ1 without Cγ1; an approximately 7.4 kb fragment covering the intergenic region between Cγ1 and Cγ2b amplified with primers HC27-17 and -18; an approximately 11.3 kb XhoI fragment encompassing the rat Cγ2b switch region excised from pBelo+SacII-SwaI, 19 kb; H A ∼5.7 kb PCR fragment containing Cγ2b without Cγ1, 2b, and the pCAU vector was amplified using primers HC27-19 and -20. The rat genomic region in pCAU+rat Cγ1, 2b (-CH1) can be excised as a single ∼40 kb FspI fragment.

[0109] Finally, human V with all modifications H 6-DJ H A BAC (Georg) encoding the rat C region was assembled using four overlapping fragments: human V excised from BAC10 (CTD-3216M13, Invitrogen); HThe purified approximately 78.2 kb FspAI-MluI fragment encompassing the 6-D region, the 16.7 kb SnaBI-FspI fragment excised from pCAU+HuJ-rat Cγ2a(-CH1) as described above, the approximately 40 kb FspI fragment excised from pCAU+rat Cγ1,2b(-CH1), Cγ2b and Cγ2b. ε The intergenic region between ε , C α , 3' enhancer region, pBelo-CEN-URA vector, and human V H A 77.2 kb SwaI-SacII fragment was excised from construct Annabel, which contained the 5' region upstream of 6. This final construct was thoroughly examined by restriction mapping and partial sequencing. (Human V H 6-DJ H The rat C) region can be excised and purified as an approximately 201 kb NotI fragment.

[0110] BAC6 contains the human genomic region from VH4-39 to VH3-23, while BAC3 contains the downstream region from VH3-11 to VH6-1 (the most D-proximal VH gene). To provide overlap between BAC6 and BAC3, the human VH gene in BAC3 was cloned as previously described (Osborn et al. 2013, supra). H A 10.6 kb fragment located at the 5' end of the locus was integrated downstream of VH3-23 in BAC6. H The gene was excised as an approximately 182-kb AsiSI-AscI fragment. BAC3 was unmodified, and the human V in the BAC H The gene was excised as a NotI fragment of approximately 173 kb.

[0111] Oligonucleotides: HC27-1:GTATTACACACAAAATGGGAAAAGCTG (SEQ ID NO: 1) HC27-2: [ka] (SEQ ID NO: 2) HC27-3: [ka] (SEQ ID NO: 3) HC27-4:GAATCCTAGGATTGCCTTCTTAGCCTG (SEQ ID NO: 4) HC27-5:CCATAGACCAAACTTACCTACTATCTAGTCCTGCCAACCTTAAGAGCAGCAACATGGAGACAGCAGAGTGTAGAGAGATCTCCTGACTGGCAGGAGGCAAGAAGATGGATTCTTACTCGTCCATTTCTCTTTTATCCCTCTCTGGTCCTAGAGAACAACCAGGGGATGAGGGGCTC (SEQ ID NO: 5) HC27-6:GCACAAGTGGACAAAGTCTTTGGCCAGTCTAGAAAGAAGCCCGTCTCAGAGATCAAAGCTGGAGGGCAACACAGGAAAGATGTGGGAATAAGTTTACTAGTCATACAGGCAGGAACCCCAGGCCCAGAGGTAGTGTCCCTGTGGGAGGGTCTCTTGCTCTCTGATGTCCTTCCATGCTGAGAGTTAGGGCCCTTGTCCAATCATGTTC (SEQ ID NO: 6) HC27-7: GAATTTTGCCCAAGTTTTTTCAGCTTTTCCCATTTTGTGTGTAATACGTACACACCGCAGGGTAATAACTG (SEQ ID NO: 7) HC27-8:GACGGGCTTCTTTCTAGACTGGCCAAAGACTTTGTCCACTTGTGCGCAGTTATCTATGCTGTCTCACCATAGAG (SEQ ID NO: 8) HC27-9: GGAGGTCTAGGCTGGAGCTGATCCAG (SEQ ID NO: 9) HC27-10: CCTCGTCCCCTGGTTGTTCTCTCAAGAAAAAGTATGCGTGATCATTTTGTC (SEQ ID NO: 10) HC27-11: AGAGAACAACCAGGGGACGAGG (SEQ ID NO: 11) HC27-12: GTCCACATAGTCCTCCAGAGAGAGAAG (SEQ ID NO: 12) HC27-13: GACCCAAGTCCAGTTCCCAACAACCAC (SEQ ID NO: 13) HC27-14: CCTCGTCCCCTGGTTGTCCTCTCAAGAGAGGAGGGAGTGTGAGCTTTTCC (SEQ ID NO: 14) HC27-15: AGAGGACAACCAGGGGACGAGGGGCTC (SEQ ID NO: 16) HC27-16: GCATGGGGAAGGGGCATTGTATGTAGG (SEQ ID NO: 17) HC27-17: CAGATCACACTGTCTGCTCACTTCAC (SEQ ID NO: 18) HC27-18:AAGGCAGCAGGATGGAAGCTGATGTCG (SEQ ID NO: 19) HC27-19:GCTGGAGGGCAACACAGGAAAGATGTGGGAATAAGTTTACTAGTCATACAGGCAGGAACCCCAGGCCCAGAGGTAGTGTCCCTGTGGGAGGGTCTCTTGCGCACACACCGCAGGGTAATAACTG (SEQ ID NO: 20) HC27-20:GATTTAAATGTCAATTGGTGAGTCTTCTGGGGCTTCCTACATACAATGCCCCTTCCCCATGCGCAGTTATCTATGCTGTCTCACCATAGAG (SEQ ID NO: 21)

[0112] Construction of Georg II A "human-rat" IgH locus was constructed and assembled in several parts, each containing a mutated human J gene containing a point mutation encoding W→R. H1 -J H6 downstream modification and ligation of rat C region genes, followed by the human V H It contained an addition upstream of the 6-1-D segment region, and this BAC was named Georg II.

[0113] Finally, the mutated human J H1 -J H6was synthesized on a 2.3 kb Sca< / em>I fragment (Thermo Fisher Scientific, see below).

[0114] Second, the mutated human J H1 -J H6 Human J H Approximately 3.1 kb of the upstream DNA region and coding region have been replaced with the rat Cγ2a coding region. H Missing 1, J H This was combined with an approximately 11.4 kb region spanning the rat sequence immediately downstream of the human Cμ gene to form a BAC called pCAU+HuJ(WR)-rat Cγ2a(-CH1). The entire modified region in this BAC can be excised as a 16.7 kb SnaBI-FspI fragment. This BAC was derived from the assembly of four overlapping fragments in yeast as a cYAC, which was then converted into a BAC: human J, amplified with primers HC32-1 and -2, and human J. H A fragment of approximately 2.7 kb covering the region upstream of H1 -J H6- ScaI fragment, amplified with primers HC32-3 and -4, from rat J H a fragment of approximately 2.1 kb covering the region immediately downstream of pCAU+HuJ-rat Cγ2a(-CH1), an approximately 18.4 kb MluI-HpaI fragment (C H The rat Cμ locus had its coding region replaced by the rat Cγ2a coding region lacking 1 and the pCAU vector described in "HC27 Construction Methods." All modified regions were checked by sequencing to confirm accuracy.

[0115] Finally, Human V H 6-1-D-mutated J H Georg II, encoding the modified rat C region, was assembled using four overlapping fragments: human V, excised from BAC10 (CTD-3216M13, Invitrogen); HA purified approximately 78.2 kb FspAI-MluI fragment encompassing the 6-1-D region, a 16.7 kb SnaBI-FspI fragment excised from pCAU+HuJ(WR)-rat Cγ2a(-CH1) as described above, an approximately 40 kb FspI fragment excised from pCAU+rat Cγ1,2b(-CH1) (described in "HC27 Construction Method"), Cγ2b and C ε The gene circle region between ε , C α , 3' enhancer region, pBelo-CEN-URA vector, and human V H A 77.2 kb SwaI-SacII fragment was excised from construct Annabel, which contained the 5' region upstream of 6-1. This final construct was thoroughly examined by restriction mapping and partial sequencing. (Human V H 6-1-D-mutated J H The modified rat C) region can be excised and purified as an approximately 201 kb NotI fragment.

[0116] Microinjection to generate HC32 and HC33 transgenic rats BAC6 contains the human genomic region from VH4-39 to VH3-23, while BAC3 contains the downstream region from VH3-11 to VH6-1 (the most D-proximal VH gene). To provide overlap between BAC6 and BAC3, the human VH gene in BAC3 was cloned as previously described (Osborn et al. 2013, J. Immunol. 190:1481-1490). H A 10.6 kb fragment located at the 5' end of the locus was integrated downstream of VH3-23 in BAC6. H The gene was excised as an approximately 182-kb AsiSI-AscI fragment. BAC3 was unmodified, and the human V in the BAC H The gene was excised as an approximately 173 kb NotI fragment, and both fragments were purified and coinjected into rat embryos with an approximately 201 kb NotI fragment from Georg II to construct HC32.

[0117] BAC9 contains the human genomic region from VH3-74 to VH3-53. BAC(14+5) contains the downstream region from VH3-53 to VH3-13, with a 6.1 kb region immediately upstream of VH6-1 added to its 3' end to provide overlap for Georg II. H The region was excised as an approximately 185 kb NotI fragment, and that from BAC(14+5) was excised as an approximately 209 kb BsiwI fragment. Both fragments were purified and coinjected into rat embryos with an approximately 201 kb NotI fragment from Georg II to construct HC33.

[0118] DNA purification Linear YAC, circular YAC, and digested BAC fragments were purified by electroextraction using Elutrap™ (Schleicher and Schuell) from standard 0.8% agarose gels or strips excised from pulsed-field gel electrophoresis (PFGE) (Gu et al., J. Biochem. Biophys. Methods., 1992, 24:45-50). DNA concentrations were typically a few ng / µl in a volume of approximately 100 µl. For fragments up to approximately 200 kb, DNA was precipitated and redissolved at the desired concentration in microinjection buffer (10 mM Tris-HCl, pH 7.5, 100 mM EDTA, pH 8, and 100 mM NaCl, but without spermine / spermidine).

[0119] Purification of circular YACs from yeast was performed using Nucleobond AX silica-based anion exchange resin (Macherey-Nagel, Germany). Briefly, spheroplasts were generated using zymolyase or lyticase and pelleted (Davies et al., 1996, Human antibody repertoires in transgenic mice: manipulation of transfer of YACs. In Antibody Engineering: A Practical Approach. J. McCafferty, H.R. Hoogenboom, and D.J. Chiswell eds.). IRL, Oxford, UK, pp. 59-76). Cells were then alkaline lysed, bound to an AX100 column, and eluted as described for the Nucleobond method for low-copy plasmids. Contaminating yeast chromosomal DNA was hydrolyzed using Plasmid-Safe™ ATP-dependent DNase (Epicenter Biotechnologies), followed by a final purification step using SureClean (Bioline). Aliquots of DH10 electrocompetent cells (Invitrogen) were then transformed with the circular YAC to obtain BAC colonies. A filtration step with Sepharose 4B-CL was used to separate the insert DNA for microinjection, 150-200 kb, from the approximately 10 kb BAC vector DNA (Yang et al., 1997, Nat. Biotechnol. 1997, 15:859-865).

[0120] Gel analysis Purified YAC and BAC DNA was analyzed by restriction digestion and separation on a standard 0.7% agarose gel (Sambrook and Russell, 2001). Larger fragments, 50-200 kb, were separated by PFGE (Biorad ChefMapper™) at 8°C using 0.8% PFC agarose in 0.5% TBE for 16 hours at 6 V / cm and 10 mA with switching times of 2-20 seconds. Purification allowed direct comparison of the resulting fragments with the predicted sizes obtained by sequence analysis. Modifications were analyzed by PCR and sequencing.

[0121] Microinjection Outbred SD / Hsd animals were housed in standard microisolator cages under approved animal care protocols in an animal facility accredited by the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC). Rats were maintained on a 14-10 h light / dark cycle with free access to food and water. Four- to five-week-old SD / Hsd female rats were injected with 20-25 IU PMSG (Sigma-Aldrich), followed 48 h later by 20-25 IU hCG (Sigma-Aldrich) and mated with inbred SD / Hsd males. Fertilized one-cell embryos were collected for subsequent microinjection. The manipulated embryos were transferred to pseudopregnant SD / Hsd female rats and brought to term.

[0122] Purified DNA encoding recombinant immunoglobulin loci was resuspended in microinjection buffer containing 10 mM spermine and 10 mM spermidine. DNA was injected into fertilized oocytes at concentrations ranging from 0.5 to 3 ng / μl.

[0123] Plasmid DNA or mRNA encoding ZFNs specific for rat immunoglobulin genes was injected into fertilized oocytes at various concentrations ranging from 0.5 to 10 ng / μl.

[0124] Zinc finger nucleases (ZFNs) ZFNs specific for rat immunoglobulin genes were generated. The ZFN specific for rat C kappa had the following binding site: ATGAGCAGCACCCTCtcgttgACCAAGGCTGACTATGAA (SEQ ID NO: 22) The ZFNs specific for the rat J-locus sequence had the following binding sites: CAGGTGTGCCCATCCagctgaGTTAAGGTGGAG (SEQ ID NO: 23) and CAGGACCAGGACACCTGCAgcagcTGGCAGGAAGCAGGT (SEQ ID NO: 24) The ZFNs specific for the rat Cγ-locus sequence had the following binding sites: AACAGCCATTTGcagaccAAAGGGAAGGAAAGA (SEQ ID NO: 25) and TTCTACCCTGGTGTTATGacagtgGTCTGGAAGGCAGATGGT (SEQ ID NO: 26)

[0125] Rats carrying the trans locus. Transgenic rats carrying an artificial heavy-chain immunoglobulin locus in an unrearranged configuration were generated. RT-PCR and serum analysis (ELISA) of the transgenic rats revealed productive rearrangement of the transgenic immunoglobulin locus and expression of heavy-chain-only antibodies of various isotypes in the serum. Immunization of the transgenic rats resulted in the production of high-affinity, antigen-specific heavy-chain-only antibodies.

[0126] Novel zinc finger nuclease knockout technology. To further optimize heavy chain-only antibody production in transgenic rats, knockout rats were generated with the endogenous rat immunoglobulin loci inactivated.

[0127] To inactivate rat heavy immunoglobulin heavy chain expression and rat lambda light chain expression, ZFNs were microinjected into one-cell rat embryos. The embryos were then transferred to pseudopregnant female rats and brought to term. Animals carrying the mutated heavy and light chain loci were identified by PCR. Analysis of such animals demonstrated inactivation of rat immunoglobulin heavy and light chain expression in the mutant animals.

[0128] Example 2: Generation of antigen-specific heavy chain-only antibodies in rats For the generation of antigen-specific heavy chain-only antibodies in rats, genetically modified rats expressing heavy chain-only antibodies, such as those described in Example 1, are immunized in a variety of ways.

[0129] Immunization with inactivated viruses Influenza viruses with various hemagglutinin and neuraminidase genes were provided by the Immunology and Pathogenesis Branch, Influenza Division, CDC, Atlanta, GA. Virus stocks were grown in the allantoic cavity of 10-day-old embryonated chicken eggs and purified on a 10%-50% sucrose gradient by ultracentrifugation. Viruses were resuspended in phosphate-buffered saline and inactivated by treatment with 0.05% formalin at 4°C for 2 weeks. Inactivated virus and alum solution (Pierce) were mixed in a 3:1 ratio and incubated at room temperature for 1 hour before immunization. Genetically modified rats expressing heavy chain-only antibodies were immunized with all inactivated virus.

[0130] Immunization with proteins or peptides Typically, immunogens (proteins or peptides such as human immunoglobulin kappa light chain, human IgM or IgG heavy chain, human serum albumin, or protein-peptide conjugates) are diluted to 0.05–0.15 ml with sterile saline and combined with an adjuvant to a final volume of 0.1–0.3 ml. Many suitable adjuvants are available (i.e., heat-inactivated Bordetella pertussis, aluminum hydroxide gel, Quil A or saponin, bacterial lipopolysaccharide, or anti-CD40), but none possess the activity of complete Freund's adjuvant (CFA) or incomplete Freund's adjuvant (IFA). The concentration of soluble immunogens, such as proteins and peptides, can vary between 5 μg and 5 mg in the final preparation. Priming with the immunogen in CFA is administered intraperitoneally and / or subcutaneously and / or intramuscularly. When intact cells are used as immunogens, they are best injected intraperitoneally and / or intravenously. The cells are diluted in saline and administered at 1 to 20 million cells per injection. Cells that survive in the rat provide the best immunization results. After a primary immunization with the immunogen in CFA, a second immunization in IFA (booster) is usually delivered four weeks later. This series results in the development of B cells that produce high-affinity antibodies. If the immunogen is weak, boosters are administered every two weeks until a strong humoral response is achieved. The immunogen concentration can be lower in the booster, and the intravenous route can be used. Serum is collected from the rats every two weeks to measure the humoral response.

[0131] Immunization with lipid II pentapeptide, penicillin-binding proteins, β-lactamase, sortase, and other prokaryotic membrane proteins is performed as outlined above.

[0132] Immunization with lipids, glycolipids, and carbohydrate polymers Immunization with Poly-N-acetyl-β-(1-6)-glucosamine (PNAG) and Other Carbohydrate Polymers Purified dPNAG, PNAG, or other carbohydrate polymers are conjugated to diphtheria toxin, albumin, or other carrier proteins by reductive amination. Aldehyde groups are first introduced onto the surface of the carrier protein by treatment with glutaraldehyde. The activated carrier protein is then reacted with dPNAG (or other carbohydrate polymers) via its free amino groups in the presence of the reducing agent sodium NaCNBH3. Animals are immunized subcutaneously or in the footpad with PNAG and dPNAG-DT conjugates on day 0 and boosted weekly with 0.15–100 μg doses of conjugated PNAG or dPNAG in complete Freund's adjuvant or other adjuvants. Booster immunizations are preferably in incomplete Freund's adjuvant. Blood is collected weekly, and specific antibody titers are determined by ELISA. B cells are harvested from the draining lymph nodes or spleen, and hybridomas are generated using standard methods. Alternatively, yeast cells are used to select antigen-binding antibodies or fragments.

[0133] Lipid II immunization Purified lipid II with a lipid tail of C55 or less is mixed with Titermax, liposomes, Ribi adjuvant, or other adjuvants. Proteins such as KLH or ovalbumin, and immunostimulatory compounds such as lipid A or complete Freund's adjuvant, are added to the mixture. The primary immunization is performed on day 0 with 0.1–1 mg of lipid II in the footpad or subcutaneously, followed by weekly boosts with 0.15–100 μg of conjugated PNAG or dPNAG in complete Freund's adjuvant or other adjuvants. Booster immunizations are preferably in incomplete Freund's adjuvant. Blood is collected weekly, and specific antibody titers are determined by ELISA. B cells are harvested from the draining lymph nodes or spleen, and hybridomas are generated using standard methods. Alternatively, yeast cells are used to select antigen-binding antibodies or fragments.

[0134] Lipid A immunization Core lipid A is prepared according to the method of Bogard et al., 1987, Infection and Immunity, 55:4, 899-908. Acinetobacter baumannii ATCC 19606 or other Gram-negative bacteria are cultured in Luria broth, harvested by centrifugation, suspended in lyophilization medium to a cell density of 109 CFU / mL, and placed in preweighed ampoules or glass vials, filled to no more than one-third capacity. Sterile cotton or glass wool is inserted into the neck of the ampule, or a stopper is inserted into the vial. Samples are slowly frozen in an ultra-low temperature freezer, followed by overnight application of vacuum for primary drying. Secondary drying is performed by raising the temperature to 20°C for several hours. Lyophilized samples are stored at 4°C. Ten mg of lyophilized cells were suspended in 400 μL of isobutyric acid and 1 M ammonium hydroxide (5:3, v / v) and incubated at 100°C for 2 hours in a screw-cap test tube containing a stir bar. The sample was cooled in ice water and centrifuged at 2000 × g for 15 minutes. The supernatant was transferred to a new tube, diluted with an equal volume of water, and lyophilized. The sample was washed twice with 400 μL of methanol and centrifuged at 2000 × g for 15 minutes. The bottom organic layer and its interface were preserved and dried under a stream of nitrogen. Five milligrams of lipid A were then suspended in 5 ml of 0.5% (wt / vol) triethylamide (Sigma, St. Louis, MO), followed by the addition of 5 mg of acid-treated bacteria. The mixture was stirred slowly at room temperature for 30 minutes and vacuum-dried using a Speed ​​Vac centrifuge.

[0135] Lipid A-coated cells are used to immunize animals intraperitoneally or in the footpad. A 50 μl dose of core LPS-coated cell suspension was used per injection in a 1:1 mixture with Freund's incomplete adjuvant (Difco) (De Kievit & Lam, Journal of Bacteriology, December 1994, pp. 7129-7139). Animals are immunized on days 0, 4, 9, 14, and 28. Hybridoma cell lines are screened for the production of anti-LPS antibodies by enzyme-linked immunosorbent assay (ELISA) and purified LPS from different sources (Avanti Polar Lipids, Alabaster, Ala.). Supernatants were also tested with heat-killed or live Gram-negative bacteria such as Klebsiella, E. coli, Pseudomonas aeruginosa, Acitenobacter baumannii, and Salmonella. Broadly reactive antibodies are selected and competition assays with polymyxin B are performed.

[0136] Minimum inhibitory concentration (MIC) of HCAb Various laboratory methods can be used to measure the in vitro susceptibility of bacteria to antimicrobial agents. To quantitatively measure the in vitro activity of an antimicrobial agent against a given bacterial isolate, either the broth dilution method or the agar dilution method can be used. To perform the test, a series of tubes or plates are prepared using broth or agar media supplemented with various concentrations of the antimicrobial agent. A standardized suspension of the test organism is then inoculated into the tubes or plates. After overnight incubation at 35 ± 2°C, the test is performed to determine the minimum inhibitory concentration (MIC). The final result is significantly affected by the methodology, which must be carefully controlled if reproducible results (intra- and inter-laboratory) are to be achieved. The MIC obtained using the dilution test indicates the concentration of antimicrobial agent required to inhibit the infecting organism. However, the MIC does not represent an absolute value. The "true" MIC lies somewhere between the lowest test concentration that inhibits the growth of the organism (i.e., the measured MIC) and the next lowest test concentration. For example, if a 2-fold dilution is used and the MIC is 16 μg / mL, the "true" MIC would be between 16 and 8 μg / mL. Even under the best-controlled conditions, the same endpoint may not be obtained each time a dilution test is performed. Generally, acceptable reproducibility of a test is within 2-fold dilutions of the actual endpoint.

[0137] In vitro activity of the antibody or its fragment and a comparator antibiotic (vancomycin, polymyxin, cephalosporin, or other beta-lactam) was determined according to standard CLSI methodology (Clinical and Laboratory Standards Institute. 2003. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. Approved standard M7-A7) will be tested by broth microdilution MIC assay.

[0138] The activity of the antibody or its fragments is determined by the presence of Staphylococcus aureus ATCC29213, tested against Gram-positive and Gram-negative bacteria. MICs are determined as follows: 1. Preparation of bacterial inoculum. Pick a single colony of each strain from a fresh plate (less than 1 week old) and transfer to 5 ml of cation-adjusted Muller-Hinton Broth (CAMHB). Incubate overnight at 37°C on a shaker. 2. The next morning, make a 1:100 dilution of the overnight culture (50ul into 5ml). Incubate at 37°C on a shaker for 2-4 hours. 3. After 2-4 hours (absorbance at 600 nm approximately 0.3-0.5), centrifuge the bacteria (5000 rpm, 5 min), resuspend in PBS, adjust the culture to MacFarland 0.5, transfer 50 ul of the adjusted culture to 9950 ul of CAMHB and mix by vortexing. 4. After 2-4 hours (absorbance at 600 nm approximately 0.3-0.5), the bacteria are centrifuged (5000 rpm, 5 minutes), resuspended in PBS, the culture adjusted to MacFarland 0.5, and 50 ul of the adjusted culture transferred to 9950 ul of 1.1x CAMHB (cation-adjusted Muller-Hinton Broth) and mixed by vortexing. 5. Prepare mother plates [one mother plate will have 10 daughter plates, one daughter plate per strain]: (Prepare while bacteria are growing, step 5): Add 200 μl of compound stock to the first well of the deep-well plate and 100 μl of DMSO to all other wells. Make two-fold serial dilutions of compound in wells 2-11 (transfer 100 μl from 1 to 2, mix by pipetting four times, transfer 100 μl from 2 to 3, mix, etc., discard 100 μl from well 11). Well 12 is a DMSO-only control. Add 900 μl of sterile distilled water to each well and mix by pipetting. 6. MIC Plate Preparation: Transfer 10 ul from each well of the mother plate to the corresponding well of the daughter plate. Add 90 ul of bacterial inoculum to each well and mix by pipetting. 7. Incubate at 37°C for 24 hours and score for growth. Growth is considered either a cloudy well, a visible pellet, or >3 pinpoints of bacteria present in the well. The lowest concentration of compound showing no growth is scored as the MIC.

[0139] The MIC of vancomycin against Staphylococcus aureus varies between 0.1 μg / ml and 10 μg / ml using a standard broth microdilution MIC assay. The MIC of intact HCAbs against Staph. aureus varies between 0.025 μg / ml and 25 μg / ml. When variable region fragments or nanobodies are used, the MIC against Staph. aureus varies between 0.008 μg / ml and 8 μg / ml. (Vancomycin MICs for Staph. aureus are 0.25-4 μg / ml, vancomycin MICs for MRSA are 1-138 μg / ml. The molecular weight of vancomycin is 1450 daltons, the molecular weight of HCAb is 80,000 daltons. HCAb is approximately 50 times heavier than vancomycin. The affinity of vancomycin for lipid II is 50 nM, and the affinity of HCAb is 0.5-10 nM. The HCAb will have an MIC of 0.025-25 μg / ml.) (J. Clin. Microbiol. 2006,44(11):3883. DOI: A. Bruckner, Guiqing Wang, Janet F. Hindler, Kevin W. Ward and David. Increased Vancomycin MICs for Staphylococcus aureus Clinical Isolates from a University Hospital during a 5-Year Period)

[0140] MICs of HCAbs in the presence of immunoglobulins, complement, and phagocytes Opsonophagocytosis assays (OPAs) were performed as described in U.S. Patent No. 8,410,249. OPAs measure bacterial killing in the presence of antibodies, complement, and phagocytes. Human complement and cells are typically used. HCA antibodies or fragments were tested at concentrations ranging from 0.01 μg / ml to 10 μg / ml. Bacterial killing was measured by determining colony-forming units before and after incubation with all components. Opsonization was also visualized microscopically. Either human polymorphonuclear leukocytes (PMNs) or differentiated HL60 promyelocytic leukemia (HL60) cells were used as effector cells. Complement in human serum or baby rabbit serum was used as the complement source. Briefly, HCAb or other specimens are serially diluted in two-fold steps in Hank's balanced salt solution in 96-well microtiter plates and then incubated with bacteria (approximately 2,000 CFU per well) and complement on an orbital shaker for 30 minutes at 37°C. To minimize nonspecific killing or overgrowth, the optimal shaking speed is determined for each bacterial strain. Freshly isolated human PMN or differentiated HL60 cells (effector cells) are added to the bacteria (target)-complement-serum mixture at a 400:1 ratio, and the mixture is incubated for 45 minutes at 37°C. The OPA titer is the serum dilution that causes a 50% reduction in CFU (kill) compared to the CFU from control wells containing all reagents except the HCAb or its fragment. HCAb kills bacteria at 10 ng / ml to 10 μg / ml.

[0141] Cellular immunity Methods for immunizing with cells are well known in the art. For example, human Jurkat cells are grown in tissue culture to express anti-CD3e antibodies. Expression of the desired human antibody is analyzed by incubating Jurkat cells with the monoclonal antibody OKT3. Subsequently, unbound OKT3 is removed by washing the cells, and bound OKT3 is detected using fluorescein-conjugated anti-mouse IgG and flow cytometry analysis.

[0142] Rat T cell hybridoma cells are transfected by electroporation with a eukaryotic expression plasmid encoding human CD3 as described (Transy et al., 1989, Eur J Immunol 19(5):947-50). Transfectants expressing human CD3 are enriched by FACS and expanded in tissue culture.

[0143] Genetically modified rats expressing heavy chain-only (HCO) antibodies are immunized by intraperitoneal injection of 30 x 10(6) Jurkat cells. Four and eight weeks after the primary immunization, the rats are immunized with rat T cells expressing human CD3. Animals expressing anti-human CD3e heavy chain-only antibodies are used for the isolation of monoclonal heavy chain-only anti-CD3e antibodies.

[0144] DNA-based immunization protocols Genetic vaccines, or the use of DNA encoding antigens for immunization, represent an alternative approach to the generation of strong antibody responses in rats.

[0145] DNA inoculation is typically via skin, muscle, or other routes that support antigen transfection and expression. Purified plasmid DNA engineered to express antigens, such as influenza virus hemagglutinin glycoprotein or other human or viral antigens, is used. Routes of DNA inoculation include intravenous (tail vein), intraperitoneal, intramuscular (both quadriceps), intranasal, intradermal (e.g., footpad), and subcutaneous (e.g., nape of the neck). Typically, 10–100 μg of DNA is administered in 100 μl of saline per inoculation site, or DNA is administered with an appropriate vehicle, such as gold particles or specific formulations that promote cellular uptake and transfection (http: / / www.incellart.com / index.php?page=genetic-immunization&menu=3.3). The immunization scheme is similar to the protocol described above; a primary immunization is followed by a booster immunization.

[0146] Heavy chain-only antibody purification To purify antibodies, blood is collected from immunized rats and serum or plasma is obtained by centrifugation, thereby separating the clotted cell pellet from the liquid upper phase containing serum antibodies. Antibodies from the plasma serum are purified by standard procedures, including precipitation, ion exchange chromatography, and / or affinity chromatography. Protein A or Protein B can be used to purify IgG (Brueggemann et al., JI, 142, 3145, 1989).

[0147] Example 3: Isolation of antibody-expressing B cells from rats Isolation of B cells from spleen, lymph nodes, or peripheral blood Single-cell suspensions are prepared from the spleen or lymph nodes of immunized rats. After removing red blood cells or isolating B cells, memory B cells, antigen-specific B cells, or plasma cells, the cells can be used without further enrichment. Enrichment may yield better results, and minimal red blood cell removal is recommended. Memory B cells are isolated by depletion of unwanted cells followed by positive selection. Unwanted cells, such as T cells, NK cells, monocytes, dendritic cells, granulocytes, platelets, and red blood cells, are removed using a cocktail of antibodies against CD2, CD14, CD16, CD23, CD36, CD43, and CD235a (glycophorin A). Positive selection using antibodies specific for IgG or CD19 results in highly enriched B cells (50%–95%). Antigen-specific B cells are obtained by exposing the cells to antigen(s) labeled with fluorescent markers and / or magnetic beads. Cells tagged with fluorescent dyes and / or magnetic beads are then separated using a FACS sorter and / or magnet (flow cytometry or fluorescence activated cell sorter [FACS]). Because plasma cells rarely express surface Ig, intracellular staining can be applied.

[0148] Isolation of B cells by fluorescence-activated cell sorting FACS-based methods are used to separate cells according to their individual characteristics. It is important that the cells are in a single-cell suspension. Single-cell suspensions prepared from the peripheral blood, spleen, or other immune organs of immunized rats are mixed with fluorochrome-conjugated antibodies specific for B cell markers such as CD19, CD138, CD27, or IgG. Alternatively, cells are incubated with fluorochrome-tagged antigens. The cell concentration is 1 to 20 million cells / ml in an appropriate buffer, such as PBS. For example, memory B cells can be isolated by selecting CD27-positive and CD45R-negative cells. Plasma cells can be isolated by selecting CD138-positive and CD45R-negative cells. The cells are loaded onto a FACS machine, and the gated cells are placed into 96-well plates or tubes containing medium. If necessary, positive controls for each fluorochrome are used in the experiment, allowing for background subtraction and correction calculations.

[0149] Isolation of B cells from bone marrow Bone marrow plasma cells (BMPCs) were isolated from immunized animals as described (Reddy et al., 2010, Nature Biotechnology 28, 965-969). Muscle and adipose tissue were removed from the harvested tibias and femurs. The ends of both tibias and femurs were cut with surgical scissors, and the bone marrow was flushed with a 26-gauge insulin syringe (Becton Dickinson, BD). The bone marrow was collected in sterile-filtered Buffer No. 1 (PBS, 0.1% BSA, 2 mM EDTA). Bone marrow cells were collected by filtering with mechanical disruption through a cell strainer (BD), washed with 20 ml of PBS, and collected in a 50 ml tube (Falcon, BD). Bone marrow cells were centrifuged at 335 g for 10 minutes at 4°C. The supernatant is decanted and the cell pellet is resuspended in 3 ml of red blood cell lysis buffer (eBioscience) and gently shaken for 5 minutes at 25° C. The cell suspension is diluted with 20 ml of PBS and centrifuged at 335 g for 10 minutes at 4° C. The supernatant is decanted and the cell pellet is resuspended in 1 ml of buffer no. 1.

[0150] The bone marrow cell suspension is incubated with biotinylated anti-CD45R and anti-CD49b antibodies. The cell suspension is then rotated at 4°C for 20 minutes. This is followed by centrifugation at 930g for 6 minutes at 4°C, the supernatant is removed, and the cell pellet is resuspended in 1.5 ml of buffer No. 1. Streptavidin-conjugated M28 magnetic beads (Invitrogen) are washed and resuspended according to the manufacturer's protocol. Magnetic beads (50 μl) are added to each cell suspension, and the mixture is rotated at 4°C for 20 minutes. The cell suspension is then placed on a Dynabead magnet (Invitrogen), and the supernatant (negative fraction, cells not bound to the beads) is collected, and the bead-bound cells are discarded.

[0151] Prewashed streptavidin M280 magnetic beads were incubated with biotinylated anti-CD138 containing 0.75 μg of antibody per 25 μl of magnetic bead mixture at 4°C for 30 minutes. The beads were then washed according to the manufacturer's protocol and resuspended in Buffer 1. The negative cell fraction collected as described above (depleted of CD45R+ and CD49b+ cells) was incubated with 50 μl of CD138-conjugated magnetic beads, and the suspension was rotated at 4°C for 30 minutes. Beads with CD138+ bound cells were isolated with a magnet, washed three times with Buffer 1, and negative (CD138-) cells not bound to beads were discarded. The positive CD138+ bead-bound cells were collected and stored at 4°C until further processing.

[0152] Alternatively, the method described in Ouisse et al., BMC Biotechnology, 2017, 17:3, 1-17 can be used.

[0153] Example 4: Hybridoma generation Isolated B cells are immortalized by fusion with myeloma cells such as X63 or YB2 / 0 cells as described (Koehler and Milstein, Nature, 256, 495, 1975). Hybridoma cells are cultured in a selective medium, and antibody-producing hybridoma cells are generated by limiting dilution or single-cell sorting.

[0154] Example 5: Isolation of cDNA encoding a heavy chain-only antibody Generation of cDNA sequences from isolated cells The isolated cells are centrifuged at 930 g for 5 minutes at 4°C. Cells are lysed with TRI reagent, and total RNA is isolated according to the manufacturer's protocol for the Ribopure RNA isolation kit (Ambion). mRNA is isolated from total RNA using oligo-dT resin and the Poly(A)purist kit (Ambion) according to the manufacturer's protocol. mRNA concentration is measured using an ND-1000 spectrophotometer (Nanodrop).

[0155] The isolated mRNA is used for first-strand cDNA synthesis by reverse transcription using Maloney murine leukemia virus reverse transcriptase (MMLV-RT, Ambion). cDNA synthesis is performed by RT-PCR priming with 50 ng of mRNA template and oligo-dT primers according to the Retroscript (Ambion) manufacturer's protocol. After cDNA construction, PCR amplification is performed to amplify the heavy chain-only antibody. A list of primers is provided in Table 1.

[0156] [Table 1]

[0157] A 50 μl PCR reaction consisted of 0.2 mM forward and reverse primer mix, 5 μl of Thermopol buffer (NEB), 2 μl of unpurified cDNA, 1 μl of Taq DNA polymerase (NEB), and 39 μl of double-distilled HO. The PCR thermocycling program was 92°C for 3 minutes; 4 cycles (92°C for 1 minute, 50°C for 1 minute, 72°C for 1 minute); 4 cycles (92°C for 1 minute, 55°C for 1 minute, 72°C for 1 minute); 20 cycles (92°C for 1 minute, 63°C for 1 minute, 72°C for 1 minute); 72°C for 7 minutes, 4°C storage. The PCR product was gel-purified, and the DNA was sequenced.

[0158] Example 6: Cloning and expression of recombinant heavy chain-only antibodies The PCR product is subcloned into a plasmid vector. For expression in eukaryotic cells, the cDNA encoding the heavy chain-only antibody is cloned into an expression vector as described (Tiller et al., 2008;329(1-2):112-124).

[0159] Alternatively, the gene encoding the heavy chain-only antibody is cloned into a minicircle-producing plasmid as described (Kay et al., 2010; Nature Biotechnology 28.12(2010):1287-1289).

[0160] Alternatively, genes encoding heavy chain-only antibodies can be synthesized from overlapping oligonucleotides using a modified thermodynamic equilibrium inside-out nucleation PCR (Gao et al., 2003; Nucleic Acids Research.; 31(22):e143) and cloned into a eukaryotic expression vector.

[0161] Alternatively, a gene encoding the heavy chain only antibody is synthesized and cloned into a plasmid.

[0162] To assemble multiple expression cassettes encoding various heavy chain-only antibodies in artificial chromosomes, the multiple expression cassettes are linked together and then cloned into a BAC vector that is propagated in bacteria. For transfection, Invitrogen's ElectroMAX™ DH10B™ cells are used (http: / / tools.invitrogen.com / content / sfs / manuals / 18290015.pdf). Alternatively, the linked expression cassettes are further linked with yeast artificial chromosome arms that are propagated in yeast cells (Davies et al., 1996, supra).

[0163] Plasmid purification For plasmid isolation from approximately 5 ml (or more) overnight bacterial cultures, the Sigma-Aldrich GenElute™ Plasmid Miniprep Kit is used (http: / / www.sigmaaldrich.com / life-science / molecular-biology / dna-and-rna-purification / plasmid-miniprep-kit.html). This involves harvesting the bacterial cells by centrifugation followed by alkaline lysis. The DNA is then bound to a column, washed, and eluted, ready for digestion or sequencing.

[0164] BAC purification Clontech's NucleoBond® BAC100 is a kit designed for BAC purification (http: / / www.clontech.com / products / detail.asp?tabno=2&product_id=186802). For this, bacteria are harvested from a 200 ml culture and lysed using a modified alkaline / SDS procedure. The bacterial lysate is clarified by filtration and loaded onto an equilibrated column, where the plasmid DNA binds to the anion exchange resin. After subsequent washing steps, the purified plasmid DNA is eluted in a high-salt buffer and precipitated with isopropanol. The plasmid DNA is reconstituted in TE buffer for further use.

[0165] YAC purification Linear YAC, circular YAC, and digested BAC fragments are purified by electroextraction using Elutrap™ (Schleicher and Schuell) from standard run 0.8% agarose gels or strips excised from pulsed-field gel electrophoresis (PFGE) (Gu et al., 1992, supra). The purified DNA is precipitated and redissolved in buffer to the desired concentration.

[0166] Purification of circular YACs from yeast is performed using Nucleobond AX silica-based anion exchange resin (Macherey-Nagel, Germany). Briefly, spheroplasts are generated using zymolyase or lyticase and pelleted (Davies et al., 1996, supra). Cells are then alkaline lysed, bound to an AX100 column, and eluted as described for the Nucleobond method for low-copy plasmids. Contaminating yeast chromosomal DNA is hydrolyzed using Plasmid-Safe™ ATP-dependent DNase (Epicenter Biotechnologies), followed by a final purification step using SureClean (Bioline). An aliquot of DH10 electrocompetent cells (Invitrogen) is then transformed with the circular YAC to obtain BAC colonies (see above). To separate the insert DNA, 150-200 kb from the approximately 10 kb BAC vector DNA, a filtration step with Sepharose 4B-CL is used (Yang et al., supra).

[0167] Transfection of cells with plasmid or BAC DNA For expression of recombinant heavy chain-only antibodies, eukaryotic cells are transfected as described (Andreason and Evans, 1989, Anal. Biochem. 180(2):269-75; Baker and Cotten, 1997, Nucleic Acid Res., 25(10):1950-6; http: / / www.millipore.com / cellbiology / cb3 / mammaliancell). Cells expressing heavy chain-only antibodies are isolated using various selection methods. Limiting dilution or cell sorting is used to isolate single cells. Clones are analyzed for heavy chain-only antibody expression.

[0168] Example 7: J Gene Usage in UniRat™ and OmniFlic™ Figure 1 shows the human transgene used in UniRat™ to express heavy chain-only antibodies. OmniFlic™ uses the same human V gene cluster as UniRat, but does not express a fixed kappa light chain.

[0169] FIG. 2 shows the human transgenes used in UniRat™ to express heavy chain-only antibodies in which all J genes express arginine at position 101, as described in the Examples above.

[0170] The antibody repertoires expressed by UniRat™ and OmniFlic™ were determined by next-generation sequencing of all VH regions of mRNA isolated from B cells derived from lymph nodes from immunized animals. All VH sequences from expressed antibodies were aligned with germline sequences of human IGHV and IGHJ. The frequency of J gene usage was calculated from at least six independent UniRat™ and OmniFlic™ animals. Figure 3 shows that UniRat™ uses IGHJ4 containing the W101R mutation more frequently than OmniFlic™, which has the wild-type IGHJ4 sequence. OmniFlic™ also uses IGHJ6 much more frequently than UniRat™.

[0171] Example 8: W101 mutation inhibits λ binding Lambda binding for a large collection of 1,058 heavy chain antibodies was measured by standard ELISA. Of the 1,058 total heavy chain antibodies, 859 contained an R at position 101 and 199 contained a W at position 101. Figure 4 shows that only 2.7% of the R101 heavy chain antibodies showed significant binding to free lambda protein, as determined by an ELISA signal 10 times or greater than background. In contrast, 31.2% of the W101 heavy chain antibodies showed significant binding to free lambda protein using similar criteria. These results indicate that the W101R mutation is highly protective against lambda binding and that W101 heavy chain antibodies have a much higher potential for binding to lambda than R101.

[0172] Example 9: Binding of free λ protein to heavy chain-only antibodies in the same CDR3 family. Figure 5 shows a multiple sequence alignment of 11 VH sequences from heavy-chain antibodies in the same CDR3 family. All of these sequences contain a W at position 101. The top seven sequences in the alignment were all positive for lambda binding as measured by ELISA. The bottom four sequences in the alignment were all negative for lambda binding, also measured by ELISA. This family of VH sequences exhibits additional mutations at positions a and b that distinguish lambda-positive from lambda-negative sequences. Ser or Glu at either position a or b eliminates lambda binding. However, Ser or Glu at these positions in other CDR3 families do not have the same binding with lambda. The results from this family suggest that there are compensatory mutations in the VH sequence of W101 that prevent lambda binding, but that these compensatory mutations are specific to the CDR3 family.

[0173] Example 10: DJ junction diversity differs between UniRat™ and OmniFlic™ when IGHJ6 is used As shown in Example 6, IGHJ6 is used more than three times more frequently in OmniFlic™ compared to UniRat™. Furthermore, as shown in Figure 3, when IGHJ6 is used in UniRat™, the stretch of five Tyr residues found in germline IGHJ6 is most frequently shortened to a single Tyr. In contrast, when IGHJ6 is used, a stretch of four Tyr residues is the most common length in OmniFlic™. This suggests that there is selective pressure to shorten the stretch of five Tyr residues present in the germline IGHJ6 sequence in heavy chain antibodies containing W101 when IGHJ6 is used.

[0174] Example 11: Chimeric antigen receptors using human VH extracellular binding domains Expression of a chimeric antigen receptor in primary T cells requires the expression of a single chimeric protein containing an extracellular antigen-binding domain and an intracellular signaling domain. A single-chain Fv fragment is typically used as the antigen-binding domain. An example of an scFv chimeric antigen receptor is shown in panel A of Figure 6. Alternatively, a single human VH-binding domain is used as the extracellular binding domain (panel B or Figure 6). Using a single human VH has the advantage of being a smaller, less complex protein to express and is less immunogenic.

[0175] While preferred embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will occur to those skilled in the art without departing from the invention. It is understood that various alternatives to the embodiments of the invention described herein may be used in practicing the invention. It is intended that the following claims define the scope of the invention, and that methods and structures within the scope of these claims and their equivalents be covered thereby.

Claims

[Claim 1] The method or nucleic acid described in the specification.

Images