Double pinching of plants

Abstract

The present invention relates to a method for producing a plant shoot comprising one or more cells with a genetic modification. The method preferably comprises the steps of: i) providing a plant; ii) introducing a vector expressing at least one of gRNA and CRISPR nuclease into the plant's cells; iii) removing the shoot apical meristem of the plant; and iv) regenerating a shoot comprising one or more cells with a genetic modification at a second location of the plant. The shoot apical meristem of the plant is preferably removed by pinching the plant. Similarly, the shoot is preferably regenerated by a second pinching of the plant at the second location. The present invention further relates to a plant having a shoot comprising one or more cells with a genetic modification obtained by the method of the present invention.

Description

[Technical field]

[0001] The present invention relates to the field of molecular plant biology and plant production. The present invention relates to targeted genetic modification of plant cells. In particular, the present invention relates to shoots containing one or more cells with targeted genetic modification, and plants and plant products derived therefrom. [Background technology]

[0002] Plant breeding aims to increase plant productivity and performance through the selection and modification of useful and superior traits, and to improve plant traits by genetic techniques. These techniques face a central technical challenge: how to regenerate fertile plants from modified single cells. This applies both to techniques aimed at genetic changes (genome editing, mutagenesis, genetic transformation) and to techniques affecting the entire genome (DH production, polyploidization, somatic hybridization).

[0003] An essential step in plant regeneration is the formation of one or more new shoots. Prior to regeneration, the plant may be exposed to a vector that introduces a genetic modification into one or more plant cells. These modified cells may subsequently form part of the newly regenerated shoot. However, this technique is rather inefficient, and only a limited number of the newly regenerated shoots contain the genetic mutation. Also, the number of modified cells present in those shoots is rather low. Therefore, there remains a strong need in the art to improve the ability of plants to form shoots that contain one or more cells with genetic modifications. Summary of the Invention

[0004] The method can be summarized in the following embodiments: Embodiment 1. i) providing a plant; ii) introducing into a cell of the plant a vector expressing at least one of a guide element and a nuclease element of the site-specific nuclease; iii) removing the apical meristem of the plant, preferably by pinching the plant at a first location; iv) regenerating a shoot comprising one or more cells having the genetic modification at a second location of the plant, preferably by wounding the second location of the plant; 2. A method for producing a plant shoot comprising one or more cells having a genetic modification, comprising:

[0005] Embodiment 2. The method of embodiment 1, wherein shoot regeneration is performed by pinching the plant at the second location.

[0006] Embodiment 3. The method of embodiment 1 or 2, wherein the first location in step iii) is above the cotyledons, preferably within the epicotyl above the cotyledons and below the first true leaf.

[0007] Embodiment 4. The method according to any one of embodiments 1 to 3, wherein the second location in step iv) is below the cotyledons, preferably in the hypocotyl below the cotyledons.

[0008] Embodiment 5. The method of any one of embodiments 1 to 4, wherein the site-specific nuclease is selected from the group consisting of a CRISPR nuclease complex, an Argonaute, a zinc finger nuclease, a TALEN, and a meganuclease.

[0009] Embodiment 6. The method according to any one of embodiments 1 to 5, wherein the site-specific nuclease is a CRISPR nuclease complex, the plant provided in step i) expresses the nuclease component of said complex, and in step ii) the vector expresses the gRNA.

[0010] Embodiment 7. The method according to any one of embodiments 1 to 6, wherein the period between step ii) and step iii) is about 1 to 21 days.

[0011] Embodiment 8. The method according to any one of embodiments 1 to 7, wherein the period between step iii) and step iv) is about 1 to 7 days.

[0012] Embodiment 9. The method according to any one of embodiments 1 to 8, wherein the plant provided in step i) is a seedling.

[0013] Embodiment 10. The method according to any one of embodiments 1 to 9, wherein the vector introduced in step ii) is preferably a virus selected from the group consisting of tobacco rattle virus (TRV), tobacco mosaic virus (TMV), potato virus X (PVX), geminivirus, and sonchus yellow net virus (SYNV), and is preferably a tobacco mosaic virus RNA-based overexpression vector (TRBO).

[0014] Embodiment 11. The method according to any one of embodiments 1 to 10, wherein the vector is introduced in step ii) by contacting the cotyledons with an Agrobacterium or viral particle carrying said vector.

[0015] Embodiment 12. The method according to any one of embodiments 1 to 11, further comprising the steps of selecting a shoot containing one or more cells having a genetic modification and regenerating the plant.

[0016] Embodiment 13. The method of any one of embodiments 1 to 12, further comprising cultivating the plant and producing gametes that contain the genetic modification.

[0017] Embodiment 14. The method of Example 13, further comprising growing a seed from the gamete and optionally cultivating a progeny plant from the seed, wherein the seed and optional progeny plant comprise one or more cells having a genetic modification.

[0018] Embodiment 15. A plant having a shoot containing one or more cells having a genetic modification, obtained by the method according to any one of embodiments 1 to 14.

[0019] definition Various terms relating to the methods, compositions, applications and other aspects of the present invention are used throughout the specification and claims. Such terms have their ordinary meaning in the art to which the present invention pertains, unless otherwise indicated. Other specifically defined terms are to be interpreted in a manner consistent with the definitions set forth herein. It will be apparent to one skilled in the art that methods and materials similar or equivalent to those described herein can be used to practice the present invention.

[0020] The skilled artisan will understand how to carry out the conventional techniques used in the methods of the present invention. Conventional techniques in molecular biology, biochemistry, computational chemistry, cell culture, recombinant DNA, bioinformatics, genomics, sequencing, and related fields are well known to those skilled in the art and are described, for example, in the following references: Sambrook et al. Molecular Cloning. A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989; Ausubel et al. Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1987 and periodic updates; and the series Methods in Enzymology, Academic Press, San Diego.

[0021] The singular terms "a," "an," and "the" include plural referents unless the context clearly indicates otherwise. Thus, for example, a reference to a "cell" includes a combination of two or more cells, and the indefinite article "a" or "an" thus typically means "at least one."

[0022] In the specification, the term "about" is used to describe and take into account small variations. For example, the term may refer to ± (+ or -) 10% or less, such as ± 5% or less, ± 4% or less, ± 3% or less, ± 2% or less, ± 1% or less, ± 0.5% or less, ± 0.1% or less, or ± 0.05% or less. In addition, amounts, ratios, and other numerical values ​​may be presented in a range format. Such range formats are used for convenience and brevity and should be understood to be flexible to include numerical values ​​expressly specified as range limitations, but should also be understood to include all individual numerical values ​​or subranges contained within the range as if each numerical value and subrange were expressly specified. For example, a ratio in the range of about 1 to about 200 should be understood to include not only the explicitly stated limitations of about 1 and about 200, but also individual ratios such as about 2, about 3, and about 4, and subranges such as about 10 to about 50, about 20 to about 100, etc.

[0023] "Similar" with respect to a domain, sequence, or position of a protein in reference to a specified domain, sequence, or position of a reference protein, as used herein, should be understood as a domain, sequence, or position that matches the indicated domain, sequence, or position of the reference protein when the protein is aligned to the reference protein using an alignment algorithm described herein, such as Needleman Wunsch.

[0024] The term "and / or" refers to a situation in which one or more of the recited cases may occur alone, or in combination with at least one of the recited cases, up to all of the recited cases.

[0025] The term "cDNA" refers to complementary DNA. Complementary DNA is produced by reverse transcribing RNA into a complementary DNA sequence. Thus, the cDNA sequence corresponds to the RNA sequence expressed from a gene. It is understood that the sequence of the cDNA corresponds to the sequence of the mRNA since the RNA sequence expressed from the genome may be spliced, i.e., introns are excised from the pre-mRNA and exons are joined before being translated into a protein in the cytoplasm. Thus, the cDNA may only encode the complete open reading frame of the protein consisting of joined exons, whereas the cDNA sequence may not be identical to the corresponding genomic DNA sequence, since the genomic DNA sequence may contain exon sequences interspersed with intron sequences. Thus, genetic modification of a gene encoding a protein may not only involve modification of the protein-encoding sequence, but may also involve mutations in the intron sequences of the genomic DNA and / or other genetic control sequences of the gene.

[0026] The term "comprises" is to be interpreted as inclusive and open-ended rather than exclusive. Specifically, this term and its variations mean that the specified features, steps or components are included. These terms are not to be interpreted as excluding the presence of other features, steps or components.

[0027] The term "conditions allowing regeneration" is understood herein as an environment in which plant cells or tissues can regenerate. Such conditions include at least suitable temperature (0°C to 60°C), nutrients, day-night rhythm, irrigation, and one or more plant hormones and / or plant hormone-like compounds. Furthermore, "optimal conditions allowing regeneration" are environmental conditions that maximally allow the regeneration of plant cells.

[0028] A "control plant" as referred to herein is a plant of the same species and preferably of the same genetic background as the plant of the present invention, i.e., the plant subjected to the method taught herein. Preferably, the control plant is grown under the same conditions as the plant subjected to the method of the present invention.

[0029] A "CRISPR nuclease" or "CAS protein" contains two nuclease domains and can form a complex with a guide RNA. Once complexed with a guide RNA, the CRISPR nuclease complex is guided to a specific nucleic acid sequence by the guide RNA. If both domains of the nuclease are catalytically active, the protein can introduce a double-stranded break at a target site. The guide RNA interacts with the CRISPR nuclease and also interacts with a target-specific nucleic acid sequence, herein referred to as a protospacer sequence, such that when guided to a site containing a target nucleic acid sequence via a guide sequence, the CRISPR nuclease can introduce a double-stranded break at or near the target site. If the CRISPR nuclease has one catalytically active domain and one catalytically inactive domain, the CRISPR nuclease is herein referred to as a CRISPR nickase. The CRISPR nickase can introduce a single-stranded break at a target site. When a CRISPR nuclease is a dead CRISPR nuclease, both domains are catalytically inactive and the protein cannot introduce a break at the target site. Those skilled in the art are well aware of how to design guide RNAs such that when combined with a CRISPR nuclease with endonuclease or nickase activity, they introduce double-stranded or single-stranded breaks at a predetermined site in a nucleic acid molecule, respectively. CRISPR nucleases are generally classified into six major types (types I-VI), which are further subdivided into subtypes based on the content and sequence of the core element (Makarova et al, 2011, Nat Rev Microbiol 9:467-77; and Wright et al, 2016, Cell 164(1-2):29-44). In general, the two key components of the CRISPR nuclease complex are the CRISPR nuclease and the guide RNA. Type II CRISPR nuclease complexes include a single protein (~160KDa), the signature Cas9 protein, that can bind to guide RNA and specifically cleave double-stranded DNA.Cas9 proteins typically contain two active nuclease domains: a RuvC-like nuclease domain near the amino terminus and an HNH (or McrA-like) nuclease domain near the middle of the protein. Each nuclease domain of the Cas9 protein is specialized to cleave one strand of the double helix (Jinek et al, 2012, Science 337(6096):816-821). The Cas9 protein is an example of a CRISPR nuclease in the type II CRISPR-CAS system, which forms a site-specific endonuclease when bound to the crRNA and a second RNA called the trans-activating crRNA (tracrRNA). The crRNA and tracrRNA function together as guide RNAs. The CRISPR nuclease complex introduces a DNA double-strand break (DSB) at the location in the genome defined by the crRNA. Jinek et al. (2012, Science 337:816-820) demonstrated that a single-stranded chimeric guide RNA (defined herein as "sgRNA" or "single guide RNA") generated by fusing the essential portions of the crRNA and tracrRNA can form a functional CRISPR nuclease complex when combined with Cas9 protein. A V-type CRISPR nuclease complex, clustered regularly interspaced short palindromic repeats (CRISPR / Cpf1), from the genera Prevotella and Francisella, has been described. The Cpf1 gene is associated with the CRISPR locus and encodes an endonuclease that targets DNA using the crRNA. Cpf1 is a smaller endonuclease than Cas9 and may overcome some of the limitations of CRISPR-Cas9. Cpf1 is a single RNA-guided endonuclease that lacks tracrRNA and utilizes a T-rich protospacer adjacent motif. Cpf1 cleaves DNA through staggered DNA double strand breaks (Zetsche et al (2015) Cell 163(3):759-771). The V-type CRISPR nuclease system preferably includes at least one of Cpf1, C2c1, and C2c3.The portion of the crRNA that is complementary to the protospacer sequence is designed to have sufficient complementarity with the protospacer sequence to hybridize to the protospacer sequence and induce sequence-specific binding of the composite CRISPR protein. The protospacer sequence is preferably adjacent to a protospacer adjacent motif (PAM) sequence, which may interact with the CRISPR protein of the RNA-guided CRISPR nuclease complex. For example, if the CRISPR protein is S. pyogenes Cas9, the PAM sequence is preferably 5'-NGG-3', where N can be any one of T, G, A, or C. One skilled in the art can easily engineer a crRNA that targets any desired sequence to hybridize to it, preferably by engineering the sequence to be at least partially complementary to any desired protospacer sequence. Preferably, the complementarity between a portion of the crRNA sequence and the corresponding protospacer sequence is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 100% when optimally aligned using a suitable alignment algorithm. The length of the portion of the crRNA sequence complementary to the protospacer sequence may be at least about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75 nucleotides or more. Preferably, the portion of the crRNA complementary to the protospacer sequence is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length, preferably 20 or 21 nucleotides, preferably 20 nucleotides. Molecules or sequences suitable as crRNA and tracrRNA are well known in the art. (See, e.g., WO2013142578; and Jinek et al., Science (2012) 337, 816-821). Preferably, the crRNA and tracrRNA are linked to form a single guide (sg)RNA.The crRNA and tracrRNA can be linked, preferably covalently, using any conventional method known in the art. Covalent linkage of the crRNA and tracrRNA is described, for example, in Jinek et al. (supra); and WO 13 / 176772, which are incorporated herein by reference. The crRNA and tracrRNA can be covalently linked, for example, using a linker nucleotide or via a direct covalent bond between the 3' end of the crRNA and the 5' end of the tracrRNA.

[0030] "CRISPR nuclease complex" or "gRNA-CAS complex" is herein to be understood as a CAS protein (also referred to as CRISPR nuclease) complexed or hybridized with a guide RNA, where the guide RNA may be a crRNA and / or tracrRNA, or an sgRNA.

[0031] A "CRISPR nickase" is a mutant form of a CRISPR nuclease in which one of the nuclease domains has been mutated to render it non-functional (i.e., lacking nuclease activity). One example is a mutant form of SpCas9 that has either the D10A or H840A mutation.

[0032] A "dead CRISPR nuclease" is a mutant of a CRISPR nuclease, which contains modifications such that none of the nuclease domains exhibit cleavage activity. An example is a SpCas9 mutant with both D10A and H840A mutations. The term "endogenous" used in conjunction with a protein or nucleic acid in the context of the present invention means that said protein or nucleic acid is contained within a plant, i.e., is present in its natural environment. In many cases, endogenous genes are present in the plant in their normal genetic context.

[0033] An "endonuclease", also referred to herein as a "nuclease" or "nuclease element", is an enzyme that hydrolyzes phosphodiester bonds within a nucleic acid strand. A nuclease or endonuclease is understood herein as a protein that can hydrolyze both strands of a duplex, preferably simultaneously, to introduce double-strand breaks in DNA.

[0034] A "nickase" is understood herein as a protein, optionally an endonuclease having one inactive domain and one active domain, that hydrolyzes only one strand of double-stranded DNA, producing a "nicked" DNA molecule rather than a cut.

[0035] The term "exemplary" means "serving as an example, instance, or illustration," and is not to be construed as excluding other configurations disclosed herein.

[0036] "Expression of a gene" refers to the process by which a DNA region operably linked to appropriate regulatory regions, particularly a promoter, is transcribed into biologically active RNA, e.g., a biologically active protein or peptide, or into RNA that can be translated, e.g., into a regulatory non-coding RNA.

[0037] The term "gene" refers to a nucleic acid fragment that contains a region (transcribed region) that is transcribed into an RNA molecule (e.g., mRNA) in a cell and is operably linked to an appropriate regulatory region (e.g., a promoter). A gene usually contains several operably linked fragments, such as a promoter, a 5' leader sequence, a coding region, and a 3' untranslated sequence (3' end) that contains a polyadenylation site.

[0038] As used herein, a "guide element" or "guide" is understood as an element that directs a nuclease element to a specific sequence within a (double-stranded) nucleic acid molecule. The guide element preferably comprises a guide sequence for recognizing a specific sequence within a nucleic acid molecule in a genome to target a site-specific nuclease. The guide element is preferably at least one of: (i) an oligonucleotide, preferably an RNA and / or DNA oligonucleotide, that can hybridize or complex with a nuclease (element) to form a site-specific nuclease; and (ii) a polypeptide, protein, or protein domain that is part of a site-specific nuclease. The polypeptide, protein, or protein domain may be covalently linked, fused, or complexed with a nuclease (element) to form a site-specific nuclease.

[0039] "Guide RNA" or "gRNA" is herein understood as a guide element, which is an RNA molecule comprising a guide sequence for targeting a gRNA-CAS complex to a protospacer sequence, preferably near, on or within a sequence of interest in a nucleic acid molecule, and may be an sgRNA, or a combination of crRNA and tracrRNA (e.g., in the case of Cas9), or only crRNA (e.g., in the case of Cpf1). Optionally, more than one guide RNA may be used in the same experiment, e.g., targeting two or more different sequences of interest, or the same sequence of interest.

[0040] A "guide sequence" is herein understood as a portion of a guide element that recognizes, binds to, and / or hybridizes to a specific site within an RNA or DNA molecule. A guide sequence may be a nucleotide sequence when the site-specific endonuclease is an RNA or DNA-guided endonuclease, such as a gRNA-CAS complex, or an amino acid sequence when the site-specific endonuclease is a protein-guided endonuclease, such as a TALEN, ZFN, or meganuclease. In the context of a gRNA-CAS complex, a "guide sequence" is herein further understood as a portion of the sgRNA or crRNA required to target the gRNA-CAS complex to a specific site within a double-stranded DNA.

[0041] "Plant" refers to a whole plant or a part of a plant such as a tissue or organ obtained from a plant (e.g., pollen, seeds, gametes, roots, leaves, flowers, flower buds, anthers, fruits, etc.), as well as any derivatives thereof, and progeny obtained from such a plant by self-pollination or crossbreeding. Non-limiting examples include barley, cassava, cotton, groundnuts or peanuts, corn, millet, oil palm, potato, beans, rapeseed or canola, rice, rye, sorghum, soybean, sugarcane, sugar beet, sunflower, wheat, okra, leeks, celery, asparagus, wax gourd, beets, cruciferous plants including vegetable cruciferous plants, bell peppers, chili peppers, endive, chicory, melons including watermelon, cucumber, gherkins, and the like. These include, for example, zucchini, pumpkin, artichoke, carrot, arugula, fennel, lettuce, gourd, loofah, gourd, bitter melon, parsnip, parsley, beans, ground cherry, tomatillo, radish, eggplant, tomatoes including tomato rootstocks, pepino, spinach, snake gourd, field lettuce, peas including chickpeas, soybeans, fava beans, sweet corn, hemp, hops, berries, dandelions, and ornamental plants.

[0042] The terms "protein" or "polypeptide" are used interchangeably and refer to a molecule consisting of a chain of amino acids, regardless of a specific mechanism of action, size, three-dimensional structure, or origin. Thus, a "fragment" or "portion" of a protein may still be referred to as a "protein." An "isolated protein" is used to refer to a protein that is no longer in its natural environment, e.g., in a test tube or within a recombinant bacterial or plant host cell.

[0043] The terms "sequence identity", "homology" and the like are used interchangeably herein. As used herein, sequence identity is defined as the relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleotide (polynucleotide) sequences, as determined by comparing the sequences. In the art, "identity" also means the degree of sequence relatedness between amino acid or nucleic acid sequences, as the case may be, as determined by the match between strings of such sequences. The "similarity" between two amino acid sequences is determined by comparing the amino acid sequence of one polypeptide and its conserved amino acid substitutes with the sequence of a second polypeptide. "Identity" and "similarity" can be readily calculated by known methods. The percentage of sequence identity / similarity can be determined over the entire length of the sequence. As used herein, "sequence identity" refers to the degree to which two optimally aligned polynucleotide or peptide sequences are invariant over the entire alignment window of components such as nucleotides or amino acids. The "percent identity" of an aligned segment between a test sequence and a reference sequence is the number of identical components shared by the two aligned sequences divided by the total number of components in the reference sequence segment (i.e., the entire reference sequence or a smaller defined portion of the reference sequence). The "percent identity" is the percent identity multiplied by 100. "Sequence identity" and "sequence similarity" can be determined by aligning two peptide sequences or two nucleotide sequences using a global alignment algorithm or a local alignment algorithm, depending on the length of the two sequences. Sequences of similar length are preferably aligned using a global alignment algorithm (e.g., Needleman Wunsch) that optimally aligns sequences over their entire length, while sequences of significantly different lengths are preferably aligned using a local alignment algorithm (e.g., Smith Waterman). Sequences may then be referred to as "substantially identical" or "essentially similar" if they share at least a certain minimum percentage of sequence identity (as defined herein) (e.g., when optimally aligned by the GAP or BESTFIT programs using default parameters).Percent sequence identity is preferably determined using the "BESTFIT" or "GAP" program (version 10; Genetics Computer Group, Inc., Madison, Wis.) of the Sequence Analysis Software Package™. GAP uses the Needleman and Wunsch global alignment algorithm, (Needleman and Wunsch, Journal of Molecular Biology 48:443-453, 1970), to align two sequences over their entire length (full length), maximizing the number of matches and minimizing the number of gaps. When the two sequences are similar in length, global alignment is preferably used to determine sequence identity. Generally, the GAP default parameters are used: gap creation penalty = 50 (nucleotides) / 8 (protein), gap extension penalty = 3 (nucleotides) / 2 (protein). For nucleotides the default weight matrix is ​​nwsgapdna and for proteins the default weight matrix is ​​Blosum62 (Henikoff & Henikoff, 1992, PNAS 89, 915-919). Sequence alignments and percentage sequence identity scores can be determined using computer programs such as the GCG Wisconsin Package version 10.3 available from Accelrys Inc., 9685 Scranton Road, San Diego, CA 92121-3752 USA, or using open source software such as the programs "needle" (which uses the global Needleman Wunsch algorithm) or "water" (which uses the local Smith Waterman algorithm) in EmbossWIN version 2.10.0, using the same parameters as GAP above, or with default settings (for both "needle" and "water", and for both protein and DNA alignments, the default gap opening penalty is 10.0 and the default gap extension penalty is 0.5; the default weighting matrices are Blossum62 for proteins and DNAFull for DNA).The gap extension penalty is 0.5; the default weighting matrix is ​​Blossum62 for proteins and DNAFull for DNA. "BESTFIT" uses the Smith and Waterman local homology algorithm to perform an optimal alignment of the most similar segments between two sequences, inserting gaps to maximize the number of matches (Smith and Waterman, Advances in Applied Mathematics, 2:482-489, 1981; Smith et al., Nucleic Acids Research 11:2205-2220, 1983). When the overall lengths of the sequences differ significantly, local alignments such as those using the Smith Waterman algorithm are preferred. Useful methods for determining sequence identity are also disclosed in Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994; and Carillo, H., and Lipton, D., Applied Math (1988) 48:1073. Preferred computer programs for determining sequence identity include the Basic Local Alignment Search Tool (BLAST) program, publicly available from the National Center Biotechnology Information (NCBI) at the National Library of Medicine, National Institute of Health, Bethesda, Md. 20894; see BLAST Manual, Altschul et al., NCBI, NLM, NIH; Altschul et al., J. Mol. Biol. 215:403-410 (1990); version 2.0 and later of the BLAST program allows for the introduction of gaps (deletions and insertions) in the alignment; for peptide sequences, sequence identity can be determined using BLASTX; for polynucleotide sequences, sequence identity can be determined using BLASTN.Alternatively, the percentage of similarity or identity may be determined by searching public databases using algorithms such as FASTA, BLAST, etc. Thus, the nucleic acid and protein sequences of the present invention may further be used as a "query sequence" to perform searches against public databases to identify, for example, other family members or related sequences. Such searches may be performed using the BLASTn and BLASTx programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10. BLAST nucleotide searches may be performed with the NBLAST program, score=100, wordlength=12 to obtain nucleotide sequences homologous to the nucleic acid molecules of the present invention. BLAST protein searches may be performed with the BLASTx program, score=50, wordlength=3 to obtain amino acid sequences homologous to the protein molecules of the present invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17):3389-3402. When using BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., BLASTx and BLASTn) can be used. See the National Center for Biotechnology Information homepage (http: / / www.ncbi.nlm.nih.gov / ).

[0044] "3' untranslated sequence" or "3'UTR" (often referred to as 3' untranslated region, or 3' end) refers to the nucleic acid sequence downstream of the coding sequence of a gene that includes the transcription termination site and (in most but not all eukaryotic mRNAs) a polyadenylation signal (such as, for example, AAUAAA or variants thereof). After transcription is completed, the mRNA transcript may be cleaved downstream of the polyadenylation signal and a poly(A) tail may be added, which is involved in transporting the mRNA to the cytoplasm, where translation takes place.

[0045] As used herein, "nucleic acid" or "polynucleotide" may include any polymer or oligomer of pyrimidine and purine bases, preferably cytosine, thymine and uracil, and adenine and guanine, respectively (see Albert L. Lehninger, Principles of Biochemistry, at 793-800 (Worth Pub. 1982), which is incorporated by reference in its entirety for all purposes). The present invention contemplates any deoxyribonucleotide, ribonucleotide or nucleic acid building block, and any chemically modified forms, such as methylated, hydroxymethylated or glycosylated forms of these bases. The polymer or oligomer may be heterogeneous or homogenous in composition, and may be isolated from naturally occurring sources or may be artificially or synthetically produced. Furthermore, the nucleic acid may be DNA (optionally cDNA) or RNA, or a mixture thereof, and may exist permanently or temporarily in single-stranded or double-stranded form, including homoduplexes, heteroduplexes, and hybrid states. An "isolated nucleic acid" is used to refer to a nucleic acid that is no longer in its natural environment, for example, in a test tube or in a recombinant bacterial or plant cell.

[0046] The terms "nucleic acid construct", "nucleic acid vector", "vector" and "expression construct" are used interchangeably herein and are defined as an artificial nucleic acid molecule resulting from the use of recombinant DNA technology. Thus, the terms "nucleic acid construct" and "nucleic acid vector" do not include naturally occurring nucleic acid molecules, although a nucleic acid construct may include (parts of) naturally occurring nucleic acid molecules. The vector backbone may be, for example, a binary vector or a superbinary vector (see, for example, U.S. Pat. No. 5,591,616, U.S. Patent Publication No. 2002138879, and WO 95 / 06722), a cointegration vector or a T-DNA vector incorporating a chimeric gene as known in the art and described elsewhere herein, or, if appropriate transcriptional control sequences are already present, only the desired nucleic acid sequence (e.g., coding sequence, antisense sequence or inverted repeat sequence) is integrated downstream of the transcriptional control sequence. Vectors may contain additional genetic elements, such as selectable markers, multiple cloning sites, to facilitate their use in molecular cloning.

[0047] The term "operably linked" refers to the linkage of polynucleotide elements in a functional relationship. A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, a promoter, or more precisely a transcription control sequence, is operably linked to a coding sequence if it affects the transcription of the coding sequence. Operably linked may mean that the DNA sequences being linked are contiguous.

[0048] "Plant cells" include protoplasts, gametes, suspension cultures, microspores, pollen grains, etc., either alone or within a tissue, organ, organism, etc. A plant cell can be part of a multicellular structure, such as, for example, a callus, a meristem, a plant organ, or an explant.

[0049] A "plant hormone", "plant growth hormone", "plant growth regulator" or "phytohormone" is a chemical that affects the growth and / or development of plant cells and tissues. Plant growth regulators include five groups of chemicals: auxins, cytokinins, gibberellins, abscisic acid (ABA), and ethylene. In addition to the five main groups, two other chemical classes are often considered plant growth regulators: brassinosteroids and polyamines.

[0050] "Promoter" refers to a nucleic acid fragment that functions to control the transcription of one or more nucleic acids. A promoter fragment is preferably located upstream (5') in the direction of transcription of the transcription start site of a gene, is structurally identified by the presence of a DNA-dependent RNA polymerase binding site, a transcription start site, and may further include any other DNA sequences, including, but not limited to, transcription factor binding sites, repressor and activator protein binding sites, and other nucleotide sequences known to those skilled in the art to act directly or indirectly to control the amount of transcription from the promoter. A "constitutive promoter" is a promoter that is active in most tissues under most physiological and developmental conditions. An "inducible promoter" is a promoter that is physiologically (e.g., by external application of a particular compound) or developmentally regulated. A "tissue-specific promoter" is only active in a particular type of tissue or cell. Optionally, the term "promoter" may also include the 5' UTR region (5' untranslated region) (e.g., a promoter may include one or more portions upstream of the translation start codon of the transcribed region, as this region may have a role in controlling transcription and / or translation).

[0051] A "protospacer sequence" is a sequence that is recognized as or can hybridize to a guide sequence within a guide element, preferably within a guide RNA, more specifically within a crRNA, or in the case of an sgRNA, within the crRNA portion of the guide RNA, and is located within, on, or near a target nucleic acid fragment.

[0052] The term "regeneration" is defined herein as the formation of new tissues and / or new organs from a single plant cell, callus, explant, tissue, or organ. Regeneration may include the formation of new plants from a single plant cell, or from, for example, callus, explant, tissue, or organ. The regeneration process may occur directly from a parent tissue, or indirectly, such as through the formation of a callus. The regeneration pathway may be somatic embryogenesis or organogenesis. Somatic embryogenesis is understood herein as the formation of a somatic embryo that can be grown to regenerate a whole plant. Organogenesis is understood herein as the formation of a new organ from an (undifferentiated) cell. Organogenesis may be at least one of meristem formation, adventitious shoot formation, inflorescence formation, root formation, elongation of adventitious shoots, and (subsequently) the formation of a whole plant. Preferably, the regeneration is at least one of shoot regeneration and (ectopic) apical meristem formation. Shoot regeneration as defined herein is new shoot formation. For example, regeneration can be the regeneration of (inflorescence) shoots from (elongated) hypocotyls (explants).

[0053] The term "sequence of interest" includes, but is not limited to, any genetic sequence preferably present in a cell, such as, for example, a gene, a part of a gene, or a non-coding sequence within or adjacent to a gene. The sequence of interest may be present in a chromosome, an episome, an organelle genome, such as a mitochondrial or chloroplast genome, or in genetic material that may exist independently of the body of genetic material, such as, for example, an infectious viral genome, a plasmid, an episome, a transposon. The sequence of interest may be present within the coding sequence of a gene, for example, within a transcribed non-coding sequence, such as a leader sequence, a trailer sequence, or an intron. The sequence of interest may be present in a double-stranded or single-stranded nucleic acid molecule. The nucleic acid sequence is preferably present in a double-stranded nucleic acid molecule. The sequence of interest may be any sequence within a nucleic acid, such as, for example, a gene, a gene complex, a locus, a pseudogene, a control node region, a highly repeated region, a polymorphic region, or a portion thereof. The sequence of interest may be a region containing genetic or epigenetic variation indicative of a phenotype or disease. Preferably, the sequence of interest is a short or longer contiguous stretch of nucleotides (i.e., a polynucleotide) of double-stranded DNA, wherein said double-stranded DNA further comprises a sequence complementary to a target sequence within the complementary strand of said double-stranded DNA.

[0054] "Shoot organogenesis" is a regeneration pathway by which cells form a new shoot apical meristem, which develops into a shoot with leaf primordia and leaves. Since there is only one apical meristem, it is a monopolar structure and no roots are formed at this stage. The vascular system of the shoot is often connected to the parent tissue. Only when the shoot is fully formed, elongated and excised can root formation be induced, preferably in a separate root induction step on a different culture medium (Thorpe, TA (1993) In vitro Organogenesis and Somatic Embryogenesis: Physiological and Biochemical Aspects. In: Roubelakis-Angelakis KA, Van Thanh KT (eds) Morphogenesis in Plants. NATO ASI Series (Series A: Life Sciences), Vol. 253. Springer, Boston, MA). Shoot organogenesis may occur spontaneously, i.e. without the exogenous addition of plant growth regulators (PGRs). Shoot organogenesis may be induced by plant growth regulators, usually different concentrations of cytokinins alone or in combination with auxins, where preferably the cytokinins remain as components of the culture medium until the new shoot apical meristems and shoots have formed, e.g., elongated sufficiently that they can be removed. Preferably, for induction of shoot formation, the concentration of cytokinins exceeds the concentration of auxins.

[0055] "Similar conditions" for culturing plants / plant cells means, inter alia, the use of similar temperature, humidity, nutrient, light conditions, similar irrigation, and day-night rhythms.

[0056] A "site-specific (endo)nuclease", also referred to herein as a "site-specific nuclease", is herein understood as a nucleic acid protein complex or protein (dimer) that includes both a guide element as defined herein and a nuclease or nuclease element as defined herein, wherein said guide element targets the nuclease element to a target sequence, preferably a protospacer sequence, preferably present in a genome. Preferably, the site-specific nuclease is a programmable nuclease such as, but not limited to, a zinc finger nuclease (ZFN), a transcription activator-like endonuclease (TALEN), a meganuclease, a clustered regularly interspaced short palindromic repeats (CRISPR) nuclease complex, and an Argonaute. The site-specific nuclease may have endonuclease activity, preferably capable of introducing a double-stranded break into double-stranded DNA, or may be modified to reduce endonuclease activity, for example modified into a nickase, preferably capable of introducing a single-stranded break into double-stranded DNA, or may be modified to eliminate nuclease activity and become a dead nuclease.

[0057] "Targeted mutagenesis" refers to mutagenesis that can be designed to alter specific nucleotides or nucleic acid sequences, such as, but not limited to, oligo-directed mutagenesis, RNA-guided endonucleases (e.g., CRISPR technology), TALEN, or zinc finger technology.

[0058] As used in the context of the present invention, the term "wild-type" in combination with a protein or nucleic acid means that said protein or nucleic acid consists of an amino acid or nucleotide sequence, respectively, that exists in nature as a whole, that can be isolated from an organism in nature, and that is not the result of a modification technique, such as, for example, targeted or random mutagenesis. A wild-type protein is expressed, for example, under particular environmental conditions as it occurs in nature, at least at a particular developmental stage. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0059] The present inventors have discovered a method for increasing the number of shoots of genetically modified plants after vector-mediated transfection of at least one element of a site-specific nuclease in the plant. These modified shoots preferably contain a high percentage of modified cells. In a first aspect, the method relates to a method for producing shoots of a plant, wherein the shoot contains one or more cells carrying a genetic modification. The method of the present invention preferably comprises: i) providing a plant; ii) introducing into a cell of the plant a vector expressing at least one of a guide element and a nuclease element of the site-specific nuclease; iii) removing the apical meristem of the plant; iv) regenerating a shoot comprising one or more cells having the genetic modification at a second location of the plant; Includes.

[0060] Preferably, the order of steps in the method of the invention is steps i), ii), iii), and iv). Alternatively, the order of steps may be steps i), iii), ii), and iv). The method of the invention detailed herein may also be, for example, - A method for producing a plant having one or more genetically modified cells. - a method for producing a transgenic plant; and - A method for genetically modifying plant shoots may be considered as at least one of the following:

[0061] Preferably, the method of the invention comprises the steps of: i) providing a plant expressing a nuclease component of a site-specific nuclease; ii) introducing into a cell of the plant a vector expressing a guide element for the site-specific nuclease; iii) removing the apical meristem of the plant; iv) regenerating a shoot comprising one or more cells having the genetic modification at a second location of the plant; Includes.

[0062] Alternatively, the method of the present invention comprises: i) providing a plant; ii) introducing into a cell of the plant a vector expressing a site-specific nuclease; iii) removing the apical meristem of the plant; iv) regenerating a shoot comprising one or more cells having the genetic modification at a second location of the plant; may include:

[0063] The genetic modification (or "genetic modification") is preferably present in a sequence of interest. The sequence of interest is preferably part of or operably linked to a gene of interest. A gene of interest preferably refers to any genomic or episomal DNA sequence in a cell that is desired to be targeted for cleavage and possible modification. The site-specific nuclease of the method of the invention is designed to target the sequence of interest or a sequence nearby it to induce a genetic modification in the sequence of interest. Thus, the genetic modification of the method of the invention is a targeted genetic modification. In some embodiments, the gene may code for a protein. In some embodiments, the gene codes for a non-coding RNA. In some embodiments, the part of the gene that is targeted is a promoter, an enhancer, or a coding or non-coding sequence.

[0064] Step i) - Provide the plants Preferably, the first step of the method of the invention is the provision of a plant. The provided plant is preferably regenerative, preferably capable of regenerating one or more shoots. Preferably, the plant is not a recalcitrant plant. Preferably, the plant of step i) is a regenerated plant. Preferably, the regenerated plant is capable of forming new shoots on the multicellular tissue. The regenerated plant provided in step i) is preferably regenerative under normal growth conditions, optionally in the presence of exogenously supplied growth regulators such as auxins and / or cytokines. Such normal growth and / or optimal conditions include at least an appropriate nutrient supply, optionally supplemented with plant hormones. Such conditions may further include an appropriate temperature and / or an optimal temperature and / or a light / dark cycle.

[0065] Preferably, the plant provided in step i) is capable of regenerating shoots after wounding in vivo. Preferably, the plant provided in step i) is capable of regenerating shoots after pruning in vivo. Pruning is understood herein as removing already formed meristems, apices or axillaries. Although both recalcitrant and regenerable cultivars, varieties and / or accessions may exist within a species, generally, species of the Solanaceae family (Solonaceae), such as but not limited to potato (Solanum tuberosum), tomato (Solanum lycopersicum) and tobacco (Nicotiana tabacum), have long been reported to be regenerable species (Roest and Gilissen, Acta Bot. Neerl. 1998;38(1):p1-23). At present, understanding of the mechanisms of shoot regeneration has led to effective protocols for shoot regeneration of many different species, including many more recalcitrant species (for review, see, e.g., Shin et al. Journal of Experimental Botany, 2020;71(1):63-72).

[0066] Preferably, the plant provided is a seedling, a vegetative plant, an emergent plant, a flowering plant or a mature plant. Preferably, the plant provided is a seedling.

[0067] The provided plant may be a dicotylenous plant. The provided plant may be a naturally occurring regenerated plant, i.e., a plant that has a natural ability to regenerate. Alternatively, the provided plant may be genetically modified to induce or enhance regeneration ability. Examples of such plants include, but are not limited to, the plants disclosed in WO 2019 / 211296 and WO 2019 / 193143, which are incorporated herein by reference. As a non-limiting example, the provided regenerated plant may be a plant modified to express a histidine kinase selected from the group consisting of CHK4, CHK2, and CHK3. Additionally or alternatively, the provided regenerated plant is preferably a plant modified to transiently express at least one of WOX5 and PLT proteins, preferably at least one of WOX5 and PLT1.

[0068] The plant provided in step i) may be a cultivar or a wild-type plant. Optionally, the plant is a genetically modified plant. The method of the invention may include the use of a site-specific (programmable) nuclease that functions as a non-covalently assembled complex, for example, the site-specific nuclease may consist of a nuclease element, such as a CAS protein, complexed with a guide element, such as a guide RNA. In this case, the provided plant may be genetically modified to (stably) express at least one of the guide element and the nuclease element. Optionally, the provided plant is modified to express said nuclease element in at least a part of the plant. Optionally, the provided plant is modified to stably express a guide element or a nuclease element of a site-specific nuclease. Optionally, the plant is modified to express said nuclease element or guide element after activation of an inducible promoter. The nuclease element is preferably a CRISPR nuclease or an Argonaute, and the guide element is preferably a guide RNA. The provided plant may express the guide element or nuclease element in all or substantially all cells. Optionally, the provided plant is modified to express at least one of CRISPR nuclease and guide RNA. Optionally, the provided plant is modified to express CRISPR nuclease, wherein the CRISPR nuclease is a CRISPR nuclease as defined herein below. Preferably, the CRISPR nuclease is at least one of Cas9, Cpf1, and Mad7. Optionally, the provided plant is modified to express Argonaute.

[0069] In step i), two or more plants may be provided. Optionally, in step i), at least 2, 5, 10, 15, 20, 50, 100, 200, 500, 1000, 5000 or more plants are provided. These plants may be subjected to the method of the invention simultaneously or essentially simultaneously, as specified herein.

[0070] Step ii)—Introducing the Vector In step ii) of the method of the invention, plant cells of the provided plant are exposed to a vector, resulting in the introduction of the vector into the cells of the provided plant, the vector encoding at least one element of the site-specific nuclease.

[0071] When the method of the present invention uses a site-specific (programmable) nuclease, such as a meganuclease, ZFN, or TALEN, which comprises a nuclease element covalently linked to a guide element, the vector preferably encodes both the nuclease element and the guide element. When the method of the present invention utilizes a site-specific (programmable) nuclease that functions as a non-covalently assembled complex, such as a CAS protein complexed with a guide RNA, the plant may be genetically modified to (stably) express at least one of the elements of the complex, and the vector may include other elements of the complex. For example, the plant may be genetically modified to express a nuclease element, such as a CAS protein, and the vector may encode one or more guide elements, such as a guide RNA for targeting the nuclease element to one or more target sequences. Alternatively, the vector may encode both a nuclease element, such as a CAS protein, and one or more guide elements, such as one or more guide RNAs. Optionally, in step ii), the plant may be exposed to multiple vectors, where at least one of the vectors encodes a nuclease element, such as a CAS protein, and another vector encodes a guide element, such as a guide RNA, for targeting the nuclease element to a target sequence.

[0072] The vector, preferably a viral vector, may be contained in a viral particle or Agrobacterium to initially introduce the vector into the plant cells. Viral particles for use in the methods of the invention may, for example, be produced in Nicotiana benthamiana.

[0073] After infection in step ii) of the method of the present invention, the vector is expressed from the virus or Agrobacterium in the plant cell. The viral vector may subsequently replicate and infect surrounding plant cells. A preferred Agrobacterium for introducing the vector is Agrobacterium tumefaciens.

[0074] The vector may be introduced by infiltration, painting, rubbing, brushing, spraying, immersion with Agrobacterium or viral particles. Optionally, a gene gun approach is used, i.e., the vector may be introduced by bombardment with Agrobacterium or viral particles. Preferably, the vector is introduced by painting the Agrobacterium onto the leaf material using a cotton swab.

[0075] The vector may be introduced into cells of any part of the provided plant. The vector may be introduced into cells of the shoot system and / or cells of the root system. The vector may be introduced into cells of the root, stem, fruit, leaf, internode, and / or flower. Preferably, the vector is introduced into cells of the seedling. As non-limiting examples, the vector may be introduced into cells of the true leaves, epicotyl, cotyledon, hypocotyl, and / or radicle. Preferably, the vector is introduced into cells of the cotyledon. Preferably, the vector is introduced into cells of the provided plant, preferably cells of the cotyledon of said plant, wherein the plant is a young seedling consisting of a radicle (embryonic root), hypocotyl (embryonic shoot), and cotyledon. Preferably, the vector is introduced into cells of the provided plant, preferably cells of the cotyledon of said plant, about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days after sowing, preferably about 7 to 10 days after sowing.

[0076] The vector preferably expresses a site-specific nuclease selected from the group consisting of CRISPR nuclease complex or its components, Argonaute complex or its components, zinc finger nuclease, TALEN, and meganuclease.Preferably, the vector expresses CRISPR nuclease complex or its components, where preferably the components are at least one of CRISPR nuclease and gRNA.Preferably, the vector expresses both CRISPR nuclease and gRNA.

[0077] The provided plant may be exposed to a single vector. Optionally, the single vector is PVX or geminivirus. Optionally, the single vector expresses both CRISPR nuclease and guide RNA, optionally expressing CRISPR nuclease and multiple guide RNAs. Optionally, the provided plant is exposed to 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different vectors. Preferably, the plant is exposed to at least two vectors, where one vector expresses CRISPR nuclease and another vector expresses guide RNA, optionally expressing multiple guide RNAs.

[0078] The vector used in the method of the present invention preferably comprises a sequence encoding a site-specific nuclease as defined herein, in addition to one or more elements for the expression of the encoded site-specific nuclease. The vector used in the method of the present invention preferably expresses at least one of a CRISPR nuclease and a guide RNA (gRNA). The vector of the present invention preferably expresses a CRISPR nuclease, where the nuclease may have endonuclease or nickase activity (CRISPR nickase) or may be a dead CRISPR nuclease. Optionally, the CRISRP-nuclease is fused to one or more deaminase domains.

[0079] The (nuclease element of) the site-specific nuclease, preferably the nuclease element is a CRISPR nuclease, may contain a nuclear localization signal (NLS) to direct the expressed nuclease element to the nucleus of the plant cell. The NLS may be located at the C-terminus and / or N-terminus of the (nuclease element of) the site-specific nuclease. Any known nuclear localization signal is suitable for use in the present invention. Preferred nuclear localization signals include, but are not limited to, the SV40 large T antigen NLS MEDPTMAPKKKRKV (SEQ ID NO: 1), the monokaryotic NLS PKKKRKV (SEQ ID NO: 2), and the nucleoplasmin NLS KRPAATKKAGQAKKKK (SEQ ID NO: 3). The (nuclease element of) the site-specific nuclease may contain two or more nuclear localization signals, for example, one or more at the N-terminus and one or more at the C-terminus. A site-specific nuclease (nuclease element) may contain two or more different nuclear localization signals, for example the C-terminal NLS and the N-terminal NLS may be different.

[0080] The nuclease element used in the present invention may be any CRISPR nuclease as defined herein.Preferably, the nuclease element is a type II CRISPR nuclease, preferably a type II CRISPR nuclease, such as Cas9 (e.g., the protein of SEQ ID NO: 4, encoded by SEQ ID NO: 5, or the protein of SEQ ID NO: 6); or a type V CRISPR nuclease, preferably a type V CRISPR nuclease, such as Cpf1 (e.g., the protein of SEQ ID NO: 7, encoded by SEQ ID NO: 8); or Mad7 (e.g., the protein of SEQ ID NO: 9 or 10); or a protein derived therefrom, preferably having at least about 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with said protein over its entire length.

[0081] Preferably, the nuclease component of the site-specific nuclease is a type II CRISPR nuclease, preferably a Cas9 nuclease.

[0082] Those skilled in the art know how to find and prepare vectors containing sequences encoding site-specific nucleases (nuclease components of the same), such as sequences encoding CRISPR nucleases. Numerous reports on their design and use are available in the prior art. See, for example, the reviews by Haeussler et al. (J Genet Genomics. (2016) 43(5): 239-50. doi: 10.1016 / j.jgg.2016.04.008.) or Lee et al. (Plant Biotechnology Journal (2016) 14(2) 448-462) on the design of guide RNAs and their use in combination with CAS proteins (originally obtained from S. pyogenes).

[0083] Optionally, the nuclease component of the site-specific nuclease is a CRISPR nuclease, which is either a nickase or an (endo)nuclease.

[0084] The nuclease element expressed by the vector may comprise or consist of the entire CRISPR nuclease type II or type V, or a variant or functional fragment thereof. Optionally, such a fragment binds to a guide RNA but may, for example, lack one or more residues required for nuclease activity.

[0085] Preferably, the nuclease component of the site-specific nuclease is a Cas9 protein. The Cas9 protein has been identified in the bacteria Streptococcus pyogenes (SpCas9; NCBI Reference Sequence NC_017053.1; UniProtKB-Q99ZW2), Geobacillus thermodenitrificans (UniProtKB-A0A178TEJ9), Corynebacterium ulcerous (NCBI Refs:NC_015683.1, NC_017317.1); Corynebacterium diphtheria (NCBI Refs:NC_016782.1, NC_016786.1); Spiroplasma syrphidicola (NCBI Refs:NC_016782.1, NC_016786.1); Ref:NC_021284.1);Prevotella intermedia (NCBI Ref:NC_017861.1);Spiroplasma taiwanense (NCBI Ref:NC_021846.1);Streptococcus iniae (NCBI Ref:NC_021314.1);Belliella baltica (NCBI Ref:NC_018010.1);Psychroflexus torquis (torquisl) (NCBI Ref:NC_018721.1);Streptococcus thermophilus (NCBI Ref:YP_820832.1);Listeria innocua innocua (NCBI Ref: NP_472073.1); Campylobacter jejuni (NCBI Ref: YP_002344900.1); or Neisseria meningitidis (NCBI Ref: YP_002342100.1).These include Cas9 mutants that have inactivated HNH or RuvC domains homologous to SpCas9 and become nickases (e.g., SpCas9_D10A or SpCas9_H840A), or Cas9s that have equivalent substitutions at positions corresponding to D10 or H840 of the SpCas9 protein and become nickases.

[0086] The nuclease component of the site-specific nuclease may be Cpf1 (e.g., Cpf1 from Acidaminococcus sp.; UniProtKB-U2UMQ6) or may be derived from Cpf1. The mutant may be a Cpf1 nickase with an inactivated RuvC or NUC domain, where the RuvC or NUC domain no longer has nuclease activity. The skilled artisan is well aware of techniques available in the art, such as site-directed mutagenesis, PCR-mediated mutagenesis, and total gene synthesis, which allow for inactivated nucleases, such as inactivated RuvC or NUC domains. One example of a Cpf1 nickase with an inactive NUC domain is Cpf1 R1226A (see Gao et al. Cell Research (2016) 26:901-913; Yamano et al. Cell (2016) 165(4):949-962). In this mutant, there is an arginine to alanine (R1226A) conversion in the NUC domain, rendering it inactive.

[0087] The nuclease component of the site-specific nuclease may be or be derived from CRISPR-CasΦ, a nuclease that is approximately half the size of Cas9. CRISPR-CasΦ uses a single crRNA for nucleic acid targeting and cleavage, as described, for example, in Pausch et al (CRISPR-CasΦ from huge phages is a hypercompact genome editor, Science (2020); 369 (6501): 333-337).

[0088] The active, partially inactive, or dead site-specific nuclease, preferably the active, partially inactive, or dead CRISPR nuclease complex, may serve to guide the fused functional domain to a specific site in DNA determined by a guide element, preferably a guide RNA. Thus, the (nuclease element of) the site-specific nuclease may be fused to a functional domain. Optionally, such a functional domain is for epigenetic modification, such as, for example, a histone modification domain. The domain for epigenetic modification may be selected from the group consisting of methyltransferase, demethylase, deacetylase, methylase, deacetylase, dioxygenase, glycosylase, and acetylase (Cano-Rodriguez et al, Curr Genet Med Rep (2016) 4: 170-179). The methyltransferase may be selected from the group consisting of G9a, Suv39h1, DNMT3, PRDM9, and Dot1L. The demethylase may be LSD1. The deacetylase may be SIRT6 or SIRT3. The methylase may be at least one of KYP, TgSET8, and NUE. The deacetylase may be selected from the group consisting of HDAC8, RPD3, Sir2a, and Sin3a. The deoxygenase may be at least one of TET1, TET2, and TET3, preferably TET1cd (Gallego-Bartolome J et al, Proc Natl Acad Sci US A. (2018); 115(9): E2125-E2134). The glycosylase may be TDG. The acetylase may be p300.

[0089] Optionally, the functional domain is a deaminase, or a functional fragment thereof, selected from the group consisting of apolipoprotein B mRNA editing complex (APOBEC) family deaminases, activation-induced cytosine deaminase (AID), ACF1 / ASE deaminase, adenine deaminase, and ADAT family deaminase. Alternatively, or in addition, the deaminase or functional fragment thereof may be ADAR1 or ADAR2, or a mutant form thereof.

[0090] The Apolipoprotein B mRNA editing complex (APOBEC) family of cytosine deaminase enzymes includes 11 proteins that serve to initiate mutagenesis in a controlled and beneficial manner.Preferably, the APOBEC deaminase is selected from the group consisting of APOBEC1, APOBEC2, APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3D, APOBEC3F, APOBEC3G, APOBEC3H, APOBEC4 and activation-induced (cytidine) deaminase.Preferably, the APOBEC family cytosine deaminase is activation-induced cytosine (or cytidine) deaminase (AID) or apolipoprotein B editing complex 3 (APOBEC3).Preferably, the deaminase domain fused to the CRISPR nuclease is an APOBEC1 family deaminase.

[0091] Another exemplary suitable type of deaminase domain that may be fused to the nuclease element of the site-specific nuclease, preferably a CRISPR nuclease, is an adenine or adenosine deaminase, for example, the ADAT family of adenine deaminases. Furthermore, the adenine deaminase may preferably be TadA or a variant thereof, as described in Gaudelli et al., 2017 (Gaudelli et al. 2017 Nature 551:464-471). Furthermore, the nuclease element, preferably a CRISPR nuclease, may be fused to an adenine deaminase domain, for example, from ADAR1 or ADAR2. The deaminase domain of the present invention may comprise or consist of the entire catalytically active deaminase protein or a fragment thereof. Preferably, the deaminase domain has deaminase activity. Optionally, the nuclease element, preferably a CRISPR nuclease, is further fused to a UDG inhibitor (UGI) domain.

[0092] The nuclease element of a site-specific nuclease, preferably a CRISPR nuclease, may be fused to a reverse transcriptase, preferably for use in prime editing, as described, for example, in Anzalone AV, et al. (Nature (2019), 576, pages 149-157).

[0093] The vector used in the method of the present invention may comprise two or more sequences encoding the nuclease element of the site-specific nuclease. Optionally, the vector may encode the same nuclease element more than once. Alternatively, or in addition, the vector may encode two or more different nuclease elements, such as, but not limited to, CRISPR-Cas9 and CRISPR-Cpf1.

[0094] The nuclease component of the site-specific nuclease may be an Argonaute protein. Argonaute (Ago) proteins bind small RNA or DNA guides that provide base-pairing specificity for recognition and cleavage of complementary nucleic acid targets (Kaya et al. PNAS 2016 Apr 12; 113(15): 4057-4062). Thus, the plant demonstrated in step i) may express an Argonaute protein, and in step ii) a guide is provided to direct the Argonaute protein to a specific location in the genome of the plant cell, achieving targeted genetic modification. Alternatively, the guide and the Argonaute protein are expressed from one or more vectors in step ii). The Argonaute protein may cleave DNA, a process called DNA interference, as described, for example, in Kuzmenko et al (Nature (2020), 587, 632-637). Optionally, the Argonaute protein is complexed or fused with one or more functional domains or proteins, preferably at least one of a helicase and a topoisomerase domain, and preferably unwinds genomic DNA.

[0095] Optionally, the site-specific nuclease of the method of the invention is a protein comprising a domain designed to recognize and target a nuclease (element) to a specific location in the genome, such as, for example, a TALEN comprising a TAL effector DNA binding domain fused to a DNA cleavage domain; a ZFN comprising a zinc finger DNA binding domain fused to a DNA cleavage domain; or a meganuclease such as I-SceI, I-CreI or I-DmoI. Optionally, the site-specific nuclease is a fusion protein comprising both the nuclease element of the method of the invention in the form of a nuclease domain of said fusion protein; and the guide element of the method of the invention, shown in the form of a guide domain, such as, for example, a zinc finger motif or a TAL effector, for the guidance of the fusion protein to the target sequence to be edited. Optionally, said fusion protein is in an active form, i.e., capable of inducing DSBs as a dimer. The expressed site-specific nuclease may be designed to target a specific location in the genome of the plant cell to achieve a targeted gene modification. The target site is preferably located near, on or within the sequence of interest in the genome of the plant cell. The vector of the method of the invention may encode both monomers of the dimer. Alternatively, each monomer of the fusion protein is encoded on a separate vector.

[0096] When the nuclease element of the site-specific nuclease is a nuclease that requires complexation with a guide to guide the nuclease element to the target sequence to be edited, such as CRISPR nuclease or Argonaute, the vector used in the method of the present invention preferably expresses the guide element. The guide element is preferably a guide RNA. The same vector may also express the nuclease element of the site-specific nuclease, preferably a CRISPR nuclease. Alternatively, the guide element and the nuclease element of the site-specific nuclease, preferably a guide RNA and a CRISPR nuclease, are expressed from separate vectors. Alternatively, the nuclease element of the site-specific nuclease, preferably a CRISPR nuclease, may already be expressed in the provided plant.

[0097] The expressed guide element may guide the nuclease element of the site-specific nuclease to a specific location in the genome of the plant cell to achieve targeted gene modification. The guide element guides the complex to a defined target site in the double-stranded nucleic acid molecule, also called a protospacer sequence. The guide element preferably includes a sequence for targeting a specific nuclease complex to a protospacer sequence site near, on, or within the sequence of interest in the genome of the plant cell.

[0098] When the site-specific nuclease is a CRISPR endonuclease complex, the guide element may be a guide RNA, which is a single guide (sg)RNA molecule, or a combination of crRNA and tracrRNA (e.g., in the case of Cas9) as separate molecules, or only a crRNA molecule (e.g., in the case of Cpf1 and CasΦ). Optionally, the guide RNA is a single guide (sg)RNA (e.g., in the case of Cas9) or only a crRNA (e.g., in the case of Cpf1 and CasΦ). Thus, the CRISPR nuclease complex used in the method of the invention may comprise a guide RNA, where the guide RNA comprises a combination of crRNA and tracrRNA, preferably the CRISPR nuclease is Cas9. The crRNA and tracrRNA are preferably combined into a sgRNA (single guide RNA). Alternatively, the CRISPR nuclease complex used in the method of the invention may comprise a guide RNA, where the guide RNA comprises a crRNA, preferably the CRISPR protein is Cpf1 or CasΦ.

[0099] A guide element, preferably a guide RNA, for use in the methods of the invention may comprise a sequence capable of hybridizing to or adjacent to a sequence of interest, preferably a sequence of interest as defined herein. A guide element, preferably a guide RNA, may comprise a nucleotide sequence that is fully complementary to a sequence within the sequence of interest, i.e. the sequence of interest comprises a protospacer sequence. Alternatively or additionally, a guide element, preferably a guide RNA, for use in the methods of the invention may comprise a sequence capable of hybridizing to or adjacent to a complementary sequence of a sequence of interest.

[0100] Optionally, a vector used in the methods of the invention may express more than one guide element, preferably more than one guide RNA, e.g., targeting two or more different sequences of interest or targeting two or more positions in the same sequence of interest.

[0101] The vector may express at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more guide elements or guide RNAs that have different seed sequences, i.e., can hybridize with different protospacer sequences. Different guide elements may direct the nuclease element to different locations within the same gene. Alternatively, or in addition, different guide elements may direct the nuclease element to different genes within the plant cell.

[0102] When the guide element is a guide RNA, optionally, the vector does not include a spacer sequence located between different (pre)guide RNA sequences, i.e., the different (pre)RNA guide sequences are located directly adjacent to each other. Alternatively, there is a sequence of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25 or more nucleotides that separate the different (pre)guide RNA sequences. Optionally, the different (pre)guide RNA sequences are separated by a cleavable spacer sequence, which is preferred when the CRISPR nuclease is Cas9 and the guide RNA is sgRNA. When the CRISPR nuclease is Cpf1, the (pre-)crRNA guide may not require a cleavable spacer, since Cpf1 can process the pre-crRNA (Zetsche et al. Nat Biotechnol 2017;35:31-34).

[0103] The cleavable spacer sequence may be any sequence known to the skilled artisan suitable for cleaving an RNA molecule in a plant cell (see, for example, He et al. J. Genet. Genomics 2017;44(9):469-472). Non-limiting examples of such cleavable spacer sequences include, but are not limited to, a spacer having the following sequence: UCGCGGCCGGGUACGUGUUGAGC (SEQ ID NO: 11). The cleavable sequence may have at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 11. Alternatively, the cleavable spacer sequence may be any tRNA sequence or tRNA-like structure, preferably from a plant. The cleavable tRNA sequence may be a naturally occurring sequence or may be modified to include a cleavable sequence. The tRNA or tRNA-like structure used in the present invention has the ability to function as a cleavable sequence. Any naturally occurring plant tRNA may have the ability to function as a cleavable sequence. Those skilled in the art know how to easily obtain the sequences of such plant tRNA or tRNA-like structures.

[0104] Naturally occurring tRNAs may include recognition sites for cleavage by at least one of RNase P and RNase Z. Naturally occurring tRNAs may include a leader sequence AACAAA, preferably at or near the 3' and / or 5' end. The leader sequence may allow for processing or "cleavage" of the sequence. Preferably, the tRNA includes a leader sequence AACAAA at or near the 5' end of the tRNA. Suitable tRNA cleavable elements are described, for example, in Xie et al. ("Boosting CRISPR / Cas9 multiplex editing capability with the endogenous tRNA-processing system", 2015, Proc Natl Acad Sci USA; 112(11):3570-5), which is incorporated herein by reference. A preferred cleavable tRNA is a tRNA. Gly It is.

[0105] Alternatively, or in addition, a tRNA or tRNA-like structure as defined herein may be modified to function as a cleavable sequence. The tRNA or tRNA-like structure may be modified to include a recognition site for cleavage by at least one of RNase P and RNase Z. Preferably, the tRNA or tRNA-like structure is modified to include the leader sequence AACAAA, preferably at or near the 3' and / or 5' end. Preferably, the tRNA includes the leader sequence AACAAA at or near the 5' end of the tRNA.

[0106] The vector can be used to express at least one of the site-specific nuclease, preferably CRISPR nuclease and guide RNA in a plant host cell. The vector backbone can be, for example, a plasmid into which the expression cassette is integrated, or, if an appropriate transcription control sequence (e.g., (inducible) promoter) is already present, only the desired nucleotide sequence (e.g., the sequence encoding the guide RNA and / or CRISPR nuclease) is integrated downstream of the transcription control sequence.

[0107] Suitable promoters include, but are not limited to, natural coat protein promoters of viruses. Such natural coat protein promoters used in the present invention may be derived from, for example, tobacco rattle virus (e.g., as described in Deng X et al, 2013, Mol Plant-Microbe Interact. doi:10.1094 / MPMI-12-12-0280-R), pea early browning virus (e.g., as described in MacFarlane SA and Popovich AH (2000), Virology. doi:10.1006 / viro.1999.0098), or any of the tobacco rattle virus strains TCM, PLB, PSG, and PRV (e.g., as described in Goulden MG et al, 1990, Nucleic Acids Res. doi:10.1093 / nar / 18.15.4507). The promoter may be a PEBV promoter, a U6 promoter, or a pol III promoter.

[0108] The vectors of the present invention may contain additional genetic elements, such as, for example, selectable markers, multiple cloning sites, etc., to facilitate their use in molecular cloning. The vector backbone may be, for example, a binary or superbinary vector (see, for example, U.S. Pat. No. 5,591,616, U.S. Patent Publication No. 2002138879, and WO 95 / 06722), a cointegrate vector, or a T-DNA vector as known in the art.

[0109] The vector used according to the present invention is preferably particularly suitable for introducing the expression of at least one element of a site-specific nuclease, preferably a CRISPR nuclease and / or a guide RNA into a plant cell.Preferred expression vectors are naked DNA, DNA complexes, or viral vectors.

[0110] Preferred naked DNA is a linear or circular nucleic acid molecule, such as a plasmid. Plasmid refers to a circular double-stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques. DNA complex is a DNA molecule bound to any carrier suitable for delivering DNA into cells. Preferred carriers are selected from the group consisting of lipoplexes, liposomes, polymersomes, polyplexes, PEG, dendrimers, inorganic nanoparticles, virosomes, and cell-penetrating peptides.

[0111] The vector used in the method of the present invention is preferably a viral vector.The viral vector can be a DNA virus or an RNA virus.The viral vector can be or be based on tobamovirus, tobravirus, potexvirus, geminivirus, alphamovirus, cucumovirus, potyvirus, tombusvirus, hordeivirus, or nucleorhabdovirus.

[0112] The tobamovirus virus vector may be at least one of Tobacco Mosaic Virus (TMV) and Sun Hemp Mosaic Virus (SHMV). The tobravirus virus vector may be Tobacco Rattle Virus (TRV). The potexvirus virus vector may be at least one of Potato Virus X (PVX) and Papaya Mosaic Potexvirus (PapMV). The geminivirus virus vector may be Comovirus Cowpea Mosaic Virus (CPMV). Further examples of suitable geminivirus virus vectors may include Cabbage Leaf Curl Virus, Tomato Golden Mosaic Virus, Bean Yellow Dwarf Virus, African Cassava Mosaic Virus, Wheat Dwarf Virus, Miscanthus Stripe Virus, Tobacco Yellow Dwarf Virus, Tomato Yellow Leaf Curl Virus, Bean Golden Mosaic Virus, Beet Curly Top Virus, Maize Stripe Virus, and Tomato Pseudo Curly Top Virus. The alphamovirus may be Alfalfa Mosaic Virus (AMV). The cucumovirus may be Cucumber Mosaic Virus (CMV) or Cucumber Green Mottle Mosaic Virus (CGMMV). The potyvirus may be Plum Pox Virus (PPV). The tombusvirus may be Tomato Bushy Stunt Virus (TBSV). The hordeivirus may be Barley Stripe Mosaic Virus. The nucleorhabdovirus may be Sonchus Yellow Net Virus (SYNV) (see, e.g., Hefferon K, Plant Virus Expression Vectors: A Powerhouse for Global Health, Biomedicines. 2017, 5(3):44; and Lico et al, Viral vectors for production of recombinant proteins in plants, J Cell Physiol, 2008; 216(2):366-77).

[0113] Preferably, the viral vector is selected from the group consisting of tobacco rattle virus (TRV), tobacco mosaic virus (TMV), sonchus yellow net virus (SYNV), and potato virus X (PVX). Preferably, the viral vector is at least one of tobacco rattle virus (TRV), tobacco mosaic virus (TMV), geminivirus, potato virus X (PVX), and sonchus yellow net virus (SYNV).

[0114] Preferably, the vector does not have any modification that impairs or significantly impairs its systemic movement properties. Thus, the vector used in the present invention preferably comprises a functional coat protein. Alternatively, the vector used in the present invention does not express a functional coat protein. The sequence encoding the coat protein may contain a mutation that abolishes the expression of the functional coat protein. The mutation may be at least one of a deletion, an addition, a substitution, or a combination thereof, preferably resulting in a premature stop codon. Preferably, at least a part of the sequence encoding the coat protein is deleted. Preferably, at least 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% of the sequence encoding the viral coat protein is deleted from the viral genome. Although the deletion of the coat protein may impair systemic movement properties, it may be desirable as it may increase the packaging capacity. Preferably, the viral vector comprising at least a partial mutation, preferably a deletion, of the sequence encoding the coat protein is a tobamovirus or tobravirus, optinally a tobacco mosaic virus (TMV), modified to comprise said mutation or deletion. A preferred viral vector is, for example, a TMV RNA-based overexpression vector (TRBO), as described by Lindbo (TRBO: A High-Efficiency Tobacco Mosaic Virus RNA-Based Overexpression Vector, Plant Physiol, 2007; 145(4): 1232-40). Thus, the viral vector used in the method of the invention may comprise a deletion of one or more genes, for example, to increase the packaging capacity of the virus, improve genome stability and / or increase gene expression.

[0115] Infection of the plant cell with a suitable vector preferably results in high-level expression of at least one element of the site-specific nuclease, preferably at least one of the CRISPR nuclease and the guide RNA, in the plant cell. High-level expression may be achieved, for example, by deletion of viral coat proteins and / or use of a strong promoter. The viral vector may be, for example, a self-replicating RNA, as described in WO 2018 / 226972, which is incorporated herein by reference.

[0116] Step iii) Remove the shoot apical meristem After the vector is introduced in step ii), the shoot apical meristem (or "meristem") may be removed from the provided plant. The shoot apical meristem may be removed immediately after the vector is introduced into the plant cells, e.g., the time between steps ii) and iii) may be less than about 24 hours, less than 28 hours, less than 12 hours, less than 6 hours, or less than about 3 hours. Preferably, the plant produces (self-replicates) the introduced vector before the shoot apical meristem is removed. Thus, there may be an interval of one or more days between steps ii) and iii) of the method of the present invention. Preferably, there is an interval of about 1, 2, 3, 4, or 5 weeks between steps ii) and iii). Preferably, there is an interval of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 days between steps ii) and iii). Preferably, there is an interval of about 1 to 21 days, 2 to 15 days, or about 7 to 10 days between step ii) and step iii).

[0117] Step iii) of the method of the present invention concerns the removal of the shoot apical meristem of the provided plant.

[0118] The removal of the shoot apical meristem may also result in the removal of one or more axillary meristems. Preferably, the removal of the shoot apical meristem does not result in the removal of all axillary meristems of the provided plant. Preferably, the removal of the shoot apical meristem preferably does not initiate the regeneration of the provided plant. After the removal of the shoot apical meristem, the provided plant preferably still comprises one or more axillary meristems. Preferably, after the removal of the shoot apical meristem, the provided plant comprises a cotyledon axillary meristem. Optionally, after the removal of the shoot apical meristem, the provided plant does not further comprise any axillary shoot meristems, except for the cotyledon axillary meristem.

[0119] The skilled artisan is well aware of suitable methods for removing the shoot apical meristem of a plant. Preferably, the removal of the shoot apical meristem is performed by pinching the plant at a first location. Preferably, the first location is above the cotyledons. Preferably, the first location is directly above the cotyledons. Preferably, the (first) location at which the plant is pinched is in the epicotyl. Preferably, the first location is below the first true leaf, preferably above the cotyledons, below the first true leaf. Preferably, the (first) location at which the plant is pinched is less than about 20 cm, less than 15 cm, less than 10 cm, less than 9 cm, less than 8 cm, less than 7 cm, less than 6 cm, less than 5 cm, less than 4 cm, less than 3 cm, less than 2 cm, less than 1 cm, less than 0.9 cm, less than 0.8 cm, less than 0.7 cm, less than 0.6 cm, less than 0.5 cm, less than 0.4 cm, less than 0.3 cm, less than 0.2 cm, or less than 0.1 cm above the cotyledons.

[0120] Step iv) Shoot regeneration The step of removing the shoot apical meristem is followed by step iv) of regenerating shoots at a second location of the plant resulting from step iii). Shoot regeneration at the second location is preferably induced by wounding the plant at the second location. Preferably, said wound is pinching at the second location. Preferably, shoot regeneration is de novo formation of shoots. Preferably, in step iv), the plant is pinched and shoot formation is induced. Preferably, pinching is performed at a second location, preferably the second location is below the cotyledons. Preferably, step iv) comprises the removal of (shoot) axillary meristems, preferably all (shoot) axillary meristems, including potential axillary meristems that have developed into dominant new shoot apical meristems as a result of the shoot apical meristem removal in step iii), thereby inducing meristem formation from somatic cells, preferably somatic cells containing the genome modification. In particular, the shoot is preferably regenerated from a meristem formed from at least one somatic cell. Preferably, said at least one somatic cell comprises a site-specific nuclease-induced genetic modification.

[0121] Optionally, step iii) of removing the apical meristem is immediately followed by step iv) of regenerating shoots at a second location on the plant, e.g., steps iii) and iv) may be performed on the same day, e.g., the time between steps iii) and iv) may be less than about 24 hours, less than 28 hours, less than 12 hours, less than 6 hours, or less than about 3 hours.

[0122] Preferably, the time between steps iii) and iv) may be one day or more, such that the provided plant comprises one or more cells that include the site-specific nuclease-induced genetic modification at the second location.

[0123] Thus, there may be an interval of one or more days between steps iii) and iv) of the method of the present invention. Optionally, there is an interval of about 1, 2, 3, 4, or 5 weeks between steps iii) and iv). Preferably, there is an interval of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 25, 30, 35, 40, 45, or 50 days between steps iii) and iv). Preferably, there is an interval of about 1-50 days, 2-40 days, 3-30 days, 4-25 days, 5-20 days, 6-15 days, 7-14 days, 1-7 days, or 1-5 days between steps iii) and iv).

[0124] Shoot regeneration is preferably induced at a second location of the provided plant (see also FIG. 1 for a schematic diagram of one embodiment of the present invention). The second location is therefore a location that allows shoot regeneration. Preferably, the location is a location that does not allow root regeneration. The location is preferably within the shoot system of the plant. Preferably, the second location is not within the root system of the plant and / or is not ablated from the root apical meristem. Preferably, the first and second locations are adjacent to each other. The first and second locations may both be located within the epicotyl of the provided plant, or both may be located within the hypocotyl. The first location may be within the epicotyl and the second location may be within the hypocotyl. Preferably, the first location is above the cotyledons and the second location is below the cotyledons. Preferably, the first location is directly above the cotyledons and the second location is directly below the cotyledons, where "directly above or below" is within about 3 cm, 2 cm, 1 cm, 0.5 cm, 0.4 cm, 0.3 cm, 0.2 cm, or about 0.1 cm of the cotyledons. Preferably, the cotyledons are located between the first location and the second location of the plant provided in step i).

[0125] The distance between the first and second positions is preferably less than about 20 cm, 15 cm, 10 cm, 9 cm, 8 cm, 7 cm, 6 cm, 5 cm, 4 cm, 3 cm, 2 cm, 1 cm, 0.9 cm, 0.8 cm, 0.7 cm, 0.6 cm, 0.5 cm, 0.4 cm, 0.3 cm, 0.2 cm, or less than about 0.1 cm. Preferably, the distance between the first and second positions is about 0.1 cm to 20 cm, 0.5 cm to 10 cm, 1 cm to 8 cm, or about 2 cm to 6 cm.

[0126] Those skilled in the art are well aware of methods for regenerating plant shoots. Such conventional methods include, but are not limited to, wounding (preferably, pinching) the provided plant at a second location. In the present specification, pinching is understood as removing the axillary meristem, preferably removing all (shoot) axillary meristems of the provided plant. Preferably, all axillary meristems are removed to prevent shoot development from existing meristems. Preferably, no shoots are formed from existing meristems. Preferably, there are one or more shoots formed from somatic cells that have been transformed into new meristems. Preferably, at least one or more of these somatic cells contain the genetic modification induced by the site-specific nuclease, and therefore preferably, the meristem formed from said one or more somatic cells contains the genetic modification.

[0127] Alternatively, or in addition, the provided plants may be wounded in step iv) to stimulate shoot regeneration. Wounding is a well-known step in tissue culture technology and the skilled artisan knows how to injure plant cells and induce wound stress.

[0128] The second location is preferably within the hypocotyl of the plant provided in step i). Preferably, the second location is below the cotyledons. Preferably, the second location for topping the plant is less than about 20 cm, 15 cm, 10 cm, 9 cm, 8 cm, 7 cm, 6 cm, 5 cm, 4 cm, 3 cm, 2 cm, 1 cm, 0.9 cm, 0.8 cm, 0.7 cm, 0.6 cm, 0.5 cm, 0.4 cm, 0.3 cm, 0.2 cm, or less than about 0.1 cm below the cotyledons.

[0129] At least step iv) is preferably carried out under conditions that allow shoot regeneration, which are understood herein to be at least the minimum requirements for the regeneration of the provided plant and generally include at least the normal growth conditions of said plant.

[0130] The regeneration process may occur directly from the parent tissue or indirectly, such as through the formation of a callus. Thus, the shoot regeneration in step iv) of the method of the present invention may involve a callus stage. Shoots may thus be formed from the callus. This callus formation may occur spontaneously, i.e. without exogenously supplied plant hormone(s), for example after wounding (preferably pinching). Similarly, shoot formation, for example after callus formation, may occur spontaneously in the absence of exogenously supplied plant hormone(s).

[0131] Alternatively, callus formation in the method of the present invention may be induced and / or enhanced in the presence of one or more plant hormones. Alternatively, or in addition, shoot formation may be induced and / or enhanced in the presence of one or more plant hormones. Preferably, the plant hormone for shoot regeneration used in step iv) may be one or more cytokinins, one or more auxins, or a combination of one or more cytokinins and one or more auxins.

[0132] The one or more cytokinins that may be used in the methods of the present invention may be at least one of adenine-type cytokinins and phenylurea-type cytokinins. Similarly, the cytokinins may be naturally produced plant hormones or may be synthetic compounds. The adenine-type cytokinins may be plant hormones that are synthesized in at least one of roots, seeds, and fruits. Additionally, the cambium and other actively dividing tissues may also synthesize cytokinins. Non-limiting examples of naturally occurring adenine-type cytokinins are zeatin and its metabolic precursor 2iP. Non-limiting examples of synthetic adenine-type cytokinins are kinetin and 6-benzylaminopurine (BAP). Substituted urea compounds such as thidiazuron and CPPU are not present in plants but may act as cytokinins in tissue culture. The adenine-type cytokinins may be selected from the group consisting of kinetin, zeatin, trans-zeatin, cis-zeatin, dihydrozeatin, 6-benzylaminopurine, and 2iP, and combinations thereof. The phenylurea type cytokinin may be diphenylurea or thidiazuron. It is known to those skilled in the art that the type of cytokinin to be added depends on the type of plant cell, and those skilled in the art can select an appropriate cytokinin according to the need.

[0133] The one or more auxins that may be used in the methods of the present invention may be endogenously synthesized auxins. The endogenously synthesized auxins may be selected from the group consisting of indole-3-acetic acid (IAA), 4-chloroindole-3-acetic acid, phenylacetic acid, indole-3-butyric acid, and indole-3-propionic acid. The auxin may be a synthetic auxin, such as, for example, an auxin analog. The synthetic auxin may be at least one of 1-naphthaleneacetic acid, 2,4-dichlorophenoxyacetic acid (2,4-D), α-naphthaleneacetic acid (α-NAA), 2-methoxy-3,6-dichlorobenzoic acid (dicamba), 4-amino-3,5,6-trichloropicolinic acid (trudon or picloram), 1-naphthaleneacetic acid (NAA), indole-3-butyric acid (IBA), and 2,4,5-trichlorophenoxyacetic acid (2,4,5-T). The auxin can be 1-naphthaleneacetic acid (NAA).

[0134] In shoot organogenesis by a combination of cytokinin and auxin, the ratio of cytokinin to auxin is preferably greater than 1 (Dodds, JH and Roberts, LW (1985) Experiments in plant tissue culture. Cambridge University Press, Cambridge, UK).

[0135] Step iv) may be performed using conditions that allow callus formation at the second location of the provided plant. Optionally, step iv) is performed using minimal conditions that allow callus formation at the second location. Optionally, step iv) is performed using optimal conditions for callus formation at the second location of the provided plant.

[0136] Step iv) may be carried out using conditions that allow shoot formation at the second location of the provided plant. Preferably, step iv) is carried out using minimal conditions that allow shoot formation at the second location. In a preferred embodiment, step iv) of the method of the present invention is carried out using optimal conditions for shoot formation at the second location of the provided plant.

[0137] Preferably, at least one of the shoots regenerated from the plant comprises one or more cells with genetic modifications induced by site-specific nuclease. Optionally, at least one of the shoots regenerated from the plant comprises a plurality of cells with genetic modifications induced by site-specific nuclease, wherein the resulting modifications (optionally nucleotide substitutions, insertions, and / or deletions, e.g., indels) may be different between a plurality of cells. Different modifications induced by a single site-specific nuclease of the method of the present invention may occur when the DSB induced by the site-specific nuclease is repaired in different ways in different cells in a process referred to as NHEJ (non-homologous end joining), optionally resulting in different nucleotide substitutions, deletions, and / or insertions.

[0138] Preferably, the shoots regenerated in step iv) of the method of the present invention contain more genetically modified cells compared to the regenerated shoots of a control plant. Preferably, the shoots of the control plant are regenerated using the same method as described herein, except that step iii) of the method is omitted. The percentage of genetically modified cells in the shoots produced by the method of the present invention is preferably at least about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% different compared to the percentage of genetically modified cells in the shoots produced by the control plant. As a non-limiting example, 50% of the cells of the shoots regenerated by the method of the present invention may have a genetic modification induced by a site-specific nuclease. Using the same experimental setup, when step iii) is omitted (referred to herein as the control method), 30% of the cells may have a genetic modification induced by a site-specific nuclease. In this non-limiting example, thus, there is a 20% difference in the number of cells of regenerated shoots with genetic modification between the method of the present invention (double pinching) and the control method (single pinching). Preferably, the shoots of the control plant are regenerated shoots from an otherwise identical plant, preferably subjected to the same method as defined herein, except that step iii) is omitted. Optionally, if a plant regenerates more than one shoot, the percentage of genetically modified cells in the shoots of the plant defined herein may be understood herein as the average of all shoots of said plant. Preferably, at least about 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% of the cells of the shoot formed at the second location have the site-specific nuclease-induced genetic modification. Preferably, all cells of the formed shoot contain the site-specific nuclease-induced genetic modification.

[0139] Preferably, at least one of the shoots regenerated from the plant contains one or more cells having a genetic modification induced by the site-specific nuclease. Preferably, at least about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% of the regenerated shoots contain one or more cells having a genetic modification induced by the site-specific nuclease. Preferably, all regenerated shoots contain one or more cells having a genetic modification induced by the site-specific nuclease. The method of the present invention preferably increases the number of shoots having one or more genetically modified cells. Thus, preferably, the method of the present invention results in an increase in the number of regenerated shoots having one or more genetically modified cells compared to the same method except that step iii) is omitted. Preferably, there is a difference of at least about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% between the percentage of shoots having one or more genetically modified cells produced by the method of the invention and the percentage of shoots having one or more genetically modified cells produced by a control plant. Preferably, the shoots of the control plant are shoots regenerated from an otherwise identical plant, preferably subjected to the same method as defined herein, except that step iii) is omitted.

[0140] In the case where more than one plant is provided in step i), the percentage of modified cells in the shoot may be understood herein as the average percentage of modified cells in the shoot determined after analysis of all regenerated shoots of all plants.Similarly, the percentage of shoots containing one or more genetically modified cells may be understood herein as the average percentage of shoots containing one or more genetically modified cells after analysis of all regenerated shoots of all plants.

[0141] The method of the present invention may further include a step of selecting a shoot comprising one or more cells having a genetic modification induced by the site-specific nuclease, and may optionally include a step of selecting a shoot comprising one or more cells having a specific desired genetic modification, such as, for example, a specific indel or single nucleotide polymorphism of interest. Preferably, the method of the present invention includes a step of identifying and / or selecting a shoot comprising one or more meristematic cells having a genetic modification. Optionally, said shoot may be isolated. Preferably, the selected shoot is regenerated into a plant. Preferably, the selected shoot is regenerated into a plant that carries or produces gametes having the genetic modification. Preferably, the selected shoot is cultivated as part of the plant of the method of the present invention from which the shoot originates, and develops an inflorescence carrying at least one gamete having the genetic modification. The gamete may be a male gamete in a pollen grain or a female gamete in an ovule of a flower. Optionally, the pollen or ovule is part of a cross that produces seeds and / or progeny containing the genetic modification.

[0142] The step of selecting the shoots may be carried out using any conventional method known to the skilled artisan. The selection may include a step of determining the phenotype and / or molecular characteristics of the shoots. The selection may include a step of detecting the genetic modification. The selection may include a step of determining the genotype. The detection of the genetic modification and / or the determination of the genotype may be carried out using any conventional method known to the skilled artisan, such as, but not limited to, conventional (high redundancy) sequencing methods.

[0143] Alternatively or in addition, the method of the invention as defined herein may comprise a step of cultivating the plant after step iv). Preferably, after regenerating shoots at the second location of the provided plant, and optionally after pinching the provided plant at the second location, the plant may be cultured or "grown" for at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or about 10 weeks, preferably at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or about 10 months. Preferably, after regenerating shoots at the second location of the provided plant, and optionally after pinching the provided plant at the second location, the plant may be grown towards at least one of a vegetative plant, an emergent plant, a flowering plant, or a mature plant. The plant may be cultivated to produce pollen and / or eggs. Preferably, the method comprises a step of cultivating the plant to produce seeds, and optionally a step of (self-)fertilizing the egg cell comprising the genetic modification. Preferably, the seed production step does not involve an essential or exclusive biological process.

[0144] The produced seed preferably comprises one or more cells having a genetic modification induced by the site-specific nuclease of the method of the present invention. Preferably, the cells of the embryo comprise said genetic modification. Optionally, the integument may comprise said genetic modification. Preferably, all cells of the produced seed comprise the genetic modification induced by the site-specific nuclease of the method of the present invention.

[0145] The method may further comprise cultivating a progeny plant from the produced seed, wherein the progeny plant comprises one or more cells having a genetic modification induced by the site-specific nuclease of the invention. Preferably, the progeny plant is not obtained by an essential biological process or is not obtained only by an essential biological process.

[0146] In an embodiment, the present invention relates to a plant obtained by the method of the present invention, i.e. a plant comprising one or more regenerated shoots with a genetic modification induced by site-specific nuclease. The plant of the present invention preferably differs from a plant occurring in nature at least in that it contains at least one mutation in the sequence of interest. Preferably, the plant of the present invention is not obtained essentially or exclusively by a biological process.

[0147] In a further aspect, the present invention relates to a shoot obtained by the method of the present invention, wherein the shoot comprises one or more cells comprising a genetic modification induced by the site-specific nuclease of the method of the present invention. Optionally, the shoot may be cultivated into a plant comprising the genetic modification.

[0148] The present invention further relates to a seed or progeny plant produced by the method of the present invention comprising a genetic modification. Preferably, the seed and progeny plant are not essentially or exclusively obtained by a biological process.

[0149] The invention has been described above with reference to several exemplary embodiments. Modifications and alternative implementations of some parts or elements are possible and fall within the scope of protection defined in the appended claims. [Brief description of the drawings]

[0150] [Figure 1] FIG. 1 is a schematic diagram of one embodiment of the present invention. [Diagram 2] Shoots containing edits in at least one of the target genes using the double pinching approach (left, 15 shoots) and the single pinching approach (right, 4 shoots). The Y-axis represents the editing frequency of each target gene (Lin5, ETR1, and RR-A). EXAMPLES

[0151] Experimental procedure Seeds of the tomato line Moneyberg TMV (Netherlands) expressing Cas9 (SEQ ID NO: 4) under the control of the parsley ubiquitin promoter (Fauser et al. Plant J. 2014;79:348-359) were sown in small pots and placed in an air-conditioned compartment for 7-10 days for germination.

[0152] Agrobacterium strains containing plasmid pTRV1 (Accession Number: AF406991.1) or pTRV2 (Accession Number: AF406991) were grown overnight at 28°C and 225 rpm in LB medium supplemented with kanamycin (Liu et al. Plant J. 2002 May;30(4):415-429). pTRV1 and pTRV2 encode two RNA molecules that together form the genome of the bipartite virus TRV. pTRV1 encodes TRV RNA1. The RNA molecule "RNA1" contains elements known in the art to be essential for viral self-replication and operation. pTRV2 encodes TRV RNA2. The RNA molecule "RNA2" expresses single guide (sg)RNAs targeting the LIN5, ETR1, and RRA genes, respectively, with seed sequences of CCTGACGATGAAATTAAGAA (SEQ ID NO: 12), ACGAAGTATATCAACTCCAC (SEQ ID NO: 13), and TATTGTATGCCTGGGATGAC (SEQ ID NO: 14), under the control of the PEBV subgenomic promoter (Ali et al. Molecular Plant, 2015;8(8):p1288-1291).

[0153] The next day, bacteria were harvested by centrifugation at 3400 rcf for 5 min at room temperature, and the bacterial pellet was resuspended in 10 mL of infiltration buffer (10 mM MES, 10 mM MgCl2, pH 5.6, suspended with 200 μM acetosyringone).

[0154] TRV1 and TRV2 cultures were cultured at their final OD using infiltration buffer. 600The mixtures were diluted to an A of 0.8–0.9 and mixed 1:1. The mixtures were incubated in infiltration buffer at room temperature for 3–4 h before being infiltrated into the cotyledons of each plant.

[0155] After 10 days, 20 seedlings were topped above the cotyledons (for the double-topped samples) and 20 seedlings were topped just below the cotyledons (for the single-topped samples) using a single-edged razor. The tray was filled with water and then returned to the climate-controlled cabinet.

[0156] After an additional 3 days, the shoots were pinched just below the cotyledons with a single-edged razor. The covered trays were returned to the climate-controlled cabinet. Once buds began to form, both single- and double-pinched seedlings were transferred to the greenhouse. Each shoot was individually labeled.

[0157] Leaf material was collected near young fruits or inflorescences during fruiting (or late flowering). After DNA extraction, amplicons spanning the sgRNA cleavage sites for all three target genes were generated by PCR. After adding sample tags and sequencing adapters by PCR, samples were pooled and sequenced on the Illumina MiSeq platform.

[0158] Editing frequency was determined as the percentage of reads containing indels at the predicted cleavage site per amplicon. The results are shown in Table 1 and Figure 2.

[0159] [Table 1]

[0160] Additionally, the number of edited shoots was determined, as shown in Table 2 below.

[0161] [Table 2]

[0162] As shown in Table 1 and Figure 2, double pinching resulted in editing at a frequency of over 40% in many shoots (75%), whereas single pinching resulted in only 16% editing at over 40%. Thus, the method of the present invention clearly increases the number of editings per regenerated shoot.

[0163] Remarkably, the percentage of regenerated roots containing edits was also significantly increased using the methods of the invention (Table 2 shows an increase of 23%). Thus, the methods of the invention result in an increase in the number of edits per shoot, as well as an increase in the number of shoots containing edited cells.

Claims

1. i) providing a plant; ii) introducing into a cell of the plant a vector expressing at least one of a guide element and a nuclease element of a site-specific nuclease; iii) removing the shoot apical meristem of the plant, preferably by topping the plant at a first location; iv) regenerating a shoot comprising one or more cells having the genetic modification at a second location of the plant, preferably by wounding the second location of the plant; 2. A method for producing a plant shoot comprising one or more cells having a genetic modification, comprising:

2. The method of claim 1 , wherein the shoot regeneration is effected by pinching of the plant at the second location.

3. 3. The method of claim 1 or 2, wherein the first location in step iii) is above the cotyledons, preferably in the epicotyl above the cotyledons and below the first true leaf.

4. The method according to any one of claims 1 to 3, wherein the second location in step iv) is below the cotyledons, preferably in the hypocotyl below the cotyledons.

5. The method of any one of claims 1 to 4, wherein the site-specific nuclease is selected from the group consisting of a CRISPR nuclease complex, an Argonaute, a zinc finger nuclease, a TALEN, and a meganuclease.

6. The method according to any one of claims 1 to 5, wherein the site-specific nuclease is a CRISPR nuclease complex, the plant provided in step i) expresses the nuclease component of the complex, and in step ii) the vector expresses a gRNA.

7. The method according to any one of claims 1 to 6, wherein the period between steps ii) and iii) is about 1 to 21 days.

8. The method according to any one of claims 1 to 7, wherein the period between steps iii) and iv) is about 1 to 7 days.

9. The method according to any one of claims 1 to 8, wherein the plant provided in step i) is a seedling.

10. The method according to any one of claims 1 to 9, wherein the vector introduced in step ii) is a virus preferably selected from the group consisting of Tobacco Rattle Virus (TRV), Tobacco Mosaic Virus (TMV), Potato Virus X (PVX), Geminivirus, and Sonchus Yellow Net Virus (SYNV), preferably a Tobacco Mosaic Virus RNA-based Overexpression Vector (TRBO).

11. The method according to any one of claims 1 to 10, wherein the vector is introduced in step ii) by contacting the cotyledons with an Agrobacterium or a viral particle carrying the vector.

12. 12. The method of any one of claims 1 to 11, further comprising the step of selecting a shoot containing one or more cells with the genetic modification and regenerating said plant.

13. 13. The method of any one of claims 1 to 12, further comprising cultivating said plant and producing gametes comprising said genetic modification.

14. 14. The method of claim 13, further comprising growing a seed from the gamete and optionally cultivating a progeny plant from the seed, wherein the seed and optional progeny plant comprise one or more cells having the genetic modification.

15. A plant having a shoot comprising one or more cells carrying a genetic modification, obtainable by the method according to any one of claims 1 to 14.

Images