Engineered agrobacteria for plant editing
Patent Information
- Application Number
- JP2024536073
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-12-17
- Filing Date
- 2022-12-15
- Publication Date
- 2026-02-05
AI Technical Summary
Existing methods for plant genetic modification using Agrobacterium-mediated transformation often result in the integration of foreign DNA into the plant genome, leading to transgenic plants, which may not be favored by consumers and regulators.
Engineered bacteria with reduced VirD5 activity and site-specific DNA editing machinery are used to introduce precise mutations into plant cells, allowing for transient expression of DNA editing agents without significant integration of foreign DNA, thereby producing gene-edited, non-transgenic plants.
The method enables the efficient generation of plants with specific mutations without foreign DNA integration, providing predictable results and meeting consumer and regulatory preferences.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical field]
[0001] The present invention relates to modified bacteria for introducing desired mutations into target sequences in plant cells, and methods of using such bacteria to generate plant cells, plant parts, plants or populations thereof. [Background technology]
[0002] The ability of Agrobacterium to transfer DNA into plant cells has been exploited for the purpose of plant genetic engineering. Rhizobium and Ensifer have similar DNA transfer and genetic engineering capabilities.
[0003] Agrobacterium-mediated genetic transformation of plants usually requires the presence of two genetic components on the bacterial Ti plasmid. The first essential component is the T-DNA, a region defined by conserved 25-bp imperfect repeats called border sequences. The second genetic component is the virulence (vir) region, which consists of at least seven major loci (virA, virB, virC, virD, virE, virF, and virG) that encode components of the bacterial protein machinery that mediates T-DNA processing and transfer. The VirA and VirG proteins are two-component regulators that activate the expression of other Vir genes on the Ti plasmid. The remaining Vir proteins are involved in T-DNA processing, transfer, and integration.
[0004] A single-stranded form of T-DNA (T-strand) and Vir effector proteins are transferred to the plant cell. After transfer, the T-strand forms a complex with Vir and plant proteins and passes through the cytoplasm into the nucleus. The T-DNA is integrated into the plant genome. Although transient expression of T-DNA-encoded genes can occur without integration into the genome, integration of the T-DNA into the genome establishes a permanent transformation event that allows stable expression.
[0005] Foreign DNA sequences can be integrated into plant genomes using a binary system. In the binary system, the foreign DNA sequence is cloned into the T-DNA encoded on a T-binary plasmid, while virulence genes are expressed from another plasmid (also called a "helper" plasmid). Agrobacterium transformation is then used to integrate the T-DNA region containing the foreign DNA sequence into the plant genome, allowing the plant to express new proteins from the integrated foreign DNA sequence. Thus, Agrobacterium is commonly used to create transgenic plants.
[0006] The foreign DNA sequence expressing the protein of interest may also be integrated into the plant genome through homologous recombination without the remaining part of the T-DNA region at the same time, but this generally occurs at a low frequency.For example, WO 2015 / 174514 describes a mutant Agrobacterium that may show more efficient integration of foreign genes cloned into the T-DNA region, particularly foreign genes related to, for example, seed yield or environmental stress, through homologous recombination. There is a need for improved methods for modifying plants. Summary of the Invention
[0007] The present inventors have developed modified bacteria for introducing desired mutations into target sequences in plant cells, and methods for using such bacteria to generate plant cells, plant parts, plants or populations thereof.
[0008] The present invention can be used to introduce precise mutations into plants with reduced or no integration of foreign DNA into the plant genome. The present invention uses modified bacteria with reduced VirD5 activity and site-specific DNA editing mechanisms. The examples show that the bacteria of the present invention allow gene editing to occur via transient expression of DNA editing agents from T-DNA while reducing T-DNA integration. Thus, the present invention allows efficient production of plants with specific mutations without integrating foreign DNA. Such plants are described as gene-edited plants because their genome contains specific, targeted mutations, and as non-transgenic plants because their genome does not contain integrated foreign DNA. Such plants are preferred by consumers and regulators.
[0009] Modified bacteria with reduced VirD5 activity and carrying site-specific DNA editing machinery are particularly useful for generating gene-edited, preferably non-transgenic plants. Because reducing VirD5 activity is not expected to promote degradation of T-DNA molecules in plant cells or nuclei, it leads to reduced expression of DNA editing machinery. Reducing VirD5 activity according to the present invention does not change the stability or sequence of T-DNA in any way, allowing longer and higher levels of transient expression. Also, reducing VirD5 activity leads to more predictable results in a variety of different plants compared to, for example, changing border sequences, whose role is not well understood. Also, reducing VirD5 activity is more compatible with the expression of DNA editing machinery than, for example, changing border sequences that allow integration at double-strand breaks repaired by NHEJ.
[0010] Thus, in a first aspect, the present invention provides a bacterium capable of introducing a nucleotide sequence into a plant cell, the bacterium comprising: (a) a nucleotide sequence encoding a Vir gene, wherein the expression and / or activity of VirD5 is reduced or disrupted, and (b) a T-DNA sequence encoding at least one site-specific DNA editing agent capable of introducing at least one mutation into at least one target sequence in a plant cell.
[0011] In certain embodiments, the site-specific DNA editing agent comprises a base editor, and the T-DNA sequence also encodes one or more guide RNAs specific to the target sequence(s). The base editor directly converts a base or base pair to another base, directly generating precise point mutations in DNA. The examples show that the bacterium of the present invention, comprising a base editor, particularly an APOBEC base editor, and a T-DNA expressing one or more guide RNAs, can effectively generate gene-edited non-transgenic plants.
[0012] In certain embodiments, the site-specific DNA editing agent comprises a prime editor, and the T-DNA sequence also encodes one or more guide RNAs that are pegRNAs specific for the target sequence(s). The prime editor generates targeted insertions, deletions and base exchanges, and is effective to generate gene-edited non-transgenic plants according to the present invention.
[0013] In certain embodiments, the site-specific DNA editing agent comprises an endonuclease, and the T-DNA sequence also comprises at least one donor template that can introduce at least one mutation via homology-dependent repair (HDR) or non-homologous end joining (NHEJ), and optionally encodes one or more guide RNAs specific to the target sequence(s). HDR and NHEJ using the donor template allow precise editing in DNA, making it possible to generate gene-edited non-transgenic plants according to the present invention.
[0014] The bacteria used in the present invention are capable of transferring nucleotide sequences to plant cells. Preferred such bacteria are those of the genera Agrobacterium, Rhizobium, and Ensifera. Procedures for mediating gene transfer using these bacteria have been well characterized. In a preferred embodiment, the bacteria is Agrobacterium tumefaciens. In a preferred embodiment, the Agrobacterium tumefaciens bacteria is derived from the Agrobacterium tumefaciens strain EHA105 or the Agrobacterium tumefaciens strain AGL1. The examples show that the Agrobacterium tumefaciens bacteria according to the present invention are effective in producing gene-edited non-transgenic plants.
[0015] In certain embodiments, the expression and / or activity of VirD5 encoded by the nucleotide sequence encoding the vir gene is disrupted. The examples show that disrupting the expression and / or activity of VirD5 improves the efficiency of producing gene-edited non-transgenic plants.
[0016] In certain embodiments, the reduction or disruption of the expression and / or activity of VirD5 encoded by the nucleotide sequence encoding the vir gene is mediated by at least one mutation in the sequence encoding VirD5. In a preferred embodiment, the at least one mutation in the sequence encoding VirD5 is selected from the group consisting of: (a) at least one nucleotide insertion; (b) at least one nucleotide deletion; (c) an indel; (d) an inversion; (e) at least one nucleotide substitution; and (f) any combination of (a) to (e), and optionally, the insertion or deletion is a frameshift insertion or frameshift deletion. In certain embodiments, the at least one mutation in the sequence encoding VirD5 is at least one nonsense or missense nucleotide substitution.
[0017] In certain embodiments, at least one mutation in the VirD5-encoding sequence is an insertion, and the inserted sequence encodes a selectable marker. The examples show that such mutations are effective to disrupt the virD5 gene, yet allow for selection of the mutant sequence.
[0018] In certain embodiments, the reduction or disruption of expression of VirD5, encoded by a nucleotide sequence encoding a vir gene, is mediated by expression of a silencing RNA targeting VirD5.
[0019] In a preferred embodiment of the present invention, the nucleotide sequence encoding vir gene is a plasmid, most preferably a Vir-helper plasmid.In a particular embodiment, the plasmid is a Ti plasmid or a Ri plasmid.Vir-helper plasmid, Ti plasmid and Ri plasmid are particularly effective in mediating the delivery of genetic material to plant cells.According to some embodiments, the nucleotide sequence encoding vir gene is a plasmid that does not contain T-DNA sequence, such as, but not limited to, the Vir-helper plasmid of T-binary system.
[0020] In certain embodiments, at least one target sequence comprises ACO or PPO, preferably ACO1 or PPO2. The examples show that the bacteria of the present invention are effective for introducing mutations into ACO1 or PPO2 to obtain ACO1- or PPO2-edited non-transgenic plants.
[0021] In certain embodiments, at least one mutation in at least one target sequence in plant cell comprises at least one mutation that causes a selectable trait in plant cell, and optionally, the selectable trait is herbicide resistance.If the mutation causes a selectable trait, the plant can be screened for the presence of the selectable trait to determine which plants have the mutation.Examples show that such a process can effectively select the plants that have the desired edit, particularly by using bacteria that introduce mutations into genes that cause resistance to herbicides.
[0022] In a particular embodiment, the at least one mutation in the at least one target sequence in the plant cell comprises at least one mutation in at least one acetolactate synthase (ALS) gene, and the at least one mutation in the ALS gene provides resistance to an ALS inhibitor. In a preferred embodiment, the ALS gene is the banana acetolactate synthase 1 (ALS1) gene or the acetolactate synthase 2 (ALS2) gene, and the plant cell is a banana cell. In a preferred embodiment, the at least one mutation in the ALS gene is a substitution that introduces a substitution into the encoded amino acid sequence, preferably Pro-187 in banana ALS1 or Pro-181 in ALS2, most preferably Pro187Ser in ALS1 or Pro181Ser in ALS2. In certain embodiments, the ALS inhibitor is a sulfonylurea, an imidazolinone, a triazolopyrimidine, a pyrimidinyl oxybenzoate, or a sulfonylamino carbonyl triazolinone, preferably, the ALS inhibitor is chlorsulfuron.
[0023] In certain embodiments, the T-DNA sequence encodes at least one site-specific DNA editing agent capable of introducing at least one mutation into an additional target sequence. The examples show that the bacteria of the present invention are effective in co-editing two or more target sequences simultaneously. This allows for the effective generation of plants with two or more specific mutations. Furthermore, bacteria capable of introducing mutations into two or more target sequences allow for highly efficient selection of gene-edited non-transgenic plants, since plants that are edited in the first target sequence are more likely to also be edited in the second sequence. For example, if one mutation introduces a selectable trait, this can be used to select plants enriched in the second mutation.
[0024] Thus, in certain embodiments, the T-DNA sequence encodes (a) at least one CRISPR-associated endonuclease or modified CRISPR-associated endonuclease; (b) a first guide RNA specific to a first target sequence; and (c) a second guide RNA specific to a second target sequence, where the at least one endonuclease can introduce at least one mutation into the first target sequence and can introduce at least one mutation into the second target sequence. This co-editing approach allows for the introduction of mutations into multiple target sequences. Preferably, the at least one mutation introduced into the first target sequence results in a selectable trait in plant cells, and optionally, the selectable trait is herbicide resistance, which allows the highly efficient selection of gene-edited non-transgenic plants that carry both mutations.
[0025] In certain embodiments, the at least one modified CRISPR-associated endonuclease is one or more base editors capable of introducing at least one mutation into a first target sequence that results in a selectable trait in a plant cell, and optionally the selectable trait is herbicide resistance, and can introduce at least one mutation into a second target sequence. The examples show that the bacterium of the present invention carrying a T-DNA encoding a base editor can introduce transversion mutations into the first and second target sequences to generate co-edited non-transgenic plants.
[0026] In certain embodiments, the T-DNA sequence also encodes a donor template capable of introducing at least one mutation into a second target sequence via homology-dependent repair (HDR) or non-homologous end joining (NHEJ).
[0027] In certain embodiments, the T-DNA sequence also encodes a first donor template capable of introducing at least one mutation into a first target sequence via homology-dependent repair (HDR) or non-homologous end joining (NHEJ) that results in a selectable trait in a plant cell, optionally the selectable trait being herbicide tolerance, and a second donor template capable of introducing at least one mutation into a second target sequence.
[0028] In certain embodiments, the at least one modified CRISPR-associated endonuclease is one or more prime editors, the first guide RNA is a first pegRNA specific for a first target sequence and capable of introducing at least one mutation into the first target sequence that results in a selectable trait in the plant cell, optionally the selectable trait is herbicide resistance, and the second guide RNA is a second pegRNA specific for a second target sequence and capable of introducing at least one mutation into the second target sequence.
[0029] In certain embodiments, the at least one CRISPR-associated endonuclease or modified CRISPR-associated endonuclease comprises at least two different endonucleases, where the first endonuclease can introduce at least one mutation into the first target sequence and the second endonuclease can introduce at least one mutation into the second target sequence. By using different endonucleases, more powerful and efficient gene editing can be achieved. In certain such embodiments, the first endonuclease does not function to introduce any mutation into the second target sequence and / or the second endonuclease does not function to introduce any mutation into the first target sequence. Such an arrangement allows different editing actions to be performed on the first target sequence and the second target sequence without the risk of undesired editing results. In such an embodiment, the first endonuclease may form a ribonucleoprotein complex with a first guide RNA specific to a first target sequence, and the second endonuclease may form a ribonucleoprotein complex with a second guide RNA specific to a second target sequence. For example, an endonuclease incorporating a specific type of guide RNA may be used. For example, Cas9 uses both crRNA and trRNA to form sgRNA, while Cas12a requires only crRNA. Thus, in certain embodiments, the first endonuclease is Cas9 or modified Cas9, the first guide RNA is sgRNA, the second endonuclease is Cas12a or modified Cas12a, and the second guide RNA is crRNA, or the first endonuclease is Cas12a or modified Cas12a, the first guide RNA is crRNA, the second endonuclease is Cas9 or modified Cas9, and the second guide RNA is sgRNA. Alternatively, or in combination, the first and second endonucleases may recognize different PAM sequences. In such embodiments, the first and second endonucleases may be selected separately from SpCas9, CjCas9, and Cas12a.
[0030] In certain embodiments, the first endonuclease and the second endonuclease can both introduce at least one mutation into the first target sequence and / or both introduce at least one mutation into the second target sequence. In such embodiments, the first endonuclease and / or the second endonuclease can form a complex with both a first guide RNA specific to the first target sequence and a second guide RNA specific to the second target sequence. For example, the first and second endonucleases can recognize the same PAM sequence and / or incorporate the same type of guide RNA. Such an arrangement creates greater editing diversity. When different endonucleases are used, they may preferably introduce different modifications. For example, the first endonuclease may be a base editor and the second endonuclease may be a prime editor, or vice versa. Alternatively, the first endonuclease may be a base editor and the second endonuclease may be a CRISPR-associated endonuclease such as Cas9, or vice versa. Thus, the T-DNA may also encode a donor template that can introduce at least one mutation into the first or second target sequence via homology-dependent repair (HDR) or non-homologous end joining (NHEJ). In any of the above embodiments, the at least one mutation introduced into the first target sequence results in a selectable trait in the plant cell, and optionally, the selectable trait is herbicide resistance, which allows for highly efficient selection of gene-edited non-transgenic plants that carry both mutations.
[0031] In certain embodiments, the nucleotide sequence encoding the vir genes, optionally the Vir-helper plasmid, Ti plasmid or Ri plasmid, does not comprise a T-DNA cassette, and the T-DNA is encoded by an additional plasmid. The examples demonstrate that bacteria carrying a Vir helper plasmid containing the vir gene operon and a second binary plasmid encoding the T-DNA are effective for generating gene-edited non-transgenic plants.
[0032] In certain embodiments, the additional plasmid encodes one or more additional elements selected from the group consisting of a plant selectable marker, a bacterial selectable marker, a reporter gene, and at least one bacterial origin of replication.
[0033] In certain embodiments, the plant cell is selected from the group consisting of a cell of a suspension culture (such as an embryonic cell suspension), an embryogenic cell, a cell of a meristematic region, a cell of a callus tissue, a leaf cell, a root cell, a shoot cell, a somatic cell, a floral cell, a pollen cell, a microspore, a protoplast, and combinations thereof.
[0034] In particular embodiments, the plant cell is banana, coffee, or rice.
[0035] In certain embodiments, the banana is selected from the group consisting of Musa acuminata, Musa balbisiana, Musa itinerans, autotriploid Musa acuminata "Cavendish", and autotriploid Musa acuminata "Gros Michel". The examples show that the bacteria and methods of the invention are effective in producing gene-edited non-transgenic bananas, particularly Cavendish bananas.
[0036] In a second aspect, the present invention provides a method for producing a plant, plant part, plant cell or population thereof comprising at least one mutation in at least one target sequence, the method comprising contacting a plant, plant part or plant cell with a bacterium of the present invention, and optionally further comprising regenerating said cell or plant part to obtain a whole plant. The examples demonstrate that the method of the present invention effectively and efficiently produces plants, plant parts, plant cells or populations thereof that contain a desired mutation in a target sequence but are non-transgenic.
[0037] In certain embodiments, the at least one mutation in the at least one target sequence comprises: (a) at least one mutation in a first target sequence that confers a selectable trait in a plant, plant part or plant cell, optionally the selectable trait being herbicide resistance, optionally the first target sequence being an ALS gene, and optionally the mutation providing herbicide resistance to an ALS inhibitor; and (b) at least one mutation in a second gene. The examples show that introducing a mutation that confers a selectable trait and a mutation in a second gene allows for highly efficient selection of gene-edited non-transgenic plants, because plants that have been edited with the first target sequence and have a selectable trait are more likely to have been edited with the second sequence as well. The selectable trait can be used to select plants enriched for the second mutation, as shown in the examples. The examples show that introducing a mutation in the ALS gene is effective in conferring resistance to ALS inhibitors, allowing for effective selection.
[0038] In certain embodiments, at least one of the mutations in the target sequences results in a selectable trait being conferred to the plant cell, plant part or plant; optionally, the selectable trait is herbicide resistance; optionally, at least one of the target sequences is in an ALS gene and the mutation provides herbicide resistance to an ALS inhibitor.
[0039] In a preferred embodiment, the genome of the plant, plant part or plant cell produced does not contain any integrated T-DNA sequence.The examples show that the method of the present invention can be used to produce plants that do not have any integrated T-DNA sequence at a high frequency.The lack of integration of T-DNA sequence is attractive to growers and consumers, and greatly reduces potential problems for growers who want to obtain certain regulatory approvals.
[0040] In certain embodiments, the method further comprises selecting at least one plant cell, plant part or plant that comprises at least one mutation in the target sequence(s) and does not comprise any integrated T-DNA sequence in its genome. In certain embodiments, said selecting comprises genotyping.
[0041] In certain embodiments, the method further comprises selecting the cells, plant parts or plants having the selectable trait.
[0042] In a preferred embodiment, the selectable trait is herbicide resistance and selection is performed by selecting cells, plant parts or plants that are resistant to the herbicide; optionally, the target sequence is an ALS gene and selection is performed by selecting cells, plant parts or plants that are resistant to an ALS inhibitor.
[0043] In a particular embodiment, at least 40%, optionally at least 55%, preferably at least 65% of the plant cells, plant parts or plants in the population resulting from the method do not contain integrated T-DNA and contain a mutation in a second gene in their genome. The examples show that the method of the invention is effective to provide a highly enriched population of plants that contain a mutation in a second gene and do not have any integrated T-DNA sequences when a mutation in the first sequence is selected.
[0044] In certain embodiments, the method comprises: (a) introducing at least one mutation into a first target sequence that results in a selectable trait in a plant cell, optionally the selectable trait being herbicide resistance; (b) introducing at least one mutation into a second target sequence; and (c) selecting a plant, plant part, plant cell or population thereof comprising said selectable trait, optionally by treatment with a herbicide, wherein the selected plant, plant part, plant cell or population contains or is enriched for a mutation in the second target sequence, and optionally the selected plant, plant part, plant cell or population does not contain an integrated T-DNA in their genome or is enriched for plants, plant parts or plant cells that do not contain an integrated T-DNA in their genome.
[0045] In certain embodiments, the method further comprises producing at least one plant embryo, plant part or plant from the selected cell, plant part or plant.
[0046] In certain embodiments, the plant, plant part or plant cell is banana, coffee or rice.
[0047] In a preferred embodiment, the plant, plant part or plant cell is of a banana variety selected from the group consisting of Malayan wild japonica, Ryukyu wild japonica, Burmese blue banana, autotriploid Malayan wild japonica "Cavendish", and autotriploid Malayan wild japonica "Gros Michel".
[0048] In a third aspect, the present invention provides a plant, plant part, plant cell or population thereof produced by the method of the present invention.
[0049] In a particular embodiment, at least 40%, optionally at least 55%, preferably at least 65% of the plant cells, plant parts or plants in the population resulting from the method do not contain the T-DNA integrated into their genome and contain a mutation in the second gene. The examples show that when mutations in the first sequence are selected, the plant population resulting from the method of the invention is highly enriched for plants that contain a mutation in the second gene and do not have any integrated T-DNA sequences.
[0050] In a preferred embodiment, the invention provides an Agrobacterium cell comprising (a) a Vir-helper plasmid encoding a vir gene, wherein expression and / or activity of VirD5 is disrupted, and (b) a T-DNA sequence encoding at least one base editor capable of introducing at least one mutation into at least one target sequence in a plant cell, and one or more guide RNAs specific for at least one target sequence in the plant cell. In a particularly preferred embodiment, the base editor is a fusion polypeptide comprising a modified CRISPR-associated endonuclease and a deaminase moiety, preferably APOBEC.
[0051] In a preferred embodiment, the invention provides an Agrobacterium cell comprising (a) a Vir-helper plasmid encoding a vir gene, wherein expression and / or activity of VirD5 is disrupted, and (b) a T-DNA sequence encoding at least one prime editor capable of introducing at least one mutation into at least one target sequence in a plant cell, and one or more guide RNAs, which are pegRNAs specific for at least one target sequence in the plant cell. In a particularly preferred embodiment, the prime editor is a fusion polypeptide comprising nCas9 and reverse transcriptase.
[0052] In a preferred embodiment, the present invention provides a bacterial cell capable of introducing a nucleotide sequence into a plant cell, preferably an Agrobacterium cell, comprising: (a) a Vir helper encoding a vir gene, wherein expression and / or activity of VirD5 is disrupted; and (b) a T-DNA sequence encoding at least one CRISPR-associated endonuclease or modified CRISPR-associated endonuclease capable of introducing at least one mutation into at least one target sequence in a plant cell and one or more guide RNAs specific for at least one target sequence in the plant cell, wherein the at least one mutation in the at least one target sequence comprises a mutation that results in a selectable trait in the plant cell, optionally the selectable trait is herbicide resistance, and optionally the at least one mutation comprises at least one mutation in at least one acetolactate synthase (ALS) gene, wherein the at least one mutation in the ALS gene provides resistance to an ALS inhibitor.
[0053] In a preferred embodiment, the invention provides an Agrobacterium cell comprising: (a) a Vir-helper plasmid encoding a vir gene, wherein expression and / or activity of VirD5 is disrupted; and (b) a T-DNA sequence encoding at least one CRISPR-associated endonuclease or modified CRISPR-associated endonuclease capable of introducing at least one mutation into at least one target sequence in a plant cell, one or more guide RNAs specific for at least one target sequence in a plant cell, and at least one donor template capable of introducing at least one mutation via homology-dependent repair (HDR).
[0054] In a preferred embodiment, the invention provides an Agrobacterium cell comprising: (a) a Vir-helper plasmid encoding a vir gene, wherein expression and / or activity of VirD5 is disrupted; and (b) a T-DNA sequence encoding at least one CRISPR-associated endonuclease or modified CRISPR-associated endonuclease capable of introducing at least one mutation into at least one target sequence in a plant cell, one or more guide RNAs specific for at least one target sequence in a plant cell, and at least one donor template capable of introducing at least one mutation via homology-dependent repair (HDR) or non-homologous end joining (NHEJ).
[0055] In some embodiments, the invention provides an Agrobacterium cell comprising: (a) a Vir-helper plasmid encoding a vir gene, wherein the expression and / or activity of VirD5 is reduced or disrupted; and (b) i) at least one CRISPR-associated endonuclease or modified CRISPR-associated endonuclease; ii) a first guide RNA specific for a first target sequence; iii) a second guide RNA specific for a second target sequence, and iv) a donor template capable of introducing at least one mutation into a second target sequence via homology-dependent repair (HDR) or non-homologous end joining (NHEJ); A T-DNA sequence encoding wherein at least one CRISPR-associated endonuclease or modified CRISPR-associated endonuclease is capable of introducing at least one mutation into a first target sequence and is capable of introducing at least one mutation into a second target sequence via said donor template; optionally, the at least one mutation in the first target sequence results in a selectable trait in the plant cell, optionally the selectable trait is herbicide resistance, and optionally the at least one mutation comprises at least one mutation in at least one acetolactate synthase (ALS) gene, wherein the at least one mutation in the ALS gene provides resistance to an ALS inhibitor; and
[0056] In some embodiments, the invention provides an Agrobacterium cell comprising: (a) a Vir-helper plasmid encoding a vir gene, wherein the expression and / or activity of VirD5 is reduced or disrupted; and (b) i) at least one CRISPR-associated endonuclease or modified CRISPR-associated endonuclease; ii) a first guide RNA specific for a first target sequence; iii) a second guide RNA specific for a second target sequence; iv) a first donor template capable of introducing at least one mutation into a first target sequence via homology-dependent repair (HDR) or non-homologous end joining (NHEJ); and v) a second donor template capable of introducing at least one mutation into a second target sequence via homology-dependent repair (HDR) or non-homologous end joining (NHEJ); A T-DNA sequence encoding wherein at least one CRISPR-associated endonuclease or modified CRISPR-associated endonuclease is capable of introducing at least one mutation into said first target sequence via said second donor template, and is capable of introducing at least one mutation into said second target sequence via said second donor template; optionally, at least one mutation in the first target sequence results in a selectable trait in the plant cell, optionally, the selectable trait is herbicide resistance, and optionally, the at least one mutation comprises at least one mutation in at least one acetolactate synthase (ALS) gene, and the at least one mutation in the ALS gene provides resistance to an ALS inhibitor; and a T-DNA sequence.
[0057] In a preferred embodiment, the invention provides an Agrobacterium cell comprising: (a) a Vir-helper plasmid encoding a vir gene; and (b) i) at least one base editor; ii) a first guide RNA specific for at least one ALS gene; and iii) a second guide RNA specific for a second target sequence; A T-DNA sequence encoding wherein the at least one base editor is capable of introducing at least one mutation into at least one ALS gene that provides resistance to an ALS inhibitor and is capable of introducing at least one mutation into a second target sequence, the T-DNA sequence. In a particularly preferred embodiment, the base editor is a fusion polypeptide comprising a modified CRISPR-associated endonuclease and a deaminase portion, preferably an APOBEC.
[0058] In a preferred embodiment, the invention provides an Agrobacterium cell comprising: (a) a Vir-helper plasmid encoding vir genes, wherein VirD5 expression and / or activity is reduced or disrupted; and (b) i) at least one base editor; ii) a first guide RNA specific for at least one ALS gene; iii) a second guide RNA specific for a second target sequence, and iv) a first donor template capable of introducing at least one mutation into the ALS gene via homology-dependent repair (HDR) or non-homologous end joining (NHEJ); A T-DNA sequence encoding wherein the at least one base editor is capable of introducing at least one mutation into at least one ALS gene that provides resistance to an ALS inhibitor and is capable of introducing at least one mutation into a second target sequence, the T-DNA sequence. In a particularly preferred embodiment, the base editor is a fusion polypeptide comprising a modified CRISPR-associated endonuclease and a deaminase portion, preferably an APOBEC.
[0059] In a preferred embodiment, the invention provides an Agrobacterium cell comprising: (a) a Vir-helper plasmid encoding vir genes, wherein VirD5 expression and / or activity is reduced or disrupted; and (b) i) at least one Prime Editor; ii) a first guide RNA that is pegRNA and is specific for at least one ALS gene; and iii) a second guide RNA, which is pegRNA and is specific for a second target sequence; A T-DNA sequence encoding wherein the at least one prime editor is capable of introducing at least one mutation into at least one ALS gene that provides resistance to an ALS inhibitor and is capable of introducing at least one mutation into a second target sequence, a T-DNA sequence. In a particularly preferred embodiment, the prime editor is a fusion polypeptide comprising nCas9 and a reverse transcriptase.
[0060] In a preferred embodiment, the invention provides an Agrobacterium cell comprising: (a) a Vir-helper plasmid encoding vir genes, wherein VirD5 expression and / or activity is reduced or disrupted; and (b) i) at least one CRISPR-associated endonuclease or modified CRISPR-associated endonuclease; ii) a first guide RNA specific for at least one ALS gene; iii) a second guide RNA specific for a second target sequence; iii) a first donor template; and iv) a second donor template; A T-DNA sequence encoding wherein the at least one CRISPR-associated endonuclease or modified CRISPR-associated endonuclease and a first donor template are capable of introducing, via HDR or NHEJ, at least one mutation into at least one ALS gene that provides resistance to an ALS inhibitor, and the at least one CRISPR-associated endonuclease or modified CRISPR-associated endonuclease and a second donor template are capable of introducing, via HDR or NHEJ, at least one mutation into a second target sequence, a T-DNA sequence.
[0061] In a preferred embodiment, the present invention provides an Agrobacterium cell comprising: (a) a Vir-helper plasmid encoding a vir gene, wherein the expression and / or activity of VirD5 is reduced or disrupted, and (b) a T-DNA sequence encoding at least one base editor capable of introducing at least one mutation into at least one target sequence in a banana cell, and one or more guide RNAs specific for at least one target sequence in a banana cell, optionally wherein the at least one target sequence comprises an ALS gene. In a particularly preferred embodiment, the base editor is a fusion polypeptide comprising a modified CRISPR-associated endonuclease and a deaminase portion, preferably an APOBEC.
[0062] In a preferred embodiment, the present invention provides an Agrobacterium cell comprising: (a) a Vir-helper plasmid encoding a vir gene, wherein the expression and / or activity of VirD5 is reduced or disrupted; and (b) a T-DNA sequence encoding at least one prime editor capable of introducing at least one mutation into at least one target sequence in a banana cell, and one or more guide RNAs that are pegRNAs specific for at least one target sequence in a banana cell, where optionally the at least one target sequence comprises an ALS gene. In a particularly preferred embodiment, the prime editor is a fusion polypeptide comprising nCas9 and reverse transcriptase.
[0063] In a preferred embodiment, the present invention provides an Agrobacterium cell comprising: (a) a Vir-helper plasmid encoding vir genes, wherein VirD5 expression and / or activity is reduced or disrupted; and (b) a T-DNA sequence encoding at least one CRISPR-associated endonuclease or modified CRISPR-associated endonuclease capable of introducing at least one mutation into at least one target sequence in a banana cell, one or more guide RNAs specific for at least one target sequence in a banana cell, and at least one donor template capable of introducing at least one mutation via homology-dependent repair (HDR).
[0064] In a preferred embodiment, the invention provides an Agrobacterium cell comprising: (a) a Vir-helper plasmid encoding a Vir gene, wherein VirD5 expression and / or activity is disrupted; and (b) i) at least one base editor; ii) a first guide RNA specific for at least one ALS gene in a banana cell; and iii) a second guide RNA specific for a second target sequence in the banana cell; A T-DNA sequence encoding wherein the at least one base editor is capable of introducing at least one mutation into at least one ALS gene that provides resistance to an ALS inhibitor and is capable of introducing at least one mutation into a second target sequence, the T-DNA sequence. In a particularly preferred embodiment, the base editor is a fusion polypeptide comprising a modified CRISPR-associated endonuclease and a deaminase portion, preferably an APOBEC.
[0065] Accordingly, the present invention provides the following numbered embodiments: 1. A bacterium capable of introducing a nucleotide sequence into a plant cell, comprising: (a) a nucleotide sequence encoding a vir gene, the nucleotide sequence having reduced or disrupted expression and / or activity of VirD5; and (b) a T-DNA sequence encoding at least one site-specific DNA editing agent capable of introducing at least one mutation into at least one target sequence in a plant cell. Including, bacteria.
[0066] 2. The bacterium of embodiment 1, wherein the site-specific DNA editing agent comprises an endonuclease selected from the group consisting of meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), homing endonucleases, CRISPR-associated endonucleases, and modified CRISPR-associated endonucleases.
[0067] 3. The bacterium of embodiment 1, wherein the site-specific DNA editing agent comprises a CRISPR-associated endonuclease or a modified CRISPR-associated endonuclease, and the T-DNA sequence also encodes one or more guide RNAs specific for at least one target sequence in the plant cell.
[0068] 4. The bacterium of embodiment 1, wherein the site-specific DNA editing agent comprises a CRISPR-associated endonuclease or modified CRISPR-associated endonuclease selected from the group consisting of a base editor, a prime editor, a Cas9 endonuclease, or an endonuclease selected from the group consisting of SpCas9, xCas9, SpCas9-NG, SaCas9, AsCpf1, LbCpf1, CjCas9, NmCas9, StCas9, TdCas9, eSpCas9, HypaCas9, Cas9-SpRY / SpG, Cas4-Cas1-Cas2 complex, and MAD7.
[0069] 5. The bacterium of embodiment 1, wherein the site-specific DNA editing agent comprises a base editor and the T-DNA sequence also encodes one or more guide RNAs specific for at least one target sequence in the plant cell.
[0070] 6. The bacterium of embodiment 5, wherein the base editor is a fusion polypeptide comprising a modified CRISPR-associated endonuclease and a deaminase portion.
[0071] 7. The bacterium of embodiment 6, wherein the modified CRISPR-associated endonuclease is nCas9 or dCas9, and the deaminase moiety is a cytidine deaminase moiety or an adenine deaminase moiety.
[0072] 8. The bacterium of embodiment 6, wherein the base editor is selected from the group consisting of: APOBEC, BE1, BE2, BE3, HF-BE3, BE4, BE4max, BE4-GAM, YE1-BE3, EE-BE3, YE-BE3, YEE-BE3, VQR-BE3, VRER-BE3, Sa-BE3, Sa-BE4, SaBE4-Gam, SaKKH-BE3, Cas12a-BE, Target-AID, Target-AID-NG, xBE3, eA3A-BE3, A3A-BE3, BE-PLUS, TAM, CRISPR-X, ABE7.9, ABE7.10, ABE7.10*, xABE, ABESa, VQR-ABE, VRER-ABE, and SaKKH-ABE.
[0073] 9. The bacterium of embodiment 1, wherein the site-specific DNA editing agent comprises a prime editor and the T-DNA sequence also encodes one or more guide RNAs that are pegRNAs specific for at least one target sequence in the plant cell.
[0074] 10. The bacterium of embodiment 9, wherein the prime editor is a fusion polypeptide comprising a modified CRISPR-associated endonuclease and a reverse transcriptase.
[0075] 11. The bacterium of embodiment 10, wherein the modified CRISPR-associated endonuclease is nCas9.
[0076] 12. The bacterium of embodiment 10, wherein the prime editor is selected from the group consisting of PE2, PE2-VQR, PE2-VRQR, PE2-VRER, PE2-NG, PE2-SpG, PE2-SpRY, PE2*, PE4, PE5, and PE3.
[0077] 13. The bacterium of embodiment 1, wherein the site-specific DNA editing agent comprises an endonuclease, such as a CRISPR-associated endonuclease, a modified CRISPR-associated endonuclease, a transcription activator-like effector nuclease or a zinc finger nuclease, and the T-DNA sequence also encodes at least one donor template capable of introducing at least one mutation via homology-dependent repair (HDR) or non-homologous end joining (NHEJ), and optionally encodes one or more guide RNAs specific for at least one target sequence in the plant cell.
[0078] 14. The bacterium of any of the preceding embodiments, which is a bacterium of the genus Agrobacterium, Rhizobium, or Ensifera, and is optionally selected from the group consisting of Agrobacterium tumefaciens, Agrobacterium fabrum str. C58, Agrobacterium genomosp, Agrobacterium sp. S2 / 73, Agrobacterium sp. 13-2099-1-2, Agrobacterium sp. NCPPB925, Agrobacterium rhizogenes, Agrobacterium salinitolerans, Agrobacterium vitis, and the like. vitis, Agrobacterium arsenijevicii, Agrobacterium deltaense, Agrobacterium larrymoorei, Rhizobium sp.AB2 / 73, Rhizobium sp.16-488-2b, Rhizobium sp.16-488-2a, Rhizobium sp. 16-449-1b, Rhizobium sp. L58 / 93, Rhizobium sp. L245 / 93, Rhizobium sp. E27B / 91, Rhizobium sp. K1 / 93, Rhizobium sp.BK007, Rhizobium tumorigenes, Rhizobium schierniiwisens skierniewicense, Rhizobium lusitanum, Neorhizobium sp. NCHU2750, Neorhizobium galegae, Ensifer sp. YR511, and Ensifer adhaerens.
[0079] 15. The bacterium according to embodiment 14, wherein the bacterium is Agrobacterium tumefaciens.
[0080] 16. The bacterium according to embodiment 15, wherein the Agrobacterium tumefaciens bacterium is derived from the Agrobacterium tumefaciens EHA105 strain or the Agrobacterium tumefaciens AGL1 strain.
[0081] 17. The bacterium according to any of the preceding embodiments, wherein expression and / or activity of VirD5 encoded by a nucleotide sequence encoding a vir gene is disrupted.
[0082] 18. The bacterium according to any of the preceding embodiments, wherein said reduction or disruption of expression and / or activity of VirD5 encoded by a nucleotide sequence encoding a vir origin is mediated by at least one mutation in the nucleotide sequence encoding VirD5.
[0083] 19. The bacterium according to embodiment 18, wherein the at least one mutation in the sequence encoding VirD5 is: (a) at least one nucleotide insertion; (b) at least one nucleotide deletion; (c) insertion-deletion (indel); (d) inversion; (e) at least one nucleotide substitution; and (f) any combination of (a) to (e); is selected from the group consisting of wherein optionally the insertion or deletion is a frameshift insertion or a frameshift deletion.
[0084] 20. The bacterium of embodiment 19, wherein the at least one mutation in the sequence encoding VirD5 is at least one nonsense or missense nucleotide substitution.
[0085] 21. The bacterium of embodiment 19, wherein the at least one mutation in the sequence encoding VirD5 is an insertion, and the inserted sequence encodes a selectable marker.
[0086] 22. The bacterium according to any of the preceding embodiments, wherein said reduction or disruption of expression of VirD5 encoded by a nucleotide sequence encoding a vir gene is mediated by expression of a silencing RNA targeting VirD5.
[0087] 23. The bacterium according to any of the preceding embodiments, wherein the nucleotide sequence encoding the Vir gene is a plasmid, such as a Vir-helper plasmid, a Ti plasmid or a Ri plasmid.
[0088] 24. The bacterium of any of the previous embodiments, wherein the plant cell is a banana cell and the at least one target sequence comprises ACO or PPO, preferably ACO1 or PPO2.
[0089] 25. The bacterium of any of the preceding embodiments, wherein the at least one mutation in the at least one target sequence in the plant cell comprises at least one mutation that confers a selectable trait in the plant cell, and optionally the selectable trait is herbicide resistance.
[0090] 26. The bacterium of any of the preceding embodiments, wherein the at least one mutation in the at least one target sequence in the plant cell comprises at least one mutation in at least one acetolactate synthase (ALS) gene, and the at least one mutation in the ALS gene provides resistance to an ALS inhibitor.
[0091] 27. The bacterium of embodiment 26, wherein the ALS gene is the banana acetolactate synthase 1 (ALS1) gene or the acetolactate synthase 2 (ALS2) gene, and the plant cell is a banana cell.
[0092] 28. The bacterium according to embodiment 26 or 27, wherein at least one mutation in the ALS gene is a substitution that introduces a substitution into the encoded amino acid sequence, preferably Pro-187 in banana ALS1 or Pro-181 in ALS2, most preferably Pro187Ser in ALS1 or Pro181Ser in ALS2.
[0093] 29. The bacterium according to any one of embodiments 26 to 28, wherein the ALS inhibitor is a sulfonylurea, imidazolinone, triazolopyrimidine, pyrimidinyloxybenzoate, or sulfonylaminocarbonyltriazolinone, preferably, the ALS inhibitor is chlorsulfuron.
[0094] 30. A bacterium according to any one of embodiments 25 to 29, wherein the T-DNA sequence encodes at least one site-specific DNA editing agent capable of introducing at least one mutation into an additional target sequence.
[0095] 31. The bacterium of any of the preceding embodiments, wherein the T-DNA sequence is: a) at least one CRISPR-associated endonuclease or modified CRISPR-associated endonuclease; b) a first guide RNA specific for a first target sequence, and c) a second guide RNA specific for a second target sequence; Code the following: wherein the at least one endonuclease is capable of introducing at least one mutation into a first target sequence and is capable of introducing at least one mutation into a second target sequence, the bacterium.
[0096] 32. The bacterium of embodiment 31, wherein the at least one modified CRISPR-associated endonuclease is one or more base editors capable of introducing at least one mutation into a first target sequence and at least one mutation into a second target sequence.
[0097] 33. The bacterium according to embodiment 31, wherein (a) the T-DNA sequence also encodes a donor template capable of introducing at least one mutation into a second target sequence via homology-dependent repair (HDR) or non-homologous end joining (NHEJ); or (b) the T-DNA sequence also encodes a first donor template capable of introducing at least one mutation into a first target sequence via homology-dependent repair (HDR) or non-homologous end joining (NHEJ), and a second donor template capable of introducing at least one mutation into a second target sequence via homology-dependent repair (HDR) or non-homologous end joining (NHEJ).
[0098] 34. The bacterium of embodiment 31, wherein the at least one modified CRISPR-associated endonuclease is one or more prime editors, the first guide RNA is a first pegRNA specific to a first target sequence and capable of introducing at least one mutation into the first target sequence, and the second guide RNA is a second pegRNA specific to a second target sequence and capable of introducing at least one mutation into the second target sequence.
[0099] 35. The bacterium according to embodiment 31, wherein the at least one CRISPR-associated endonuclease or modified CRISPR-associated endonuclease comprises at least two different endonucleases, wherein a first endonuclease is capable of introducing at least one mutation into a first target sequence and a second endonuclease is capable of introducing at least one mutation into a second target sequence.
[0100] 36. The bacterium according to embodiment 35, wherein the first endonuclease does not function to introduce a mutation into the second target sequence and / or the second endonuclease does not function to introduce a mutation into the first target sequence.
[0101] 37. The bacterium of embodiment 36, wherein the first and second endonucleases recognize different PAM sequences.
[0102] 38. The bacterium according to embodiment 35, wherein the first endonuclease and the second endonuclease are both capable of introducing at least one mutation into the first target sequence and / or both capable of introducing at least one mutation into the second target sequence.
[0103] 39. The bacterium of embodiment 38, wherein the first and second endonucleases recognize the same PAM sequence.
[0104] 40. The bacterium according to embodiment 38 or 39, wherein (i) the first endonuclease is a base editor, the second endonuclease is a prime editor, and the second guide RNA is a pegRNA, or the first endonuclease is a prime editor, the first guide RNA is a pegRNA, and the second endonuclease is a base editor; or (ii) the first endonuclease is a base editor and the second endonuclease is a CRISPR-associated endonuclease, such as Cas9, or the second endonuclease is a CRISPR-associated endonuclease, such as Cas9, and the first endonuclease is a base editor; Bacteria.
[0105] 41. The bacterium according to any of embodiments 31 to 40, wherein at least one mutation introduced into the first target sequence confers a selectable trait in a plant cell, and optionally the selectable trait is herbicide resistance, and optionally the at least one mutation comprises at least one mutation in at least one acetolactate synthase (ALS) gene, and the at least one mutation in the ALS gene provides resistance to an ALS inhibitor.
[0106] 42. The bacterium of any of the preceding embodiments, wherein the nucleotide sequence encoding the vir gene does not comprise a T-DNA sequence, and wherein the T-DNA is encoded by an additional plasmid.
[0107] 43. The bacterium according to embodiment 42, wherein the additional plasmid encodes one or more additional elements selected from the group consisting of a plant selectable marker, a bacterial selectable marker, a reporter gene, and at least one bacterial origin of replication.
[0108] 44. The bacterium of any of the preceding embodiments, wherein the plant cells are selected from the group consisting of cells of a suspension culture (such as an embryonic cell suspension), embryogenic cells, cells of the meristematic region, cells of callus tissue, leaf cells, root cells, shoot cells, somatic cells, floral cells, pollen cells, microspores, protoplasts, and combinations thereof.
[0109] 45. The bacterium of any of the preceding embodiments, wherein the plant cell is from banana, coffee, or rice.
[0110] 46. The bacterium of embodiment 45, wherein the banana is selected from the group consisting of: Malayan wild jasmine, Ryukyu wild jasmine, Burmese blue banana, autotriploid Malayan wild jasmine "Cavendish", and autotriploid Malayan wild jasmine "Gros Michel".
[0111] 47. A method for producing a plant, plant part, plant cell or population thereof comprising at least one mutation in at least one target sequence, the method comprising contacting a plant, plant part or plant cell with a bacterium according to any one of the preceding embodiments, and optionally further comprising regenerating said cell or plant part to obtain a whole plant.
[0112] 48. The method according to embodiment 47, wherein at least one mutation in at least one target sequence is: a. at least one mutation in a first target sequence that confers a selectable trait in a plant, plant part, or plant cell, optionally the selectable trait is herbicide resistance, optionally the first target sequence is an ALS gene, and optionally the mutation provides herbicide resistance to an ALS inhibitor; and b. At least one mutation in a second gene A method comprising:
[0113] 49. The method of embodiment 47, wherein at least one of the mutations in the target sequences confers a selectable trait to the plant cell, plant part or plant; optionally, the selectable trait is herbicide resistance; optionally, at least one of the target sequences is in an ALS gene and the mutation provides herbicide resistance to an ALS inhibitor.
[0114] 50. The method according to any one of embodiments 47 to 49, wherein the genome of the plant, plant part or plant cell produced does not contain any integrated T-DNA sequences.
[0115] 51. The method according to any one of embodiments 47 to 50, further comprising selecting at least one plant cell, plant part or plant that contains at least one mutation in the target sequence(s) and does not contain an integrated T-DNA sequence in its genome.
[0116] 52. The method of embodiment 51, wherein said selecting comprises genotyping.
[0117] 53. The method of any one of embodiments 48 to 52, further comprising selecting a cell, plant part or plant having a selectable trait.
[0118] 54. The method of embodiment 53, wherein the selectable trait is herbicide resistance and selecting is by selecting a cell, plant part or plant that is herbicide resistant; optionally, the target sequence is an ALS gene and selecting is by selecting a cell, plant part or plant that is resistant to an ALS inhibitor.
[0119] 55. The method according to any one of embodiments 48 to 54, wherein at least 40%, optionally at least 55%, preferably at least 65% of the plant cells, plant parts or plants in the population resulting from said method do not contain the T-DNA integrated into their genome and contain a mutation in the second gene.
[0120] 56. The method according to embodiment 47, comprising: a) introducing at least one mutation into a first target sequence that confers a selectable trait in a plant cell, optionally the selectable trait being herbicide resistance; b) introducing at least one mutation into the second target sequence; c) selecting plants, plant parts, plant cells or populations thereof containing the selectable trait, optionally by treatment with a herbicide; Including, wherein the selected plant, plant part, plant cell or population contains or is enriched for a mutation in the second target sequence, and optionally the selected plant, plant part, plant cell or population does not contain a T-DNA integrated into its genome or is enriched for plants, plant parts or plant cells that do not contain a T-DNA integrated into their genome.
[0121] 57. The method of any one of embodiments 47 to 56, further comprising producing at least one plant embryo, plant part or plant from the selected cell, plant part or plant.
[0122] 58. The method of any one of embodiments 47-57, wherein the plant, plant part, or plant cell is banana, coffee, or rice.
[0123] 59. The method of embodiment 58, wherein the plant, plant part or plant cell is of a banana variety selected from the group consisting of: Malayan wild ginger, Ryukyu wild ginger, Burmese blue banana, autopolyploid Malayan wild ginger "Cavendish", and autopolyploid Malayan wild ginger "Gros Michel".
[0124] 60. A plant, plant part, plant cell or population thereof produced by the method according to any one of embodiments 47 to 59.
[0125] 61. The plant, plant part or plant cell population according to embodiment 60, wherein at least 40%, optionally at least 55%, preferably at least 65% of the plant cells, plant parts or plants in the population resulting from said method do not contain the T-DNA integrated into their genome and contain a mutation in a second gene.
[0126] In an alternative aspect that may be combined with any of the embodiments herein, the present invention provides a bacterium capable of introducing a nucleotide sequence into a plant cell, the bacterium comprising: (a) a nucleotide sequence encoding a vir gene, the nucleotide sequence having reduced or disrupted expression and / or activity of VirD5; and (b) a T-DNA sequence encoding at least one DNA editing agent, morphogen, antibiotic resistance genes, phosphite converting enzymes, or an RNAi construct. A preferred phosphite converting enzyme is PtxD. Preferred antibiotic resistance genes are NptII, HptII, Bla, Bar. Preferred morphogens are WUS, BBM, LEAFY COTYLEDON1, LEAFY COTYLEDON2, Lec1. [Brief description of the drawings]
[0127] [Figure 1] From the structure of the virD5 operon: virA and virG activate the Ti plasmid repABC operon and increase plasmid copy number in response to chemical signals released from wounds. (Hongbaek Cho, Stephen C.Winans. Proceedings of the National Academy of Sciences.2005, 102 (41) 14843-14848; DOI: 10.1073 / pnas.0503458102) [Diagram 2] The top left panel shows the nature of the virD5 mutagenic construct with 3' and 5' 500 bp fragments of virD5 sequence flanking a spectinomycin resistance cassette. The bottom left panel shows the primer sequences used to verify the genotype of the EHA105virD5 mutant strain. The right panel is a DNA agarose gel (1%) of PCR fragments obtained from total genomic DNA of Agrobacterium strains EHA105 and EHA105virD5 using oligos 569 and 571, and 569 and 570. [Diagram 3] Banana ECS expressing mcherry fluorescence assessed 10 days after transformation with Agrobacterium strains (AGL1, EHA105, and EHA105virD5) harboring pMol_0630 (mcherry, a cytidine base editor targeting ALS1). [Figure 4] mCherry fluorescence in 2-month-old banana embryos transformed with WT Agrobacterium AGL1 harboring pMol_0630 (mcherry, a cytidine base editor targeting ALS1) and selected with 25ug / L chlorsulfuron (CSF). Magnification 20x, bright field (BF) exposure 10ms, fluorescence exposure 200ms. Highlighted within the box are non-fluorescent embryos. [Diagram 5]mCherry fluorescence in 2-month-old banana embryos transformed with WT Agrobacterium EHA105 harboring pMol_0630 (mcherry, a cytidine base editor targeting ALS1) selected with 25ug / L chlorsulfuron (CSF). Magnification 20x, bright field (BF) exposure 10ms, fluorescence exposure 200ms. Non-fluorescent embryos are shown in the frame. [Figure 6] mCherry fluorescence in 2-month-old banana embryos transformed with Agrobacterium EHA105virD5 harboring pMol_0630 (mcherry, a cytidine base editor targeting ALS1) and selected with 25ug / L chlorsulfuron (CSF). Magnification 20x, bright field (BF) exposure 10ms, fluorescence exposure 200ms. [Figure 7] T-DNA detection in 39 banana plantlets transformed with pMOL_0630; 7 from Agrobacterium strain AGL1, 11 from EHA105, 20 from EHA105virD5, and 1 WT shoot. Low ΔCt values (<25) indicate the presence of T-DNA genes in plant tissues, strongly indicating T-DNA integration (transgenic plant tissues). For each primer set, thresholds (>25 cycles) were set based on the WT control. Data were normalized using housekeeping genes to account for slight DNA concentration differences. High / absent ΔCt values (marked *) indicate the absence of T-DNA in tissues (non-transgenic). [Figure 8] Collation of data on the presence of T-DNA and ALS1 editing in banana plants transformed with Agrobacterium AGL1, EHA105 or EHA105virD5 harboring pMol_0630 (mcherry, a cytidine base editor targeting ALS1) and selected with 25ug / L chlorsulfuron (CSF). [Figure 9]1 is a summary of editing and transduction detected in banana plants transformed with Agrobacterium EHA105 or EHA105virD5 harboring pMol_0926 (a cytidine base editor targeting ALS1 and PPO2) and pMOL_0931 (a cytidine base editor targeting ALS2 and ACO1), all selected with 25ug / L chlorsulfuron (CSF). Of the plants genotyped in Example 4, the percentage of plants found to have the following genotypes: non-transgenic with both ALS and trait gene edited (non-transgenic co-edited); non-transgenic with no trait gene edited (non-transgenic WT); transgenic with ALS and trait gene co-edited (transgenic co-edited); or transgenic but with no trait gene edited (transgenic WT). The trait gene is either ACO1 or PPO2 depending on the construct used to transform each regenerated plant. [Figure 10] Embryos were recovered from banana plants transformed with Agrobacterium EHA105 or EHA105virD5 carrying pMOL_1936, all selected with CSF. Editing of the ALS2 locus was assessed using amplicon Sanger sequencing to detect the presence of HDR donor integration using primers that anneal to the genomic region surrounding ALS2. None of the EHA105 embryos showed evidence of editing of the ALS2 locus, whereas 1 of 16 EHA105virD5 embryos showed evidence of HDR donor integration. [Figure 11]T-DNA detection in banana embryos transformed with EHA105virD5 showing evidence of HDR donor integration compared to T-DNA detection in banana embryos transformed with EHA105. Low ΔCt values (<27) indicate the presence of T-DNA genes in plant tissues, strongly indicative of T-DNA integration (transgenic plant tissues). For each individual primer set, thresholds (>27 cycles) were set based on the WT control. Data were normalized using housekeeping genes to account for slight differences in DNA concentration. High / absent ΔCt values (marked *) indicate the absence of T-DNA in tissues (non-transgenic).
[0128] Sequence List SEQ ID NO: 1 - ACO1 from Malayan wild cabbage (Ma01_g11540.1) SEQ ID NO: 2 - ACO from Malayan wild cabbage (Ma07_g19730.1) SEQ ID NO: 3 - ACS from Malayan wild cabbage (Ma04_g31490.1) SEQ ID NO: 4 - ACS from Malayan wild cabbage (Ma04_g35640.1) SEQ ID NO: 5 - ACS from Malayan wild cabbage (Ma09_g19150.1) SEQ ID NO: 6 - PPO2 from Malayan wild ginger (Ma07_g03540) SEQ ID NO: 7 - F1_D5_F oligonucleotide for amplifying the EHA105 virD5 gene sequence SEQ ID NO: 8 - F1_D5_R oligonucleotide for amplifying the EHA105 virD5 gene sequence SEQ ID NO: 9 - F2_D5_F oligonucleotide for amplifying the spectinomycin resistance cassette SEQ ID NO: 10 - F2_D5_R oligonucleotide for amplifying the spectinomycin resistance cassette SEQ ID NO: 11 - F3_D5_F oligonucleotide for amplifying the EHA105 virD5 gene sequence SEQ ID NO: 12 - F3_D5_R oligonucleotide for amplifying the EHA105 virD5 gene sequence SEQ ID NO: 13 - 569 oligonucleotide for screening for insertion into the virD5 locus SEQ ID NO: 14 - 570 oligonucleotide for screening for insertion into the virD5 locus SEQ ID NO: 15 - 571 oligonucleotide for screening for insertion into the virD5 locus SEQ ID NO: 16 - G0390 oligonucleotide for qPCR of ACTIN SEQ ID NO: 17 - G0391 oligonucleotide for qPCR of ACTIN SEQ ID NO: 18 - G0327 oligonucleotide for qPCR of mCherry SEQ ID NO: 19 - G0328 oligonucleotide for qPCR of mCherry SEQ ID NO: 20 - nCas9 5' G0418 oligonucleotide for qPCR SEQ ID NO: 21 - nCas9 5' G0419 oligonucleotide for qPCR SEQ ID NO: 22 - nCas9 3' G0422 oligonucleotide for qPCR SEQ ID NO: 23 - nCas9 3' G0423 oligonucleotide for qPCR SEQ ID NO: 24 - GO117 oligonucleotide for sequencing ALS1 SEQ ID NO: 25 - GO118 oligonucleotide for sequencing ALS1 SEQ ID NO: 26 - GO163 oligonucleotide for sequencing PPO2 SEQ ID NO: 27 - GO164 oligonucleotide for sequencing PPO2 SEQ ID NO: 28 - 3022 oligonucleotide for sequencing of ACO1 SEQ ID NO: 29 - 1757 oligonucleotide for sequencing ACO1 SEQ ID NOs:30-33 - Exemplary primers for disrupting or reducing activity or expression of VirD5 SEQ ID NO: 34 - GO975 oligonucleotide for sequencing ALS2 SEQ ID NO: 35 - GO976 oligonucleotide for sequencing ALS2 SEQ ID NO: 36 - nCas9 5' G0534 oligonucleotide for qPCR SEQ ID NO: 37 - nCas9 5' G0535 oligonucleotide for qPCR SEQ ID NO: 38 - nCas9 3' G1158 oligonucleotide for qPCR SEQ ID NO: 39 - nCas9 3' G1159 oligonucleotide for qPCR SEQ ID NO: 40 - G0989 oligonucleotide for qPCR of TaU6 SEQ ID NO: 41 - G0990 oligonucleotide for qPCR of TaU6 SEQ ID NO: 42 - G0390 oligonucleotide for qPCR of nptii SEQ ID NO: 43 - G0391 oligonucleotide for qPCR of nptii DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0129] Detailed Description of the Invention The present invention provides a bacterium capable of introducing a nucleotide sequence into a plant cell, the nucleotide sequence comprising: (a) a nucleotide sequence encoding a vir gene, wherein the expression and / or activity of VirD5 is reduced or disrupted; and (b) a T-DNA sequence encoding at least one site-specific DNA editing agent capable of introducing at least one mutation into at least one target sequence in the plant cell.
[0130] Nucleotide sequence encoding the vir gene The bacteria of the invention comprise a nucleotide sequence encoding a vir gene and a T-DNA sequence, allowing the bacteria to transfer the nucleotide sequence to a plant cell. In certain embodiments, the vir gene is encoded by a Vir-helper plasmid, a Ti plasmid or a Ri plasmid, but may alternatively be encoded by a different plasmid or replicon or bacterial chromosome. The vir gene may be present in a pathogenicity region (vir region) of the nucleotide sequence. In certain embodiments, the nucleotide sequence encoding the vir gene also comprises a conserved DNA region known as a repABC gene cassette. The Ti or Ri plasmid described herein may be, for example, a modified version thereof that contains the vir gene from the Ti or Ri plasmid but lacks other features (such as T-DNA) present in the original Ti or Ri plasmid. According to some embodiments, the T-DNA sequence and the nucleotide sequence encoding the vir gene are present on two separate vectors, such as, but not limited to, a T-binary vector and a "vir helper plasmid" of a T-binary system.
[0131] T-DNA sequence The bacterium of the invention also comprises a T-DNA sequence. As used herein, a "T-DNA sequence" is a specific nucleotide sequence that forms the transfer DNA that is transferred to the host plant cell. In certain embodiments, the nucleotide sequence encoding the vir gene also comprises a T-DNA sequence. In certain embodiments, the nucleotide sequence encoding the vir gene does not comprise a T-DNA sequence, and the T-DNA sequence is encoded by an additional plasmid. The additional plasmid may encode one or more additional elements selected from the group consisting of a plant selectable marker, a bacterial selectable marker, a reporter gene, and at least one bacterial origin of replication. The T-DNA sequence may include left and right borders that contain a conserved 25 bp imperfect repeat sequence. It is the sequence between the borders that is introduced during transformation.
[0132] In certain embodiments, the T-DNA sequence also encodes one or more additional elements, including, but not limited to, a selectable marker. Suitable selectable markers include antibiotic resistance genes, phosphite converting enzymes, morphology genes, and RNAi constructs. A preferred phosphite converting enzyme is PtxD. Preferred antibiotic resistance genes are NptII, HptII, Bla, Bar. Preferred morphology genes are WUS, BBM, LEAFY COTYLEDON1, LEAFY COTYLEDON2, Lec1. Examples of antibiotic selection markers that can be used include neomycin phosphotransferase II (nptII) and hygromycin phosphotransferase (hpt). Other marker genes that can be used according to the present teachings include, but are not limited to, gentamicin acetyltransferase (accC3) resistance, bleomycin and phleomycin resistance genes. Further preferred markers include: mutant psbA that confer triazine resistance, particularly G264S and I219V; and mutant enolpyruvylshikimate-3-phosphate synthase (EPSPS) that confer resistance to EPSP synthase inhibitors, particularly the tryptophan 102, alanine 103 and proline 106 mutations.
[0133] In a preferred embodiment, the T-DNA sequence also codes for a marker that allows to identify cells expressing the T-DNA sequence. In a particular embodiment, the marker is a fluorescent protein that has been shown to be particularly effective in the examples, such as mCherry, mTurquoise 2, GFP, such as sfGFP or pH-tdGFP, Gamillus, mNeonGreen, mEYPF, mCitrine, Citrine, or TagRFP. Preferably, the marker is mCherry.
[0134] The nucleotide sequence used in the present invention generally includes a promoter. A promoter is a DNA sequence that can control (start) transcription in a cell. As used herein, the "promoter" used to drive gene expression on T-DNA is plant-expressible, i.e., can induce, confer, activate or enhance expression in plant cells, tissues or organs. This includes promoters of plant origin (e.g., T-DNA gene promoters, development-specific promoters, tissue-specific promoters (e.g., mesophyll-specific promoters), seed-specific promoters, constitutively active promoters (e.g., Ubil, Uepl, or Actl), or organ-specific promoters (e.g., stem-specific promoters, leaf-specific promoters, root-specific promoters, tuber-specific promoters, stolon-specific promoters, tricome-specific promoters, ovule-specific promoters, anther-specific promoters, pollen-specific promoters, pollen tube-specific promoters, sepal-specific promoters, or pistil-specific promoters), as well as promoters of non-plant origin that can direct transcription in plant cells (e.g., promoters of viral or bacterial origin, such as the CaMV35S promoter). The promoter may comprise a constitutive promoter, or the promoter may comprise an inducible promoter. Examples of constitutive promoters are the cauliflower mosaic virus (CaMV) 35S promoter, the nopaline synthase promoter, or the octopine synthase promoter. Examples of tissue-specific or inducible promoters are napin promoter, phaseolin promoter, PTA29 promoter, PTA26 promoter, PTA13 promoter, XVE estradiol-inducible promoter, or ethanol-inducible promoter. Examples of promoters useful in the present invention include, but are not limited to, actin, CANV 35S, CaMV19S, GOS2. A preferred promoter is CsVMV. The promoter may be a Pol3 promoter.The nucleotide sequence of the agent to be expressed may be optimized for plant expression. Examples of such sequence modifications include, but are not limited to, changing the G / C content to more closely resemble that normally found in bananas, and removing codons not normally found in the plant species (called codon optimization). In certain embodiments, a promoter is operably linked to a coding sequence. A promoter "operably linked" to a structural coding sequence can effectively control the expression of the structural coding sequence. Thus, a structural coding sequence is "operably linked" to a promoter in a cell if RNA polymerase is capable of transcribing the coding sequence into RNA. In certain embodiments, multiple promoters are used.
[0135] Additional plasmids In certain embodiments, the nucleotide sequence encoding the vir genes does not comprise a T-DNA cassette, and the T-DNA is encoded by an additional plasmid.
[0136] Systems in which the T-DNA and vir genes are present on separate replicons are called T-DNA binary systems. Additional plasmids are also known as T-DNA binary vectors. Examples of binary vectors are pICSL4723, pBIN19, pBHOl, pBinAR, pGPTV, pCAMBIA, pBIB-HYG, pBecks, pGreen or pPZP (Hajukiewicz, P. et al., Plant Molecular Biology, 25, 989 (1994) and Hellens et al., Trends in Plant Science 5, 446 (2000)).
[0137] In certain embodiments, the additional plasmid encodes one or more additional elements selected from the group consisting of a plant selectable marker, a bacterial selectable marker, a reporter gene, and at least one bacterial origin of replication.
[0138] A suitable plant selectable marker is an antibiotic selection marker. Examples of antibiotic selection markers that can be used are neomycin phosphotransferase II (nptII) and hygromycin phosphotransferase (hpt). Further marker genes that can be used include gentamicin acetyltransferase (accC3) resistance, bleomycin and phleomycin resistance genes. Further preferred markers include: mutant psbA that confers triazine resistance, in particular G264S and I219V; and mutant enolpyruvylshikimate-3-phosphate synthase (EPSPS) that confers resistance to EPSP synthase inhibitors, in particular tryptophan 102, alanine 103 and proline 106 mutations. Plant selectable markers can be fluorescent proteins, such as GFP, such as mCherry, mTurquoise 2, sfGFP or pH-tdGFP, Gamillus, mNeonGreen, mEYPF, mCitrine, Citrine, or TagRFP.
[0139] The bacterial selectable marker ensures that bacteria containing the additional plasmid are selected and that plants are transformed only with bacteria carrying the additional plasmid (and therefore the T-DNA). Suitable markers include antibiotic selection markers. Examples of antibiotic selection markers include resistance to one or more of ampicillin, carbenicillin, chloramphenicol, gentamicin, G418, kanamycin, nalidixic acid, novobiocin, rifampicin, spectinomycin, streptomycin, tetracycline, trimethoprim, and zeocin. In a particular embodiment, the selectable marker is spectinomycin resistance.
[0140] Reducing or disrupting VirD5 expression and / or activity The expression and / or activity of VirD5 encoded by the nucleotide sequence encoding the vir gene of the bacterium of the present invention, preferably a vir helper plasmid, is reduced or destroyed. In a particular embodiment, the expression and / or activity of VirD5 encoded by the nucleotide sequence encoding the vir gene is reduced. As used herein, the term "reduced" in the context of the expression of VirD5 may refer to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or complete reduction in the expression of VirD5. As used herein, the term "reduced" in the context of the activity of VirD5 may refer to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or complete reduction in the activity of VirD5. In a preferred embodiment, the expression and / or activity of VirD5 encoded by the nucleotide sequence encoding the vir gene is destroyed.
[0141] In certain embodiments, the reduction or destruction of the expression and / or activity of VirD5 encoded by the nucleotide sequence encoding the vir gene is mediated by at least one mutation in the sequence encoding VirD5. The at least one mutation in the sequence encoding VirD5 may be selected from the group consisting of: (a) at least one nucleotide insertion; (b) at least one nucleotide deletion; (c) an insertion-deletion (indel); (d) an inversion; (e) at least one nucleotide substitution; and (f) any combination of (a)-(e); optionally, the insertion or deletion is a frameshift insertion or a frameshift deletion. In certain embodiments, the at least one mutation in the sequence encoding VirD5 is at least one nonsense or missense nucleotide substitution. In certain embodiments, the at least one mutation in the sequence encoding VirD5 is at least one nucleotide substitution that introduces a substitution in the encoded amino acid sequence that reduces or destroys the activity. In certain embodiments, the at least one mutation in the sequence encoding VirD5 is an insertion, and the inserted sequence encodes a selectable marker. The selectable marker can help select bacteria that have the selectable marker inserted into the VirD5 sequence. Suitable markers include antibiotic selectable markers. Examples of antibiotic selectable markers include resistance to one or more of ampicillin, carbenicillin, chloramphenicol, gentamicin, G418, kanamycin, nalidixic acid, novobiocin, rifampicin, spectinomycin, streptomycin, tetracycline, trimethoprim and zeocin. In certain embodiments, the selectable marker is spectinomycin resistance.
[0142] In certain embodiments, the mutation that reduces or disrupts VirD5 expression or activity is in an endogenous VirD5 gene and the bacterium does not contain an exogenously provided VirD5 or a sequence encoding an exogenously provided VirD5. As used herein, the term "endogenous" means native to the genome of the bacterium.
[0143] In certain embodiments, the reduction or destruction of the expression of VirD5 encoded by the nucleotide sequence encoding the vir gene is mediated by the expression of silencing RNA targeting VirD5.As used herein, "silencing RNA" refers to any RNA molecule that has the ability to reduce or destroy the expression of VirD5 encoded by the nucleotide sequence encoding the vir gene.As used herein, "silencing RNA" includes, but is not limited to, non-coding RNA such as small interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), Piwi-interacting RNA (piRNA), phased small interfering RNA (phasiRNA), trans-acting siRNA (tasiRNA), transfer RNA (tRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), long non-coding RNA (lncRNA), ribosomal RNA (rRNA), repeat-derived RNA, autonomous transposable RNA, non-autonomous transposable RNA, and antisense RNA.
[0144] In a specific embodiment, disruption or reduction of VirD5 activity or expression is achieved by introducing mutations using the following primers: Forward 1 GCCTTTCACATTGGAATCAT (SEQ ID NO: 30) Reverse 1 ATGGGAAGACCTCGTTGTCA (SEQ ID NO: 31) Forward 2 AAGGTCGTCCACGATACTTT (SEQ ID NO: 32) Reverse 2 GGCACTGCTGTCAAGAAATC (SEQ ID NO: 33)
[0145] In certain embodiments, an in-frame deletion of VirD5 is used. Such a deletion can be generated by obtaining upstream and downstream fragments using primers with complementary sequences and generating a single fragment that substantially or completely deletes VirD5. This single fragment can be introduced into cells by electroporation or the like.
[0146] In certain embodiments, VirD5 is deleted in its entirety.
[0147] DNA editing agents The bacterium of the present invention comprises a T-DNA sequence encoding at least one site-specific DNA editing agent capable of introducing at least one mutation into at least one target sequence in a plant cell.
[0148] In certain embodiments, the site-specific DNA editing agent comprises an endonuclease selected from the group consisting of a meganuclease, a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), a homing endonuclease, a CRISPR-associated endonuclease, and a modified CRISPR-associated endonuclease.
[0149] In certain embodiments, the site-specific DNA editing agent comprises a CRISPR-associated endonuclease or a modified CRISPR-associated endonuclease, and the T-DNA sequence also encodes one or more guide RNAs specific to at least one target sequence in the plant cell. In certain embodiments, the site-specific DNA editing agent comprises a CRISPR-associated endonuclease or a modified CRISPR-associated endonuclease selected from the group consisting of: base editor, prime editor, Cas9 endonuclease, or SpCas9, xCas9, SpCas9-NG, SaCas9, AsCpf1, LbCpf1, CjCas9, NmCas9, StCas9, TdCas9, eSpCas9, HypaCas9, Cas9-SpRY / SpG, Cas4-Cas1-Cas2 complex, and MAD7.
[0150] Endonucleases are enzymes that cleave phosphodiester bonds in polynucleotide chains, including restriction endonucleases, which cleave DNA at specific sites without damaging bases. Restriction endonucleases include type I, type II, type III, and type IV endonucleases, with further subtypes. In type I and type III systems, both methylase and restriction enzyme activities are contained in a single complex. Endonucleases also include meganucleases, also known as homing endonucleases (HEases), which bind and cleave specific recognition sites, similar to restriction endonucleases. Endonucleases allow for precise genetic engineering of eukaryotic genomes, such as plant genomes. In some embodiments, endonucleases are inactivated and catalytically dead, such as dCas9, as discussed further below.
[0151] As used herein, "meganucleases" are generally classified into four families: the LAGLIDADG family, the GIY-YIG family, the His-Cys box family, and the HNH family. These families are characterized by structural motifs that affect catalytic activity and recognition sequences. For example, members of the LAGLIDADG family are characterized by one or two conserved LAGLIDADG motifs. The four families of meganucleases differ significantly from each other in terms of conserved structural elements and thus DNA recognition sequence specificity and catalytic activity. Meganucleases are commonly found in microbial species and have the unique property of having very long recognition sequences (>14 bp), which makes them naturally highly specific for cleavage at desired positions. This property can be used to perform site-specific double-strand breaks in genome editing. Those skilled in the art can use such naturally occurring meganucleases, but the number of such naturally occurring meganucleases is limited. To overcome this challenge, mutants of meganucleases that recognize unique sequences have been created using mutagenesis and high-throughput screening methods. For example, various meganucleases have been fused to generate hybrid enzymes that recognize new sequences. Alternatively, the DNA-interacting amino acids of meganucleases can be altered to design sequence-specific meganucleases (see, for example, U.S. Pat. No. 8,021,867). Meganucleases can be designed using methods described, for example, in Certo, MT et al., Nature Methods (2012) 9:073-975; U.S. Pat. Nos. 8,304,222; 8,021,867; 8,119,381; 8,124,369; 8,129,134; 8,133,697; 8,143,015; 8,143,016; 8,148,098; or 8,163,514. Alternatively, meganucleases with site-specific cleavage properties can be produced using commercially available technologies, such as the Directed Nuclease Editor from Precision Biosciences. TM It can be obtained using genome editing technology.
[0152] As used herein, "zinc finger nucleases" (or "ZFNs") and "transcription activator-like effector nucleases" (or "TALENs") have proven effective in generating targeted double-strand breaks (see Christian M, Cermak T, Doyle EL, et al. Targeting DNA double-strand breaks with TAL effector nucleases. Genetics. 2010;186(2):757-761. doi:10.1534 / genetics.110.120717). ZFN and TALEN restriction enzyme technologies utilize non-specific DNA cleavage enzymes bound to specific DNA binding domains (either a series of zinc finger domains or TALE repeats, respectively). Typically, a restriction enzyme is selected in which the DNA recognition site and the cleavage site are separated from each other. The cleavage site is separated and then ligated to the DNA binding domain, thereby resulting in an endonuclease with very high specificity for the desired sequence. A representative restriction enzyme with such properties is FokI. Additionally, FokI has the advantage that it requires dimerization to have nuclease activity, meaning that each nuclease partner recognizes a unique DNA sequence, thus increasing specificity. To enhance this effect, FokI nucleases have been engineered to function only as heterodimers, increasing catalytic activity. Such nucleases avoid the possibility of unwanted homodimer activity and increase the specificity of double-stranded breaks. Thus, to target specific sites, ZFNs and TALENs are constructed as pairs of nucleases, with each member of the pair designed to bind adjacent sequences at the target site. When transiently expressed in cells, the nucleases bind to the target site and the FokI domains heterodimerize to create double-stranded breaks. Repair of these double-stranded breaks via the non-homologous end joining (NHEJ) pathway often results in small deletions or insertions of small sequences. Because each NHEJ repair is unique, the use of a single nuclease pair results in a series of alleles with various deletions at the target site.Deletions typically range in length from a few base pairs to a few hundred base pairs, but larger deletions have been successfully created in cell culture by using two pairs of nucleases simultaneously (Carlson DF, Fahrenkrug SC, Hackett PB. Targeting DNA With Fingers and TALENs. Mol Ther Nucleic Acids. 2012;1(1):e3. Published 2012 Jan 24. doi:10.1038 / mtna.2011.5). Furthermore, when a DNA fragment with homology to the target region is introduced together with a nuclease pair, double-strand breaks or double-strand breaks can be repaired via homologous recombination (HR) to generate specific modifications (Urnov, F., Miller, J., Lee, Y. et al., Designed zinc-finger nucleases using Highly efficient endogenous human gene correction. Nature 435, 646-651 (2005). https: / / doi.org / 10.1038 / nature03556). Although the nuclease moieties of ZFNs and TALENs have similar properties, the difference between these artificial nucleases lies in the DNA recognition peptide. ZFNs rely on Cys2-His2 zinc fingers, whereas TALENs rely on TALEs. Both of these DNA recognition peptide domains have the characteristic of being combinations that naturally occur in proteins. Cys2-His2 zinc fingers are usually found in repeats spaced 3 bp apart and exist in diverse combinations in various nucleic acid interacting proteins. On the other hand, TALEs are found in a 1:1 repeat pattern with the recognition ratio of amino acids to the recognized nucleotide pairs. Because both zinc fingers and TALEs exist in a repeating pattern, a wide variety of sequence specificities can be created by trying various combinations.Approaches to making site-specific zinc finger endonucleases include, for example, modular assembly (where zinc fingers correlating with a triplex sequence are attached in a line to cover the required sequence), OPEN (low stringency selection of peptide domains versus triplex nucleotides in a bacterial system followed by high stringency selection of peptide combinations versus the final target), bacterial one-hybrid screening of zinc finger libraries, etc. ZFNs can also be designed and obtained commercially, for example from Sangamo Biosciences® (Richmond, Calif.). Methods for designing and obtaining TALENs are described in Reyon et al., Nature Biotechnology (2012) 30(5):460-465; Miller et al., Nature Biotechnology (2011) 29: 143-148; Cermak et al., Nucleic Acids Research (2011) 39(12): e82, and Zhang et al., Nature Biotechnology (2011) 29(2):149-153. A recently developed web-based program named "Mojo Hand" was introduced by Mayo Clinic to design TAL and TALEN constructs for genome editing applications (accessible at www.talendesign.org).
[0153] As used herein, a "homing endonuclease" is a double-stranded DNase with a large asymmetric recognition site (12-40 base pairs (bp)) and a coding sequence that is usually incorporated into either an intron or an intein (Belfort, M. and Roberts, RJ (1997) Nucleic Acids Research, 25, 3379-3388). Introns are spliced out of precursor RNA, whereas inteins are spliced out of precursor proteins (Dujon, B. et al. (1989) Gene, 82, 115-118; Perler, FB et al. (1994) Nucleic Acids Research, 22, 1125-1127). Homing endonucleases are named using a convention similar to that of restriction endonucleases, including the prefix "I-" for intron-encoded endonucleases and "PI-" for intein endonucleases (Belfort, M. and Roberts, RJ (1997) Nucleic Acids Research, 25, 3379-3388; Roberts, RJ et al. (2003) Nucleic Acids Research, 31, 1805-1812). Homing endonuclease recognition sites are rare; for example, an 18 base pair (bp) recognition sequence has a 7 x 10 10 occurs only once in a random sequence of base pairs. However, unlike restriction endonucleases, homing endonucleases tolerate a certain degree of sequence degeneracy within their recognition sequences (Gimble, FS and Wang, J. (1996) Journal of Molecular Biology, 263, 163-180; Argast, MG et al., (1998) Journal of Molecular Biology, 280, 345-353). That is, a single base change does not abolish cleavage, but reduces its efficiency to various degrees. As a result, the observed sequence specificity is usually in the range of 10-12 base pairs.
[0154] As used herein, "CRISPR-associated endonuclease" (or "Cas") refers to an endonuclease with RNA-guided polynucleotide editing activity, and is one of the components of the CRISPR / Cas system for genome editing, which uses at least one additional component, the "guide RNA" (gRNA). In some embodiments of the present invention, the "CRISPR-associated endonuclease" is a "Cas9 endonuclease" (or "Cas9"). According to some embodiments, the "CRISPR-associated endonuclease" may be any Cas9 known in the art, such as, but not limited to, SpCas9, SaCas9, FnCas9, NmCas9, St1Cas9, BlatCas9 (Shota Nakade, Takashi Yamamoto & Tetsushi Sakuma (2017), Cas9, Cpf1 and C2c1 / 2 / 3-What's next?, Bioengineered, 8:3, 265-273, and references therein). In other embodiments, the "CRISPR-associated endonuclease" may be, but is not limited to, Cpf1, such as AsCpf1 or LbCpf1 (Shota Nakade, Takashi Yamamoto & Tetsushi Sakuma (2017), Cas9, Cpf1 and C2c1 / 2 / 3-What's next?, Bioengineered, 8:3, 265-273, and references therein).
[0155] As used herein, "modified CRISPR-associated endonuclease" (or "modified Cas") refers to a Cas whose catalytic domain has been modified and / or fused to additional domains. According to some embodiments, "modified Cas" refers to a Cas that contains an inactive catalytic domain (dead Cas, or dCas) and does not have nuclease activity, but can bind to DNA based on gRNA specificity. According to some embodiments, "modified Cas" refers to a Cas that has nickase activity ("nCas9"), thus inducing a single-strand break. In some embodiments, the modified CRISPR-associated endonuclease is a "modified Cas9 endonuclease", possibly a catalytically inactive Cas9 (or "dCas9") or a nickase Cas9 ("nCas9"). dCas can be utilized as a platform for DNA transcription regulators to activate or repress gene expression by fusing the inactive enzyme to known regulatory domains. For example, dCas alone can be bound to a target sequence in genomic DNA to inhibit gene transcription. There are many publicly available tools to help select and / or design target sequences, such as Target Finder from Feng Zhang lab, Target Finder “E-CRISP” from Michael Boutros lab, RGEN Tools: “Cas-OFFinder”, CasFinder: a flexible algorithm for identifying specific Cas9 targets in genomes and CRISPR Optimal Target Finder, as well as a list of unique gRNAs bioinformatically determined for different genes in different species.
[0156] Engineering Cas enzymes containing a single inactive RuvC- or HNH-catalyst domain Versions of Cas nickases are called "nickases". With only one active nuclease domain, Cas nickases cleave only one strand of the target DNA, creating a single-strand break or "nick". Single-strand breaks or nicks are usually repaired by single-strand break repair mechanisms involving proteins such as, but not limited to, PARP (sensor) and the XRCCl / LIG III complex (ligation). If single-strand breaks (SSBs) are created by topoisomerase I poisons or drugs that trap PARP1 on naturally occurring SSBs, these may persist and become single-strand breaks DSBs that can only be repaired by HR when cells enter S phase and a replication fork encounters such an SSB. However, two adjacent opposite strand nicks introduced by Cas nickases are often treated as double-strand breaks, often referred to as "double-nick" CRISPR systems. Double nicks, which are essentially non-parallel DSBs, can be repaired by HR or NHEJ like any other DSB, depending on the desired effect on the gene target, the presence of the donor sequence, and the stage of the cell cycle (HR is very low in abundance and can only occur in the S and G2 stages of the cell cycle). Therefore, if specificity and reduced off-target effects are important, creating a double nick using Cas nickases by designing two gRNAs whose target sequences are in close proximity and on opposite strands of the genomic DNA can reduce off-target effects, since such an event is not impossible, but it creates a nick that cannot be altered by either gRNA alone.
[0157] In certain embodiments, the modified CRISPR-associated endonuclease is a base editor or a prime editor.
[0158] In certain embodiments, the site-specific DNA editing agent comprises a base editing agent, and the T-DNA sequence also encodes one or more guide RNAs specific to the target sequence(s). Base editing is a genome editing approach that uses components of the CRISPR system together with other enzymes to directly introduce point mutations into cellular DNA or RNA without generating double-stranded DNA breaks. In particular, modified Cas, such as dCas9 or nCas9, can be used together with other enzymes (generally as fusion proteins) for base editing. DNA base editors comprise a non-catalytic nuclease fused with a nucleobase deaminase enzyme and, in some cases, a DNA glycosylase inhibitor. RNA base editors use RNA-targeting components to achieve similar changes. Base editors directly convert one base or base pair to another, allowing efficient placement of point mutations in non-dividing cells without generating excessive undesired editing by-products (Rees and Liu (2018), "Base Editing: Precision Chemistry on the Genome and Transcriptome of Living Cells", Nature Reviews Genetics, 19(12):770-788). In certain embodiments, the base editor is a fusion polypeptide comprising a modified CRISPR-associated endonuclease and a deaminase moiety. In preferred embodiments, the modified CRISPR-associated endonuclease is nCas9 or dCas9, and the deaminase moiety is a cytidine deaminase moiety or an adenine deaminase moiety. In some embodiments, the base editor may optionally comprise a DNA glycosylase inhibitor. A preferred base editor is a fusion comprising nCas9(D10A), a cytidine deaminase APOBEC and a uracil glycosylase inhibitor. Exemplary suitable base editors are provided in Zong et al., Nat Biotechnol. 2017, 35(5):438-440).In certain embodiments, the base editor has both adenine and cytidine deaminase activity and is a dual deaminase base editor (Grunewald et al., 2020, Nature Biotechnology, 38:861-864). Contemplated base editors include APOBEC, BE1, BE2, BE3, HF-BE3, BE4, BE4max, BE4-GAM, YE1-BE3, EE-BE3, YE-BE3, YEE-BE3, VQR-BE3, VRER-BE3, Sa-BE3, Sa-BE4, SaBE4-Gam, SaKKH-BE3, Cas12a-BE, Target-AID, Target-AID-NG, xBE3, eA3A-BE3, A3A-BE3, BE-PLUS, TAM, CRISPR-X, ABE7.9, ABE7.10, ABE7.10*, xABE, ABESa, VQR-ABE, VRER-ABE, and SaKKH-ABE (Rees and Liu (2018), "Base Editing: Precision Chemistry on the Genome and Transcriptome of Living Cells", Nature Reviews Genetics, 19(12):770-788, and references therein. Additional contemplated base editors include modified Cas12 or Cas13, such as dCas12, dCas13, dCas12a, dCas12b, dCas13a, dCas13b, dCas13c, or dCas13d.
[0159] In certain embodiments, the site-specific DNA editing agent comprises a prime editor, and the T-DNA sequence also encodes one or more guide RNAs that are pegRNAs specific to the target sequence(s). Prime editing is a genome editing approach that can generate targeted insertions, deletions, and point mutations. Prime editing uses Cas9 nickase fused with reverse transcriptase and is programmed with a pegRNA that specifies the target site and the desired edit. In certain embodiments, the prime editor is a fusion polypeptide that includes a modified CRISPR-associated endonuclease, preferably nCas9, and a reverse transcriptase. The prime editor may be selected from the group consisting of PE2, PE2-VQR, PE2-VRQR, PE2-VRER, PE2-NG, PE2-SpG, PE2-SpRY, PE2*, PE3, PE3b, PE3b-CaMV, PE3b-retron, PE4, PE5, and PE+serine recombinase-Bxb1 integrase (Lin et al., Nat Biotechnol 38, 582-585 (2020), Anzalone et al., Nature 576, 149-157 (2019), Chen et al., Cell. 2021, 184(22):5635-5652). Derivatives of these prime editors can also be used.
[0160] Drag-and-drop genome insertion without DNA cleavage using CRISPR-directed integrase Eleonora I. Ioannidi, Matthew TN Yarnall, Cian Schmitt-Ulms, Rohan N. Krajeski, Justin Lim, Lukas Villiger, Wenyuan Zhou, Kaiyi Jiang, Nathaniel Roberts, Liyang Zhang, Christopher A. Vakulskas, John A. Walker II, Anastasia P. Kadina, Adrianna E. Zepeda, Kevin Holden, Jonathan S. Gootenberg, Omar O. Abudayyeh bioRxiv 2021.11.01.466786; doi: https: / / doi.org / 10.1101 / 2021.11.01.466786 Anzalone, AV, Gao, XD, Podracky, CJ et al., Programmable deletion, replacement, integration and inversion of large DNA sequences with twin prime editing. Nat Biotechnol (2021). https: / / doi.org / e10.1038 / s41587-021-01133-w).
[0161] In certain embodiments, the endonuclease is a prime-recombinase fusion.
[0162] In certain embodiments, the site-specific DNA editing agent comprises a CRISPR-associated endonuclease or a modified CRISPR-associated endonuclease, and the T-DNA sequence also encodes one or more guide RNAs specific for the target sequence(s), and at least one donor template capable of introducing at least one mutation via homology-dependent repair (HDR) or non-homologous end joining (NHEJ).
[0163] Preferably, the endonuclease and any guide RNA and donor template are encoded by T-DNA, the T-DNA is transferred to the plant cell, and then the gene editing mechanism is transiently expressed to mediate the introduction of mutation.In certain embodiments, the gene editing mechanism is expressed by the bacterial cell and forms a ribonucleoprotein complex that is delivered to the plant cell.
[0164] In certain embodiments, the T-DNA sequence comprises at least one donor template that can introduce at least one mutation via homology-dependent repair (HDR) or non-homologous end joining (NHEJ).The T-DNA sequence can comprise at least one donor template adjacent to the sequence that can be recognized by guide RNA, also known as guide RNA site or CRISPR-Cas9 site.Preferably, the T-DNA sequence encodes a CRISPR-associated endonuclease or modified CRISPR-associated endonuclease and one or more guide RNAs that are specific to the target sequence and are specific to the guide RNA site adjacent to the donor template, thereby causing donor release upon expression of the T-DNA sequence.
[0165] Collaborative editing The examples show that the bacteria of the present invention are effective in co-editing two or more target sequences simultaneously. This allows for the effective generation of plants with two or more specific mutations. Furthermore, bacteria capable of introducing mutations into two or more target sequences allow for highly efficient selection of gene-edited non-transgenic plants, since plants edited in the first target sequence are more likely to also be edited in the second sequence. For example, if one mutation introduces a selectable trait, this can be used to select plants enriched for the second mutation.
[0166] In certain embodiments, the T-DNA sequence encodes: (a) at least one CRISPR-associated endonuclease or modified CRISPR-associated endonuclease, (b) a first guide RNA specific for a first target sequence, and (c) a second guide RNA specific for a second target sequence, where the at least one endonuclease is capable of introducing at least one mutation into the first target sequence and is capable of introducing at least one mutation into the second target sequence.
[0167] In certain embodiments, the at least one modified CRISPR-associated endonuclease is one or more base editors capable of introducing at least one mutation into a first target sequence and capable of introducing at least one mutation into a second target sequence.
[0168] In certain embodiments, the T-DNA sequence encodes: (a) at least one CRISPR-associated endonuclease or modified CRISPR-associated endonuclease, (b) a first guide RNA specific for a first target sequence, and (c) at least one additional guide RNA specific for at least one additional target sequence other than the first target sequence, where the at least one endonuclease is capable of introducing at least one mutation into the first target sequence and is capable of introducing at least one mutation into the at least one additional target sequence.
[0169] In certain embodiments, the at least one modified CRISPR-associated endonuclease is one or more base editors that can introduce at least one mutation into the first target sequence and can introduce at least one mutation into at least one additional target sequence. According to certain embodiments, the same base editor can introduce at least one mutation into the first target sequence and can introduce at least one mutation into at least one additional target sequence via a guide RNA sequence that is specifically directed to the first target sequence and the at least one additional target sequence.
[0170] In certain embodiments, (a) the T-DNA sequence also encodes a donor template capable of introducing at least one mutation into a second target sequence via homology dependent repair (HDR) or non-homologous end joining (NHEJ); or (b) the T-DNA sequence also encodes a first donor template capable of introducing at least one mutation into a first target sequence via homology dependent repair (HDR) or non-homologous end joining (NHEJ) and a second donor template capable of introducing at least one mutation into a second target sequence via homology dependent repair (HDR) or non-homologous end joining (NHEJ).
[0171] In certain embodiments, the at least one modified CRISPR-associated endonuclease is one or more prime editors, the first guide RNA is a first pegRNA specific to a first target sequence and capable of introducing at least one mutation into the first target sequence, and the second guide RNA is a second pegRNA specific to a second target sequence and capable of introducing at least one mutation into the second target sequence.
[0172] In certain embodiments, the at least one CRISPR-associated endonuclease or modified CRISPR-associated endonuclease comprises at least two different endonucleases, the first endonuclease can introduce at least one mutation into the first target sequence, and the second endonuclease can introduce at least one mutation into the second target sequence. The first endonuclease may not function to introduce any mutation into the second target sequence, and / or the second endonuclease may not function to introduce any mutation into the first target sequence. The first endonuclease may form a ribonucleoprotein complex with a first guide RNA specific to the first target sequence, and the second endonuclease may form a ribonucleoprotein complex with a second guide RNA specific to the second target sequence. For example, an endonuclease incorporating a specific type of guide RNA may be used. For example, Cas9 uses both crRNA and trRNA to form sgRNA, while Cas12a only requires crRNA. Thus, in certain embodiments, the first endonuclease is Cas9 or modified Cas9, the first guide RNA is sgRNA, the second endonuclease is Cas12a or modified Cas12a, and the second guide RNA is crRNA, or the first endonuclease is Cas12a or modified Cas12a, the first guide RNA is crRNA, the second endonuclease is Cas9 or modified Cas9, and the second guide RNA is sgRNA. Alternatively, or in combination, the first and second endonucleases may recognize different PAM sequences. In such embodiments, the first and second endonucleases may be selected separately from SpCas9, CjCas9, and Cas12a.
[0173] In further embodiments, the first endonuclease may form a ribonucleoprotein complex with an sgRNA specific for a first target sequence and the second endonuclease may be a prime editor that forms a ribonucleoprotein complex with a pegRNA specific for a second target sequence. In further embodiments, the first endonuclease may be a prime editor that forms a ribonucleoprotein complex with a pegRNA specific for a first target sequence and the second endonuclease may form a ribonucleoprotein complex with an sgRNA specific for a second target sequence.
[0174] Thus, in some embodiments, the first and second endonucleases may recognize different PAM sequences. In some embodiments, the first and second endonucleases can both introduce at least one mutation into the first target sequence, and / or both introduce at least one mutation into the second target sequence. The first and second endonucleases may recognize the same PAM sequence. In some embodiments, (i) the first endonuclease is a base editor, the second endonuclease is a prime editor, and the second guide RNA is a pegRNA, or the first endonuclease is a prime editor, the first guide RNA is a pegRNA, and the second endonuclease is a base editor; or (ii) the first endonuclease is a base editor, and the second endonuclease is a CRISPR-associated endonuclease such as Cas9, or the first endonuclease is a CRISPR-associated endonuclease such as Cas9, and the second endonuclease is a base editor. In embodiments employing a CRISPR-associated endonuclease such as Cas9, a donor template is generally used that can introduce at least one mutation via homology-dependent repair (HDR) or non-homologous end joining (NHEJ).
[0175] In a preferred embodiment, the at least one mutation introduced into the first target sequence results in a selectable trait in the plant cell. The selectable trait may be herbicide resistance, and optionally, the at least one mutation comprises at least one mutation in at least one acetolactate synthase (ALS) gene, and the at least one mutation in the ALS gene provides resistance to an ALS inhibitor. Without wishing to be bound by theory or mechanism, the selectable trait allows for the selection of cells, plant parts or plants that are edited in the second target sequence or at least one additional target sequence.
[0176] Guide RNA The T-DNA can optionally encode one or more guide RNAs specific for the target sequence.
[0177] The term "guide RNA" as used herein refers to a polynucleotide that facilitates the specific targeting of a CRISPR-associated endonuclease or modified CRISPR-associated endonuclease to a target sequence, such as a genomic or episomal sequence in a cell. According to some embodiments, the guide RNA may be chimeric / single molecule (comprising a single RNA molecule, also referred to as single guide RNA or sgRNA) or modular (comprising two or more separate RNA molecules, typically a crRNA and a tracrRNA, which may be linked, for example, by duplex formation). According to some embodiments, the guide RNA is an sgRNA, which is an RNA molecule that includes both the tracrRNA and the crRNA (and a linking loop). The sgRNA contains a nucleotide sequence that encodes the target homologous sequence (crRNA) and an endogenous bacterial RNA that links the crRNA to the Cas nuclease (tracrRNA) in a single chimeric transcript. This region of the crRNA, known as the variable region, confers the cleavage specificity of the associated endonuclease and is usually 20 nucleotides long. The guide RNA / Cas complex is recruited to the target sequence by base pairing between the gRNA sequence and complementary genomic DNA. For successful binding of some Cas molecules, such as Cas9, the genomic target sequence must contain the correct PAM (Protospacer Adjacent Motif) sequence immediately following the target sequence. Binding of the guide RNA / Cas complex localizes Cas to the genomic target sequence. Wild-type Cas9 cleaves both strands of DNA, causing a double-stranded or double-stranded break. Mutants of Cas9, such as nickases, cleave only a single strand. Guide sequences for base editors (nickases, or catalytically dead Cas9 fused to a deaminase) target the deaminase to a specific region of the genome where specific nucleotides are edited in an activity window within the sgRNA sequence. Similar to ZFNs and TALENs, double-stranded breaks produced by CRISPR / Cas can be repaired by HR (homologous recombination) or NHEJ (non-homologous end joining) and are susceptible to specific sequence modifications during DNA repair. Cas nucleases have two functional domains: RuvC and HNH, each of which cleaves a different DNA strand.When both of these domains are activated, Cas induces double-stranded breaks in genomic DNA. A major advantage of CRISPR / Cas is the high efficiency of the system and the ease with which synthetic guide RNAs can be generated. This creates a system that can be easily modified to target different genomic sites and / or target different modifications at the same site. Furthermore, protocols have been established that allow for the simultaneous targeting of multiple genes. The majority of cells carrying mutations have biallelic mutations in the target genes. However, there is an apparent flexibility in the base-pairing interactions between the guide RNA sequence and the genomic DNA target sequence, allowing imperfect matches to the target sequence to be cut by Cas.
[0178] According to some embodiments, the guide RNA is a prime editing RNA (pegRNA). The pegRNA can identify the target site and provide new genetic information for replacing the target DNA nucleotide. The pegRNA can include an extended sgRNA sequence containing the desired edit, a primer binding site, and a reverse transcriptase template sequence. During genome editing, the primer binding site hybridizes the 3' end of the nicked DNA strand to the pegRNA, and the reverse transcriptase template serves as a template for the synthesis of the edited genetic information.
[0179] In certain embodiments, the sequence encoding one or more guide RNAs specific to at least one target sequence in plant cells can be operably linked to Pol3 promoter.Examples of Pol3 promoters include but are not limited to AtU6-29, AtU626, AtU3B, AtU3d, and TaU6.
[0180] Donor Template As used herein, the term "donor oligonucleotide" or "donor template" refers to an exogenous nucleotide, i.e., a nucleotide introduced from outside into a plant cell to generate a precise change in the genome. The donor oligonucleotide may be synthetic. Preferably, the donor oligonucleotide is encoded by a T-DNA sequence. In certain embodiments, the donor oligonucleotide is an RNA oligonucleotide. In certain embodiments, the donor oligonucleotide is a DNA oligonucleotide. In certain embodiments, the donor oligonucleotide comprises a single-stranded donor oligonucleotide (ssODN), a double-stranded donor oligonucleotide (dsODN), a double-stranded DNA (dsDNA), a double-stranded DNA-RNA duplex (DNA-RNA duplex), a double-stranded DNA-RNA hybrid, a single-stranded DNA-RNA hybrid, a single-stranded DNA (ssDNA), a double-stranded RNA (dsRNA), a single-stranded RNA (ssRNA). In certain embodiments, the donor oligonucleotide is provided in a non-expression vector format or oligo. In certain embodiments, the donor oligonucleotide comprises a DNA donor plasmid (e.g., a circular or linearized plasmid). According to some embodiments, the donor template is encoded as part of a pegRNA that is used with a prime editor (e.g., at least a portion of a primer sequence of the pegRNA), and optionally, the pegRNA is encoded by a T-DNA sequence.
[0181] In some embodiments, the donor template introduces only minimal changes to the target sequence, hi certain embodiments, the donor template includes 1-40, e.g., 5-40, 5-30, 5-20, 3-40, 3-30, 3-20, 5-15, 3-10, 10-30, or 10-20 nucleotide additions, deletions, and substitutions to the target sequence.
[0182] According to some embodiments, the donor template is designed to introduce precise changes into the genome by a homology-dependent repair (HDR) mechanism. Any suitable design for the HDR donor template may be used. In certain embodiments, the donor template comprises homology arms, such as two homology arms of length 10-1000 nucleotides, such as 100-1000, 200-1000, 200-800, 300-800, 300-700, 400-600 nucleotides each. According to some embodiments, the HDR donor template is released from a T-DNA. Guide RNA sites flanking the donor may be encoded on the DNA delivered to the plant cell nucleus to facilitate release of the donor from the T-DNA.
[0183] According to another embodiment, the donor template is designed to introduce precise changes into genome via non-homologous end joining (NHEJ) mechanism. Any suitable design for NHEJ donor template can be used. Since NHEJ donor is inserted into genome at double-strand break site, no homology arm is required. This mechanism requires NHEJ donor to be released from T-DNA, and therefore requires guide RNA site adjacent to donor, encoded on DNA delivered to plant cell nucleus.
[0184] In one embodiment, the template contains a chemical modification, such as a phosphorothioate modification. The modification may prevent ligation of the linear donor and / or enhance its stability. According to one embodiment, the donor oligonucleotide has a length of about 50-5000, about 100-5000, about 250-5000, about 500-5000, about 750-5000, about 1000-5000, about 1500-5000, about 2000-5000, about 2500-5000, about 3000-5000, about 4000-5000, about 5000-5000, about 6000-6000, about 7000-7000, about 8000-8000, about 9000-9000, about 1000-5000, about 1500-5000, about 2000-5000, about 2500-5000, about 3000-5000, about 4000-5000, about 5000-5000, about 5000-5000, about 6000-5000, about 7000-5000, about 8000-5000, about 9000-5000, about 1000-5000, about 1500-5000, about 2000-5000, about 2500-5000, about 3000-5000, about 4000-5000, about 5 ... 0~4000, approx. 100~4000, approx. 250~4000, approx. 500~4000, approx. 750~4000, approx. 1000~4000, approx. 1500~4000, approx. 2000~4000, approx. 2500~4000, approx. 3000~4000, approx. 50~3000, approx. 100~3000, approx. 250~3000, approx. 50~3,000 , about 750-3,000, about 1000-3000, about 1500-3000, about 2000-3000, about 50-2000, about 100-2000, about 250-2000, about 500-2000, about 750-2000, about 1000-2000, about 1500-2000, about 50-1000, about 100-1000, about 250-1 000, about 500-1000, about 750-1000, about 50-750, about 150-750, about 250-750, about 500-750, about 50-500, about 150-500, about 200-500, about 250-500, about 350-500, about 50-250, about 150-250, or about 200-250 nucleotides. According to certain embodiments, the donor oligonucleotide (e.g., ssDNA or ssRNA) comprising ssODN comprises about 200-500 nucleotides. According to further embodiments, the donor oligonucleotide (e.g., ssDNA or ssRNA) comprising ssODN comprises about 300-500 nucleotides or about 400-500 nucleotides. According to certain embodiments, the donor oligonucleotide, including a dsODN (eg, a dsDNA or a dsRNA), comprises about 250 to 5000 nucleotides.
[0185] In certain embodiments, the donor template is between 40 and 200 nucleotides in length, such as between 50 and 180, 60 and 150, 60 and 120, 70 and 120, 70 and 110, 80 and 110, or 80 and 100 nucleotides in length.
[0186] bacteria The bacteria of the present invention can transfer nucleotide sequences to plant cell nuclei. In certain embodiments, this ability can be achieved by transferring virulence genes and T-DNA to bacteria that are otherwise unable to transfer DNA to plants. Alternatively, the bacteria can transfer nucleotide sequences to plants if they naturally contain virulence genes. The bacteria used in the present invention preferably contain a type IV secretion system.
[0187] In certain embodiments, the bacterium is of the genus Agrobacterium, Rhizobium, Ensifera, Allorhizobium, Neorhizobium, or Shinella. These taxa are current as of the filing date. They may be subject to change in the future if the taxa are revised. Homologs of Agrobacterium virulence proteins have been found in several symbiotic plant-associated bacterial species belonging to the genus Rhizobium. For example, Rhizobium etli encodes a complete set of virulence proteins and, when provided with T-DNA, can mediate the transfer and integration of DNA into the host plant cell genome. Preferably, the bacterium is of the genus Agrobacterium. In some embodiments, the bacterium is: Agrobacterium tumefaciens, Agrobacterium fabram str. C58, Agrobacterium genomosp, Agrobacterium sp. S2 / 73, Agrobacterium sp. 13-2099-1-2, Agrobacterium sp. NCPPB925, Agrobacterium rhizogenes, Agrobacterium salinitorensis, Agrobacterium vitis, Agrobacterium arsenijevic, Agrobacterium deltaense, Agrobacterium larimoulei, Rhizobium sp. AB2 / 73, Rhizobium sp. 16-488-2b, Rhizobium sp. 16-488-2a, Rhizobium sp. 16-449-1b, Rhizobium sp. L58 / 93, The bacterium is selected from the group consisting of Rhizobium sp. L245 / 93, Rhizobium sp. E27B / 91, Rhizobium sp. K1 / 93, Rhizobium sp. BK007, Rhizobium tuberculosis, Rhizobium schierniwiscens, Rhizobium lucitanum, Neorhyzobium sp. NCHU2750, Neorhyzobium gallegae, Ensifer sp. YR511, and Ensifer adherens.In some embodiments, the bacteria is selected from the group consisting of: Ensifer adherens, Ensifer adherens OV14, Ensifer alkalisoli, Ensifer aridi, Ensifer glycinis, Ensifer psoraleae, Ensifer sesbaniae, Ensifer shofinae, Ensifer sojae CCBAU 05684, Ensifer sp. 1H6, Ensifer sp.AP48, Ensifer sp. BR816, Ensifer sp. LC11, Ensifer sp. LC13, Ensifer sp. LC14, Ensifer sp. LC163, Ensifer sp. LC384, Ensifer sp. LC499, Ensifer sp. LC54, Ensifer sp. LCM 4579, Ensifer sp. M14, Ensifer sp.MMN_5, Ensifer sp. NM-2, Ensifer sp. OV372, Ensifer sp. Root1252, Ensifer sp. Root127, Ensifer sp. Root1298, Ensifer sp. Root1312, Ensifer sp. Root142, Ensifer sp. Root231, Ensifer sp. Root258, Ensifer sp.Root278, Ensifer sp. Root31, Ensifer sp. Root423, Ensifer sp. Root558, Ensifer sp. Root74, Ensifer sp. Root954, Ensifer sp. T2_8, Ensifer sp. USDA 6670, Ensifer sp. WSM1721, Ensifer sp. YR511, Ensifer sp. ZNC0028.
[0188] In a preferred embodiment, the bacterium is Agrobacterium tumefaciens. The Agrobacterium tumefaciens bacterium may be derived from the Agrobacterium tumefaciens strain EHA105 or the Agrobacterium tumefaciens strain AGL1.
[0189] Target sequence and its mutations The site-specific DNA editing agent is capable of introducing at least one mutation into at least one target sequence in a plant cell.
[0190] As used herein, "mutation" may refer to at least one nucleotide insertion, at least one nucleotide deletion, insertion-deletion (indel), inversion, at least one nucleotide substitution, or any combination of the above. The modification may result in frameshift, missense mutation, loss-of-function mutation, nonsense mutation, or gain-of-function mutation in the target sequence. The agent capable of introducing the desired mutation can be designed according to the type of mutation required using standard techniques.
[0191] In certain embodiments, the guide RNA or pegRNA is specific for at least one target sequence.
[0192] The at least one target sequence may be present within a gene. The at least one target sequence may be at a locus of a gene that encodes a silencing RNA.
[0193] In certain embodiments, at least one target sequence may encode a protein that confers herbicide resistance, confers susceptibility to pests, confers susceptibility to pathogens, or is involved in stress resistance, yield, growth rate, or yield quality.
[0194] The phrase "stress tolerance" as used herein refers to the ability of a plant to withstand biotic or abiotic stress without substantial changes in metabolism, growth, productivity and / or survival. As used herein, "biotic stress" refers to the exposure of a plant, plant cell, etc. to non-living ("abiotic") environmental, physical, or chemical factors that adversely affect the metabolism, growth, development, proliferation, or survival (collectively "growth") of the plant. Abiotic stresses include, for example, water (e.g., flood, drought, or dehydration), anaerobic conditions (e.g., low levels of oxygen or high levels of CO2), abnormal osmotic conditions (e.g., osmotic stress), salinity, or temperature (e.g., heat, cold, freeze, frost), exposure to pollutants (e.g., heavy metal toxicity), anaerobes, nutrient deficiencies (nitrogen deficiency or nitrogen limitation), air pollution, ultraviolet radiation, and the like. The phrase "biotic stress" as used herein refers to the exposure of plants, plant cells, etc., to living ("biological") organisms (including viruses) that adversely affect the metabolism, growth, development, proliferation, yield, or survival (collectively "growth") of the plant. Biotic stress can be caused, for example, by bacteria, viruses, fungi, parasites, beneficial and harmful insects, weeds, and cultivated or native plants. The phrase "yield" or "plant yield" as used herein refers to increased plant growth (growth rate), increased crop growth, increased biomass, and / or increased plant product production (including grains, fruits, seeds, etc.). The term "pest" as used herein refers to organisms that directly or indirectly harm plants. Direct effects include, for example, feeding on plant leaves. Indirect effects include, for example, the transmission of disease agents (e.g., viruses, bacteria, etc.) to plants. In the latter case, the pest acts as a vector for pathogen transmission. According to one embodiment, the pest is an invertebrate organism. Exemplary pests include, but are not limited to, insects, nematodes, snails, slugs, spiders, caterpillars, scorpions, mites, ticks, fungi, etc. Identification of the plant or pathogen target gene to be mutated can be accomplished using any method known in the art, such as routine bioinformatics analysis.
[0195] In certain embodiments, mutation of the target sequence inactivates the gene or reduces its expression or activity.
[0196] Any method known in the art for assessing increased stress tolerance can be used in accordance with the present invention. Exemplary methods of assessing increased stress tolerance include, but are not limited to, reduced expression of PagSAP1 in poplar to increase salt stress tolerance, as described in Yoon, SK., Bae, EK., Lee, H., et al., Trees (2018) 32: 823.), and increased drought tolerance in tomato by reduced expression of SlbZIP38 (Pan Y et al., Genes 2017, 8, 402; doi:10.3390 / genes8120402). Any method known in the art for assessing increased yield can be used in accordance with the present invention. Exemplary methods of assessing increased yield include reduced DST expression in rice, as described in Ar-Rafi Md.Faisal, et al., AJPS> Vol.8 No.9, August 2017 DOI: 10.4236 / ajps.2017.89149; and Wang Y et al., Mol Plant.2009 Jan; 2(1):191-200.doi:10.1093 / mp / ssn088, and the increased yield due to reduced expression of BnFTA in canola. Any method known in the art for evaluating increased growth rate can be used in accordance with the present invention. Exemplary methods for evaluating increased growth rate include, but are not limited to, the enhanced growth and biomass resulting from reduced expression of BIG BROTHER, or GA2-OXIDASE, in Arabidopsis thaliana, as described in Marcelo de Freitas Lima et al., Biotechnology Research and Innovation (2017)1,14---25. Any method known in the art for evaluating increased yield quality can be used in accordance with the present invention.Exemplary methods of assessing increased yield quality include, but are not limited to, reduced expression of OsCKX2 in rice results in more tillers, more grain production, and heavier grains, as described in Yeh S_Y et al., Rice (NY). 2015; 8: 36; and reduced levels of OMT in many plants results in the accumulation of modified lignin, increasing digestibility of materials for commercial purposes, as described in Verma SR and Dwivedi UN, South African Journal of Botany Volume 91, March 2014, Pages 107-125.
[0197] In certain embodiments, the at least one target sequence may encode an RNA or protein involved in a plant trait or a fruit trait, including but not limited to ripening, metabolite levels, starch content, sugar content, etc. In certain embodiments, the at least one target sequence may encode an RNA or protein involved in fruit sweetness, fruit sugar content, fruit flavor, fruit ripening control, water stress tolerance, heat stress tolerance, or salt tolerance.
[0198] In some embodiments, the target sequence encodes a protein involved in fruit ripening, such as a protein involved in the production of ethylene. When the plant is a banana, in some embodiments, the target sequence may encode ACO (1-aminocyclopropane-1-carboxylic acid oxidase) and / or ACS (ACC-synthase). ACO and ACS are involved in the production of ethylene. In certain embodiments, the desired mutation may reduce the expression or activity of ACO and / or ACS, delaying the ripening of banana fruits. In preferred embodiments, the desired mutation introduces a stop codon into the sequence encoding ACO or ACS or both. In preferred embodiments, the target sequence is ACO1 (e.g., SEQ ID NO:1, or a sequence having at least 90, 95, 98, or 99% sequence identity to SEQ ID NO:1). In certain embodiments, the target is ACO, and the target sequence is selected from SEQ ID NO:1 and SEQ ID NO:2, or a sequence having at least 90, 95, 98, or 99% sequence identity to SEQ ID NO:1 or SEQ ID NO:2. In certain embodiments, the target sequence is an ACS, and the target sequence is selected from SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:5, or a sequence having at least 90, 95, 98, or 99% sequence identity to SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:5. Exemplary target sequences are also provided in WO 2018 / 220581.
[0199] In certain embodiments, the target sequence encodes a protein involved in fruit browning. When the plant is a banana, in some embodiments, the target sequence may encode PPO (polyphenol oxidase). PPO is an enzyme believed to be involved in banana browning. In a preferred embodiment, the target sequence is PPO2 (e.g., SEQ ID NO:6, or a sequence having at least 90, 95, 98, or 99% sequence identity to SEQ ID NO:6). Exemplary target sequences are also provided in WO 2018 / 220581. In certain embodiments, the desired mutation may reduce the expression or activity of PPO and delay the ripening of banana fruits. In a preferred embodiment, the desired mutation introduces a stop codon into the sequence encoding PPO.
[0200] Optionally, multiple sequences can be targeted for mutation (e.g., any combination of ACO, ACS and PPO genes can be targeted simultaneously), and for each sequence target, one or more mutations can be introduced. The present invention can be used to mutate a large number of different genes to achieve a variety of effects. The present invention is particularly useful for regulating endogenous genes to provide improved traits and protect organisms from different biotic and abiotic stresses, such as cancer, viruses, insects, fungi, nematodes, heat, drought, starvation, etc. Preferably, the desired mutation reduces the expression of the gene or the activity of the expressed protein. Preferably, the mutation is the introduction of a stop codon.
[0201] In certain embodiments, the at least one mutation in the at least one target sequence in the plant cell comprises at least one mutation that confers a selectable trait in the plant cell, optionally, the selectable trait is herbicide tolerance.
[0202] In some embodiments, the at least one mutation in the at least one target sequence in the plant cell comprises at least one mutation that results in a selectable trait in the plant cell. As used herein, a "selectable trait" refers to a trait that can be selected, for example, when the plant is exposed to a particular compound, or when the plant is exposed to a particular environment, or when there is a physical characteristic of editing in the plant that can be observed. Such selection can identify plants that have the desired mutation. Preferably, the selectable trait allows for transient selection, i.e., selection can only occur when a particular temporary condition exists, such as when the plant is exposed to a particular compound. In a preferred embodiment, the selectable trait is herbicide resistance. Examples of other selectable traits include antibiotic resistance and phosphite selection. In certain embodiments, the "selectable trait" is a phenotypic outcome that can serve as a marker for transformation, for example, by visual selection. For example, transient PDS gene editing creates selectable albino plants.
[0203] In certain embodiments, the target sequence is an acetolactate synthase (ALS) gene. At least one mutation in the ALS gene can provide resistance to an ALS inhibitor. The ALS gene can be the banana acetolactate synthase 1 (ALS1) gene or the acetolactate synthase 2 (ALS2) gene, where the plant cell is a banana cell. At least one mutation in the ALS gene can be a substitution that introduces a substitution into the encoded amino acid sequence, preferably at Pro-187 in banana ALS1 or Pro-181 in ALS2, most preferably at Pro187Ser in ALS1 or Pro181Ser in ALS2. In certain embodiments, the ALS inhibitor is a sulfonylurea, imidazolinone, triazolopyrimidine, pyrimidinyloxybenzoate, or sulfonylaminocarbonyltriazolinone, preferably the ALS inhibitor is chlorsulfuron. Other examples of ALS inhibitors include a pyrimidinylthiobenzoate, a sulfonylaminocarbonyltriazolinone, and a sulfonylurea. Preferred imidazolinones include imazamethabenz-methyl, imazamox, imazapic, imazapyr, imazaquin, and imazethapyr. Preferred pyrimidinylthiobenzoates include bispyribac-sodium and pyrithiobac-sodium. Preferred sulfonylaminocarbonyltriazolinones include flucarbazone-sodium and propoxycarbazone-sodium.Preferred sulfonylureas include bensulfuron-methyl, chlorimuron-ethyl, chlorsulfuron, foramsulfuron, halosulfuron-methyl, mesosulfuron-methyl, metsulfuron-methyl, nicosulfuron, primisulfuron-methyl, prosulfuron, and the like. Prosulfuron, rimsulfuron, sulfometuron-methyl, sulfosulfuron, thifensulfuron-methyl, triasulfuron, tribenuron-methyl, trifloxysulfuron-sodium and triflusulfuron-methyl. Preferred triazolopyrimidines include cloransulam-methyl, diclosulam, florasulam, flumetsulam, penoxsulam, and pyroxsulam. The introduced ALS mutation(s) can provide resistance to any one or more ALS inhibitors. For example, a single mutation can confer resistance to multiple inhibitors, and multiple mutations can confer resistance to different inhibitors.
[0204] plant In some embodiments, the plant cell is banana, coffee, or rice.
[0205] In a preferred embodiment, the plant cell is a banana. As used herein, the term "banana" refers to plants of the Musa genus, including Plantago major. These include Musa acuminata (e.g., Musa acuminata banksia, Musa acuminata Calcutta, and Musa acuminata DH-Pahang), Ryukyu musca, Burmese blue banana, and autopolyploid Musa acuminata "Cavendish" and "Gros Michel". According to a particular embodiment, the banana is an autotriploid Musa acuminata "Cavendish". According to a particular embodiment, the banana is the Grand Nain variety of Musa acuminata "Cavendish", preferably GN236. Cultivated bananas are sterile autotriploids (AAA) derived from the progenitor species, Rhamnus moniliforme (genome AA). Additionally, Plantago major (AAB or ABB) is a sterile interspecific allotriploid derived from a hybrid between Rhamnus moniliforme (AA) and Rhamnus moniliforme (genome BB). The triploid nature of cultivated bananas and Plantago major renders them unable to produce viable seeds, whereas wild species are diploid and can produce viable seeds. In certain embodiments, the banana plant is triploid. Other polyploids, including diploids and tetraploids, are also contemplated.
[0206] In certain embodiments, the plant cell is from coffee.As used herein, the term "coffee" refers to plants of the genus Coffea.These include Coffea arabica, Coffea canephora, Coffea liberica, Coffea charrieriana and Coffea eugenioides.
[0207] In certain embodiments, the plant cell is rice. As used herein, the term "rice" refers to plants of the genus Oryza and Zizania. These include Oryza sativa, Oryza glaberrim, Oryza rufipogon, Oryza barthii, and Oryza nivara.
[0208] Plant Cells and Plant Parts Plant cells include cells of meristematic zone, cells of callus tissue, leaf cells, root cells, shoot cells, somatic cells, flower cells, pollen cells, microspores, seed cells, embryonic cells, embryogenic cells, gametophyte cells, sporophyte cells, somatic cells, and combinations of the above. Protoplasts can be derived from any plant tissue. According to some embodiments, the plant cells are cells of suspension cultures, such as embryonic cell suspensions (ECS).
[0209] As used herein, "plant parts" include differentiated and undifferentiated tissues, including but not limited to roots (including tubers), rootstocks, stems, scions, shoots, fruits, leaves, pollen, seeds, tumor tissues, and various forms of cells and cultures (e.g., single cells, protoplasts, embryos, embryogenic cells, embryonic cells, cells of meristematic regions, cells of callus tissue, leaf cells, root cells, shoot cells, somatic cells, floral cells, pollen cells, microspores, protoplasts, and combinations of the foregoing). Plant tissues may be within a plant body or in a plant organ, tissue, or cell culture. In certain embodiments, the "plant part" is a fruit, leaf, root, or plant vasculature (e.g., xylem). Fruits include tissues such as pulp and pericarp. In other embodiments, the "plant part" is a seed. As used herein, the term "seed" refers to the reproductive unit of a flowering plant that can develop into another such plant.
[0210] method The present invention provides a method for producing a plant, a plant part, a plant cell or a population thereof comprising at least one mutation in at least one target sequence, the method comprising contacting a plant, a plant part or a plant cell with a bacterium of the present invention, and optionally further comprising regenerating said cell or plant part to obtain a whole plant. According to a preferred embodiment, the method provides a non-transgenic plant, a plant part, a plant cell or a population thereof comprising at least one mutation in at least one target sequence. According to some embodiments, at least 50%, optionally at least 60%, or 70%, preferably at least 80% of the contacted plant, plant part or plant cell is non-transgenic and comprises at least one mutation in at least one target sequence.
[0211] Preferably, the cells, plants, and plant parts described herein are non-transgenic. According to some embodiments, the methods disclosed herein result in cells, plants, or plant cells that are non-transgenic. In the context of plants and their parts and cells, "transgenic" means having a heterologous polynucleotide in its genome that is introduced by a transformation process. The heterologous polynucleotide may be stably integrated into the genome so that the polynucleotide is passed on to the next generation. The heterologous polynucleotide may be integrated into the genome alone or as part of a recombinant DNA construct. A non-transgenic plant does not contain such a heterologous polynucleotide in its genome. In contrast, the changes made by gene editing as discussed herein are made to endogenous sequences. As used herein, the term "endogenous" means native to the genome of the plant or plant cell and in its native location in the genome. As used herein, a "heterologous" polynucleotide is from a foreign species. In some preferred embodiments, the plant of the present invention does not contain heterologous DNA, especially when the endogenous sequence is gene edited.
[0212] "Contacting" as used herein encompasses transformation, whereby the bacteria introduce a nucleic acid construct into the cells. In a preferred embodiment, a suspension of Agrobacterium cells is mixed with the ECS. The mixture can then be incubated and then the bacterial suspension removed to provide culturable ECS cells. In a particular embodiment, a heat shock treatment is applied (e.g., 45°C for 5 minutes). A method suitable for banana is described, for example, in Shivani and Tiwari, Scientia Horticulturae, 246:675-685). In another embodiment, infiltration of plant leaves is used.
[0213] In a preferred embodiment, the genome of the plant, plant part or plant cell produced does not contain any integrated T-DNA sequence. In some embodiments, the method further comprises selecting at least one plant cell, plant part or plant that contains at least one mutation in the target sequence(s) and does not contain any integrated T-DNA sequence in its genome. The selection may comprise genotyping.
[0214] In certain embodiments, at least one of the mutations in the target sequence confers a selectable trait to the plant cell, plant part, or plant. In certain embodiments, the at least one mutation in the at least one target sequence comprises: (a) at least one mutation in a first target sequence that confers a selectable trait to the plant, plant part, or plant cell; and (b) at least one mutation in a second gene. In some embodiments, the method further comprises selecting the cell, plant part, or plant having the selectable trait. Such embodiments may comprise treating the cell, plant part, or plant with a selective agent. In a preferred embodiment, the selectable trait is herbicide resistance. In said embodiments, the selection is by selecting a cell, plant part, or plant that is herbicide resistant. Such embodiments may comprise treating the cell, plant part, or plant with a herbicide. In a preferred embodiment, the target sequence or the first target sequence is an ALS gene, and optionally, the mutation provides herbicide resistance to an ALS inhibitor. In said embodiments, the selection is by selecting a cell, plant part, or plant that is resistant to an ALS inhibitor.
[0215] In certain embodiments, the ALS inhibitor for use in the method of the present invention is imidazolinone, pyrimidinylthiobenzoate, sulfonylaminocarbonyltriazolinone, sulfonylurea, or triazolopyrimidine.Preferably, the ALS inhibitor is sulfonylurea.Preferred imidazolinones include imazamethabenzmethyl, imazamox, imazapic, imazapyr, imazaquin and imazethapyr.Preferred pyrimidinylthiobenzoate includes bispyribac sodium and pyrithiobac sodium.Preferred sulfonylaminocarbonyltriazolinones include flucarbazone sodium and propoxycarbazone sodium. Preferred sulfonylureas include bensulfuron-methyl, chlorimuron-ethyl, chlorsulfuron, foramsulfuron, halosulfuron-methyl, mesosulfuron-methyl, metsulfuron-methyl, nicosulfuron, primisulfuron-methyl, prosulfuron, rimsulfuron, sulfometuron-methyl, sulfosulfuron, thifensulfuron-methyl, triasulfuron, tribenuron-methyl, trifloxysulfuron-sodium and triflusulfuron-methyl. Preferred triazolopyrimidines include cloransulam-methyl, diclosulam, florasulam, flumetsulam, penoxsulam and pyroxsulam. Most preferably, the ALS inhibitor used in the method of the present invention is chlorsulfuron. The introduced ALS mutation(s) can provide resistance to any one or more ALS inhibitors, for example, a single mutation can provide resistance to multiple inhibitors and multiple mutations can provide resistance to different inhibitors.
[0216] In a preferred embodiment, the method includes treating an embryo, or a population of embryos, such as culturing the embryo on an embryogenesis medium that includes an ALS inhibitor. As used herein, "culturing an embryo," "incubating an embryo," and "treating an embryo" encompass producing an embryo from embryogenesis cells and incubating a developing embryo. In such an embodiment, the embryo is preferably incubated on an embryogenesis medium that includes an ALS inhibitor. This means that the embryogenesis cells are cultured on the embryogenesis medium as they develop into an embryo. In certain embodiments, the embryo is cultured until a fully developed embryo is observed. In certain embodiments, the embryo is cultured on an embryogenesis medium that includes an ALS inhibitor for 8 to 20 weeks, such as 8 to 16 weeks, 10 to 16 weeks, 10 to 14 weeks, 12 to 14 weeks, or around 13 weeks. In certain embodiments, the embryos are incubated on an embryo development medium containing an ALS inhibitor at a concentration of 10 to 80 μg / L, for example, 10 to 70, 15 to 65, 15 to 55, 20 to 55, 20 to 50, 20 to 40, 20 to 30, or about 25 μg / L. In certain embodiments, the embryos are incubated on an embryo development medium containing an ALS inhibitor at a concentration of 10 to 80 μg / L, for example, 20 to 70, 25 to 65, 30 to 60, 40 to 60, 40 to 55, 45 to 55, or about 50 μg / L. In certain embodiments, the embryos are incubated for 8-20 weeks, e.g., 8-16 weeks, 10-16 weeks, 10-14 weeks, 12-14 weeks or 13 weeks on embryogenesis medium containing an ALS inhibitor at a concentration of about 10-80 μg / L, e.g., 10-70, 15-65, 15-55, 20-55, 20-50, 20-40, 20-30 or about 25 μg / L, or at a concentration of about 10-80 μg / L, e.g., 20-70, 25-65, 30-60, 40-60, 40-55, 45-55 or about 55 μg / L. In certain embodiments, the embryos or embryogenic cell suspensions are allowed to recover for 1-14 days, 3-10 days, 5-10 days or about 7 days after transformation and prior to ALS inhibitor selection. Similar methods would be appropriate for other selectable markers and selection agents.
[0217] In certain embodiments, the method comprises treating an embryogenetic cell suspension. In certain embodiments, the embryogenetic cell suspension is incubated in the presence of an ALS inhibitor for at least 3 days, for example at least 5 days, 10 days or 15 days, optionally less than 30 days, for example less than 25 days, 20 days, 15 days or less than 10 days. In certain embodiments, the embryogenetic cell suspension is incubated in the presence of an ALS inhibitor at a concentration of at least 500 μg / L, for example at least 1, 2, 3, 4 or 5 mg / L. In certain embodiments, the embryogenetic cell suspension is incubated in the presence of an ALS inhibitor at a concentration of at least 500 μg / L, for example at least 1, 2, 3, 4 or 5 mg / L, optionally less than 30 days, for example less than 25, 20, 15 or 10 days. In certain embodiments, the method comprises treating a banana embryo with an ALS inhibitor by culturing the embryo, for example starting from cells from the ECS, in an embryogenetic medium comprising an ALS inhibitor. In certain such embodiments, the method then comprises transferring the embryos to an embryogenesis medium that does not contain an ALS inhibitor. In certain embodiments, the method comprises culturing embryos from a cell suspension, cell mass or cell cluster in an embryogenesis medium that contains an ALS inhibitor, observing the development of embryos that are resistant to the ALS inhibitor, and physically separating the embryos from the remaining cells that develop less or do not develop. In certain embodiments, the developed embryos are transferred to an embryogenesis medium that does not contain an ALS inhibitor. Similar methods would be suitable for other selectable markers and selection agents.
[0218] In certain embodiments, the present invention comprises selecting at least one plant cell, plant tissue or plant, such as embryo, that is resistant to treatment with an ALS inhibitor, and physically separating them from non-resistant cells, tissues or plants.In certain embodiments, at least one selected cell, tissue or plant is transferred to another plate or growth medium that preferably does not contain an ALS inhibitor.
[0219] In certain embodiments, treatment of cells with an ALS inhibitor, such as culturing embryos in the presence of an ALS inhibitor, provides a population of cells or embryos that are edited in the endogenous ALS gene and also edited in the target sequence and contain the desired mutation. In certain embodiments, at least 1%, 2%, 3%, 4% or 5% of the cells or embryos contain a mutation in the endogenous acetolactate synthase gene and the desired mutation in the target sequence.
[0220] In certain embodiments, the method includes treating the plant or plant body. In certain embodiments, the method includes spraying the plant or plant body with an ALS inhibitor. In certain embodiments, the spraying further includes an adjuvant, such as Silwett L-77. In certain embodiments, the plant or plant body is sprayed with the ALS inhibitor at a concentration of at least 1 mg / L, such as at least 2, 3, 4, or 5 mg / L, or 1-10 mg / L, or 2-7 mg / L. In certain embodiments, the plant or plant body is sprayed about once a week. In certain embodiments, the plant or plant body is sprayed every week for four weeks. In certain embodiments, the first weekly spray is at the beginning of the first week. In certain embodiments, the plant or plant body is sprayed four times, preferably once a week. In certain embodiments, the method includes growing the plant or plant body in a rooting medium supplemented with an ALS inhibitor. In certain embodiments, the rooting medium comprises less than 1 mg / L, such as less than 0.5 mg / L or less than 0.1 mg / L, such as 0.01-0.09 mg / L or 0.002-0.06 mg / L or about 0.005 mg / L of the ALS inhibitor. In certain embodiments, the plant body is grown in the ALS inhibitor-containing rooting medium for 2-6 weeks, such as 3-5 weeks, about 1 month, or 4 weeks. In certain embodiments, the treatment comprises spraying the plants or plant bodies and growing them in the rooting medium comprising the ALS inhibitor. In certain embodiments, the plants or plant bodies are exposed to the ALS inhibitor for 2-6 weeks, such as 3-5 weeks, about 1 month, or 4 weeks. In certain embodiments, the method comprises culturing the embryos in the presence of the ALS inhibitor, preferably using the concentrations and / or durations indicated above, and does not comprise any other treatment with the ALS inhibitor. In such embodiments, the method does not comprise treating the plants or plant bodies with the ALS inhibitor and does not comprise incubating the ECS with the ALS inhibitor. In such an embodiment, the transformed ECS is incubated in a medium that does not contain an ALS inhibitor, and the plants and plant bodies are grown in a medium that does not contain an ALS inhibitor.
[0221] In certain embodiments, the plant cells to be transformed are protoplasts. In preferred embodiments, the plant cells to be transformed are embryonic cells, such as cells in an embryogenic cell suspension.
[0222] In certain embodiments, at least 40%, optionally at least 55%, preferably at least 65% of the plant cells, plant parts or plants in the population resulting from the method do not contain the T-DNA integrated into their genome and contain a mutation in a second gene.
[0223] In certain embodiments, the method includes an additional selection step following selection with a selection agent, such as treatment with an ALS inhibitor.In particular, it may be useful to select embryos or plants that do not contain heterologous DNA integrated into their genome, and embryos or plants that have been confirmed to contain at least one desired mutation in the target sequence.As mentioned above, the bacteria and methods of the present invention are useful for enriching such plants and plant cells.
[0224] In certain embodiments, the method comprises selecting at least one cell or plant that comprises at least one desired mutation in target sequence, followed by selection with ALS inhibitor or other selection agent.Mutation can be at least one nucleotide insertion; at least one nucleotide deletion; at least one nucleotide substitution; and any combination of the above.Selecting at least one cell or plant that comprises at least one desired mutation in target sequence can comprise detecting the presence of mutated genomic sequence.
[0225] In certain embodiments, the method comprises selecting at least one cell or plant that does not contain heterologous DNA, particularly the integrated nucleic acid construct that encodes the agent that can introduce mutations, following selection with an ALS inhibitor or other selection agent.The selection of such at least one cell or plant comprises confirming that the nucleic acid construct sequence is not present in the genome of the cell or plant.
[0226] This can be accomplished using any technique known in the art that can detect modifications or editing events, including, but not limited to, DNA sequencing (e.g., next-generation sequencing), electrophoresis, enzyme-based mismatch detection assays, and hybridization assays such as PCR, RT-PCR, RNase protection, in situ hybridization, primer extension, Southern blot, Northern blot, and dot blot analysis. A variety of methods can be used to detect single nucleotide polymorphisms (SNPs), including T7 endonuclease, heteroduplex, and Sanger sequencing of PCR bases. High-resolution melting analysis is another method to verify the presence of editing events. Yet another method is the heteroduplex mobility assay. Mutations can also be detected by directly analyzing rehybridized PCR fragments by native polyacrylamide gel electrophoresis (PAGE). This method exploits the difference in migration of heteroduplex and homoduplex DNA in polyacrylamide gels. Other methods for verifying the presence of editing events are detailed in Zischewski (2017), Biotechnology Advances 1(1):95-104.
[0227] In a preferred embodiment, the T-DNA sequence further encodes a selectable marker, such as a fluorescent marker like mCherry, which can aid in the selection of non-transgenic cells, e.g., where the T-DNA sequence has not integrated into the genome and only transiently expresses the editing agent, since these cells do not express the selectable marker, as shown in the examples.
[0228] Suitable markers include antibiotic selection markers. Examples of antibiotic selection markers that can be used are neomycin phosphotransferase II (nptII) and hygromycin phosphotransferase (hpt). Other marker genes that can be used according to the present teachings include, but are not limited to, gentamicin acetyltransferase (accC3) resistance, bleomycin and phleomycin resistance genes. Further preferred markers include: mutations psbA that confer triazine resistance, particularly G264S and I219V; and mutations enolpyruvylshikimate-3-phosphate synthase (EPSPS) that confer resistance to EPSP synthase inhibitors, particularly tryptophan 102 mutation, alanine 103 mutation and proline 106 mutation. In a preferred embodiment, the selectable marker is a fluorescent protein that has been shown in the examples to be particularly effective, such as mCherry, mTurquoise 2, GFP, such as sfGFP or pH-tdGFP, Gamillus, mNeonGreen, mEYPF, mCitrine, Citrine, or TagRFP. Preferably, the selectable marker is mCherry. Thus, the method of the present invention can incorporate a step of detecting such a marker and selecting cells or plants that do not express the marker.
[0229] general It is to be understood that different applications of the disclosed products and methods can be tailored to the particular needs of the art, and that the terminology used herein is for the purpose of describing particular embodiments of the invention only, and is not intended to be limiting.
[0230] Additionally, as used in the specification and accompanying embodiments, the singular forms "a," "an," and "the" include plural references unless the content clearly dictates otherwise. Thus, for example, reference to a "polypeptide" includes "polypeptides," and the like.
[0231] Unless specifically prohibited, steps of methods disclosed herein may be performed in any suitable order, and the order in which the steps are recited should not be considered limiting.
[0232] When specific sequences are mentioned herein, they may also include sequences that substantially correspond to their complementary sequences, including minor sequence differences due to, for example, sequencing errors, cloning errors, or other modifications that result in base substitution, base deletion, or base addition.Provided that the frequency of such differences is less than 1 in 50 nucleotides, or less than 1 in 100 nucleotides, or less than 1 in 200 nucleotides, or less than 1 in 500 nucleotides, or less than 1 in 1000 nucleotides, or less than 1 in 5000 nucleotides, or less than 1 in 10000 nucleotides.
[0233] As used herein, "identification" may include any technique known in the art that can detect the presence of one or more silencing molecules, including, but not limited to, DNA sequencing (e.g., next-generation sequencing), electrophoresis, enzyme-based mismatch detection assays, and hybridization assays such as PCR, RT-PCR, RNase protection, in situ hybridization, primer extension, Southern blot, Northern blot, and dot blot analysis.
[0234] Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention belongs.Although similar or equivalent methods and materials to those described herein can be used, exemplary methods and / or materials are described.The materials, methods, and examples are illustrative only and are not intended to be limiting.
[0235] The terms "comprises," "comprising," "includes," "including," "having," and their conjugates mean "including, but not limited to." The term "consisting of" means "including and limited to." The term "consisting essentially of" means that a composition, method, or structure may include additional components, steps, and / or moieties, but only if the additional components, steps, and / or moieties do not materially alter the basic and novel characteristics of the claimed composition, method, or structure.
[0236] All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety. EXAMPLES
[0237] Example 1: Generation of virD5 mutants in Agrobacterium tumefaciens EHA105 This example demonstrates the generation of a mutant virD5 Agrobacterium strain. Agrobacterium VirD5 - To investigate the effect of the strain on plant transformation and regeneration of non-transgenic banana plants, we decided to create a mutant of virD5 in Agrobacterium EHA105. Fortunately, the transcription unit of virD5 is encoded by an operon (virD1, D2, D3, D4, D5), the gene that ultimately encodes virD5, and it was possible to disrupt this gene without affecting the expression of downstream genes.
[0238] To effectively knock out the function of the VirD5 protein in A. tumefaciens EHA105, we employed a strategy to disrupt the virD5 gene with a spectinomycin resistance cassette. To generate the mutagenic plasmid construct, 1000 bp of the virD5 gene sequence from EHA105 was amplified in two 500 bp fragments using primers F1_D5_F and F1_D5_R (5' fragment) and F3_D5_F and F3_D5_R (3' fragment). These were flanked by a spectinomycin resistance cassette (amplified with primers F2_D5_F and F2_D5_F) for bacterial resistance and integrated into the recipient vector pJQ200SK using Clontech in-fusion.
[0239] [Table 1]
[0240] [Table 2]
[0241] The resulting plasmid (pVIRD5specKO) cannot replicate in Agrobacterium, so selection for spectinomycin resistance requires that the plasmid be integrated into the Agrobacterium genome by recombination. The plasmid was introduced into WT EHA105 cells by electroporation, and recombination events were selected with spectinomycin (100 μg / ml). Single colonies were picked and grown in LB medium without antibiotics to allow secondary recombination to occur. These cells were diluted and plated on minimal medium supplemented with 20% (w / v) sucrose and 100 μg / ml spectinomycin (AB minimal medium + 1.5% w / v agar). Several resulting colonies were streaked for single colonies on new sucrose / spectinomycin plates. Each new single colony was screened by PCR (primers 569+571 and 569+570) to identify strains in which the WT band was no longer present with either primer set. This strain represents a complete insertion of the spectinomycin resistance cassette into all copies of the virD5 locus on the plasmid, and the resulting strain was designated EHA105virD5 (Figure 2).
[0242] Example 2: The EHA105virD5 strain is not impaired compared to WT EHA105 in transient expression of mcherry following transformation of banana ECS cells. This example shows that the EHA105virD5 strain is not impaired in the expression of T-DNA-derived genes during the first few days after Agrobacterium-mediated transformation, referred to as "transient expression". The mCherry fluorescent marker was used to assess expression 7 days after transformation. The banana cultivar ECS Grand Nine GN236 was used as germplasm for these experiments.
[0243] Agrobacterium tumefaciens preparation Agrobacterium tumefaciens AGL1, EHA105 and EHA105virD5 carrying the binary plasmids pMol_0628 and pMol_0630 were streaked from glycerol in LB solid medium supplemented with rifampicin 50 mg / L, kanamycin 100 mg / L and carbenicillin 50 mg / L and incubated for 2 days at 28 °C. On the second day, the bacteria were inoculated onto MG / L medium (described in Sarkar et al., Methods Mol Biol. 2013; 966: 187-204) supplemented with the same antibiotics and incubated overnight at 28 °C. The next day, the cultures were spun down at 4000 rpm for 10 min to pellet the cells, then resuspended in ABIM (Agrobacterium Induction Medium; described in Sarkar et al., Methods Mol Biol. 2013; 966: 187-204) to induce virulence and incubated overnight at room temperature in the dark. The bacterial OD 600nm was measured using a NanoDrop2000 and normalized to 0.6 in CS liquid medium supplemented with acetosyringone (100 μM).
[0244] Agrotransformation of banana ECS Three-day-old cultures of banana ECS were pelleted and resuspended in CS medium. 0.5 mL of the suspension (approximately 0.1 mL of sedimented cells of ECS) was dispensed into small Eppendorf tubes depending on the number of transformations. It was incubated at 45°C for 5 min and then at room temperature for another 5 min. To this, 1 mL of Agrobacterium suspension was added to each banana ECS sample. The mixture was mixed well and spun down at 1000 rpm for 5 min, then incubated at room temperature for 25 min. Banana cells were pooled and the bacterial suspension was removed. The cells were used to inoculate CS plates supplemented with 100 μM acetosyringone and incubated at room temperature for 3 days to promote transformation.
[0245] Fluorescence microscopy analysis The presence of mCherry transient expression in banana ECS 3 days after transformation was confirmed using a fluorescent microscope (Figure 3). All images were taken at two magnifications (8x and 50x) with equal gain.
[0246] Expression of mCherry was observed in both EHA105 WT and EHA105virD5, with individual clusters of transformed cells showing bright expression comparable to the control (AGL1) in both lines, suggesting that EHA105virD5 is not impaired in transient expression of elements from the T-DNA immediately after transformation compared to WT EHA105.
[0247] Example 3: Transformation of Cavendish banana with EHA105virD5 strain enriches for non-transgenic editing events compared to WT EHA105 This example shows that the EHA105virD5 strain can enrich for a population of regenerated plants that contain a high percentage of non-transgenic (the genome does not contain integrated exogenous DNA) gene editing events.
[0248] A proline to serine mutation (Pro187Ser) in the banana ALS protein (acetolactate synthase) in embryos and plants renders them resistant to the sulfonylurea compound chlorsulfuron. The cytidine base editor APOBEC described in Zong et al., Nat Biotechnol. 2017, 35(5):438-440) can be used to carry out these changes in the banana genome and can be delivered to banana cells using a T-DNA-based delivery system. Importantly, the T-DNA-encoded base editor can edit the ALS locus either before or after T-DNA integration. Typically, a 10% non-transgenic banana, ALS-edited, plant frequency is observed when using this system with a WT Agrobacterium strain. We determined that in the absence of the VirD5 protein in the plant nucleus in the presence of T-DNA, rapid degradation of the T-DNA is achieved, resulting in fewer integration events and fewer transgenic plants resulting from each transformation. Importantly, however, the rate of non-transgenic, i.e., transient editing, was not expected to be affected, which would result in an increased proportion of non-transgenic, ALS-edited banana plants when the EHA105virD5 strain was used for transformation, compared to the WT EHA105 strain.
[0249] Cavendish banana cultivar ECS Grand Nine GN236 was transformed as described in Example 2. Embryos and plants were produced from banana ECS material transformed with plasmids pMol_0628 (containing a T-DNA expressing an APOBEC base editor, a non-targeting guide control and mCherry) and pMol_0630 (containing a T-DNA expressing an APOBEC base editor, an ASL1 guide RNA implementing the Pro187Ser mutation in the banana ALS1 gene and mCherry) without either selection or with 25 μg / L chlorsulfuron added to the medium during embryo development.
[0250] Banana Embryo Development and Germination After 3 days, banana ECS were harvested from the previous medium and transferred to CS medium supplemented with 300 mg / L cefotaxime. After 1 week, banana cells were transferred to EDM plates supplemented with 300 mg / L cefo (cefotaxime) (control), or EDM plates supplemented with 300 mg / L cefo and 25 μg / L CSF, or EDM plates supplemented with 300 mg / L cefo and 50 μg / L CSF. The medium was refreshed every 2 weeks until embryos developed. After that, banana embryos were transferred to CSF-free maturation medium (EMM - embryo maturation medium) for 1 month and then to CSF-free germination medium (GM4) until shoots developed.
[0251] Plant Development Embryogenic cell suspensions (ECS) were transformed with an Agrobacterium strain carrying a plasmid encoding the nCas9 machinery and expressing the sgRNA. Agrobacterium transformation was performed according to Kanna et al., Molecular Breeding October 2004, Volume 14, Issue 3, pp 239-252. Embryogenic cells were co-cultured with Agrobacterium for 1-3 days and then transferred to embryogenesis medium (EDM) containing CSF and maturation medium without CSF (related media are described for example in Strosse H., R. Domergue, B. Panis, JV Escalant and F. Cote, 2003, Banana and plantain 15 embryogenic cell suspensions (A. Vezina and C. Picq, eds). INIBAP Technical Guidelines 8, The International Network for the Improvement of Banana and Plantain, Montpellier, France). Mature embryos are germinated on germination medium (Strosse H., R. Domergue, B. Panis, JV Escalant and F. Cote. 2003. Banana and plantain embryogenic cell suspensions (A. Vezina and C. Picq, eds). INIBAP Technical Guidelines 8. The International 20 Network for the Improvement of Banana and Plantain, Montpellier, France) and young shoots are transferred to shoot maturation medium until they reach a height of approximately 1 cm. Shoots are transferred to rooting medium for the generation of plantlets.
[0252] The mcherry fluorescence shown in Figures 4 to 6 indicates that the ratio of fluorescent (putative transgenic) to non-fluorescent (putative non-transgenic) cells in EHA105virD5 is significantly reduced compared to both the EHA105 and AGL1 WT Agrobacterium strains.
[0253] The number of CSF-resistant embryos that developed after transformation with the three Agrobacterium strains was examined (Table 3).
[0254] [Table 3]
[0255] Without CSF selection, a consistent number of regenerated embryos was observed from all three Agrobacterium strains (AGL1, EHA105, and the resistance and non-resistance plasmids (pMOL_0628 and pMOL_0630). When CSF selection was applied, the control construct (no ALS sgRNA-pMOL_0628) did not support the regeneration of CSF-resistant, ALS base-edited embryos, as expected. Both Agrobacterium WT strains (AGL1 and EHA105) supported the regeneration of ~200 CSF-resistant base-edited embryos, but banana cells transformed with EHA105virD5 had a reduced yield of CSF-resistant base-edited embryos. This is consistent with reduced transgenic editing in the population of transformed cells with the EHA105virD5 strain. It was hypothesized that embryos derived from the EHA105virD5 strain were mostly ALS-edited non-transgenic embryos. To support these data, plants from this experiment were genotyped for ALS gene editing and for the presence of the T-DNA gene.
[0256] Plant genotyping Plant tissue was sampled from tissue cultured leaf tissue. Briefly, a 5 mm square leaf piece was sampled and placed in Qiagen collection microtubes (Cat. No. 19560). DNA was extracted using the LGC sbeadex plant kit on an Oktapure automated platform.
[0257] To detect the presence of the transgene in banana plant genomic DNA, qPCR was used with a primer set that binds to T-DNA. Primer pairs G0418, G0419 and G0422, G0423 were used to detect nCas9-PBE fusions, and primer pair G0327, G0328 were used to detect mCherry. ACTIN was amplified from all samples with primers G0390 and G0391, and the amplification Ct value of this amplicon was used as a control (normalization for genome copy number).
[0258] [Table 4]
[0259] All reactions were set up with 5 μl of template DNA, two WT embryo DNA controls and a water control. PCR was performed on a Roche LightCycler96 using Applied PowerUp SYBR Green master mix according to the manufacturer's recommendations.
[0260] [Table 5]
[0261] The raw data was analyzed with Roche Lightcycler 96 software and the Ct values of each sample were collected and exported to MS excel. The Ct values of the T-DNA amplicons were normalized using the Ct levels of ACTIN. After normalization, the data were plotted (Figure 7).
[0262] Edits at the ALS1 locus were assessed using amplicon Sanger sequencing to detect the presence of mutations induced by cytidine base editors.
[0263] [Table 6]
[0264] [Table 7]
[0265] Amplicons were sent to Genewiz for Sanger sequencing. Geneious was used to assess the presence of T-DNA and ALS1 edits in each sample. Data regarding the presence of T-DNA and ALS1 edits are summarized in Figure 8. EHA105virD5 transformants have a significantly different proportion of non-transgenic edits in ALS1 (84%) compared to lines transformed with either EHA105 (11%) or WT strains of AGL1 (14%).
[0266] Thus, the EHA105virD5 strain can enrich for a population of regenerated plants that contain a high percentage of non-transgenic gene edits when ALS base editing is used as a selection tool.
[0267] Example 4: Agrobacterium strain EHA105virD5 promotes enrichment of non-transgenic, ALS and trait gene-edited banana plants This example shows that the EHA105virD5 strain can enrich for a population of regenerated plants containing a high percentage of non-transgenic gene editing events at ALS and trait loci.
[0268] Banana ECS transformation and plant regeneration were performed as detailed in previous examples. Table 8 details the plasmid constructs used in this example. Plasmid pMOL0628 is a non-resistant mutant control (no ALS editing but contains a cytidine base editor). Plasmids pMOL0630 and pMOL0632 encode a cytidine base editor and sgRNA to create CSF-resistant edits in ALS1 and ALS2, respectively. These are control constructs to show that CSF resistance and ALS base editing work as expected. The experimental constructs in this example are pMOL0926 (ALS1 base-edited sgRNA and PPO2 sgRNA in pMOL0630 to generate a nonsense, premature stop codon mutation in MaPPO2) and pMOL0931 (ALS2 base-edited sgRNA and ACO1 sgRNA in pMOL0632 to generate a nonsense, premature stop codon mutation in MaACO1). Banana line GN236 ECS was transformed with Agrobacterium strain EHA105 WT and EHA105virD5 and plants were regenerated with 25 ng / mL CSF selection only during embryo development (EDM medium).
[0269] [Table 8]
[0270] The first 44 plants regenerated from these transformations were genotyped using the same method detailed in Example 3, where tissue samples were sampled from single leaves, DNA was extracted using LGC Oktapure sbeadex technology, and amplicons were generated and subjected to Sanger sequencing for ALS1 and ALS2 as detailed above. Transgenic plants were identified using gDNA T-DNA qPCR as detailed in Example 3. Additional amplicon PCR sequencing was performed for PPO2 and ACO1. The results are shown in Figure 9. With the EHA105virD5 strain of Agrobacterium, a non-transgenic, co-edited (ALS1 / 2 and trait gene; either ACO1 or PPO2) plant frequency of 88% was observed. With ALS alone, a non-transgenic, ALS-edited plant frequency of 84% was observed, which appears to be robust and reproducible.
[0271] [Table 9]
[0272] [Table 10]
[0273] [Table 11]
[0274] Example 5: Editing of coffee ALS using strain EHA105virD5 The EHA105virD5 Agrobacterium is used to transform coffee embryogenic cali material with the regular EHA105 strain, plus the T-DNA plasmids detailed below.
[0275] Example 6: Transformation of Cavendish banana with strain EHA105virD5 allows non-transgenic HDR editing events in embryos This example shows that the EHA105virD5 strain promotes the production of non-transgenic (the genome contains no integrated exogenous DNA) HDR-edited embryos while reducing the overall number of non-edited embryos. A donor release HDR strategy was used.
[0276] A proline to serine mutation (Pro181Ser) in the banana ALS2 protein (acetolactate synthase 2) in embryos and plants renders them resistant to the sulfonylurea compound chlorsulfuron. These mutations can be introduced using donor molecules delivered to banana cells using a T-DNA base delivery system. The donor molecule is 1,088 bp in size and shares sequence homology with ALS2 except for the Pro181Ser change and 11 silent mutations within 71 bp of the Pro181Ser site. The donor module within the T-DNA is flanked on either side by CRISPR-Cas9 sites to facilitate the "release" of the donor from the T-DNA.
[0277] The Cavendish banana cultivar ECS Grand Nine GN218 was transformed as described in Example 2. Embryos were produced from banana ECS material transformed with four plasmids: pMOL_0628 (containing a T-DNA expressing an APOBEC base editor, a non-targeting guide control and mCherry); pMOL_0630 (containing a T-DNA expressing an APOBEC base editor, an ALS1 guide RNA carrying out the Pro197Ser mutation in the banana ALS1 gene and mCherry); pMOL_1935 (containing a T-DNA expressing mCherry, Cas9(D10A) nickase, an ALS2 P181S donor, 2xsgRNA targeting ALS2); pMOL_1936 (containing a T-DNA expressing mCherry, Cas9(D10A) nickase, an ALS2 P181S donor flanked by sgRNA sites, 2xsgRNA targeting ALS2 and donor flanking sites). All were tested without selection and with 50 μg / L chlorsulfuron added to the medium during embryo development.
[0278] Banana embryo development and sampling After 3 days, banana ECS were harvested from the previous medium and transferred to CS medium supplemented with cefotaxime 300mg / L. After 3 weeks, banana cells were transferred to EDM plates supplemented with cefo (cefotaxime) 300mg / L (control) or EDM plates supplemented with cefo 300mg / L and CSF 50μg / L. The medium was refreshed every 2 weeks for 8 weeks, with the final 2 weeks being transferred to EDM plates supplemented with cefo 300mg / L and CSF 25μg / L. Banana embryos were then counted, sampled, and genomic DNA extracted.
[0279] Genotyping of embryos Embryos were sampled from tissue culture and placed into Qiagen collection microtubes (Cat. No. 19560). DNA was extracted using the LGC sbeadex plant kit on an Oktapure automated platform.
[0280] With CSF selection, 31 embryos were recovered from EHA105 Agrobacterium transformations and 16 embryos were recovered from EHA105VirD5 Agrobacterium transformations, both using the donor release strategy.
[0281] Editing at the ALS2 locus was assessed using amplicon Sanger sequencing to detect the presence of HDR donor integration using primers annealing to the genomic region surrounding ALS2.
[0282] [Table 12]
[0283] [Table 13]
[0284] Amplicons were sent to Genewiz for Sanger sequencing. Geneious was used to assess the presence of HDR editing within the ALS2 target region for each sample. No evidence of editing was seen in any of the 31 EHA105 embryos, but evidence of HDR (10 / 12 specific bases edited) was seen in 1 of 16 EHA105VirD5 embryos, as shown in Figure 10. Because of previous evidence that EHA105VirD5 reduces the recovery of transgenic embryos, qPCR methods were used to determine if embryos were transgenic.
[0285] To detect the presence of the transgene in banana plant genomic DNA, qPCR was used with a primer set that binds to T-DNA. Primer pair G0327, G0328 were used to detect mCherry, G0534, G0535, G1158, G1159 were used to detect nCas9(D10A), G0989, G0990 were used to detect promoter TaU6, and G1001, G1002 were used to detect nptii. ACTIN was amplified from each sample using primers G0390 and G0391, and the amplification Ct value of this amplicon was used as a control (normalization for genome copy number).
[0286] [Table 14]
[0287] All reactions were set up with 1 μl of template DNA. WT embryo DNA and water controls were included. PCR was performed on a Roche LightCycler96 using Applied PowerUp SYBR Green master mix according to the manufacturer's recommendations.
[0288] [Table 15]
[0289] The raw data was analyzed with Roche Lightcycler 96 software and the Ct values for each sample were collected and exported to MS excel. The Ct values of the T-DNA amplicons were normalized using the Ct levels of ACTIN. After normalization, the data were plotted (Figure 11). Primers amplifying portions of the T-DNA returned significantly lower values than the ACTIN genomic control. The results show non-transgenic, partial HDR positive embryos with EHA105VirD5.
[0290] Further sequences SEQ ID NO: 1 ACO1 - Malayan wild ginger >Ma01_g11540.1 ggctatatat aagtagcaac gtggagtgac gagtgggaat agacaaagga aatggcgtgc 60 tccttcccgg tcctcgactt ggagaagctc cgtggagagg agagagagca gtccatggac 120 ctccttcgtg acgcttgcga gaaatggggc ttctttgagg tgctctcatt cttttacgtg 180 aacaagttga tgcccacgag catttgaagc taattatcat ggctttccat ttgcttgctg 240 atgtagctgc tcaaccatgg gatctcgcat gagctgatgg acgaggtgga gaggcggacc 300 aaagcgcact acgagcaatg caggaagcaa aagttcaaac agttggcgtg caaggctctc 360 aagagcggac ccgggacgga tgtcaccgac atggactggg agagcacctt cttcctgcgc 420 catctccccg tctccaacat gtccgacttc ccagacatgg acgaggagta ccggtaccgc 480 ttcgatttcc ttcgttacag cgcacccccc accaccatcg actgtagtct gccccgacta 540 accttcgcct tcaggaaggc gatgacggaa ttcgcgacgg ggttagagaa gctggcggag 600 cgtcttctcg atctgctctg cgagaacctc ggcctggagg agggttacct caagaacgcc 660 ttctacggat ccaaaggtcc gaactttggc accaaggtga gcaactaccc gccatgccct 720 cgcccggagc tgatccacgg cctgcgagcc cacaccgacg ccggcggcat catcttgctc 780 ttccaagacg accgcgtcag cggcctccag cttctcaagg atggccagtg gatcgacgtg 840 ccgcccatgc accactccat cgtggtcaac ctcggagatc agatagaggt cctctctctc 900 tctctctctc tctctctttc tctctctgcg ggacaaaaga tcaaacaaca tgagggcgtt 960 catgcaggtg atcacgaacg gcaagtacaa gagcgtgctg caccgggtgg tggctcggag 1020 cgacggcaac aggatgtcga tcgcctcctt ctacaacccg agcggcgacg ccgtcatcta 1080 ccccgcgccc tccctggtcc agaaggaagc ggaggcgtac ccgaggtttg tgttcgagga 1140 ctatatgaag ctctacgtca cgcaaaagtt tcaagcgaag cagcccaggt ttgaagcaat 1200 gaaggccacg gtaacagtca atggccaacc tacgcctaca ccttaggaca ccacgacgtc 1260 tcacgtggag atgccaccat ctattagaat gtggcatcca attgtggaaa taataagcga 1320 agcactatga acgtggcttt ttttagtctc gagggttatg tcgtcgatcc aattttccac 1380 ttct 1384 Accession number: 2 ACO - Musa acuminata >Ma07_g19730.1 acactccaga tagaaagcac aagtgcaatc agggaagaaa gagcgtgtca tggattcctt 60 tccggttatc gacatggaga agcttttggg aagggagaga ggagaagcca tggagatcct 120 ccgagatgct tgcgagaaat ggggcttctt tgaggtgctg aagcatacat aactggtttt 180 gcttctttga actatatata tattgctaaa atgtactatt tgcacatgca atctgtgtgt 240 agattttaaa ccatggcatc tcacatgacc tcatggatga agtggagaag gtgaacaaag 300 accagtacaa caaatgcagg gagcaaaagt tcaacgagtt cgccaacaaa gcactggaaa 360 acgccgactc agaaatcgac cacctcgact gggaaagcac ctttttcctg cgtcatctcc 420 ccgtctccaa catttctgag atccccgatc ttgatgacca gtataggttg cacgatctga 480 tcatgatgtc atcttctggc ctggtctttt caccttgctc atcgtttcgt ttcttgggac 540 gatgactgcg tgcaggaagg cgatgaagga atttgcggca gagatggaga agctggcaga 600 gcggctgctc gacttgctgg gtgagaacct ggggctggag aaggggtacc tgaagaaagc 660 cttctctaat ggatccaagg ggccaacctt tgggaccaag gtcagcagct acccgccatg 720 cccgcgcccg gacctggtga agggcctgag ggcgcacacc gacgccggag gcatcatctt 780 gctcttccag gacgaccagg tcagcggcct gcagttcctc aaggacggcg agtggctgga 840 cgtgcccccc atgcgccacg ccatcgtcgt caacctcggc gaccagctcg aggtttgggt 900 cctctttgct ctcgtttccg ctgcccgtcg tctgtgatgt tgaatgcaac gaggtctgca 960 ggtaatcacc aatggcaagt acaagagcgt ggtgcaccgc gtggtggctc agactgatgg 1020 caacaggatg tcgattgcct ccttctacaa ccccgggagc gacgctgtga tcttcccggc 1080 ccccgctctt gtggagaagg aagcggagga gaagaaggag gtctatccga agttcgtgtt 1140 cgaggattac atgaagctct acgtcgggca taagttccag gccaaggagc caagattcga 1200 agccatgaaa gccatggaag cagttgccac ccacccaatc gctacctctt aagtgacagc 1260 ccccaagtta gtgcatgtcg ctgtacttcg cgttaggaag ctgtcgtcta tgtctatgta 1320 acccgatgga tgtgtggtat gtacgtgtgt gagccttttc taatgaagca aatcatataa 1380 tatatatata tatatatata ta 1402 SEQ ID NO: 3 ACS - マレーヤマバショウ >Ma04_g31490.1 atggggattc ccggtgacga gatcctctcc agggtcgcta cgggcgatgg ccacggtgag 60 aacacctcgt acttcgatgg ctggaaggcc tacgataatg atcctttcca cccgattcat 120 aatcccaatg gtgtcatcca aatgggactc gcagaaaacc aggtaatgct tgtttctggc 180 tctgtccatt actttctcct cctcctgctg ctgctgctgc taatgggttt cggtctgcct 240 ttcctcagct ctgcttggac ttgatgcgag attggatcag gaagaatcca caggcttcta 300 tatgcaccaa ggagggcgtt tcagagttcg aagccatcgc taacttccag gactaccatg 360 gcctgccgga cttccgtaag gtaatcaccg tctgcagcca taatgcagct cctcgatccc 420 ttactcatgc gtgccatgaa cgatgagggc acagttggat cgatatgcgt tgctatagcc 480 gaaaggtaat gacgcgatca tctatggaaa tgcacaggcc attgccaagt tcatggagaa 540 agcgagagga ggacgagcca ggttcgaccc ggagcgcata gtgatgagcg gtggagccac 600 cggagctcaa gaaacgatcg cattttgtct ggccaatccc ggggacgcct tcctcattcc 660 gacgccatac tacccagcgt acgtatgcct gttgagtcaa cattctgatc tctcaagtaa 720 ttgcgtcgtc aacttccccg ttcgaacaaa tgttccagcc gaccaatcag tcgtgcaatg 780 acccaaacga cagtcaaact tttatctgcc tgagcattga ccaaaaccac accattcaac 840 gtaattgtgg tcatgcaatc cgacactaaa gaacgacatt tggttcttct caggttcgat 900 cgagacttca ggtggagaac tggagttcag ctcctcccta ttcgctgcca cagtcacgac 960 aacttcaaga tcaccgaagc cgagcttgct gctgcctacc ggaaggcgcg cgactctaag 1020 atcagggtta aaaggaatact aataaccaac ccgtcgaatc ctctgggcac aaccatggac 1080 agggagacgc taagaaccct agtaagattc gcgaacgagg aaaggatcca cctagtctgc 1140 gacgagatct tctccggcac agtcttgac gggccggaat atgtcagtgt ggcggagata 1200 ttgcaagagg atccgtcgac ctgcgacgga gacctaatcc acatcgtcta cagcctgtcg 1260 areacctcg gcgtccccgg attccgtgtc ggcatcatat actcgttcaa cgacgcggtg 1320 gtcagctgcg ctcggaggat gtccagcttc ggactggtct cgacgcagac tcaacgcctg 1380 cttgcttcca tgctggaga cgacgacttc accaccgacc tcttggcgga gagcaggagg 1440 agattaatgc acaggcacag gacgtttact gccggcctcg aaggcgtcgg cattcgttgc 1500 ttacagagca acgccggact attctgctgg atgagcttga agcctctgct gaaagacgcc 1560 acggcggagg gcgaggttcga gctgtggcgg gtgatagtga acgaggtgaa gctcaacatc 1620 tctccggggt cctcgttcca ctgcaccgag ccggggtggt tcagggcgtg ctttgccaac 1680 atggacgagg agaccatgga gacggccctg cggcggatca ggacgttcgt gcgccgggcg 1740 aacgacgcag ctactgccgc caagaccaag aagaggtggg acacatcgct tcgcctgagc 1800 ttgccacgaa ggttcgagga gatgaccgtc ctgacaccgc gtctgatgtc tcctcgctct 1860 ccgctcgttc aggccgccac ctga 1884 Accession number: 4 ACS - Malayopython reticulatus >Ma04_g35640.1 gcagcagctg cttctccttc ttctctgctc gcttcagcct tttccggtac gtacctgaga 60 taacgggtca catgaggatc tacggcgagg agcacccaaa tcagcagatc ctctctcgga 120 tcgcgaccaa cgacggccat ggcgagaact cctcctactt cgatgggtgg aaggcctacg 180 agaaggatcc tttccacctc accgacaacc ccacgggggt catccaaatg ggactcgcag 240 aaaaccaggt tagagttcct tcatggtgat gattaatcgc acatgccttc cgtcaattgc 300 cactccctgc ggttgctaat ctaatctgta tgtgggtttt gggtctttct ttcctcagct 360 ttccctcgac ttgatccgag actggatgaa gaagaacccg caggcttcga tctgcaccga 420 agaaggggtc tcagagttca aagcaattgc caactttcag gactatcatg gcctcccagc 480 cttccgaaag gtaatgattt caacccaaaa cgcagcgctg cagctgcttg tcctcactgt 540 ccaagtagct acatacgtcc aatatgataa agctgggact gacagccact tacggcccga 600 gccctgcctg ctcaccctgg ataagggata agctaatgat ggtgtgattt gctgacacgc 660 gcaggccatc gcccagttca tggagaaggt gagaggggga cgagccagat ttgacccaga 720 ccgcatcgtg atgagcggtg gagccaccgg tgctcaggaa accatcgcct tttgcctggc 780 tgatcctggc gaggccttct tgattccaac gccatattat ccggggtaag tgttcaggtg 840 tactaatcta ccgagttctt tatccggcag aggatctaat ggcatctgca tggtttccag 900 attcgatcga gacttcaggt ggaggacagg agttcagctc ctccccattc actgccacag 960 ttccaacaag ttcaagatca cccaagccgc actggagact gcttacagga aggctcgaaa 1020 ctcacacatt agagtcaaag gaatactggt gaccaaccca tcgaaccctc tgggcacaac 1080 catggacaga gagacgctga gaaccctagt cagcttcgtc aacgagaaaa ggatgcactt 1140 ggtgtgcgac gagatcttct ccggaaccgt cttcgacaag ccgagttacg tgagcgtctc 1200 cgaggtgatc gaagacgatc cctactgcga cagggatctg attcacatcg cctacagcct 1260 ctccaaggac ctgggcgtcc ctggcttccg cgtcggcgtc atatactcct aaacgacgc 1320 cgtggtcagc tgcgcgagga agatgtcgag ctttggactg gtctcgtcgc agacgcagca 1380 cctgctcgct tccatgttgg ggagagga gttcaccacg agtttcttag cgacgagccg 1440 gacgaggttg tgcgggcggc gcagggtctt tacggacggc ctcaagcgag tcgggattca 1500 ttgcttggac ggcaacgcgg ggctgttctg ctggatggac ttgaggccgt tgctgaagga 1560 agcgacggtg gaggcggagc tccggctgtg gcgggtgatc atcaacgacg tgaagctcaa 1620 catctcgccg gggtcgtcct tccactgctc ggagccgggg tggttcaggg tatgcttcgc 1680 caacatggac gacacggcca tgaagatagc gctgaggagg atcgagagtt tcgtgtaccg 1740 gggagaacgac gccgctgtgc aggcgaagaa caagaggagg tgggacgaag cgctgcggct 1800 gagcttgcct cgtcggaggt tcgaggatcc gaccatcatg acaccacatc tgatgtctcc 1860 ccactcgcct ctcgttcaag ccgccacctg aaacatcgac agcggcgtgt ctgatgtcaa 1920 cgaaggttaa ttaccgtctg atatgttgca catttctttg ttctttggat tatttatttt 1980 tttttttttg ggaaaaatgg gttgaatgtt cccactaagt tatattagat tgttgttcgg 2040 tctcattcat gttataggaa acgaggatag aattgcttgc ctctctcttt cttttatata 2100 tggaaatatg ttacaattgg cctaagctta tttgatgaca ttaatttcac aagacaaagc 2160 cttctaatta atgtttcgga ccaaatgcag gagctcacta catacatttg ttacacttca 2220 tatgttcaaa attagtccag tttaccggtg actcagtttt aaaggttata aatggttctg 2280 attcaagtac ttatctttgg ttctgttaat tggttcaaac cgaatcgatt ttaatttaaa 2340 caatattaat ttaattaaat tttttaattg gtttaaatcg attaatcaaa tcagttgatc 2400 agggaaaata ttattgatgt cttactcaac tcgatatggt ctatactcac gtgcgtagga 2460 atgtccgaga tgtctctgag ataaaaacat cgtgctttcg tgat 2504 Accession number: 5 ACS - Malayan tapir >Ma09_g19150.1 tagctcgtgt tctcccttct ccccaggctt cccagtactc gcctaagatc gtaacgtcgg 60 caatggggct ccacgttgat gaacactcaa attacaatgt cctctccagc atcgcaacga 120 gcgatggcca cggggagaac tcctcatact tcgatggctg gaaggcctac gataatgatc 180 cttccaccc catcgacaat cctcaggggg tcatccaaat gggacttgca gaaaaccagg 240 taaatgctgt ttcacaacta gttcggtaat tatggtagtt ttttcatggc ctatggccaa 300 aaatatgcct tccgtattct cctactactt ggaatgctaa cgggtgctgc gttttcctta 360 tctcagctct gcctggactt gatgcagcag tggatcaagc agaacccaca ggcttccatt 420 tgcaccggcg agggcgtttc cgagtttaag gacgtcgcga acttccaaga ctaccacggc 480 ctgccagact tccgaaaggt aataaccatc acagtgcagc tctttagtta gtccttatca 540 tgtcataaac tgtggaccct cgagaataga ttacatcact cagataaaag atgtgcgcat 600 tatgactcac gtacatgagt ccagaacttg tatctacttg taacgacgtc aagaggattc 660 tggaaatggt gcctgctggg ctagggacaa cctcactaga ttgctttgct gttctgaaa 720 ggctaatgat gtgatttgtg gaaacacgca ggcgattgct aggttcatgg ggaaagcgag 780 <h2 style=";text-align:left;direction:ltr">aggaggagga gctacgttcg acccggagcg cattgtaatg agcggcggag ccaccggagc 840<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> tcaggaaacc atcgcatttt gtctagcgaa tcctggggag gccttcctga ttccaacgcc 900<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> atattatcca gggtacgtag acctatccta catcaagatt ttatgtttta tgtatatttc 960<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> acagtgacac taatctgttt taaagaaaac tgtttgagga tgagccgatc gaactacgga 1020<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ggcaacatta atataatcca gcttactggt ataaccaaaa aattagtagt caatatttgc 1080<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> catcgcacga ctgtgacgtc gacaagacag tctcagtata ttatatttct taattaataa 1140<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> cgctacacca aaaccataac cgacctaccg gccgcttgag gtttctgcac tctccggcct 1200<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> cattatggat ctatcggttg atatatatat atatatatat gacagcgatt tcacatttcc 1260<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> tgcagcttcg atcgagactt tcggtggaga actggagttc aactcctccc tattcagtgc 1320<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> cacagcttcg acaacttcaa gatcaccgaa cccgcgctag ttactgccta tcaaagggca 1380<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> caaacagcta acatcagggt taaaggaatc ctggtaacca acccttcaaa ccctctgggt 1440<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> acaaccttgg acagagagac actgagaacc ttagtgagct tcgccaacga gaaacggatc 1500<h2 style=";text-align:left;direction:ltr"> cacttggtgt gcgacgagat attctcgggc accgtcttcg acaagcctac ctacgtcagc 1560 gtctccgaga tcgtggaaga ggaaccatac tacgacaggg acctaattca catcgtctac 1620 agtctgtcca aggatctcgg cgtccctgga ttccgcgtgg gtgtcattta ctcgtacaat 1680 gatgcagtgg tcagctgtgc tcggaagatg tccagctttg gactggtctc gactcaaacg 1740 cagcacctac tggcttccat gctgggagat gatgacttca caaccaaatt tttggcggag 1800 agcaggagga gattgtcgcg caggcacaaa tattttactg ctggcctcca cagagttgat 1860 atcaaatgtt tggagagcaa tgcggggcta ttctgctgga tgaacttgac gcatctgcta 1920 aacgaagcca cggtggaggc ggaactcaag ctgtggcgag tgataattaa ggaggtgaag 1980 ctcaacattt caccggggtc ttcgttccac tgctctgagc cggggtggtt cagggtgtgc 2040 ttcgccaaca tggacgataa caccatggaa accgcattga agaggatcag gaagtttgtg 2100 tcccccggga atcacactgc ggctgcgcaa gccaagaaga agaacaagag gtgggacgcg 2160 gcgctccgcc taagtttgcc tcgtcggttc gaggaactga gcatcatgac acctcgcctc 2220 atgtctcctc actcgcccct tgttcaggcc gccaactgat ggtgatggat gagcgtgggc 2280 gatttaacc gacg அக்க்கு நுர்க்கு: 6 PPO2 - マレーヤマバショウ >Ma07_g03540 atggccggcc ttccttattc agctcctcac cctgccacca tctccgcttc ctccaactcc 60 tttgcatgcc ccttccgcag caaggggctt gtttcccct accctaccag aagagcactc 120 catgttcgtc ccaacatcgc atgcaaggca ggcgaggac acgagatcgc tgctaaggtc 180 gaccgacgcg acgtactcgt gggcctcggt gggctctgcg gagccgccgc tggccttggc 240 gggttcgata aagccgccct cgctaacccc attcaggccc ctgatctctc caagtgcggc 300 cctgccgacc tccccaccgg cgtgccagtc gtcaactgct gcccgcccta ccgtcccggt 360 gcgaagattg tggatttcaa gcggccgtcg ccgtcctccc cactccgcgt ccgccccgcc 420 gccacttgg ttgaccccga gtacctggcc aagtacaaga aggccatcga gctcatgaag 480 gcgctcccgg ccgatgaccc tcgcaacttc atgcagcagg ccgacgtcca ctgcgcctac 540 tgcgacggcg cttacgacca gatcggcttc cccaaccttg agatccaagt ccacaacagc 600 tggctcttct tcccctggca ccgcttgtac ctctacttca acgagaggat cctcggcaag 660 ctcatcggcg acgacacctt ctcgctccct ttctggaact gggacgcacc cggcggaatg 720 atgctgcctt cgatctacgc cgatccttcg tcacccctct acgacaaact tcgcgacgcc 780 aagcaccaac ctcctgtcct tgtcgacctc gactacaatg gaaccgaccc aaccttcccc 840 gacgcccagc aaatcgatca caacctcaag atcatgtacc gccaagtctt ctccaacggc 900 aagacgccgt tgctgttctt aggctcagct taccgtgccg gtgaacagcc taaccctggc 960 gcgggctccg tcgagaacat gccgcacaac aacgtgcact tgtggaccgg cgaccgcacc 1020 cagcccaact tcgagaacat gggcaccttc tacgccgcgg cgcgcgaccc catcttcttc 1080 gcccaccacg ccaacatcga ccgcatgtgg tacctgtgga agaagctcag caggaaagcac 1140 caggacttca atgactcgga ctggctcaaa gcttctttcc ttttctacga cgagaacgcc 1200 gacttagttc gggtcacggt caaggactgc ttggagaccg attggctgcg ctacacgtac 1260 cagacgtga agatcccatg ggtgaacgcc cgaccgactc CAagctcgc caggcgagg 1320 aaagccgcca gcagttcgct gaagccacc gcggaggtgc agttccctgt gacgctggaa 1380 tcccggtca aagcgacggt gagaggccc aaggtgggga ggagcggcaa gagaagga 1440 gatgaggagg agatactcat agtggagggg atcgagttcg accgcgacta cttcatcag 1500 ttcgacgtct tcgtgaacgc gacggaggc gacggcatca cggccggggc cagcgagttc 1560 gccggcagct tcgtgaacgt cccgcacaag cacaagcacc gcaagatga gaatagctg 1620 aagacgaggc tgtgtcttgg aatcaccgac ctgctcgagg acatcggcg ggaggacgac 1680 gawagcgtgc tcgtcaccat cgtgccgaag gcgggcaaag gaaggtgtc cgtcggcggt 1740 cttcggattg acttttccaa g 1761
Claims
1. 1. A bacterium capable of introducing a nucleotide sequence into a plant cell, comprising: (a) a nucleotide sequence encoding a vir gene, wherein the expression and / or activity of VirD5 is reduced or disrupted; and (b) a T-DNA sequence encoding at least one site-specific DNA editing agent capable of introducing at least one mutation into at least one target sequence in a plant cell; Including bacteria.
2. 2. The bacterium of claim 1, wherein the site-specific DNA editing agent comprises an endonuclease selected from the group consisting of a meganuclease, a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), a homing endonuclease, a CRISPR-associated endonuclease, and a modified CRISPR-associated endonuclease.
3. 2. The bacterium of claim 1, wherein the site-specific DNA editing agent comprises a CRISPR-associated endonuclease or a modified CRISPR-associated endonuclease, and the T-DNA sequence also encodes one or more guide RNAs specific for at least one target sequence in the plant cell.
4. 2. The bacterium of claim 1, wherein the site-specific DNA editing agent comprises a base editor, a prime editor, a Cas9 endonuclease, or a CRISPR-associated endonuclease or modified CRISPR-associated endonuclease selected from the group consisting of SpCas9, xCas9, SpCas9-NG, SaCas9, AsCpf1, LbCpf1, CjCas9, NmCas9, StCas9, TdCas9, eSpCas9, HypaCas9, Cas9-SpRY / SpG, a Cas4-Ca1-Cas2 complex, and MAD7.
5. 2. The bacterium of claim 1, wherein the site-specific DNA editing agent comprises a base editor and the T-DNA sequence also encodes one or more guide RNAs specific for at least one target sequence in the plant cell.
6. 2. The bacterium of claim 1, wherein the site-specific DNA editing agent comprises a prime editor, and the T-DNA sequence also encodes one or more guide RNAs that are pegRNAs specific for at least one target sequence in the plant cell.
7. 2. The bacterium of claim 1, wherein the site-specific DNA editing agent comprises an endonuclease, such as a CRISPR-associated endonuclease, a modified CRISPR-associated endonuclease, a transcription activator-like effector nuclease, or a zinc finger nuclease; and wherein the T-DNA sequence also encodes at least one donor template capable of introducing at least one mutation via homology-dependent repair (HDR) or non-homologous end joining (NHEJ), and optionally encodes one or more guide RNAs specific for at least one target sequence in the plant cell.
8. The bacterium according to claim 1, which is a bacterium of the genus Agrobacterium, Rhizobium, or Ensifer, and optionally is selected from the group consisting of Agrobacterium tumefaciens, Agrobacterium fabram str. C58, Agrobacterium genomosp, Agrobacterium sp. S2 / 73, Agrobacterium sp. 13-2099-1-2, Agrobacterium sp. NCPPB925, Agrobacterium rhizogenes, Agrobacterium salinitorensis, Agrobacterium vitis, Agrobacterium arsenijevic, Agrobacterium deltaense, Agrobacterium larimoulei, Rhizobium sp. AB2 / 73, Rhizobium sp. 16-488-2b, and Rhizobium sp.16-488-2a, Rhizobium sp. 16-449-1b, Rhizobium sp. L58 / 93, Rhizobium sp. L245 / 93, Rhizobium sp. E27B / 91, Rhizobium sp. K1 / 93, Rhizobium sp. BK007, Rhizobium tumoligens, Rhizobium schierniiwiscens, Rhizobium lusitaniam, Neorhizobium sp. NCHU2750, Neorhizobium gallegae, Ensifer sp. YR511, and Ensifer adherens.
9. A bacterium as described in claim 1, in which the expression and / or activity of VirD5 encoded by a nucleotide sequence encoding a vir gene is disrupted.
10. A bacterium as described in claim 1, wherein the reduction or destruction of the expression and / or activity of VirD5 encoded by the nucleotide sequence encoding the vir gene is mediated by at least one mutation in the sequence encoding VirD5.
11. 11. The bacterium of claim 10, wherein at least one mutation in the VirD5 coding sequence is: (a) at least one nucleotide insertion; (b) at least one nucleotide deletion; (c) insertion-deletion (indel); (d) Inversion; (e) at least one nucleotide substitution; and (f) any combination of (a) to (e); selected from the group consisting of wherein optionally the insertion or deletion is a frameshift insertion or a frameshift deletion.
12. The bacterium of claim 1, wherein the nucleotide sequence encoding the vir gene is a plasmid such as a Vir-helper plasmid, a Ti plasmid or a Ri plasmid.
13. The bacterium according to claim 1, wherein the plant cell is a banana cell and at least one target sequence comprises ACO or PPO, preferably ACO1 or PPO2.
14. The bacterium of claim 1, wherein at least one mutation in at least one target sequence in the plant cell comprises at least one mutation that confers a selectable trait in the plant cell, and optionally the selectable trait is herbicide resistance.
15. The bacterium of claim 1, wherein the at least one mutation in at least one target sequence in the plant cell comprises at least one mutation in at least one acetolactate synthase (ALS) gene, wherein the at least one mutation in the ALS gene confers resistance to an ALS inhibitor, and optionally the ALS gene is the acetolactate synthase 1 (ALS1) gene or the acetolactate synthase 2 (ALS2) gene in banana, and wherein the plant cell is a banana cell.
16. The bacterium of claim 14, wherein the T-DNA sequence encodes at least one site-specific DNA editing agent capable of introducing at least one mutation into an additional target sequence.
17. The bacterium of claim 1, wherein the T-DNA sequence is: (a) at least one CRISPR-associated endonuclease or modified CRISPR-associated endonuclease; (b) a first guide RNA specific for a first target sequence; and (c) a second guide RNA specific for a second target sequence; Code wherein the at least one endonuclease is capable of introducing at least one mutation into a first target sequence and is capable of introducing at least one mutation into a second target sequence, the bacterium.
18. 18. The bacterium of claim 17, wherein: (A) the at least one modified CRISPR-associated endonuclease is one or more base editors capable of introducing at least one mutation into a first target sequence and at least one mutation into a second target sequence; or (B) (a) the T-DNA sequence also encodes a donor template capable of introducing at least one mutation into a second target sequence via homology-dependent repair (HDR) or non-homologous end joining (NHEJ); or (b) the T-DNA sequence also encodes a first donor template capable of introducing at least one mutation into a first target sequence via homology-dependent repair (HDR) or non-homologous end joining (NHEJ) and a second donor template capable of introducing at least one mutation into a second target sequence via homology-dependent repair (HDR) or non-homologous end joining (NHEJ); or (C) the at least one modified CRISPR-associated endonuclease is one or more prime editors, the first guide RNA is a first pegRNA specific to a first target sequence and capable of introducing at least one mutation into the first target sequence, and the second guide RNA is a second pegRNA specific to a second target sequence and capable of introducing at least one mutation into the second target sequence; or (D) the at least one CRISPR-associated endonuclease or modified CRISPR-associated endonuclease comprises at least two different endonucleases, wherein a first endonuclease is capable of introducing at least one mutation into a first target sequence and a second endonuclease is capable of introducing at least one mutation into a second target sequence; Bacteria.
19. 18. The bacterium of claim 17, wherein at least one mutation introduced into the first target sequence confers a selectable trait in a plant cell, and optionally the selectable trait is herbicide resistance, and optionally the at least one mutation comprises at least one mutation in at least one acetolactate synthase (ALS) gene, wherein the at least one mutation in the ALS gene provides resistance to an ALS inhibitor.
20. 1. A method for producing a plant, plant part, plant cell or population thereof comprising at least one mutation in at least one target sequence, the method comprising contacting the plant, plant part or plant cell with the bacterium described in claim 1, and optionally further comprising regenerating the cell or plant part to obtain a whole plant.
21. 21. The method of claim 20, wherein at least one mutation in at least one target sequence is: a. at least one mutation in a first target sequence that confers a selectable trait in a plant, plant part, or plant cell, optionally wherein the selectable trait is herbicide resistance, optionally wherein the first target sequence is an ALS gene, and optionally wherein the mutation provides herbicide resistance to an ALS inhibitor; and b. at least one mutation in a second gene A method comprising:
22. 21. The method of claim 20, wherein at least one of the mutations in the target sequences confers a selectable trait to the plant cell, plant part, or plant; optionally, the selectable trait is herbicide tolerance; and optionally, at least one of the target sequences is in an ALS gene, wherein the mutation provides herbicide tolerance to an ALS inhibitor.
23. 21. The method of claim 20, wherein: (a) the genome of the plant, plant part or plant cell produced does not contain any integrated T-DNA sequences; and / or (b) the method further comprises the step of selecting at least one plant cell, plant part or plant that comprises at least one mutation in the target sequence or target sequences and does not comprise any integrated T-DNA sequences in its genome, optionally wherein said selection comprises genotyping; and / or (c) the method further comprises selecting the cells, plant parts, or plants having the selectable trait; Optionally, the selectable trait is herbicide tolerance and the selecting step is by selecting cells, plant parts or plants that are herbicide resistant; optionally, the target sequence is an ALS gene and the selecting step is by selecting cells, plant parts or plants that are resistant to an ALS inhibitor; and / or (d) at least 40%, optionally at least 55%, preferably at least 65% of the plant cells, plant parts or plants in the population resulting from the method do not contain integrated T-DNA in their genome and contain a mutation in a second gene; method.
24. 21. The method of claim 20, comprising: a) introducing at least one mutation into a first target sequence that confers a selectable trait in a plant cell, optionally wherein the selectable trait is herbicide resistance; b) introducing at least one mutation into the second target sequence; c) selecting plants, plant parts, plant cells or populations thereof containing the selectable trait, optionally by treating with a herbicide; Including, wherein the selected plant, plant part, plant cell or population comprises or is enriched for a mutation in the second target sequence, and optionally the selected plant, plant part, plant cell or population does not contain an integrated T-DNA in its genome or is enriched for plants, plant parts or plant cells that do not contain an integrated T-DNA in their genome.
25. 21. The method of claim 20, further comprising producing at least one plant embryo, plant part or plant from the selected cell, plant part or plant.
26. 21. The method of claim 20, wherein the plant, plant part or plant cell is banana, coffee or rice, and optionally the plant, plant part or plant cell is of a banana variety selected from the group consisting of: Malayan wild jasmine, Ryukyu wild jasmine, Burmese blue banana, autopolyploid Malayan wild jasmine 'Cavendish', and autopolyploid Malayan wild jasmine 'Gros Michel'.
27. 21. A plant, plant part, plant cell or population thereof produced by the method of claim 20, optionally wherein at least 40%, optionally at least 55%, preferably at least 65% of the plant cells, plant parts or plants in the population resulting from the method do not contain integrated T-DNA in their genome and contain a mutation in a second gene.