Shortened corn

Abstract

Modifications of maize genes Zm1d31079 and Zm1d44812 are disclosed that provide maize plants with reduced plant height. Maize plants containing modified Zm1d31079 or Zm1d44812 with heterologous enhancing elements are described. Also disclosed are seeds obtained from such plants, and the use of the seeds and plants to produce commercial crops and in maize breeding.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This international patent application claims the benefit of U.S. Provisional Patent Application No. 63 / 266,684, filed January 12, 2022, which is incorporated by reference in its entirety.

[0002] Incorporation of sequence listing The sequence listing included in this application, entitled "P13777WO00.XML", which is 105,723 bytes (measured in MS-Windows®), contains 125 biological sequences, was created on December 1, 2022, was filed electronically herewith, and is incorporated herein by reference in its entirety. [Background technology]

[0003] Plant height is largely determined by the degree of stem elongation, which is regulated by a variety of factors, including plant hormones such as gibberellic acid. Reduction in plant height is a useful commercial trait that is associated with improved productivity, agronomic practices and overall yield. Several genes have been described to be involved in plant height, such as Brevis plant1 (BV1), brachytic2 (BR2), compact plant2 (ct2), etc. Most of these genes are positive regulators of plant growth, so complete or near-complete loss-of-function mutations in such genes typically result in severe shortening of plant height and are of little use. Ellis et al., 1987, EMBO J. (6): 11: 3203-3208, disclose a 16 base pair bacterial octopine synthase gene enhancer element that was able to increase expression of exogenous genes in maize and tobacco protoplasts in transient expression assays. WO 2018 / 140899 discloses the insertion of an expression enhancing element having homology to the bacterial octopine synthase gene enhancer element into the promoter region of the maize Lc gene in the maize protoplast genome to increase expression of the gene. [Prior art documents] [Patent documents]

[0004] [Patent Document 1] International Publication No. 2018 / 140899 Brochure [Non-patent literature]

[0005] [Non-Patent Document 1] Ellis et al.,1987,EMBO J.(6):11:3203-3208 Summary of the Invention [Means for solving the problem]

[0006] A corn plant is provided that comprises a modified Zm1d31079 gene, wherein a heterologous expression enhancing element is located in the modified gene, and wherein the unmodified Zm1d31079 gene comprises a DNA molecule of SEQ ID NO: 1 or an allelic variant thereof. A corn plant is provided that comprises a modified Zm1d44812 gene, wherein a heterologous expression enhancing element is located in the modified gene, and wherein the unmodified Zm1d44812 gene comprises a DNA molecule of SEQ ID NO: 8 or an allelic variant thereof, and wherein the modified Zm1d44812 gene is located at the natural chromosomal location of the unmodified Zm1d44812 gene. A corn plant part that comprises a modified Zm1d31079 gene or a modified Zm1d44812 gene is also provided. In some embodiments, the corn plant part is a seed, a culm, a stem, or a leaf.

[0007] A method for producing corn seeds is provided, comprising growing any of the aforementioned corn plants and harvesting seeds therefrom.A method for producing hybrid corn seeds is provided, comprising crossing the aforementioned corn plants homozygous for the modified Zm1d31079 gene with a corn plant homozygous for the unmodified Zm1d31079 gene and harvesting seeds from a pollinator of the cross, wherein the corn plant homozygous for the modified Zm1d31079 gene is optionally the pollen donor.A method for producing hybrid corn seeds is provided, comprising crossing the aforementioned corn plants homozygous for the modified Zm1d31079 gene with a corn plant homozygous for the unmodified Zm1d31079 gene and harvesting seeds from a pollinator of the cross, wherein the corn plant homozygous for the modified Zm1d31079 gene is optionally the pollinator. A method for producing a hybrid corn seed is provided, comprising crossing the aforementioned corn plant homozygous for the modified Zm1d31079 gene with another corn plant homozygous for the modified Zm1d31079 gene and harvesting seeds from a pollinator of the cross. A method for producing a hybrid corn seed is provided, comprising crossing the aforementioned corn plant homozygous for the modified Zm1d44812 gene with a corn plant homozygous for the unmodified Zm1d44812 gene and harvesting seeds from a pollinator of the cross, optionally with the corn plant homozygous for the modified Zm1d44812 gene being the pollen donor. A method for producing an inbred corn seed is also provided, comprising (i) a corn plant homozygous for the modified Zm1d31079 gene; or (ii) selfing a corn plant homozygous for the modified Zm1d44812 gene.A method for producing a hybrid corn seed is provided, comprising crossing the aforementioned corn plant homozygous for the modified Zm1d44812 gene with a corn plant homozygous for the unmodified Zm1d44812 gene, and harvesting seeds from the pollinator of the cross, optionally the corn plant homozygous for the modified Zm1d44812 gene being the pollinator. A method for producing a hybrid corn seed is provided, comprising crossing the aforementioned corn plant homozygous for the modified Zm1d44812 gene with another corn plant homozygous for the modified Zm1d44812 gene, and harvesting seeds from the pollinator of the cross. A method for producing an inbred corn seed is also provided, comprising (i) a corn plant homozygous for the modified Zm1d31079 gene; or (ii) selfing a corn plant homozygous for the modified Zm1d44812 gene.

[0008] Methods for producing a corn plant containing an additional desired trait are provided, comprising introducing a transgene, targeted genetic change, and / or locus that confers the desired trait into any of the aforementioned corn plants.

[0009] Provided is a method for making a commodity corn plant product that includes: (i) processing any of the aforementioned corn plants or corn seeds obtained therefrom; and (ii) recovering the commodity corn plant product from the processed corn plant or corn seeds.

[0010] A biological sample is provided that contains a detectable amount of DNA molecules that contain a heterologous transcriptional enhancer, a heterologous intron, and / or a heterologous translational enhancing element located in a DNA fragment of a modified Zm1d31079 gene or located in a DNA fragment of a modified Zm1d44812 gene.

[0011] The method of making the aforementioned corn plant comprises: (a) contacting a corn plant genome with a gene editing molecule comprising: (i) a first site-specific nuclease that introduces a double-stranded DNA break in a promoter region, a 5' UTR, a coding region, a 3' UTR, or a 3' flanking region of (i) an unmodified Zm1d31079 gene comprising a DNA molecule of SEQ ID NO: 1 or an allelic variant thereof; or (ii) an unmodified Zm1d44812 gene comprising a DNA molecule of SEQ ID NO: 8 or an allelic variant thereof; and a donor DNA template or other DNA template comprising a heterologous expression-enhancing element; and (b) contacting a corn plant genome with a gene editing molecule that includes the modified Zm1d31079 gene or the modified Zm1d44812 gene. The present invention provides a method comprising selecting a corn plant, wherein the modified Zm1d31079 gene or the modified Zm1d44812 gene comprises an insertion of a heterologous expression enhancing element in the promoter region, 5'UTR, coding region, 3'UTR, or 3' flanking region of the gene, wherein expression of the modified Zm1d31079 gene or the modified Zm1d44812 gene is increased in at least one tissue, and the plant height of the corn plant comprising the modified Zm1d31079 gene or the modified Zm1d44812 gene is reduced compared to a control corn plant lacking the modified Zm1d31079 gene or the modified Zm1d44812 gene.

[0012] A method for producing the aforementioned corn plant is provided, the method comprising: (a) contacting a transgene containing a modified Zm1d31079 gene with a corn plant genome, wherein the modified Zm1d31079 gene comprises a heterologous promoter, a heterologous 5'UTR, and / or a heterologous intron operably linked to a coding region encoding the Zm1d31079 protein of SEQ ID NO:2 or an allelic variant thereof; or (b) selecting a transgenic corn plant containing the modified Zm1d31079 gene, wherein expression of the modified Zm1d31079 gene is increased in at least one tissue and the plant height of the corn plant is reduced compared to a control corn plant lacking the modified Zm1d31079 gene. [Brief description of the drawings]

[0013] [Figure 1] The unmodified maize Zm1d31079 gene sequence (SEQ ID NO:1) is depicted, with the location of the guide RNA recognition site in the promoter in bold, the 5' untranslated region (5'UTR) underlined, the coding region in uppercase, and the 3'UTR and 3' flanking regions in italics. [Diagram 2] The unmodified maize Zm1d44812 gene sequence (SEQ ID NO:8) is depicted, with the location of the guide RNA recognition site in the promoter in bold, the 5' untranslated region (5'UTR) underlined, and the ATG translation start codon in capital letters. [Diagram 3] 1 shows two "T zero" (T0) ZM187 gene edited corn plants containing a transcriptional enhancer inserted into the Zm1d44812 gene promoter and a T0 ZM190 control plant lacking the transcriptional enhancer insertion. The T0 ZM187 gene edited corn plants were generated with Cas nuclease, Zm1d44812_Pro-75 gRNA containing RNA encoded by SEQ ID NO: 10, and triplex ZmOCS enhancer element donor DNA (SEQ ID NO: 18). [Figure 4] 1 shows two "T zero" (T0) ZM200 gene edited corn plants containing a transcriptional enhancer inserted into the Zm1d31709 gene promoter and a T0 ZM194 control plant lacking the transcriptional enhancer insertion. The T0 ZM200 gene edited corn plants were generated with Cas nuclease, Zm1d31709_Pro-242 gRNA containing RNA encoded by SEQ ID NO:6, and triplex ZmOCS enhancer element donor DNA (SEQ ID NO:18). [Diagram 5]1 shows a "T zero" (T0) ZM202 gene edited corn plant containing a transcription enhancer inserted into the Zm1d31709 gene promoter, a "T zero" (T0) ZM203 gene edited corn plant containing a transcription enhancer inserted into the Zm1d44812 gene promoter, and a T0 ZM194 control plant lacking any transcription enhancer insertion. The T0 ZM202 gene edited corn plant was made with Cas nuclease, ZM1d31709_Pro-242 gRNA containing RNA encoded by SEQ ID NO:6, and triple ZmOCS enhancer element donor DNA (SEQ ID NO:16). The T0 ZM203 gene edited corn plant was made with Cas nuclease, Zm1d44812_Pro-259 gRNA containing RNA encoded by SEQ ID NO:15, and triple ZmOCS enhancer element donor DNA (SEQ ID NO:18). [Figure 6] 1 shows two "T zero" (T0) ZM185 gene edited corn plants containing a transcriptional enhancer inserted into the Zm1d31709 gene promoter, two "T zero" (T0) ZM186 gene edited corn plants containing a transcriptional enhancer inserted into the Zm1d31709 gene promoter, and T0 ZM184 and Zm182 control plants lacking any transcriptional enhancer insertion. The T0 ZM185 and ZM186 gene edited corn plants were generated with Cas nuclease, ZM1D31709_Pro-109 gRNA containing RNA encoded by SEQ ID NO:4, and triplex ZmOCS enhancer element donor DNA (SEQ ID NO:18). [Figure 7] Two "T zero" (T0) ZM185 gene edited corn plants containing a transcriptional enhancer inserted into the Zm1d31709 gene promoter and a T0 Zm182 control plant lacking any transcriptional enhancer insertion are shown. The T0 ZM185 gene edited corn plants were generated with Cas nuclease, ZM1d31709_Pro-109 gRNA containing RNA encoded by SEQ ID NO:4, and triplex ZmOCS enhancer element donor DNA (SEQ ID NO:18). [Figure 8]Five "T zero" (T0) ZM187 gene edited corn plants containing a transcriptional enhancer inserted into the Zm1d44812 gene promoter and a T0 ZM190 control plant lacking the transcriptional enhancer insertion are shown. The T0 ZM187 gene edited corn plants were generated with Cas nuclease, Zm1d44812_Pro-75 gRNA containing RNA encoded by SEQ ID NO: 10, and triplex ZmOCS enhancer element donor DNA (SEQ ID NO: 18). [Figure 9] Expression of Zm1d31079 (SEQ ID NO: 1) relative to ZmAct1 (actin) control in young shoot apices in two populations segregating the enhancer insertion allele, comparing plants containing no enhancer allele (C) to siblings that are heterozygous (HeZ) or homozygous (HoZ) for the triple ZmOCS enhancer allele at the indicated positions (-109 or -242 relative to the TSS). Each data point represents the average of two technical replicates per individual plant. [Figure 10] Figure 1 shows plant height over time for plants homozygous for the triple ZmOCS enhancer element inserted at the indicated positions in the Zm1d31079 (SEQ ID NO: 1) promoter versus segregating control plants. Mean plant height ± SEM is shown, where N=5-8 per group; triple ZmOCS enhancer element insertion homozygotes are in black (lower curve), and segregating controls lacking the enhancer insertion are in grey (upper curve). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0014] The term "allelic variant" as used herein refers to a polynucleotide or polypeptide sequence variant found in a particular gene at a particular location in different strains, varieties, or isolates of a given organism.

[0015] The term "and / or" as used herein should be construed as a specific disclosure of each of the two specified features or components with or without the other. Thus, when the term "and / or" is used herein in phrases such as "A and / or B", it is intended to include "A and B", "A or B", "A" (single), and "B" (single). Similarly, when the term "and / or" is used in phrases such as "A, B, and / or C", it is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (single); B (single); and C (single).

[0016] As used herein, the phrase "biological sample" refers to either intact plant tissue or non-intact corn plant tissue (e.g., ground corn seeds or corn plant tissue, shredded corn plant tissue, freeze-dried tissue). It may also be an extract containing intact or non-intact seeds or corn plant tissue. Biological samples may include flours, meals, syrups, oils, starches, and cereals that are manufactured in whole or in part to contain corn plant products or by-products. In certain embodiments, the biological sample is "non-regenerable" (i.e., unable to regenerate into a corn plant or corn plant part).

[0017] As used herein, the terms "corresponding," "corresponding," and the like, when used in the context of nucleotide positions, mutations, and / or substitutions in any given polynucleotide (e.g., an allelic variant of SEQ ID NO:1 or SEQ ID NO:8) compared to a reference polynucleotide sequence (e.g., SEQ ID NO:1 or SEQ ID NO:8), all refer to polynucleotide residue positions in the given sequence that have identity to residues in the reference nucleotide sequence when the given polynucleotide is aligned with the reference polynucleotide sequence using a pairwise alignment algorithm (e.g., CLUSTAL O 1.2.4 with default parameters).

[0018] As used herein, the terms "Cpf1" and "Cas12a" are used synonymously to refer to the same RNA-dependent DNA endonuclease (RdDe).

[0019] As used herein, the phrases "endogenous promoter," "endogenous gene," "endogenous plant transcription unit," and the like refer to a promoter, gene, or plant transcription unit in its native form in its natural location in an organism or in the genome of an organism.

[0020] As used herein, the word "exemplary" refers to an example, instance, or illustration, and does not necessarily refer to a preferred embodiment, unless specifically stated otherwise.

[0021] The term "heterologous" as used herein in reference to a DNA molecule, nucleotide, or polynucleotide inserted into a plant genome refers to any DNA molecule, nucleotide, or polynucleotide that is synthetic or has been removed from its natural location and inserted into a new genomic location.

[0022] As used in this specification, the terms "include", "includes", and "including" should be interpreted to include at least the features it refers to, but not to exclude any additional features not specified.

[0023] As used herein, the phrase "operably linked" refers to an arrangement in which the components so described are in a relationship that allows them to function in their intended manner. For example, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. In another non-limiting example, an "expression enhancing element" (e.g., a transcriptional enhancer element) is operably linked to a promoter if the expression increasing element increases the activity of the promoter (e.g., as measured by the accumulation of the transcript or protein encoded by the transcript that the promoter drives).

[0024] As used herein, the term "plant" includes whole plants and any progeny, cell, tissue, or part of a plant. The term "plant part" includes any part or parts of a plant, including, for example, without limitation, seeds (including mature and immature seeds); plant cuttings; plant cells; plant cell cultures; or plant organs (e.g., pollen, embryos, flowers, fruits, shoots, leaves, roots, stems, and explants). A plant tissue or plant organ may be a seed, protoplast, callus, or any other collection of plant cells organized into a structural or functional unit. A plant cell or tissue culture may be capable of regenerating a plant having physiological and morphological characteristics of the plant from which the cell or tissue was obtained, and of regenerating a plant having substantially the same genotype as the plant. The regenerative cells in a plant cell or tissue culture may be embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, roots, root tips, flowers, grains, or culms. In contrast, some plant cells do not have the ability to regenerate to produce plants, and are referred to herein as "non-regenerable" plant cells.

[0025] As used herein, the terms "unmodified Zm1d31079 gene" and "Zm1d31079 protein" refer respectively to either the gene of SEQ ID NO: 1 and allelic variants thereof or the protein of SEQ ID NO: 2 and allelic variants thereof.

[0026] As used herein, the terms "unmodified Zm1d44812 gene" and "Zm1d44812 protein" refer respectively to either the gene of SEQ ID NO:8 and allelic variants thereof or the protein of SEQ ID NO:9 and allelic variants thereof.

[0027] To the extent that any of the foregoing definitions conflict with a definition provided in any patent or non-patent literature incorporated by reference herein, any patent or non-patent literature cited herein, or any patent or non-patent literature found elsewhere, it is understood that the foregoing definition shall be used herein.

[0028] Disclosed is a corn plant comprising a modified Zm1d31079 gene or a modified Zm1d44812 gene, wherein a heterologous expression enhancing element is located in the modified gene, which results in increased expression of the Zm1d31079 or Zm1d44812 gene product (e.g., Zm1d31079 or Zm1d44812 protein or an RNA transcript encoding the protein). The endogenous unmodified Zm1d31079 gene allele (SEQ ID NO: 1) is listed in "MaizeGDB" (Maize Genome Database World Wide Web Internet site "maizegdb.org") under accession number Zm00001d031079 and encodes the Zm1d31079 protein (SEQ ID NO: 2). The endogenous unmodified Zm1d44812 gene (SEQ ID NO: 8) is listed in the "MaizeGDB" (Maize Genome Database World Wide Web Internet site maizegdb.org) under the accession number Zm00001d044812 and encodes the Zm1d44812 protein (SEQ ID NO: 9). The Zm1d44812 protein (SEQ ID NO: 9) has also been identified as the ZmPIN1a protein (Li, ZX et al. Plant Biotechnology Journal (2018) 16, pp. 86-99; doi: 10.1111 / pbi.12751).

[0029] Allelic variants of the endogenous Zm1d31079 gene (SEQ ID NO:1) and endogenous Zm1d44812 gene (SEQ ID NO:8) include sequence variants in both the non-coding regions (e.g., the promoter, 5'UTR, and 3'UTR shown in SEQ ID NO:1 and SEQ ID NO:8) and the coding regions (the regions of these genes that encode the proteins SEQ ID NO:2 and SEQ ID NO:9). Allelic variants of the endogenous Zm1d31079 gene include variants that encode a Zm1d31079 protein having at least 95%, 96%, 98%, 99%, or 99.5% sequence identity to SEQ ID NO:2. Allelic variants of the endogenous Zm1d31079 gene also include variants that have at least 95%, 96%, 98%, 99%, or 99.5% sequence identity to SEQ ID NO:1. Allelic variants of the endogenous Zm1d44812 gene include variants that encode a Zm1d44812 protein having at least 95%, 96%, 98%, 99%, or 99.5% sequence identity to SEQ ID NO: 9. Allelic variants of the endogenous Zm1d44812 gene also include variants having at least 95%, 96%, 98%, 99%, or 99.5% sequence identity to SEQ ID NO:8.

[0030] To obtain corn plants with reduced plant height and improved productivity, both as inbred parents and as hybrids, in certain embodiments, it is desirable to obtain an allelic series of corn plants that includes various modified Zm1d31079 genes or various modified Zm1d44812 genes, wherein the various modified Zm1d31079 genes or various modified Zm1d44812 genes are obtained at characteristic expression levels that produce plants with a characteristically reduced plant height ranging from about 5% or 10% to about 15%, 20%, 30%, or 50% as compared to a control plant lacking the modified Zm1d31079 gene or the modified Zm1d44812 gene. In certain contexts, corn plants having a given Zm1d31079 gene or modified Zm1d44812 gene have a smaller shortened plant height (e.g., about 5% to about 15% compared to a control plant) and are selected from an allelic series to obtain a plant exhibiting the desired shortened plant height. In certain contexts, corn plants having a given Zm1d31079 gene or modified Zm1d44812 gene have a smaller shortened plant height (e.g., about 15% to about 20%, 30%, or 50% compared to a control plant) and are selected from an allelic series to obtain a plant exhibiting the desired shortened plant height. In certain embodiments, a corn plant having a given modified Zm1d31079 gene or modified Zm1d44812 gene exhibits about a 10%, 15%, or 20% to about a 30%, 40%, 50%, 60%, 70%, 80%, or 100% increase in expression of the Zm1d31079 gene or Zm1d44812 gene in one or more corn tissues compared to a control corn plant lacking the modified Zm1d31079 gene or modified Zm1d44812 gene, and is obtained in an allelic series.In certain embodiments, corn plants having a given modified Zm1d31079 gene or modified Zm1d44812 gene exhibit from about a 1.2-fold or 1.5-fold to about a 2-fold, 3-fold, or 5-fold increase in expression of the Zm1d31079 gene product or Zm1d44812 gene in at least one corn tissue in the corn plant as compared to a control corn plant lacking the modified Zm1d31079 gene or modified Zm1d44812 gene. In certain embodiments, the desired plant height reduction and / or expression level can be selected based on productivity characteristics (e.g., inbred and / or hybrid seed yield) for the particular germplasm and / or for use in a particular target terrain.

[0031] In certain embodiments, allelic series of various modified Zm1d31079 genes or various modified Zm1d44812 genes can be obtained by the insertion or formation of a transcription enhancer in the unmodified Zm1d31079 gene or the unmodified Zm1d44812 gene, which transcription enhancer is operably linked to the promoter of the gene but is placed at various positions relative to the transcription start site (TSS). In certain embodiments, allelic series can be obtained by placing the transcription enhancer at various different positions from about 10, 20, 30, 40, 100, or 150 base pairs (bp) to about 200, 240, 300, 350, 400, 500, or 1000 bp 5' from the transcription start site (TSS) of the Zm1d31079 or Zm1d44812 gene. In certain embodiments, operably linking to an endogenous promoter is achieved by inserting or forming (e.g., by CRISPR, TALEN, or artificial zinc finger-mediated gene editing) an enhancer in one or more of the endogenous promoter, 5' untranslated region (5'UTR), intron, and / or 3' untranslated region of the endogenous Zm1d31079 gene or endogenous Zm1d44812 gene located at its natural chromosomal location. Transcriptional enhancer elements that can be inserted or formed in the Zm1d31079 gene or Zm1d44812 gene promoter, 5'UTR, intron, or 3'UTR can include one or more DNA molecules set forth in SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 19 to SEQ ID NO: 124, and / or SEQ ID NO: 125. In certain embodiments, two distinctive enhancers independently selected from SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 19 to SEQ ID NO: 124, and / or SEQ ID NO: 125 are inserted or formed in a gene promoter, 5'UTR, intron, or 3'UTR. In certain embodiments, two distinctive enhancers independently selected from SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 19 to SEQ ID NO: 124, and / or SEQ ID NO: 125 are inserted or formed in a Zm1d31079 gene or Zm1d44812 gene promoter, 5'UTR, intron, or 3'UTR.In certain embodiments, a member of the modified Zm1d31079 gene allele series comprises an insertion of a transcription enhancer (e.g., one or more DNA molecules set forth in SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:19-SEQ ID NO:124, and / or SEQ ID NO:125) at or near the TSS of the Zm1d31079 gene, the insertion being located at or near the TSS of the Zm1d31079 gene. (ii) at about 119 to about 99 base pairs or about 117, 115, 113, 111, or 109 base pairs 5' to the TSS of the Zm1d31079 gene; (iii) at about 170 or 164 to about 150 base pairs or about 168, 166, 164, 162, 1 (iv) at about 252 to about 242 base pairs or about 250, 248, 246, 244, 242, 240, or 238 base pairs 5' to the TSS of the Zm1d31079 gene; (v) at about 261 to about 241 base pairs or about 259, 257, 256, 253, 251, 2 (v) a double stranded break introduced in the Zm1d31079 promoter with Cas9 nuclease and a guide RNA encoded by SEQ ID NO: 4, 5, or 6; or (vi) a double stranded break introduced in the Zm1d31079 promoter with Cas12 nuclease and a guide RNA encoded by SEQ ID NO: 3 or 7. In certain embodiments, the insertion of a transcriptional enhancer at any of the aforementioned positions in the Zm1d31079 promoter involves a deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more base pairs of DNA in the Zm1d31079 promoter either 5' and / or 3' to the transcriptional enhancer insertion in the corresponding DNA of SEQ ID NO: 1 or an allelic variant thereof.In certain embodiments, a member of the modified Zm1d44812 gene allele series comprises an insertion of a transcription enhancer (e.g., one or more DNA molecules set forth in SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:19-SEQ ID NO:124, and / or SEQ ID NO:125) at or near the TSS of the Zm1d44812 gene, the insertion being located at or near the TSS of the Zm1d44812 gene. (ii) at about 93 to about 73 base pairs, or about 91, 89, 87, 85, 83, 81, 79, 77, or 75 base pairs, 5' to the TSS of the Zm1d44812 gene; (iii) at about 183 to about 163 base pairs, or about 181, 179, 177, 175, 173, 171, 169, 167 (iv) at about 188 to about 168 base pairs, or about 186, 184, 182, 180, 178, 176, 174, 172, or 170 base pairs, 5' to the TSS of the Zm1d44812 gene; (v) at about 269 to about 249 base pairs, or about 267, 265, 263, 261, 259, 257, 255, (v) a double stranded break introduced in the Zm1d44812 promoter with Cas9 nuclease and a guide RNA encoded by SEQ ID NO: 10, 12, or 15; or (vi) a double stranded break introduced in the Zm1d44812 promoter with Cas12 nuclease and a guide RNA encoded by SEQ ID NO: 11, 13, or 14. In certain embodiments, the insertion of a transcriptional enhancer at any of the aforementioned positions in the Zm1d44812 promoter involves a deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more base pairs of DNA in the Zm1d44812 promoter either 5' and / or 3' to the transcriptional enhancer insertion in the corresponding DNA of SEQ ID NO: 1 or an allelic variant thereof. In certain embodiments, any of the above transcriptional enhancer insertions can be combined with the insertion of a heterologous translation enhancing element and / or a heterologous intron in the Zm1d31079 or Zm1d44812 gene.Table 1 provides a list of useful transcriptional enhancer elements that can be used to obtain allelic series of the various different modified Zm1d31079 genes or the various different modified Zm1d44812 genes.

[0032] [Table 1]

[0033] [Table 2]

[0034] [Table 3]

[0035] [Table 4]

[0036] [Table 5]

[0037] [Table 6]

[0038] The transcriptional enhancer element of SEQ ID NO: 16 contains three copies of the 12-nucleotide core element nucleotide sequence of SEQ ID NO: 17. The 12-nucleotide core element nucleotide sequence of SEQ ID NO: 17 is present at several locations in the maize genome. For example, it can be found at several chromosomal locations in maize variety B73. According to the genome sequence of the B73v4 version (available at the World Wide Web Internet site https: / / maizegdb.org / genome / assembly / Zm-B73-REFERENCE-GRAMENE-4.0, hereafter referred to as the "B73v4 maize genome"), SEQ ID NO:17 corresponds to Chr3 coordinates 1,063,395..1,063,406 (intron of Zm00001d039287), Chr3 coordinates 12,253,969..12,253,980 (immediately downstream of Zm00001d039695), Chr3 coordinates 12,265,615..1 2,265,626 (intron of Zm00001d039695), Chr3 coordinates 12,277,428..12,277,439 (intron of Zm00001d039695), Chr3 coordinates 147,698,750..147,698,761 (not within 2 kb of the annotated gene model), Chr6, coordinates 107,132,183..107,132,194 (approximately 2 kb downstream from Zm00001d036949), Chr10, coordinates 53,761,662..53,761,673 (not within 2 kb of the annotated gene model).

[0039] In a particular embodiment, a modified Zm1d31079 gene or a modified Zm1d44812 gene with increased expression resulting in shortened plant height is obtained by inserting a heterologous intron into the 5'UTR and / or coding region of the Zm1d31079 gene or Zm1d44812 gene. Previously described materials and methods for intron-mediated enhancement (IME) of plant gene expression (Laxa, M. Front. Plant Sci., 06 January 2017 doi.org / 10.3389 / fpls.2016.01977; Rose, ABPlant J. 17 November 2004 doi.org / 10.1111 / j.1365-313X.2004.02247.x; Parra, G. et al. Nucleic Acids Research, Volume 39, Issue 13, 1 July 2011, 5328-5337, doi.org / 10.1093 / nar / gkr043) can be adapted for use in enhancing expression of the Zm1d31079 or Zm1d44812 genes. Heterologous introns that can be used to increase expression of plant genes include actin, Hsp70, PEPC, UBQ (e.g., UBQ1, UBQ10), EF-1α, EF-1β, histone H3, ATPK1, RHD3, or MHX introns (e.g., rice or maize actin, Hsp70, PEPC, UBQ1, UBQ10, EF-1α, EF-1β, histone H3, ATPK1, RHD3, or MHX introns). In certain embodiments, the intron is inserted within or within about 500, 200, 100, 50, 30, or 20 base pairs from the transcription start site (TSS). In certain embodiments, the intron is inserted into the 5'UTR and / or coding region within or about 500, 200, 100, 50, 30, or 20 base pairs from the transcription start site (TSS) of the Zm1d31079 gene or Zm1d44812 gene. In certain embodiments, the intron is inserted into the 5'UTR and / or coding region within or about 20 to about 100 or 200 base pairs from the transcription start site (TSS) of the Zm1d31079 gene or Zm1d44812 gene.

[0040] In certain embodiments, the modified Zm1d31079 gene or the modified Zm1d44812 gene with increased expression resulting in reduced plant height is obtained by inserting a heterologous translational enhancer into the 5'UTR and / or coding region of the Zm1d31079 gene or the Zm1d44812 gene. The translational enhancer may include one or more codons in the 5'UTR and / or the 5'UTR and the coding region. Examples of translation enhancers include the 5'UTRs of various rice genes that can enhance the translation of a linked heterologous reporter gene (e.g., the 5'UTR of the rice Adh gene (Sugio et al. J. Biosci. Bioengin. 105(3), 300-302 (2008) doi.org / 10.1263 / jbb.105.300); glutathione transferase U50, glutathione peroxidase 1, 20S proteasome α1 subunit, pathogenesis-related protein 4b, glycine-rich cell wall structural protein 1, or UspA domain-containing protein; Yamasaki et al. Plant Biotechnology 35, 365-373 (2018) DOI: 10.5511 / plantbiotechnology.18.0903a). In certain embodiments, the translation enhancer is encoded by a DNA molecule comprising the DNA sequence of any of the above 5'UTRs, and all or a portion of the 5'UTR is replaced with all or a portion of the Zm1d31079 5'UTR or Zm1d44812 5'UTR in a modified Zm1d31079 or modified Zm1d44812 gene.

[0041] Expression of Zm1d31079 or Zm1d44812 encoding transgenes can also be increased by in vitro insertion or formation of the transgene such that it is operably linked to a promoter that is operably linked to the transgene, and then introducing the transgene into the maize plant genome (e.g., by Agrobacterium-mediated transformation or gene gun). In certain embodiments, such transgenes can include modified promoters including any of the modified Zm1d31079 or Zm1d44812 described above with the insertion and / or replacement of the transcription enhancer described above. In certain embodiments, such transgenes can include full or partial replacement of the Zm1d31079 or Zm1d44812 promoter, 5'UTR, and / or intron with a heterologous promoter, 5'UTR, and / or intron.

[0042] The expression of the modified Zm1d31079 gene or the modified Zm1d44812 gene may be increased compared to a control corn plant containing an unmodified Zm1d31079 gene or an unmodified Zm1d44812 gene. Such increased expression can be measured by various methods. In a specific embodiment, the shortened plant height trait conferred by increased expression of the modified Zm1d31079 gene or the modified Zm1d44812 gene is measured in a corn plant containing an increased expression element and compared to a control corn plant containing an unmodified Zm1d31079 gene or an unmodified Zm1d44812 gene. The shortened plant height trait can be assessed by comparing any measurement of the shortened plant height trait itself (e.g., total plant height, internode length, etc.) or a surrogate value for that trait (e.g., seed and / or other biomass yield in kg / hectare) in corn plants containing a modified Zm1d31079 gene or a modified Zm1d44812 gene, and may be increased compared to a control corn plant containing an unmodified Zm1d31079 gene or an unmodified Zm1d44812 gene. In certain embodiments, an increase in expression of the encoded transcript itself is directly measured by determining the amount of Zm1d31079 gene or Zm1d44812 gene-encoding transcript (e.g., mRNA or non-coding RNA) in a corn plant containing a modified Zm1d31079 gene or a modified Zm1d44812 gene, and compared to the amount of the transcript-encoding polynucleotide in a control corn plant containing an unmodified Zm1d31079 gene or an unmodified Zm1d44812 gene. The amount of Zm1d31079 gene or Zm1d44812 gene coding transcript can be determined by a variety of techniques, including PCR (e.g., quantitative reverse transcriptase PCR; qRT-PCR), hybridization, CRISPR-based, and / or sequencing-based techniques (Khodakov et al., doi.org / 10.1016 / j.addr.2016.04.005; Gootenberg, et al. doi:10.1126 / science.aaq0179).In certain embodiments, expression of the Zm1d31079 gene or Zm1d44812 gene-encoding polynucleotide can also be determined by measuring the amount of Zm1d31079 or Zm1d44812 protein encoded by the transcript in a corn plant containing a transcriptional enhancer, and compared to the amount of Zm1d31079 or Zm1d44812 protein in a control corn plant containing an unmodified Zm1d31079 gene or an unmodified Zm1d44812 gene. The amount of Zm1d31079 or Zm1d44812 protein can be determined by a variety of techniques, including protein immunoassays and mass spectrometry-based techniques (Chen et al. doi:10.1186 / s12967-015-0537-6; Bruce et al. doi:10.1002 / 0471250953.bi1321s41). The magnitude of the increase in transcript production may depend on the baseline expression level of the coding polynucleotide of the unmodified endogenous Zm1d31079 or Zm1d44812 transcript in the respective cell or tissue. As a non-limiting example, the magnitude of the increase in expression of the endogenous Zm1d31079 or Zm1d44812 gene modified by the insertion or formation of SEQ ID NO: 16 in the endogenous Zm1d31079 or Zm1d44812 promoter compared to the baseline expression level of the unmodified endogenous Zm1d31079 or Zm1d44812 gene will be greatest when the baseline Zm1d31079 or Zm1d44812 expression level is low. In certain embodiments, expression of an endogenous Zm1d31079 or Zm1d44812 gene modified by insertion of a heterologous expression enhancer (e.g., a transcriptional enhancer of SEQ ID NO: 16) may be increased by at least 1.2-fold, 1.5-fold, 2-fold, 3-fold, 4-fold, or 5-fold compared to the baseline expression level of the unmodified endogenous Zm1d31079 or Zm1d44812 gene.In certain embodiments, expression of an endogenous Zm1d31079 or Zm1d44812 gene modified by the insertion or formation of a heterologous expression enhancer (e.g., a transcriptional enhancer of SEQ ID NO: 16) may be increased by at least about 1.2-fold or 1.5-fold to about 2-fold, 3-fold, 4-fold, 5-fold, 6-fold or more compared to the baseline expression level of the unmodified endogenous Zm1d31079 or Zm1d44812 gene in an unmodified control plant.

[0043] In certain embodiments, it may be desirable to use genome editing molecules to introduce or form heterologous expression enhancing elements (e.g., heterologous transcriptional enhancers, heterologous translational enhancing elements, and / or heterologous introns) into endogenous Zm1d31079 or Zm1d44812 genes. Gene editing molecules useful in the methods provided herein include molecules capable of introducing double-stranded breaks ("DSBs") or single-stranded breaks ("SSBs") at specific sites or sequences in double-stranded DNA, such as in genomic DNA or in target genes located within genomic DNA, and associated guide RNAs or donor or other DNA template polynucleotides.Examples of such gene editing molecules include: (a) RNA-guided nucleases, RNA-guided DNA endonucleases or RNA-directed DNA endonucleases (RdDe), class 1 Nucleases including CRISPR-type nuclease systems, type II Cas nucleases, Cas9, nCas9 nickase, type V Cas nucleases, Cas12a nuclease, nCas12a nickase, Cas12d (CasY), Cas12e (CasX), Cas12b (C2c1), Cas12c (C2c3), Cas12i, Cas12j, Cas14, engineered nucleases, codon-optimized nucleases, zinc finger nucleases (ZFNs) or nickases, transcription activator-like effector nucleases (TAL-effector nucleases or TALENs) or nickases (TALE-nickases), Argonautes, and meganucleases or engineered meganucleases. (b) a polynucleotide encoding one or more nucleases capable of generating a site-specific modification of a target nucleotide sequence (including the introduction of a DSB or SSB); (c) a guide RNA (gRNA) for use with an RNA-guided nuclease, or DNA encoding a gRNA for use with an RNA-guided nuclease; (d) a donor DNA template polynucleotide suitable for insertion by homology directed repair (HDR) or microhomology-mediated end joining (MMEJ) at the break in the genomic DNA; and (e) other DNA templates (e.g., dsDNA, ssDNA, or a combination thereof) suitable for insertion (e.g., by non-homologous end joining (NHEJ) at the break in the genomic DNA.

[0044] CRISPR technology for editing eukaryotic genes has been disclosed in U.S. Patent Application Publication Nos. 2016 / 0138008A1 and 2015 / 0344912A1, as well as U.S. Pat. Nos. 8,697,359, 8,771,945, 8,945,839, 8,999,641, 8,993,233, 8,895,308, 8,865,406, 8,889,418, 8,871,445, 8,889,356, 8,932,814, 8,795,965, and 8,906,616. Cpf1 endonuclease and corresponding guide RNAs and PAM sites are disclosed in US Patent Application Publication No. 2016 / 0208243 A1. Plant RNA promoters for expression of CRISPR guide RNAs and plant codon-optimized CRISPR Cas9 endonucleases are disclosed in PCT / US2015 / 018104 (published as WO 2015 / 131101 and claiming priority to US Provisional Patent Application No. 61 / 945,700). Methods for using CRISPR technology for genome editing in plants are disclosed in US Patent Application Publication Nos. 2015 / 0082478A1 and 2015 / 0059010A1 and PCT / US2015 / 038767 A1 (claiming priority to US Provisional Patent Application No. 62 / 023,246, published as WO 2016 / 007347). In certain embodiments, RNA-guided endonucleases that leave blunt ends after cleavage of the target site are used. RNA-guided endonucleases that cleave at blunt ends include Cas9, Cas12c, Cas12i, and Cas12h (Yan et al., 2019). In certain embodiments, RNA-guided endonucleases that leave sticky-end type single-stranded DNA overhang ends after cleavage of the target site are used. RNA-guided endonucleases that cleave at sticky ends include Cas12a, Cas12b, and Cas12e.The target Cas nuclease cleavage sites in the promoters of both endogenous Zm1d31079 or Zm1d44812 genes are shown in SEQ ID NO:1 and SEQ ID NO:8, respectively, as depicted in Figures 1 and 2. All patent documents referenced in this paragraph are hereby incorporated by reference in their entirety.

[0045] CRISPR-based genome editing can be applied in several ways for use in the plant cells and methods provided herein. Gene editing molecules, such as CRISPR elements, including CRISPR endonuclease and CRISPR guide RNA, including single guide RNA or guide RNA in combination with tracrRNA or scoutRNA, or polynucleotides encoding same, are useful for achieving genome editing without remnants of CRISPR elements or selective genetic markers appearing in progeny. In certain embodiments, CRISPR elements are provided directly to eukaryotic cells (e.g., corn plant cells), systems, methods, and compositions as isolated molecules, as isolated or semi-purified products of cell-free synthetic processes (e.g., in vitro translation), or as isolated or semi-purified products of cell-based synthetic processes (e.g., in bacterial or other cell lysates). In certain embodiments, the corn plant or corn plant cell used in the systems, methods, and compositions provided herein may contain a transgene expressing a CRISPR endonuclease (e.g., Cas9, Cpf1-type, or other CRISPR endonuclease). In certain embodiments, one or more CRISPR endonucleases with unique PAM recognition sites can be used. Guide RNAs (sgRNAs or crRNAs and tracrRNAs) to form an RNA-guided endonuclease / guide RNA complex that can specifically bind to a sequence in the gDNA target site adjacent to a protospacer adjacent motif (PAM) sequence. Typically, the type of RNA-guided endonuclease informs the location of a suitable PAM site and the design of the crRNA or sgRNA. G-rich PAM sites, e.g., 5'-NGG, are typically targeted in the design of the crRNA or sgRNA to be used with the Cas9 protein.Examples of PAM sequences include 5'-NGG (Streptococcus pyogenes), 5'-NNAGAA (Streptococcus thermophilus CRISPR1), 5'-NGGNG (Streptococcus thermophilus CRISPR3), 5'-NNGRRT or 5'-NNGRR (Staphylococcus aureus Cas9, SaCas9), and 5'-NNNGATT (Neisseria meningitidis). T-rich PAM sites (e.g., 5'-TTN or 5'-TTTV, where "V" is A, C, or G) are typically targeted in the design of crRNAs or sgRNAs to be used with Cas12a proteins. In some cases, Cas12a can also recognize the 5'-CTA PAM motif. Other examples of possible Cas12a PAM sequences include TTN, CTN, TCN, CCN, TTTN, TCTN, TTCN, CTTN, ATTN, TCCN, TTGN, GTTN, CCCN, CCTN, TTAN, TCGN, CTCN, ACTN, GCTN, TCAN, GCCN, and CCGN, where N is defined as any nucleotide. The Cpf1 endonuclease and corresponding guide RNAs and PAM sites are disclosed in US Patent Application Publication No. 2016 / 0208243 A1, which is incorporated by reference herein for its disclosure of DNA encoding the Cpf1 endonuclease and guide RNAs and PAM sites.

[0046] In certain embodiments, zinc finger nucleases or zinc finger nickases can also be used in the methods provided herein. Zinc finger nucleases are site-specific endonucleases that contain two protein domains: a DNA binding domain that contains multiple individual zinc finger repeats, each of which recognizes 9-18 base pairs, and a DNA cleavage domain that contains a nuclease domain (typically Fokl). The cleavage domains dimerize to cleave DNA; thus, a pair of ZFNs is required to target a non-palindromic target polynucleotide. In certain embodiments, zinc finger nuclease and zinc finger nickase design methods described (Urnov et al. (2010) Nature Rev. Genet., 11:636-646; Mohanta et al. (2017) Genes vol. 8, 12:399; Ramirez et al. Nucleic Acids Res. (2012); 40(12):5560-5568; Liu et al. (2013) Nature Communications, 4:2565) can be adapted for use in the methods provided herein. The zinc finger binding domain of a zinc finger nuclease or nickase provides specificity and can be engineered to specifically recognize any desired target DNA sequence. Zinc finger DNA binding domains are derived from the DNA binding domains of a large class of eukaryotic transcription factors called zinc finger proteins (ZFPs). The DNA-binding domain of a ZFP typically has a tandem array of at least three zinc "fingers," each of which recognizes a specific DNA triplet. Several strategies can be used to engineer the binding specificity of zinc finger binding domains. One approach, termed "modular assembly," relies on the functional autonomy of individual zinc fingers with DNA. In this approach, a given sequence is targeted by identifying zinc fingers for each component triplet in the sequence and linking them into a multi-finger peptide.Several alternative strategies have also been developed for the design of zinc finger DNA binding domains. These methods are designed to accommodate the ability of a zinc finger to contact neighboring fingers as well as nucleotide bases outside its target triplet. Typically, an engineered zinc finger DNA binding domain has a novel binding specificity compared to naturally occurring zinc finger proteins. Engineering methods include, for example, rational design and various selections. Rational design includes, for example, the use of a database of triplet (or quadruplet) nucleotide sequences and individual zinc finger amino acid sequences, where each triplet or quadruplet nucleotide sequence is associated with one or more amino acid sequences of zinc fingers that bind to a particular triplet or quadruplet sequence. See, for example, U.S. Patent Nos. 6,453,242 and 6,534,261 (both of which are incorporated herein by reference in their entirety). Exemplary selection methods (e.g., phage display and yeast two-hybrid systems) can be adapted for use in the methods described herein. In addition, the enhancement of the binding specificity of zinc finger binding domains is described in U.S. Patent No. 6,794,136 (incorporated herein by reference in its entirety). In addition, individual zinc finger domains may be linked together using any suitable linker sequence. Examples of linker sequences are known, see, for example, U.S. Patent Nos. 6,479,626; 6,903,185; and 7,153,949 (incorporated herein by reference in its entirety). The nucleic acid cleavage domain is non-specific and is typically a restriction endonuclease such as Fokl. This endonuclease must dimerize to cleave DNA. Thus, cleavage by Fokl as part of a ZFN requires two adjacent independent binding events that must occur in both the correct orientation and at an appropriate distance to allow dimerization. The requirement of two DNA binding events allows for targeting of long, potentially unique recognition sites with greater specificity.Fokl mutants with enhanced activity have been described and can be adapted for use in the methods described herein; see, e.g., Guo et al. (2010) J. Mol. Biol., 400:96-107.

[0047] Transcription activator-like effectors (TALEs) are proteins secreted by certain Xanthomonas species to regulate gene expression in host plants and promote bacterial colonization and survival. TALEs act as transcription factors and regulate the expression of resistance genes in plants. Recent studies of TALEs have revealed a code that links the repeat region of TALEs with its target DNA binding site. TALEs contain a highly conserved repeat region consisting of tandem repeats of a segment that is most often 33 or 34 amino acids. The monomeric repeats differ from each other mainly at amino acid positions 12 and 13. A strong correlation has been found between the unique amino acid pairs at positions 12 and 13 and the corresponding nucleotides in the TALE binding site. This simple relationship between amino acid sequence and DNA recognition of the TALE binding domain allows the design of DNA binding domains of any desired specificity. TALEs can be linked to non-specific DNA cleavage domains to prepare genome editing proteins called TAL-effector nucleases or TALENs. As in the case of ZFN, conveniently, restriction endonucleases such as Fokl can be used. Methods for using TALENs in plants have been described and can be adapted for use in the methods described herein, see Mahfouz et al. (2011) Proc. Natl. Acad. Sci. USA, 108: 2623-2628; Mahfouz (2011) GM Crops, 2: 99-103; and Mohanta et al. (2017) Genes vol. 8, 12: 399). TALE nickases have also been described and can be adapted for use in the methods described herein (Wu et al.; Biochem Biophys Res Commun. (2014); 446 (1): 261-6; Luo et al; Scientific Reports 6, Article number: 20657 (2016)).

[0048] In certain embodiments in which a heterologous expression enhancing element (e.g., a heterologous transcriptional enhancer, a heterologous translational enhancing element, and / or a heterologous intron) is inserted into the genome at the site of a double-stranded break in an endogenous Zm1d31079 or Zm1d44812 gene introduced by one or more nucleases or nickases (e.g., a site-specific endonuclease or nickase, a ZF nuclease or nickase, and / or a CRISPR / guide RNA complex with a TALE nuclease or nickase), the donor DNA template or other DNA template comprises a heterologous expression enhancing element (e.g., a heterologous transcriptional enhancer, a heterologous translational enhancing element, and / or a heterologous intron). In certain embodiments where a heterologous expression enhancing element is formed in the genome at the site of the double strand break of the maize plant genome introduced by the nuclease, the donor DNA template or other DNA template may contain less than a complete set of nucleotides or base pairs of the transcription enhancer (e.g., less than the full 36 nucleotides or base pairs of the sequence of SEQ ID NO: 16), and the genomic DNA at the integration site may contribute the nucleotides or base pairs of the transcription enhancer that are missing from the donor DNA template or other DNA template. In certain embodiments where SEQ ID NO: 16 is formed in the genomic DNA, the donor DNA template or other DNA template may contain up to 35 contiguous nucleotides or base pairs of SEQ ID NO: 16, and the genomic DNA at the integration site may contribute one or more nucleotides or base pairs of the SEQ ID NO: 16 sequence that are missing from the donor DNA template or other DNA template, and the full 36 base pair sequence of SEQ ID NO: 16 is formed at the integration site in the genome. The donor DNA template molecule used in the methods provided herein comprises a DNA molecule comprising, from 5' to 3', a first homology arm, a replacement DNA, and a second homology arm, where the homology arm has a sequence that is partially or completely homologous to a genomic DNA (gDNA) sequence adjacent to a target site-specific endonuclease cleavage site in the gDNA. In certain embodiments, the replacement DNA can contain an insertion, deletion, or substitution of one or more DNA base pairs compared to the target gDNA.In one embodiment, the donor DNA template molecule is double-stranded and is perfectly base-paired over all or most of its length, except for the possible presence of some unpaired nucleotides at either or both termini. In another embodiment, the donor DNA template molecule is double-stranded and contains one or more non-terminal mismatches or non-terminal unpaired nucleotides within the otherwise double-stranded duplex. In one embodiment, the donor DNA template molecule that is integrated into at least one double-stranded break (DSB) site contains 2-20 nucleotides on one strand (if single-stranded) or both strands (if double-stranded), e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides on one or both strands, each of which can base-pair with nucleotides on the opposite strand of the targeted integration site (in the case of a fully base-paired double-stranded polynucleotide molecule). Such donor DNA templates can be integrated into genomic DNA bearing blunt-ended and / or sticky-ended double-stranded DNA breaks by homology directed repair (HDR) or microhomology-mediated end joining (MMEJ). In certain embodiments, the donor DNA template homology arms can be about 20, 50, 100, 200, 400, or 600 to about 800, or 1000 base pairs in length. In certain embodiments, integration of the donor DNA template by HDR can be facilitated by the use of exonucleases (e.g., bacteriophage λ exonuclease), single-stranded DNA annealing proteins (SSAPs; e.g., bacteriophage λβ SSAP proteins), and single-stranded DNA binding proteins (SSBs; e.g., E. coli SSB), essentially as set forth in U.S. Patent Publication No. 20200407754, which is incorporated herein by reference in its entirety. In certain embodiments, the donor DNA template molecule can be delivered to the corn plant cell in a circular (eg, a plasmid or a viral vector, including a geminiviral vector) or linear DNA molecule.In certain embodiments, the circular or linear DNA molecule used may comprise a modified donor DNA template molecule comprising, from 5' to 3', a first copy of a target sequence-specific endonuclease cleavage site sequence, a first homology arm, a replacement DNA, a second homology arm, and a second copy of a target sequence-specific endonuclease cleavage site sequence. In other embodiments, a DNA template suitable for NHEJ insertion will lack a homology arm that is partially or completely homologous to a genomic DNA (gDNA) sequence adjacent to the target site-specific endonuclease cleavage site in gDNA. In certain embodiments, a DNA template (e.g., dsDNA, ssDNA, or a combination thereof) containing all expression enhancing elements may be inserted into the double-stranded break of gDNA by non-homologous end joining (NHEJ). In certain embodiments, a DNA template (e.g., dsDNA, ssDNA, or a combination thereof) containing less than a complete set of nucleotides of an expression-enhancing element (e.g., a transcriptional enhancer of less than 36 nucleotides or base pairs of the sequence of SEQ ID NO: 16) may be inserted by non-homologous end joining (NHEJ) into a double-stranded break in gDNA, and the gDNA at the insertion site may contribute the nucleotides or base pairs of the expression-enhancing element (e.g., SEQ ID NO: 16) that are missing from the DNA template, forming an expression-enhancing element (e.g., SEQ ID NO: 16) at the site of the double-stranded break in gDNA.

[0049] In some embodiments, the expression enhancing element (e.g., a heterologous transcriptional enhancer, a heterologous translational enhancing element, and / or a heterologous intron) replaces or largely replaces the corresponding sequence in the gene, such as in the promoter, 5'UTR, or intron. Thus, due to substitution rather than insertion, the positional relationship of other elements remains unchanged. The replacement target site may be selected by similarity to the expression enhancing element or a portion thereof. To create the desired replacement region corresponding to the expression enhancing element or a portion thereof, a replacement template may be used in the HDR process, and / or DNA base editing and / or genome editing may be used. Base editors include, for example, site-specific base editing mediated by C*G→T·A or A·T→G*C base editing deaminase enzymes (Gaudelli et al., “Programmable base editing of A·T to G*C in genomic DNA without DNA cleavage.” Nature (2017); Nishida et al. “Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems.” Science 353(6305)(2016); Komor et al. “Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage.” Nature 533(7603)(2016):420-4. Fusing catalytically dead dCas9 to a cytidine deaminase or adenine deaminase protein results in a specific base editor that can modify DNA bases without inducing DNA cleavage. The base editor converts C → T (or G → A on the opposite strand) (or an adenine base editor can convert an adenine to an inosine), resulting in an A → G change within the editing window specified by the gRNA.

[0050] A variety of processes can be used to deliver gene editing and / or other molecules to plant cells. In certain embodiments, one or more processes are used to deliver gene editing or other molecules (e.g., including polynucleotides, polypeptides, or combinations thereof) to eukaryotic or plant cells through barriers such as cell walls, cell membranes, nuclear membranes, and / or other lipid bilayers. In certain embodiments, polynucleotide-containing, polypeptide-containing, or RNP (ribonucleoprotein)-containing compositions that include these molecules are delivered directly, for example, by directly contacting the composition with plant cells. The aforementioned compositions may be provided in the form of liquids, solutions, suspensions, emulsions, inverse emulsions, colloids, dispersions, gels, liposomes, micelles, injectable materials, aerosols, solids, powders, particulate matter, nanoparticles, or combinations thereof, and can be applied directly to plants, plant parts, plant cells, or plant explants (e.g., by microinjection, by spraying, immersion, dipping, or other direct contact, through abrasion, puncture, or other disruption of cell walls or cell membranes). For example, plant cells or plant protoplasts are immersed in a liquid genome editing molecule-containing composition, thereby delivering the drug to the plant cells. In certain embodiments, the drug-containing composition is delivered using negative or positive pressure, for example, vacuum infiltration or application of hydrodynamic or fluid pressure. In certain embodiments, the drug-containing composition is introduced into the plant cells or plant protoplasts by, for example, microinjection, or by disruption or deformation of cell walls or cell membranes, for example, by physical treatment, such as negative or positive pressure, application of shear force, or treatment with chemical or physical delivery agents, such as surfactants, liposomes, or nanoparticles; see, for example, the delivery of material to cells using microfluidic flow by cell deformation contraction, as described in U.S. Patent Application Publication No. 2014 / 0287509 (incorporated herein by reference in its entirety).Other techniques useful for delivery of drug-containing compositions to eukaryotic cells, plant cells or plant protoplasts include ultrasound or sonication; vibration, friction, shear stress, vortexing, cavitation; centrifugation or application of mechanical forces; mechanical deformation or disruption of cell walls or membranes; enzymatic disruption or permeabilization of cell walls or membranes; abrasion or mechanical injury (e.g., abrasion with carborundum or other particulate abrasives or scratching with files or sandpaper) or chemical injury (e.g., treatment with acids or caustics); and electroporation. In certain embodiments, the agent-containing composition is provided by bacterial (e.g., Agrobacterium sp., Rhizobium sp., Sinorhizobium sp., Mesorhizobium sp., Bradyrhizobium sp., Azotobacter sp., Phyllobacterium sp.) mediated transfection of a polynucleotide encoding a genome editing molecule (e.g., an RNA-dependent DNA endonuclease, an RNA-dependent DNA binding protein, an RNA-dependent nickase, an ABE, or a CBE, and / or a guide RNA) into a plant cell or plant protoplast; see, e.g., Broothaerts et al. (2005) Nature, 433:629-633). Alternatively, any of these techniques or a combination thereof are applied to plant explants, plant parts or tissues, or intact plants (or seeds), from which plant cells are then optionally obtained or isolated; in certain embodiments, the drug-containing composition is delivered in a separate step after the plant cells are isolated.

[0051] Commodity plant products obtained from corn plants or corn plant parts that contain at least one modified Zm1d31079 gene or modified Zm1d44812 gene, as well as methods of making such products, are provided. In certain embodiments, the commodity products are (a) corn seed meal (defatted or not); (b) extracted corn proteins, oils, sugars, syrups, and starches; (c) soy fermentation products; (d) animal feed or human food products (e.g., feeds and foods that contain corn seed meal (defatted or not) and other raw materials (e.g., other grains, other seed meals, other protein meals, other oils, other starches, other sugars, binding agents, preservatives, humectants, vitamins, and / or minerals); (e) pharmaceuticals; (f) raw or processed biomass (e.g., cellulosic and / or lignocellulosic materials; silage); and (g) processed products, including various industrial products, made from corn plants or seeds thereof.

[0052] Also provided herein is a method for detecting DNA fragments comprising modified Zm1d31079 gene or modified Zm1d44812 gene in any of the aforementioned biological samples and commercial products, the DNA fragments comprising a detectable amount of DNA molecules comprising heterologous transcriptional enhancers, heterologous introns, and / or heterologous translational enhancing elements located in the DNA fragments of modified Zm1d31079 gene or in the DNA fragments of modified Zm1d44812 gene. Non-limiting and illustrative examples of such DNA fragments include those in which the enhancer of SEQ ID NO: 16 is inserted. Detection of DNA molecules comprising enhancer insertions and / or substitutions in the transcriptional regulatory region can be achieved by any combination of nucleic acid amplification (e.g., PCR amplification), hybridization, sequencing, and / or mass spectrometry-based techniques. Methods described for detecting foreign nucleic acids in transgenic loci as described in US Patent Publication No. 20190136331 and US Patent No. 9,738,904 (both of which are incorporated herein by reference in their entirety) can be adapted for use in detecting the nucleic acids provided herein. In certain embodiments, such detection is achieved by amplification and / or hybridization-based detection methods using methods (e.g., selective amplification primers) and / or probes (e.g., capable of selective hybridization or generating specific primer extension products) that specifically recognize target DNA molecules (e.g., heterologous transcriptional enhancers, heterologous introns, and / or heterologous translational enhancing elements located in DNA fragments of modified Zm1d31079 genes or modified Zm1d44812 genes) but not DNA of unmodified Zm1d31079 genes or Zm1d44812 genes. In certain embodiments, hybridization probes (eg, polynucleotides each comprising at least about 18-30 base pairs spanning a junction) can include a detectable label (eg, fluorescent, radioactive, epitope, and chemiluminescent labels).In certain embodiments, single nucleotide polymorphism detection assays can be applied to detect target DNA molecules (e.g., heterologous transcriptional enhancers, heterologous introns, and / or heterologous translational enhancing elements located in a DNA fragment of a modified Zm1d31079 gene or a DNA fragment of a modified Zm1d44812 gene).

[0053] Provided herein are inbred and hybrid corn plants and seeds that contain a modified Zm1d31079 gene or a modified Zm1d44812 gene, along with methods for making and using such hybrids and inbred seeds. Methods for making inbred seeds include selfing an inbred corn plant and limiting cross-pollination with any corn plant other than the inbred corn plant. Methods for making such hybrid seeds may include crossing elite crop corn plant lines, where at least one of the pollen donor or pollinator contains a modified Zm1d31079 gene or a modified Zm1d44812 gene that includes an expression enhancing element (e.g., a transcription enhancer). In certain embodiments, a method for producing a hybrid seed may include crossing elite crop corn plant lines, where the pollinator comprises a modified Zm1d31079 gene or a modified Zm1d44812 gene that includes an expression enhancing element (e.g., a transcription enhancer), and where the pollinator is homozygous for the modified Zm1d31079 gene or the modified Zm1d44812 gene. In certain embodiments, a method for producing a hybrid seed may include crossing elite crop corn plant lines, where both the pollen donor and the pollinator comprise a modified Zm1d31079 gene or a modified Zm1d44812 gene that includes an expression enhancing element (e.g., a transcription enhancer), and where both the pollen donor and the pollinator are homozygous for the modified Zm1d31079 gene or the modified Zm1d44812 gene. Hybrid seed production methods are disclosed in (MacRobert, JF, PSSetimela, J. Gethi, and M. Worku. 2014. Maize Hybrid Seed Production Manual. Mexico, DF: CIMMYT) and can be applied to the production of the hybrids disclosed herein. In certain embodiments, the inbred corn plant, the hybrid corn plant, the pollen donor and / or the pollinator can each contain a transgenic locus that confers a trait (e.g., herbicide resistance or resistance to insects, such as Coleoptera or Lepidoptera).Transgenes that can be introduced into a corn plant line containing a modified Zm1d31079 gene or a modified Zm1d44812 gene by breeding or by direct transformation include (i) transgenes that confer insect resistance (e.g., Bacillus thuringiensis (B. thuringiensis) transgenes, including Cry1Ab, Cry1Ac, Cry1F, Cry2Ab, Cry2Ae, Cry3A, Cry3Bb, Cry9c, Cry34, Cry35, VIP3A, and variants thereof) and (ii) transgenes that confer insect resistance (e.g., Bacillus thuringiensis (B. thuringiensis) transgenes, including Cry1Ab, Cry1Ac, Cry1F, Cry2Ab, Cry2Ae, Cry3A, Cry3Bb, Cry9c, Cry34, Cry35, VIP3A, and variants thereof) and (iii) transgenes that confer insect resistance (e.g., Bacillus thuringiensis (B. thuringiensis) transgenes, including Cry1Ab, Cry1Ac, Cry1F, Cry2Ab, Cry2Ae, Cry3A, Cry3Bb, Cry9c, Cry34, Cry35, VIP3A, and variants thereof) and (iv) transgenes that confer insect resistance (e.g., Bacillus thuringiensis (B. thuringiensis) transgenes, including Cry1Ab, Cry1Ac, Cry1F, Cry2Ab, Cry2Ae, Cry3A, Cry3Bb, Cry9c, Cry34, Cry35, VIP3A, and variants thereof) and (v) transgenes that confer insect resistance (e.g., Bacillus thuringiensis (B. thuringiensis) transgenes, including Cry1A thuringiensis proteins; transgenes that induce an insect inhibitory RNAi response); and (ii) transgenes that confer resistance to characteristic herbicides (e.g., CP4-EPSPS or other EPSPS genes that confer glyphosate resistance; PAT or BAR genes that confer resistance to glufosinate herbicides; aad-1 genes that confer resistance to 2,4-D and aryloxyphenoxypropionic acid herbicides; DMO genes that confer resistance to dicamba herbicides). For examples of selected transgenic corn plant events carrying transgenes that confer traits such as herbicide resistance and / or pest resistance, see U.S. Pat. Nos. 6,342,660, 7,956,246, 8,575,434, 7,314,970, 8,759,618, 6,852,915, 10,316,330, 8,6 Nos. 18358, 8450561, 8686230, 9428765, 8455720, 7897748, 8273959, 8093453, 8502047, and 8466346 (each of which is incorporated herein by reference in its entirety).

[0054] In certain embodiments, the corn plants provided herein comprising a modified Zm1d31079 gene or a modified Zm1d44812 gene can further comprise one or more targeted genetic changes introduced by one or more gene editing molecules or systems. Such targeted genetic changes include those that confer traits such as improved yield, improved food and / or feed properties (e.g., improved quality or quantity of oil, starch, protein, or amino acids), improved nitrogen utilization efficiency, improved biofuel application properties, herbicide resistance (e.g., by targeting an endogenous ALS, EPSPS, HPPD, or other herbicide target gene), delayed flowering, non-flowering, increased biotic stress resistance (e.g., resistance to insect, nematode, bacterial, or fungal attack), increased abiotic stress resistance (e.g., resistance to drought, cold, heat, metal, or salt), increased lodging resistance, increased growth rate, increased biomass, increased branching, delayed flowering time, delayed senescence, increased flower number, improved high density planting configuration, increased photosynthesis, increased root mass, increased cell number, increased seedling vigor, increased seedling size, increased cell division rate, improved metabolic efficiency, and increased meristem size, relative to a control corn plant lacking the targeted genetic change. Types of targeted genetic changes that can be introduced include insertions, deletions, and substitutions of one or more nucleotides in the corn crop plant genome. Sites of targeted genetic changes in the endogenous corn plant gene include promoters, coding regions, and non-coding regions (e.g., 5'UTR, introns, splice donor-acceptor sites, and 3'UTR). In certain embodiments, the targeted genetic change comprises the insertion of a regulatory sequence or other DNA sequence in the endogenous corn plant gene. Non-limiting examples of regulatory sequences that can be inserted into an endogenous plant gene with a gene editing molecule to produce a targeted genetic change that confers a useful phenotype include: (a) an auxin response element (AuxRE) sequence; (b) at least one D1-4 sequence (Ulmasov et al. (1997) Plant Cell, 9:1963-1971), (c) at least one DR5 sequence (Ulmasov et al.(d) at least one m5-DR5 sequence (Ulmasov et al. (1997) Plant Cell, 9:1963-1971); (e) at least one P3 sequence; (f) a small RNA recognition site sequence to which a corresponding small RNA binds (e.g., an siRNA, a microRNA (miRNA), a trans-acting siRNA as described in U.S. Pat. No. 8,030,473, or a phased sRNA as described in U.S. Pat. No. 8,404,928). (sRNA) (both of these cited patents are incorporated herein by reference); (g) microRNA (miRNA) recognition site sequences; (h) microRNA (miRNA) recognition sequences for engineered miRNAs, such that the specific binding agent is the corresponding engineered mature miRNA; (i) transposon recognition sequences; (j) sequences recognized by an ethylene response element binding factor-associated amphipathic repression (EAR) motif; (k) splice site sequences (e.g., donor, branch formation, or acceptor sites; see, e.g., the internet site lemur[dot]a (see splice sites and splicing signals shown at mu[dot]edu[dot]pl / share / ERISdb / home.html); (l) a recombinase recognition site sequence recognized by a site-specific recombinase; (m) a sequence encoding an RNA or amino acid aptamer or an RNA riboswitch, the specific binding agent being a corresponding ligand, and the change in expression being up-regulation or down-regulation; (n) a hormone response element recognized by a nuclear receptor or its hormone binding domain; (o) a transcription factor binding sequence; and (p) a polycomb response element (Xiao et al. (2017) Nature Genetics, 49:1546-1552, doi:10.1038 / ng.3937) and others as set forth in US Patent Publication No. 20190352655, which is incorporated herein by reference in its entirety. Non-limiting examples of target corn genes that can be subjected to targeted gene editing to impart useful traits include quality and herbicide resistance traits. In certain embodiments, such targeted genetic changes can be combined with plants containing modified Zm1d31079 genes or modified Zm1d44812 genes by breeding techniques. Such breeding techniques include introgression by crossing and / or backcrossing with the recurrent parent. In such crosses, the plants containing modified Zm1d31079 genes or modified Zm1d44812 genes can be either pollen donors or pollinators. In certain embodiments, a plant comprising a modified Zm1d31079 gene or a modified Zm1d44812 gene can be used as a recurrent parent in such a backcross to introgress a targeted genetic change into a plant germplasm comprising a modified Zm1d31079 gene or a modified Zm1d44812 gene. In certain embodiments, a plant comprising one or more targeted genetic changes can be used as a recurrent parent in such a backcross to introgress a genomic region comprising a modified Zm1d31079 gene or a modified Zm1d44812 gene into a plant germplasm comprising one or more targeted genetic changes.

[0055] In certain embodiments, plants provided herein that comprise a modified Zm1d31079 gene or a modified Zm1d44812 gene exhibit improved yield, improved food and / or feed characteristics (e.g., improved quality or quantity of oil, starch, protein, or amino acids), improved nitrogen utilization efficiency, improved biofuel application characteristics (e.g., improved ethanol production), herbicide tolerance (e.g., by targeting an endogenous ALS, EPSPS, HPPD, or other herbicide target gene), delayed flowering, non-flowering, biological sequence abnormalities, or the like, as compared to a control plant lacking the targeted genetic alteration. The plant may further include one or more genetic loci that confer traits such as increased stress resistance (e.g., resistance to insect, nematode, bacterial, or fungal attack), increased abiotic stress resistance (e.g., resistance to drought, cold, heat, metal, or salt), increased lodging resistance, increased growth rate, increased biomass, increased tillering, increased branching, delayed flowering, delayed senescence, increased flower number, improved dense planting configuration, improved photosynthesis, increased root mass, increased cell number, improved seedling vigor, increased seedling size, increased cell division rate, improved metabolic efficiency, and increased meristem size. Sources of such loci include elite cultivars, sexually compatible wild species or other closely related species (e.g., Zea sp.), plant germplasm that has been subjected to random mutagenesis (e.g., by chemical mutagens such as EMS or by gamma ray mutagenesis), and the like. In certain embodiments, such loci can be combined with plants comprising modified Zm1d31079 or modified Zm1d44812 genes by breeding techniques. Such breeding techniques include introgression by crossing and / or backcrossing with a recurrent parent. In such crosses, the plants comprising modified Zm1d31079 or modified Zm1d44812 genes can be either pollen donors or pollinators. In certain embodiments, the plants comprising modified Zm1d31079 or modified Zm1d44812 genes can be used as recurrent parents in such backcrosses to introgress the loci into plant germplasm comprising the genetically altered transcriptional regulatory region.In certain embodiments, a plant containing one or more loci can be used as a recurrent parent in such a backcross to introgress a genomic region containing a modified Zm1d31079 gene or a modified Zm1d44812 gene into plant germplasm containing one or more loci.

[0056] Also provided herein is a method for producing a commercial plant product or plant material, comprising growing any of the above-mentioned plants containing a modified Zm1d31079 gene or a modified Zm1d44812 gene, or growing a plant from a seed containing a modified Zm1d31079 gene or a modified Zm1d44812 gene. In certain embodiments, such plants and / or seeds are irrigated, fertilized, and / or treated with biological agents (e.g., plant beneficial microorganisms, including Bacillus sp., Rhizobium sp., Bradyrhizobium sp., etc.), nematicides (e.g., carbamate or organophosphate insecticides), insecticides (e.g., neonicotinoid, pyrethroid, carbamate, or organophosphate insecticides), and / or fungicides (e.g., benzimidazole, imidazole, or strobilurin fungicides). Plants can be treated with such fertilizers, biological agents, nematicides, insecticides, and fungicides by methods including spraying, fumigation, and / or soil dressing. Seeds can be treated with such fertilizers, biological agents, nematicides, insecticides, and fungicides by methods including in-furrow application or by coating (e.g., using drum coaters, rotary coaters, tumbler drums, fluidized beds, and / or spouted bed equipment). Methods and compositions including various binders, fillers, film coats, and active ingredients, such as fertilizers, surfactants, plant growth regulators, crop desiccants, fungicides, bactericides, bacteriostats, insecticides, and insect repellents, for seed coating that can be applied for use with the seeds provided herein are disclosed in U.S. Pat. No. 10,745,578, which is incorporated herein by reference in its entirety.

[0057] Embodiment Various embodiments of the DNA molecules, plants, plant parts, genomes, chromosomes, methods, biological samples, and other compositions described herein are set forth in the set of numbered embodiments below.

[0058] 1. A corn plant comprising a modified Zm1d31079 gene, wherein a heterologous expression enhancing element is located in the modified gene, and the unmodified Zm1d31079 gene comprises a DNA molecule of SEQ ID NO:1 or an allelic variant thereof.

[0059] 2. The corn plant of embodiment 1, wherein the modified and / or unmodified Zm1d31079 gene encodes the Zm1d31079 protein of SEQ ID NO:2 or an allelic variant thereof.

[0060] 3. The corn plant of embodiment 1 or 2, wherein the modified Zm1d31079 gene is located at the native chromosomal location of the unmodified Zm1d31079 gene.

[0061] 4. The corn plant of embodiment 1 or 2, wherein the modified Zm1d31079 gene comprises a transgene located at a chromosomal location other than the native chromosomal location of the unmodified Zm1d31079 gene.

[0062] 5. A corn plant comprising a modified Zm1d44812 gene, wherein a heterologous expression enhancing element is located in the modified gene, and the unmodified Zm1d44812 gene comprises a DNA molecule of SEQ ID NO:8 or an allelic variant thereof, and the modified Zm1d44812 gene is located at the native chromosomal location of the unmodified Zm1d44812 gene.

[0063] 6. The corn plant of embodiment 5, wherein the modified and / or unmodified Zm1d44812 gene encodes the Zm1d44812 protein of SEQ ID NO: 9 or an allelic variant thereof.

[0064] 7. A corn plant according to embodiment 5 or 6, wherein expression of the Zm1d44812 gene product in a plant having a modified Zm1d44812 gene is increased by about 5% to 10% or 20%, respectively, in at least one tissue of the corn plant compared to a control corn plant lacking the modified Zm1d44812 gene.

[0065] 8. A corn plant according to embodiment 5, 6, 7, or 8, wherein the plant height of the corn plant is shortened compared to a control corn plant lacking the modified Zm1d44812 gene, and optionally the plant height is shortened by about 5% or 10% to about 15%, 20%, 30%, or 50% compared to a control corn plant lacking the modified Zm1d44812 gene.

[0066] 9. A corn plant according to any one of embodiments 1 to 8, wherein the heterologous expression enhancing element comprises: (i) a heterologous transcription enhancer, a heterologous translation enhancing element, and / or a heterologous intron; or (ii) a heterologous promoter, a heterologous 5'UTR, and / or a heterologous intron.

[0067] 10. A corn plant according to embodiment 9, wherein the heterologous transcriptional enhancer is located in the promoter, 5' untranslated region (5'UTR), intron, 3' untranslated region (3'UTR), or 3' flanking region of the modified Zm1d31079 gene or the modified Zm1d44812 gene.

[0068] 11. The corn plant of embodiment 9 or 10, wherein the heterologous transcriptional enhancer comprises a DNA molecule as set forth in SEQ ID NO: 16, 17, SEQ ID NO: 19-124, and / or 125.

[0069] 12. A corn plant according to embodiment 9, 10 or 11, wherein the transcription enhancer is located from about 10, 20, 30, 40, 100, or 150 base pairs (bp) to about 200, 240, 300, 350, 400, 500, or 1000 bp 5' of the transcription start site (TSS) of the Zm1d31079 or Zm1d44812 gene.

[0070] 13. The transcription enhancer comprises SEQ ID NO: 16 or 17, 19-124, and / or 125, and the insertion is (i) about 116 to about 96 base pairs or about 106 base pairs 5' to the TSS of the Zm1d31079 gene; (ii) about 119 to about 99 base pairs or about 109 base pairs 5' to the TSS of the Zm1d31079 gene; (iii) about 170 to about 150 base pairs or about 160 base pairs 5' to the TSS of the Zm1d31079 gene; (iv) about 252 to about 232 base pairs or about 242 base pairs 5' to the TSS of the Zm1d31079 gene; (v) about 261 to about 241 base pairs or about 251 base pairs 5' to the TSS of the Zm1d31079 gene; (vi) a double-stranded break introduced into the Zm1d31079 promoter with Cas9 nuclease and a guide RNA encoded by SEQ ID NO: 4, 5, or 6; or (vii) a double-stranded break introduced into the Zm1d31079 promoter with Cas12 nuclease and a guide RNA encoded by SEQ ID NO: 3 or 7; 10. The corn plant of embodiment 9, wherein the corn plant is located in

[0071] 14. The transcription enhancer comprises SEQ ID NO: 16, 17, 19-124, and / or 125, and the insertion is (i) about 85 to about 65 base pairs or about 75 base pairs 5' to the TSS of the Zm1d44812 gene; (ii) about 93 to about 73 base pairs or about 83 base pairs 5' to the TSS of the Zm1d44812 gene; (iii) about 183 to about 163 base pairs or about 173 base pairs 5' to the TSS of the Zm1d44812 gene; (iv) about 188 to about 168 base pairs or about 178 base pairs 5' to the TSS of the Zm1d44812 gene; (v) about 269 to about 249 base pairs or about 259 base pairs 5' to the TSS of the Zm1d44812 gene; (vi) a double-stranded break introduced into the Zm1d44812 promoter with Cas9 nuclease and a guide RNA encoded by SEQ ID NO: 10, 12, or 15; or (vii) a double-stranded break introduced into the Zm1d44812 promoter with Cas12 nuclease and a guide RNA encoded by SEQ ID NO: 11, 13, or 14; 10. The corn plant of embodiment 9, wherein the corn plant is located in

[0072] 15. A corn plant according to embodiment 9, wherein the heterologous intron is located within the 5'UTR and / or coding region of the modified Zm1d31079 gene or the modified Zm1d44812 gene, and optionally the intron is located within about 500, 200, 100, 50, 30, or 20 base pairs of the transcription start site (TSS).

[0073] 16. The corn plant of embodiment 15, wherein the heterologous intron comprises a UBQ, EF-1 alpha, EF-1 beta, histone H3, ATPK1, RHD3, or MHX intron, and optionally the UBQ, EF-1 alpha, EF-1 beta, histone H3, ATPK1, RHD3, or MHX intron is a rice or corn intron.

[0074] 17. The corn plant of embodiment 9, wherein the heterologous translational enhancer is located within the 5'UTR and / or coding region of the modified Zm1d31079 gene or the modified Zm1d44812 gene.

[0075] 18. The translation enhancer is encoded by a DNA molecule comprising a DNA sequence including rice alcohol dehydrogenase (OsAdh), glutathione transferase U50 (OsGstU50), glutathione peroxidase 1 (OsGsp1), 20S proteasome α1 subunit (Os20Sα1), pathogenesis-related protein 4b (OsPrp4b), glycine-rich cell wall structural protein 1 (Os Grcwp1), or UspA domain-containing protein (Os UspA) 5'UTR, and all or a part of OsAdh, Os GstU50, Os20Sα1, OsPrp4b, Os Grcwp1, or Os UspA 5'UTR is expressed by a modified Zm1d31079 gene or a modified Zm1d44812 gene. 18. The corn plant of embodiment 17, wherein the 5'UTR or all or a portion of the Zm1d44812 5'UTR has been replaced.

[0076] 19. A corn plant according to any one of embodiments 1 to 18, wherein expression of the Zm1d31079 or Zm1d44812 gene is increased in at least one tissue of the corn plant compared to a control corn plant lacking the modified Zm1d31079 gene or the modified Zm1d44812 gene, and optionally expression of the Zm1d31079 or Zm1d44812 gene is increased in at least culm tissue.

[0077] 20. A corn plant described in any one of embodiments 1 to 19, wherein the plant height of the corn plant is shortened compared to a control corn plant lacking the modified Zm1d31079 gene or the modified Zm1d44812 gene, and optionally the plant height is shortened by about 5% or 10% to about 15%, 20%, 30%, or 50% compared to a control corn plant lacking the modified Zm1d31079 gene or the modified Zm1d44812 gene.

[0078] 21. A corn plant according to any one of embodiments 1 to 20, which is a hybrid corn plant heterozygous for the modified Zm1d31079 or modified Zm1d44812 gene.

[0079] 22. A corn plant described in any one of embodiments 1 to 21, wherein expression of the Zm1d31079 gene product or the Zm1d44812 gene product in a plant having a modified Zm1d31079 gene or a modified Zm1d44812 gene, respectively, is increased by about 20% to 80% in at least one tissue of the corn plant compared to a control corn plant lacking the modified Zm1d31079 gene or the modified Zm1d44812 gene.

[0080] 23. A corn plant described in any one of embodiments 1 to 21, wherein expression of the Zm1d31079 gene product or the Zm1d44812 gene product in a plant having a modified Zm1d31079 gene or a modified Zm1d44812 gene is increased by about 1.2-fold or 1.5-fold to about 2-fold, 3-fold, or 5-fold in at least one corn tissue of the corn plant compared to a control corn plant lacking the modified Zm1d31079 gene or the modified Zm1d44812 gene.

[0081] 24. A corn plant part comprising a modified Zm1d31079 gene or a modified Zm1d44812 gene according to any one of embodiments 1 to 23.

[0082] 25. The corn plant part of embodiment 24, which is a seed, culm, stem, or leaf.

[0083] 26. The corn plant part of embodiment 25, wherein the seed further comprises at least a partial coating of a composition comprising a biological agent, a nematicide, an insecticide, or a fungicide.

[0084] 27. The corn plant part of embodiment 25 or 26, wherein the corn plant seed is a hybrid corn plant seed heterozygous for the modified Zm1d31079 or modified Zm1d44812 gene.

[0085] 28. A method for producing corn seed, comprising growing a corn plant according to any one of embodiments 1-23, and harvesting seed therefrom.

[0086] 29. A method for producing hybrid corn seeds, comprising crossing a corn plant homozygous for the modified Zm1d31079 gene or the modified Zm1d44812 gene described in any one of embodiments 1-4, 9-13, or 15-23 with another corn plant homozygous for the modified Zm1d31079 gene or the modified Zm1d44812 gene, and harvesting seeds from pollinators of the cross.

[0087] 30. A method for producing a hybrid corn seed, comprising crossing a corn plant homozygous for the modified Zm1d44812 gene described in any one of embodiments 5-12 or 14-23 with another corn plant homozygous for the modified Zm1d44812 gene, and harvesting seeds from pollinators of the cross.

[0088] 31. A method for producing an inbred corn seed, comprising selfing (i) a corn plant homozygous for a modified Zm1d31079 gene described in any one of embodiments 1-4, 9-13, or 15-23; or (ii) a corn plant homozygous for a modified Zm1d44812 gene described in any one of embodiments 5-12, or 14-23.

[0089] 32. A method for producing a corn plant containing an additional desired trait, comprising introducing a transgene, targeted genetic change, and / or locus that confers the desired trait into a corn plant described in any one of embodiments 1-23.

[0090] 33. A method for making a commodity corn plant product, comprising: (i) processing a corn plant or corn seed obtained therefrom of any one of embodiments 1-23; and (ii) recovering the commodity corn plant product from the processed corn plant or corn seed.

[0091] 34. The method of embodiment 33, wherein the commodity corn plant product is a seed meal, starch, syrup, silage, oil, or protein.

[0092] 35. The method of embodiment 33, wherein the commodity corn plant product comprises a detectable amount of a DNA molecule comprising a heterologous transcriptional enhancer, a heterologous translational enhancing element, and / or a heterologous intron located in a DNA fragment of the modified Zm1d31079 gene or a DNA fragment of the modified Zm1d44812 gene.

[0093] 36. A biological sample comprising a detectable amount of a DNA molecule comprising a heterologous transcriptional enhancer, a heterologous intron, and / or a heterologous translational enhancing element located in a DNA fragment of a modified Zm1d31079 gene or a DNA fragment of a modified Zm1d44812 gene.

[0094] 37. The biological sample of embodiment 36, wherein the biological sample comprises material obtained from a corn plant or a part thereof of any one of embodiments 1 to 23, the part optionally being a seed.

[0095] 38. The biological sample of embodiment 37, which is non-renewable.

[0096] 39. The biological sample of embodiment 37, comprising corn seed meal.

[0097] 40. A method for producing a corn plant according to any one of embodiments 1-3 or 5-23, comprising: (a) contacting a gene editing molecule comprising: (i) a first site-specific nuclease that introduces a double-stranded DNA break in the promoter region, the 5' UTR, the coding region, the 3' UTR, or the 3' flanking region of an unmodified Zm1d31079 gene comprising a DNA molecule of SEQ ID NO: 1 or an allelic variant thereof; or (ii) an unmodified Zm1d44812 gene comprising a DNA molecule of SEQ ID NO: 8 or an allelic variant thereof; and a donor DNA template or other DNA template comprising a heterologous expression-enhancing element, with a corn plant genome; and (b) selecting a corn plant comprising a modified Zm1d31079 gene or a modified Zm1d44812 gene, wherein the modified Zm1d31079 gene or the modified Zm1d44812 gene comprises an insertion of a heterologous expression-enhancing element in the promoter region, 5' UTR, coding region, 3' UTR, or 3' flanking region of the gene, wherein expression of the modified Zm1d31079 gene or the modified Zm1d44812 gene is increased in at least one tissue, and the plant height of the corn plant comprising the modified Zm1d31079 gene or the modified Zm1d44812 gene is reduced compared to a control corn plant lacking the modified Zm1d31079 gene or the modified Zm1d44812 gene. The method includes:

[0098] 41. The method of embodiment 40, wherein the heterologous expression enhancing element comprises a heterologous transcription enhancer, a heterologous translation enhancing element, and / or a heterologous intron.

[0099] 42. The method of embodiment 40 or 41, wherein a double-stranded break is introduced into the promoter, 5' untranslated region (5'UTR), intron, 3' untranslated region (3'UTR), or 3' flanking region of the unmodified Zm1d31079 gene or the unmodified Zm1d44812 gene, and the donor DNA template or other DNA template comprises a heterologous transcriptional enhancer.

[0100] 43. The method of embodiment 42, wherein the transcription enhancer comprises a DNA molecule as set forth in SEQ ID NO: 16, 17, 19-124, and / or SEQ ID NO: 125.

[0101] 44. The method of embodiment 40, wherein a double-stranded break is introduced about 10, 20, 30, 40, 100, or 150 base pairs (bp) to about 200, 240, 300, 350, 400, 500, or 1000 bp 5' from the transcription start site (TSS) of the Zm1d31079 or Zm1d44812 gene.

[0102] 45. The transcription enhancer comprises SEQ ID NO: 16, 17, 19-124, and / or 125, and the double-stranded break is (i) about 116 to about 96 base pairs or about 106 base pairs 5' to the TSS of the Zm1d31079 gene; (ii) about 119 to about 99 base pairs or about 109 base pairs 5' to the TSS of the Zm1d31079 gene; (iii) about 170 to about 150 base pairs or about 160 base pairs 5' to the TSS of the Zm1d31079 gene; (iv) about 252 to about 142 base pairs or about 242 base pairs 5' to the TSS of the Zm1d31079 gene; (v) about 261 to about 241 base pairs or about 251 base pairs 5' to the TSS of the Zm1d31079 gene; (vi) the Zm1d31079 promoter with a Cas9 nuclease and a guide RNA encoded by SEQ ID NO: 4, 5, or 6; or (vii) Cas12 nuclease and a guide RNA encoded by SEQ ID NO: 3 or 7, and Zm1d31079 promoter 45. The method of embodiment 44, wherein the vector is introduced into

[0103] 46. ​​The transcription enhancer comprises SEQ ID NO: 16, 17, 19-124, and / or 125, and the double-stranded break is (i) about 85 to about 65 base pairs or about 75 base pairs 5' to the TSS of the Zm1d44812 gene; (ii) about 93 to about 73 base pairs or about 83 base pairs 5' to the TSS of the Zm1d44812 gene; (iii) about 183 to about 163 base pairs or about 173 base pairs 5' to the TSS of the Zm1d44812 gene; (iv) about 188 to about 168 base pairs or about 178 base pairs 5' to the TSS of the Zm1d44812 gene; (v) about 269 to about 249 base pairs or about 259 base pairs 5' to the TSS of the Zm1d44812 gene; (v) the Zm1d44812 promoter with a Cas9 nuclease and a guide RNA encoded by SEQ ID NO: 10, 12, or 15; or (vi) Cas12 nuclease and a guide RNA encoded by SEQ ID NO: 11, 13, or 14, and the Zm1d44812 promoter 45. The method of embodiment 44, wherein the vector is introduced into

[0104] 47. The method of embodiment 41, wherein the donor or other DNA template contains a heterologous translational enhancer and a double-stranded break is introduced within the 5'UTR and / or coding region of the unmodified Zm1d31079 gene or the unmodified Zm1d44812 gene.

[0105] 48. The translation enhancer is encoded by a DNA molecule comprising a DNA sequence of rice alcohol dehydrogenase (OsAdh), glutathione transferase U50 (OsGstU50), glutathione peroxidase 1 (OsGsp1), 20S proteasome α1 subunit (Os20Sα1), pathogenesis-related protein 4b (OsPrp4b), glycine-rich cell wall structural protein 1 (OsGrcwp1), or UspA domain-containing protein (OsUspA) 5'UTR, and all or a part of the OsAdh, OsGstU50, Os20Sα1, OsPrp4b, OsGrcwp1, or OsUspA 5'UTR is a modified Zm1d31079 5'UTR or a modified Zm1d44812 5'UTR of the Zm1d44812 gene. 48. The method of embodiment 47, wherein all or part of the 5'UTR is replaced.

[0106] 49. The method of embodiment 41, wherein the DNA donor or other DNA template comprises a heterologous translational enhancer and a double-stranded break is introduced within the 5'UTR and / or coding region of the modified Zm1d31079 gene or the modified Zm1d44812 gene.

[0107] 50. The method of embodiment 49, wherein the heterologous intron comprises a UBQ, EF-1α, EF-1β, histone H3, ATPK1, RHD3, or MHX intron, optionally wherein the UBQ, EF-1α, EF-1β, histone H3, ATPK1, RHD3, or MHX intron comprises a rice or maize intron.

[0108] 51. A method for producing a corn plant according to any one of embodiments 1-2 or 4-23, comprising: (a) contacting a transgene comprising a modified Zm1d31079 gene with a corn plant genome, the modified Zm1d31079 gene comprising a heterologous promoter, a heterologous 5' UTR, and / or a heterologous intron operably linked to a coding region encoding the Zm1d31079 protein of SEQ ID NO:2 or an allelic variant thereof; and (b) selecting a transgenic corn plant comprising a modified Zm1d31079 gene, wherein expression of the modified Zm1d31079 gene is increased in at least one tissue and the plant height of the corn plant is reduced compared to a control corn plant lacking the modified Zm1d31079 gene. The method includes:

[0109] 52. The method of embodiment 51, wherein the promoter is a ubiquitin promoter, an actin promoter, or a plant viral promoter, optionally wherein the plant viral promoter comprises a caulimovirus promoter.

[0110] 53. The method of embodiment 51, wherein the heterologous intron comprises a UBQ, EF-1α, EF-1β, histone H3, ATPK1, RHD3, or MHX intron, optionally wherein the UBQ, EF-1α, EF-1β, histone H3, ATPK1, RHD3, or MHX intron comprises a rice or maize intron. EXAMPLES

[0111] Example 1. Insertion of a transcription enhancer in the Zm1d31079 (SEQ ID NO: 1) and Zm1d44812 (SEQ ID NO: 8) promoters Maize genes Zm1d31079 (SEQ ID NO: 1) and Zm1d44812 (SEQ ID NO: 8) were targeted for the insertion of a transcription enhancer (SEQ ID NO: 16) to increase the expression of these genes and reduce maize plant height. Guide RNAs were designed at various distances from the transcription start site (TSS) of the genes to generate an allelic series and evaluate whether increasing the distance to the TSS could result in a milder phenotype in terms of plant height. A summary of the guide RNAs designed for these two genes is provided in Tables 2 and 3.

[0112] [Table 7]

[0113] [Table 8]

[0114] Immature embryos of the transgenic B104 “editor” corn line constitutively overexpressing the CasB nuclease polypeptide were harvested 13 days after pollination and transfected with herbicide and visually selectable markers (p35S::pat::tNOS and pZmUbi::mScarlet::tZmUbi), single guide RNA for CasB nuclease containing one of the indicated spacers (Zm1d31079_Pro-109, Zm1d44812_Pro-75, Zm1d31079_Pro-242, or Zm1d44812_Pro-259), and DNA for the 3× enhancer ( / 5Phos / G * T * AAGCGCTTACGTAAGCGCTTACGTAAGCGCTT * A * C; SEQ ID NO:18; * The plants were transformed by biolistic bombardment with a plasmid for NHEJ insertion containing the nucleotide sequence α, β, β-terminal α ...

[0115] [Table 9]

[0116] DNA fragments encompassing the targeted sites were PCR amplified and observed for the presence of the insertion in the edited T0 plants. The edited plants were observed to have reduced plant height at the T0 stage. Figures 3, 4, 5, 6, 7, and 8 show the difference between T0 plants containing enhancer insertions in the Zm1d31079 or Zm1d44812 promoters and control plants lacking insertions in those promoters. The control plants were edited T0 plants at a similar developmental stage but carrying edits in genes unrelated to plant height.

[0117] Example 2. Further analysis of plants containing transcriptional enhancer insertions in the Zm1d31079 (SEQ ID NO: 1) and Zm1d44812 (SEQ ID NO: 8) promoters T0 plants such as those described in Example 1 are backcrossed with B104 wild type. The resulting T1 plants are analyzed for the presence / absence of enhancers at the target site, and the T1 plants are grown and subjected to phenotypic analysis focusing on plant height and general plant development, using siblings lacking enhancer insertion as control. The selected T1 plants are crossed with different genotypes (e.g., PHRO3) to generate hybrid F1 seeds, and the resulting F1 plants are subjected to phenotypic analysis including quantitative plant height component measurement. In addition, molecular analysis is performed, if relevant, to measure changes in the expression levels of the target Zm1d31079 and Zm1d44812 genes.

[0118] Example 3. Analysis of plants containing triple ZmOCS transcriptional enhancer insertions in the Zm1d31079 promoter Two lines were generated that contained a triple ZmOCS enhancer element (SEQ ID NO:16) insertion in the promoter of the Zm1d31079 (SEQ ID NO:1) gene: one with the triple ZmOCS enhancer inserted 109 bases upstream from the transcription start site (TSS) of the Zm1d31079 gene, and one with the triple ZmOCS enhancer inserted 242 bases upstream from the TSS of the Zm1d31079 gene. Expression in the young shoot apex showed that in both lines, the enhancer insertion led to higher expression of Zm1d31079, with the effect being stronger in individuals homozygous for the enhancer compared to individuals heterozygous (Figure 9). For each, T2 individuals homozygous or heterozygous for the triple ZmOCS enhancer insertion were grown in the greenhouse and compared to segregating siblings that did not contain the enhancer insertion. Genotypes were spaced apart to avoid shade effects. Plant height (from ground to the collar of the youngest leaf) was measured periodically throughout development (Figure 10), and at maturity, plant height (from ground to the collar of the flag leaf) and ear height (from ground to the base of the ear) were measured, which showed that in both cases the presence of the triple ZmOCS enhancer led to a statistically significant reduction in both plant height and ear height (Table 5). In both triple ZmOCS enhancer insertion heterozygotes phenotyped, the effect on plant height was weaker than that of the triple ZmOCS enhancer insertion homozygotes (Table 5; Figure 10).

[0119] [Table 10]

[0120] The breadth and scope of the present disclosure should not be limited by any of the above-described exemplary embodiments, but should be defined only in accordance with the following claims and their equivalents.

Claims

1. A corn plant comprising a modified Zm1d31079 gene, wherein a heterologous expression enhancing element is located in the modified gene, and the unmodified Zm1d31079 gene comprises a DNA molecule of SEQ ID NO: 1 or an allelic variant thereof.

2. The corn plant of claim 1 , wherein the modified Zm1d31079 gene and / or the unmodified Zm1d31079 gene encodes a Zm1d31079 protein of SEQ ID NO:2 or an allelic variant thereof.

3. The corn plant of claim 1 , wherein the modified Zm1d31079 gene is located at the native chromosomal location of the unmodified Zm1d31079 gene.

4. The corn plant of claim 1 , wherein the modified Zm1d31079 gene comprises a transgene located at a chromosomal location other than the native chromosomal location of the unmodified Zm1d31079 gene.

5. 2. The corn plant of claim 1, wherein the heterologous expression enhancing element comprises: (i) a heterologous transcription enhancer, a heterologous translation enhancing element, and / or a heterologous intron; or (ii) a heterologous promoter, a heterologous 5'UTR, and / or a heterologous intron.

6. The corn plant of claim 5, wherein the heterologous transcriptional enhancer is located in the promoter, the 5' untranslated region (5' UTR), an intron, a 3' untranslated region (3' UTR), or a 3' flanking region of the modified Zm1d31079 gene.

7. The corn plant of claim 5, wherein the heterologous transcriptional enhancer comprises a DNA molecule set forth in SEQ ID NOs: 16, 17, 19-124, and / or 125.

8. 6. The corn plant of claim 5, wherein the transcription enhancer is located from about 10, 20, 30, 40, 100, or 150 base pairs (bp) to about 200, 240, 300, 350, 400, 500, or 1000 bp 5' of the transcription start site (TSS) of Zm1d31079.

9. the transcription enhancer comprises SEQ ID NO: 16 or 17, and the insertion (i) about 116 to about 96 base pairs or about 106 base pairs 5' to the TSS of the Zm1d31079 gene; (ii) about 119 to about 99 base pairs or about 109 base pairs 5' to the TSS of the Zm1d31079 gene; (iii) about 170 to about 150 base pairs or about 160 base pairs 5' to the TSS of the Zm1d31079 gene; (iv) about 252 to about 232 base pairs or about 242 base pairs 5' to the TSS of the Zm1d31079 gene; (v) about 261 to about 241 base pairs or about 251 base pairs 5' to the TSS of the Zm1d31079 gene; (vi) a double-stranded break introduced into the Zm1d31079 promoter with Cas9 nuclease and a guide RNA encoded by SEQ ID NO: 4, 5, or 6; or (vii) a double-stranded break introduced into the Zm1d31079 promoter with Cas12 nuclease and a guide RNA encoded by SEQ ID NO: 3 or 7; 6. The corn plant of claim 5, wherein said corn plant is located at

10. 6. The corn plant of claim 5, wherein the heterologous intron is located within the 5'UTR and / or coding region of the modified Zm1d31079 gene, and optionally the intron is located within about 500, 200, 100, 50, 30, or 20 base pairs of a transcription start site (TSS).

11. 11. The corn plant of claim 10, wherein the heterologous intron comprises a UBQ, EF-1 alpha, EF-1 beta, histone H3, ATPK1, RHD3, or MHX intron, and optionally the UBQ, EF-1 alpha, EF-1 beta, histone H3, ATPK1, RHD3, or MHX intron is a rice or maize intron.

12. The corn plant of claim 5 , wherein the heterologous translational enhancer is located within the 5′UTR and / or coding region of the modified Zm1d31079 gene.

13. the translation enhancer is encoded by a DNA molecule comprising a DNA sequence including rice alcohol dehydrogenase (OsAdh), glutathione transferase U50 (OsGstU50), glutathione peroxidase 1 (OsGsp1), 20S proteasome α1 subunit (Os20Sα1), pathogenesis-related protein 4b (OsPrp4b), glycine-rich cell wall structural protein 1 (Os Grcwp1), or UspA domain-containing protein (Os UspA) 5′UTR, and all or a part of the OsAdh, Os GstU50, Os20Sα1, OsPrp4b, Os Grcwp1, or Os UspA 5′UTR is expressed by the Zm1d31079 gene in the modified Zm1d31079 gene. The corn plant of claim 12, wherein all or part of the 5'UTR has been replaced.

14. 14. The corn plant of any one of claims 1 to 13, wherein expression of Zm1d31079 is increased in at least one tissue of the corn plant compared to a control corn plant lacking the modified Zm1d31079 gene, and optionally expression of Zm1d31079 is increased in at least culm tissue.

15. 14. The corn plant of any one of claims 1 to 13, wherein the plant height of the corn plant is reduced compared to a control corn plant lacking the modified Zm1d31079 gene, and optionally the plant height is reduced by about 5% or 10% to about 15%, 20%, 30%, or 50% compared to a control corn plant lacking the modified Zm1d31079 gene.

16. The corn plant of any one of claims 1 to 13, which is a hybrid corn plant heterozygous for the modified Zm1d31079.

17. 14. The corn plant of any one of claims 1 to 13, wherein expression of the Zm1d31079 gene product in a plant having the modified Zm1d31079 gene is increased by about 20% to 80% in at least one tissue of the corn plant compared to a control corn plant lacking the modified Zm1d31079 gene.

18. 14. The corn plant of any one of claims 1 to 13, wherein expression of the Zm1d31079 gene product in a plant having the modified Zm1d31079 gene is increased from about 1.2-fold or 1.5-fold to about 2-fold, 3-fold, or 5-fold in at least one corn tissue of the corn plant compared to a control corn plant lacking the modified Zm1d31079 gene.

19. A corn plant part comprising a modified Zm1d31079 gene according to any one of claims 1 to 13.

20. 20. The corn plant part of claim 19, which is a seed, culm, stem, or leaf.

21. 21. The corn plant part of claim 20, wherein the seed further comprises at least a partial coating of a composition comprising a biological agent, a nematicide, an insecticide, or a fungicide.

22. 20. The corn plant part of claim 19, wherein the corn plant seed is a hybrid corn plant seed heterozygous for the modified Zm1d31079.

23. 14. A method of producing corn seed, comprising growing a corn plant according to any one of claims 1 to 13, and harvesting seed therefrom.

24. 14. A method for producing a hybrid corn seed, comprising crossing a corn plant homozygous for the modified Zm1d31079 gene described in any one of claims 1 to 13 with another corn plant homozygous for the modified Zm1d31079 gene, and harvesting seeds from pollinators of the cross.

25. 14. A method for producing a corn plant containing an additional desired trait, the method comprising introducing a transgene, targeted genetic change, and / or locus that confers the desired trait into the corn plant of any one of claims 1 to 13.

28. 14. A method for making a commodity corn plant product, the method comprising: (i) processing the corn plant of any one of claims 1-13, or corn seeds obtained therefrom; and (ii) recovering the commodity corn plant product from the processed corn plant or corn seeds.

29. 30. The method of claim 28, wherein the commodity corn plant product is a seed meal, starch, syrup, silage, oil, or protein.

30. 30. The method of claim 29, wherein the commercial corn plant product comprises a detectable amount of a DNA molecule comprising the heterologous transcriptional enhancer, the heterologous translational enhancing element, and / or the heterologous intron located in a DNA fragment of the modified Zm1d31079 gene.

31. A biological sample comprising a detectable amount of a DNA molecule comprising a heterologous transcriptional enhancer, a heterologous intron, and / or a heterologous translational enhancing element located in a DNA fragment of a modified Zm1d31079 gene.

32. 32. The biological sample of claim 31 , wherein the biological sample comprises material obtained from a corn plant or a part thereof according to any one of claims 1 to 13, said part optionally being a seed.

33. 32. The biological sample of claim 31, which is non-renewable.

34. 34. The biological sample of claim 33, comprising corn seed meal.

35. A method for producing a corn plant according to any one of claims 1 to 3 or 5 to 13, comprising the steps of: (a) contacting a gene editing molecule comprising a first site-specific nuclease that introduces a double-stranded DNA break in the promoter region, 5' UTR, coding region, 3' UTR, or 3' flanking region of an unmodified Zm1d31079 gene comprising a DNA molecule of SEQ ID NO:1 or an allelic variant thereof; and a donor DNA template or other DNA template comprising a heterologous expression-enhancing element with a corn plant genome; and (b) selecting a corn plant comprising a modified Zm1d31079 gene, wherein the modified Zm1d31079 gene comprises an insertion of the heterologous expression-enhancing element in the promoter region, the 5' UTR, the coding region, the 3' UTR, or the 3' flanking region of the gene, wherein expression of the modified Zm1d31079 gene is increased in at least one tissue, and wherein the plant height of the corn plant comprising the modified Zm1d31079 gene is reduced compared to a control corn plant lacking the modified Zm1d31079 gene. The method includes:

36. 36. The method of claim 35, wherein the heterologous expression enhancing element comprises a heterologous transcription enhancer, a heterologous translation enhancing element, and / or a heterologous intron.

37. The method of claim 36, wherein the double-stranded break is introduced into the promoter, the 5' untranslated region (5' UTR), an intron, a 3' untranslated region (3' UTR), or a 3' flanking region of the unmodified Zm1d31079 gene, and the donor DNA template or other DNA template comprises the heterologous transcriptional enhancer.

38. The method of claim 37, wherein the transcription enhancer comprises a DNA molecule set forth in SEQ ID NO: 16, 17, 19-124, and / or 125.

39. 38. The method of claim 37, wherein the double-stranded break is introduced about 10, 20, 30, 40, 100, or 150 base pairs (bp) to about 200, 240, 300, 350, 400, 500, or 1000 bp 5' from the transcription start site (TSS) of Zm1d31079.

40. the transcription enhancer comprises SEQ ID NO: 16 or 17, and the double-stranded break is (i) about 116 to about 96 base pairs or about 106 base pairs 5' to the TSS of the Zm1d31079 gene; (ii) about 119 to about 99 base pairs or about 109 base pairs 5' to the TSS of the Zm1d31079 gene; (iii) about 170 to about 150 base pairs or about 160 base pairs 5' to the TSS of the Zm1d31079 gene; (iv) about 252 to about 142 base pairs or about 242 base pairs 5' to the TSS of the Zm1d31079 gene; (v) about 261 to about 241 base pairs or about 251 base pairs 5' to the TSS of the Zm1d31079 gene; (vi) the Zm1d31079 promoter with a Cas9 nuclease and a guide RNA encoded by SEQ ID NO: 4, 5, or 6; or (vii) the Zm1d31079 promoter with Cas12 nuclease and a guide RNA encoded by SEQ ID NO: 3 or 7.

40. The method of claim 39, wherein the

41. The method of claim 35, wherein the donor DNA template or other DNA template contains a heterologous translational enhancer and the double-stranded break is introduced within the 5'UTR and / or coding region of the unmodified Zm1d31079 gene.

42. The method of claim 41, wherein the translation enhancer is encoded by a DNA molecule comprising a DNA sequence of rice alcohol dehydrogenase (OsAdh), glutathione transferase U50 (OsGstU50), glutathione peroxidase 1 (OsGsp1), 20S proteasome alpha 1 subunit (Os20Sα1), pathogenesis-related protein 4b (OsPrp4b), glycine-rich cell wall structural protein 1 (OsGrcwp1), or UspA domain-containing protein (OsUspA) 5'UTR, and all or a portion of the OsAdh, OsGstU50, Os20Sα1, OsPrp4b, OsGrcwp1, or OsUspA 5'UTR is replaced with all or a portion of the Zm1d31079 5'UTR of the modified Zm1d31079 gene.

43. The method of claim 35, wherein the DNA donor template or other DNA template comprises a heterologous intron and the double-stranded break is introduced within the 5'UTR and / or coding region of the modified Zm1d31079 gene, and optionally the double-stranded break is introduced within about 500, 200, 100, 50, 30, or 20 base pairs of a TSS.

44. 44. The method of claim 43, wherein the heterologous intron comprises a UBQ10, EF-1 alpha, EF-1 beta, histone H3, ATPK1, RHD3, or MHX intron, optionally wherein the UBQ10, EF-1 alpha, EF-1 beta, histone H3, ATPK1, RHD3, or MHX intron comprises a rice or maize intron.

45. A method for producing a corn plant according to any one of claims 1 to 2 or 4 to 13, comprising the steps of: (a) contacting a transgene comprising a modified Zm1d31079 gene with a corn plant genome, the modified Zm1d31079 gene comprising a heterologous promoter, a heterologous 5′ UTR, and / or a heterologous intron operably linked to a coding region encoding a Zm1d31079 protein of SEQ ID NO:2 or an allelic variant thereof; and (b) selecting a transgenic corn plant comprising the modified Zm1d31079 gene, wherein expression of the modified Zm1d31079 gene is increased in at least one tissue, and wherein the plant height of the corn plant is reduced compared to a control corn plant lacking the modified Zm1d31079 gene. The method includes:

46. 46. ​​The method of claim 45, wherein the promoter is a ubiquitin promoter, an actin promoter, or a plant viral promoter, optionally wherein the plant viral promoter comprises a caulimovirus promoter.

47. 46. ​​The method of claim 45, wherein the heterologous intron comprises a UBQ, EF-1 alpha, EF-1 beta, histone H3, ATPK1, RHD3, or MHX intron, optionally wherein the UBQ, EF-1 alpha, EF-1 beta, histone H3, ATPK1, RHD3, or MHX intron comprises a rice or maize intron.

Images