Analysis, screening and selection of soluble protein functions in secreted protein cellular libraries

Abstract

Disclosed herein are methods, compositions, systems and kits relating to the functional testing of soluble polypeptides in a single cell format.

Description

[Technical field]

[0001] [CROSS REFERENCE TO RELATED APPLICATIONS] This application claims priority to U.S. Provisional Application No. 63 / 299,315, filed January 13, 2022, and U.S. Provisional Application No. 63 / 398,085, filed August 15, 2022. The entire contents of both applications are incorporated herein by reference.

[0002] [STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT] This invention was made with Government support under DP5OD23118 awarded by the National Institutes of Health. The Government has certain rights in this invention.

[0003] [Reference to electronic sequence listing] The contents of the electronic sequence listing (631020.00153.xml; size: 36,358 bytes; created on November 8, 2022) are incorporated herein by reference in their entirety.

[0004] The present technology generally relates to methods and compositions useful for the analysis and screening of soluble peptides, for example, as applied in the field of drug discovery. The methods, systems, kits and compositions disclosed herein provide tools for rapid, efficient and accurate screening and selection of active antibodies, proteins or peptides from large libraries of antibodies, proteins or peptides. [Background technology]

[0005] Many assays for drug discovery that analyze the function of soluble proteins require significant amounts of purified protein and test protein function in well plates using low-throughput or medium-throughput (<10,000) assays. Examples include cell-based assays, virus neutralization assays, or cell activity-based protein function activation assays. Most critically for biotechnological discovery purposes, the process of expressing, purifying, and analyzing proteins is not easily compatible with direct selection of functional protein or peptide variants from variant libraries. Important examples of drug classes that frequently require soluble screening or cell activity-based assays to test function include antibodies, proteins or peptides that neutralize viruses, antibodies, proteins or peptides that activate surface cell receptors, and antibodies, proteins or peptides that block activation of surface cell receptors. Thus, there is a demand for improved and rapid assays for soluble protein or peptide function. Summary of the Invention

[0006] Disclosed herein are methods, compositions, systems and kits relating to the functional testing of soluble polypeptides in a single cell format.

[0007] In some aspects, a screening method is provided.

[0008] In some embodiments, the method comprises (a) detecting the presence and / or level of expression of a reporter molecule in an isolated, genetically engineered single cell, the cell displaying a cell surface protein, the cell being engineered to (i) secrete a heterologous test polypeptide and (ii) express the reporter molecule when the test polypeptide activates the cell surface protein.

[0009] In some embodiments, the method comprises (a) detecting the presence and / or level of expression of a reporter molecule in an isolated, genetically engineered single cell, the cell displaying a cell surface protein, the cell being engineered to (i) secrete a heterologous test polypeptide, and (ii) express the reporter molecule when the test polypeptide does not activate the cell surface protein.

[0010] In some embodiments, the method includes the steps of: (a) contacting an isolated, genetically engineered single cell with a test reagent, where the cell displays a surface protein and the cell has been engineered to (i) secrete a heterologous test polypeptide and (ii) express a reporter molecule when the test polypeptide or one of the test reagents activates the cell surface protein; and (b) detecting the presence and / or level of expression of the reporter molecule.

[0011] In some embodiments, the method includes the steps of: (a) contacting an isolated, genetically engineered single cell with a test reagent comprising a reporter molecule, where the cell displays a cell surface protein, and the test reagent is capable of binding to the cell surface protein displayed by the cell and forming a reagent-receptor complex, whereupon the test reagent gains entry into the cell, and the cell (i) has been engineered to secrete a heterologous test polypeptide; and (b) detecting the presence and / or level of expression of the reporter molecule in the cell.

[0012] In some embodiments of the foregoing methods, the cell comprises a mammalian cell, an insect cell, an avian cell, a yeast cell, a fungal cell, a plant cell, or a bacterial cell.

[0013] In some embodiments, the cell surface protein comprises an endogenous protein. In some embodiments, the cells are engineered to express the cell surface protein. In some embodiments, the cell surface protein comprises a heterologous protein.

[0014] In some embodiments, secretion of the test polypeptide is constitutive. In some embodiments, secretion of the test polypeptide is inducible.

[0015] In some embodiments, isolated, genetically engineered single cells are within a well of a multi-well plate, within a chamber of a microchip in a microfluidic droplet, such as an emulsion droplet, or within a Nanoopen™.

[0016] In some embodiments of the aforementioned methods, the reporter molecule comprises a fluorescent marker, an enzyme, a tagged protein, or a nucleic acid sequence.

[0017] In some embodiments, the cells comprise human cells.

[0018] In some embodiments, the reporter molecule comprises a nucleic acid sequence, optionally a barcode sequence, and detecting the presence and / or level of expression of the reporter molecule comprises one or more of an amplification reaction and a sequencing reaction, optionally a single cell sequencing reaction.

[0019] In some embodiments, the reporter molecule comprises a fluorescent moiety, and detecting the presence and / or level of expression of the reporter molecule comprises fluorescence activated cell sorting.

[0020] In some embodiments, the method further comprises sequencing a nucleic acid encoding the heterologous test polypeptide.

[0021] In some embodiments, the heterologous test peptides comprise variants of the receptor ligand.

[0022] In some embodiments, the variants are derived from a library of ligand variants.

[0023] In some embodiments, the test polypeptide comprises a variant of a cell surface protein ligand, and the test reagent comprises an agonist or antagonist of protein activation by the wild-type ligand.

[0024] In some embodiments, the test reagent comprises a cell surface protein ligand and the test polypeptide is derived from a library of potential agonists or antagonists of receptor activation by the ligand. In some embodiments, the test polypeptide comprises an antibody or antigen-binding fragment thereof. In some embodiments, the antibody or antigen-binding fragment is derived from a library of antibodies or antigen-binding fragments.

[0025] In some embodiments, the test reagent comprises one or more of a virus, a virus-like particle, a pseudovirus, and a recombinant virus particle, and the cell surface protein comprises a component of viral entry into a cell. In some embodiments, the virus is selected from coronavirus A, B, C, or D, flavivirus, lentivirus, influenza A, B, or C. In some embodiments, the virus is selected from HIV, SARS-CoV-2, Esptein-Barr virus, herpes simplex virus, cytomegalovirus, respiratory syncytial virus, Ebola virus, Marburg virus, Dengue virus, and yellow fever virus. In some embodiments, the virus comprises SARS-CoV-2 virus, and the cell surface protein comprises human angiotensin-converting enzyme 2 (hACE2), and in some embodiments, the cell is engineered to express transmembrane serine protease 2 (TMPRSS2).

[0026] In some aspects, a composition, kit, or system is provided that comprises the genetically engineered cell of any of the preceding embodiments.

[0027] In some aspects, a kit is provided.

[0028] In some embodiments, the kit comprises: (a) a vector encoding a heterologous test polypeptide; (b) a vector encoding a reporter molecule, the expression of which is activated when the heterologous test polypeptide activates a cell surface protein, where one or more of the vectors may be an expression vector or where one or more of the vectors may be an integration vector.

[0029] In some embodiments, the kit comprises: (a) a vector encoding a heterologous test polypeptide; (b) a vector encoding a reporter molecule, the expression of which is activated when the heterologous test polypeptide does not activate a cell surface protein, wherein one or more of the vectors may be an expression vector, or wherein one or more of the vectors may be an integration vector.

[0030] In some embodiments, the kit comprises (1) a test reagent; and (2) (a) a vector encoding a heterologous test polypeptide; (b) a vector encoding a reporter molecule, the expression of which is activated upon activation of a cell surface protein by either the heterologous test polypeptide or the test reagent, wherein one or more of the vectors may be an expression vector or wherein one or more of the vectors may be an integration vector.

[0031] In some embodiments, the kit includes (1) a test reagent comprising a reporter molecule, and (2)(a) a vector encoding a heterologous test polypeptide, where one or more of the vectors may be an expression vector, or where one or more of the vectors may be an integration vector.

[0032] In some embodiments of any of the foregoing kits, the one or more nucleic acids further encode (c) a cell surface protein. In some embodiments, the heterologous test polypeptide is operably linked to a promoter. In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter is an inducible promoter.

[0033] In some embodiments, the reporter molecule comprises a fluorescent marker, an enzyme, a tagged protein, or a nucleic acid sequence.

[0034] In some embodiments, the test reagents include viruses, virus-like particles, pseudoviruses, and recombinant virus particles. In some embodiments, the virus is selected from coronavirus A, B, C, or D, flavivirus, lentivirus, and influenza A, B, or C. In some embodiments, the virus is selected from HIV, SARS-CoV-2, Esptein-Barr virus, herpes simplex virus, cytomegalovirus, respiratory syncytial virus, Ebola virus, Marburg virus, dengue virus, and yellow fever virus. In some embodiments, the pseudovirus includes a peptide, polypeptide, or protein derived from coronavirus A, B, C, or D, flavivirus, lentivirus, or influenza A, B, or C. In some embodiments, the pseudovirus includes a peptide, polypeptide, or protein derived from HIV, SARS-CoV-2, Esptein-Barr virus, herpes simplex virus, cytomegalovirus, respiratory syncytial virus, Ebola virus, Marburg virus, dengue virus, or yellow fever virus.

[0035] In some embodiments, the heterologous test peptide comprises an antibody or a portion thereof, hi some embodiments, the heterologous test peptide is a single chain variable region fragment (scFv) or a nanobody.

[0036] In some embodiments, the kit includes (1) a vector for expressing a heterologous test polypeptide; and (2) a genetically engineered cell that contains (a) a nucleic acid encoding a reporter, the expression of which is activated when the heterologous test polypeptide activates a cell surface protein.

[0037] In some embodiments, the kit includes (1) a vector for expressing a heterologous test polypeptide; and (2) a genetically engineered cell that contains (a) a nucleic acid encoding a reporter, the expression of which is activated when the heterologous test polypeptide does not activate a cell surface protein.

[0038] In some embodiments, the kit includes (1) a vector for expressing a heterologous test polypeptide, (2) a genetically engineered cell that contains (a) a nucleic acid encoding a reporter, the expression of which is activated when the heterologous test polypeptide activates a cell surface protein, and optionally (3) a test reagent.

[0039] In some embodiments, the kit comprises: (1) a vector for expressing a heterologous test polypeptide; (2) genetically engineered cells; and (3) a test reagent comprising a reporter molecule that can bind to a cell surface protein presented by the cell and form a reagent-receptor complex, which upon formation of the reagent-receptor complex gains entry into the cell.

[0040] In some embodiments of any of the aforementioned kits, the genetically engineered cell further comprises (c) a nucleic acid encoding a heterologous cell surface protein. [Brief description of the drawings]

[0041] [Figure 1a-b] Figure 1a shows the receptor expression plasmids used to modify cell lines to be permissive for virus or pseudovirus entry (a) SARS-CoV-2. Figure 1b shows the receptor expression plasmids used to modify cell lines to be permissive for virus or pseudovirus entry (b) HIV. [Diagram 2] Generation of cells expressing ACE2 and TMPRSS2 against SARS-CoV-2 infection that are also capable of antibody secretion, allowing large-scale compartment-based library screening of antibodies SARS-CoV-2. [Diagram 3]The generation of cell lines contains ACE2, TMPRSS2 and IgG genes, allowing neutralization assays to be performed on a single cell basis by linking protein secretion (in this case, IgG) to viral infection, along with a functional readout for infection. [Figure 4a] Development of cell lines for single-cell SARS-CoV-2 neutralization assays. (a) Incorporation of ACE2 and TMPRSS2 into site-specific TARGATT cell lines for transgene insertion. [Figure 4b] Development of cell lines for single-cell SARS-CoV-2 neutralization assays. (b) Paired VH:VL library cloning in TARGATT cells. [Diagram 5] Assessment of SARS-CoV-2 pseudovirus infectivity using different amounts of virus by flow cytometry analysis. [Figure 6a-b] Figure 6a shows two examples of vectors that can enable secretion of proteins or peptides: (a) pCMV-EF1a vector. In this case, the secreted protein is IgG. Figure 6b shows two examples of vectors that can enable secretion of proteins or peptides: (b) vector map of pBI vector. In this case, the secreted protein is IgG. [Figure 7] ELISA quantification comparison of IgG yield for transient IgG expression. Combinations of different leader peptide sequences can provide different levels of secreted protein expression. [Figure 8] An FRT / FLP-based site-specific integration system for IgG expression. [Figure 9] An integrase-based site-specific integration system for IgG expression. [Figure 10] CRISPR / Cas9 homology-directed repair system to express IgG in cell lines for analysis of soluble protein function. [Figure 11] Overview of several possible secreted protein expression platforms for cloning libraries into mammalian cells for secreted protein assays. [Figure 12a-b] Figure 12a: Expression of IgG in a unidirectional format. (a) Expression of IgG as single chain variable region fragments. Figure 12b: Expression of IgG in a unidirectional format. (b) Expression of complete IgG in a bicistronic format with p2A truncation peptide. [Figure 13] Neutralizing activity of VRC01 and 910-30 by flow cytometry in HEKACE2 cells. [Figure 14a-b] Figure 14a: Antibody secretion and SARS-CoV-2 infection coupled for neutralization assay. (a) ELISA standard curve of IgG secreted by HEK293-ACE2. The concentration of secreted mAb is reported above each bar. IgG-secreting cells prevented pseudovirus infection. 910-30 SARS-CoV-2 IC50 is approximately 0.2 μg / mL. Figure 14b: Antibody secretion and SARS-CoV-2 infection coupled for neutralization assay. (b) 96-well neutralization assay of HEK293-ACE2 cells expressing neutralizing mAbs (groups 1, 2, 5, 6) or non-neutralizing mAbs (groups 3 and 4) with two different leader peptides (LP4 or LP5). The concentration of secreted mAb is reported above each bar. IgG-secreting cells prevented pseudovirus infection. 910-30 SARS-CoV-2 IC50 is approximately 0.2 μg / mL. [Figure 15a-b] Figure 15a: Single cell isolation and antibody secretion in emulsion droplets. (a) Single cells were encapsulated in 80 μm droplets and analyzed by light microscopy. Supernatants were collected and analyzed by ELISA to determine antibody concentration (avg.+ / -st.dev.). Concentrations in droplets rapidly exceeded 0.5 μg / mL by day 2. *Extrapolation slightly above standard curve. Figure 15b: Single cell isolation and antibody secretion in emulsion droplets. (b) Cells were incubated either in bulk cell culture or in droplets and allowed to secrete antibody. Supernatants were collected and analyzed by ELISA to determine antibody concentration (avg.+ / -st.dev.). Concentrations in droplets rapidly exceeded 0.5 μg / mL by day 2. *Extrapolation slightly above standard curve. [Figure 16a-b]Figure 16a is an example of a high-throughput single-cell neutralization assay for mapping naturally paired human antibodies against diverse SARS-CoV-2 variants. (a) Single TARGATT-HEK293-ACE2 cells secreting antibodies are captured inside emulsion droplets. DNA amplicons of the sorted library are recovered for quantitative analysis and subsequent antibody expression. The renewable library can be screened against diverse SARS-CoV-2 pseudoviruses separately or repeatedly against a pseudovirus panel to select for broad vs. strain-specific antibodies. Figure 16b is an example of a high-throughput single-cell neutralization assay for mapping naturally paired human antibodies against diverse SARS-CoV-2 variants. (b) After approximately 24 hours of antibody secretion, single-cell droplets are mixed with SARS-CoV-2 pseudovirus droplets. Cells secreting neutralizing antibodies at sufficient concentrations are protected from infection. Non-infected GFP- cells can be advanced to multiple screening rounds. DNA amplicons of the sorted libraries are recovered for quantitative analysis and subsequent antibody expression. The renewable libraries can be screened against diverse SARS-CoV-2 pseudoviruses separately or repeatedly against pseudovirus panels to select for broad vs. strain-specific antibodies. [Figure 16c] Example of a high-throughput single-cell neutralization assay to map naturally paired human antibodies against diverse SARS-CoV-2 variants. (c) Cells are sorted into GFP- and GFP+ populations. Uninfected GFP- cells can proceed to multiple screening rounds. DNA amplicons of the sorted library are recovered for quantitative analysis and subsequent antibody expression. Renewable libraries can be screened against diverse SARS-CoV-2 pseudoviruses separately or repeatedly against pseudovirus panels to select for broad vs. strain-specific antibodies. [Figure 17]Neutralization detection of Yellow Fever Virus (YFV) in anti-YFV monoclonal antibody-secreting cells. Cells secreting mAb-17 were protected from YFV RVP infection. Cells not expressing mAb-17 were infected with RVP as demonstrated by GFP expression after RVP exposure. [Figure 18a-b] Figure 18a: ELISA quantification of antibody expression using different leader peptide and promoter combinations. (a) Table of leader peptide amino acid sequences and leader peptide pair names. Figure 18b: ELISA quantification of antibody expression using different leader peptide and promoter combinations. (b) Plasmid diagram of the dual promoter consisting of the minimal human cytomegalovirus (miniCMV) bidirectional promoter to drive expression of the antibody heavy and light chains, and CMV to express the antibody heavy chain and human elongation factor-1 alpha (Ef1α) to drive expression of the light chain. [Fig. 18c-d] Figure 18c shows ELISA quantification of antibody expression using different leader peptide and promoter combinations. (c) Sandwich ELISA quantification of VRC01 transient expression levels using different leader peptide combinations in each vector. Figure 18d shows ELISA quantification of antibody expression using different leader peptide and promoter combinations. (d) Sandwich ELISA quantification of CR3022 transient expression levels using different leader peptide combinations in each vector. [Figure 19] CRISPR-Cas9 integration system for antibody secretion in mammalian cells. [Figure 20] Neutralization was demonstrated using the CRISPR-Cas9 integration system for antibody secretion. [Figure 21] Quantification of cell-secreted antibodies demonstrated that antibody secretion could be achieved using CRISPR-Cas9. [Figure 22] Validation of CRISPR-Cas9-based genomic insertion of antibody genes into mammalian cells. [Diagram 23] TARGATT gene integration of mAb 2-15 sequence. [Figure 24] Neutralizing activity of anti-SARS-CoV2 antibody, 2-15, secreted from TARGATT12-15 cells. [Diagram 25] Quantification of antibody secretion from TARGATT2-15 cells. [Figure 26a-b] Figure 26a (a) Gel electrophoresis of genomic PCR using the downstream primer set verifies successful gene integration in TARGATT2-15 cells, and Figure 26b (b) PCR reaction using the human control primer set as an internal PCR control (panel b). [Figure 27] HIV-1 neutralization detection in cells secreting anti-HIV-1 monoclonal antibodies. Cells secreting VRC34 were protected from HIV-1 pseudovirus infection; cells not expressing VRC34 were infected with pseudovirus as demonstrated by GFP expressed after W6M.EnV.C2 HIV-1 pseudovirus exposure. n=2 replicates were performed for each condition. Initial cell density was 2,500 cells / well. Dilutions were made with pseudovirus particles; cell number and antibody concentration were kept constant across pseudovirus dilutions. WT-wild type, NC-negative control (no pseudovirus particles added). [Figure 28] Droplet mixing using electrofusion. Top: Droplet mixing is off. Droplets containing cells and droplets containing rhodamine are clearly separated both in bright field and when measuring rhodamine fluorescence. Bottom: Droplet mixing is on using an electric field with a setting of 1.6 V. Droplets containing cells are mixed with rhodamine 110 dye for visibility using a microscope, as shown in the rhodamine 110 channel. Arrows indicate the presence of cells within the droplets. When the droplet mixing voltage is "off", rhodamine is not present in the cell-containing droplets, and when the droplet mixing voltage is "on", rhodamine is present in the droplets containing cells, indicating successful droplet mixing. [Figure 29]PCR amplification of variable heavy chain sequences from cell lines analyzed in high-throughput assays. Cell population libraries were sorted for GFP- or GFP+ expression using a flow cytometer prior to DNA recovery. These data demonstrate our ability to recover cellular DNA sequences that are utilized in high-throughput droplet-based cell-secreted protein functional assays. [Diagram 30] Conducting a SARS-CoV-2 droplet neutralization assay with synthetic libraries. HEK293 / ACE2 cells expressing either VRC01, CR3022 910-30 or mAb 1-20 were pooled and single cells were captured and allowed to secrete antibodies for 24 h. Droplets containing cells and antibodies were mixed with droplets containing SARS-CoV-2 D614G RVP and allowed to infect for 24 h. After infection, cells were harvested from the droplets and left to stand. After 2 days, GFP- / mCherry+ (no cells infected / mAb producing) and GFP+ / mCherry+ (cells infected / mAb producing) cells were sorted. gDNA was extracted from both populations for sequencing and 10% of the harvested GFP- / mCherry+ cells were grown for a second round of droplet neutralization assays. Zero reads were observed for several clones in the GFP+ population, reflecting a complete lack of infection events for these neutralizing antibody clones, providing the expected results with very high assay precision. Division for clonal fraction of read fold change, defined as (GFP- read prevalence / GFP+ read prevalence), can introduce error by dividing by zero when there are zero reads available (e.g., indicating complete neutralization within a droplet for a particular antibody clone). Mathematically, the closest approximation of division by zero is infinity, but these fold changes were artificially estimated here with a value of 9,999 for comparison with other clones. [Diagram 31]Droplet neutralization assay using HIV-1 pseudovirus with synthetic library. TZM / GFP cells expressing either 72A1, VRC01 or VRC34 were pooled. Single cells were then captured and allowed to secrete antibodies for 24 hours. Droplets containing cells and antibodies were then mixed with droplets containing HIV pseudovirus (generated with sequence BG505.W6M.Env.C2) and allowed to infect for 24 hours. After infection, cells were harvested from the droplets and left alone. After 2 days, GFP- / mCherry+ (no cell infection / mAb production) and GFP+ / mCherry+ (cell infection / mAb production) cells were sorted. gDNA was extracted from both populations. Non-neutralizing antibodies (72A1) were highly enriched in the GFP+ population and showed low neutralizing activity. This figure demonstrates the ability to successfully perform neutralization assays within droplets for HIV-1 pseudovirus assays using NGS analysis of sorted cell libraries. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0042] The invention is described herein below using several definitions that are set out throughout the application.

[0043] Unless otherwise specified or indicated by context, the terms "a," "an," and "the" mean "one or more." For example, "an inhibitor of tumor cell aggregation" should be interpreted as meaning "one or more inhibitors of tumor cell aggregation."

[0044] As used herein, "about," "approximately," "substantially," and "significantly" are understood by those of ordinary skill in the art and vary to some extent depending on the context in which they are used. If there are uses of these terms that are not clear to those of ordinary skill in the art given the context in which they are used, "about" and "approximately" mean ±10% or less of the particular term, and "substantially" and "significantly" mean ±10% or more of the particular term.

[0045] As used herein, the terms "include" and "including" have the same meaning as the terms "comprise" and "comprising," which are "open" transitional phrases that do not limit the scope of the claim to only the recited elements that follow the transitional phrase. The term "consisting of" is encompassed by the term "comprising," but should be interpreted as a "closed" transitional phrase that limits the scope of the claim to only the recited elements that follow the transitional phrase. The term "consisting essentially of" is encompassed by the term "comprising," but should be interpreted as a "partially closed" transitional phrase that allows for additional elements that follow the transitional phrase, but only if those additional elements do not materially affect the basic and novel characteristics of the claim.

[0046] As used herein, the terms "protein," "peptide," and "polypeptide" are used interchangeably.

[0047] As used herein, the term "microwell" is defined as a sealed or partially sealed compartment having at least one dimension of diameter or width between 0.1 microns and 4,999 microns. One or two of the other dimensions of the microwell may or may not be open and connected to a wider reservoir.

[0048] Disclosed herein are rapid, high-throughput and cost-effective methods, compositions, systems and kits for the functional screening of soluble protein libraries.

[0049] By way of example, as described herein, cell lines permissive for virus infection and concomitant antibody secretion were generated and the virus neutralizing characteristics of the produced antibodies were analyzed.

[0050] In some embodiments, cell lines are generated that are susceptible to SARS-CoV-2 infection and also secrete antibodies or antigen-binding fragments thereof. In some embodiments, the ability of the secreted antibodies to neutralize, prevent, or reduce viral infection (SARS-coV-2 infection) of antibody-secreting cells is analyzed.

[0051] In some embodiments, cell lines are generated that are susceptible to HIV infection and also secrete anti-HIV antibodies. In some embodiments, the ability of the secreted antibodies to neutralize, prevent, or reduce viral infection (HIV infection) of antibody-secreting cells is analyzed.

[0052] In some embodiments, a cell line that is already permissive for viral infection (eg, Raji-DC-SIGN harboring yellow fever virus recombinant viral particles) is used.

[0053] In some embodiments, antibody expression can be engineered into a mammalian cell line that can be naturally infected with a virus. In some embodiments, the cell line is engineered to express at least one component of viral entry (e.g., a heterologous cell surface molecule).

[0054] In some embodiments, a heterologous polypeptide (such as a potential ligand or a potential ligand receptor antagonist or agonist) is expressed in a cell line generated for the analysis of ligand receptor agonism or antagonism (e.g., for the PD-1 surface receptor).

[0055] [Screening method]

[0056] Alternative approaches for the functional analysis of secreted polypeptide molecules currently known in the prior art require multi-cell droplet compartmentalization along with sorting of sensor cells and polypeptide-secreting cells, as shown for example (for example by the microfluidic functional sorting service sold by the company AbCheck, as well as by Lin et al. (Lin, W. et al., (2022). Rapid microfluidic platform for screening and enrichment of cells secreting virus neutralizing antibodies. Lab on a Chip, 22(13), 2578-2589). These dual-cell-in-single-droplet approaches generally have a much lower throughput compared to single-cell droplet systems. Furthermore, these platforms present technical complexities to allow sorting and selection of droplets containing multiple cells. In contrast, our approach allows the recovery of polypeptide-secreting cells linked to a selection marker related to the activity of the antibody, allowing easy selection of cells showing the desired activity.

[0057] Several alternative published approaches focus on viral neutralization (e.g., blocking ACE2 binding to the SARS-CoV-2 fusion protein (e.g., Shiakolas, AR, Kramer, KJ, Johnson, NV, Wall, SC, Suryadevara, N., Wrapp, D., Periasamy, S., Pilewski, KA, Raju, N., Nargi, R., Sutton, RE, Walker, LM, Setliff, I., Crowe, J. E., Bukreyev, A., Carnahan, RH, McLellan, JS & Georgiev, IS Effective discovery of SARS-CoV-2-neutralizing antibodies via B cell receptor sequencing and ligand blocking. Nat Secreted polypeptides can be screened for interference with receptor binding as a proxy signal for polypeptide activity, including by screening for receptor-specific agonists (see, for example, Fabry-Perot ELISA). Biotechnol (2022). doi:10.1038 / s41587-022-01232-2).

[0058] However, screening for receptor binding inhibition does not directly screen for neutralization, and there are many antibodies that will be missed from the selection round when screening for interference with receptor binding. Furthermore, screening for ligand blocking cannot efficiently select agonistic antibodies. In contrast, here we demonstrate the ability to directly use current technology to screen for neutralizing and agonistic antibodies.

[0059] As disclosed herein, it is highly advantageous to achieve high throughput assays using single cells rather than multiple cells in droplets to improve throughput and assay simplicity.Furthermore, being able to sort single cells rather than droplets is advantageous because droplet sorting often requires specialized and / or customized equipment to perform, whereas single cells can be sorted using a wider range of cell equipment (e.g., various types of FACS machines available from multiple different vendors).

[0060] Some alternative approaches include polypeptide-secreting cells within droplets (e.g., Gerard, A., Woolfe, A., Mottet, G., Reichen, M., Castrillon, C., Menrath, V., Ellouze, S., Poi tou, A., Doineau, R., Briseno-Roa, L., Canales-Herrerias, P., Mary, P., Rose, G., Ortega, C., Delince, M., Essono, S., Jia, B., Iannas coli, B., Goff, O. R.-L., Kumar, R., Stewart, S. N., Pousse, Y., Shen, B., Grosselin, K., Saudemont, B., Sautel-Caille, A., Godina, A., McNamara, S., Eyer, K., Millot, G. A., Baudry, J., England, P., Nizak, C., Jensen, A., Griffiths, A. D., Bruhns, P. & Brenan, C. High-throughput single-cell activity-based screening and sequencing of antibodies using droplet microfluidics. Nature Biotechnology 1-7 (2020). doi:10.1038 / s41587-020-0466-7), for example, by performing a binding assay screen for antibody-secreting plasma cells. However, these techniques require complex and inefficient droplet-based sorting, and the use of transduced cells precludes most neutralization assays and selection of agonist or antagonist molecules against membrane proteins such as GPCRs. In contrast, our approach allows cells to be directly sorted using standard FACS equipment, and its adaptability to a wide range of membrane protein-based selections and virus neutralization assays represents a major advantage compared to techniques described in the prior art.

[0061] The procedures described herein can be carried out, if desired, by sorting cell droplets on a microfluidic chip as one variation of the procedure (e.g., sorting the droplets before breaking the emulsion to recover the cells).

[0062] In one aspect of the present disclosure, a screening method is provided.In some embodiments, the screening method comprises (a) detecting the presence and / or level of expression of a reporter molecule in an isolated and genetically engineered single cell, the cell presenting a cell surface protein, the cell being engineered to (i) secrete a heterologous test polypeptide, and (ii) express the reporter molecule when the test polypeptide activates the cell surface protein.

[0063] As used herein, "presenting a cell surface protein" refers to a cell of interest having a cell surface protein localized to the cell surface. The localization of the cell surface protein may depend on the intrinsic molecular properties of the cell surface protein itself. Furthermore, the localization of the cell surface protein may be required for the function of the protein. In some embodiments, the cell surface protein is an integral membrane protein. In some implementations, the cell surface protein is localized to the cell surface by a glycosylphosphatidylinositol (GPI) moiety. In some embodiments, the cell surface protein can transmit a signal across the cell membrane into the cell. In other embodiments, the cell surface protein is present to allow the entry of a test reagent, which may include, for example, a reporter molecule. In some embodiments, the cell surface protein is expressed by the cell and then localized to the cell membrane. In other embodiments, the cell surface protein is delivered to the cell by means known in the art, such as exosomes, microvesicles, liposomes, etc.

[0064] As used herein, a "cell surface protein" is any cell surface associated protein or polypeptide. In some embodiments, a cell surface protein is a protein for which a ligand can transmit a signal within a cell upon receptor ligation. Thus, in some embodiments, a cell surface protein comprises a cell surface receptor.

[0065] As used herein, "detecting" refers to obtaining information provided by one or more reporters in a cell. Thus, in some embodiments, detection can be performed by automated equipment, such as a flow cytometer, a fluorometer, a luminometer, a microscope, a digital camera, a plate reader, etc., or by the human eye. In other embodiments, detection is performed using techniques related to nucleic acid sequencing, such as Sanger sequencing, next generation sequencing (NGS), single cell RNA sequencing (scRNA-seq), etc.

[0066] As used herein, a "reporter molecule" refers to a molecule expressed by a cell of interest that indicates a particular molecular state of the cell. For example, in some embodiments, a cell line is engineered to provide a signal (e.g., expression of a reporter molecule) in response to receptor agonism or antagonism. Thus, the reporter molecule indicates the state of the cell, i.e., whether the receptor of interest is ligated or prevented from being ligated. Exemplary reporter molecules include, but are not limited to, fluorescent proteins, luminescent proteins, enzymes, tagged proteins, and nucleic acid sequences.

[0067] Exemplary fluorescent proteins include, but are not limited to, the molecules provided below and functional variants thereof:

[0068] Green fluorescent protein (GFP) having the following sequence: MSKGEELFTG VVPILVELDG DVNGHKFSVS GEGEGDATYG KLTLKFICTT GKLPVPWPTL 60 VTTFSYGVQC FSRYPDHMKQ HDFFKSAMPE GYVQERTIFF KDDGNYKTRA EVKFEGDTLV 120 NRIELKGIDF KEDGNILGHK LEYNYNSHNV YIMADKQKNG IKVNFKIRHN IEDGSVQLAD 180 HYQQNTPIGD GPVLLPDNHY LSTQSALSKD PNEKRDHMVL LEFVTAAGIT HGMDELYK (SEQ ID NO: 1)

[0069] A red fluorescent protein (RFP) having the following sequence: MRGSHHHHHH GSAHGLTDDM TMHFRMEGCV DGHKFVIEGN GNGNPFKGKQ FINLCVIEGG 60 PLPFSEDILS AAFXNRLFTE YPEGIVDYFK NSCPAGYTWH RSFRFEDGAV CICSADITVN 120 VRENCIYHES TFYGVNFPAD GPVMKKMTTN WEPSCEKIIP INSQKILKGD VSMYLLLKDG 180 GRYRCQFDTI YKAKTEPKEM PDWHFIQHKL NREDRSDAKN QKWQLIEHAI ASRSALP (SEQ ID NO: 2)

[0070] Yellow fluorescent protein (YFP) having the following sequence: KGEELFTGVV PILVELDGDV NGHKFSVSGE GEGDATYGKL TLKFICTTGK LPVPWPTLVT 60 TFXLQCFARY PDHMKRHDFF KSAMPEGYVQ ERTIFFKDDG NYKTRAEVKF EGDTLVNRIE 120 LKGIDFKEDG NILGHKLEYN YNSHNVYIMA DKQKNGIKVN FKIRHNIEDG SVQLADHYQQ 180 NTPIGDGPVL LPDNHYLSYQ SALSKDPNEK RDHMVLLEFV TAAGI (SEQ ID NO: 3)

[0071] A blue fluorescent protein (BFP) having the following sequence: MSKGEELFTG VVPILVELDG DVNGHKFSVS GEGEGDATYG KLTLKFICTT GKLPVPWPTL 60 VTTFXVQCFS RYPDHMKRHD FFKSAMPEGY VQERTIFFKD DGNYKTRAEV KFEGDTLVNR 120 IELKGIDFKE DGNILGHKLE YNFNSHNVYI MADKQKNGIK VNFKIRHNIE DGSVQLADHY 180 QQNTPIGDGP VLLPDNHYLS TQSALSKDPN EKRDHMVLLE FVTAAGITHG MDELYK (SEQ ID NO: 4)

[0072] Cyan fluorescent protein (CFP) having the following sequence: MVSKGEELFT GVVPILVELD GDVNGHKFSV SGEGEGDATY GKLTLKFICT TGKLPVPWPT 60 LVTTLXVQCF ARYPDHMKQH DFFKSAMPEG YVQERTIFFK DDGNYKTRAE VKFEGDTLVN 120 RIELKGIDFK EDGNILGHKL EYNAISDNVY ITADKQKNGI KANFKIRHNI EDGSVQLADH 180 YQQNTPIGDG PVLLPDNHYL STQSALSKDP NEKRDHMVLL EFVTAAGITL GMDELYK (SEQ ID NO: 5) or MVSKGEELFT GVVPILVELD GDVNGHKFSV SGEGEGDATY GKLTLKFICT TGKLPVPWPT 60 LVTTLXVQCF SRYPDHMKQH DFFKSAMPEG YVQERTIFFK DDGNYKTRAE VKFEGDTLVN 120 RIELKGIDFK EDGNILGHKL EYNYISHNVY ITADKQKNGI KANFKIRHNI EDGSVQLADH 180 YQQNTPIGDG PVLLPDNHYL STQSALSKDP NEKRDHMVLL EFVTAAGITL GMDELYK (SEQ ID NO: 6)

[0073] mCherry with the following sequence: MVSKGEEDNM AIIKEFMRFK VHMEGSVNGH EFEIEGEGEG RPYEGTQTAK LKVTKGGPLP 60 FAWDILSPQF MYGSKAYVKH PADIPDYLKL SFPEGFKWER VMNFEDGGVV TVTQDSSLQD 120 GEFIYKVKLR GTNFPSDGPV MQKKTMGWEA SSERMYPEDG ALKGEIKQRL KLKDGGHYDA 180 EVKTTYKAKK PVQLPGAYNV NIKLDITSHN EDYTIVEQYE RAEGRHSTGG MDELYK (SEQ ID NO: 7)

[0074] Exemplary photoproteins include, but are not limited to, the following:

[0075] Renilla luciferase having the sequence: MTSKVYDPEL RKRMITGPQW WARCKQMNVL DSFINYYDSE KHAENAVIFL HGNAASSYLW 60 RHVVPHVEPV ARCIIPDLIG MGKSGKSGNG SYRLLDHYKY LTEWFKHLNL PKKIIFVGHD 120 WGACLAFHYC YEHQDRIKAV VHAESVVDVI ESWDEWPDIE EDIALIKSEE GEKMVLENNF 180 FVETMLPSKI MRKLEPEEFA AYLEPFKEKG EVRRPTLSWP REIPLVKGGK PDVVEIVRNY 240 NAYLRASHDL PKMFIESDPG FFSNAIVEGA KKFPNTEFVK VKGLHFSQED APDEMGNYIK 300 SFVERVLKNEQ (SEQ ID NO: 8)

[0076] Firefly (Photinus pyralis) luciferase having the following sequence: MEDAKNIKKG PAPFYPLEDG TAGEQLHKAM KRYALVPGTI AFTDAHIEVN ITYAEYFEMS 60 VRLAEAMKRY GLNTNHRIVV CSENSLQFFM PVLGALFIGV AVAPANDIYN ERELLNSMNI 120 SQPTVVFVSK KGLQKILNVQ KKLPIIQKII IMDSKTDYQG FQSMYTFVTS HLPPGFNEYD 180 FVPESFDRDK TIALIMNSSG STGSPKGVAL PHRTACVRFS HARDPIFGNQ IIPDTAILSV 240 VPFHHGFGMF TTLGYLICGF RVVLMYRFEE ELFLRSLQDY KIQSALLVPT LFSFFAKSTL 300 IDKYDLSNLH EIASGGAPLS KEVGEAVAKR FHLPGIRQGY GLTETTSAIL ITPEGDDKPG 360 AVGKVVPFFE AKVVDLDTGK TLGVNQRGEL CVRGPMIMSG YVNDPEATNA LIDKDGWLHS 420 GDIAYWDEDE HFFIVDRLKS LIKYKGCQVA PAELESILLQ HPNIFDAGVA GLPGDDAGEL 480 PAAVVVLEHG KTMTEKEIVD YVASQVTTAK KLRGGVVFVD EVPKGLTGKL DARKIREILI 540 KAKKGGKSKL (SEQ ID NO: 9)

[0077] As used herein, "expression" refers to either the transcription of nucleic acid, including DNA, into RNA or the translation of RNA into a protein or polypeptide, or both the transcription of DNA into RNA and the translation of RNA into a protein or polypeptide.

[0078] The methods disclosed herein utilize an efficient single-cell platform that allows for rapid high-throughput testing of candidate molecules. Thus, as used herein, "single isolated cell" refers to a cell that is physically separated from other cells in a reaction vessel, such as a multi-well plate, a microchip, a microfluidic chip, Nanoopen™, etc.

[0079] The disclosed methods, compositions, systems, and kits utilize "genetically engineered cells." As used herein, "genetically engineered" or grammatical variations thereof refer to cells that have one or more genetic modifications made by the hand of man. Such modifications include, for example, expression of an introduced or exogenous nucleic acid. Methods for introducing exogenous nucleic acids are known in the art and include, but are not limited to, transfection, lipofection, viral transduction, such as retroviral, lentiviral, or adenoviral transduction. In some embodiments, the genetically engineered cells contain a nucleic acid integrated into the genome of the cell, while in other embodiments, the genetically engineered cells contain a nucleic acid contained in an episome.

[0080] In some embodiments, the genetically engineered cells include a nucleic acid encoding a gene of interest that is operably controlled by one or more promoters or one or more enhancer sequences. In some embodiments, the promoter may have constitutive activity, i.e., the promoter continuously directs the transcription of the nucleic acid under its control. Exemplary constitutive promoters include, but are not limited to, the cytomegalovirus (CMV) promoter and the elongation factor 1 alpha (EF1a) promoter. In other embodiments, the one or more promoters are inducible, meaning that they are responsive to the addition of another molecule. Exemplary inducible promoters include tetracycline-inducible promoters, coumate-inducible promoters, and estrogen receptor-based tamoxifen-inducible promoters. In some embodiments, the promoter is a "strong" promoter that results in a relatively high level of expression of downstream sequences. In some embodiments, the promoter is a "weak" promoter that results in a relatively low level of expression of downstream sequences. By way of example and not limitation, the mammalian CMV promoter is generally considered by those skilled in the art to be a strong promoter.

[0081] In some embodiments, the disclosed methods use a single cell as an expression source for both the protein of interest, a "cell surface protein," and a potential ligand of interest, referred to as a "heterologous test peptide." In some embodiments, the genetically engineered cell expresses a reporter in response to successful ligation of the receptor of interest by the heterologous test peptide, and in some instances downstream signaling. Each cell screened is engineered to express, in addition to the receptor itself, a different potential ligand for the receptor of interest, and a reporter molecule that indicates receptor ligation. Thus, screening of many such cells reveals multiple ligands for the receptor.

[0082] In some embodiments, the heterologous test peptide is an antibody or an antigen-binding fragment thereof, such as a single chain variable region fragment (scFv), nanobody, or Fab fragment. As used herein, "single chain variable region fragment (scFv)" refers to a single immunoglobulin heavy chain and a single immunoglobulin light chain fused by a linker. As used herein, "nanobody" refers to a protein that comprises a single monomeric variable antibody domain. "Fab" fragment refers to the antigen-binding region of an antibody.

[0083] In some embodiments, the ligand for the cell surface protein is known, and the structure or sequence of the heterologous test polypeptide is based on that of the known ligand.

[0084] In some embodiments, the screening method comprises (a) detecting the presence and / or level of expression of a reporter molecule in an isolated, genetically engineered single cell, the cell displaying a cell surface protein, the cell being engineered to (i) secrete a heterologous test polypeptide, and (ii) express the reporter molecule if the test polypeptide does not activate the cell surface protein. Thus, in such embodiments, prevention of activation of the cell surface protein is manifested by expression of the reporter molecule.

[0085] In some embodiments of the screening method, the screening method includes the steps of (a) contacting an isolated, genetically engineered single cell with a test reagent, where the cell displays a cell surface protein and the cell (i) secretes a heterologous test polypeptide and (ii) has been engineered to express a reporter molecule if the test polypeptide or one of the test reagents activates the cell surface protein; and (b) detecting the presence and / or level of expression of the reporter molecule.

[0086] In some embodiments, the test reagent is a ligand of the cell surface protein and the heterologous test polypeptide is a potential agonist or antagonist of the cell surface protein, hi other embodiments, the test reagent is an agonist or antagonist of the cell surface protein and the heterologous test polypeptide is a potential ligand of the cell surface protein.

[0087] In some embodiments, the screening method comprises: (a) contacting an isolated, genetically engineered single cell with a test reagent comprising a reporter molecule, where the cell displays a cell surface protein, and the test reagent is capable of binding to the cell surface protein displayed by the cell and forming a reagent-protein complex, whereupon the reagent-protein complex is capable of entering the cell, the cell being engineered to (i) secrete a heterologous test polypeptide; and (b) detecting the presence and / or level of expression of the reporter molecule in the cell.

[0088] In some embodiments, the test reagent is an infectious agent or is derived from an infectious agent. In some embodiments, the test reagent is a virus or is derived from a virus. Exemplary non-limiting viruses include, for example, coronavirus A, B, C, D, flavivirus, lentivirus, influenza A, B, C or D virus, Epstein-Barr virus, herpes simplex virus, cytomegalovirus, respiratory syncytial virus, Ebola virus, Marburg virus, and dengue virus. In some embodiments, the test reagent is or is derived from human immunodeficiency virus (HIV), yellow fever virus, severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2), Epstein-Barr virus, herpes simplex virus, cytomegalovirus, respiratory syncytial virus, Ebola virus, Marburg virus, or dengue virus. In some embodiments, the test reagent is a pseudovirus. As used herein, "pseudovirus" refers to a replication-incompetent virus or virus-like particle, often based on a retrovirus, lentivirus, e.g., HIV, or vesicular stomatitis virus, that further contains an important viral factor from another virus, e.g., SARS-CoV-2 surface glycoprotein (spike protein). Thus, the risk of infection to researchers using pseudoviruses is reduced compared to the use of wild-type viruses, while the methods, compositions, and kits disclosed herein are useful as tools for the discovery of novel neutralizing agents against wild-type viruses. In some embodiments, the virus can infect mammals, fish, birds, plants, insects, yeast, or bacteria.

[0089] In some embodiments, the test reagent comprises a reporter molecule, such that when a test agent containing a reporter molecule binds to a cell surface protein and gains entry into the cell, the cell contains the reporter molecule.

[0090] In some embodiments, the cell surface protein is a receptor necessary to form a complex with a test reagent and catalyze the entry of the test reagent into the cell, hi some embodiments, the cell surface protein is a receptor for a ligand that can transmit a signal intracellularly upon receptor ligation.

[0091] Exemplary cell surface proteins include, but are not limited to, the following:

[0092] Human angiotensin-converting enzyme 2 (hACE-2), having the following amino acid sequence: MSSSSWLLLS LVAVTAAQST IEEQAKTFLD KFNHEAEDLF YQSSLASWNY NTNITEENVQ 60 NMNNAGDKWS AFLKEQSTLA QMYPLQEIQN LTVKLQLQAL QQNGSSVLSE DKSKRLNTIL 120 NTMSTIYSTG KVCNPDNPQE CLLLEPGLNE IMANSLDYNE RLWAWESWRS EVGKQLRPLY 180 EEYVVLKNEM ARANHYEDYG DYWRGDYEVN GVDGYDYSRG QLIEDVEHTF EEIKPLYEHL 240 HAYVRAKLMN AYPSYISPIG CLPAHLLGDM WGRFWTNLYS LTVPFGQKPN IDVTDAMVDQ 300 AWDAQRIFKE AEKFFVSVGL PNMTQGFWEN SMLTDPGNVQ KAVCHPTAWD LGKGDFRILM 360 CTKVTMDDFL TAHHEMGHIQ YDMAYAAQPF LLRNGANEGF HEAVGEIMSL SAATPKHLKS 420 IGLLSPDFQE DNETEINFLL KQALTIVGTL PFTYMLEKWR WMVFKGEIPK DQWMKKWWEM 480 KREIVGVVEP VPHDETYCDP ASLFHVSNDY SFIRYYTRTL YQFQFQEALC QAAKHEGPLH 540 KCDISNSTEA GQKLFNMLRL GKSEPWTLAL ENVVGAKNMN VRPLLNYFEP LFTWLKDQNK 600 NSFVGWSTDW SPYADQSIKV RISLKSALGD KAYEWNDNEM YLFRSSVAYA MRQYFLKVKN 660 QMILFGEEDV RVANLKPRIS FNFFVTAPKN VSDIIPRTEV EKAIRMSRSR INDAFRLNDN 720 SLEFLGIQPT LGPPNQPPVS IWLIVFGVVM GVIVVGIVIL IFTGIRDRKK KNKARSGENP 780 YASIDISKGE NNPGFQNTDD VQTSF (SEQ ID NO: 10)

[0093] The human programmed cell death 1 protein (PD-1), having the following sequence: MEDAKNIKKG PAPFYPLEDG TAGEQLHKAM KRYALVPGTI AFTDAHIEVN ITYAEYFEMS 60 VRLAEAMKRY GLNTNHRIVV CSENSLQFFM PVLGALFIGV AVAPANDIYN ERELLNSMNI 120 SQPTVVFVSK KGLQKILNVQ KKLPIIQKII IMDSKTDYQG FQSMYTFVTS HLPPGFNEYD 180 FVPESFDRDK TIALIMNSSG STGSPKGVAL PHRTACVRFS HARDPIFGNQ IIPDTAILSV 240 VPFHHGFGMF TTLGYLICGF RVVLMYRFEE ELFLRSLQDY KIQSALLVPT LFSFFAKSTL 300 IDKYDLSNLH EIASGGAPLS KEVGEAVAKR FHLPGIRQGY GLTETTSAIL ITPEGDDKPG 360 AVGKVVPFFE AKVVDLDTGK TLGVNQRGEL CVRGPMIMSG YVNDPEATNA LIDKDGWLHS 420 GDIAYWDEDE HFFIVDRLKS LIKYKGCQVA PAELESILLQ HPNIFDAGVA GLPGDDAGEL 480 PAAVVVLEHG KTMTEKEIVD YVASQVTTAK KLRGGVVFVD EVPKGLTGKL DARKIREILI 540 KAKKGGKSKL (SEQ ID NO: 11)

[0094] Human cytotoxic T-lymphocyte protein 4 (CTLA-4), having the following sequence: MACLGFQRHK AQLNLATRTW PCTLLFFLLF IPVFCKAMHV AQPAVVLASS RGIASFVCEY 60 ASPGKATEVR VTVLRQADSQ VTEVCAATYM MGNELTFLDD SICTGTSSGN QVNLTIQGLR 120 AMDTGLYICK VELMYPPPYY LGIGNGTQIY VIDPEPCPDS DFLLWILAAV SSGLFFYSFL 180 LTAVSLSKML KKRSPLTTGV YVKMPPTEPE CEKQFQPYFI PIN (SEQ ID NO: 12)

[0095] Human 4-1BB, having the following sequence: MGNSCYNIVA TLLLVLNFER TRSLQDPCSN CPAGTFCDNN RNQICSPCPP NSFSSAGGQR 60 TCDICRQCKG VFRTRKECSS TSNAECDCTP GFHCLGAGCS MCEQDCKQGQ ELTKKGCKDC 120 CFGTFNDQKR GICRPWTNCS LDGKSVLVNG TKERDVVCGP SPADLSPGAS SVTPPAPARE 180 PGHSPQIISF FLALTSTALL FLLFFLTLRF SVVKRGRKKL LYIFKQPFMR PVQTTQEEDG 240 CSCRFPEEEE GGCEL (SEQ ID NO: 13)

[0096] Human Hepatitis A Virus Cellular Receptor 2 (TIM-3), having the following sequence: MFSHLPFDCV LLLLLLLLTR SSEVEYRAEV GQNAYLPCFY TPAAPGNLVP VCWGKGACPV 60 FECGNVVLRT DERDVNYWTS RYWLNGDFRK GDVSLTIENV TLADSGIYCC RIQIPGIMND 120 EKFNLKLVIK PAKVTPAPTR QRDFTAAFPR MLTTRGHGPA ETQTLGSLPD INLTQISTLA 180 NELRDSRLAN DLRDSGATIR ​​IGIYIGAGIC AGLALALIFG ALIFKWYSHS KEKIQNLSLI 240 SLANLPPSGL ANAVAEGIRS EENIYTIEEN VYEVEEPNEY YCYVSSRQQP SQPLGCRFAM 300 P (SEQ ID NO: 14)

[0097] Human lymphocyte activation gene 3 (LAG3), having the following sequence: MWEAQFLGLL FLQPLWVAPV KPLQPGAEVP VVWAQEGAPA QLPCSPTIPL QDLSLLRRAG 60 VTWQHQPDSG PPAAAPGHPL APGPHPAAPS SWGPRPRRYT VLSVGPGGLR SGRLPLQPRV 120 QLDERGRQRG DFSLWLRPAR RADAGEYRAA VHLRDRALSC RLRLRLGQAS MTASPPGSLR 180 ASDWVILNCS FSRPDRPASV HWFRNRGQGR VPVRESPHHH LAESFLFLPQ VSPMDSGPWG 240 CILTYRDGFN VSIMYNLTVL GLEPPTPLTV YAGAGSRVGL PCRLPAGVGT RSFLTAKWTP 300 PGGGPDLLVT GDNGDFTLRL EDVSQAQAGT YTCHIHLQEQ QLNATVTLAI ITVTPKSFGS 360 PGSLGKLLCE VTPVSGQERF VWSSLDTPSQ RSFSGPWLEA QEAQLLSQPW QCQLYQGERL 420 LGAAVYFTEL SSPGAQRSGR APGALPAGHL LLFLILGVLS LLLLVTGAFG FHLWRRQWRP 480 RRFSALEQGI HPPQAQSKIE ELEQEPEPEP EPEPEPEPEP EPEQL (SEQ ID NO: 15)

[0098] hACE-2 is required for SARS-CoV-2 entry into cells, while TMPRSS2 facilitates viral entry into cells. Thus, in some embodiments, the cells of the present disclosure may contain both hACE-2 and TMPRSS2.

[0099] Human transmembrane serine protease 2 (TMPRSS2), having the following sequence: MALNSGSPPA IGPYYENHGY QPENPYPAQP TVVPTVYEVH PAQYYPSPVP QYAPRVLTQA 60 SNPVVCTQPK SPSGTVCTSK TKKALCITLT LGTFLVGAAL AAGLLWKFMG SKCSNSGIEC 120 DSSGTCINPS NWCDGVSHCP GGEDENRCVR LYGPNFILQV YSSQRKSWHP VCQDDWNENY 180 GRAACRDMGY KNNFYSSQGI VDDSGSTSFM KLNTSAGNVD IYKKLYHSDA CSSKAVVSLR 240 CIACGVNLNS SRQSRIVGGE SALPGAWPWQ VSLHVQNVHV CGGSIITPEW IVTAAHCVEK 300 PLNNPWHWTA FAGILRQSFM FYGAGYQVEK VISHPNYDSK TKNNDIALMK LQKPLTFNDL 360 VKPVCLPNPG MMLQPEQLCW ISGWGATEEK GKTSEVLNAA KVLLIETQRC NSRYVYDNLI 420 TPAMICAGFL QGNVDSCQGD SGGPLVTSKN NIWWLIGDTS WGSGCAKAYR PGVYGNVMVF 480 TDWIYRQMRA DG (SEQ ID NO: 16)

[0100] Programmed cell death protein 1 (PD-1) is a transmembrane protein that contains immunoreceptor tyrosine-based inhibitory motifs (ITIMS) and immunoreceptor tyrosine-based switch motifs, suggesting that PD-1 negatively regulates T cell receptor TCR signaling. Therefore, drugs that block PD-1 signaling have been successfully used to increase T cell effector function and treat cancer.

[0101] Human cytotoxic T-lymphocyte protein 4 (CTLA-4) is a transmembrane protein that binds to the costimulatory molecules CD80 and CD86 on antigen-presenting cells (APCs) and transmits coinhibitory signals to T cells. Thus, agents that block CTLA-4 signaling have been successfully used to increase T cell effector functions and treat cancer.

[0102] 4-1BB (CD137, or TNFRSF9) is a membrane protein that acts to stimulate the effector functions of T cells. Therefore, agents that modulate 4-1BB signaling may be useful in the treatment of human diseases. For example, agents that stimulate 4-1BB may be useful to activate tumor-infiltrating lymphocytes to destroy cancer cells, while agents that antagonize 4-1BB signaling may be useful to prevent autoimmunity or treat transplant-related conditions in humans.

[0103] Human hepatitis A virus cellular receptor 2 (TIM-3) is a transmembrane protein that acts as an inhibitory molecule in T cells. Therefore, agents that reduce or block TIM-3 signaling may be useful in cancer immunotherapy.

[0104] Human lymphocyte activation gene 3 (LAG3) is a transmembrane protein that acts as an inhibitory molecule in T cells. Therefore, agents that reduce or block LAG3 signaling may be useful in cancer immunotherapy.

[0105] In some embodiments, the heterologous test peptide secreted by the cell includes any protein that can neutralize the virus or alter cellular function to prevent viral infection. Exemplary secreted proteins can include interferon variants, Griffithins, peptides, receptor traps (e.g., soluble ACE2 variants of SARS-CoV-2, or soluble CD4 variants of HIV-1).

[0106] In some embodiments of the screening method, the method further comprises amplifying and / or sequencing the nucleic acid encoding the heterologous test polypeptide.Thus, in some embodiments, the cells expressing the reporter molecule can be separated from the cells not expressing the reporter molecule by methods known in the art, such as fluorescence-activated cell sorting (FACS), magnetic bead enrichment, and each group is sequenced to generate a library of sequences encoding the heterologous test polypeptides associated with the expression or lack of expression of the reporter in a given system.

[0107] In some embodiments, the reporter molecule comprises a nucleic acid sequence. In some embodiments, the nucleic acid sequence comprises a barcode sequence. As used herein, "barcode" or "barcode sequence" refers to a unique nucleotide sequence used to identify a particular state, such as the ligation of a cell surface protein. The barcode sequence suitably comprises a sequence that is not found in the genome, transcriptome, exogenous expression vector, etc. present in the cell in which the barcode is expressed so that it can be easily identified.

[0108] The present technology is not limited to a particular cell type or a particular cell line, and any suitable cells, including prokaryotic cells (e.g., bacterial), yeast, mammalian, avian, fish, or plant cells, can be used for both the virus infection neutralization assay and the testing of polypeptide-receptor activity (e.g., antibodies, ligands, receptors, agonists, antagonists, etc.). Exemplary non-limiting cell lines useful for the screening assays disclosed herein, e.g., neutralization assays, include CHO, BHK, Cos-7 NS0, SP2 / 0, YB2 / 0, HEK293, HT-1080, Huh-7, PER.C6, and variants thereof, etc. In some embodiments, B cell lines, e.g., Raji, ARH-77, MOPC-315, MOPC-21, etc., can be used.

[0109] As an example, in some embodiments, insect cells can be used with reporters that are compatible with insect cells. In some embodiments, the reporter can be induced by an insect cell virus. In some embodiments, bacterial cells can be used with reporters that are compatible with bacterial cells. In some embodiments, the reporter can be induced by a bacteriophage infection. In some embodiments, plant cells can be used with reporters that are compatible with plant cells. In some embodiments, the reporter can be induced by a plant cell virus. In some embodiments, mammalian cells can be used with reporters that are compatible with mammalian cells, such as expression of a fluorescent marker, an enzyme, a tagged protein, or a nucleic acid. In some embodiments, the mammalian cells are human cells. In some embodiments, the reporter can be induced by a mammalian cell virus.

[0110] In some embodiments, the assay readout may be fluorophore expression. In some embodiments, the assay readout may be based on next generation sequencing ("NGS") NGS-based signals or integrated NGS barcodes. In some embodiments, the assay readout may be cell proliferation or cell death.

[0111] In some instances, selectable markers can be used to select cells transformed with nucleic acids encoding antibodies and / or viral entry receptors.

[0112] As used herein, a "selection marker" refers to any molecule that allows for the selection of cells expressing a desired nucleic acid, including a nucleic acid encoding the selection marker and a nucleic acid of interest. For example, in one embodiment, the cells of the present disclosure express a nucleic acid that encodes an antibody and includes a nucleic acid encoding a fluorescent molecule, e.g., a fluorescent protein (selection marker). Thus, in the foregoing example, cells expressing the desired nucleic acid can be separated using methods known in the art to separate cells expressing the fluorescent molecule from cells that do not express the nucleic acid, e.g., fluorescence-activated cell sorting (FACS). Other methods of separating cells expressing a selection marker are known in the art and include, but are not limited to, antibody and magnetic bead separation. In some embodiments, the selection marker confers a survival advantage to cells expressing the nucleic acid of interest. For example, in some embodiments, the selection marker is an antibiotic, e.g., blasticidin, hygromycin B, puromycin, zeocin, G418 / geneticin, or a combination of both. (1) Thus, treatment of cells with an antibiotic in which the resistance-conferring molecule is encoded in the nucleic acid of interest will select for cells expressing the nucleic acid of interest, thus acting as a selectable marker.

[0113] Thus, in some embodiments, the reporter comprises a selectable marker, however, the reporter may in some embodiments comprise a selectable marker, but the reporter functions to indicate to one of skill in the art practicing the disclosed methods using the disclosed compositions or kits, a change in the state of the cell in which the reporter is expressed, e.g., infection by a virus, the presence of a cell signaling event, the absence of a cell signaling event, etc.

[0114] In some embodiments, a selection marker expressed by the cells may be used that allows for the selection of optimal protein or peptide function from a library of protein or peptide variants. In some embodiments, the selection marker for secreted protein function may be a fluorescent protein that is not normally expressed in the cell line, including but not limited to green fluorescent protein (GFP), red fluorescent protein (RFP), yellow fluorescent protein (RFP), mCherry, blue fluorescent protein (BFP), cyan fluorescent protein (CFP), and the like. In some embodiments, the selection marker may induce expression of a surface protein for affinity-based selection, some examples may include CD19, CD4, CD34, and other surface proteins. In other embodiments, the selection marker may include an enzyme that allows cell survival, including but not limited to apoptosis pathway genes, glutathione S-transferase, antibiotic resistance markers, bleomycin, adenosine deaminase, xanthine-guanine phosphoribosyltransferase, or the like. (1) and others. In some embodiments, the selection marker may be read as a result of Cre-lox or CRISPR gene activation resulting in chromosomal changes. In some embodiments, integrase may be used to insert genes into cells to clone the library. In other embodiments, stable cell pools may be used to generate libraries from transfected plasmids. In other embodiments, secreted protein libraries may be generated using integrase. In other embodiments, secreted protein libraries may be generated using transposase. In some embodiments, the assay readout may be based on sequencing the cell population after screening. In some embodiments, the assay readout may include identification of DNA barcodes encoded by the antibodies and / or viruses or viral infection models as unique identifiers for each antibody or viral infection variant. In other embodiments, the assay readout may be based on fluorescent markers and sorting by flow cytometry.

[0115] In some embodiments, the heterologous test polypeptide may be an antibody variant. In some embodiments, the antibody may be of one or more of the following formats: IgG, IgM, IgA, Fab, ScFv, Fab2'. In some embodiments, the antibody may be a bispecific antibody. In other embodiments, the antibody may be a trispecific antibody. In some embodiments, the secreted protein may be an antibody native heavy:light antibody. (2,3,4) It may include pairs.

[0116] In some embodiments, the heterologous test polypeptide may comprise randomly paired heavy and light chains. In some embodiments, the expression of the heavy:light of the antibody may be on the same mRNA transcript. In other embodiments, the heavy and light chains of the antibody may be expressed on separate mRNAs. In some embodiments, the heavy and light chains of the antibody may be expressed on the same mRNA transcript. (3) A bidirectional promoter can be used between the

[0117] In some embodiments, the heterologous test polypeptides include antibodies found in antibody gene libraries derived from human patients developed by screening of natural human immune libraries. In other embodiments, the antibody gene libraries may be derived from animal sources including mice, transgenic mice, camelids, sharks, non-human primates, guinea pigs, or other animals. In some embodiments, the antibody gene libraries may be synthetically generated. In certain embodiments, the libraries may include synthetically generated libraries in which diversity has been introduced (e.g., by targeted mutagenesis, site saturation mutagenesis, DNA shuffling, error-prone PCR, somatic hypermutation, or other diversity-introducing mechanisms). In some embodiments, the protein libraries may be based on antibody genes with known activity. In some embodiments, the disclosed screening methods may be used to select for improved potency, selectivity, or breadth of diversified libraries derived from antibodies with known baseline activity. In some embodiments, the heterologous test polypeptides may be selected for the ability to agonize or antagonize cellular receptors expressed by any species, including but not limited to mice, non-human primates, guinea pigs, ferrets, pigs, and humans.

[0118] In some embodiments, a heterologous test polypeptide or heterologous test polypeptide library variant may have some baseline activity, and the described functional screens are used to improve its potency, selectivity, or breadth of activity. In some embodiments, the starting protein or peptide library may have uncharacterized activity, and the functional assays described herein are used to characterize the functional activity of variants in the protein or peptide library and select desired functional variants.

[0119] In some embodiments, the cells can be engineered to introduce genetic diversity into the secreted polypeptide (heterologous test polypeptide) during the selection rounds. Several mechanisms for introducing genetic diversity are known to those skilled in the art, including expression of activation-induced cytidine deamidase (AID), expression of an error-prone polymerase, or the use of an orthogonal plasmid replication system.

[0120] In some embodiments, the promoter of expression of the heterologous test polypeptide can be changed to adjust the secreted protein concentration, with a stronger promoter affecting the secreted concentration. A weaker promoter can be used to allow stronger secreted protein selection. In some embodiments, the amount of time of protein secretion can be changed to adjust the secreted protein concentration as well. In some embodiments, for example, a shorter incubation time before the addition of virus can reduce the soluble polypeptide concentration in the supernatant, thereby selecting for more active or protective secreted molecules.

[0121] In some embodiments, functional assays resulting in a reporter (e.g., GFP expression) may be derived from viral infection and the assays include virus neutralization assays in which the heterologous polypeptide expressed and secreted by the cell is an antibody or antigen-binding fragment.

[0122] In some embodiments, the functional assay may include binding and activation or signaling through a cellular receptor (e.g., G protein-coupled receptor, T cell receptor, chimeric antigen receptor, apoptosis marker, immunomodulatory agent such as PD-1, LAG-3, TIM, 4-1BB, or others). In such embodiments, the functional assay may include screening for secreted proteins that can activate the cellular receptor and induce signaling. The signaling event may be linked to any reporter (e.g., fluorescent protein expression, apoptosis marker, cell surface marker expression, Cre-Lox or CRISPR expression, or mRNA-based marker) that allows a readout of the functional effect of the secreted protein on the desired cellular receptor activation. In some embodiments, the secreted protein blocks the surface receptor in the presence of an activating moiety (e.g., a ligand that is naturally produced by the cell, engineered to be produced by the cell, or added to contact the cell), preventing its activation, resulting in a functional readout, e.g., a reporter. In other embodiments, the secreted protein may directly activate the surface receptor.

[0123] In some embodiments, single cells are isolated into compartments for functional screening of secreted proteins. In some embodiments, the compartments can be 96 or 384 well plates. In some embodiments, the compartments can be printed (4,5) The compartments may be microwells, open microchambers, or Nanopen™, a cell-containing device that contains arrays of nanolight-scale wells, available from Berkeley Light. In other embodiments, the compartments are emulsions. (6) The compartments may be droplets (see, e.g., Figures 15, 16, 18, 28, and 29). In some embodiments, additional reagents can be added to the compartments after a period of time has elapsed and the desired secreted test polypeptide has accumulated within the droplets. In well plates, reagent addition can occur by fluid addition. (4,5)In microwells, open microchambers, or NanopakTm, reagent addition can be achieved by washing or fluid flow near the non-sealed compartment. In emulsion droplets, reagent addition can occur by droplet mixing. In some embodiments, droplet mixing can be achieved by electrofusion (see Example 26, Figure 29), printed pillar resistors, or other means of induced droplet fusion. In certain embodiments, addition of reagents after initial encapsulation of library cells containing secreted protein variants may not be necessary.

[0124] In some embodiments, the reagents added to the compartments may contain a virus or pseudovirus, in which case the assay may be a virus neutralization assay. In some embodiments, only a single virus or pseudovirus may be added. In other embodiments, multiple viruses or virus variants may be added. In some embodiments, the virus or pseudovirus may be barcoded with different selection markers to identify the infecting virus. In some embodiments, the virus or pseudovirus may be barcoded, tagged, or labeled with one or more different fluorescent markers, DNA barcodes, or cell surface proteins. In some embodiments, the virus or pseudovirus infection may cause cell death, and only cells that encode protective secreted proteins that neutralize the virus or pseudovirus may survive the assay.

[0125] A long-standing challenge in antibody engineering and discovery is the need to identify agonistic or antagonistic antibodies against membrane proteins. Using membrane protein interactions to manipulate cellular behavior is an important goal in modern medicine, including cancer biology and autoimmune disease treatment. Some examples of important membrane protein targets include surface markers 4-1BB, OX40, PD-L1, PD-1, CTLA-4, LAG-3, G protein-coupled receptors (GPCRs), and ion channels. Two of the greatest challenges to the discovery of antibodies targeting membrane proteins include 1) the ability to express and purify soluble versions of membrane-bound proteins, since membrane proteins are not natively expressed in a soluble format, and 2) the need to screen for binding, rather than simply screening for binding. (7) and the technical complexity of screening for the ability of an antibody to bind to the native membrane-bound version of a protein. The presently described approach for correlating secreted test protein expression in the same cell as the membrane surface expression of the target protein elegantly addresses these two traditional challenges, as it is not necessary to express and purify the membrane protein in a non-native soluble format for screening, and the use of a cell-based activation marker (such as fluorescent marker expression or luciferase expression) can provide a direct readout of the functional activity of the test protein secreted by a single cell. Thus, the herein described approach for secreted protein analysis can be used for important membrane targets, including surface proteins, as well as receptors such as 4-1BB, OX40, PD-L1, PD-1, CTLA-4, LAG-3, G protein-coupled receptors (GPCRs), and ion channels.

[0126] In some embodiments, the secreted protein activity can be an agonist or antagonist of receptor activity. In certain embodiments, a reagent can be added to the compartment, for example a receptor agonist, for example PD-L1 for the PD-1 receptor. In other embodiments, the reagent added to the compartment can be a receptor antagonist that prevents receptor activation upon binding. In some of these embodiments, receptor activation is linked to reporter expression, for example fluorescent moiety expression, to screen cells for the ability to secrete antibodies that modulate protein receptor activity. Specific cell lines are generated that have receptor activation reporters, including fluorescent signals, luciferase signals, or other signals indicative of receptor activity, which can be used for this purpose once appropriately transformed with libraries of secreted proteins for analysis and selection.

[0127] Below is a set of assays that may utilize or be utilized by embodiments of the present application. The assays may be commercially available from various companies, such as Promega. An example of an assay used to detect and / or characterize membrane-bound and / or secreted proteins is the 4-1BB assay. 4-1BB (CD137 / TNFRSF9), a member of the tumor necrosis factor receptor superfamily, is an inducible co-stimulatory receptor expressed on T cells, natural killer (NK) cells and innate immune cell populations. When present on the cell surface, 4-1BB interacts with 4-1BB ligand (4-1BBL) and induces subsequent cell proliferation and the production of interferon gamma (IFNγ) and interleukin-2 (IL-2), especially in T cells and NK cells. Another example of an assay used to detect and / or characterize membrane-bound and / or secreted proteins is the OX40 assay. The OX40 bioassay is a bioluminescent cell-based assay that measures the potency and stability of ligands or agonist antibodies that can bind and activate OX40. OX40 (CD134 / TNFRSF4) is a member of the tumor necrosis factor (TNF) receptor superfamily and is a costimulatory receptor expressed primarily on activated T cells and to a lesser extent on neutrophils and natural killer (NK) cells. When present on the cell surface, OX40 interacts with OX40 ligand (OX40L), particularly in T cells, and induces subsequent cell proliferation, survival and cytokine production.

[0128] Another example of an assay used to detect and / or characterize membrane-bound and / or secreted proteins is the PD-1 / PD-L1 assay. PD-1 is an immunoinhibitory receptor expressed on activated T cells and B cells and plays a key role in regulating immune responses to tumor antigens and self-antigens. Engagement of PD-1 by either of its ligands, PD-L1 or PD-L2, on neighboring cells inhibits TCR signaling and TCR-mediated proliferation, transcriptional activation and cytokine production. Therapeutic antibodies and Fc fusion proteins designed to block PD-1 / PD-L1 interactions show promising results in clinical trials for the treatment of various cancers. Another example of an assay used to detect and / or characterize membrane-bound and / or secreted proteins is the CTLA-4 assay. CTLA-4 (cytotoxic T-lymphocyte-associated protein 4), also known as CD152, is an immunoinhibitory receptor constitutively expressed on regulatory T cells (Treg) and upregulated in activated T cells. CTLA-4 plays a key role in regulating immune responses to tumor antigens and self-antigens. When CTLA-4 expression is upregulated on the surface of T cells, T cells bind B7 with higher avidity, thus overpowering the positive costimulatory signal from CD28. Furthermore, engagement of CTLA-4 by either of its ligands, CD80 (B7-1) or CD86 (B7-2), on neighboring antigen-presenting cells (APCs) inhibits CD28 costimulation of T cell activation, cell proliferation and cytokine production.

[0129] Another example of an assay used to detect and / or characterize membrane-bound and / or secreted proteins is the LAG-3 / MHCII Blockade Bioassay assay. The LAG-3 / MHCII Blockade Bioassay is a bioluminescent cell-based assay that measures the potency and stability of antibodies and other biologics designed to block the interaction of LAG-3 with its best-characterized ligand, major histocompatibility complex II (MHCII). LAG-3, also known as CD223, is an immune checkpoint receptor expressed on activated CD4+ and CD8+ T cells and natural killer (NK) cells. LAG-3 plays a key role in regulating immune responses to tumor antigens and self-antigens. Engagement of LAG-3 by MHCII inhibits TCR signaling, cytokine production and proliferation of activated T cells. Therapeutic antibodies designed to block the LAG-3 / MHCII interaction show promising results in clinical trials for the treatment of various cancers.

[0130] [Composition]

[0131] In one aspect of the present disclosure, a composition is provided. In some embodiments, the composition comprises an isolated, genetically engineered single cell, the cell presents a cell surface protein, the cell is engineered to (i) secrete a heterologous test polypeptide, and (ii) express a reporter molecule when the test polypeptide activates the cell surface protein.

[0132] In some embodiments, the composition comprises an isolated, genetically engineered single cell, the cell displaying a cell surface protein, the cell engineered to (i) secrete a heterologous test polypeptide, and (ii) express a reporter molecule if the test polypeptide does not activate the cell surface protein.

[0133] In some embodiments, the composition comprises an isolated, genetically engineered single cell, and optionally a test reagent, where the cell displays a cell surface protein, and the cell is engineered to (i) secrete a heterologous test polypeptide, and (ii) express a reporter molecule when the test polypeptide or one of the test reagents activates the cell surface protein.

[0134] In some embodiments, the composition comprises an isolated, genetically engineered single cell and a test reagent, optionally including a reporter molecule, where the cell displays a cell surface protein, the test reagent is capable of binding to the cell surface protein displayed by the cell and forming a reagent-receptor complex, whereupon the test reagent gains entry into the cell, and the cell is engineered to (i) secrete a heterologous test polypeptide.

[0135] In some embodiments, the cell comprises a mammalian cell, an insect cell, an avian cell, a yeast cell, a plant cell, or a bacterial cell, hi some embodiments, the cell comprises a human cell.

[0136] In some embodiments, the cell surface protein comprises an endogenous receptor. In some embodiments, the cells are engineered to express the cell surface protein. In some embodiments, the cell surface protein comprises a heterologous protein.

[0137] In some embodiments, secretion of the test polypeptide is constitutive. In some embodiments, secretion of the test polypeptide is inducible.

[0138] In some embodiments, the isolated, genetically engineered single cell is in a well of a multi-well plate. In some embodiments, the isolated, genetically engineered single cell is in a chamber of a microchip. In some embodiments, the isolated, genetically engineered single cell is in a microfluidic droplet, such as an emulsion droplet. In some embodiments, the isolated, genetically engineered single cell is in a Nanoopen™.

[0139] In some embodiments, the reporter molecule comprises a fluorescent marker, an enzyme, a tagged protein, or a nucleic acid sequence. In some embodiments, the reporter molecule comprises a nucleic acid sequence, optionally a barcode sequence. In some embodiments, the reporter molecule comprises a fluorescent moiety.

[0140] In some embodiments, the heterologous test peptides comprise variants of the receptor ligand. In some embodiments, the variants are derived from a library of ligand variants. In some embodiments, the heterologous test polypeptides comprise potential receptor agonists or antagonists.

[0141] In some embodiments, the test reagent comprises an agonist or antagonist of receptor activation, hi some embodiments, the test reagent comprises a cell surface protein ligand and the heterologous test polypeptide is derived from a library of potential agonists or antagonists of receptor activation.

[0142] In some embodiments, the heterologous test polypeptide comprises an antibody, a VHH (e.g., an antigen-binding fragment of a heavy-chain-only antibody called a nonobody) or an antigen-binding fragment thereof. In some embodiments, the antibody or antigen-binding fragment is derived from a library of antibodies or antigen-binding fragments.

[0143] In some embodiments, the test reagent comprises a virus and the cell surface protein comprises a component of viral entry into a cell. In some embodiments, the virus is one or more selected from coronavirus A, B, C, or D, flavivirus, lentivirus, influenza A, B, or C. In some embodiments, the virus is selected from HIV, SARS-CoV-2, and yellow fever virus. In some embodiments, the virus comprises SARS-CoV-2 virus and the cell surface protein comprises human angiotensin-converting enzyme 2 (hACE2). In some embodiments, the cell is engineered to express transmembrane serine protease 2 (TMPRSS2).

[0144] In some embodiments, the cells are also engineered to introduce new genetic diversity into the heterologous test polypeptide during the selection rounds. Several mechanisms for introducing genetic diversity are known to those skilled in the art, including expression of activation-induced cytidine deamidase (AID), expression of an error-prone polymerase, or the use of an orthogonal plasmid replication system.

[0145] [kit]

[0146] In another aspect of the present disclosure, a kit is provided.In some embodiments, the kit comprises: (a) the vector for expressing heterologous test polypeptide in cell; (b) the vector encoding reporter molecule, and its expression is activated when heterologous test polypeptide activates the cell surface protein that is presented on cell, and one or more of the vectors can be expression vectors, or one or more of the vectors can be integration vectors.

[0147] In some embodiments, the kit comprises: (a) a vector for expression of a heterologous test polypeptide in a cell; (b) a vector encoding a reporter molecule, the expression of which is activated when the heterologous test polypeptide does not activate a cell surface protein, where one or more of the vectors may be an expression vector or one or more of the vectors may be an integration vector.

[0148] In some embodiments, the kit comprises: (1) a test reagent; and (2) (a) a vector for expression of a heterologous test polypeptide in a cell; (b) a vector encoding a reporter molecule, the expression of which is activated upon activation of a cell surface protein by either the heterologous test polypeptide or the test reagent, wherein one or more of the vectors may be an expression vector or one or more of the vectors may be an integration vector.

[0149] In some embodiments, the kit includes (1) a test reagent comprising a reporter molecule, and (2)(a) a vector for expressing a test polypeptide in a cell, which may be an expression vector or an integration vector.

[0150] In some embodiments, the kit additionally or alternatively includes (c) one or more vectors for expression of a cell surface protein. In some embodiments, the heterologous test polypeptide is operably linked to a promoter. In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter is an inducible promoter. In some embodiments, the reporter molecule includes one or more of a fluorescent marker and a barcode. In some embodiments, the reporter molecule is operably linked to an inducible promoter. In some embodiments, the test reagent includes a virus or a pseudovirus. In some embodiments, the virus is selected from one or more of coronavirus A, B, C, or D, flavivirus, lentivirus, and influenza A, B, or C. In some embodiments, the virus is selected from HIV, SARS-CoV-2, and yellow fever virus. In some embodiments, the pseudovirus includes a peptide, polypeptide, or protein derived from one or more of coronavirus A, B, C, or D, flavivirus, lentivirus, or influenza A, B, or C. In some embodiments, the pseudovirus includes a peptide, polypeptide, or protein derived from HIV, SARS-CoV-2, or yellow fever virus. In some embodiments, the heterologous test peptide comprises an antibody or a portion thereof, hi some embodiments, the heterologous test peptide is a single chain variable region fragment (scFv) or a nanobody.

[0151] In some embodiments, the kit includes (1) a vector for expressing a heterologous test polypeptide; and (2) a genetically engineered cell that contains (a) a nucleic acid encoding a reporter, the expression of which is activated when the heterologous test polypeptide activates a cell surface protein.

[0152] In some embodiments, the kit includes (1) a vector for expressing a heterologous test polypeptide; and (2) a genetically engineered cell that contains (a) a nucleic acid encoding a reporter, the expression of which is activated when the heterologous test polypeptide does not activate a cell surface protein.

[0153] In some embodiments, the kit includes (1) a vector for expressing a heterologous test polypeptide, (2) a genetically engineered cell that contains (a) a nucleic acid encoding a reporter, the expression of which is activated when the heterologous test polypeptide activates a cell surface protein, and optionally (3) a test reagent.

[0154] In some embodiments, the kit includes: (1) a vector for expressing a heterologous test polypeptide; (2) genetically engineered cells; and (3) a test reagent comprising a reporter molecule that can bind to a cell surface protein presented by the cell and form a reagent-receptor complex, and that can enter the cell upon formation of the reagent-receptor complex.

[0155] In some embodiments, the genetically engineered cell further comprises (c) a nucleic acid encoding a heterologous cell surface protein.

[0156] As used herein, "expression vector" refers to a vector used to express a nucleic acid sequence of interest encoded on the vector. In some embodiments, the expression vector expresses a nucleic acid as an RNA product. In some embodiments, the RNA expression product is translated into a polypeptide or protein.

[0157] As used herein, "integration vector" refers to the vector that is used to integrate nucleotide sequence of interest into the genome of target cell.The exemplary method of integrating nucleic acid into the genome of cell is known in the art, for example, CRISPR Cas9-based homologous recombination, retrovirus or lentivirus transduction.

[0158] Exemplary embodiments

[0159] Disclosed herein are systems, kits, methods and compositions useful for functional screening of libraries of secreted proteins. In some embodiments, the systems, kits, methods and / or compositions include one or more engineered cells that express one or more test polypeptides and can conditionally express one or more reporter molecules. The embodiments described below are illustrative only and are not intended to be limiting. 1. An assay for protein or peptide discovery comprising: a. a library of cells is generated, each encoding a secreted protein or peptide variant; B each cell is segregated into a compartment c. An assay in which the functional activity of each of the encoded variant peptides or proteins in the library is analyzed based on analysis of cells which secrete the protein or peptide variant. 2. More than 1,000 cells are screened simultaneously, as above. 3. More than 10,000 cells are screened simultaneously, as above. 4. Any of the above, wherein the analysis of protein or peptide secreting cells comprises detection of fluorescent protein expression, including but not limited to GFP, YFP, mCherry, and other fluorescent proteins. 5. Any of the above, wherein analysis of protein or peptide secreting cells comprises detection of enzyme expression, including but not limited to luciferase and horseradish peroxidase. 6. Any of the above, wherein analysis of protein or peptide-secreting cells comprises detection of a nucleic acid encoding that protein. 7. Any of the above, wherein analysis of protein- or peptide-secreting cells comprises detection of a nucleic acid sequence associated with the protein- or peptide-secreting cells. 8. Any of the above, wherein the nucleic acid sequence or barcode indicates a secreted protein or peptide variant. 9. Any of the above, wherein the nucleic acid sequence or barcode is indicative of a viral or pseudoviral infection event. 10. Any of the above where the protein function detected is virus neutralization. 11. Any of the above, wherein the compartments comprise emulsion droplets, printed microwells, nanoopens, 96-well plates, or 384-well plates. 12. Any of the above wherein the functional activity is the ability to block viral infection. 13. Any of the above, wherein functional activity is based on receptor activation in the same cells that secrete the protein. 14. Any of the above, wherein functional activity is based on receptor inactivation in the same cells that secrete the protein. 15. Generation of cell libraries capable of both protein secretion and functional assays of viral infection. 16. Generation of cell libraries capable of both protein secretion and functional analysis of engineered receptor activity. 17. Any of the above, wherein the secreted protein is an antibody, Fab, IgG, IgM, IgA, ScFv, Fab'2, Fab2', VHH, or other antibody or immunoglobulin expression format. 18. Any of the above, where DNA barcodes can be used to track the sequences of secreted proteins. 19. Any of the above, in which DNA barcoding can be used to track viral or pseudoviral infection events. 20. Any of the above where the readout of the virus neutralization assay is insertion of DNA into cells by virus, pseudovirus, virus-like particle or recombinant virus particle. 21. Any of the above, wherein the inserted DNA comprises a DNA barcode. 22. Any of the above where the readout of the virus neutralization assay is the expression of a fluorescent marker by the virus, pseudovirus, virus-like particle or recombinant virus particle. 23. Any of the above where the readout of the virus neutralization assay is expression of a surface protein reporter by virus, pseudovirus, virus-like particle or recombinant virus particle. 24. Any of the above, where the readout of the virus neutralization assay is expression of a growth selection marker by the virus, pseudovirus, virus-like particle or recombinant virus particle. 25. Any of the above, where the readout of engineered receptor agonism or antagonism is expression of a fluorescent marker by a virus, pseudovirus, virus-like particle or recombinant virus particle. 26. Any of the above, where the readout of engineered receptor agonism or antagonism is expression of a surface protein reporter by a virus, pseudovirus, virus-like particle or recombinant viral particle. 27. Any of the above, wherein the readout of engineered receptor agonism or antagonism is expression of a growth selection marker by a virus, pseudovirus, virus-like particle or recombinant viral particle. 28. Any of the above, wherein the cell is a mammalian cell. 29. Any of the above, wherein the cell is an insect cell. 30. Any of the above, in which the cell is a plant cell. 31. Any of the above, in which the cell is a bacterial cell. 32. (a) A screening method comprising detecting the presence and / or level of expression of a reporter molecule in an isolated, genetically engineered single cell, the cell displaying a cell surface protein, the cell being engineered to (i) secrete a heterologous test polypeptide, and (ii) express the reporter molecule when the test polypeptide activates the cell surface protein. 33. (a) A screening method comprising detecting the presence and / or level of expression of a reporter molecule in an isolated, genetically engineered single cell, where the cell displays a cell surface protein and the cell is engineered to (i) secrete a heterologous test polypeptide and (ii) express the reporter molecule when the test polypeptide does not activate the cell surface protein. 34. A screening method comprising: (a) contacting an isolated, genetically engineered single cell with a test reagent, wherein the cell displays a cell surface protein, and the cell has been engineered to (i) secrete a heterologous test polypeptide, and (ii) express a reporter molecule upon activation of the cell surface protein by one of the test polypeptide or the test reagent; and (b) detecting the presence and / or level of expression of the reporter molecule. 35. A screening method comprising the steps of: (a) contacting an isolated, genetically engineered single cell with a test reagent comprising a reporter molecule, wherein the cell displays a cell surface protein, and the test reagent is capable of binding to the cell surface protein displayed by the cell and forming a reagent-protein complex, and upon formation of the reagent-receptor complex, the test reagent gains entry into the cell, and the cell has been engineered to (i) secrete a heterologous test polypeptide; and (b) detecting the presence and / or level of expression of the reporter molecule in the cell. 36. The method of any of embodiments 32-35, wherein the cell comprises a mammalian cell, an insect cell, an avian cell, a yeast cell, a plant cell or a bacterial cell. 37. The method of any of the previous embodiments, wherein the cell surface protein comprises an endogenous receptor. 38. The method of any of the preceding embodiments, wherein the cells are engineered to express a cell surface protein. 39. The method of embodiment 38, wherein the cell surface protein comprises a heterologous receptor. 40. The method of any of the preceding embodiments, wherein secretion of the test polypeptide is constitutive. 41. The method of any of embodiments 32-39, wherein secretion of the test polypeptide is inducible. 42. The method of any of the previous embodiments, wherein the isolated, genetically engineered single cell is within a well of a multi-well plate. 43. The method according to any one of embodiments 32 to 42, wherein the isolated, genetically engineered single cell is in a chamber of a microchip. 44. The method of any one of embodiments 32 to 42, wherein the isolated, genetically engineered single cell is in a microfluidic droplet, such as an emulsion droplet. 45. The method of any one of embodiments 32 to 42, wherein the isolated, genetically engineered single cell is within a Nanoopen™. 46. ​​The method of any one of the preceding embodiments, wherein the reporter molecule comprises a fluorescent marker, an enzyme, a tagged protein, or a nucleic acid sequence. 47. The method of any one of the preceding embodiments, wherein the cell comprises a human cell. 48. The method of any one of the preceding embodiments, wherein the reporter molecule comprises a nucleic acid sequence, optionally a barcode sequence, and detecting the presence and / or level of expression of the reporter molecule comprises one or more of an amplification reaction and a sequencing reaction, optionally a single cell sequencing reaction. 49. The method of any one of embodiments 32-48, wherein the reporter molecule comprises a fluorescent moiety and detecting the presence and / or level of expression of the reporter molecule comprises sorting fluorescent activated cells. 50. The method of any one of the preceding embodiments, further comprising sequencing the nucleic acid encoding the heterologous test polypeptide. 51. The method of any one of embodiments 1-3 or 5-19, wherein the heterologous test peptide comprises a variant of a receptor ligand. 52. The method of embodiment 51, wherein the variant is derived from a library of ligand variants. 53. The method of any one of embodiments 3, or 5-19, wherein the test polypeptide comprises a variant of a cell surface protein ligand and the test reagent comprises an agonist or antagonist of receptor activation by the wild-type ligand. 54. The method of any one of embodiments 3, or 5-19, wherein the test reagent comprises a cell surface protein ligand and the test polypeptide is derived from a library of potential agonists or antagonists of receptor activation by the ligand. 55. The method of any one of embodiments 1-19, wherein the test polypeptide comprises an antibody, an antibody-derived format, a nanobody, a VHH, or an antigen-binding fragment thereof. 56. The method of embodiment 24, wherein the antibody or antibody-derived format, nanobody, VHH, antigen-binding fragment is derived from a library of antibodies or antigen-binding fragments. 57. The method of any of embodiments 4, 5-19 or 24-25, wherein the test reagent comprises one or more of a virus, a virus-like particle, a pseudovirus and a recombinant virus particle, and the cell surface protein comprises a component of viral entry into a cell. 58. The method of embodiment 26, wherein the virus is selected from coronavirus A, B, C or D, flavivirus, lentivirus, influenza A, B or C. 59. The method of embodiment 26, wherein the virus is selected from HIV, SARS-CoV-2, Esptein-Barr virus, herpes simplex virus, cytomegalovirus, respiratory syncytial virus, Ebola virus, Marburg virus, Dengue virus, and Yellow Fever virus. 60. The method of embodiment 26, wherein the virus comprises the SARS-CoV-2 virus and the cell surface protein comprises human angiotensin-converting enzyme 2 (hACE2). 61. The method of embodiment 29, wherein the cells are engineered to express transmembrane serine protease 2 (TMPRSS2). 62. A composition, kit or system comprising the genetically engineered cell of any of the preceding embodiments. 63. A kit comprising: (a) a vector encoding a heterologous test polypeptide; (b) a vector encoding a reporter molecule, the expression of which is activated upon the heterologous test polypeptide activating a cell surface protein, wherein one or more of the vectors may be an expression vector or one or more of the vectors may be an integration vector. 64. A kit comprising: (a) a vector encoding a heterologous test polypeptide; (b) a vector encoding a reporter molecule, the expression of which is activated when the heterologous test polypeptide does not activate a cell surface protein, wherein one or more of the vectors may be an expression vector or one or more of the vectors may be an integration vector. 65. A kit comprising: (1) a test reagent; and (2) (a) a vector encoding a heterologous test polypeptide; (b) a vector encoding a reporter molecule, the expression of which is activated upon activation of a cell surface protein by either the heterologous test polypeptide or the test reagent, wherein one or more of the vectors may be an expression vector or one or more of the vectors may be an integration vector. 66. A kit comprising (1) a test reagent comprising a reporter molecule, and (2)(a) vectors encoding a heterologous test polypeptide, wherein one or more of the vectors may be an expression vector, or one or more of the vectors may be an integration vector. 67. The kit according to any one of embodiments 36 to 35, wherein the one or more nucleic acids further encode (c) a cell surface protein. 68. A kit according to any one of embodiments 63 to 66, wherein the heterologous test polypeptide is operably linked to a promoter. 69. The kit of embodiment 68, wherein the promoter is a constitutive promoter. 70. The kit of embodiment 68, wherein the promoter is an inducible promoter. 71. A kit according to any of embodiments 63 to 70, wherein the reporter molecule comprises a fluorescent marker, an enzyme, a tagged protein, or a nucleic acid sequence. 72. A kit according to any of embodiments 66-71, wherein the test reagent comprises one or more of a virus, a virus-like particle, a pseudovirus, and a recombinant virus particle. 73. The kit of embodiment 72, wherein the virus is selected from coronavirus A, B, C or D, flavivirus, lentivirus, and influenza A, B or C. 74. The kit of embodiment 72, wherein the virus is selected from HIV, SARS-CoV-2, Esptein-Barr virus, herpes simplex virus, cytomegalovirus, respiratory syncytial virus, Ebola virus, Marburg virus, Dengue virus, and Yellow Fever virus. 75. The kit of embodiment 72, wherein the pseudovirus comprises a peptide, polypeptide or protein derived from coronavirus A, B, C or D, flavivirus, lentivirus, herpesvirus or influenza A, B or C. 76. The kit of embodiment 72, wherein the pseudovirus comprises a peptide, polypeptide or protein derived from HIV, SARS-CoV-2, Esptein-Barr virus, herpes simplex virus, cytomegalovirus, respiratory syncytial virus, Ebola virus, Marburg virus, Dengue virus, or Yellow Fever virus. 77. A kit according to any of embodiments 63-65 or 68-71, wherein the heterologous test peptide comprises an antibody or a portion thereof. 78. The kit of embodiment 77, wherein the heterologous test peptide is a single-chain variable region fragment (scFv) or a nanobody. 79. A kit comprising: (1) a vector for expressing a heterologous test polypeptide; and (2) a genetically engineered cell containing (a) a nucleic acid encoding a reporter, the expression of which is activated when the heterologous test polypeptide activates a cell surface protein. 80. A kit comprising: (1) a vector for expressing a heterologous test polypeptide; and (2)(a) a genetically engineered cell containing a nucleic acid encoding a reporter, the expression of which is activated when the heterologous test polypeptide does not activate a cell surface protein. 81. A kit comprising: (1) a vector for expressing a heterologous test polypeptide; (2) a genetically engineered cell comprising (a) a nucleic acid encoding a reporter, the expression of which is activated upon activation of a cell surface protein by the heterologous test polypeptide; and, optionally, (3) a test reagent. 82. A kit comprising: (1) a vector for expressing a heterologous test polypeptide; (2) a genetically engineered cell; and (3) a test reagent comprising a reporter molecule capable of binding to a cell surface protein displayed by the cell and forming a reagent-surface protein complex, which gains entry into the cell upon formation of the reagent-protein complex. 83. A kit according to any of embodiments 79 to 82, wherein the genetically engineered cells further comprise (c) a nucleic acid encoding a heterologous cell surface protein. EXAMPLES

[0160] The following examples are illustrative and should not be construed as limiting the scope of the claimed subject matter.

[0161] Example 1: Establishment of cell lines for simultaneous mAb secretion and viral infection.

[0162] In this example, SARS-CoV-2 receptors / coreceptors and anti-SARS-CoV-2 antibodies were used as application examples of neutralization assays performed simultaneously for both protein secretion and viral infection using the same cell line. Aa mammalian cell lines were developed to express anti-viral antibodies and their respective viral entry receptors or coreceptors to allow viral infection simultaneously with antibody secretion. As an example, viral application, anti-SARS-CoV-2 antibodies and their receptors human angiotensin-converting enzyme 2 (hACE2) and / or transmembrane serine protease 2 (TMPRSS2) were expressed in mammalian cell lines (Figure 1). A bicistronic vector was constructed containing the promoter of human cytomegalovirus, the ACE2 surface receptor for SARS-CoV-2 infection, an internal ribosome entry site (IRES) and the TMPRSS2 gene, and hACE2 and TMPRSS2 were co-expressed in a mammalian expression vector. (The TMPRSS2 gene is optional and not required for SARS-CoV-2 infection, but can enhance the virus's ability to infect some cells (8). This expression cassette was cloned into a vector with a selection marker for plasmid transfection, allowing for transformed cell selection using the selection marker. We transfected HEK293 cells with this plasmid by mixing the plasmid with Lipofectamine transfection reagent. After 2 days, the cell culture medium was replenished and the selection reagent corresponding to the selection marker was added to the culture medium to start the selection process. After 7-14 days, we obtained a stable cell pool that was resistant to the selection reagent. This cell pool was then stained with both fluorescently conjugated anti-ACE2 and fluorescently conjugated anti-TMPRSS2 (Figure 2). The cells were sorted for ACE2 and TMPRSS2 expression, and the cells were left to recover. After cell recovery by normal growth, limiting dilution cloning was performed to isolate single clones. After 10-15 days, the single clones formed cell colonies, which were transferred to 24-well plates to expand the cells.After cell expansion, the clones were stained with anti-ACE2 and anti-TMPRSS2, and the clone with the highest expression of ACE2 and TMPRSS2 was selected (named HEKACE2 / TMPRSS2).

[0163] These cells were then transformed to express full IgG of antibodies with known SARS-CoV-2 neutralizing capacity. Alternatively, other IgG fragments could be expressed, such as single chain variable region fragments (Scfv), antigen binding fragments (Fab) or bispecific antibodies. The desired antibody or antibody fragment was cloned into a mammalian vector along with a selection marker. Following transfection and selection with a selection marker reagent, the stable pool of IgG-expressing HEKACE2 / TMPRSS2 was subjected to limiting dilution cloning to isolate individual secreted protein expressing clones, in this case the antibody IgG. After 10-15 days of cell growth, 50uL of cell culture medium was transferred to assess IgG expression by direct ELISA. ELISA was performed by coating IgG onto 96-well plates overnight. Plates were washed with phosphate buffered saline with 0.05% Tween 20 (PBST) and blocked with 5% BSA in PBST for 2 hours. The plates were washed three times with PBST, and HRP-conjugated rabbit anti-human Fc antibody was added to the wells and incubated for 2 hours. The plates were washed four times with PBST, and 3,3',5,5'-tetramethylbenzidine liquid substrate was added for the HRP reaction, which was stopped with 2M H2SO4 for detection. The plates were analyzed at an absorbance wavelength of 450 nm using a plate reader. The absorbance of IgG expressed by HEKACE2 / TMPRSS2 stable clones was then compared to an IgG standard to estimate the relative IgG expression yield. The clone with the highest IgG expression was selected as our candidate clone. A cell line containing ACE2, TMPRSS2 and IgG was generated, which allows neutralization assays to be performed on single cells (Figure 3). Several strategies for cell line development can be used (Figure 4).

[0164] Example 2: Quantification of infection with viruses or pseudoviruses in modified mammalian cell lines capable of secreting soluble proteins.

[0165] The HEK293 cell line can be used for protein expression or secretion in lab experiments. In this example, a HEK293 cell line expressing ACE2 but not TMPRSS2 was used for pseudovirus neutralization assay (named HEKACE2). HEKACE2 was infected with a strain of lentivirus-based pseudovirus encoding SARS-CoV-2CoV2 spike protein on the viral surface containing a GFP reporter gene in a viral expression vector. Thus, SARS-CoV-2 pseudovirus-infected cells will express GFP. HEKACE2 cells were detached with 0.05% trypsin and the trypsin reaction was stopped in DMEM medium containing 10% FBS. The cell density was then counted and the cells were diluted to 3 × 10 5 The cells were resuspended to a density of 1000 cells / mL and 100 µL of the cell suspension was added to each well of a 96-well plate. An aliquot of frozen pseudovirus was collected and various amounts of virus (15 µL, 30 µL, 60 µL and 90 µL) were added to the 96-wells. After incubating the 96-well plates at 37 °C for 48-72 h, neutralization was quantified by acquiring GFP signals using flow cytometry. As shown in Figure 5, the percentage of pseudovirus-infected HEKACE2 cells, reflected by the percentage of GFP-positive cells, correlated with the amount of virus added (Figure 5).

[0166] Example 3: Enabling protein secretion in a single cell using a library of encoded protein variants.

[0167] In this example, we demonstrate a method to enable protein secretion in single cells for subsequent protein secretion and assay-based selection. In this example, the secreted protein is the antibody IgG. A library of naturally paired antibody heavy and light chain variable regions (VH:VL) can be obtained from patients infected with SARS-CoV-2, as described in the protocol by McDaniel et al. (3) Paired VH:VL sequences were cloned into a plasmid vector with one CMV promoter and one EF1alpa promoter (pCMV-EF1a, FIG. 6) or a vector with a bidirectional promoter (FIG. 6, pBI) similar to the format previously described. (10,11,12,13,14) Cloning of VH:VL libraries into pCMV-EF1a and pBI utilizes NotI and NheI cleavage sites to clone amplicons into a promoterless backbone vector, and then clone into a dual promoter (CMV and EF1a) or bidirectional vector (Bi-CMV) using NheI and NcoI sites on the leader peptide regions of the heavy and light chains, respectively. Previous studies have shown that varying the leader peptide of a protein can modulate the level of protein expression. 10、11、12、13、14)Various leader peptides were designed to achieve different levels of protein secretion. Three leader peptides containing an NheI cleavage site for the heavy chain (Le11, Alb2 and L2B) and two leader peptides containing an NcoI cleavage site for the light chain (Le12 and Alb1) were designed (Table 1). Two antibodies (anti-HIV antibody VRC01 and anti-SARS-CoV antibody, CR3022) with six different heavy and light chain leader peptide combinations (Table 2) were expressed in two different vectors (pBI or pCMV-EF1a). These 24 IgG constructs were transfected into HEKACE2 cells (without TMPRSS2 expression) using lipofectamine. Three days after transfection, IgG expression was detected by ELISA as described in Example 1. As shown in Figure 6, for both VRC01 and CR3022 antibodies, it was observed that all leader peptide combinations allowed IgG expression and that various leader peptide combinations could be selected to adjust the concentration of the desired secreted antibody. The two highest IgG expression was observed in the pCMV-EF1a vector using LP4 and LP5 (Figure 7). A stable IgG expression pool was generated by adding blasticidin to a final concentration of 5 μg / mL.

[0168] [Table 1]

[0169] [Table 2]

[0170] Alternatively, naturally paired VH:VL could be expressed in HEKACE2 derived from Flip-In HEK293 kit via Flp recombinase mediated integration at FRT site (Figure 8). To do so, first clone IgG expression gene cassette into pcDNA5 / FRT vector. Then co-transfect engineered pcDNA5 / FRT vector with Flp recombinase vector pOG44 into HEK-Flp-In 293 with ACE2 expression. Generate library of IgG expressing cells by hygromycin selection. Flp mediated cloning has the advantage that only a single protein variant is encoded by each cell, which is not strictly necessary for performing the assay, but is beneficial for the selectivity of our assay.

[0171] In another example, an integrase-based gene integration system was used to express IgG from HEK293ACE cells derived from the TARGATT™-HEK293 master cell line. The IgG expression gene cassette was cloned into a donor vector containing an integrase recognition site, attB, a blasticidin resistance marker and mCherry (Figure 9). The donor plasmid and the integrase expression plasmid were then co-transfected into an engineered HEK cell line stably expressing ACE2. The attP landing pad was at the hH11 locus.

[0172] In another example, the CRISPR homology-directed repair platform system was used to express IgG in HEK-ACE2 cells. A donor IgG expression cassette (VH:VL sequence with dual or bidirectional promoters) was co-transfected with homologous arms (Figure 10). The gRNA / Cas9 expression vector naturally led to the integration of the paired VH:VL sequence into safe harbor loci. Target safe harbor loci include CCR5, AAVS1 and Hipp11 (Figure 10).

[0173] Cloning and transformation methods can be appropriately adapted to the cell line and cell-based functional activity model of interest. Several different cloning and transformation methods can be appropriately used to generate libraries of secreted proteins in mammalian or other cells (Figure 11). Other types of cloning can be used to insert nucleic acids for protein secretion into host cells, including, but not limited to, lentiviral gene transfer, infectious molecular clones, adenoviral vectors, adeno-associated viral vectors, chemical DNA transfection, chemical RNA transfection, nanoparticle-encapsulated mRNA, nanoparticle-encapsulated DNA, or other methods known in the art for inducing cellular expression of desired proteins and plasmid vectors.

[0174] Example 4: Generation of antibody protein libraries for cloning in a VH:VL bidirectional format and for soluble antibody functional analysis.

[0175] In this prophetic example, a randomly paired VH:VL library or a mutant VH:VL library can be synthesized via a gene synthesis service, where the VH and VL genes of an antibody are linked by a DNA linker. Alternatively, VH:VL gene libraries can be directly amplified from human, mouse, or non-human primate samples, as previously reported. (15)In some embodiments, error-prone PCR, site-saturation mutagenesis, and / or DNA shuffling can be used to introduce diversity into the library. The VH library can be cloned using a combination of NotI and NcoI, and the VL library can be cloned using a combination of NheI and AscI in the dual promoter (contiguous format), or the bidirectional promoter format as shown in Figure 6 can be maintained by cloning the complete construct using first NotI and AscI, and then cloning in the bidirectional promoter using NcoI and NheI, as previously reported. (16、17) This plasmid can be transfected into HEKACE2 cells for IgG expression. Alternatively, the gene cassette (dual promoter or bidirectional promoter with heavy and light chains) can be cloned into a FLP / FRT-based gene integration donor plasmid (Figure 8), an integrase-based donor plasmid (Figure 9), or a CRISPR / Cas9 donor plasmid for stable IgG integration into safe harbor loci (Figure 10). Several possible cloning strategies can be used for bidirectional antibody expression (Figure 11).

[0176] Example 5: Methods to enable expression of synthetically produced antibodies in a standard unidirectional format.

[0177] Randomly paired VH:VL libraries or mutated VH:VL libraries can be synthesized via gene synthesis services. VH and VL can then be separately cloned into mammalian expression vectors and IgG can be expressed in one open reading frame, as shown in Figure 12a.

[0178] IgG can be expressed in a single chain variable region fragment format using a GS linker between the heavy and light chain variable regions.

[0179] Alternatively, complete IgG can be expressed in a bicistronic format with a p2A cleavage peptide between the IgG heavy and light chains (FIG. 12B) (see Yellow Fever example below). The plasmid was transfected and IgG was expressed.

[0180] Unidirectional formats of IgG can be integrated into safe harbor locus expression sites. Options for integration include FLP / FRT-based gene integration (Figure 8), integrase-based donor plasmids (Figure 9), transposon-based integration, or using CRISPR / Cas9 donor plasmids for stable IgG integration (Figure 10). Depending on the cell line and functional model used for secreted proteins, several cloning and transformation methods are suitable (e.g., Figure 11).

[0181] Example 6: Application of secreted protein assay to select antibodies with virus-neutralizing properties in well plates as compartments

[0182] This example demonstrates a functional assay using a secreted protein together with a readout of the secreted protein activity in the same cell line. In this example, the secreted protein is an antibody, the activity assayed is neutralization of the SARS-CoV-2 pseudovirus, and the selection marker is GFP.

[0183] 2×10 4HEKACE2 cells were seeded in 96-well plates to reach 70% cell confluency at the time of transfection. 100ng / well of mAb in mammalian expression vector pBI was diluted in 5μL of Opti-MEM™ Reduced Serum Media (Thermo Fisher Scientific) and 0.2μL of P3000™ Reagent was added according to the protocol included in the Lipofectamine™ 3000 Reagent Kit (Invitrogen). Separately, 0.2μL of Lipofectamine™ 3000 Reagent was also diluted in 5μL of Opti-MEM™. The diluted DNA was added to the diluted Lipofectamine™ 3000 Reagent and incubated for 12 minutes at room temperature. The DNA-lipid complex was then added to HEKACE2 cells and incubated at 37°C for 3 days. Because the pBI vector contains mCherry on the light chain of the mAb, we were able to visualize the cells after transfection using a fluorescent microscope or flow cytometry to confirm gene expression. Three days after transfection, the neutralizing activity of the antibodies was measured as follows.

[0184] SARS-CoV-2 Wuhan Hu-1 GFP reporter virus particles (Integral Molecular) were thawed and placed on ice, and 60 μL of reporter virus particles were added directly to the cell medium. After incubating the 96-well plate at 37 °C for 48–72 h, neutralization was quantified by acquiring the GFP signal using flow cytometry. ELISA analysis of IgG expression demonstrated that VCR01 inhibited the expression of the anti-SARS-CoV-2 antibody, antibody 910-30. (17) It was shown that HEKACE2 expressing VCR01 had a higher IgG expression level than HEKACE2 expressing 910-30. Neutralization assays showed that HEKACE2 expressing VCR01 exhibited a higher GFP population than HEKACE2 cells expressing 910-30 (Figure 13). Similar results were obtained when the experiment was repeated (Figure 14).

[0185] Example 7: Selection of neutralizing antibodies from a library of antibodies encoded by cells capable of both antibody secretion and pseudovirus infection.

[0186] In this prophetic example, a mixture of stable cell lines expressing secreted VRC01 and 910-30 is generated as described in Example 6. Limiting dilution isolation is performed to generate single cells in 96-well plates with an average of 0.25 cells per well. Cells are grown for 40 days after limiting dilution cloning, and then 30 μL of pseudovirus is added for direct neutralization assay. Cells are harvested and the GFP+ population is sorted, enriched for cells that were not protected from infection by the antibodies they secrete (i.e., expressed non-neutralizing antibodies). The GFP- population is also sorted to enrich for cells that were protected from infection (i.e., expressed neutralizing antibodies). RNA is extracted and RT-PCR is performed for antibody genes to determine the identity of the cells. (22) The paired antibody DNA gene sequences are then recovered from the GFP- and GFP+ populations. High-throughput sequencing is performed to obtain VH:VL information in the GFP- and GFP+ populations. The frequency of antibody variants in each population is compared, and the populations are analyzed. (21) The neutralizing capacity of each antibody in the pool is determined. We found that the VRC01 sequence was relatively enriched in the GFP+ virus-infected group, whereas the 910-30 sequence was relatively enriched in the GFP- group, and the quantitative signals of these selections demonstrate the ability of our secreted protein assay to test the virus-neutralizing capacity of encoded antibodies secreted by cells.

[0187] To discover naturally paired VH:VL antibodies directly from B cells, a natural VH:VL library from a SARS-CoV-2 human patient sample is cloned into an IgG expression vector and expressed in HEKACE2 cells as described in Example 3, Example 4, and Example 5. Single cells are isolated by limiting dilution cloning into 96-wells at one cell per well. After 40 days of limiting dilution cloning, 30 μL of pseudovirus is added for direct neutralization assay. The GFP+ population, enriched for non-neutralizing antibodies, is sorted. The GFP- population is sorted to enrich the population for neutralizing antibodies. RNA is extracted and RT-PCR is performed for antibody genes. (22) , recover paired antibody DNA gene sequences from the GFP- and GFP+ populations. Perform high-throughput sequencing analysis to obtain VH:VL information. Compare the frequency of antibody variants in each population to determine the population (21) To determine the identity of neutralizing antibodies in

[0188] Example 8: Application of secreted protein functional assays in printed microchambers as compartments

[0189] In this prophetic example, first, HEKACE2 cells expressing paired VH:VL are generated by one of the methods described in Examples 3, 4, and 5. A population of cells is plated onto a polydimethylsiloxane (PDMS) slide. (2) Add 1.7 x 10 5Four slides are processed simultaneously to contain 68,000 IgG-expressing HEKACE2 / TMPRSS2 cells at a cell-to-well ratio occupancy of approximately 1:10, allowing a single cell / well probability of >95% by Poisson statistics. The slides are incubated overnight in a 37°C, 5% CO2 incubator to allow IgG secretion. SARS-CoV-2 pseudovirus is deposited on the microwells and allowed to diffuse inside, and the PDMS slide is sealed with a dialysis membrane. The slides are incubated for 16 hours to allow virus entry into the cells. The slides are washed and live cells are harvested from the slides in the presence of a high concentration (1mg / mL) of soluble 910-30 neutralizing IgG to prevent viral infection after the cells are pooled together. The cells are seeded in 24-well plates to recover and grow for 2 days in a 37°C, 5% CO2 incubator. The cells are centrifuged and resuspended in FACS buffer. Harvest the GFP- and GFP+ populations, extract RNA, and perform RT-PCR for antibody genes (22) High-throughput sequencing analysis is performed to obtain VH:VL information. The frequency of antibody variants in each population is compared to determine the population as described in Example 6. (3、21) To determine the identity of neutralizing antibodies in

[0190] Alternatively, screen for anti-SARS-CoV-2 neutralizing antibodies by Lightning Optofluidic System. Load IgG-expressing HEKACE2 / TMPRSS2 cells into OptoSelect™ chips with NanoPen™ chambers to isolate on a one cell per chamber basis and incubate cells overnight to allow antibody secretion. Add SARS-CoV-2 pseudovirus to the chambers and incubate for 3 days. Harvest live cells from Nanoopen™ in the presence of high concentration (1mg / mL) of soluble 910-30 neutralizing IgG to prevent subsequent virus infection when cells are harvested together. Isolate GFP- and GFP+ populations using fluorescence activated cell sorting (FACS), extract RNA and perform RT-PCR for antibody genes. (22)High-throughput sequencing analysis is performed to obtain VH:VL information. The frequency of antibody variants in each population is compared to determine the population as described in Example 6. (3、21) To determine the identity of neutralizing antibodies in

[0191] Example 9: Application of the assay in an emulsion droplet system

[0192] In this example, a microfluidic device was used to encapsulate IgG-expressing HEKACE2 cells in cell secretion medium to form droplets containing one cell per droplet. (6、25、26) An example of cell isolation and antibody secretion using transiently transfected CHO cells for antibody secretion is shown in FIG.

[0193] We implemented this system for a SARS-CoV-2 secreted protein neutralization assay using HEKACE2 cells. The workflow for the neutralization assay using cells secreting proteins within emulsion droplets is shown in Figure 16. Although a broader range of timescales can be used, we incubated the droplets for 4-96 hours to allow secretion of the secreted protein (in this example, IgG) within the droplet. A second droplet containing a SARS-CoV-2 pseudovirus was subsequently mixed with the droplet containing the IgG-expressing HEKACE2 cells. We mixed the droplets using electrofusion, but (24) Alternative droplet mixing methods are known to those skilled in the art and include micropillar resistor arrays. The mixed droplets were incubated for an additional 4-96 hours to allow for pseudovirus infection or neutralization to occur, although broader time scales can be used. The droplets were disrupted and cells were harvested.

[0194] The droplets can be disrupted using chemical reagents including 1H,1H,2H,2H-perfluoro-1-octanol, or other methods known to those skilled in the art. Optionally, strongly neutralizing compounds (e.g., high concentrations of neutralizing antibodies) can be added to the system to prevent new pseudoviral infections after the droplets are mixed together. In one notable example, the droplets are disrupted and live cells are recovered from the droplets in the presence of high concentrations (1 mg / mL) of soluble 910-30 neutralizing IgG to prevent viral infections after the cells are collected together. Optionally, the recovered cells can be cultured for additional hours, days, weeks, or months before screening. Fluorescence-activated cell sorting (FACS) was then used to isolate GFP- and GFP+ cells, RNA was extracted, and RT-PCR was performed for antibody genes. (22) High-throughput sequencing analysis is performed to obtain VH:VL information in GFP- and GFP+ cells. The frequency of antibody variants in each population is compared to determine the population as described in Example 6. (3,21) We determined the identity of neutralizing antibodies in droplets, where GFP- cells are enriched for encoded antibodies that provide protection against SARS-CoV-2 pseudovirus infection, whereas GFP+ cells are enriched for encoded antibodies that do not protect against SARS-CoV-2 or are not expressed in sufficient amounts within the droplets to provide protection under the assay conditions used.

[0195] Example 10: Natural antibody library (9、16、17、19) Discovery of neutralizing antibodies from

[0196] In this prophetic example, a naturally paired VH:VL library is obtained using a naturally paired VH:VL sequencing platform. VH:VL amplicons can be delivered as IgG or IgG fragments via random gene integration using plasmid transfection and resistance gene marker selection, as well as site-specific integration, as described in Example 3. Potent SARS-CoV-2 neutralizing antibodies are screened using multiple methods for single cell isolation, including single cell isolation into well plates (Example 7), printed chambers (Example 8) or microfluidic droplets (Example 9). GPF-HEKACE2 cells and GFP+HEKACE2 cells are then sorted and RT-PCR is performed to obtain paired VH:VL amplicons from each cell population. As previously described (16、17、19) , PCR is performed to add primer barcodes for next generation sequencing analysis of the antibody population. Ten of the most common VH:VL clones enriched in the GFP-negative population are selected for gene synthesis. Transient transfection of the plasmids is then performed to express IgG in suspension of Expi293 cells. Seven days after transfection, the cultures are centrifuged and the supernatant is transferred to a 50 mL centrifuge tube. 0.5 mL of protein G resin is added and the reaction is allowed to proceed for 2 hours on a bench rotator. The reaction mixture is then poured into a polypropylene column, retaining the protein G resin. The IgG is then eluted with 0.1 M glycine-HCl (pH 2.7) and the pH is neutralized with 1 M Tris-HCl (pH 9.0). The purified IgG is then concentrated and subjected to neutralization assay analysis of the individual IgG. The IgG protein concentration was quantified by BCA protein assay. 2 μg of purified IgG is then mixed with SDS-page sample buffer and analyzed for IgG purity by running a TGX Stain-Free precast gel. Serial dilutions of antibodies are made from 10 μg / mL to a final concentration of 0.001 μg / mL. The serially diluted antibodies are combined with 30 μL of SARS-CoV-2 pseudovirus and the reaction is incubated for 1 hour at 37 °C. The virus-antibody mixture is then diluted with 2 × 105 of ACE-expressing HEK293 cells. Incubate at 37° C. and 5% CO2 for 3 days. Analyze the neutralizing activity of the antibodies by flow cytometric analysis of the GFP signal to demonstrate recovery of neutralizing antibodies enriched in the GFP− cell population.

[0197] Example 11: Antibody library variant expression and directed evolution selection for potent neutralizing antibodies.

[0198] In this prophetic example, anti-SARS-CoV-2 antibodies are mutated by one of the methods from DNA shuffling, error-prone PCR, single-site directed mutagenesis to generate an antibody variant library. Combinatorial and / or sequential mutations can be further performed to increase the mutation landscape. The synthetic antibody variant library is cloned into HEKACE2 cells as described in Example 3. SARS-CoV 2 neutralizing antibodies are screened by one of the approaches depicted in Examples 7, 8, and 9. After sorting GFP- and GFP+ cells and subsequent recovery of VH:VL sequence information by RT-PCR from GFP-negative IgG-expressing HEKACE2 cells (enriched for secreting neutralizing antibodies), the screened VH:VL genes are redelivered into an IgG-expressing vector as detailed in Example 3 for subsequent screening rounds (named enriched IgG library). Sequential mutations can also be performed using DNA shuffling, error-prone PCR, single-site directed mutagenesis to increase diversity between screening rounds. Other DNA sequencing and library diversity generation strategies can also be used and are known to those skilled in the art. As shown in Example 3, express both the enriched library and the enriched + mutated IgG library on an IgG expression platform. Rescreen and obtain neutralizing antibody VH:VL sequences using the methods described in Example 7, Example 8 or Example 9. Repeat redelivery and screening of the enriched library for subsequent rounds to further enrich for neutralizing potency until a molecule with the desired neutralizing potency is obtained. This process of rescreening, mutation and redelivery allows for directed evolutionary selection for potently neutralizing antibodies.

[0199] [Example 12: Antibody variants that sequentially neutralize multiple virus strains]

[0200] In this prophetic example, SARS-CoV-2 Wuhan Hu-1 strain is used as a pseudovirus for neutralization analysis to isolate neutralizing antibodies from the methods described in Examples 10 and 11. Neutralizing IgG library expressing HEKACE2 cells can be harvested via harvesting GFP-cells. A sequential neutralization screening (defined as the second round) is performed via the cell isolation platform described in Examples 7, 8 or 9 using another virus mutation variant, such as the S-D614G variant. After the second round of screening, the population is enriched for antibodies that show neutralizing ability against both Wuhan Hu-1 and D614G.

[0201] Alternatively, after FACS after sorting GFP-negative cells, RNA is extracted from these cells and RT-PCR is performed to obtain VH:VL sequences. The VH:VL pairs are then re-delivered to HEKACE2 cells as described in Example 3 to generate secreted protein libraries after single library sorting. A second round of screening is then performed using pseudovirus variants containing the D614 mutation. These methods allow for the selection of neutralizing antibodies that target multiple virus strains of interest.

[0202] Example 13: Neutralization of antibody variants using multiple virus strains simultaneously

[0203] In this prophetic example, pseudovirus neutralization is performed using multiple virus strains simultaneously. First, equal amounts of viruses from a wide range of coronavirus strains, including SARS-CoV-2, SARS-Cov-2-D614G, SARS-CoV-1, and MERS-CoV, are mixed, with each pseudovirus containing YFP, GFP, DsRed, and CFP, respectively. Alternatively, different virus strains can be used, all from different SARS-CoV-2 variants (e.g., B.1.1.7, B.1.351, P.1, B.1.427, and B.1.429). In some embodiments, all viruses encode the same reporter (e.g., GFP). In some embodiments, each virus encodes a different DNA or RNA barcode that is expressed by target cells after infection. In some embodiments, authentic viruses are used. In another embodiment, pseudoviruses are used. Neutralization assays of antibody libraries containing a mixture of virus strains are performed based on the approaches described in Example 7 (multiple-well plate-based), Example 8 (microchamber-based) or Example 9 (microfluidic droplet-based). For the multiple-well plate assay of Example 7, wells containing cells that did not show YFP, GFP, DsRed and CFP were selected as candidate cells expressing antibodies with broad neutralization. Other fluorescent markers can be used and are known to those skilled in the art. In both the microchamber-based method (Example 8) and the microfluidic droplet-based method (Example 9), after recovering the cells from either the microchamber (Example 8) or the droplet (Example 9), the cells are left to grow for an additional 48 hours (the cells can be left to grow for any period between 0 hours and multiple months depending on the experimental priority). Cells that do not express YFP, GFP, DsRed and CFP, as well as cells that show fluorophore expression (i.e., infected), are sorted. VH:VL pairing information of each population is obtained by RT-PCR gene recovery and high-throughput sequencing. The sequences of both screening populations are compared and then candidate antibodies enriched in the YFP, GFP, DsRed and CFP-free populations from HEK293Expi cells are expressed and the antibodies purified for quantification.The neutralizing capacity of individual antibodies against SARS-CoV-2, SARS-Cov-2-D614G, SARS-CoV-1, and MERS-CoV will be evaluated according to the methods described in Example 10.

[0204] Example 14: Neutralization of antibody variants using multiple different viruses simultaneously

[0205] In this prophetic example, pseudovirus neutralization is performed using multiple different virus types at the same time. First, equal amounts of viruses from different strains including SARS-CoV-2, SARS-Cov-2-D614G, YFV, and DENV-1 are mixed, with each pseudovirus containing YFP, GFP, DsRed, and CFP, respectively. In some embodiments, all viruses encode the same reporter (e.g., GFP). In some embodiments, each virus encodes a different DNA or RNA barcode that is expressed by target cells after infection. In some embodiments, authentic viruses are used. In another embodiment, pseudoviruses are used. Cell lines are generated that can be infected with any of the viruses used. In some embodiments, cells that can be infected with SARS-CoV-2, SARS-Cov-2-D614G, YFV, and DENV-1 can be generated by starting with Raji-DC-SIGN cells, which are used for in vitro infection with YFV and DENV-1 recombinant viral particles (RVPs), and modifying Raji-DC-SIGN to express the ACE2 protein, which also allows infection with SARS-CoV-2. Next, a library of antibodies is cloned to express and secrete antibodies from the modified Raji-DC-SIGN-ACE2 cells, and a neutralization assay of the antibody library with a mixture of viruses is performed based on the approach described in Example 7 (multiple-well plate-based), Example 8 (microchamber-based) or Example 9 (microfluidic droplet-based). For the multiple-well plate assay in Example 7, wells containing cells that did not show YFP, GFP, DsRed, and CFP were selected as candidate cells expressing antibodies with broad neutralization. For both the microchamber-based method (Example 8) and the microfluidic droplet-based method (Example 9), after recovering the cells from either the microchamber (Example 8) or droplet (Example 9), they are left to grow for an additional 48 hours (although the cells can be left to grow for anywhere between 0 hours and multiple months, depending on experimental priorities).Cells that do not express YFP, GFP, DsRed and CFP, as well as cells that show fluorophore expression (i.e., infected) are selected. VH:VL pairing information for each population is obtained by RT-PCR gene recovery and high-throughput sequencing. The sequences of both screening populations are compared, and then candidate antibodies enriched in the YFP, GFP, DsRed and CFP-free population from HEK293Expi cells are expressed and the sequences of neutralizing antibodies are determined using a high-throughput assay. In some embodiments, each virus encodes a cell-specific barcode that codes for the virus type, allowing high-throughput DNA-based readout of the virus infecting the bulk or single-cell library in addition to high-throughput analysis of antibody gene sequences of infected or uninfected antibody populations. In some embodiments, single-cell sequencing is used to directly link the barcode of the infecting virus to the DNA sequence of the antibody.

[0206] Example 15: Rapid, high-throughput discovery of secreted proteins that activate 4-1BB.

[0207] In this prophetic example, a cell line is used for 4-1BB expression along with a reporter or other reporter (e.g., GFP or other cell selection markers known in the art) that triggers expression of a fluorescent marker when 4-1BB is activated. A fusion protein of the 4-1BB extracellular domain is generated along with an internal activation signal that triggers GFP expression when 4-1BB is activated. A protein library is encoded into the cell line (one protein variant per cell) that causes each cell to secrete a protein variant. The cells are isolated as single cells in compartments and allowed to incubate for 4 hours to accumulate secreted proteins (however, the time can range from seconds to months depending on the conditions and goals of the experiment). In some embodiments, the compartments are composed of emulsion droplets. Cells that secrete a protein that activates 4-1BB activate a fluorescent marker expression (e.g., GFP). After cell harvesting, marker+ and marker- cells are isolated by flow cytometry and their identities are characterized by DNA sequencing to determine protein variants in the library that can functionally activate 4-1BB. As an alternative approach, a luciferase detection system can be used instead of fluorescent cell sorting to detect secreted proteins with the desired functional activity. After identification of a suitable secreted protein with the desired functional activity, the discovered protein has potential as an immunotherapy to activate 4-1BB for the treatment of cancer or other diseases.

[0208] Example 16: Rapid, high-throughput discovery of secreted proteins that block programmed death receptor 1 (PD-1) activation.

[0209] In this prophetic example, cell lines are generated for PD-1 expression along with a selection marker that triggers expression of a fluorescent reporter or other reporter (e.g., GFP or other cell selection markers known in the art) when PD-1 is activated. Fusion proteins of the PD-1 extracellular domain are generated along with an internal activation signal that triggers GFP expression when PD-1 is activated. A protein library is encoded into the cell line (one protein variant per cell) that causes each cell to secrete a protein variant. Cells are isolated as single cells in compartments and allowed to incubate for 4 hours to accumulate secreted proteins (however, the time can range from seconds to months depending on the conditions and goals of the experiment). In some embodiments, the compartments are composed of emulsion droplets. PD-L1 is then added to the compartments to induce ligation and activation of PD-1. Cells that secrete proteins that block PD-L1 binding and / or prevent PD-1 activation will prevent expression of the fluorescent marker. After cell harvesting, GFP- cells are isolated by flow cytometry and their identity is characterized by DNA sequencing to determine protein variants in the library that can block activation of PD-1 through PD-L1. As an alternative approach, a luciferase detection system can be used instead of fluorescent cell sorting to detect secreted proteins with the desired functional activity. After identification of suitable secreted proteins with the desired functional activity, the discovered proteins have the potential to become immunotherapeutic checkpoint inhibitors for cancer treatment.

[0210] Example 17: Rapid, high-throughput discovery of secreted proteins that block GPCR activation.

[0211] In this prophetic example, cell lines are generated for G protein-coupled receptor (GPCR) expression with a reporter or other reporter (e.g., GFP or other cell selection markers known in the art) that causes expression of a fluorescent marker when the GPCR is activated. The GPCR is expressed in the cell line that activates an internal activation signal when the GPCR is activated. Exemplary cell lines are available, for example, from Eurofins DiscoverX, a company that sells GPCR cell lines, or can be constructed similarly. A secreted protein library is also encoded in the cell line (one protein variant per cell) that causes each cell to secrete a protein variant. The cells are isolated as single cells in compartments and allowed to incubate for 4 hours to accumulate secreted proteins (however, the time can range from seconds to months depending on the conditions and goals of the experiment). In some embodiments, the compartments are composed of emulsion droplets. A GPCR agonist is then added to the compartments to induce ligation and activation of the GPCR. Cells that secrete proteins that block GPCR agonist binding and / or prevent GPCR activation will prevent the expression of the fluorescent marker. After cell harvesting, activated and non-activated cells are isolated by flow cytometry and their identities are characterized by DNA sequencing to determine protein variants in the library that can block GPCR activation. As an alternative approach, a luciferase detection system can be used instead of fluorescent cell sorting to detect secreted proteins with the desired functional activity. After identification of suitable secreted proteins with the desired functional activity, the discovered proteins would be promising candidates as drugs to block GPCR activation.

[0212] Example 18: Rapid, high-throughput discovery of secreted proteins that induce GPCR activation.

[0213] In this prophetic example, cell lines are generated for G protein-coupled receptor (GPCR) expression with a reporter or other reporter (e.g., GFP or other cellular reporters known in the art) that causes expression of a fluorescent reporter when the GPCR is activated. The GPCR is expressed in the cell line that generates an internal activation signal when the GPCR is activated. Exemplary cell lines are available, for example, from Eurofins DiscoverX, a company that sells GPCR cell lines, or can be constructed similarly. A secreted protein library is encoded in the cell line (one protein variant per cell) that causes each cell to secrete a protein variant. The cells are isolated as single cells in compartments and allowed to incubate for 4 hours to accumulate the secreted protein (however, the time can range from seconds to months depending on the conditions and goals of the experiment). Cells that secrete a protein that activates the GPCR express a fluorescent marker in those same cells. After cell harvesting, activated and non-activated cells are isolated by flow cytometry and their identities are characterized by DNA sequencing to determine the protein variants in the library that activate GPCRs. As an alternative approach, a luciferase detection system can be used instead of fluorescent cell sorting to detect secreted proteins with the desired functional activity. After identification of suitable secreted proteins with the desired functional activity, the discovered proteins would be promising candidates as drugs that activate GPCRs.

[0214] Example 19: Secreted protein assay for neutralization of yellow fever virus

[0215] In this example, Raji-DCSIGNR cells were used to test the ability of secreted proteins to neutralize Yellow Fever Virus (YFV). In this example, lentiviral transduction was used to insert genes into cells for secretion to express antibodies in a bicistronic format using the p2a motif described in Example 5. Lentiviral transduction of Raji-DCSIGNR cells was used to evaluate their ability in a high-throughput single-cell neutralization assay. Raji-DCSIGNR cells (16) were transduced with the yellow fever virus neutralizing antibody mAb-17 for antibody secretion, or an empty plasmid that does not induce antibody expression. The cell lines after 4 days of antibody secretion in 96-well plates were tested followed by the addition of YFV recombinant viral particles (RVPs) to verify that the secreted antibodies provide protection from YFV RVP (Figure 17). Cells expressing mAb 17 were protected from YFV RVP infection, whereas cells not expressing mAb 17 were not protected from infection. These data established that the functional neutralizing properties of antibody-secreted proteins can be coupled to a GFP-based reporter (expressed following an RVP infection event) as a cell line platform for direct screening of anti-YFV antibody neutralization in a rapid and high-throughput manner.

[0216] [Example 20: Antibody expression using different leader peptide and promoter combinations]

[0217] In this example, the ability of HEK293 cells expressing ACE2 to be transiently transfected with a plasmid containing 910-30 expressed with different leader peptide combinations (LP1, LP4, LP5 and LP6) for antibody secretion was tested. Lipofectamine 3000 was used as a transfection reagent following the reverse transfection protocol in 96-well plates and incubated at 37°C for 2 days. Two days after transfection, 40 μL of SARS-CoV-2 pseudovirus with a GFP reporter gene was added to the cells and incubated at 37°C for an additional 3 days. Three days after adding the pseudovirus, the supernatant containing the secreted IgG is removed from the cells for use in ELISA antibody quantification. The ELISA readout is shown in Figure 18. Antibodies VRC01 and CR3022 expressed by multiple peptide combinations showed successful antibody expression and demonstrated successful secretion of antibodies using different leader peptides and promoter sequences.

[0218] Example 21: Use of CRISPR-Cas9 to clone antibodies into a soluble protein cellular secretion platform

[0219] In this example, anti-SARS-Cov2 monoclonal antibody, 2-15, was cloned into the donor vector AAVS1 Safe Harbor Targeting Knock-in HR Donor 2 Vector GE622A-1 from System Biosciences. The donor plasmid containing the 2-15 monoclonal antibody was named pGE622A2-15. The 2-15 donor plasmid (pGE622A2-15) and All-in-one Cas9 Smart Nuclease AAVS1 Targeting Plasmid (System Bioscience #CAS601A-1) were then co-transfected into Expi293 cells. Expression of Cas9 nuclease and gRNA after transfection caused a double strain disruption at the Expi293 cell AAVS1 genome site. The 2-15 gene sequence from the donor plasmid was integrated into the AAVS1 locus due to a homologous recombination event (see below for a description of 2-15 gene integration). One week after transfection, puromycin selection (at a concentration of 5 μg / mL) was initiated to reduce randomly integrated Expi293 cells. A stable cell pool with 2 to 15 gene integrations was named Expi2-15.

[0220] Expi2-15 and Expi293 cells were cultured at 3.2 × 10 per well. 4Cells were seeded in 96-well plates at a density of 100x100x100. The cells were then transfected with ACE2 / TMRPSS2 expression plasmid immediately after seeding these cells (both Expi2-15 and Expi293). For the positive control of the neutralization assay, purified 91030 antibody (final concentration 5μg / mL) was added to ACE2 / TMRPSS2 expressing Expi293 cells. For further IgG quantification analysis, 20μL of culture medium was dispensed from each well. 80 μL of SARS CoV-2 reporter virus particles carrying the spike protein D614G mutation and luciferase reporter gene were added to ACE2 / TMPRSS2-expressing Expi2-15 cells (ACE2 / TMPRSS2+Expi2-15), ACE2 / TMPRSS2-expressing wild-type Expi293 cells (ACE / TMPRSS2+Expi293), and ACE / TMPRSS2-expressing wild-type Expi293 cells containing 5 μg / mL of 91030 (ACE / TMPRSS2+Expi293+91030).

[0221] Three days after adding the reporter virus, the culture medium was removed and 30 μL of PBS and 30 μL of diluted Renilla-Glo assay substrate (Renilla-Glo assay substrate diluted 1:100 in assay buffer) were added. Luminescence was then detected with a luminometer after 10 minutes of incubation at room temperature. The average relative light units (RLU) of the luminometer readings for each group were calculated. As shown in the figure below, both the ACE2 / TMPRSS2+Expi2-15 group and the ACE / TMPRSS2+Expi293+91030 (positive control) group showed a significant decrease in relative light units compared to the ACE / TMPRSS2+Expi293 group, indicating that 2-15 secreted from Expi2-15 cells can neutralize the SARS-CoV2 pseudovirus (Figure 20).

[0222] The antibody expression level of the ACE2 / TMPRSS2+Expi2-15 group was verified by ELISA. The average antibody expression level was 0.23μg / mL (n=6) antibody expression from ACE / TMPRSS 2+Expi2-15, suggesting that Expi2-15 cells can secrete functionally active 2-15 (Figure 21). The group ACE / TMPRSS2+Expi293+91030, containing 5ug / mL purified 91030 monoclonal antibody (calculated based on nanodrops of purified 91030), was measured by ELISA at a concentration of 3.9μg / mL as an internal control for our ELISA assay.

[0223] Genomic PCR was further performed to verify the integration of 2-15 mab gene sequencing into Expi2-15 cell line. First, genomic DNA was isolated from wild type Expi293 and Expi2-15 cell lines. Then, PCR amplification was performed to amplify the upstream gene integration region using GoTaq2 hot start polymerase (Promega#M7405) and primers verified and provided by System Bioscience (upstream primer set, forward 5' TCCTGAGTCCGGACCACTTT 3' (SEQ ID NO:25) and reverse 5' CACCGCATGTTAGAAGACTTCC 3' (SEQ ID NO:26)). 1000 b.p. amplicon from Expi2-15 cells showed successful gene integration compared to no PCR amplification from wild type Expi293 cells (see Figure 22a).

[0224] A separate PCR reaction using the human control primer set (forward 5'-ACCTCCAGTTAGGAAAGGGGACT-3' (SEQ ID NO: 27) reverse 5'-AAGTTTTTCTTGAAAACCCATGGAA-3' (SEQ ID NO: 28)) for an internal PCR control (Figure 22b).

[0225] Example 22: Use of TARGATT-specific integration to clone antibodies into a soluble protein cellular secretion platform.

[0226] In this example, anti-SARS-Cov2 monoclonal antibody, 2-15, was cloned into TARGATT 24 CMV-MCS-attB to generate a donor plasmid (designated pTARGATT2-15) according to the instructions of the TARGATT™ HEK Master Cell Line Knock-in Kit. The 2-15 donor plasmid (pTARGATT2-15) and the integrase plasmid were then co-transfected into TARGATT HEK Master cells. The integrase catalyzes the genetic recombination event that allows the integration of the 2-15 monoclonal antibody, mCherry and blasticidin selection marker into the genome (see FIG. 23).

[0227] Three days after transfection, the transfected cells were subcultured at a split ratio of 1:20. 24 hours after subculture, blasticidin was added at a concentration of 10 μg / mL, and blasticidin selection pressure was maintained for 2 weeks. Cell sorting was then performed to isolate mCherry-positive cells enriched for 2-15 integrated cells (named TARGATT2-15). After harvesting of TARGATT2-15 cells, TARGATT2-15 and wild-type TARGATT cells were cultured at 3.2 × 10 per well. 4 Cells were seeded in a 96-well plate at a density of 100 μg / mL. Immediately after seeding, cells were then transfected with ACE2 / TMRPSS2 expression plasmid (as described in Example 1 and Figure 2). Two days after transfection, purified 91030 antibody (final concentration 5 μg / mL) was added to unmodified TARGATT cells as a positive control prior to the pseudovirus neutralization assay. For further IgG quantification analysis, 20 μL of culture medium was dispensed from each well.

[0228] 80 μL of SARS CoV-2 reporter virus particles with spike protein D614G mutation and luciferase reporter gene were added to ACE2 / TMPRSS2-expressing TARGATT2-15 cells (ACE2 / TMPRSS2+TARGATT2-15), ACE2 / TMPRSS2-expressing wild-type TARGATT cells (ACE / TMPRSS2+TARGATTWT), and ACE / TMPRSS2-expressing wild-type TARGATT cells with 5 μg / mL purified 91030 (ACE / TMPRSS2+91030). Three days after adding the reporter virus, the culture medium was removed and 30 μL of PBS and 30 μL of diluted Renilla-Glo assay substrate (Renilla-Glo assay substrate diluted 1:100 in assay buffer) were added. Luminescence was then detected with a luminometer after 10 min of incubation at room temperature. The average relative light units (RLU) of the luminometer readings for each group were calculated. As shown in the figures below, both the ACE2 / TMPRSS2+2-15 group and the ACE / TMPRSS2+91030 group showed a significant decrease in relative luminescence compared to the ACE / TMPRSS2+WT group, indicating that 2-15 secreted from TARGATTHEK2-15 cells can neutralize the SARS-CoV2 pseudovirus (Figure 24).

[0229] The antibody expression level of the ACE2 / TMPRSS2+TARGATT2-15 group was verified by ELISA. The average antibody expression level was 0.44 μg / mL (n=6) antibody expression from TARGATT2-15, suggesting that TARGATT2-15 cells can secrete functionally active 2-15 (Figure 25). The group, ACE / TMPRSS2+91030, containing 5 μg / mL of purified 91030 monoclonal antibody (calculated based on nanodrops of purified 91030), was measured by ELISA at a concentration of 2.74 μg / mL as an internal control for our ELISA assay.

[0230] Genomic PCR was further performed to verify the integration of 2-15 mab gene sequencing into TARGATT2-15 cell line. First, genomic DNA was isolated from wild-type TARGATT and TARGATT2-15 cell lines. PCR amplification was then performed to amplify the downstream gene integration region using GoTaq2 hot start polymerase (Promega#M7405) and primer sequences verified and provided by Applied StemCell, Inc. (downstream primer set, forward 5' CCTTGTAGATGAACTCGCCGT 3' (SEQ ID NO: 29) and reverse 5' GGTGTCGTGATTATTCGAAGGG 3' (SEQ ID NO: 30)). The 500 b.p. amplicon from the TARGATT2-15 group showed successful gene integration compared to no PCR amplification from wild-type TARGATT cells (Figure 26).

[0231] Example 23: Use of a rapid droplet-based assay to identify neutralizing antibodies using next-generation sequencing.

[0232] In this prophetic example, antibodies are cloned into Raji-DCSIGNR cells and a synthetic library mixture is generated to test the ability of droplet-based screening to identify neutralizing antibodies targeting Yellow Fever Virus (YFV). Lentiviral transduction of Raji-DCSIGNR cells was utilized to evaluate their ability to be used in high-throughput single-cell neutralization assays. Raji-DCSIGNR cells are transduced with the Yellow Fever Virus neutralizing antibody mAb-17 for antibody secretion, or other antibodies that do not neutralize YFV (910-30, VRC01, and 2-15). Cells are encapsulated in microfluidic droplets and incubated for 24 hours (although incubation times can range from minutes to weeks depending on the experimental goal) to promote the secretion and accumulation of antibodies within the droplets. The droplets are then mixed using electrofusion techniques (other techniques for droplet mixing can also be used and are known to those skilled in the art) and incubated overnight at 37 °C to infect any cells not protected by secreted antibodies with the pseudovirus (incubation time and incubation temperature may be modified depending on the experimental goal). The droplets are disrupted and the cells are harvested. After a short incubation time (which can range from 0 minutes to several weeks depending on the experimental goal), the GFP+ and GFP- cells are sorted in a flow cytometer to separate neutralized and non-neutralized cells. The cells are harvested and genomic DNA is extracted for PCR-based amplification.

[0233] DNA is sent for next generation sequencing to quantify the prevalence of each antibody clone in the dataset. Neutralizing antibodies were enriched in the set of GFP- cells and depleted in GFP+ cells, allowing neutralizing antibodies to be identified based on these enrichment features. These data will establish that the functional neutralizing properties of antibody secreted proteins can be coupled to a reporter (recombinant viral particles, expressed after an RVP infection event) as a cell line platform for direct screening of anti-YFV antibody neutralization in a rapid and high-throughput manner, and further that the sequences of neutralizing antibodies can be detected using next generation sequencing analysis.

[0234] Example 24: Secreted protein analysis for HIV-1 neutralization

[0235] In this example, TZM-GFP cells were used to test the ability of secreted proteins to neutralize human immunodeficiency virus 1 (HIV-1). Lentiviral-transduced TZM-GFP cells were utilized to evaluate their ability in a high-throughput single-cell neutralization assay. TZM-GFP cells (23) were transduced with the HIV-1 neutralizing antibody VRC34 for antibody secretion, or a control antibody (72A1) that does not neutralize HIV-1. The cell lines were tested after secreting the antibodies for 2 days in 96-well plates before adding HIV-1 pseudovirus particles (strain W6M.EnV.C2) to confirm that the secreted antibodies provided protection from HIV-1 pseudovirus (Figure 27). Cells expressing VRC34 were protected from HIV-1 pseudovirus infection, whereas cells not expressing VRC34 were not protected from infection. These data established that the functional neutralizing properties of antibody-secreted proteins can be coupled to a GFP-based reporter (expressed after a pseudovirus infection event) as a cell line platform for direct screening of anti-HIV-1 antibody neutralization in a rapid and high-throughput manner.

[0236] Example 25: Droplet mix-up technique to enable soluble secretion assays in droplets using secreted protein cellular libraries.

[0237] In this example, we apply the droplet mixing technique to demonstrate the recovery of DNA from a cell library, enabling encapsulation and droplet mixing, as well as secretion cell assays. We first generated a synthetic cell library, where each cell secretes a distinct antibody clone and also expresses ACE2, which can be used to screen secreted protein function. Four different cell populations expressing antibody clones were mixed into a single library (Table 3).

[0238] Table 3. Cells expressing known antibody clones were mixed and used as an artificial cell library. ACE2-expressing HEK293-T clones and different monoclonal antibody clones were cultured at 1 × 10 in high glucose DMEM supplemented with 5% fetal bovine serum and 1% penicillin-streptomycin. 6 Mix as indicated in cells / mL.

[0239] [Table 3]

[0240] Cells were captured in single-cell emulsions using a droplet generator (F02-HPB-8x, uFluidix, Canada) that generates droplets with a diameter of approximately 80 μm. The droplets were then loaded into a droplet mixing device that applies an electric field to induce droplet mixing. This device also generates droplets containing Rhodamine 110 (diameter: approximately 40 μm, #83695, Sigma-Aldrich, USA) for mixing with the cell droplets (Figure 28).

[0241] Example 26: Recovery of DNA to identify secreted proteins in cell populations selected with different selection markers following soluble protein secretion assay.

[0242] In this example, we apply the droplet mixing technique to demonstrate the recovery of DNA from a cell library, enabling encapsulation and droplet mixing, as well as secretion cell assays. We generated and screened a synthetic cell library (Table 3) containing four distinct antibody clones, only some of which are capable of potently neutralizing SARS-CoV-2.

[0243] After droplet mixing with SARS-CoV-2 pseudovirus, which induces GFP expression in infected cells, cells were harvested from the emulsion and sorted for expression of the GFP marker, indicating functional performance differences between the secreted antibodies in the library: in this case, the functional screen identified neutralizing antibodies that were relatively enriched in the GFP- cell population, while non-neutralizing antibodies were included in the GFP+ cell population.

[0244] Genomic DNA was isolated from HEK cells using a Quick-DNA Miniprep Kit (Zymo Research, USA). The heavy chain variable region was then amplified using Platinum Taq DNA Polymerase (ThermoFisher Scientific, USA) using primers anchoring the 3' region of the cytomegalovirus promoter and the 5' region of the heavy constant chain. The primer sequences used were forward: 5'-GGTGGGAGGTCTATATAAGCA-3' (SEQ ID NO: 31), reverse: 5'-CCAGAGGTGCTCTTGGAG-3' (SEQ ID NO: 32). Polymerase chain reaction was performed in 40 cycles using 51°C as the annealing temperature. PCR products were resolved and sized in a 1% agarose gel using a 1 Kb DNA ladder (#N0550S, New England BioLabs, USA). The resulting DNA gel is shown in Figure 29. These data demonstrate our ability to recover DNA sequences from cells for use in high-throughput droplet-based cell-secreted protein functional assays.

[0245] Example 27: Application of a single cell assay using a synthetic library of antibodies with known neutralizing properties against SARS-CoV-2 in an emulsion droplet system.

[0246] This example concerns the successful screening of a synthetic cell library secreting antibody molecules for neutralization of SARS-CoV-2 pseudovirus. First, HEK-ACE2 expressing different monoclonal antibodies were mixed to generate a synthetic library consisting of four antibody-producing cells (previously reported antibodies VRC01, CR3022, 910-30 and mAb1-20). VRC01 does not neutralize SARS-CoV-2 and serves as a negative control. The synthetic library was encapsulated with DMEM medium using a microfluidic device to form droplets containing one cell per droplet. The droplets were incubated for 24 hours to allow IgG secretion within the droplets for antibody accumulation. Subsequently, a second droplet containing D614G SARS-CoV-2 pseudovirus was mixed with the droplet containing IgG-expressing HEK-ACE2 cells. Electrofusion was used to mix the droplets, although alternative methods of mixing droplets have been reported, including the use of micropillar resistor arrays. The mixed droplets were incubated for an additional 24 h to allow infection or neutralization of the pseudovirus to occur. The droplets were then disrupted and the cells harvested. The cells were allowed to recover for 48 h. Fluorescence-activated cell sorting (FACS) was used to isolate GFP- and GFP+ populations, gDNA was extracted from cell aliquots, and PCR was performed to recover antibody gene libraries for NGS analysis. GFP- cells were also harvested and used as input for subsequent screening rounds to further enrich for neutralizing clones.

[0247] High-throughput sequencing analysis was performed on each sorted library of GFP- and GFP+ cells to obtain heavy chain sequence information. The frequency of heavy chain antibody variants in each population was compared to determine the effect of the droplet neutralization assay on neutralizing and non-neutralizing antibodies in the population (Figure 30, Table 4).

[0248] [Table 4]

[0249] Example 28: Application of single cell assays using a synthetic library of antibodies with known neutralizing properties against HIV pseudoviruses in an emulsion droplet system.

[0250] This example concerns the successful screening of a synthetic cell library secreting antibody molecules for neutralization of HIV pseudovirus. First, TZM-GFP cells expressing different monoclonal antibodies were mixed to generate a synthetic library consisting of three antibody-producing cells (previously reported antibodies 72A1, VRC01 and VRC34). 72A1 does not neutralize HIV-1 and serves as a negative control. The synthetic library was encapsulated with medium using a microfluidic device to form droplets containing one cell per droplet. The droplets were incubated for 24 hours to allow IgG to be secreted within the droplets for antibody accumulation. Subsequently, a second droplet containing HIV-1 BG505.W6M.Env.C2 pseudovirus was mixed with a droplet containing IgG-expressing TZM-GFP cells. Electrofusion was used to mix the droplets, although alternative methods of mixing droplets have been reported, including the use of micropillar resistor arrays. The mixed droplets were incubated for an additional 24 hours to allow infection or neutralization of the pseudovirus to occur. The droplets were then disrupted and the cells were harvested. The cells were allowed to recover for 48 h. Fluorescence-activated cell sorting (FACS) was used to isolate the GFP- and GFP+ populations, gDNA was extracted from cell aliquots, and PCR was performed to recover antibody gene libraries for NGS analysis. GFP- cells were also harvested and used as input for subsequent screening rounds to further enrich for neutralizing clones.

[0251] High-throughput sequencing analysis was performed on each sorted library of GFP- and GFP+ cells to obtain heavy chain sequence information. The frequency of heavy chain antibody variants in each population was compared to determine the effect of the droplet neutralization assay on neutralizing and non-neutralizing antibodies in the population (Figure 31, Table 5).

[0252] [Table 5]

[0253] [Cited documents] All references provided in this disclosure, including those listed below, are incorporated herein by reference in their entirety. 1. Mortensen, Richard M., and Robert E. Kingston. “Selection of Transfected Mammalian Cells.” Current Protocols in Molecular Biology, vol. 86, no. 1, Apr. 2009, 10.1002 / 0471142727.mb0905s86. 2.DeKosky,BJ,Kojima,T.,Rodin,A.,Charab,W.,Ippolito,GC,Ellington,AD&Georgiou,G.In-depth determination and analysis of the human paired heavy-and light-chain antibody repertoire.Nat.Med.21,86-91(2015). 3.Wang,B.,DeKosky,B.J.,Timm,M.R.,Lee,J.,Normandin,E.,Misasi,J.,Kong,R.,McDaniel,J.R.,Delidakis,G.,Leigh,K.E.,Niezold,T.,Choi,C.W.,Viox,E.G.,Fahad,A.,Cagigi,A.,Ploquin,A.,Leung,K.,Yang,E.S.,Kong,W.-P.,Voss,W.N.,Schmidt,A.G.,Moody,M.A.,Ambrozak,D.R.,Henry,A.R.,Laboune,F.,Ledgerwood,J.E.,Graham,B.S.,Connors,M.,Douek,D.C.,Sullivan,N.J.,Ellington,A.D.,Mascola,J.R.&Georgiou,G.Functional interrogation and mining of natively paired human VH:VL antibody repertoires.Nature Biotechnology 36,152-155(2018). 4.DeKosky,B.J.,Ippolito,G.C.,Deschner,R.P.,Lavinder,J.J.,Wine,Y.,Rawlings,B.M.,Varadarajan,N.,Giesecke,C.,Dorner,T.,Andrews,S.F.,Wilson,P.C.,Hunicke-Smith,S.P.,Willson,C.G.,Ellington,A.D.&Georgiou,G.High-throughput sequencing of the paired human immunoglobulin heavy and light chain repertoire.Nat Biotech 31,166-169(2013). 5.As shown within the Berkeley Lights website at www.berkeleylights.com. 6.Lagerman,C.E.,Lopez Acevedo,S.N.,Fahad,A.S.,Hailemariam,A.T.,Madan,B.&DeKosky,B.J.Ultrasonically-guided flow focusing generates precise emulsion droplets for high-throughput single cell analyses.Journal of Bioscience and Bioengineering 128,226-233(2019). 7.Georgina To’a Salazar,et al.,Antibody Therapies Targeting Complex Membrane Proteins,Engineering,Volume 7,Issue 11,021,Pages 1541-1551. 8.Hoffmann,M.,Kleine-Weber,H.,Schroeder,S.,Kruger,N.,Herrler,T.,Erichsen,S.,Schiergens,T.S.,Herrler,G.,Wu,N.-H.,Nitsche,A.,Muller,M.A.,Drosten,C.&Pohlmann,S.SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor.Cell 181,271-280.e8(2020). 9.Nat Protoc.2016 Mar;11(3):429-42.doi:10.1038 / nprot.2016.024.Epub 2016 Feb 4. 10.Kulmala A,Huovinen T,Lamminmaki U.Improvement of Fab expression by screening combinatorial synonymous signal sequence libraries.Microb Cell Fact.2019 Sep 16;18(1):157.doi:10.1186 / s12934-019-1210-1.PMID:31526395;PMCID:PMC6745802. 11.Zalucki YM,Beacham IR,Jennings MP.Biased codon usage in signal peptides:a role in protein export.Trends Microbiol.2009 Apr;17(4):146-50.doi:10.1016 / j.tim.2009.01.005.Epub 2009 Mar 21.PMID:19307122. 12.Zhang J,Collins A,Chen M,Knyazev I,Gentz R.High-density perfusion culture of insect cells with a biosep ultrasonic filter.Biotechnol Bioeng.1998 Aug 5;59(3):351-9.doi:10.1002 / (sici)1097-0290(19980805)59:3<351::aid-bit11>3.0.co;2-h.PMID:10099346. 13.Arnold CE,Parekh RN,Yang W,Wittrup KD.Leader peptide efficiency correlates with signal recognition particle dependence in Saccharomyces cerevisiae.Biotechnol Bioeng.1998 Aug 5;59(3):286-93.PMID:10099339. 14.Khorshidi S,Zomorodipour A,Behmanesh M,Vatandoost J,Bos MH.Functional expression of the human coagulation factor IX using heterologous signal peptide and propeptide sequences in mammalian cell line.Biotechnol Lett.2015 Sep;37(9):1773-81.doi:10.1007 / s10529-015-1868-3.Epub 2015 Jun 24.Erratum in:Biotechnol Lett.2015 Oct;37(10):2097.PMID:26105559. 15.Mukhamedova M,Wrapp D,Shen CH,Gilman MSA,Ruckwardt TJ,Schramm CA,Ault L,Chang L,Derrien-Colemyn A,Lucas SAM,Ransier A,Darko S,Phung E,Wang L,Zhang Y,Rush SA,Madan B,Stewart-Jones GBE,Costner PJ,Holman LA,Hickman SP,Berkowitz NM,Doria-Rose NA,Morabito KM,DeKosky BJ,Gaudinski MR,Chen GL,Crank MC,Misasi J,Sullivan NJ,Douek DC,Kwong PD,Graham BS,McLellan JS,Mascola JR.Vaccination with prefusion-stabilized respiratory syncytial virus fusion protein induces genetically and antigenically diverse antibody responses.Immunity.2021 Apr 13;54(4):769-780.e6.doi:10.1016 / j.immuni.2021.03.004.Epub 2021 Apr 5.PMID:33823129;PMCID:PMC8099422. 16.Fahad,A.S.et al.Functional Profiling of Antibody Immune Repertoires in Convalescent Zika Virus Disease Patients.Front.Immunol.12,(2021). 17.Banach,B.B.et al.Paired heavy and light chain signatures contribute to potent SARS-CoV-2 neutralization in public antibody responses.bioRxiv 2020.12.31.424987(2021)doi:10.1101 / 2020.12.31.424987. 18.DeKosky,B.J.et al.In-depth determination and analysis of the human paired heavy-and light-chain antibody repertoire.Nat.Med.21,86-91(2015). 19.Wang,B.et al.Functional interrogation and mining of natively paired human VH:VL antibody repertoires.Nature Biotechnology 36,152-155(2018). 20.Tian,M.et al.Induction of HIV Neutralizing Antibody Lineages in Mice with Diverse Precursor Repertoires.Cell 166,1471-1484.e18(2016). 21.Jin,W.,Madan,B.,Mussman,B.K.,Hailemariam,A.T.,Fahad,A.S.,Wolfe,J.R.,Kwon,Y.D.,Zhang,B.,Shapiro,L.,Kwong,P.D.&DeKosky,B.J.The Covalent SNAP Tag for Protein Display Quantification and Low-pH Protein Engineering.Journal of Biotechnology(2020).doi:10.1016 / j.jbiotec.2020.06.011 22.Georgiou,G.,Ippolito,G.C.,Beausang,J.,Busse,C.E.,Wardemann,H.&Quake,S.R.The promise and challenge of high-throughput sequencing of the antibody repertoire.Nature Biotechnology 32,158-168(2014). 23.Gludish DW,Boliar S,Caldwell S,Tembo DL,Chimbayo ET,Jambo KC,Mwandumba HC,Russell DG.TZM-gfp cells:a tractable fluorescent tool for analysis of rare and early HIV-1 infection.Sci Rep.2020 Nov 16;10(1):19900.doi:10.1038 / s41598-020-76422-6.PMID:33199722;PMCID:PMC7670428. 24.Abate AR,Hung T,Mary P,Agresti JJ,Weitz DA.High-throughput injection with microfluidics using picoinjectors.Proc Natl Acad Sci U S A.2010 Nov 9;107(45):19163-6.doi:10.1073 / pnas.1006888107.Epub 2010 Oct 20.PMID:20962271;PMCID:PMC2984161. 25.Seah,Y.F.S.,Hu,H.&Merten,C.A.Microfluidic single-cell technology in immunology and antibody screening.Molecular Aspects of Medicine 59,47-61(2018). 26.Debs,B.E.,Utharala,R.,Balyasnikova,I.V.,Griffiths,A.D.&Merten,C.A.Functional single-cell hybridoma screening using droplet-based microfluidics.Proceedings of the National Academy of Sciences 109,11570-11575(2012).

[0254] It will be readily apparent to those skilled in the art that various substitutions and modifications can be made to the invention disclosed herein without departing from the scope and intent of the invention. The invention illustratively described herein may be suitably implemented in the absence of any element or elements, or any limitation or limitations not specifically disclosed herein. The terms and expressions used are used as terms of description rather than limitation, and there is no intention in the use of such terms and expressions to exclude the features shown and described or equivalents of any portion thereof, but it is recognized that various modifications are possible within the scope of the invention. Thus, although the invention is illustrated by specific embodiments and optional features, it should be understood that modifications and / or variations of the concepts disclosed herein may be made by those skilled in the art, and such modifications and variations are considered to be within the scope of the invention.

[0255] Numerous patent and non-patent literature may be cited herein. All cited literature is incorporated herein by reference in its entirety. If there is a discrepancy in the definition of a term in this specification compared to the definition of the term in the cited literature, the term shall be interpreted based on the definition in this specification.

Claims

1. A screening method comprising: The screening method comprises: (a) detecting the presence and / or level of expression of a reporter molecule in an isolated, genetically engineered single cell; the cells display cell surface proteins; The cells (i) secreting a heterologous test polypeptide; (ii) engineered to express a reporter molecule when the test polypeptide activates a cell surface protein; or The screening method comprises: (a) detecting the presence and / or level of expression of a reporter molecule in an isolated, genetically engineered single cell; the cells display cell surface proteins; The cells (i) secreting a heterologous test polypeptide; (ii) engineered to express a reporter molecule when the test polypeptide does not activate a cell surface protein; or The screening method comprises: (a) contacting an isolated, genetically engineered single cell with a test reagent; the cells display cell surface proteins; The cells (i) secreting a heterologous test polypeptide; (ii) the test polypeptide or one of the test reagents is engineered to express a reporter molecule when it activates the cell surface protein; (b) detecting the presence and / or level of expression of said reporter molecule; or The screening method comprises: (a) contacting an isolated, genetically engineered single cell with a test reagent comprising a reporter molecule; the cells display cell surface proteins; the test reagent is capable of binding to the cell surface protein presented by the cell to form a reagent-protein complex, and upon formation of a reagent-receptor complex, the test reagent gains entry into the cell; The cells (i) engineered to secrete a heterologous test polypeptide; (b) detecting the presence and / or level of expression of said reporter molecule in said cell; Screening methods.

2. The method of claim 1 , wherein the cell comprises a mammalian cell, an insect cell, an avian cell, a yeast cell, a plant cell, or a bacterial cell.

3. The method of claim 1 , wherein the cell surface protein comprises an endogenous receptor.

4. 10. The method of claim 1, wherein the isolated, genetically engineered single cell is in a well of a multi-well plate, in a chamber of a microchip, in a microfluidic droplet such as an emulsion droplet, or in a Nanopen™.

5. The reporter molecule is (a) a fluorescent marker, wherein detecting the presence and / or level of expression of said reporter molecule comprises sorting fluorescent activated cells; (b) an enzyme; (c) a tagged protein, or (d) comprising a nucleic acid sequence; 10. The method of claim 1, wherein detecting the presence and / or level of expression of the reporter molecule comprises one or more of an amplification reaction and a sequencing reaction, optionally a single cell sequencing reaction.

6. The method of claim 1, further comprising sequencing the DNA encoding the heterologous test polypeptide.

7. The heterologous test peptide comprising a variant of a receptor ligand, the test reagent comprises a cell surface protein ligand, and the test polypeptide is derived from a library of potential agonists or antagonists of receptor activation by the ligand; The method of claim 1.

8. The method of claim 1 , wherein the test polypeptide comprises an antibody or an antigen-binding fragment thereof.

9. 2. The method of claim 1, wherein the test reagent comprises one or more of a virus, a virus-like particle, a pseudovirus, and a recombinant virus particle, and the cell surface protein comprises a component of viral entry into a cell.

10. A composition, kit or system comprising the genetically engineered cells of claim 1.

11. (a) a vector encoding a heterologous test polypeptide; (b) a kit comprising a vector encoding a reporter molecule, expression of the reporter molecule is activated when the heterologous test polypeptide or the test reagent activates a cell surface protein, or when the heterologous test polypeptide does not activate a cell surface protein; kit.

12. The kit of claim 11, wherein the one or more nucleic acids further encode (c) a cell surface protein, or the heterologous test polypeptide is operably linked to a promoter, or the test reagent comprises a reporter molecule, or the heterologous test peptide comprises an antibody or portion thereof.

13. 13. The kit of claim 11 or 12, wherein the test reagent comprises one or more of a virus, a virus-like particle, a pseudovirus, and a recombinant virus particle.

14. (1) a vector for expressing a heterologous test polypeptide; (2) A nucleic acid encoding a reporter, the expression of which is activated when the heterologous test polypeptide activates a cell surface protein, or a nucleic acid encoding a reporter, the expression of which is activated when the heterologous test polypeptide does not activate a cell surface protein, or a nucleic acid encoding a reporter, the expression of which is activated when the heterologous test polypeptide activates a cell surface protein. including genetically engineered cells, kit.

Images