Gene therapy for Gaucher disease

Abstract

The present disclosure describes improved vectors, such as adeno-associated virus (AAV) vectors, for expressing beta-glucocerebrosidase (GCase) in transduced cells and the use of such vectors to increase the amount of GCase in subjects experiencing GCase deficiency, such as subjects with Gaucher disease type 1.

Description

[Background technology]

[0001] Gaucher disease (GD) is an autosomal recessive lysosomal storage disorder resulting from mutations in the gene encoding β-glucocerebrosidase (GBA). Insufficient activity of this enzyme in lysosomes results in the intracellular accumulation of the glycolipid glucocerebroside throughout the body, particularly in the bone marrow, spleen, and liver. Symptoms, age of onset, and severity vary widely among individuals, but common symptoms include hepatosplenomegaly, anemia, thrombocytopenia, and skeletal abnormalities.

[0002] There are three major clinical subtypes of Gaucher disease. Type 1, the most common, does not involve the nervous system, while types 2 (acute neuropathic) and 3 (subacute neuropathic) result in the accumulation of glucocerebroside in the brain and are therefore associated with neurological complications. Two less common forms of the disease are also known, including perinatal fatal Gaucher disease and cardiovascular Gaucher disease.

[0003] To date, two approaches to treating GD have been developed. Enzyme replacement therapy (ERT) for GD aims to compensate for deficient β-glucocerebrosidase activity by intravenously injecting a recombinant version of the enzyme. Examples of ERT drugs approved for GD type 1 include imiglucerase and velaglucerase alfa. While ERT is effective in reducing at least some symptoms of GD, it requires injections on average every two weeks, and treatment is lifelong. Furthermore, it is not uncommon for GD patients receiving ERT to develop neutralizing antibodies against exogenously supplied GCase, which can reduce efficacy or even require discontinuation of ERT. A second, more recently developed approach, substrate reduction therapy (SRT), involves the oral administration of small molecule drugs that inhibit the biosynthesis of GlcCer, a GCase substrate. Examples of SRT drugs approved for GD type 1 include eliglustat and miglustat. However, SRT is only approved for adults, not pediatric patients with GD, and is associated with numerous side effects and requires lifelong treatment to manage disease progression and symptoms associated with GD. Summary of the Invention [Problem to be solved by the invention]

[0004] Given the shortcomings associated with the current standard of care, there is a need in the art for improved methods for treating Gaucher disease type 1, particularly therapies that require less frequent administration. [Means for solving the problem]

[0005] To address this need in the art, the present disclosure provides improved adeno-associated virus (AAV) vectors for expressing beta-glucocerebrosidase (GCase) protein, methods for producing such AAV vectors, and methods for using such AAV vectors to prevent or treat diseases or disorders in a subject characterized by a deficiency in the amount of GCase protein and / or the enzymatic activity of GCase protein, including, but not limited to, Gaucher disease type 1.

[0006] Specific enumerated, non-limiting embodiments (E) of the disclosed invention are set forth below. These and related embodiments are described in further detail in the detailed description, including the examples and figures. Those skilled in the art will recognize or be able to ascertain, using no more than routine experimentation, equivalents to the specific embodiments described herein.

[0007] E1. A recombinant adeno-associated virus (AAV) vector genome containing a nucleotide sequence encoding the beta-glucocerebrosidase (GCase) protein. E2. The AAV vector genome of E1, wherein the GCase protein comprises a secretory signal peptide sequence and a mature polypeptide sequence. E3. The AAV vector genome of E1-E2, wherein the mature polypeptide sequence of said GCase protein is derived from wild-type human GCase protein. E4. The AAV vector genome of E1-E3, wherein the mature polypeptide sequence of said GCase protein comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 40. E5. The AAV vector genome according to E1 to E4, wherein the secretory signal peptide sequence is derived from a wild-type human GCase protein. E6. The AAV vector genome of E5, wherein the secretory signal peptide sequence comprises the amino acid sequence of SEQ ID NO: 39. E7. The AAV vector genome according to any one of E1 to E4, wherein the secretory signal peptide sequence is derived from a protein other than GCase. E8. The AAV vector genome of E7, wherein the secretory signal peptide sequence is derived from an immunoglobulin protein. E9. The AAV vector genome of E8, wherein the secretory signal peptide sequence comprises the amino acid sequence of SEQ ID NO: 38. E10. The AAV vector genome described in E1 to E4, wherein the amino acid sequence of the GCase protein is provided by the amino acid sequence of SEQ ID NO: 16. E11. The AAV vector genome of any one of E1 to E10, wherein the nucleotide sequence encoding the mature polypeptide sequence of the GCase protein is a wild-type nucleotide sequence. E12. The AAV vector genome of E1 to E10, wherein the nucleotide sequence encoding the mature polypeptide sequence of the GCase protein is a codon-optimized nucleotide sequence. E13. The AAV vector genome of E12, wherein the codon-optimized nucleotide sequence has a reduced number of CpG dinucleotides compared to the wild-type nucleotide sequence encoding the mature polypeptide sequence of said GCase protein. E14. The AAV vector genome of E13, wherein the nucleotide sequence encoding the GCase protein has 1 to 50, 1 to 45, 1 to 40, 1 to 35, 1 to 30, 1 to 25, 1 to 20, 1 to 15, 1 to 10 or 1 to 5 fewer CpG dinucleotides than the wild-type nucleotide sequence encoding the mature polypeptide sequence of said GCase protein. E15. The AAV vector genome described in E13 to E14, wherein the wild-type nucleotide sequence encoding the mature polypeptide sequence of the GCase protein is composed of the nucleotide sequence of SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, or SEQ ID NO: 32. E16. An AAV vector genome as described in E13, wherein the nucleotide sequence encoding the GCase protein lacks CpG dinucleotides. E17. The AAV vector genome of E1 to E13, wherein the nucleotide sequence encoding the mature polypeptide sequence of the GCase protein is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identical to the nucleotide sequence of SEQ ID NO: 13. E18. The AAV vector genome of E1 to E13, wherein the nucleotide sequence encoding the mature polypeptide sequence of said GCase protein is identical to the nucleotide sequence of SEQ ID NO: 13. E19. The AAV vector genome of E1 to E13, wherein the nucleotide sequence encoding said GCase protein is identical to the nucleotide sequence of SEQ ID NO: 41. E20. The AAV vector genome of E1 to E19, wherein said genome comprises at least one AAV inverted terminal repeat (ITR). E21. The AAV vector genome of E20, wherein the nucleotide sequence of the ITRs is wild-type. E22. The AAV vector genome of E20, wherein the nucleotide sequence of the ITRs is modified. E23. The AAV vector genome of E22, wherein the nucleotide sequences of the ITRs have been modified to reduce or eliminate the ability of the ITRs to undergo terminal degradation. E24. The AAV vector genome of E22, wherein the nucleotide sequence of the ITRs has been modified to inactivate a terminal resolution site. E25. The AAV vector genome of E22, wherein the nucleotide sequences of the ITRs have been modified to reduce or eliminate the ability of the ITRs to support packaging into a capsid. E26. The AAV vector genome of E22, wherein the nucleotide sequence of the ITRs has been modified to inactivate the D region. E27. The AAV vector genome according to E20 to E21, wherein the ITRs are AAV2 ITRs. E28. The AAV vector genome of E27, wherein the AAV2 ITRs are truncated. E29. The AAV vector genome of E20, wherein the ITRs comprise, consist essentially of, or consist of the nucleotide sequence of SEQ ID NO:7, SEQ ID NO:15, SEQ ID NO:18, or SEQ ID NO:19, or the complement or reverse complement of each of said sequences. E30. The AAV vector genome of E20-E21, wherein the ITRs are other than AAV2 ITRs. E31. An AAV vector genome as described in E1 to E30, comprising a first AAV ITR located at its 5' end and a second AAV ITR located at its 3' end. E32. The AAV vector genome of E31, further comprising a third AAV ITR. E33. The AAV vector genome of E32, wherein said third ITR is modified to inactivate a terminal resolution site. E34. The AAV vector genome according to E1 to E33, further comprising a transcriptional control region operably linked to said nucleotide sequence encoding a GCase protein. E35. The AAV vector genome of E34, wherein the transcriptional control region is constitutive. E36. The AAV vector genome of E34, wherein the transcriptional control region is inducible. E37. The AAV vector genome of E34, wherein the transcriptional control region is tissue-specific. E38. The AAV vector genome of E37, wherein the transcriptional control region is liver tissue-specific. E39. The AAV vector genome according to E34 to E38, wherein the transcriptional regulatory region comprises a promoter sequence. E40. The AAV vector genome of E39, wherein the transcriptional control region further comprises an enhancer sequence. E41. The AAV vector genome of E40, wherein said enhancer sequence is located 5' to the promoter. E42. The AAV vector genome of E40, wherein said enhancer sequence is located 3' to the promoter. E43. The AAV vector genome of E39, wherein said promoter sequence is liver tissue-specific. E44. The AAV vector genome of E40, wherein said enhancer sequence is liver tissue-specific. E45. The AAV vector genome of E40, wherein each of the promoter and enhancer sequences is liver tissue-specific. E46. The AAV vector genome of E39, wherein the promoter sequence is derived from the human albumin (ALB) gene. E47. The AAV vector genome of E40, wherein the enhancer sequence is derived from the human albumin (ALB) gene or the alpha-1-microglobulin / bikunin precursor (AMBP) gene. E48. The AAV vector genome of E46, wherein said promoter sequence comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 10, or a promoter functional subsequence, variant, or variant thereof. E49. The AAV vector genome of E47, wherein the enhancer sequence comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO:9 or SEQ ID NO:8, respectively, or an enhancer-functional subsequence, variant, or variant thereof. E50. An AAV vector genome as described in E1 to E49, further comprising a transcription termination signal sequence. E51. The AAV vector genome of E50, wherein said transcription termination signal sequence is a polyadenylation (poly(A)) signal sequence. E52. The AAV vector genome of E51, wherein said transcription termination signal sequence is derived from the bovine growth hormone (bGH) gene. E53. The AAV vector genome of E52, wherein said transcription termination signal sequence comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 14, or a transcription termination signal functional subsequence thereof, or a variant or modification thereof. E54. The AAV vector genome of E1-E53, further comprising an intron sequence. E55. The AAV vector genome of E54, wherein the intron sequence is located within and interrupts the nucleotide sequence encoding the GCase protein. E56. The AAV vector genome of E54, wherein said intron sequence does not interrupt the nucleotide sequence encoding said GCase protein. E57. The AAV vector genome of E56, wherein the intron sequence is located 5' to the nucleotide sequence encoding the GCase protein. E58. The AAV vector genome of E57, wherein the intron sequence is located 3' of the promoter and 5' of the nucleotide sequence encoding the GCase protein. E59. The AAV vector genome according to E54 to E58, wherein the intron sequence is derived from the human beta globin (HBB) gene. E60. The AAV vector genome of E59, wherein said intron sequence comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO:11. E61. The AAV vector genome described in E1-E60, further comprising a post-transcriptional regulatory element (PRE) sequence. E62. The AAV vector genome of E61, wherein the PRE sequence is located 3' to the nucleotide sequence encoding the GCase protein and 5' to a transcription termination signal sequence. E63. The AAV vector genome according to E61 to E62, wherein the PRE sequence is a WPRE or HPRE sequence. E64. The AAV vector genome of E63, wherein said PRE sequence comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 27. E65. An AAV vector genome as described in E1-E64, further comprising a binding site for a microRNA (miRNA). E66. The AAV vector genome of E65, wherein the miRNA binding site is located 3' to the nucleotide sequence encoding the GCase protein and 5' to a transcription termination signal sequence. E67. The AAV vector genome of any one of E1 to E64, further comprising a stuffer or filler nucleotide sequence of sufficient length such that the total length of the AAV vector genome is approximately 4.5 to 5.0 kilobases. E68. An AAV vector genome according to E1 to E64, comprising a first AAV ITR, a transcriptional control region operably linked to the nucleotide sequence encoding a GCase protein, a transcriptional termination signal sequence, and a second AAV ITR. E69. The AAV vector genome of E68, comprising, in 5' to 3' order, the first AAV ITR, the transcriptional control region operably linked to the nucleotide sequence encoding a GCase protein, the transcription termination signal sequence, and the second AAV ITR. E70. The AAV vector genome of E69, wherein the transcriptional control region comprises a promoter located 5' of the nucleotide sequence encoding a GCase protein and an enhancer located 5' of the promoter. E71. The AAV vector genome of E68-E70, further comprising an intron located between the promoter and the nucleotide sequence encoding a GCase protein. E72. The AAV vector genome of E68-E70, further comprising an intron located within and interrupting the nucleotide sequence encoding a GCase protein. E73. The AAV vector genome according to E68 to E72, further comprising a PRE located between the nucleotide sequence encoding a GCase protein and the poly(A) signal sequence. E74. The AAV vector genome of E68 to E73, wherein the first AAV ITR is located at the 5' end of the vector genome and the second AAV ITR is located at the 3' end of the vector genome. E75. The AAV vector genome of E74, further comprising a third AAV ITR located between the first and second AAV ITRs. E76. The AAV vector genome of E75, wherein the terminal resolution site of the third AAV ITR is inactivated. E77. The AAV vector genome according to E68 to E76, wherein the transcriptional regulatory region is liver tissue-specific. E78. The AAV vector genome of E77, wherein the transcriptional control region comprises a first copy of an AMBP gene enhancer sequence, a second copy of an AMBP gene enhancer sequence, an ALB gene enhancer sequence, and an ALB gene promoter sequence. E79. The AAV vector genome of E78, wherein each of the first and second copies of the AMBP gene enhancer sequence comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 8, the ALB gene enhancer sequence comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 9, and the ALB gene promoter sequence comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 10. E80. The AAV vector genome according to E71 to E79, wherein the intron sequence is derived from the human beta globin (HBB) gene. E81. The AAV vector genome of E80, wherein said intron sequence comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO:11. E82. The AAV vector genome of E68 to E81, wherein the transcription termination signal sequence is derived from the bovine growth hormone (bGH) gene. E83. The AAV vector genome of E82, wherein said transcription termination signal sequence comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 14, or a transcription termination signal functional subsequence thereof, or a variant or modification thereof. E84. The AAV vector genome of E68-E83, further comprising a modified TBP intron 2 sequence located 3' of the transcription termination signal sequence and 5' of the second AAV ITR. E85.5' to 3' in order, (a) the first AAV2 ITR; (b) a first copy of the AMBP gene enhancer sequence; (c) a second copy of the AMBP gene enhancer sequence; (d) ALB gene enhancer sequence; (e) ALB gene promoter sequence; (f) human beta globin (HBB) gene intron sequence; (g) a nucleotide sequence encoding a human GCase protein operably linked to the first and second copies of the AMBP enhancer, the ALB enhancer, and the ALB promoter, wherein the GCase protein comprises a secretory signal peptide sequence and a mature polypeptide sequence; (h) bovine growth hormone (bGH) gene transcription termination signal sequence; (i) a modified TBP intron 2 sequence; and (j) Second AAV2 ITR The AAV vector genome according to E1 to E4, comprising: E86. The AAV vector genome of E85, wherein each of the first and second copies of the AMBP gene enhancer sequence comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 8; the ALB gene enhancer sequence comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 9; the ALB gene promoter sequence comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 10; the human beta globin (HBB) gene intron sequence comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 11; the nucleotide sequence encoding the human GCase protein comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 41; and the bovine growth hormone (bGH) gene transcription termination signal sequence comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 14. E87. The AAV vector genome of E85-E86, wherein each of the first and second AAV2 ITRs comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO:7, SEQ ID NO:15, SEQ ID NO:18, or SEQ ID NO:19, or the complement or reverse complement of each of said sequences. E87. The AAV vector genome of E85-E87, wherein the nucleotide sequence of said vector genome comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 17, or the reverse complement thereof. An AAV vector genome, described as E1 to E87, which is 8.5 kilobases or less in length. E89. An AAV vector comprising an AAV capsid and an AAV vector genome according to any one of E1 to E88, wherein the vector genome is enveloped in the capsid. E90. The AAV vector of E89, wherein the AAV capsid is liver-tropic. E91. The AAV capsids include AAV2, AAV3B, AAV5, AAV6, AAV7, AAV8, AAV9, AAV13, AAVrh.74, AAVrh.10, AAV-DJ, AAV-LK03, AA V-KP1, AAV-hu.Lvr01, AAV-hu.Lvr02, AAV-hu.Lvr03, AAV-hu.Lvr04, AAV-hu.Lvr05, AAV-hu.Lvr06, AAV-hu.Lv The AAV vector described in E89 to E90 is selected from the group consisting of r07, AAV-Anc80, AAV-NP40, AAV-NP59, AAV-NP84, AAV-hu.37, AAV-rh.8, AAV-rh.64R1, RHM4-1, RHM15-1, RHM15-2, RHM15-3 / RHM15-5, RHM15-4 and RHM15-6, AAVHSC7, AAVHSC15 and AAVHSC17. E92. The AAV vector of E89-E90, wherein the AAV capsid comprises a VP1 protein comprising or consisting of an amino acid sequence selected from the group consisting of SEQ ID NO:1 and SEQ ID NO:4. E93. The AAV vector of E89 to E92, wherein the vector genome is a single-stranded DNA genome. E94. The AAV vector of E89-E92, wherein the vector genome is a self-complementary DNA genome. E95. The AAV vector according to E93 to E94, wherein the vector genome is of positive polarity. E96. The AAV vector according to E93 to E94, wherein the vector genome is of negative polarity. E97. An AAV vector comprising an AAV3B capsid and an AAV vector genome, wherein the nucleotide sequence of the vector genome comprises or consists of the nucleotide sequence of SEQ ID NO: 17 or its reverse complement, and wherein the vector genome is enveloped in the capsid. A pharmaceutical composition comprising an AAV vector according to E98, E89 to E97 and a pharmaceutically acceptable excipient. E99. A method for increasing the amount of active GCase protein in peripheral blood mononuclear cells (PBMCs) of a human subject diagnosed with a deficiency in GCase enzyme activity or decreasing the amount of glucosylsphingosine in the serum of said subject, comprising administering to said subject an AAV vector or composition described in E1 to E98 in an amount effective to increase the amount of active PBMC GCase protein or decrease the amount of serum glucosylsphingosine. E100. The method of E99, which is effective to increase the amount of active GCase protein in the subject's PBMCs to at least or about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90% or 100% of the amount of active GCase protein in the PBMCs of a healthy human. E101. The method of E100, wherein the amount of active GCase protein in PBMCs of healthy humans ranges from about 20 to 130 picograms per million cells (pg / 1E6), or an average of about 70 pg / 1E6 cells. E102. The method of E99, which is effective to increase the amount of active GCase protein in the subject's PBMCs by at least 25%, 50%, 75%, 100%, 125%, 150%, 175%, 200%, 225%, 250%, 300%, 400% or 500% compared to the average amount of active GCase protein in the subject's PBMCs before administration of the AAV vector or composition. E103. The method of E99, wherein the method is effective to increase the amount of active GCase protein in the subject's PBMCs to at least or about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 140, or 150 pg / 1E6 cells. E104. The method of E99, wherein the method is effective to reduce the amount of glucosylceramide or glucosylsphingosine in the serum of the subject by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, or 90% compared to the average amount of serum glucosylceramide or glucosylsphingosine in the subject before administration of the AAV vector or composition. E105. The method of E99, effective to reduce the amount of glucosylceramide or glucosylsphingosine in the subject's serum to about 200, 175, 150, 125, 100, 75, 50, 25, or 10 nanograms per mL of serum or less. E106. The method of E99 to E105, wherein the increase in active GCase protein in the subject's PBMCs or the decrease in glucosylceramide or glucosylsphingosine in the serum occurs within 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 days of administration of the AAV vector or composition. E107. A method for reducing the severity of at least one symptom or sign in a human subject caused by a deficiency in GCase enzyme activity, comprising administering to the subject an AAV vector or composition E1-E98 in an amount effective to reduce the severity of such symptom or sign. E108. The method of E107, wherein the symptom or sign is selected from the group consisting of hepatosplenomegaly, hepatomegaly, splenomegaly, anemia, neutropenia, pancytopenia, thrombocytopenia, monoclonal gammopathy, polyclonal gammopathy, anorexia, chronic fatigue, avascular osteonecrosis, bone pain, osteolysis, osteonecrosis, and osteopenia. E109. The method of E99 to E108, wherein the deficiency of GCase enzymatic activity in the subject is caused by a homozygous or heterozygous mutation in the gene encoding the GCase protein, which reduces the amount or enzymatic activity of GCase protein expressed from the gene compared to the average amount or activity of GCase protein in healthy humans having an unmutated GBA gene. E110. The method of E99 to E109, wherein the subject has been diagnosed with Gaucher disease type 1. E111. A method for preventing or treating Gaucher disease type 1 in a human subject, comprising administering to the subject a prophylactically or therapeutically effective amount of an AAV vector or composition described in E1-E98 that is effective to prevent or treat Gaucher disease type 1 in the subject. E112. The effective amount of the AAV vector is 1 x 10 per kilogram of the subject's body weight. 10 ~1×10 15 The method according to E99 to E111, which is a dose range of vector genome (vg / kg). E113. The method of E99 to E112, wherein the AAV vector or composition is administered intravenously to the subject. E114. Use of an AAV vector described in E1 to E97 in the manufacture of a medicament for treating or preventing Gaucher disease type 1 in a human subject. A DNA plasmid containing the nucleotide sequence of an AAV vector genome described in E115.E1 to E88. A host cell for producing an AAV vector, comprising the DNA plasmid described in E116.E115. E117. The host cell of E116, wherein the host cell is a HEK293 cell. E118. The host cell of E116-E117, further comprising a gene encoding an AAV Rep protein, such as contained in a DNA plasmid. E119. The host cell of E116-E118, further comprising a gene encoding the AAV VP1 capsid protein, such as contained in a DNA plasmid. E120. The host cell according to E116 to E119, further comprising a gene encoding a viral helper factor, such as that contained in a DNA plasmid. E121. A method of producing an AAV vector, comprising culturing a host cell according to E120 under conditions sufficient to allow production of an AAV vector, and purifying the AAV vector produced thereby. E122. An AAV vector produced by the method described in E121. [Brief explanation of the drawings]

[0008] [Figure 1] GCase enzyme activity produced in Huh7 cells after transduction with different doses of three AAV vectors for expressing human GCase protein. [Figure 2] Transduction of the liver and spleen by two AAV GCase vectors administered to D409V mice, quantified as the number of vector genomes normalized to the amount of cellular genomic DNA in tissue samples from treated and control mice. [Figure 3] Transduction of the liver and spleen by two AAV GCase vectors administered to D409V mice, quantified as the number of vector genomes normalized to the number of haploid cell genomes in tissue samples from treated and control mice. [Figure 4] Transduction of liver and spleen by two AAV GCase vectors administered to D409V mice, quantified as the amount of expressed human GCase mRNA, normalized to the expression of cellular housekeeping genes in tissue samples from treated and control mice. [Figure 5A] Amount of human GCase enzyme present in liver samples from D409V mice administered two AAV GCase vectors, as determined using an LC-MS / MS assay. [Figure 5B] Amount of human GCase enzyme present in spleen samples from D409V mice administered two AAV GCase vectors, as determined using an LC-MS / MS assay. [Figure 5C] Amount of human GCase enzyme present in serum samples from D409V mice administered two AAV GCase vectors, as determined using an LC-MS / MS assay. [Figure 6]Amount of human GCase enzyme present in liver samples from D409V mice administered two AAV GCase vectors compared to control mice, visualized by immunohistochemistry. Numbers indicate different test animals. [Figure 7A] The amount of human GCase enzyme activity present in liver samples from D409V mice administered two AAV GCase vectors, as determined using a fluorescent substrate assay. The dotted line indicates GCase enzyme activity in vehicle-treated D409V mice. [Figure 7B] The amount of human GCase enzyme activity present in spleen samples from D409V mice administered two AAV GCase vectors, as determined using a fluorescent substrate assay. The dotted line indicates GCase enzyme activity in vehicle-treated D409V mice. [Figure 7C] The amount of human GCase enzyme activity present in serum samples from D409V mice administered two AAV GCase vectors, as determined using a fluorogenic substrate assay. [Figure 8A] The amount of glucosylsphingosine present in liver samples from D409V mice administered two AAV GCase vectors, as determined using an LC-MS / MS assay. The dotted line indicates elevated glucosylsphingosine levels in untreated D409V mice. [Figure 8B] The amount of glucosylsphingosine present in spleen samples from D409V mice administered two AAV GCase vectors, as determined using an LC-MS / MS assay. The dotted line indicates elevated glucosylsphingosine levels in untreated D409V mice. [Figure 8C] The amount of glucosylsphingosine present in serum samples from D409V mice administered two AAV GCase vectors, as determined using an LC-MS / MS assay. The dotted line indicates elevated glucosylsphingosine levels in untreated D409V mice. [Figure 9]Transduction of liver, spleen, and dorsal root ganglia by two AAV GCase vectors administered to healthy cynomolgus monkeys, quantified as the number of vector genomes normalized to the amount of cellular genomic DNA in tissue samples from treated and control monkeys. [Figure 10] Transduction of liver, spleen, and dorsal root ganglia by two AAV GCase vectors administered to healthy cynomolgus monkeys, quantified as the number of vector genomes normalized to the number of haploid cell genomes in tissue samples from treated and control monkeys. [Figure 11] Transduction of liver, spleen, and dorsal root ganglia by two AAVGCase vectors administered to healthy cynomolgus monkeys, quantified as the amount of expressed human GCase mRNA, normalized to the expression of cellular housekeeping genes in tissue samples from treated and control monkeys. [Figure 12A] The amount of human GCase enzyme present in liver samples from healthy cynomolgus monkeys administered four increasing doses of AAV GCase vector, as determined using an LC-MS / MS assay. The dotted line indicates the mean GCase protein levels in 10–15 healthy human samples. The gray area represents the standard deviation of healthy human GCase concentrations. [Figure 12B] The amount of human GCase enzyme present in spleen samples from healthy cynomolgus monkeys administered four increasing doses of AAV GCase vector, as determined using an LC-MS / MS assay. The dotted line indicates the mean GCase protein levels in 10–15 healthy human samples. The gray area represents the standard deviation of healthy human GCase concentrations. [Figure 13A] The amount of human GCase enzyme present in liver samples from healthy cynomolgus monkeys administered two increasing doses (3E12vg / kg and 1E13vg / kg) of AAV GCase vector compared to control monkeys, as visualized by immunohistochemistry. Numbers indicate the different test animals. [Figure 13B]The amount of human GCase enzyme present in liver samples from healthy cynomolgus monkeys administered two increasing doses (3E13vg / kg and 5E13vg / kg) of AAV GCase vector compared to control monkeys, as visualized by immunohistochemistry. Numbers indicate the different test animals. DETAILED DESCRIPTION OF THE INVENTION

[0009] The following discussion relates to various embodiments of the present invention. The term "invention" is not intended to refer to a particular embodiment or otherwise limit the scope of the present disclosure. While one or more of these embodiments may be preferred, the disclosed embodiments should not be construed or otherwise used as limiting the scope of the present disclosure, including the claims. Furthermore, those skilled in the art will appreciate that the following description has broad scope, and the description of any embodiment is intended to be merely an example of that embodiment and is not intended to imply that the scope of the present disclosure, including the claims, is limited to that embodiment.

[0010] Specific Definitions As used herein, "adeno-associated viral vector" refers to an adeno-associated virus (AAV) that contains a naturally occurring or non-naturally occurring AAV capsid that encapsulates a vector genome. Adeno-associated viral vectors are sometimes abbreviated as "AAV vectors" and may be referred to synonymously as "recombinant AAV vectors," "rAAV vectors," "rAAV," or simply "vectors," depending on the context.

[0011] As used herein, "vector genome" means an AAV genome that contains a heterologous nucleotide sequence and that has been modified to render the AAV vector containing the vector genome replication-incompetent, such as by inactivating or deleting the endogenous AAV rep and / or cap genes.

[0012] As used herein, "heterologous nucleotide sequence" means a nucleotide sequence that is introduced into an organism (including a virus) from a different organism (including a living organism). The sequence of the heterologous nucleotide sequence may be the same as that found in nature, may be a modified version thereof, or may even be partially or wholly synthetic.

[0013] As used herein, "expression cassette" means a nucleotide sequence comprising a transgene operably linked to regulatory regions or elements for controlling the initiation and termination of transcription of the transgene from DNA to RNA.

[0014] As used herein, "transgene" means a nucleotide sequence that encodes at least one polypeptide and / or a nucleotide sequence that encodes at least one functional RNA molecule. A transgene may be synonymously referred to as a "gene of interest."

[0015] As used herein, "host cell" refers to a cell in which an AAV vector is produced. Producer cells and packaging cells are examples of host cells. Host cells can be cells derived from mammals or insects or other unicellular or multicellular organisms.

[0016] As used herein, the term "purify" and the related terms "purified" and "purification," when used in reference to an AAV vector or a sample or preparation thereof, refers to a relative increase or improvement in purity compared to a previous intermediate purification step in some scheme of a series of purification steps intended to purify a vector-containing starting material and / or biological product, and does not require a particular qualitative or quantitative purity, unless otherwise specified.

[0017] As used herein, "transduction" refers to the introduction of the genome of an AAV vector into a target cell. Transduction is distinguished from infection, which is used to refer to the introduction of a replication-competent adeno-associated virus genome into a cell.

[0018] As used herein, "target cell" means a cell that an AAV vector is designed or intended to transduce or a cell that has been experimentally observed to be transduced by an AAV vector in vitro or in vivo in a subject.

[0019] As used herein, "subject" means an organism to which an AAV vector is administered for the purpose of preventing or treating a disease, disorder, or condition.

[0020] Gaucher disease Glycosphingolipids (GSLs) are bioactive glycolipids present in the outer leaflet of the plasma membrane and extracellularly, and have diverse functions, including roles in cell signaling. The biosynthesis of many GSLs involves the glucosylation of ceramide, which occurs on the cytoplasmic face of the ER and in the early Golgi apparatus, to form glucosylceramide (also known as glucocerebroside, abbreviated as GlcCer or GL1). Glycosyltransferases within the Golgi lumen then attach additional sugar molecules, resulting in more complex glycan structures. See Aerts, JMFG, et al., Curr Op Chem Biol, 53:204 (2019); Schnaar, RL and Kinoshita, T, Glycosphingolipids (Chapter 11), Essentials of Glycobiology [Internet], 3rd ed. Ed., CSH Laboratory Press, Varki, A, et al., eds. (2017). During catabolism, GSLs are taken up and degraded in lysosomes, where they are subjected to the action of glycosidases that sequentially remove the terminal sugar moieties, leaving ceramide, which is degraded by lysosomal acid ceramidase into its constituent free fatty acids and sphingosine.

[0021] Among the lysosomal glycosidases responsible for degrading GSLs into their lipid cores is beta-glucocerebrosidase (also known as glucosylceramidase, acid beta-glucosidase, or beta-D-glucosyl-N-acylsphingosine monoglycohydrolase; EC 3.2.1.45; abbreviated as GCase), a lysosomal membrane-associated glycoprotein encoded by the GBA gene. It catalyzes the hydrolysis of glucocerebroside to D-glucose and ceramide. Various so-called lysosomal storage diseases are caused by deficiencies in the activity of lysosomal glycosidases involved in GSL metabolism. Deficiency in beta-glucocerebrosidase activity results in the pathological intracellular accumulation of GlcCer, which is the underlying cause of Gaucher disease (GD). The main non-CNS source of GlcCer is the degradation of senescent blood cells and tissue debris, and incompletely metabolized GlcCer substrate accumulates in monocyte-macrophage lineage cells of the reticuloendothelial system.

[0022] Although GCase deficiency is the underlying cause of GD, the clinical manifestations of this disease are highly variable, ranging from neonatal lethality to mild symptoms. The level of GCase activity measured in leukocytes does not correlate with disease severity, and even genotype is not a reliable predictor of phenotype. The extent to which other variables, such as interactions with other gene products, epigenetic mechanisms, and environmental factors, determine the course of disease in a particular individual remains incompletely understood.

[0023] Clinically, GD presents in five forms. The most common form in Caucasians is non-neuropathic type 1 (approximately 90% of GD cases), while types 2 and 3 are associated with major neurological complications. Two rarer forms have also been described.

[0024] Gaucher disease type 1 (abbreviated "GD1") can be diagnosed at any age, but particularly in young adults. It is associated with bone disease (osteopenia, focal lytic or sclerotic lesions, osteonecrosis (which may be irreversible even with treatment), and fractures), hepatomegaly, splenomegaly, cytopenias (anemia, leukopenia, and / or thrombocytopenia), pulmonary disease (interstitial lung disease, alveolar / lobar sclerosis, and / or pulmonary arterial hypertension), and the absence of major central nervous system disease. Splenomegaly is very common (at least 90% of patients), hepatomegaly is common (60-80% of patients), as is bone disease (at least 70% of patients), and cytopenias are nearly universal in untreated GD. In addition to the more common clinical manifestations, GD1 may present with coagulation, immunological, and metabolic abnormalities, as well as certain malignancies (e.g., multiple myeloma). Painful bone crises may also occur.

[0025] Gaucher disease types 2 and 3 typically present at a younger age than type 1 and are associated with many of the same visceral symptoms, but differ in the inclusion of major CNS involvement. The significant reduction in lysosomal sphingolipid degradation associated with certain GBA mutations leads to the accumulation of toxic by-products resulting from membrane ganglioside turnover within neurons. In GD type 2 (acute neuropathic; <5% of GD cases), disease onset occurs by age 2 years and rapidly progresses to death by age 2–4 years. Neurologic symptoms include bulbar signs, pyramidal signs, and cognitive impairment. Bone disease is absent. In GD type 3 (subacute / chronic neuropathic; approximately 5% of GD cases), onset frequently occurs in childhood, but disease progression is much slower, and patients can survive into their 30s or 40s. Neurologic symptoms include oculomotor apraxia, seizures, and progressive myoclonic epilepsy.

[0026] The perinatal lethal form (<1% of GD cases) is characterized by severely impaired skin barrier function due to a complete lack of GCase activity, resulting in ichthyosis-like or collodion skin abnormalities, nonimmune hydrops fetalis, and pyramidal signs, whereas the cardiovascular form is characterized by aortic and mitral valve calcifications, mild splenomegaly, corneal opacities, and supranuclear ophthalmoplegia. The cardiovascular GD phenotype is the only one described to be highly correlated with a specific genotype, namely homozygosity for the p.Asp448His variant.

[0027] Interestingly, pathogenic variants in GCase are associated with an increased risk of developing Parkinson's disease (PD) and dementia with Lewy bodies in individuals with GD and those who are solely heterozygous, suggesting a role for abnormal glucosylceramide metabolism in the pathogenesis of PD.

[0028] A defining feature of GD is the accumulation of GlcCer in macrophages (often called Gaucher cells or storage cells) present in the spleen, liver, bone marrow, lymph nodes, and lungs, and these cells are thought to contribute to many of the symptoms of GD. Gaucher cells are phenotypically similar to so-called selectively activated macrophages and have been reported to produce and secrete a variety of proteins and by-products that can regulate inflammation, coagulation, complement activation, and the function of tissues and organs throughout the body in ways that are thought to contribute to the pathogenesis and manifestation of symptoms. Boven LA, et al., Am J Clin Pathol, 122(3):359-69(2004).

[0029] Among the products produced by Gaucher cells are secreted proteins that enter the circulation and can serve as plasma biomarkers for the presence of these cells, and therefore GD. These include the enzyme chitotriosidase, the chemokine CCL18 / PARC, and another protein called glycoprotein nonmetastatic melanoma protein B (gpNMB). Gaucher cells have also been demonstrated to adapt to GCase deficiency by increasing the production of numerous products derived from excess GlcCer as a substrate or cofactor, which are detectable in plasma. These include increased production of ganglioside GM3, glycosyl-β-cholesterol (GlcChol), and glucosylsphingosine (GlcSph), which arise as a result of deacylation of GlcCer to sphingoid bases by lysosomal acid ceramidase. The latter product, in particular, may be involved in the pathogenesis of GD and can be monitored to track response to ERT or SRT. Murugesan V, et al., Am J Hematol,91:1082-9(2016).

[0030] Gaucher disease is caused by various mutations in the human GBA gene (also known as GBA1, GCB, and GLUC), which encodes the GCase protein. The GBA gene is located on chromosome 1q22, and mutations in the GBA gene cause Gaucher disease, primarily inherited as an autosomal recessive disorder. The GBA gene contains 12 exons, which give rise to five known transcript variants encoding three protein isoforms. Transcript variant 1 (2291 nt long; RefSeq NM_000157.4), variant 2 (2344 nt long; RefSeq NM_001005741.3), and variant 3 (2325 nt long; NM_001005742.3) encode the GCase isoform 1 precursor, a 536-amino acid protein (RefSeqNP_000148.2) containing a 39-amino acid signal peptide sequence and a 497-amino acid mature polypeptide sequence containing five potential N-linked glycosylation sites, respectively. Transcript variant 4 (RefSeq2 161 nt long; NM_001171811.2) encodes GCase isoform 2, a 449 amino acid long protein, and variant 5 (RefSeq2 144 nt long; NM_001171812.2) encodes GCase isoform 3, a 487 amino acid long protein.

[0031] At least 200 deleterious GBA gene variants associated with GD1 have been identified, including missense and nonsense mutations, splice junction variants, deletions and insertions of one or more nucleotides, and recombinations with a pseudogene (GBAP) located downstream of GBA. Pathogenic variants are associated with mRNA instability, premature termination of translation and loss of protein, as well as mutations affecting the protein's enzymatic activity.

[0032] The prevalence of GD1 varies among populations. For example, GD1 is more common in individuals of Ashkenazi Jewish ancestry (approximately 1:1000-2:100,000) but is much less common in other Caucasian populations (approximately 1:100,000-2:100,000). A definitive diagnosis of GD1 is made phenotypically by detecting decreased GCase enzyme activity (0-15% of normal) in blood leukocytes or mononuclear cells and molecularly by detecting biallelic pathogenic variants in the GBA gene, such as by sequencing of GBA. If no pathogenic variant is found, gene-targeted deletion / duplication analysis can then be used to test for the involvement of nearby pseudogenes. For GD1, although many variants are pathogenic, the four most common, accounting for approximately 90% of pathogenic variants in Ashkenazi Jews and 50-60% of pathogenic variants in non-Jewish populations, are c.84dupG (also known as 84GG), c.115+1G>A (also known as IVS2+1), p.Asn409Ser (also known as p.N370S or c.1226A>G), and p.Leu483Pro (also known as p.L444P or c.1448T>C).

[0033] Three recombinant GCase preparations have been approved for the treatment of GD1 by enzyme replacement therapy: Velaglucerase alfa (trade name VPRIV®) has the same amino acid sequence as mature isoform 1 GCase; Imiglucerase (trade name Cerezyme®) has the same amino acid sequence as mature isoform 1 GCase except for the Arg495His substitution; and Taliglucerase alfa (trade name Elelyso®) has the same amino acid sequence as mature isoform 1 GCase except for two additional amino acids at the N-terminus (Glu-Phe) and seven additional amino acids at the C-terminus (Asp-Leu-Leu-Val-Asp-Thr-Met).

[0034] Adeno-associated virus (AAV) The present disclosure provides vectors made from recombinant modified adeno-associated viruses (AAVs). AAV vectors can deliver genes, which may be under the control of transcriptional and other regulatory elements, to target cells by transduction. AAV vectors are useful for gene therapy of various diseases and disorders by providing functional copies of genes to target cells in which the endogenous version is defective or mutated.

[0035] AAV is a small, non-enveloped, and apparently non-pathogenic parvovirus that relies on other specific viruses to provide gene products known as helper factors essential for its replication. This biological property makes AAV highly suitable as a recombinant vector. For example, adenovirus (AdV) can function as a helper virus by providing specific adenoviral factors, such as E1A, E1B55K, E2A, and E4ORF6 proteins, as well as VA RNA, to cells co-infected with adenovirus and AAV. Other helper viruses, such as herpes simplex virus, have also been identified. Because AAV replication relies on accessory factors provided by other viruses, AAV has been characterized as a type of dependovirus. The AAV virion has two major structural features, called the capsid and the genome. The capsid is an icosahedral protein shell that encloses and protects (envelops) the viral genome, which contains genes and other sequences necessary for viral replication within infected cells.

[0036] The AAV genome is a single DNA strand containing two genes, rep and cap. In AAV2, a naturally occurring AAV that infects humans and is particularly well characterized biologically, the genome is approximately 4.7 kilobases long. Alternative splicing of transcripts from two promoters allows the rep gene to produce four related multifunctional proteins called Rep (referred to as Rep78, Rep68, Rep52, and Rep40 in AAV2, named according to their apparent molecular weights), which are involved in viral gene expression, genome replication, and packaging. Alternative splicing of transcripts from a single promoter controlling a single cap gene produces three related structural proteins, VP1, VP2, and VP3, a total of 60 of which self-assemble to form the viral icosahedral capsid in an approximately 1:1:10 ratio. VP1 is the longest of the three VP proteins and contains amino acids in its amino-terminal region that are not present in VP2, which is longer than VP3 and contains amino acids in its amino-terminal region that are not present in VP3. In addition to containing the genome, the capsid protein mediates specific binding interactions with receptors on the surface of target cells, which can limit the ability of AAV to infect specific animal species or even tissues within the same animal species, a phenomenon called tropism. For example, some types of AAV can preferentially infect liver cells (e.g., hepatocytes) compared to muscle or nerve cells.

[0037] In addition to the rep and cap genes, the intact AAV genome has relatively short (145 nucleotides in AAV2) sequence elements called inverted terminal repeats (ITRs) located at its 5' and 3' ends, respectively. The ITRs contain nested palindromic sequences that can self-anneal by Watson-Crick base pairing to form T-shaped or hairpin-shaped secondary structures. In AAV2, the ITRs have been demonstrated to have important functions required for the viral life cycle, including converting the single-stranded DNA genome to the double-stranded form required for gene expression and packaging the single-stranded AAV genome into a capsid construct by the Rep protein.

[0038] Many naturally occurring AAVs have been discovered in different species. Previously, only six types of primate AAVs (AAV1, AAV2, AAV3, AAV4, AAV5, and AAV6) were isolated from biological samples, but the first five were structurally distinct enough to be classified as distinct serotypes based on antibody cross-reactivity experiments. Subsequently, two novel AAVs, designated AAV7 and AAV8, were discovered by PCR amplification of rhesus macaque DNA using primers targeting highly conserved regions within the cap genes of previously identified AAVs. (Gao, G, et al., Novel adeno-associated viruses from rhesus monkeys as vectors for human gene therapy, PNAS (USA) 99(18):11854-11859 (2002). Subsequently, using a similar approach, numerous novel AAVs were cloned from human and nonhuman primate tissues, significantly expanding the scope of known AAV capsid protein sequences. Gao, G, et al., Clades of Adeno-Associated Viruses Are Widely Disseminated in Human Tissues, J Virol. 78(12):6381-6388 (2004). Although many AAV capsid protein sequences are highly similar to each other and to previously identified AAVs and are often referred to as different AAV "serotypes," not all such capsids would be expected to be immunologically distinguishable when tested by antibody cross-reactivity. While AAV or AAV capsids are serologically indistinguishable from defined serotypes, they contain capsid proteins with different amino acid sequences and are more appropriately referred to as variants of known serotypes. Numerous capsids made from natural and non-natural capsid proteins have been found to be useful for generating AAV gene therapy vectors.

[0039] As established in studies of AAV2, after binding to cognate receptors on the cell surface, AAV viral particles enter cells by endocytosis. Upon reaching the low pH of the lysosome, the capsid proteins undergo a conformational change that allows the capsid to escape into the cytoplasm and then be transported to the nucleus. The capsid then disassembles, releasing the genome. Cellular DNA polymerase then synthesizes a second DNA strand, starting from the 3'-end ITR, which acts as a primer after self-annealing. Expression of the rep and cap genes can then be initiated, after which new viral particles are formed and released from the cell.

[0040] AAV vectors The relatively simple structure and life cycle of AAV and the fact that it is not known to be pathogenic in humans inspired researchers to engineer AAV and investigate whether it could be converted from a virus into a recombinant vector for gene therapy. Briefly, this was accomplished by cloning the entire AAV2 genome, including both ITRs, into a plasmid, transferring the rep and cap genes to another plasmid, and replacing them with a heterologous gene expression cassette containing a promoter controlling a protein-encoding transgene. Therefore, the only viral genomic sequences retained in the vector genome are the ITRs, due to their essential functions in packaging and gene expression; without them, AAV vectors would not be produced and would not function to express transgenes after transduction of target cells. Finally, to avoid the need for coinfection with a helper virus required for AAV virion replication, genes for so-called helper factors (e.g., E1A, E1B55K, E2A, E4ORF6, and VA RNA helper factor in the case of AdV) were cloned into a third plasmid.

[0041] When the three plasmids (sometimes referred to as the transgene, rep / cap, and helper plasmids) were transfected together into mammalian host cells, the Rep and capsid proteins and helper virus factors were expressed from each plasmid. These gene products function within the host cell to replicate the vector genome from the plasmid on which they reside into single-stranded DNA, assemble capsids, and package the single-stranded genome into capsids to form the vector. The vector can then be purified from the host cell. The rep and cap genes were not packaged into the vector because they were present in trans on a different plasmid outside of their usual context adjacent to the ITRs. As a result, the AAV vectors produced in this manner can bind to expression cassettes within the genome and be delivered to target cells, but are unable to replicate and generate new vector particles.

[0042] If the vector functions as intended, after transduction, the expression cassette is transcriptionally activated and produces the gene product encoded by the transgene in the target cell. AAV vectors are highly versatile because vector genomes can be designed containing various transgenes under the control of regulatory elements with different functional sequences and various structures, and can be combined with a variety of naturally occurring and engineered capsids with different tropisms and other properties. Thus, a wide variety of gene products can be produced while maintaining some control over the type of cell transduced and the amount of gene product produced.

[0043] An AAV vector comprises a vector genome enclosed in an AAV capsid. In some embodiments, the AAV vector genome comprises at least one AAV inverted terminal repeat (ITR) and a heterologous nucleotide sequence that has a desired function when present or expressed in a transduced target cell. In some embodiments, the heterologous nucleotide sequence is derived from a different type of virus or an entirely different type of organism, such as an animal, plant, protist, fungus, bacterium, archaea, or other type of organism. In some embodiments, the heterologous nucleotide sequence replaces part or all of the native AAV rep and / or cap genes such that the vector is unable to express functional Rep or VP proteins in the transduced target cell. In some embodiments, the entire sequence of the vector genome consists of the heterologous nucleotide sequence, except for the AAV inverted terminal repeat sequences located at the termini of the genome.

[0044] Expression cassette In some embodiments, the heterologous nucleotide sequence comprises or consists of an expression cassette containing a transgene operably linked to a promoter and optionally one or more enhancers, which serve to control the initiation of transcription of the transgene from DNA to RNA, and a transcription termination element, such as a polyadenylation signal sequence, which serves to terminate transcription of the transgene into RNA. An AAV vector contains one or more transgenes, either as part of a single transcription unit or each as part of its own transcription unit. As described in later sections, the expression cassette may further comprise additional sequence elements designed to affect transcription, transcript stability, translation, or other functions.

[0045] AAV vectors are typically engineered so that the structure of the expression cassette and the entire genome are limited by the packaging capacity of the capsid, such that the length of the transgene, combined with all other elements in the genome necessary for vector function, such as transcriptional control elements and ITRs, does not exceed approximately 5 kilobases for AAV2, although other types of capsids may have larger or smaller packaging limits. However, within size constraints, there is great flexibility in the selection of the transgene, ITRs, and other elements necessary for the vector to function for its intended purpose.

[0046] For purposes of gene therapy, a transgene can be any gene whose product can be understood to prevent or treat, although not necessarily cure, any disease, disorder, or condition in a subject in need of such treatment. In some embodiments, gene therapy aims to prevent or treat a disease, disorder, or condition characterized by an abnormally low or complete absence of a product produced by a naturally occurring gene in the subject, such as may occur due to a loss-of-function mutation. In connection with such embodiments, the transgene may be intended to compensate for a defective gene in the subject by providing the same or a similar gene product to at least a portion of the subject's cells when expressed. A non-limiting example would be a vector designed to express a functional version of clotting factor IX for use in gene therapy for hemophilia B, which is caused by a loss-of-function mutation in the native factor IX gene. However, in other embodiments, the transgene may be intended to counteract the effects of a deleterious gain-of-function mutation in a target cell. In some embodiments, the transgene can encode a transcriptional activator that enhances the activity of an endogenous gene producing a desired gene product, or a transcriptional repressor that reduces the activity of an endogenous gene producing a deleterious gene product.

[0047] In some embodiments, a transgene can encode a polypeptide or can encode an RNA molecule with a function different from that which encodes a protein, such as a regulatory non-coding RNA molecule (e.g., microRNA, small interfering RNA, piwi-acting RNA, enhancer RNA, long non-coding RNA, etc.). Protein-coding sequences within a transgene can be codon-optimized, and translation initiation sites (e.g., Kozak sequences) can be modified to increase or decrease the propensity to initiate translation. In some embodiments, a transgene encoding an amino acid sequence contains one or more open reading frames and / or one or more splice donor and acceptor site pairs to allow alternative splicing of different messages and polypeptide sequences from such messages. A protein-encoding transgene further contains one or more stop codons to terminate translation of the polypeptide chain.

[0048] In some embodiments, vector genomes can be designed for the purpose of editing or modifying the genome of a target cell. For example, vector genomes can include an expression cassette or transgene flanked by homology arms intended to promote homologous recombination between the vector genome and the target cell genome. As another example, vector genomes can be designed to perform CRISPR gene editing by expressing a guide RNA (gRNA) and / or an endonuclease (e.g., Cas9) or related endonuclease (e.g., SaCas9) that can bind to the gRNA and cleave the DNA sequence targeted by the gRNA.

[0049] GCase transgene In some embodiments, the AAV vectors of the present disclosure comprise a vector genome including an expression cassette containing a coding sequence for a GCase protein. The coding sequence for any GCase protein with enzymatic activity capable of cleaving the beta-glucosidic bond of glycosylceramide (also known as glucosylceramide, glucosylcerebroside, or GlcCer) can be used, including, but not limited to, human lysosomal GCase protein isoforms 1, 2, and 3 (RefSeqNP_000148.2, RefSeqNP_001165282.1, and RefSeqNP_001165283.1, respectively) and GCase proteins from non-human species. In other embodiments, the GCase protein can include any naturally occurring variant of a human GCase protein that does not contain premature translation termination codons or pathogenic mutations, such as amino acid substitutions, insertions, or deletions, that significantly reduce GCase enzymatic activity and / or protein stability. In still other embodiments, GCase proteins may include engineered variants of human GCase proteins that retain GCase enzymatic activity, such as variants of GCase isoform 1 used in recombinant replacement therapies imiglucerase and taliglucerase alfa, as well as chimeric variants and other modified variants, including variants with amino acid substitutions, insertions or deletions designed to increase GCase-specific activity, add or remove glycosylation sites or other post-translational modifications, or alter other aspects of GCase structure or function. In some embodiments, the native secretory signal peptide sequence is modified or completely replaced by a secretory signal peptide sequence from a similar or completely different secreted protein.

[0050] For use in the AAV vectors of the present disclosure, the nucleotide sequence encoding the GCase protein can be any nucleotide sequence capable of encoding the desired GCase protein in the type of cell desired to be transduced by the vector. In some embodiments, the nucleotide sequence encoding the GCase protein (transgene) is the same as that found in a naturally occurring gene encoding a GCase (such as a human GCase), such as any of the naturally occurring human nucleotide sequences encoding human GCase isoform number 1, such as RefSeq NM_000157.4 (or including nucleotides 138-1748), RefSeq NM_001005741.3 (or including nucleotides 191-1801), and RefSeq NM_001005742.3 (or including nucleotides 172-1782); or encoding human GCase isoform number 2, such as RefSeq NM_001171811.2 (or including nucleotides 269-1618); or encoding human GCase isoform number 3, such as RefSeq NM_001171812.2 (or including nucleotides 138-1601).

[0051] In other embodiments, the nucleotide sequence encoding the GCase protein differs at one or more nucleotide positions compared to a naturally occurring nucleotide sequence and, due to redundancy in the genetic code, still encodes a GCase protein identical to the naturally occurring gene sequence. In some embodiments, the nucleotide sequence encoding the GCase protein can be intentionally modified to affect its function in transduced cells, such as by eliminating sequence motifs that can stimulate an innate immune response, eliminating cryptic splice junctions, eliminating alternative start codons, increasing the stability of the corresponding mRNA, and / or increasing the rate of translation of mRNA to protein. In other embodiments, the nucleotide sequence encoding the GCase protein can be intron-free or can contain one or more introns that interrupt the coding sequence, but which are removed by the splicing machinery in the transduced cell to allow translation of the desired GCase protein.

[0052] In some embodiments, an AAV vector of the disclosure comprises a transgene encoding a GCase protein comprising a mature GCase polypeptide, a non-limiting example of which is the amino acid sequence of SEQ ID NO: 40. In some other embodiments, an AAV vector of the disclosure comprises a transgene encoding a GCase precursor protein comprising or consisting of a secretory signal peptide and a mature GCase polypeptide, non-limiting examples of which include the amino acid sequence of SEQ ID NO: 38 or SEQ ID NO: 39, and a non-limiting example of which includes the amino acid sequence of SEQ ID NO: 40. In some embodiments, an AAV vector of the disclosure comprises a transgene encoding a mature GCase polypeptide, a non-limiting example of which is the nucleotide sequence of SEQ ID NO: 13. In some other embodiments, an AAV vector of the disclosure comprises a transgene encoding a GCase precursor protein, non-limiting examples of which include the nucleotide sequence of SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, or SEQ ID NO: 41.

[0053] In some other embodiments, the AAV vectors of the present disclosure comprise a transgene encoding a mature GCase polypeptide or a GCase precursor protein, where the protein sequence encoded by the transgene is highly similar or identical to the protein sequence of a reference sequence, but the nucleotide sequences of the transgene and the reference sequence share a certain percent identity, with differences corresponding to positions within codons that do not alter the corresponding amino acids. For example, in some embodiments, the transgene encodes the same GCase protein as SEQ ID NO:28, and is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 127%, 128%, 129%, 130%, 131%, 132%, 133%, 134%, 135%, 136%, 137%, 138%, 139%, 140%, 141%, 142%, 143%, 144%, 145%, 146%, 147%, 148%, 149%, 150%, 151%, 152%, 153%, 154%, the transgene encodes the same GCase protein as SEQ ID NO:29 and has a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, or the transgene encodes a GCase protein identical to SEQ ID NO:30; or the transgene encodes a GCase protein identical to SEQ ID NO:30; or the transgene encodes a GCase protein identical to SEQ ID NO:30; or and at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.the transgene encodes a GCase protein that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8 or 99.9% identical to SEQ ID NO:31; the transgene encodes a GCase protein that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8 or 99.9% identical to SEQ ID NO:32; the transgene encodes a GCase protein that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8 or 99.9% identical to SEQ ID NO:33; the transgene encodes a GCase protein that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8 or 99.9% identical to SEQ ID NO:34;the transgene encodes a GCase protein that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7, 99.8% or 99.9% identical to SEQ ID NO:35; the transgene encodes a GCase protein that is the same as SEQ ID NO:36 and has a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identical to SEQ ID NO:36; the transgene encodes a GCase protein that is the same as SEQ ID NO:37 and has a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identical to SEQ ID NO:37; or the transgene encodes the same GCase protein as SEQ ID NO:41 and has a nucleotide sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identical to SEQ ID NO:41.

[0054] The percentage of nucleotide sequence identity between a reference sequence and a transgene can be determined by any method known in the art. For example, in some embodiments, the nucleotide sequences of a reference sequence and a transgene (or the amino acid sequences encoded thereby) can be aligned and compared over their entire lengths, and the percentage of nucleotide sequence identity can be calculated using a computer algorithm. An exemplary algorithm for globally aligning and comparing nucleotide sequences is the Needleman-Wunsch algorithm. However, in other embodiments, a local alignment algorithm such as the BLAST algorithm can be used. Needleman, SB, and Wunsch, CD, J Mol Biol, 48(3):443-53 (1970); States DJ, et al., Methods: A companion to Methods in Enzymology 3:66-70 (1991); Pearson, WR, Curr Protoc Bioinformatics, 43:3.5.1-3.5.9 (2013). In some embodiments, if either the reference or transgene sequence contains non-coding sequences, such as introns or stop codons, the non-coding sequences are ignored and only the protein-coding sequences in the reference and transgene sequences are aligned and compared. Once an optimal global alignment between the reference sequence and the transgene is established, the percentage of identical nucleotides between the aligned sequences can be calculated.

[0055] As known in the art, sequence comparison algorithms allow users to define substitution scores and gap penalties, parameters used to calculate alignment scores for multiple possible alignments. The alignment with the highest score is considered optimal. Substitution scores involve assigning a numerical reward for a match and a penalty for a mismatch. An exemplary set of respective match and mismatch scores includes 1, -1; 1, -2; 1, -3; 1, -4; 2, -3; 4, -5, although others are possible. Gap costs involve assigning a numerical penalty for the presence of a gap (insertion or deletion of a nucleotide) and a penalty for extending the width of a gap once formed. Increasing gap costs results in alignments that introduce fewer gaps. An exemplary set of respective costs for the presence and extension of a gap includes 0, -4; -2, -2; -2, -4; -3, -3; -4, -2; -4, -4; -5, -2; -6, -2, although others are possible. In some embodiments, alignment and comparison of the reference and transgene sequences is performed using the default substitution score and gap penalty and other default settings provided in the computer software or algorithm for performing the analysis.

[0056] Secretory signal peptide sequence According to certain embodiments, AAV vectors of the present disclosure can be designed and constructed to transduce cells in which GCase protein deficiency directly contributes to the pathogenesis of GD1, e.g., cells of the monocyte and macrophage lineage that form Gaucher cells as a result of the accumulation of incompletely metabolized glucosylceramide substrate. In such embodiments, the GCase produced after vector transduction desirably remains within the cell where its presence can compensate for the loss of function of the native GCase gene.

[0057] However, in other embodiments, AAV vectors of the present disclosure can be designed and constructed to transduce cells within an organ, such as hepatocytes in the liver, from which the GCase produced after vector transduction can be secreted and transported throughout the body, such as into the blood, where it can be taken up and utilized by other cells, such as monocytes and macrophages. In such embodiments, it is often useful to design the vector so that the GCase protein contains a secretory signal peptide sequence to ensure that the GCase protein can be secreted from the transduced cells into the circulatory system. Otherwise, monocytes and macrophages or other cells may not be provided with sufficient GCase to correct the loss of function of the native GCase gene.

[0058] Any secretory signal peptide sequence known in the art to be effective in secreting a protein from the cell in which it is synthesized can be used in conjunction with the AAV vectors of the present disclosure. Desirably, although not necessarily, such a signal peptide is removed from the protein by the cell during the secretion process. In some embodiments, the naturally occurring secretory signal peptide in human GCase protein precursor isoform 1 can be used, the amino acid sequence of which is provided in SEQ ID NO: 39. However, in other embodiments, the native GCase signal peptide can be replaced with the signal peptide of a different secreted protein from human or another species, for example, to improve the rate at which GCase produced in transduced cells is secreted or for some other reason, such as reduced immunogenicity.

[0059] Numerous heterologous secretory signal peptides are known in the art and can be used to promote secretion of GCase from cells, such as liver cells, transduced with the AAV vectors of the invention. In some embodiments, the signal peptide sequence is derived from any of a variety of proteins made and secreted by hepatocytes or cells in the liver. Non-limiting examples include signal peptide sequences from human proteins such as alpha 1-antitrypsin, alpha 1-antichymotrypsin, alpha 1-acid glycoprotein 1, serum albumin, phosphatidylethanolamine-binding protein 1, haptoglobin, plasminogen activator inhibitor 1, beta 2-microglobulin, peptidyl-prolyl cis-trans isomerase B, retinol-binding protein 4, fetuin A, complement C3, apolipoprotein AI, endoplasmic reticulum chaperone BiP, complement factor B, protein AMBP, apolipoprotein E, clusterin, cathepsin D, serotransferrin, alpha 1-acid glycoprotein 2, and complement C4-B, among many others. The amino acid sequences and encoding nucleotide sequences of these and other secreted proteins are available in public sequence databases such as Genbank. In other embodiments, secretory signal peptide sequences for use in the vectors of the present disclosure can be derived from proteins (human or otherwise) that are highly secreted by non-liver cells, such as human or mouse IgG heavy chains or kappa or lambda light chains. For example, in one non-limiting embodiment, the signal peptide from mouse IgG heavy chain can be used, the amino acid sequence of which is provided as SEQ ID NO: 38. The amino acid sequences of naturally occurring secretory signal peptides can be modified to alter their function as desired, and nucleotide sequences encoding such wild-type or modified signal peptides can also be modified to achieve desired types of sequence optimization, such as removal of CpG motifs. In yet other embodiments, fully synthetic secretory signal peptide sequences can be used.

[0060] Transcriptional control region AAV vectors of the invention intended to express a GCase protein in and / or from transduced cells may further comprise, as part of the vector genome, one or more transcriptional regulatory regions operably linked to a transgene encoding a GCase polypeptide sequence. As further described below, different types of transcriptional regulatory regions are known in the art that can be used to control the initiation of transcription of a transgene into RNA. As used herein, the term "operably linked" and variations such as "operably linked," "operably linked," and "operably linked" refer to a functional relationship between a transcriptional regulatory region and a transgene in which the regulatory region can influence (positively or negatively) transcription of the transgene, without specifying a particular spatial or structural relationship between them. Thus, for example, a transcriptional regulatory region may be operably linked to a transgene even if it is located 5' or 3' of the transgene and / or immediately adjacent to or distal to the transgene. Transcriptional regulatory regions may be constitutively active, active in particular cells or tissues, inducibly active in response to some environmental stimulus, derived from a naturally occurring gene (of any appropriate species), modified to improve or alter function, or entirely synthetic.

[0061] In some embodiments, the transcriptional control region comprises a promoter region, which includes the minimal DNA sequence required to initiate transcription by the transcription machinery in the transduced cell (e.g., a TATA box or initiation sequence), and often also includes one or more additional proximal elements that act alone or in concert to increase the rate of transcription from the basal promoter. Depending on the sequence, a promoter can initiate transcription by RNA polymerase I, II, or III, although promoters from protein-coding genes that are typically transcribed by RNA pol II are often used in AAV vectors intended to express polypeptides such as GCase in transduced cells.

[0062] In other embodiments, the transcriptional control region includes or further includes at least one enhancer region, which functions to further increase the rate of gene transcription beyond that which can be sustained by the basal promoter alone. In natural contexts, enhancers are often located far from the promoter of the gene they affect, sometimes tens to hundreds or thousands of base pairs upstream (i.e., 5'), although enhancers can also be found elsewhere, such as in introns or downstream (i.e., 3') of the gene they affect. Although promoter regions may contain proximal enhancer elements (subsequences whose deletion reduces transcription from the basal promoter), enhancers typically do not contain sequences that can function as basal promoters. In nature, enhancer regions are often located distal to the promoter of the gene they affect, but enhancer elements within enhancer regions or larger enhancer regions (such elements often correspond to DNA binding sites for transcription factors) may be able to retain at least some of their transcription-enhancing function when removed from their natural context and relocated in close proximity to a promoter from the same or a different gene.

[0063] The enhancer and promoter regions of genes described in the scientific literature, when combined with transgenes and other genomic elements required for vector function, can be too large to fit into the packaging capacity of an AAV capsid. Thus, in some embodiments, functional subsequences within longer enhancer or promoter regions can be identified using methods well known to those skilled in the art, and shorter functional subsequences can be incorporated into transcriptional control regions for use in the vectors of the present disclosure. In this way, the size of the transcriptional control region can be reduced while maintaining its desired function. Using this approach, functional elements from naturally occurring enhancers or promoters can be combined in novel ways, such as by modifying their number, spacing, and / or positioning, to create hybrid or synthetic enhancers and promoters with improved properties. In some embodiments, the enhancer and promoter can each be derived from the same naturally occurring gene, while in other embodiments, the enhancer and promoter can be derived from entirely different genes, including genes from different species.

[0064] In some embodiments, in terms of the coding strand (i.e., positive-sense) single-stranded DNA AAV vector genome, the promoter sequence is located 5' of a downstream sequence to be transcribed into RNA, such as a transgene encoding a protein such as GCase. In some embodiments, an enhancer element or region, if present, may be located 5' of the promoter sequence, or alternatively may be located in the 5' or 3' untranslated region (UTR) adjacent to the transgene, introns, 3' of a transcription termination signal sequence, or elsewhere in the genome. In some embodiments, the vector genome may contain multiple enhancer regions (of the same or different types), which may be located adjacent to each other or spaced apart and / or separated by other functional elements in the genome. In some embodiments, the same enhancer element or region is provided in a tandem array of two, three, four, or more repeat units.

[0065] In some embodiments, transcriptional regulatory regions for use in the AAV vectors of the present disclosure are non-tissue-specific, meaning that they are constitutively active in many, but not necessarily all, different cell types. According to some embodiments, non-tissue-specific transcriptional regulatory regions include promoters derived from specific viruses, such as the human cytomegalovirus major immediate-early gene (CMV-IE) (Boshart, M, et al., Cell, 41:521-30 (1985); Yew, N.L., et al., Hum Gene Ther, 8:575-84 (1997)); Simian Virus 40 (SV40); and retroviral long terminal repeat (LTR) promoters from Rous Sarcoma Virus (RSV) and Moloney Murine Leukemia Virus (MoMLV), which may include enhancer elements adjacent to the basal promoter. In other embodiments, non-tissue-specific transcriptional control regions include promoters (which may include proximal enhancer elements) derivable from genes active in many different cell types, including different animal species, such as the human polypeptide chain elongation factor (EF1α) gene; the phosphoglycerate kinase (PGK) gene; the ubiquitin C (UbiC) gene; the chicken beta-actin (CBA) gene; the U1a1 or U1b2 small nuclear RNA promoters (Bartlett, J.S., et al., Proc. Natl. Acad. Sci. USA 93:8852-7 (1996); Wu, Z., et al., Mol. Ther. 16(2):280-9 (2008)); or the histone H2 or histone H3 promoters (Hurt, M.M., et al., Mol. Cell. Biol. 11:2929-36 (1991); Wu, Z., et al., Mol. Ther. 16(2):280-9 (2008)).

[0066] Similarly, enhancer regions can be derived from viruses and genes that are active in different cell types from different types of animals. As noted above, in some embodiments, promoters and enhancers from the same gene can be combined to create transcriptional control regions for use in the vectors of the present disclosure, although enhancers and promoters from different genes can also be combined to create hybrid transcriptional control regions. A commonly used example is a 1.6 kb hybrid enh / pro region called CAG (or CAGGS) that contains the CMV immediate early enhancer, chicken beta actin (CBA) gene promoter, and CBA intron / exon 1 (Niwa, H, et al., Gene, 108:193-9 (1991); Ikawa, M, et al., Dev Growth Differ, 37:455-9 (1995)), and subsequent modifications to reduce its size, including replacing the CBA intron with a smaller simian virus 40 (SV40) intron (Wang, Z, et al., Gene Ther, 10:2105-11 (2003)). This is called the CBA hybrid intron (CBh) (Gray, SJ, et al., Hum Gene Ther, 22:1143-53 (2011)), which is replaced with a hybrid intron consisting of the 5' donor splice site of the 5' UTR and the 3' acceptor splice site of the MVM intron.

[0067] In some embodiments, a transcriptional control region for use in an AAV vector of the present disclosure may be liver tissue-specific, meaning that it is more active or most active in inducing transgene expression in liver cells, such as hepatocytes, compared to cells of other tissues or organs. Without wishing to be bound by theory, one mechanism by which liver tissue specificity may arise is the presence of one or more specific binding sites within the enhancer and / or promoter for a DNA-binding transcriptional activation protein that is preferentially expressed in liver cells. The use of a liver tissue-specific transcriptional control region may, in some embodiments, be advantageous by reducing or preventing transgene expression in non-liver cells that may be transduced by the vector, thereby reducing the risk of off-target effects.

[0068] Liver-specific transcriptional control regions can be derived from genes that are naturally expressed at high levels in the liver, examples of which include the genes for albumin, transthyretin (prealbumin), alpha-1-antitrypsin, prothrombin, and many others. Certain liver-specific genes that are highly expressed have both enhancers and promoters, which can be included in the transcriptional control region. In some embodiments, enhancers and promoters from the same gene can be combined within a liver-specific transcriptional control region, while in other embodiments, an enhancer from one gene and a promoter from a different gene can be combined within a hybrid liver-specific transcriptional control region. If from the same gene, the transcriptional control region sequence, including one or more enhancers and promoters, can be copied as they are present in the native gene from which it is derived, or can be engineered to shorten its length, such as by deleting non-transcriptionally active sequences that separate one or more enhancers and promoters. In some embodiments, enhancers and promoters for use in liver-specific transcriptional control regions can be derived from genes of different species. In yet other embodiments, the sequence of the enhancer and / or promoter within the transcriptional control region can be modified relative to the original sequence by changing, adding, or removing nucleotides to improve its function, such as increasing the binding of transcriptional activators, decreasing the binding of transcriptional repressors, or reducing the size of the transcriptional control region. In some embodiments, it is the enhancer that provides liver-specific expression, and the promoter itself is not liver-specific, while in other embodiments, it is the promoter that provides liver-specific expression, and the enhancer, if present, is not liver-specific itself but may increase the rate of transcription from the liver-specific promoter. For example, a strong viral enhancer, such as the human CMV major-immediate-early gene enhancer, can be combined with a liver-specific promoter, or a strong liver-specific enhancer, such as that from the albumin gene, can be combined with a strong viral promoter, such as the SV40 early promoter. In other embodiments, both the enhancer and promoter are liver-specific.In some embodiments, different enhancer regions can be combined to form chimeric enhancer regions used in the transcriptional control regions of the AAV vectors of the present disclosure.

[0069] Non-limiting examples of enhancers and promoters that may be used and included in the liver-specific transcriptional control region of the AAV vectors of the present disclosure include enhancers (at least three have been characterized) and promoters from the albumin gene (Minghetti, PP, et al., J Biol Chem, 261(15):6747-57(1986); Frain, M, et al., Mol Cell Biol, 10(3):991-9(1990); Hayashi, Y, et al., J Biol Chem, 267(21):14580-5(1992)); enhancers and promoters from the mouse or human alpha-1-antitrypsin (A1AT) gene (Costa, RH, et al., Mol Cell Biol, 9(4):1415-25(1989); De Simone, V, et al., EMBO J, 6(9):2759-66 (1987); Monaci, P, et al., EMBO J, 7(7):2075-87 (1988); Hafenrichter, DG, et al., Blood, 84:3394-3404 (1994); Le, M, et al., Blood, 89:1254-59 (1997)); enhancer and promoter from the transthyretin (TTR) gene (Tsuszuki, T, et al., J Biol Chem, 260(22):12224-7 (1985); Costa, RH, et al., Mol Cell Biol, 6(12):4697-708 (1986)); enhancer and promoter from the alpha-fetoprotein (AFP) gene; enhancer and promoter from the prothrombin gene (Bancroft, JD, et al., Biochem, 31:12469-76(1992)); and the HCR1 and HCR2 enhancer regions from the human apolipoprotein E / CI gene cluster (Allan, C.M., et al., J. Biol. Chem, 272(46):29113-9(1997); Dang, Q., et al., J. Biol. Chem, 270(38):22577-85(1995); Simone, W.S., et al., J. Biol. Chem, 268(11):8221-9(1993)).Any of the above-mentioned enhancers can be combined with any of the above-mentioned promoters from the same or different genes to construct a liver-specific transcriptional control region for use in the AAV vectors of the present disclosure.

[0070] A variety of liver tissue-specific transcriptional control regions representing hybrid combinations of enhancers and promoters from different genes (and from the same or different species, such as mouse, rat, or human) or transcriptional control regions from liver-specific genes engineered to reduce size or improve performance have been described, any of which can be used in the AAV vectors of the present disclosure to express GCase protein in transduced liver cells. Non-limiting examples include the HCR1 enhancer region of the human ApoE gene combined with the promoter of the human alpha-1-antitrypsin (hAAT) gene (various versions have been created to reduce the size of the combined element) (Miao, CH, et al., Mol Ther, 1:522-532 (2000); Dang Q, et al., J Biol Chem 270:22577-22585 (1995); Davidoff AM, et al., Mol Ther 11:875-888 (2005); Hafenrichter DG, et al., Blood 84:3394-3404 (1994); McIntosh J, et al., Blood 121:3335-3344 (2013); Nathwani AC, et al., Blood 107:2653-2661 (2006)); a minimal enhancer and promoter of the TTR gene (Yan, C, et al., EMBO J, 9:869-78 (1990); Samadani, U and Costa, RH, Mol Cell Biol, 16:6273-84 (1996)); the human factor IX gene promoter (GTV) combined with a multimerizing liver transcription factor binding site (site 5 element) (Hoag, H, et al., Gene Ther, 6:1584-89 (1999)); the human factor VIII gene promoter (PF8+5HNF-1) combined with a multimerizing HNF-1 binding site of the same gene (Notley, C, et al., Hum Gene Ther, 13:1583-93 (2002)); the basic mouse albumin promoter combined with a short intron derived from an SV40 intron (Sarkar, R, et al., J Thromb Haemost, 1:220-6(2003)); two copies of the α1-microglobulin / bikunin enhancer combined with the thyroxine hormone-binding globulin gene promoter (Rouet P, et al., J Biol Chem 267:20765-20773(1992); Hayashi Y, et al., Mol Endocrinol 7:1049-1060(1993); Ill, CR, et al., Blood Coagul Fibrinolysis, 8(Suppl 2):S23-S30(1997); Wang, L, et al., Proc Natl Acad Sci USA, 96:3906-10(1999)); Wang L, et al., Blood 105:3079-3086 (2005)); the albumin promoter combined with the α-fetoprotein MERII enhancer (Wooddell, CI, et al., J Gene Med, 10:551-63 (2008)); and randomly assembled hepatocyte-specific transcription factor binding sites linked to the mouse transthyretin promoter (Vigna E, et al., Mol Ther 11:763-775 (2005)).

[0071] Further references regarding liver tissue-specific transcriptional control regions include Schiedner G, et al., Nat Genet 18:180-183 (1998); Xiao, W, et al., J Virol 72:10222-10226 (1998); Kuriyama S, et al., Cell Struct Funct 16:503-510 (1991); Chuah, MK, et al., Mol. Ther., 22:1605-1613 (2014); and Nair, N., et al., Blood, 123:3195-3199 (2014).

[0072] In some embodiments, the HCR enhancer sequence may comprise or consist of base pairs 134 to 442 of GenBank U32510.1, and the hAAT promoter may comprise or consist of base pairs 1747 to 2001 of GenBank K02212.1.

[0073] In some embodiments, the transcriptional control region of an AAV vector of the present disclosure may comprise or consist of a human albumin (hALB) gene promoter (in some embodiments, comprising or consisting of the nucleotide sequence of SEQ ID NO: 10). In some embodiments, the transcriptional control region may comprise, consist of, or further comprise a human albumin gene proximal enhancer (in some embodiments, comprising or consisting of the nucleotide sequence of SEQ ID NO: 9). In some embodiments, the transcriptional control region may comprise, consist of, or further comprise an alpha 1-microglobulin / bikunin precursor (AMBP) enhancer (in some embodiments, comprising or consisting of the nucleotide sequence of SEQ ID NO: 8). In some embodiments, the transcriptional control region may further comprise multiple copies of the AMBP enhancer sequence, such as two, three, four, or more such sequences, which may be arranged in tandem. In some embodiments, the transcriptional control region may comprise or consist of, in 5' to 3' order, two repeats of the AMBP enhancer sequence, a hALB proximal enhancer sequence, and a hALB promoter sequence. In some embodiments, the arrangement of such elements may comprise or consist of the nucleotide sequence of SEQ ID NO:42.

[0074] transcription termination signal sequence In some embodiments, the AAV vectors of the present disclosure comprise a vector genome that includes a transcription termination sequence located 3' of the transgene, relative to the coding (plus) strand single-stranded DNA vector genome. In some embodiments, another sequence, such as a 3' untranslated region (UTR) sequence, can be placed between the transgene sequence and the transcription termination sequence. General information regarding transcription termination can be found, for example, in Proudfoot, NJ, Genes Devel, 25:1770-82 (2011); Kuehner, JN, et al., Nat Rev Mol Cell Biol, 12:283-94 (2011); Porrua, O and Libri, D, Nat Rev Mol Cell Biol, 16:190-202 (2015).

[0075] In some embodiments, particularly when the transgene contains a protein-coding sequence (as opposed to a sequence of RNA that has some function other than encoding a protein), the transcription termination sequence may be a polyadenylation signal sequence (variously abbreviated as "polyA," "pA," "poly(A)," or "p(A)"). In some embodiments, a pA signal sequence can be derived from a naturally occurring gene and used in the vector, while in other embodiments, the pA signal can be modified by shortening it compared to the native one, altering its sequence to increase its efficiency at terminating transcription, etc. In other embodiments, the pA signal can be synthetic or a hybrid sequence combining pA sequences from different genes.

[0076] Non-limiting examples of pA signals that can be used in the vectors of the present disclosure include pA signals from the bovine growth hormone gene (bGHpA); human, mouse, or rabbit beta globin genes; SV40 late genes; sNRP1; spA; herpes simplex virus thymidine kinase gene (HSV TK); or the adenovirus type 5 L3 polyadenylation site, among many others. In other embodiments, transcription terminators for use in the vectors of the present disclosure include those that terminate RNA transcription without inducing polyadenylation, such as the histone H4 gene mRNA 3'-end processing signal (Whitelaw, E., et al., Nucleic Acids Res, 14:7059-70 (1986)).

[0077] In some embodiments, the AAV vectors of the present disclosure comprise a vector genome comprising a transgene, the transcription of which is terminated by the inclusion of a poly(A) site derived from the bovine growth hormone gene (bGH), which in some embodiments comprises or consists of the nucleotide sequence of SEQ ID NO: 14; a poly(A) site derived from the SV40 virus, which in some embodiments comprises or consists of the nucleotide sequence of SEQ ID NO: 24 or SEQ ID NO: 25; or a poly(A) site derived from the rabbit beta globin gene, which in some embodiments comprises or consists of the nucleotide sequence of SEQ ID NO: 26.

[0078] Other vector genome elements In addition to transcriptional control regions and transcription termination signals, other sequences, including cis-regulatory elements, can be included in the genome of the AAV vectors of the present disclosure to improve, control, or regulate transgene expression and / or translation in transduced cells or to confer other functions to the vector. Such elements include, but are not limited to, untranslated regions from the 5' and / or 3' ends of genes, non-coding exons, introns, splice donor and acceptor sites, lox sites, internal ribosome entry sites (IRES), sequences encoding 2A peptides, elements that stabilize RNA transcripts, binding sites for regulatory miRNAs, microRNA (miRNA) sequences, elements that enhance mRNA nuclear export (including viral post-transcriptional regulatory elements such as the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE)), and other elements that have been empirically demonstrated to improve transgene expression, even if the mechanism is unknown. In other embodiments, the vector genome may contain so-called stuffer or filler sequences, which are intended only to increase the overall length of the vector genome to a desired size (e.g., to achieve a length that approaches, but is still below, the packaging capacity of a particular capsid), thereby reducing the likelihood of accidental packaging of truncated vector genome or non-vector DNA into the capsid.

[0079] In some embodiments, introns can be included in the vector genome to enhance transgene expression and / or transcriptional stability. In some embodiments, protein-encoding transgenes are provided in which the exon and intron sequences are identical to the native gene. However, in genes with multiple exons and introns, one or more introns can be removed to minimize overall length, to facilitate inclusion of other elements without exceeding the packaging capacity of the capsid. However, in other embodiments, the intron can be provided from an entirely different gene than the gene providing the coding sequence for the vector transgene. Whether the intron is from the same gene as the transgene or a different gene, the intron can be modified from its original sequence by, for example, changing specific nucleotides or removing internal sequences to reduce its overall length while maintaining splice donor and acceptor sequence motifs necessary for efficient splicing to occur or other intron cis elements important for function (e.g., enhancers that may be present in the original, unmodified intron sequence). Introns can be hybrids, in which the splice donor portion of an intron from one gene is paired with the splice acceptor portion of an intron from another gene, or synthetic, with sequences that do not correspond to introns in known genes. In some embodiments, introns are placed within the coding sequence of the transgene, thereby interrupting the coding sequence (and providing the donor and acceptor sites necessary for efficient splicing to occur), while in other embodiments, introns are present but do not interrupt the protein-coding sequence, but instead are located either 5' or 3' of the coding sequence. If the intron does not interrupt the coding sequence, exon sequences carried over from the original genetic context may be provided, as long as the exon sequence does not contain a potential translation initiation signal. In some embodiments, the intron can be located 3' of the promoter (from the perspective of the positive-strand ssDNA vector genome) and 5' of the coding sequence. In other embodiments, the intron can be placed distally, either upstream or downstream, from the coding sequence of the vector genome.

[0080] Non-limiting examples of introns that can be used in the AAV vectors of the present disclosure include the small intron from minute virus of mice (MVM) (Haut, D.D. and Pintel, D.J., J. Virol., 72(3):1834-43 (1998); Haut, D.D. and Pintel, D.J., Virology., 258:84-94 (1999)); the internally deleted intron 1 of human coagulation factor IX (FIXm1 and FIXm2) (Kurachi, S., et al., J. Biol. Chem., 270(10):5276-81 (1995)); the chimeric beta globin splice donor and immunoglobulin heavy chain splice acceptor introns (GenBank U47120.2 nucleotides 890-1022); intron 1 from the mouse alpha globin gene; and Nathwani, A.C., et al. et al., Blood, 107(7):2653-61 (2006), which may comprise or consist of base pairs 4644 to 4552 of GenBank entry J02400.1, and may be modified at positions 4582 (g to c), 4580 (g to c), 4578 (a to c), and 4561 (a to t).

[0081] In some embodiments, a post-transcriptional regulatory element (PRE) can be included in the vector genome to increase transgene expression. Examples of PREs include the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), the hepatitis B virus post-transcriptional regulatory element (HPRE), and variants thereof. Donello, JE, et al., J Virol, 72(6):5085-92 (1998); Loeb, JE, et al., Hum Gene Ther, 10:2295-2305 (1999); Zanta-Boussif, MA, et al., Gene Ther, 16:605-19 (2009); Patricio, MI, et al., Mol Ther Nucleic Acids, 6:198-208 (2017); U.S. Patent Application Publication No. 2018-0353620A1. In some embodiments, at least one WPRE sequence can be located downstream of the transgene (thus 3' of the stop codon of the transgene encoding the polypeptide) and upstream of the poly(A) signal sequence, in terms of the coding (positive) strand single-stranded DNA vector genome. In some embodiments, multiple PREs can be included, such as two, three, or more PREs of the same or different types, which can be arranged in tandem. In some embodiments,

[0082] In some embodiments, the AAV vectors of the present disclosure comprise a vector genome that includes a WPRE element, which in some embodiments comprises or consists of the nucleotide sequence of SEQ ID NO:27.

[0083] AAV inverted terminal repeat (ITR) The adeno-associated virus genome contains unique nucleotide sequences located at its termini, called inverted terminal repeats (ITRs), which serve as origins of viral DNA replication and as priming sites that support the conversion of the single-stranded (ssDNA) genome into a double-stranded (dsDNA) form capable of supporting transcription of the genes encoding the rep and cap proteins, also contained in the viral genome, within infected cells. The ITRs also function to package the replicated ssDNA genome into AAV capsids. The AAV ITRs contain multiple palindromic sequences that can fold back to form a dsDNA T-shaped hairpin secondary structure through intrastrand complementary base pairing.

[0084] As described further below, the vector genome of an AAV vector of the present disclosure can contain one or more AAV ITRs that function similarly to those in the unmodified virus. Unless otherwise specified, the use of the term "inverted terminal repeat" or "ITR" herein includes not only intact, full-length ITRs, but also ITRs with modified sequences (such as truncations, internal deletions (such as trs or D sequences), additions, and substitutions of one or more nucleotides) that retain one or more functions derived from the ITR (even if less efficiently compared to an intact ITR of the same type), including, but not limited to, rescue of the vector genome from recombinant DNA (such as a plasmid), replication of the vector genome, and / or packaging of the vector genome into assembled capsids.

[0085] As present in packaged virus and vector genomes, ITRs located at the 3' end of the ssDNA genome have a free 3' hydroxyl group, while ITRs located at the opposite 5' end of the ssDNA genome have a free 5' end. The 5' ITR is also referred to as the "left" ITR, and the 3' ITR is referred to as the "right" ITR. However, in the context of plasmids such as those used for vector production, the vector genome sequence exists in double-stranded form, with two sets of 5' and 3' ITRs. Therefore, to avoid ambiguity, the strand on which the ITRs are located should be specified and distinguished. In the absence of such a specification, reference to ITRs of a vector genome in a double-stranded state, such as in a plasmid, refers to the plus or sense strand, i.e., the DNA strand in which the sequence of the transgene is the same as the coding sequence for the polypeptide product of the transgene or functional RNA (if the transgene does not encode a protein).

[0086] In wild-type AAV2, the ITRs are 145 bases long, of which the terminal 125 bases contain palindromic subsequences. When annealed, the AAV2 ITRs contain two double-stranded palindromes, B-B' and C-C', forming the arms of a hairpin; these arms then join a larger double-stranded palindrome, A-A', to form the stem of the hairpin. Toward the non-terminal end of the ITR, the ITRs contain a D sequence, which remains single-stranded due to the lack of a complementary sequence within the ITR, but has a complementary sequence in the D region of the ITR at the opposite end of the genome (i.e., D and D'). The A-A' stem structure contains a Rep-binding element (RBE), which contains a tetranucleotide repeat motif to which the large AAVRep protein binds to introduce a sequence-specific, strand-specific nick at the terminal resolution site (trs) of the ITR sequence (between nucleotides 124 and 125 of the AAV2 ITR, counting from the 3' end), a necessary step for DNA replication of the viral genome to occur.

[0087] Upon refolding, the ITRs fold into two structures called flip and flop, with the sequence between the A and A' inverted repeats present as the reverse complement of the other structure. For the 5' ITR (left ITR), the order of the terminal palindromic sequences in the flip structure is 5'-ABB'CC'A'D-3', and the order of the flop structure is 5'-ACC'BB'A'D-3'. For the 3' ITR (right ITR), the order of the terminal palindromic sequences in the flip structure is 3'-A'B'BC'CAD'-5', and the order of the flop structure is 3'-A'C'CB'BAD'-5'. As a result, flip structures have a B'B palindrome closest to the free 3' end, and flop structures have a C'C palindrome closest to the free 3' end (Lusby, E, et al., J Virol, 34:402-9 (1980); Srivastava, A, et al., J Virol, 45(2):555-64 (1983); Samulski, RJ, et al., Cell, 33:135-143 (1983)).

[0088] The secondary structure of the ITRs is hypothesized to support viral DNA replication through a self-priming single-strand displacement elongation mechanism initiated by endogenous cellular DNA polymerases at ITRs with free 3' hydroxyl groups. Strand elongation leads to the formation of a monomeric dsDNA genome replication intermediate with a covalently closed end. The open-end double-stranded ITR refolds (isomerizes) into a double-hairpin structure, forming a new extended 3' ITR while the complementary strand is displaced. The large AAV Rep protein binds to the ITR at the closed end (downstream), nicks the DNA at the terminal resolution site, and initiates a second DNA replication complex that copies the downstream ITR before the open-end-initiated DNA replication complex reaches the downstream ITR. The original replication complex displaces the opposite strand (whose ITR has just been newly synthesized) and completes replication to the formerly closed end of the genome, where the double-stranded ITR is now open and able to isomerize into a double hairpin. Thus, the displaced ssDNA genome (with the newly created 3' ITR) can be packaged into viral particles, while the monomeric dsDNA genome replication intermediate is recreated and the replication cycle begins again.

[0089] The replicated ssDNA genome contains both positive (plus or sense) and negative (minus or antisense) strand polarities, and evidence suggests that they are packaged separately into capsids with equal efficiency. Consequently, AAV vector particle preparations, like the viruses from which they are derived, may, in some embodiments, contain approximately equal proportions of sense or antisense ssDNA genomes. However, ITRs can also be modified by selectively removing the D sequence from one of the two ITRs used to generate AAV vectors, thereby restricting packaging to either the minus or plus strand of the vector genome (Wang, X.S., et al., J. Virol. 70(3):1668-77 (1996)). Thus, in some other embodiments, AAV vector preparations may contain vector particles in which most or substantially all of the vector genome is either the plus or minus strand.

[0090] After infection, AAV virions are transported to the nucleus, where the ssDNA genome is released from the capsid. It has been hypothesized that before the viral rep and cap genes can be expressed, the ssDNA genome must first be converted to dsDNA by complementary strand synthesis by cellular DNA polymerases, which initiate strand elongation at the 3' ITR; however, this process is thought to be slow and inefficient. It has also been hypothesized that a faster mechanism for forming intracellular dsDNA genomes may exist, in which complementary positive and negative ssDNA genomes from different virions infecting the same cell encounter each other in the nucleus and hybridize by intermolecular base pairing. Such double-stranded genomes may support transcription without first requiring elongation by cellular DNA polymerases.

[0091] When designing an AAV vector, the only AAV viral DNA sequences that are retained in the vector genome are the ITRs, because they play important roles in DNA replication and packaging during production and in the conversion of the ssDNA genome to dsDNA after transduction. The sequences encoding the Rep and Cap proteins and viral helper functions, which are also necessary for vector production, can be provided in trans by various methods known in the art. If the vector genome sequence, such as that contained in a plasmid used to produce an AAV vector, contains two intact ITRs and does not exceed the packaging capacity of the AAV capsid, approximately 5 kb, it can package the ssDNA genome as described above. However, the need for dsDNA conversion may result in lower than desirable transduction efficiencies due to inefficiencies in steps prior to gene expression. A strategy to overcome the need for dsDNA conversion by endogenous cellular DNA polymerases and potentially improve transduction efficiency and expression of heterologous sequences, such as therapeutic transgenes, relies on the replication and packaging of "self-complementary" AAV vector genomes (scAAVs), which contain plus- and minus-strand sequences within the same DNA molecule and can therefore rapidly regenerate the dsDNA transcription template by intramolecular base pairing (i.e., intramolecular hybridization) after uncoating of the capsid in the target cell nucleus.

[0092] The production of self-complementary genomes is promoted in at least two ways, both of which depend on the inability of Rep to nick the ITR at the terminal resolution site during replication of the DNA molecule that will become the genome. In the natural AAV replication cycle, if Rep is unable to nick the terminal resolution site of the downstream ITR of a monomeric genome replication intermediate with a double hairpin at the open end and a single downstream ITR at the closed end, a dimeric dsDNA genome replication intermediate molecule can result. When this occurs, replication by the initial DNA replication complex (initiating from the open-ended 3' ITR) continues through the downstream (closed-ended) ITR and the displaced strand to form a dimeric dsDNA genome. This molecule resembles the monomeric dsDNA genome replication intermediate described above, but contains two genomes. Because it has open ends with double-stranded ITRs, it can isomerize and initiate the DNA replication cycle like the monomeric form. Alternatively, the closed-ended hairpin can undergo terminal resolution to form a double-stranded ITR, which can isomerize and initiate DNA synthesis from the degraded end. In either case, replication of the dimeric template generates a new dimeric dsDNA genome replication intermediate, replacing the ssDNA dimeric inverted repeat genome containing the 5' ITR, viral genomic sequences of one polarity, the central ITR, viral genomic sequences of the opposite polarity, and the 3' ITR.

[0093] Normally, ssDNA dimer inverted repeat viral genomes are not packaged because they exceed the normal capsid packaging capacity. However, by designing a shortened vector genome length so that the ssDNA dimer inverted repeat genome does not exceed the AAV packaging capacity when formed, vector particles containing self-complementary genomes can be produced. In practice, the vector preparation produced in this way may contain a mixture of particles packaged with one scDNA genome or one or two monomer ssDNA genomes, and the total proportion may vary from preparation to preparation.

[0094] After packaging, scDNA genomes likely exist within the capsid in a single-stranded form (similar to ssDNA non-self-complementary genomes), but after capsid uncoating, they rapidly anneal to form a dsDNA molecule with a covalently closed ITR at one end and two open ITRs at the other end, similar to the structure of conventional viral genomes after self-priming dsDNA conversion. Thus, without wishing to be bound by theory, the primary difference between so-called ssDNA and scDNA genomes is not their topology when encapsidated, but the potential topology each type of genome may acquire after capsid uncoating and genome release within transduced cells.

[0095] However, further modifications can provide better control over the production of vector particles containing scDNA genomes. Specifically, by mutating or deleting the terminal resolution site from one ITR, such as in a plasmid containing a vector genome sequence used for vector production, it is possible to inhibit or eliminate single-strand nick formation at that ITR during the vector genome replication cycle. As a result, replication complexes initiated at an unmutated ITR return to the initiation end through the mutated hairpin, resulting in a dimeric dsDNA genome replication intermediate, just as they would if terminal resolution of the wild-type ITR did not occur by chance. However, this intermediate contains a closed wild-type ITR at one end, a mutated double-stranded ITR in the center of the molecule, and an open double-stranded ITR capable of isomerization at the opposite end. This molecule then undergoes a normal cycle of replication and strand displacement from the wild-type ITRs at each end to produce displaced daughter genome copies containing the 5' wild-type ITR, vector genome sequence of one polarity, the central mutated ITR, vector genome sequence of the opposite polarity, and the wild-type ITR at the 3' end. When the heterologous sequence contains a transgene encoding a protein, the scDNA genome contains both the coding sequence and its complementary sequence in the same DNA molecule. Such genomes are believed to be packaged in a single-stranded form within the capsid, but due to the presence of a significant amount of self-complementary sequence outside the ITRs, they are also believed to be able to rapidly self-anneal into a double-stranded form in the nucleus of transduced cells, and in this form, support the transcription of the heterologous sequence. When scAAV is produced from a construct containing mutated ITRs, it can produce more than 90% scDNA genomes.

[0096] In AAV2 capsids, which have a packaging capacity of approximately 4.7 kb, the ssDNA genome can accommodate approximately 4.4 kb of heterologous sequence, excluding ITR sequences, while the scDNA vector genome can accommodate approximately 2.2 kb. According to certain non-limiting embodiments, the size of the genome construct for producing an scAAV vector (such as the size that can be contained in a plasmid for AAV vector production) is approximately 2,500 nucleotides in length, including a heterologous sequence of approximately 2,200 nucleotides in length and two ITRs (one wild-type and one mutant). This results in the production of an scAAV genome approximately 4,700 nucleotides in length, which is below the packaging capacity of a typical AAV capsid.

[0097] ITR terminal resolution sites can be disrupted in various ways to facilitate the production of scAAV vectors. For example, exogenous sequences can be inserted into the terminal resolution site (trs) sequence itself or into adjacent sequences of the ITR, such as between the Rep binding element and the trs. Alternatively, the trs sequence can be deleted in part or in its entirety. In other embodiments, the adjacent D region can be deleted in part or in its entirety. In yet other embodiments, nucleotides within the trs can be replaced with different nucleotides that reduce the frequency of trs nicking by Rep. Other methods of rendering ITRs non-degradable are within the ordinary skill in the art.

[0098] Further details regarding AAV viral and vector genome replication and scAAV design can be found in McCarty, DM, et al., Gene Therapy, 10:2112-18 (2003); McCarty, DM, et al., Gene Therapy, 8:1248-54 (2001); McCarty, DM, Molecular Therapy, 16(10):1648-56 (2008); U.S. Patent No. 7,790,154.

[0099] In some embodiments, the AAV vector genome of the AAV vectors of the present disclosure may contain one or more AAV ITRs derived from different AAV serotypes and variants, with different sequences and lengths, and located at different positions within the genome. The sequences of the AAV ITRs for use in the vectors of the present invention may be wild-type or modified. In other embodiments, AAV ITR sequences may also be included as part of the vector genome sequence within plasmids and other types of vectors (such as baculovirus) used to introduce the vector genome sequence into host cells for vector production purposes.

[0100] While ITRs from AAV2 are frequently used in producing AAV vectors, alternative embodiments may include using ITRs from any AAV serotype or variant, including ITRs from AAV1, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9, or other known or yet to be discovered AAV serotypes or variants, so long as such ITRs are functional for vector genome replication and packaging and transgene expression. The ITRs may also contain modifications to the sequence of the wild-type ITR sequences or may be completely synthetic. The modified ITRs may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the wild-type ITR sequence, such as that from AAV2. In some embodiments, the ITRs are modified by adding, deleting, and / or changing nucleotides to disrupt the terminal resolution sites (trs) and / or D sequences of the ITRs, or to alter other subsequences of the ITRs. In some embodiments, the vector genome may comprise ITRs from different AAV serotypes or variants.

[0101] In some embodiments, the ITRs selected for use in vector production are from the same serotype or variant as the capsid. For example, AAV2 ITRs can be used in combination with an AAV2 capsid. However, in other embodiments, the vector can be pseudotyped or hybrid, meaning that a vector genome with ITRs from one serotype or variant can be packaged in a capsid from a different serotype or variant. For example, a vector genome with AAV2 ITRs can be packaged in a capsid from AAV8 (or a capsid of another serotype or variant). This pseudotype is often abbreviated as AAV2 / 8, with the number before the slash indicating the origin of the ITRs and the number after the slash indicating the origin of the capsid.

[0102] According to some embodiments, AAV vectors of the present disclosure may contain vector genomes with different numbers of ITRs. For example, intact AAV viral genomes typically have two ITRs, one located at the 5' and one at the 3' end, and AAV vectors produced using intact ITRs and packaged with an ssDNA genome may have two ITRs similarly arranged. However, as explained above, vectors can be designed to include three ITRs in their genome, with two at the ends of the genome, as in viruses or conventional vectors, and an additional one at or near the center (intact or mutated), as in self-complementary vectors. However, it has also been observed that in some vectors, the 5' ITR may be truncated or missing entirely, hypothetically due to premature or variable packaging termination, especially when the genome length exceeds the average packaging capacity of the capsid. Although defective interfering particles may occur, it has been hypothesized that such particles may support transgene expression as a result of complementing an otherwise incomplete genome (Kapranov, P, et al., Hum Gene Ther, 23:46-55 (2012)). Thus, in some embodiments, the AAV vector particles of the present disclosure contain a genome including a single functional ITR, such as at the 3' or 5' end, with a non-functional truncated ITR or no ITR sequence at the opposite end. Thus, in some embodiments of the AAV vector genome of the AAV vector of the present disclosure, the AAV ITR may be located at the 5' end of the genome or the 3' end of the genome, or at both the 5' and 3' ends of the genome, as well as other locations.

[0103] Another source of heterogeneity in AAV vectors may arise from differences in flip and flop ITR structures in a particular genome. Thus, for example, in some embodiments, a particular vector particle within a sample may contain a genome with ITRs at both ends of the genome in a flip configuration, or a genome with ITRs at both ends of the genome in a flop configuration, or a genome with a flip ITR at the 5' end and a flop ITR at the 3' end, or a genome with a flop ITR at the 5' end and a flip ITR at the 3' end. Combined with the observation that single-stranded DNA genomes can occur as either plus or minus strands, a sample of AAV vectors may contain eight possible configurations, in similar or potentially different proportions. Unless otherwise specified, the genomes of the AAV vectors of the present disclosure are not limited to any of these configurations, and any or all may be packaged by such vectors.

[0104] In some embodiments, the AAV vector genome includes intact, full-length ITRs at each of the 5' and 3' ends. Thus, for example, if both ITRs are from AAV2, such full-length ITRs may be 145 nucleotides in length. However, in other embodiments, one or more ITRs may be truncated, lacking one or more terminal nucleotides relative to the reference full-length sequence of that type of ITR. Thus, for example, an ITR may lack at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleotides from its end compared to the standard full-length sequence of that type of ITR. Such truncated ITRs may occur not only in genomes packaged by AAV vectors of the present disclosure, but also in vector genome sequences used to produce AAV vectors, such as plasmids. For example, it has been observed that when sequences deleted from one ITR are retained in the other, the truncated ITR still functions to produce AAV due to its self-repairing ability (Wang, XS, et al., J Mol Biol, 250:573-80 (1995); Samulski, RJ, et al., Cell, 33:135-43 (1983)).

[0105] In some embodiments, the AAV vector genome of an AAV vector of the disclosure may comprise one or more AAV ITRs that comprise, consist essentially of, or consist of the nucleotide sequence of any one or more of SEQ ID NO:7, SEQ ID NO:15, SEQ ID NO:18, or SEQ ID NO:19, or the complement or reverse complement of any such sequence.

[0106] Array Optimization In some embodiments, one or more sequences within an AAV vector genome can be optimized to improve functional properties relative to the starting reference sequence. For example, without limitation, any protein-coding sequence within the vector genome can be codon-optimized relative to the wild-type sequence based on the degeneracy of the genetic code and the codon usage biases known to exist between different species and between proteins expressed at high or low levels within the same species. Such codon biases can be identified, for example, using the codon adaptation index of a particular species. The codon adaptation index (CAI) is described in further detail in Sharp, PM and Li, WH, Nucleic Acids Res, 15:1281-95 (1987). In some embodiments, the coding sequence is human codon-optimized, meaning that the coding sequence is optimized based on human codon bias. Codon optimization can be readily performed using various algorithms known in the art. As known in the art, different CAIs can be constructed based on which highly expressed genes, such as human genes, are analyzed. An exemplary human CAI is reported in Haas, J, et al., Current Biology, 6(3):315-24 (1996). If desired, protein coding sequences can be codon-optimized for species other than human.

[0107] Different codon optimization strategies have been proposed and implemented with the aim of increasing protein expression levels. For example, the most frequently used synonymous codons (i.e., those that encode the same amino acid) can be substituted at each position where they do not occur. Alternatively, codon usage can be adjusted throughout the coding sequence to be proportional to the natural codon bias distribution of the host organism. In some embodiments, codon substitutions are limited to those that occur relatively rarely in highly expressed proteins within a species, e.g., at frequencies of less than 10%, as reflected by the CAI.

[0108] In some embodiments, the protein-coding sequence expressed by the AAV vector of the present disclosure is codon-optimized by replacing at least one rare codon with a more common synonymous codon. In some embodiments, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%, and in some embodiments, 100%, of the rare codons in the protein-coding sequence are replaced with a more frequently used synonymous codon, as reflected in a CAI, such as the human CAI. In some embodiments, the rare codon is a codon that occurs at a frequency of 10%, 9%, 8%, 7%, 6%, or 5% or less, as reflected in a CAI, such as the human CAI.

[0109] In some embodiments, a protein coding sequence expressed by an AAV vector of the disclosure is codon-optimized by replacing one or more codons with a more frequently used synonymous codon as reflected in a CAI, such as the human CAI, such that the CAI value calculated for the overall coding sequence is increased relative to the starting non-codon-optimized sequence, which in some embodiments is the wild-type coding sequence for the protein. Thus, in some embodiments, the CAI value of the starting reference sequence is calculated with reference to a particular CAI lookup table, and the overall CAI value of the current codon-optimized coding sequence is at least or about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.50, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.60, 0 0.40, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.50, 0.55, 0.60, or 0.70.

[0110] As is known in the art, the presence of hypomethylated CpG dinucleotides in nucleic acids can stimulate an immune response that eliminates transduced cells. Therefore, depleting CpG dinucleotides within a vector genome increases the likelihood that vector transduction will result in long-term gene expression. Wright, JF, Mol Ther, 28(3):701-3 (2020). Considering the potentially deleterious effects of CpG dinucleotides, in some embodiments, any sequence within the genome, including enhancers, promoters, introns, open reading frames encoding proteins or functional RNAs, transcription terminators, 5' and / or 3' untranslated region (UTR) sequences, ITRs, or other sequences, can be modified to remove one or more CpG dinucleotides, as long as doing so does not unacceptably interfere with or disrupt some of the desired functions of the modified elements. Because the function of certain elements within a vector genome, such as ITRs, promoters, and enhancers, may be highly dependent on the identity of specific nucleotides at specific positions, opportunities for significantly depleting such elements of CpG dinucleotides may be more limited. Because AAV vector genomes of both polarities (e.g., sense and antisense with respect to the coding sequence of a transgene within the genome) are packaged into capsids in approximately equal proportions, in some embodiments, CpG-depletion strategies may be directed at reducing or eliminating CpG motifs from the nucleotide sequences of vector genomes of both polarities, as well as vector genomes containing protein-coding sequences in the sense orientation.

[0111] In some embodiments, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% of the CpG dinucleotides within the coding sequence or the entire vector genome sequence (on the sense and / or antisense strand) are deleted or substituted relative to a reference starting sequence, while in other embodiments, at least 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more CpG dinucleotides, or a range between any of the foregoing values, are deleted or substituted relative to the starting reference sequence. In other embodiments, 1 to 5, 5 to 10, 10 to 15, 15 to 20, 20 to 25, 25 to 30, 30 to 35, 35 to 40, 40 to 45, 45 to 50, 50 to 55, 55 to 60, 60 to 65, 65 to 70, 70 to 75, 75 to 80, 80 to 85, 85 to 90, 90 to 95 or 95 to 100 CpG dinucleotides are deleted or substituted relative to the reference starting sequence.

[0112] In other embodiments, sequence optimization can increase or decrease the overall GC content relative to a starting reference sequence. Thus, in some embodiments, the overall percentage of G or C nucleotides in a transgene or the entire genome can be increased by at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, or 40 percent or more compared to a starting reference sequence, such as a wild-type protein-coding sequence. In other embodiments, the overall percentage of G or C nucleotides in the transgene or the entire genome can be reduced by at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, or 40 percent or more as compared to a starting reference sequence, such as a wild-type protein-coding sequence.

[0113] As will be appreciated by those skilled in the art, when optimizing a coding sequence, the goal of replacing specific amino acids in a species (such as human) with more common codons may be incompatible with other optimization strategies, because the introduction of more frequently used codons may introduce CpG motifs, or the removal of CpGs may necessitate the use of rarely occurring codons, or codon optimization may increase or decrease GC content in an undesirable way. In such cases, it may be necessary to design and test different optimized coding sequences (encoding the same polypeptide) to achieve an acceptable balance between the different optimization strategies and identify a version that achieves improved protein expression.

[0114] Transgene and vector genome sequences can be optimized by altering functions in addition to codon bias and CpG content. For example, any of the following features that may occur in a sequence and adversely affect transgene expression can be identified (conceptually, such as by using an algorithm, or empirically) and altered or eliminated to mitigate their effects: cryptic splice sites; premature transcription termination signal sequences (e.g., polyA sequences); translation start sites other than the intended initiating methionine (e.g., IRES); GC-rich sequence regions; mRNA 5'-terminal sequences capable of forming hairpins; and AU-rich elements (AREs) in the mRNA 3'-untranslated region that can be bound by destabilizing RNA-binding proteins. Other sequence features that can appear in transgene and vector genomes and, when altered, enhance transgene expression will be familiar to those skilled in the art.

[0115] In other embodiments, the transgene or vector sequence can be modified to enhance functionality. For example, the first intended start codon within a protein-coding sequence may only weakly support translation initiation from that site, in which case the surrounding sequence can be altered to match the so-called Kozak consensus sequence for eukaryotic translation initiation. Kozak, M., Gene, 234(2):187-208 (1999).

[0116] In some embodiments, other types of sequence optimization of a transgene coding sequence, such as CpG depletion (partial or complete) or codon optimization, can improve protein expression from the transgene compared to the same vector containing a non-optimized reference starting sequence, such as the wild-type coding sequence from which the optimized sequence is derived. Thus, for example, an optimized coding sequence of a transgene may be expressed at least 25%, 50%, 75%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500% or more efficiently compared to a non-optimized reference starting sequence, such as the wild-type version of the coding sequence.

[0117] AAV capsid The AAV vectors of the present disclosure can utilize capsids made from any AAV capsid protein, whether naturally occurring or modified, including those currently known or yet to be discovered or developed, that is suitable for transducing cells in a subject to express a GCase protein from a vector transgene.

[0118] The choice of capsid protein (and corresponding cap gene sequence used in its production) used to generate an AAV vector is guided by many considerations and factors. As noted above, by specifically interacting with particular cell surface receptors, different AAV capsids can have different cell or tissue tropisms, which can be advantageous when it is desirable to transduce certain tissues preferentially over others. For example, to preferentially express a transgene product in muscle, a vector can be produced using a capsid that targets muscle over liver. Conversely, to express a transgene product in the liver, a vector can be produced using a capsid that targets liver over muscle or other tissues.

[0119] Other factors may also be important. For example, studies have demonstrated that some humans, as a result of exposure to naturally occurring AAV, develop high neutralizing antibody titers against certain capsids, which can hinder the ability of AAV vectors with the same or similar capsids to transduce target cells. Therefore, in designing vectors for gene therapy, the selection of capsids may be guided in part by the immunogenicity of the capsid and / or the seroprevalence of the patient being treated. Other considerations that may influence the selection of capsids include manufacturability and stability during storage, and other considerations are known in the art.

[0120] The AAV vectors of the present disclosure can use capsids made from naturally occurring AAV capsid proteins as well as modified or engineered capsid proteins. For example, naturally occurring capsid proteins can be modified by inserting or deleting amino acids or peptides or introducing amino acid substitutions into the VP1, VP2, and / or VP3 protein sequences to improve capsid function in some respect, such as tissue tropism, immunogenicity, stability, or manufacturability. Other examples include novel capsids with improved properties created by exchanging amino acids or domains from one known capsid to another (mosaic or chimeric capsids) or using DNA shuffling and directed evolution methods.

[0121] In some embodiments, AAV vectors of the disclosure can include capsids from known AAV serotypes and variants, as well as non-naturally occurring capsids, including, but not limited to, AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrhlO, AAVrhl74, AAV-DJ, AAV-PHP.B, Anc80, AAV2.5, and AAV2i8, many others are possible. In some embodiments, the capsid of an AAV vector of the disclosure includes VP1, VP2, and / or VP3 AAV capsid proteins that are variants or derivatives of the known VP1, VP2, or VP3 AAV capsid proteins. In some embodiments, the amino acid sequence of such a variant or derivative AAV capsid protein is the AAV capsid VP1, VP2, or VP3 protein of AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrhlO, AAVrhl74, AAV-DJ, AAV-PHP.B, Anc80, AAV2.5, and AAV2i8, or other suitable AAV capsids, including, for example, the liver-tropic capsids described below. 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identical to the amino acid sequence of a known AAV capsid VP1, VP2 or VP3 protein sequence, including, but not limited to:In some other embodiments, the amino acid sequence of such variant or derivative AAV capsid proteins is selected from known AAV capsids, including, but not limited to, the AAV capsid VP1, VP2, or VP3 proteins of AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrhlO, AAVrhl74, AAV-DJ, AAV-PHP.B, Anc80, AAV2.5, and AAV2i8, or other suitable AAV capsids, including, for example, the liver-tropic capsids described below. The amino acid sequence of the VP1, VP2, or VP3 protein differs by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more amino acids (whether by amino acid deletion, insertion, or substitution).

[0122] Liver-tropic AAV capsid In some embodiments, the AAV vectors of the present disclosure comprise a liver-tropic capsid. A liver-tropic capsid is an AAV capsid that has tropism for liver cells, such as hepatocytes. According to some embodiments, the capsids for use in the AAV vectors of the present disclosure are liver-tropic for human liver cells, such as human hepatocytes. As will be understood by those skilled in the art, liver tropism does not mean that the capsid is capable of transducing only liver cells. Rather, a liver-tropic capsid has a certain degree of propensity to transduce liver cells compared to other types of cells or tissues, even if this propensity is not absolute and the liver-tropic capsid has a higher propensity to transduce other types of cells or tissues other than liver cells. In some non-limiting embodiments, the liver-tropic AAV capsid binds to heparan sulfate proteoglycans (HSPGs), which are involved as cellular receptors mediating AAV infection of human liver cells.

[0123] Examples of liver-tropic capsids include AAV2; AAV3B; AAV5; AAV6; AAV7; AAV8; AAV9; AAV13; AAV-DJ (Grimm, D, et al., J Virol, 82:5887-5911 (2008)); AAV-LK03 (Lisowski, L, et al., Nature 506:382-6(2014)); AAV-KP1; AAV-hu.Lvr01 (Genbank accession number QPP19816); AAV-hu.Lvr02 (Genbank accession number QPP19818); AAV-hu.Lvr03 (Genbank accession number QPP19819); AAV-hu.Lvr04 (Genbank accession number QPP19821); AAV-hu.Lvr05 (Genbank accession number QPP19824); AAV-hu.Lvr06 (Genbank accession number QPP19825); AAV-hu.Lvr07 (Genbank accession number QPP19828); AAV-rh.10; AAV-rh.74; AAV-Anc80 (Zinn, E, et al., Cell Rep, 12:1056-68 (2015)); AAV-NP40, AAV-NP59, and AAV-NP84 (Paulk, N.K., et al., Molecular Therapy, 26(1):289-303 (2018)); AAV-hu.37; AAV-rh.8; AAV-rh.64R1; capsids containing VP1 proteins comprising or consisting of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10 of WO 2015 / 013313 (referred to as RHM4-1, RHM15-1, RHM15-2, RHM15-3 / RHM15-5, RHM15-4, and RHM15-6, respectively), AAVHSC7, AAVHSC15, and AAVHSC17 (Smith, L.J., et al., Mol. Ther, 22(9): 1625-34 (2014); Ellsworth, JL, et al., PLOS One, 14(11): e0225582 (2019)).

[0124] AAV vector for GCase protein expression According to certain embodiments, the AAV vector of the present disclosure comprises an AAV vector genome including a transgene encoding a beta-glucocerebrosidase (GCase) protein, such as human GCase protein isoform 1. In some embodiments, the transgene includes a coding sequence for a secretory signal peptide sequence and a coding sequence for a mature form of the GCase protein. In some embodiments, the secretory signal peptide sequence is the same as that present in a naturally occurring GCase protein, although a signal peptide from a heterologous protein can also be used, such as a signal peptide from an IgG heavy chain polypeptide, such as a mouse IgG heavy chain polypeptide. In some embodiments, the human GCase mature polypeptide comprises the amino acid sequence of SEQ ID NO: 40, the amino acid sequence of the wild-type human GCase secretory signal peptide comprises SEQ ID NO: 39, and the amino acid sequence of the secretory signal peptide from a mouse IgG heavy chain polypeptide comprises SEQ ID NO: 38. In some embodiments, the amino acid sequence of a chimeric GCase precursor protein comprising a mouse IgG heavy chain polypeptide and a human GCase mature polypeptide comprises SEQ ID NO: 16.

[0125] In some embodiments, the GCase protein-encoding nucleotide sequence of the transgene is the same nucleotide sequence as that of the wild-type human GCase coding sequence, non-limiting examples of which include SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, or SEQ ID NO: 32. However, in other embodiments, the coding sequence can be optimized, such as by deletion of some or all CpG dinucleotides, and still encode the same GCase protein, non-limiting examples of which include SEQ ID NO: 13, which encodes the mature polypeptide, or SEQ ID NO: 41, which encodes a chimeric GCase protein comprising a mouse IgG heavy chain secretory signal peptide sequence and a human mature polypeptide. In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110 or more CpG dinucleotides are removed from the GCase protein transgene coding sequence, or any range therebetween, including any of the specifically recited values ​​above. In some embodiments, the nucleotide sequence encoding the GCase protein lacks CpG dinucleotides. In some embodiments, the nucleotide sequence encoding the GCase protein comprises 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 or 0 CpG dinucleotides or any range therebetween, including any of the specifically recited values ​​above, wherein the nucleotide sequence from which the CpG dinucleotides are removed relative to a reference sequence such as a wild-type sequence is either the sense strand containing the coding sequence or the antisense strand, i.e., the reverse complement of the sense strand.

[0126] In some embodiments, the nucleotide sequence of the transgene encoding the mature human GCase polypeptide is identical to that provided in SEQ ID NO:13, while in related embodiments the transgene may be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identical to the nucleotide sequence of SEQ ID NO:13 and encodes an amino acid sequence identical to that encoded by SEQ ID NO:13. In other embodiments, the nucleotide sequence of the transgene encoding the chimeric GCase precursor protein is identical to that provided in SEQ ID NO:41, while in related embodiments the transgene may be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identical to the nucleotide sequence of SEQ ID NO:41 and encodes an amino acid sequence identical to that encoded by SEQ ID NO:41. In other embodiments, the nucleotide sequence of the transgene encoding the mature human GCase polypeptide is identical to that provided in SEQ ID NO:28, SEQ ID NO:29 or SEQ ID NO:30, while in related embodiments the transgene may be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identical to the nucleotide sequence of SEQ ID NO:28, SEQ ID NO:29 or SEQ ID NO:30 and encodes an amino acid sequence identical to that encoded by SEQ ID NO:28, SEQ ID NO:29 or SEQ ID NO:30.

[0127] In some embodiments, the vector genome of an AAV vector of the present disclosure further comprises at least one AAV inverted terminal repeat (ITR) located at the 5' and / or 3' end of the genome. In some embodiments, the vector genome may further comprise at least a second AAV ITR located at the opposite end of the genome from the first AAV ITR. In some embodiments, the vector genome comprises an AAV ITR located at its 5' end. In some embodiments, the vector genome comprises an AAV ITR located at its 3' end. In some embodiments, the vector genome comprises a first AAV ITR located at its 5' end and a second AAV ITR located at its 3' end. In some embodiments, the vector genome comprises a first AAV ITR located at its 5' end, a second AAV ITR located at its 3' end, and a third AAV ITR located between the first and second AAV ITRs.

[0128] AAV ITRs for use in the vectors of the present disclosure can be of any type, such as AAV2 ITRs or non-AAV2 ITRs, and can be full-length or truncated. They can have the same sequence as known naturally occurring AAV viral ITRs (wild-type sequences) or can be modified. Non-limiting exemplary types of modifications include reducing the number of CpG dinucleotides present in the ITR sequence, reducing or eliminating the ability of the ITR sequence to undergo terminal degradation by AAV Rep proteins, such as by mutating, deleting, or inactivating terminal resolution sites (trs), and reducing or eliminating the ability of the ITR sequence to support packaging into capsids, such as by mutating, deleting, or inactivating D sequences in the ITR sequence. In some embodiments, the vector genome can further include at least a third AAV ITR located between both ends of the genome, such as near the middle of the vector genome sequence. In some of these embodiments, the third ITR can be modified, such as by inactivating its terminal resolution site, so that the vector genome containing the transgene is self-complementary. In some embodiments, the vector genome comprises AAV ITRs that comprise, consist essentially of, or consist of the nucleotide sequence of SEQ ID NO:7, SEQ ID NO:15, SEQ ID NO:18, or SEQ ID NO:19, or the complement or reverse complement of each of such sequences.

[0129] In some embodiments, the vector genome of an AAV vector of the present disclosure further comprises a transcriptional control region operably linked to a transgene encoding a GCase protein. In some embodiments, the transcriptional control region can be inducible, constitutively active, or cell- or tissue-type specific, e.g., primarily or exclusively active in hepatocytes or the liver (thus hepatocyte-specific or liver tissue-specific). In some embodiments, the transcriptional control region comprises or consists of a promoter and may further comprise at least one enhancer region or element. Any region or element within the transcriptional control region may be derived from a human gene or a non-human gene, such as a rat, mouse, bovine, non-human primate, chicken, or viral gene, or from another species or type of organism. The regions or elements of the transcriptional control region may be contiguous with each other or separated by other functional sequences in the vector genome. Thus, for example, the promoter region may be proximal and 5' (upstream) of the transgene, while the enhancer region or element may be located elsewhere in the vector genome (e.g., distal upstream) or elsewhere (e.g., distal 3' (downstream)) of the transgene. Any region or element of the transcriptional control region may be cell type or tissue specific, such as liver tissue specific. Thus, the promoter may be liver cell or tissue specific, the enhancer region or element may be liver cell or tissue specific, or both the promoter and enhancer, either alone or in concert, may be liver cell or tissue specific.

[0130] In some embodiments, a transcriptional control region for use in a vector of the present disclosure can contain a promoter sequence derived from the human albumin (ALB) gene, where such a promoter is the entire human ALB gene promoter or a promoter functional subsequence of such a human ALB gene promoter. Thus, for example, the promoter can comprise, consist essentially of, or consist of the nucleotide sequence of SEQ ID NO: 10, or a promoter functional subsequence, variant, or variant thereof.

[0131] In some embodiments, a transcriptional control region for use in a vector of the present disclosure can contain an enhancer sequence derived from the human albumin (ALB) gene, where such enhancer is the entire human ALB gene enhancer or an enhancer functional subsequence of such a human ALB gene enhancer. Thus, for example, the enhancer sequence can comprise, consist essentially of, or consist of the nucleotide sequence of SEQ ID NO:9, or an enhancer functional subsequence, variant, or variant thereof. In some embodiments, a transcriptional control region for use in a vector of the present disclosure can contain an enhancer sequence derived from the alpha 1-microglobulin / bikunin precursor (AMBP) gene, where such enhancer is the entire AMBP gene enhancer region or an enhancer functional subsequence of such an AMBP gene enhancer region. Thus, for example, the enhancer sequence can comprise, consist essentially of, or consist of the nucleotide sequence of SEQ ID NO:8, or an enhancer functional subsequence, variant, or variant thereof.

[0132] In some embodiments, the vector genome of an AAV vector of the present disclosure further comprises a transcription termination signal sequence, e.g., a polyadenylation (poly(A)) signal sequence, such as the pA signal sequence from the bovine growth hormone (bGH) gene, or a transcription termination functional subsequence of the pA signal sequence of such a bGH gene. Thus, for example, the transcription termination signal sequence can comprise, consist essentially of, or consist of the nucleotide sequence of SEQ ID NO: 14, or a transcription termination functional subsequence thereof, or a variant or variant thereof.

[0133] In some embodiments, the vector genome of an AAV vector of the present disclosure further comprises an intron sequence, which may be located within and interrupt the transgene encoding the GCase protein, or may be located elsewhere within the vector genome and not interrupt the coding sequence (e.g., located 5' of the transgene, or located 3' of the transgene, or located elsewhere (such as 3' of the promoter and 5' of the transgene)). In some embodiments, the intron sequence may be derived from the human beta globin (HBB) gene, and in some embodiments, the intron sequence may comprise, consist essentially of, or consist of the nucleotide sequence of SEQ ID NO:11.

[0134] In some embodiments, the vector genome of an AAV vector of the present disclosure further comprises an additional functional sequence, such as a viral post-transcriptional regulatory element (PRE) sequence, such as the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) or the hepatitis B virus post-transcriptional regulatory element (HPRE), either of which may be located 3' of the transgene and 5' of the transcription termination signal sequence or elsewhere in the genome. In some embodiments, the PRE may be a WPRE that comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 27, or a functional subsequence, variant, or variant thereof. Other sequences that may be useful in the vector genomes of the present disclosure include, but are not limited to, microRNA (miRNA) binding sites, which may be located 3' of the transgene and 5' of the transcription termination signal sequence or elsewhere in the genome, and stuffer or filler nucleotide sequences that are not necessarily intended to directly affect transgene expression (although such properties may be present), but are included so that the overall length of the vector genome is long enough to approximate a particular size, e.g., the packaging capacity of a particular AAV capsid, thereby reducing the amount of contaminating non-full-length vector genome DNA packaged into the capsid.

[0135] In some embodiments, the vector genome of an AAV vector of the present disclosure comprises a first AAV ITR, a transcriptional regulatory region operably linked to a transgene encoding a GCase protein, a transcription termination signal sequence, and a second AAV ITR. In related embodiments, these elements can be arranged contiguously in 5' to 3' order within a nucleic acid molecule corresponding to a single-stranded vector genome in the sense orientation or within the sense strand of a double-stranded DNA molecule containing the genomic sequence, such as might occur in a plasmid used to produce the vector in a host cell. Conversely, these elements can be arranged contiguously in 3' to 5' order within a complementary nucleic acid molecule corresponding to a single-stranded vector genome in the antisense orientation or within the antisense strand of a double-stranded DNA molecule containing the genomic sequence. Thus, for example (and not by way of limitation), if a sense-oriented vector genome contains, in 5' to 3' order, an enhancer, a promoter, a transgene encoding a protein, and a poly(A) signal sequence, the complementary antisense vector genome sequence may contain the same elements in the following order, starting from the 5' end: poly(A), transgene, promoter, enhancer, except that the nucleotide sequence of each element (and the connected sequences between them) in the 5' to 3' direction may be the reverse complement of that same element in the sense strand vector genome sequence. In the case of a self-complementary vector genome (scAAV), the arrangement of elements occurs in 5' to 3' order in approximately half of the sequence and in 3' to 5' order in the complementary half.

[0136] In some embodiments, the vector genome of an AAV vector of the present disclosure comprises, in 5' to 3' order, a first AAV ITR from AAV2 at the 5' end of the genome, a transcriptional control region, an intron, a transgene encoding a GCase protein operably linked to the transcriptional control region, a transcription termination signal sequence, and a second AAV ITR from AAV2 at the 3' end of the genome. In some embodiments, the transcriptional control region comprises (in 5' to 3' order): an enhancer sequence comprising two copies of an AMBP gene enhancer sequence, each comprising, consisting essentially of, or consisting of the nucleotide sequence of SEQ ID NO:8; an ALB gene enhancer sequence comprising, consisting essentially of, or consisting of the nucleotide sequence of SEQ ID NO:9; and an ALB gene promoter sequence comprising, consisting essentially of, or consisting of the nucleotide sequence of SEQ ID NO:10, one or both of which may be liver tissue-specific. In some embodiments, the intron is derived from the human beta globin (HBV) gene and comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO:11. In some embodiments, the transcription termination signal sequence is derived from the bovine growth hormone (bGH) gene and comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 14. In some embodiments, the AAV vector genome further comprises a modified TBP intron 2 sequence located 3' of the transcription termination signal sequence and 5' of the second AAV2 ITR. In any of the foregoing embodiments, the transgene encoding the human GCase protein may comprise, consist essentially of, or consist of the nucleotide sequence of SEQ ID NO:41, or may encode a GCase protein comprising a mature polypeptide identical in sequence to amino acids 20 to 516 of SEQ ID NO:16 and may comprise a nucleotide sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identical to the nucleotide sequence of SEQ ID NO:13.In any of the foregoing embodiments, either or both of the first and second AAV2 ITRs may be full-length or truncated, and may have a flip-flop structure. In any of the foregoing embodiments, either or both of the first and second AAV2 ITRs may comprise, consist essentially of, or consist of the nucleotide sequence of SEQ ID NO:7, SEQ ID NO:15, SEQ ID NO:18, or SEQ ID NO:19, or the reverse complement of each such sequence. In any of the foregoing embodiments, the vector genome may comprise, consist essentially of, or consist of the nucleotide sequence of SEQ ID NO:17, or its reverse complement. In any of the foregoing embodiments, the vector genome may be single-stranded, is not self-complementary (outside the ITRs), and may have a length in the range of approximately 4,000 to 5,000 nucleotides. In any of the foregoing embodiments, the vector genome may be in the sense or antisense orientation. In any of the foregoing embodiments, the vector genome can be packaged in an AAV capsid, such as a liver-tropic AAV capsid, non-limiting examples of which include AAV2, AAV3B, AAV5, AAV6, AAV7, AAV8, AAV9, AAV13, AAVrh.74, AAVrh.10, AAV-DJ, AAV-LK03, AAV-KP1, AAV-hu.Lvr01, AAV-hu.Lvr02, AAV-hu.Lvr03, AAV-hu.Lvr04, AAV-hu.Lvr05, AAV-hu.Lvr06, AAV-hu. and capsids derived from Lvr07, AAV-Anc80, AAV-NP40, AAV-NP59, AAV-NP84, AAV-hu.37, AAV-rh.8, AAV-rh.64R1, RHM4-1, RHM15-1, RHM15-2, RHM15-3 / RHM15-5, RHM15-4 and RHM15-6, AAVHSC7, AAVHSC15 and AAVHSC17, or AAV capsids comprising a VP1 protein comprising or consisting of an amino acid sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 4. In any of the foregoing embodiments, the AAV vector can comprise an AAV vector genome enveloped in an AAV3B-derived capsid, wherein the nucleotide sequence of the genome comprises, consists essentially of, or consists of the nucleotide sequence of SEQ ID NO: 17, or the reverse complement thereof.

[0137] In some embodiments, the vector genome of an AAV vector of the present disclosure further comprises a third AAV ITR located between the first and second AAV ITRs, such as in the middle (even if not exactly in the middle) of the vector genome, which in some embodiments may have a mutated or altered terminal resolution site that makes it non-terminally resolved. In these embodiments, the vector genome may be self-complementary and may range from about 4000 to 5000 nucleotides when packaged into a capsid, or may range from about 2000 to 2500 nucleotides in length when the sequence is contained in a plasmid suitable for use in producing an scAAV vector in a host cell.

[0138] AAV vector production As is known in the art, AAV vectors can be produced in a variety of ways, including on a large scale. For example, AAV vectors are produced in mammalian or insect cells and then purified. A traditional approach that does not rely on coinfection with a helper virus involves the use of three plasmids, as described above. One plasmid contains genes for helper virus factors, a second plasmid contains the AAV genome sequence in a double-stranded form, and a third plasmid contains the AAV rep and cap genes. The rep / cap plasmid often contains the rep gene from AAV2, but this is not a requirement; the cap gene sequence is selected based on which AAV capsid proteins are desired to comprise the capsid. In practice, the three plasmids are often replicated separately in bacteria, purified, mixed together in solution in a predetermined ratio, and then mixed with a transfection agent. The transfection mixture is then used to transfect appropriate mammalian host cells (adherent or suspension cell culture). These cells are incubated for a sufficient time (e.g., 48-72 hours) and cultured under conditions sufficient for the host cells to express the helper factors and the rep and cap genes and for the AAV vector genome to replicate from its plasmid template and be packaged into capsids. In some embodiments, the host cells are HEK293 cells, which constitutively express the AdV helper factors E1A and E1B, and the helper plasmid need only contain the AdV E2A, E4ORF6, and VA RNA genes. When using other mammalian host cells that do not natively produce AdV or other viral helper factors, the use of helper plasmids containing missing or otherwise required helper factors may be necessary. While the so-called triple transfection method described above is commonly employed, it is not necessary to provide the genes for the helper factors and the rep and cap genes on separate plasmids. In principle, all of these genes can be contained in a single plasmid, in which case two plasmids can be used for transfection.

[0139] In search of a more efficient method for large-scale production of AAV vectors, stable cell lines have been generated that contain some, but not all, of the components that need to be introduced into cells by transient transfection. Packaging cell lines contain stably integrated AAV rep and cap genes. Production of AAV in packaging cells requires transient transfection of a plasmid containing the AAV vector genome and infection with a helper virus. AAV vectors can also be produced in packaging cells without transfection by first infecting them with AdV (wild-type or E2b gene-deleted) (which provides the AdVE1 gene product, which induces rep and cap expression in the cells, as well as helper factors required for AAV replication), and then infecting them with a replication-deficient hybrid AdV in which the AAV vector genome replaces the E1 gene in the genome of the hybrid virus.

[0140] Alternatively, the producer cell line contains stably integrated AAV rep and cap genes and the AAV vector genome. Production of AAV in the producer cell requires its infection with a helper virus. Regarding packaging cells and producer cells, see, for example, Martin, J, et al., "Generation and characterization of adeno-associated virus producer cell lines for research and preclinical vector production," Hum. Gene Methods, 24:253-269 (2013); Gao, G. P., et al., "High-titer adeno-associated viral vectors from a Rep / Cap cell line and hybrid shuttle virus," Hum. Gene Ther., 9:2353-62 (1998); Martin, J, et al., "Generation and Characterization of Adeno-Associated Virus Producer Cell Lines for Research and Preclinical Vector Production," Hum. Gene Ther. Meth., 24:253-69 (2013); Clement, N and J. C. Grieger, "Manufacturing of recombinant adeno-associated viral vectors for clinical use." The present invention is further described in detail in the following clinical trials, Mol. Ther. Meth. & Clin. Dev. (2016) 3, 16002 (doi:10.1038 / mtm.2016.2). Other cell systems for producing AAV vectors in mammalian cells, including on a commercial scale, are possible.

[0141] The baculovirus system has also been used to produce AAV vectors; Sf9 insect cells are infected with recombinant baculovirus vectors containing various AAV rep and cap genes and the AAV genome. The foreign gene is expressed, followed by packaging of the genome into intracellular vector particles. In early versions of the system, each component (rep, cap, and genome) was carried by three separate baculoviruses. Subsequent modifications included combining rep and cap into a single baculovirus, so that only two baculoviruses were required, and producing Sf9 cell lines containing stably integrated AAV rep and cap genes that require only infection with a single recombinant baculovirus containing the AAV vector genome.The use of baculovirus systems to produce AAV vectors has been described, for example, in Urabe, M, et al., "Insect Cells as a Factory to Produce Adeno-Associated Virus Type 2 Vectors," Hum. Gene Ther., 13:1935-43 (2002); Virag, T, et al., "Producing Recombinant Adeno-Associated Virus in Foster Cells: Overcoming Production Limitations Using a Baculovirus-Insect Cell Expression Strategy," Hum. Gene Ther., 20:807-17 (2009); Smith, RH, et al., "A Simplified Baculovirus-AAV Expression Vector System Coupled with One-Step Affinity Purification Yields High-Titer rAAV Stocks from Insect Cells," Mol. Ther., 17:1888-96 (2009); and Mietzsch, M, et al., "OneBac: A Platform for Scalable and High-Titer Production of Adeno-associated virus serotype 1-12 vectors for gene therapy, Hum. Gene. Ther. 25(3):212-22 (2014), are described in further detail. Other cell systems for producing AAV vectors in insect cells, including on a commercial scale, are also possible.

[0142] host cell As used herein, "host cell" refers to a cell suitable or adapted for in vitro production of an AAV vector. Host cells are often clonal cell lines that can divide for multiple generations until senescence prevents growth and may be immortal. To produce vectors, host cells can be transiently or non-transiently modified by introducing exogenous genetic information designed to direct the biosynthesis within the host cell of various components required for AAV vector assembly, particularly AAV capsid proteins, Rep proteins, helper virus factors, and the vector genome. For example, host cells can be transfected with exogenously supplied nucleic acid, such as in the form of one or more DNA plasmids, containing nucleotide sequences encoding the necessary vector components.

[0143] Various methods for transfecting nucleic acids into host cells are known in the art. These include, but are not limited to, mixing the nucleic acid with specific compounds that form complexes with the nucleic acid and are taken up by the cell, including calcium phosphate or DEAE-dextran, polyethyleneimine (PEI), polylysine, polyornithine, polybrene, cyclodextrins, cationic lipids, and other cationic organic compounds known in the art. Transfection can also be performed non-chemically by more specialized techniques such as electroporation and biolistec particle delivery. As known in the art, transfection can be transient or stable. In transient transfection, the transfected nucleic acid remains in the cell for a limited period of time and, in the case of DNA, is not integrated into the genome. In stable transfection, DNA introduced into the cell can persist for long periods, either as an episomal plasmid or integrated into the chromosome. Typically, to produce stably transfected cells, cells are transfected with a plasmid containing a selectable marker gene and a nucleotide sequence encoding one or more necessary vector components, and then grown and maintained under selective pressure, i.e., conditions that kill untransfected cells or transfected cells that have lost the exogenous DNA containing the selectable marker for some reason. For example, the plasmid can contain an antibiotic resistance gene, and transfected cells can be selected by adding the antibiotic to the medium in which the cells are grown. In some embodiments, the nucleotide sequence encoding one or more necessary vector components introduced into the stably transfected host cell is under the control of an inducible promoter, such that it is not expressed, or is expressed only at low levels, during cell growth unless an environmental factor, such as a drug, metal ion, or elevated temperature, that induces the promoter is introduced.

[0144] In other embodiments, genetic engineering methods, such as knock-in or gene editing, can be used to modify the host cell genome in a non-transient and targeted manner to direct the host cell to produce one or more of the required vector components. In other embodiments, nucleotide sequences encoding one or more of the required vector components can be introduced into host cells to direct the production of AAV vectors via transduction, in which case the host cell is infected with a modified virus containing such nucleotide sequences. Examples of viral vectors useful for this purpose include adenoviruses, retroviruses (including lentiviruses), baculoviruses, vaccinia viruses, and herpes simplex viruses, as well as other viral vectors.

[0145] Host cells can be any type of cell known in the art to be useful for producing AAV vectors. Host cells are often animal cells and can be of various types or species, such as insect cells or mammalian cells such as rat, mouse, or human. In some embodiments, host cells useful for producing AAV vectors of the present disclosure are mammalian host cells, examples of which include HeLa cells, Cos cells, HEK293 cells (and variants of HEK293 cells such as HEK293E, HEK293F, HEK293H, HEK293T, or HEK293FT cells), A549 cells, BHK cells, Vero cells, NIH 3T3 cells, HT-1080 cells, Sp2 / 0 cells, NS0 cells, C127 cells, AGE1.HN cells, CAP cells, HKB-11 cells, WI-38 cells, MRC-5 cells, or PER.C6 cells, among many others. In some embodiments, host cells useful for producing the AAV vectors of the present disclosure are insect host cells, examples of which include Sf9 cells, ExpiSf9, ​​Sf21 cells, S2 cells, D.Mel2 cells, Tn-368 cells, or BTI-Tn-5B1-4 cells, among many others. In some embodiments, host cells, including but not limited to HEK293 cells and variants thereof, can be adapted to growth in suspension culture.

[0146] For the purpose of producing AAV vectors, host cells are often grown or maintained in culture under controlled conditions that promote their growth and vector biosynthesis. For example, host cells can be grown in a liquid medium of defined chemical composition that provides all nutrients necessary for cell growth and biosynthesis. Exemplary media include DMEM, DMEM / F12, MEM, and RPMI 1640 for mammalian host cells, and Express Five SFM, Sf-900 II SFM, Sf-900 III, or ExpiSfCD for certain insect cells. Such media can be supplemented with antibiotics, growth factors, or cytokines (recombinantly produced or present in animal serum, such as FBS) known to stimulate the growth of the specific cell type in use, as well as other components that may be required for optimal biosynthesis of AAV vectors but may otherwise be in limited supply. Exemplary supplements include essential amino acids, glutamine, vitamin K, insulin, BSA, or transferrin. In addition to the growth medium, other culture conditions, such as pH, temperature, and CO2 and oxygen concentrations, can be controlled to optimize cell growth and / or productivity.

[0147] Host cells in culture can be grown or maintained in a number of vessels known in the art, such as stirred tank bioreactors, wave bags, spinner flasks, hollow fiber bioreactors, and roller bottles, some of which can be designed and configured for single or multiple use. Depending on the characteristics of the host cells in question, host cells can be grown in adherent cell culture, in which cells attach to and grow in contact with a physical substrate, or in suspension cell culture, in which single cells float freely in the medium that sustains them or are attached to bead microcarriers suspended in the medium. As known in the art, various techniques, such as perfusion culture, have been developed that can be used to grow host cells to high densities, thereby increasing the total amount of AAV vector produced per production run.

[0148] As is known in the art, host cell samples are often maintained in frozen cell banks, such as master cell banks and working cell banks, which facilitate the production of biological products in multiple batches over time while ensuring consistent performance by the host cells. Prior to a campaign to produce an AAV vector, a frozen sample of host cells from the cell bank is typically thawed, seeded into a small culture volume, and grown to higher densities or numbers in increasing culture volumes. Once the host cells reach a desired cell density and / or volume in culture, exogenous genetic material can be introduced, such as by transfection with plasmid DNA or infection or transduction with a viral vector, to initiate AAV vector production. Alternatively, when using non-transiently modified host cells in which nucleotide sequences encoding one or more of the required vector components are under inducible control, environmental factors necessary to induce expression can be introduced. The host cells can then be cultured, expanded, or maintained for a time and under conditions sufficient to produce the AAV vector.

[0149] AAV vector purification After biosynthesis within the host cell, the AAV vector can be purified by a variety of methods known in the art. For example, in some embodiments, the host cells can be mechanically or chemically lysed, such as with detergents, followed by removal of host cell DNA and other components, followed by steps such as density gradient centrifugation or the use of one or more chromatographic separation methods, to obtain highly purified preparations of the AAV vector for use in research or therapeutic methods.

[0150] Chromatographic methods useful for purifying AAV vectors include, but are not limited to, size exclusion chromatography (SEC); affinity chromatography using any affinity ligand attached to a chromatography resin or matrix that can specifically bind to the capsid, such as an antibody, lectin, or glycan; immobilized metal chelate chromatography (IMAC); thiophilic adsorption chromatography; hydrophobic interaction chromatography (HIC); multimodal chromatography (MMC); pseudo-affinity chromatography; and ion exchange chromatography (IEX or IEC), such as anion exchange chromatography (AEX) or cation exchange chromatography (CEX).

[0151] In some embodiments, AAV vectors can be purified using antibody-based affinity chromatography, in which an antibody or antibody fragment thereof is attached to a stationary phase (matrix or resin) packed in a chromatography column through which host cell lysate is pumped, followed by washing and elution of the antibody-bound vectors. The antibody bound to the solid phase can be an IgG or fragment thereof or a single-chain camelid antibody (such as a heavy chain variable region camelid antibody), although other types of antibodies are also possible. Non-limiting examples of ligand affinity resins include Sepharose AVB, POROS CaptureSelect AAVX, POROS CaptureSelect AAV8, and POROS CaptureSelect AAV9. For example, Terova, O, et al., Affinity Chromatography Accelerates Viral Vector Purification for Gene Therapies, BioPharm Intl.eBook pp.27-35 (2017); Mietzsch, M, et al., Characterization of AAV-Specific Affinity Ligands: Consequences for Vector Purification and Development. Strategies,Mol.Ther.Meth.&Clin.Dev.,19:362-73(2020);Rieser,R,et al.,Comparison of Different Liquid Chromatography-Based Purification Strategies for Adeno-Associated Virus Vectors,Pharmaceutics 13,748(2021)(doi.org / 10.3390 / pharmaceutics13050748).

[0152] In other embodiments, AAV vectors can be purified using ligand chromatography, in which the stationary phase is bound to the same type of ligand that a particular AAV is known to use to bind to cells, such as a glycan, sialic acid (e.g., O-linked or N-linked sialic acid), galactose, heparin, heparan sulfate, or a proteoglycan such as a heparan or heparin sulfate proteoglycan (HSPG). For example, an affinity matrix containing sialic acid residues can be used to purify AAV vectors having capsids that specifically bind to sialic acid (e.g., AAV1, AAV4, AAV5, or AAV6); an affinity matrix containing galactose can be used to purify AAV vectors having capsids that specifically bind to galactose (e.g., AAV9); and an affinity matrix containing heparin, heparan, or HSPG can be used to purify AAV vectors having capsids that specifically bind to HSPG (e.g., AAV2, AAV3A, AAV3B, AAV6, or AAV13).

[0153] Depending on the physicochemical properties of the vector, such as the charge of the capsid, the AAV vector can be further purified by anion exchange, cation exchange, or hydrophobic interaction chromatography. Other downstream process steps useful for purifying AAV vectors can also be used, such as, but not limited to, desalting and buffer exchange, ultrafiltration, nanofiltration, diafiltration, and tangential flow filtration (TFF). Multiple downstream processing steps can be used, and multiple downstream processing steps can be performed in any order according to the knowledge of those skilled in the art.

[0154] Treatment method Among other embodiments, the present disclosure provides methods of treating Gaucher disease, including type 1 Gaucher disease (GD1), or other types of GCase deficiency, by administering to a subject (such as a human subject) in need of such treatment a therapeutically effective amount of an AAV vector of the present disclosure (including, but not limited to, the vector described herein as AAV3B-GBA clone 128) or a pharmaceutical composition containing such an AAV vector. Also provided is the use of an AAV vector of the present disclosure in the manufacture of a medicament for use in the methods of treatment disclosed herein. Additionally, provided is an AAV vector of the present disclosure or a pharmaceutical composition containing such an AAV vector for use in the methods of treatment disclosed herein.

[0155] Treatment of a subject with Gaucher disease need not necessarily result in a cure to be considered effective, where "cure" is defined as halting the progression of the disease or partially or completely restoring the patient's health to the state before the onset or worsening of symptoms, or compared to a healthy person without GD1. Rather, a therapeutically effective amount of an AAV vector of the present disclosure (including, but not limited to, the vector described herein as AAV3B-GBA clone 128) or a pharmaceutical composition containing such an AAV vector may be useful for at least partially reversing, reducing, or ameliorating the extent or severity in a subject of at least one symptom or sign associated with Gaucher disease or GCase deficiency, or at least partially reversing, reducing, or ameliorating the extent or severity in a subject of at least one disorder or dysfunction of the body, organ, tissue, or cell caused by Gaucher disease or GCase deficiency, or slowing the progression of other adverse effects of Gaucher disease or GCase deficiency in a subject, or improving the quality of life of a subject with Gaucher disease or experiencing the adverse effects of GCase deficiency. Examples of symptoms, signs, disorders or dysfunctions associated with Gaucher disease or GCase deficiency include, but are not limited to, hepatosplenomegaly, hepatomegaly, splenomegaly, anemia, neutropenia, leukopenia, pancytopenia, thrombocytopenia, monoclonal gammopathy, polyclonal gammopathy, anorexia, chronic fatigue, bone crisis, avascular osteonecrosis, bone pain, osteolysis, osteonecrosis, osteopenia, decreased quality of life (QoL), and other symptoms, signs, disorders or dysfunctions associated with Gaucher disease or GCase deficiency known in the art.

[0156] In some embodiments, the methods of treating GD1 or other types of GCase deficiency disclosed herein can be used to treat GD1 or other types of GCase deficiency in a human subject having any type of homozygous or heterozygous deleterious mutation in or affecting the GBA gene. Non-limiting examples of deleterious mutations include deletions, insertions, recombinations, splice site variants, missense or nonsense mutations in either or both alleles of the GBA gene, mutations affecting transcriptional regulatory regions (e.g., enhancers or promoters) of either or both alleles of the GBA gene, and / or mutations that reduce the stability of mRNA expressed from either or both alleles of the GBA gene or the amount of protein translated from such mRNA transcripts, so long as the mutation results in a reduced or absent amount of GCase protein produced and / or a reduced or absent amount of enzymatic activity of the GCase protein produced. For example, more common deleterious mutations in the human GBA gene associated with GB1 include, but are not limited to, c.1226A>G (N370S), c.1448T>C (L444P), c.84dup, c.115+1G>A (IVS2+1G>A), and the RecNciI mutation resulting from recombination between the GBA and GBAP pseudogenes, and many others known in the art. Methods for determining the genotype of a subject carrying a deleterious mutation in either or both alleles of the GBA gene, such as by RFLP analysis or gene or genome sequencing, are well known to those of skill in the art, as are methods for detecting and quantifying the amount of GCase protein and / or GCase enzymatic activity present in a sample from a subject.

[0157] In some embodiments, the subject is a human subject diagnosed with GD1 who has not previously been treated with enzyme replacement therapy (ERT) or substrate synthesis therapy (SRT) for GD1 (i.e., standard of care naive), while in other embodiments, the subject is a human subject diagnosed with GD1 who was receiving ERT or SRT prior to treatment with the methods of the disclosure. In some embodiments, for subjects with GD1 who are receiving standard of care treatment (i.e., not treatment naive), a therapeutically effective amount of an AAV vector of the disclosure or a pharmaceutical composition containing such an AAV vector can enable such patients to discontinue ERT or SRT, or reduce the dose and / or frequency of such ERT or SRT, and not experience worsening of symptoms, signs, disorders, or dysfunctions characteristic of Gaucher disease (or GCase deficiency), at least for a period of time (i.e., the therapeutic effect need not be lifelong).

[0158] The therapeutic efficacy of the methods of treatment disclosed herein can be assessed in individual subjects with GD1 or other types of GCase deficiency by observing or measuring and comparing the severity or magnitude of symptoms, signs, disorders, dysfunctions, or laboratory values ​​characteristic of GD1 (or GCase deficiency) before (baseline) and after treatment. Such comparisons can be performed at one or more time points after treatment, such as 0, 1, 2, 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, or 48 months after treatment, or at other time points after treatment. The data used for comparison from an individual subject can be a single data point or, if available, an average of multiple data points.

[0159] In other embodiments, the efficacy of treatment can be assessed using a control population (i.e., two or more individuals) of subjects with GD1 or other types of GCase deficiency as a control by observing or measuring the severity or magnitude of symptoms, signs, disorders, dysfunctions, or laboratory values ​​characteristic of GD1 (or GCase deficiency) in individuals within the population before (baseline) and after treatment, and comparing the average pre-treatment data with the average post-treatment data. Such comparisons can be performed at one or more time points after treatment, such as 0, 1, 2, 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, or 48 months after treatment, or at other time points after treatment. The study population may have received standard-of-care ERT or SRT therapy for GD1 prior to treatment with the AAV vector of the present disclosure, and typically, ERT or SRT therapy (as appropriate) is discontinued after vector treatment, at least during the period of monitoring the therapeutic effect. In other embodiments, the study population may be naive to standard-of-care therapy prior to treatment with the AAV vector of the present disclosure. In some embodiments, studies intended to establish and quantify therapeutic efficacy can be designed to compare the therapeutic effect in a population of subjects treated with an AAV vector of the present disclosure (treatment group) with the therapeutic effect in a population of subjects administered a placebo (control group). Typically, subjects within the treatment and control groups in a study are matched based on relevant subject characteristics, such as, but not necessarily, age, sex, disease severity at the time of intervention, and whether the subject has previously received, is currently receiving, or is treatment-naive with standard-of-care ERT or SRT therapy. In other embodiments, the control population is not treated with a placebo, but instead is derived from a natural history study in which GD1 patients are observed to describe and quantify the progression of relevant disease parameters in the absence of gene therapy.

[0160] In some embodiments, the methods of treating GD1 or other types of GCase deficiency disclosed herein are effective in treating subjects with GD1 or GCase deficiency of any age, including, but not limited to, subjects under the age of 1, such as subjects about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 months of age, or subjects at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70 years of age or older, or subjects with an age including or between any of the foregoing specifically recited ages.

[0161] In some embodiments, the methods of treating GD1 or other types of GCase deficiency disclosed herein are effective in treating subjects with any level or degree of severity of GD1 (e.g., mild, moderate, or severe GD1) at the time the AAV vector of the present disclosure is first administered, or any degree of severity of GD1 as reflected by the subject's severity score using an appropriate severity scoring index, such as GD1-DS3 or GauSSI-I, which are further described below. For example, and without limitation, at the time of initial treatment with an AAV vector of the present disclosure, one or more subjects may have a severity score of 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 on the GD1-DS3 Severity Score Index or a severity score of 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 on the GauSSI-I. In some embodiments, at the time of initial treatment with an AAV vector of the present disclosure, the subject does not exhibit overt signs or symptoms of GD1 but has been diagnosed as likely to develop such signs or symptoms based on genetic testing indicating the presence of at least one deleterious mutation in either or both alleles of the subject's GBA gene.

[0162] In some embodiments, methods of treating GCase deficiency, including Gaucher disease type 1 (GD1), using the AAV vectors of the present disclosure (including, but not limited to, the vector described herein as AAV3B-GBA clone 128) are effective in treating GD1 or other forms of GCase deficiency, such that after vector administration, the patient can forgo standard treatment for Gaucher disease type 1, such as ERT or SRT therapy, without experiencing any symptoms or signs of Gaucher disease, or without experiencing any worsening of symptoms or signs of Gaucher disease that may have been present at the time of gene therapy, or at worst, experiencing only a minimal worsening of symptoms or signs of Gaucher disease that may have been present at the time of gene therapy, such that the patient's overall health, function, quality of life, and / or lifespan are not substantially or materially affected. In some embodiments, this period, referred to herein as the treatment duration, can be any suitable or desired period, including, but not limited to, for example, at least or about 3, 6, 9, 12, 15, 18, 21, 24 or more months, or at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more years, or at least or about 1, 2, 3, 4, 5, 6, 7 or more generations, or any period between any of the specifically recited values, or in some embodiments, the remaining lifespan of the patient after receiving gene therapy as described herein.

[0163] hematological findings In some embodiments, methods of treating GCase deficiency, including Gaucher disease type 1 (GD1), using the AAV vectors of the present disclosure (including, but not limited to, the vector described herein as AAV3B-GBA clone 128) are effective in reducing the incidence, frequency, or severity of hematological manifestations of the disease process, including, inter alia, anemia, thrombocytopenia, and excessive bleeding. In some embodiments, the treatment is effective to reduce the frequency or severity of hematological findings during the course of disease in a GD1 patient for up to, or at least about, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, or 180 days, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 months, or 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, or 6.0 years, or a range of time periods during and including any of the foregoing recited periods, after administration of an AAV vector of the disclosure.

[0164] anemia In some embodiments, methods of treating GCase deficiency, including Gaucher disease type 1 (GD1), using AAV vectors of the present disclosure (including, but not limited to, the vector described herein as AAV3B-GBA clone 128) are effective in reducing the incidence, frequency, or severity of anemia, a lower-than-normal number of red blood cells (often quantified by measuring the amount of hemoglobin in the blood or the percentage of blood volume occupied by red blood cells (hematocrit)), and associated risks, including fatigue, weakness, shortness of breath, dizziness, etc. In some embodiments, methods of the present disclosure for treating GD1 can reduce the number of blood transfusions required in GD1 patients to prevent symptoms of anemia, such as fatigue, or other symptoms. In some embodiments, the treatment is effective to reduce the frequency or severity of anemia in a GD1 patient for up to, or at least about, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, or 180 days, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 months, or 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, or 6.0 years, or a range of times during and including any of the foregoing recited periods, after administration of an AAV vector of the disclosure.

[0165] In some embodiments, the disclosed methods for treating GD1 (or other GCase deficiency) are effective to increase the amount of hemoglobin (Hb) in the blood, e.g., from less than 8 grams per deciliter (g / dL), in an individual treated GD1 patient or averaged over a population of treated GD1 patients, to a higher value, such as 8.0-9.9 g / dL or 10-12 g / dL, or to a blood hemoglobin concentration of greater than 12 g / dL in adult males or greater than 11.5 g / dL in adult females. In some of these embodiments, the GD1 patient was standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patient received standard of care ERT or SRT therapy prior to gene therapy.

[0166] In some embodiments, the treatment method is effective to increase the blood Hb concentration in an individual treated GD1 patient or averaged over a population of treated GD1 patients by at least or about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, 100%, or 110% of the average Hb concentration in the blood of healthy humans. In some of these embodiments, the GD1 patient was standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patient received standard of care ERT or SRT therapy prior to gene therapy. In some embodiments, depending on the reference ranges used, the Hb concentration in blood of healthy humans ranges from about 13.2 to 16.6 grams per deciliter (g / dL), or 13.8 to 17.2 g / dL, or 14.0 to 17.5 g / dL, or 14 to 18 g / dL for adult males, from about 11.6 to 15.0 g / dL, or 12.1 to 15.1 g / dL, or 12.3 to 15.3 g / dL, or 12 to 16 g / dL for adult females, from 9.5 to 14.0 g / dL for children aged 1 to 6 years, and from 10.0 to 15.5 g / dL for children and adolescents aged 6 to 18 years. In some embodiments, the normal reference is another value, such as about 13, 14, 15, 16, 17, or 18 g / dL for men, about 11, 12, 13, 14, 15, or 16 g / dL for women, or an integer value within or between any of the specifically recited values ​​above.

[0167] In some embodiments, the treatment method provides for, in an individual treated GD1 patient or as an average for a population of treated GD1 patients, an increase in Hb concentration in the blood of the GD1 patient of at least or about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 112%, 113%, 114%, 115%, 120%, 121%, 122%, 123%, 124%, 125%, 130%, 131%, 1 %, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110% or more. In some embodiments, the latter control group is standard of care naive or is receiving standard of care ERT or SRT therapy. In some non-limiting embodiments, standard of care naive GD1 patients or GD1 patients receiving standard of care ERT or SRT therapy have a baseline blood Hb concentration of less than or equal to, or about, or less than, 170, 160, 150, 140, 130, 120, 110, 110, 90, 80, 70, 60, or 50 g / dL of blood, or an integer value between or including any of the foregoing specifically recited values. In some of these embodiments, the GD1 patients were standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patients received standard of care ERT or SRT therapy prior to gene therapy.

[0168] In some embodiments, the treatment method provides for, in an individual treated GD1 patient or averaged over a population of treated GD1 patients, an increase in Hb concentration in the blood of the GD1 patient of at least or about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, or 5.0 g / dL or greater. In some embodiments, the latter control group is standard of care naive or receiving standard of care ERT or SRT therapy. In some non-limiting embodiments, standard of care naive GD1 patients or GD1 patients receiving standard of care ERT or SRT therapy have a baseline blood Hb concentration of less than or equal to, or about, or less than, 170, 160, 150, 140, 130, 120, 110, 110, 90, 80, 70, 60, or 50 g / dL of blood, or an integer value between or including any of the foregoing specifically recited values. In some of these embodiments, the GD1 patients were standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patients received standard of care ERT or SRT therapy prior to gene therapy. In some of these embodiments, the GD1 patient has received standard of care ERT or SRT therapy prior to the gene therapy described herein, and such treatment is effective to maintain blood Hb levels resulting from the standard of care within a certain margin, in some embodiments, the margin is less than about 30%, 25%, 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or 0%.

[0169] In some embodiments, the treatment methods are effective to increase the hematocrit (volume percentage of red blood cells in the blood) of a GD1 patient by at least or about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, or more of the mean hematocrit of a healthy human, either in an individual GD1 patient treated or averaged over a population of treated GD1 patients. In some of these embodiments, the GD1 patient was standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patient received standard of care ERT or SRT therapy prior to gene therapy. In some embodiments, depending on the reference range used, the hematocrit of a healthy human ranges from about 40%-54% or 41%-50% for adult males and about 36%-44% or 36%-48% for adult females. In some embodiments, the normal reference value is an integer value such as 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, or 55%.

[0170] In some embodiments, the treatment method increases the hematocrit of a GD1 patient by at least or about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 1109%, 119%, 1209%, 12109%, 12209%, 12309%, 12409%, 12509%, 12 The gene therapy described herein is effective to increase GD1 expression by 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110% or more. In some embodiments, the latter control group is standard of care naive or is receiving standard of care ERT or SRT therapy. In some of these embodiments, the GD1 patient was standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patient was receiving standard of care ERT or SRT therapy prior to gene therapy.

[0171] Thrombocytopenia In some embodiments, methods of treating GCase deficiency, including Gaucher disease type 1 (GD1), using the AAV vectors of the present disclosure (including, but not limited to, the vector described herein as AAV3B-GBA clone 128) are effective in reducing the incidence, frequency, or severity of thrombocytopenia, a below-normal platelet count (often defined as fewer than 150,000 platelets per microliter (μL) of blood), and associated risks, including internal bleeding, longer than normal clotting times, and excessive bleeding. In some embodiments, the treatment is effective to reduce the frequency or severity of thrombocytopenia in a GD1 patient for up to, or at least about, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, or 180 days, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 months, or 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, or 6.0 years, or a range of times during and including any of the foregoing recited periods, after administration of an AAV vector of the disclosure.

[0172] In some embodiments, the disclosed methods for treating GD1 can increase platelet counts, e.g., from less than 60,000 / μL of blood (often defined as moderate to severe thrombocytopenia) to higher numbers, such as between 60,000 / μL and 100,000 / μL, or between 60,000 / μL and 120,000 / μL, or between 100,000 / μL and 150,000 / μL, or between 120,000 / μL and 150,000 / μL, or to platelet counts greater than 150,000 / μL of blood, in an individual treated GD1 patient or averaged over a population of treated GD1 patients. In some of these embodiments, the GD1 patient was standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patient received standard of care ERT or SRT therapy prior to gene therapy. In some embodiments, the disclosed methods for treating GD1 can reduce the number of platelet infusions required by GD1 patients to prevent excessive bleeding, such as before dental work or surgery or after trauma.

[0173] In some embodiments, the treatment method is effective to increase the platelet count, either in an individual treated GD1 patient or averaged over a population of treated GD1 patients, by at least or about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, 100%, 110% or more of the mean platelet count in a healthy human (which in some embodiments may range from 150,000 / μL to 450,000 / μL of blood). In some embodiments, the normal reference is another value, such as about 150,000 / μL, 200,000 / μL, 250,000 / μL, 300,000 / μL, 350,000 / μL, 400,000 / μL, or 450,000 / μL of blood, or an integer value in a range encompassing or between any of the foregoing specifically recited values. In some of these embodiments, the GD1 patient was standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patient received standard of care ERT or SRT therapy prior to gene therapy.

[0174] In some embodiments, the treatment method increases the platelet count per microliter of blood in a GD1 patient by at least or about 1%, 2%, 3%, 4%, or 5% over the baseline platelet count before gene therapy or compared to the platelet count of a comparable (e.g., age- and sex-matched) control patient with GD1 or other forms of GCase deficiency, either in the individual GD1 patient treated or as an average for a population of treated GD1 patients. , 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110% or more. In some embodiments, the latter control group is standard of care naive or is receiving standard of care ERT or SRT therapy. In some non-limiting embodiments, a baseline platelet count of 350,000, 300,000, 250,000, 200,000, 150,000, 100,000, 90,000, 80,000, 70,000, 60,000, 50,000, 40,000, or 30,000 per μL of blood is achieved in standard of care naive GD1 patients or patients receiving standard of care ERT or SRT therapy. 000 or less, or about 350,000, 300,000, 250,000, 200,000, 150,000, 100,000, 90,000, 80,000, 70,000, 60,000, 50,000, 40,000, or 30,000 or less per μL of blood, or any integer value between or including any of the foregoing specifically recited values. In some of these embodiments, the GD1 patient was standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patient received standard of care ERT or SRT therapy prior to gene therapy.

[0175] In some embodiments, the treatment method increases the platelet count of a GD1 patient to at least or about 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 15,000, 20,000, 25,000, 30,000, 35,000, 40,000, 45,000, 50,000, 55,000, 60,000, 70,000, 80,000, 90,000, 100,000, 110,000, 120,000, 130,000, 140,000, 150,000, 160,000, 170,000, 180,000, 190,000, 210,000, 220,000, 230,000, 240,000, 250,000, 260,000, 270,000, 280,000, 310,000, 320,000, 330,000, 340,000, 350,000, 360,000, 370,000, 380,000, 390,000, 410,000, 420,000, 430,000, 440,000, 450,000, 460,000, 470,000, 480,000, 490,000, 510,000, 520,000 100,000, 110,000, 120,000, 125,000, 130,000, 135,000, 140,000, 145,000, 150,000, 160,000, 170,000, 180,000, 190,000, 200,000, 250,000, 300,000 or more platelets, or a range of integer values ​​therebetween including any of the foregoing specifically recited values. In some embodiments, the latter control group is standard of care naive or undergoing standard of care ERT or SRT therapy. In some non-limiting embodiments, the baseline platelet count of standard of care naive GD1 patients or undergoing standard of care ERT or SRT therapy is 350,000, 300,000, 250,000, 200,000, 150,000, 100,000, 90,000, 80,000, 70,000, 60,000, 50,000, 40,000, or 30,000 per μL of blood. 000 or less, or about 350,000, 300,000, 250,000, 200,000, 150,000, 100,000, 90,000, 80,000, 70,000, 60,000, 50,000, 40,000, or 30,000 or less per μL of blood, or any integer value between or including any of the foregoing specifically recited values.In some of these embodiments, the GD1 patient was standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patient received standard of care ERT or SRT therapy prior to gene therapy.

[0176] One consequence of having a decreased platelet count is a prolonged bleeding time before blood clots, which can result in excessive bleeding in patients with GD1 or other forms of GCase deficiency, such as mucocutaneous bleeding (e.g., nosebleeds, bleeding gums, or menorrhagia) or postoperative bleeding, bleeding during childbirth, or spontaneous hematomas. Thus, in some embodiments, the disclosed methods for treating GD1 or other forms of GCase deficiency are effective in shortening bleeding time. Bleeding time can be measured using any method known in the art, such as the so-called Ivy method, where normal bleeding times are less than 8 minutes, or the Duke method, where normal bleeding times are less than 3 minutes. Thus, in some embodiments, the treatment method is effective in increasing bleeding time from greater than 8 minutes, as determined using the Ivy method, to less than 8 minutes, or increasing bleeding time from greater than 3 minutes, as determined using the Duke method, to less than 3 minutes. In some of these embodiments, the GD1 patient was standard-of-care treatment-naive prior to gene therapy as described herein, while in other embodiments, the GD1 patient received standard-of-care ERT or SRT therapy prior to gene therapy.

[0177] Leukopenia In some embodiments, methods of treating GCase deficiency, including Gaucher disease type 1 (GD1), using the AAV vectors of the disclosure (including, but not limited to, the vector described herein as AAV3B-GBA clone 128) are effective in reducing the incidence, frequency, or severity of leukopenia, a lower-than-normal white blood cell count (often defined as fewer than 4,000 white blood cells per microliter (μL) of blood), and associated risks, including increased susceptibility to infection. In some embodiments, the treatment is effective to reduce the frequency or severity of leukopenia in a GD1 patient for up to, or at least about, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, or 180 days, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 months, or 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, or 6.0 years, or a range of times during and including any of the foregoing recited periods, after administration of an AAV vector of the disclosure.

[0178] In some embodiments, the disclosed methods for treating GD1 increase white blood cell counts, e.g., from less than 1,900 / μL of blood to higher numbers, such as 1,900 / μL to 2,500 / μL, or 2,500 / μL to 4,000 / μL, or to white blood cell counts greater than 4,000 / μL of blood, in an individual treated GD1 patient or averaged over a population of treated GD1 patients. In some of these embodiments, the GD1 patient was standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patient received standard of care ERT or SRT therapy prior to gene therapy.

[0179] In some embodiments, the treatment methods are effective to increase the white blood cell count per microliter of blood in an individual treated GD1 patient or averaged over a population of treated GD1 patients by at least or about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, 100%, 110% or more of the mean white blood cell count in a healthy human (which in some embodiments ranges from 4,000 / μL to 11,000 / μL of blood). In some embodiments, the normal reference is another value, such as about 4,000 / μL, 4,500 / μL, 5,000 / μL, 5,500 / μL, 6,000 / μL, 6,500 / μL, 7,000 / μL, 7,500 / μL, 8,000 / μL, 8,500 / μL, 9,000 / μL, 9,500 / μL, 10,000 / μL, 10,500 / μL, or 11,000 / μL of blood, or an integer value between or within a range encompassing any of the specifically recited values ​​above. In some of these embodiments, the GD1 patient was standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patient received standard of care ERT or SRT therapy prior to gene therapy.

[0180] In some embodiments, the treatment method provides for an increase in the white blood cell count per microliter of blood in a GD1 patient, either in an individual treated GD1 patient or as an average for a population of treated GD1 patients, of at least or about 1%, 2%, 3%, 4%, or 5% above the baseline white blood cell count before gene therapy or compared to the white blood cell count of a comparable (e.g., age- and sex-matched) control patient with GD1 or other forms of GCase deficiency. , 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110% or more. In some embodiments, the latter control group is standard of care naive or is receiving standard of care ERT or SRT therapy. In some of these embodiments, the GD1 patient was standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patient received standard of care ERT or SRT therapy prior to gene therapy.

[0181] Cellular GCase levels In some embodiments, methods of treating GCase deficiency, including Gaucher disease type 1 (GD1), using the AAV vectors of the present disclosure (including, but not limited to, the vector described herein as AAV3B-GBA clone 128) are effective in increasing the amount and / or enzymatic activity of GCase protein in peripheral blood mononuclear cells (PBMCs), monocytes, total leukocytes, cultured fibroblasts, or other cell types from patients with GD1 or other forms of GCase deficiency. In some embodiments, treatment is continued for up to or at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, or 180 days, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 months, or 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.10, 4.11, 4.12, 4.13, 4.14, 4.15, 4.16, 4.17, or 4.18 months, or 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.10, 2.11, 2.12, 2.13, 2.14, 2.15, 2.16, 2.17, or 2.18 months, or 1.0, 1.1, 1. The present invention is effective in increasing the amount and / or enzymatic activity of GCase protein in peripheral blood mononuclear cells (PBMCs), total leukocytes, cultured fibroblasts, or other cell types from patients with GD1 or other forms of GCase deficiency for a period of 0.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, or 6.0 years, or within any of the aforementioned recited time periods and ranges of time encompassing any of the foregoing. Methods for quantifying the amount or enzymatic activity of GCase protein in PBMCs of healthy humans, serving as subjects or controls, before or after treatment are known in the art. See, e.g., Ysselstein, D, et al., Movement Disorders 36(12):2719-2730 (2021) (DOI: 10.1002 / mds.28815). For example, GCase activity can be detected and quantified using fluorescent substrates, as further described, for example, in DOE:10.1021 / ja5106738 and DOI:10.1021 / ja5106738.

[0182] In some embodiments, the treatment method is effective to increase the amount of GCase protein or enzymatic activity of PMBCs in PMBCs, monocytes, or leukocytes obtained from GD1 patients by at least or about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, 100%, 110% or more of the average amount of GCase in PMBCs, monocytes, or leukocytes obtained from healthy humans, either for an individual treated GD1 patient or on average for a population of treated GD1 patients. In some embodiments, the average amount of GCase in healthy human PBMCs, monocytes, or leukocytes ranges from about 20 to 130 picograms per million PBMCs (pg / 1E6), or an average of about 70 pg / 1E6 cells, or another value, such as about 30, 40, 50, 60, 80, 90, 100, 110, or 120 pg / 1E6 cells, or any integer value between or within any of the specifically recited values ​​above. See, e.g., Berger, J, et al., Intra-monocyte Pharmacokinetics of Imiglucerase Supports a Possible Personalized Management of Gaucher Disease Type 1, Clin Pharmacokinet 58:469-482 (2019) (doi.org / 10.1007 / s40262-018-0708-8). In some of these embodiments, the GD1 patient was standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patient received standard of care ERT or SRT therapy prior to gene therapy.

[0183] In some embodiments, the treatment methods are effective to increase the amount of GCase protein or enzymatic activity of PBMCs, monocytes, or leukocytes obtained from a GD1 patient, either for an individual treated GD1 patient or averaged over a population of treated GD1 patients, by at least or about 25%, 50%, 75%, 100%, 125%, 150%, 175%, 200%, 225%, 250%, 300%, 400%, 500%, 700%, 800%, 900%, 1000% or more over the baseline amount of GCase in PBMCs, monocytes, or leukocytes obtained from the patient prior to gene therapy, or compared to the average amount of GCase in PBMCs, monocytes, or leukocytes of comparable (e.g., age- and sex-matched) control patients with GD1 or other forms of GCase deficiency. In some embodiments, the latter control group is standard-of-care naïve or receives standard-of-care ERT or SRT therapy. In some of these embodiments, the GD1 patient was standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patient received standard of care ERT or SRT therapy prior to gene therapy.

[0184] In some embodiments, the methods are effective to increase the amount of GCase protein in PBMCs, monocytes, or leukocytes obtained from a GD1 patient, either for an individual treated GD1 patient or averaged over a population of treated GD1 patients, by at least or about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 140, 150 pg / 1E6 or more, or a range of integer values ​​encompassing or between any of the foregoing specifically recited values, above the baseline amount of GCase in PBMCs, monocytes, or leukocytes obtained from such patient prior to gene therapy, or compared to the average amount of GCase in PBMCs of comparable (e.g., age- and sex-matched) control patients with GD1 or other forms of GCase deficiency. In some embodiments, the latter control group is standard of care naive or receives standard of care ERT or SRT therapy. In some of these embodiments, the GD1 patients were standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patients received standard of care ERT or SRT therapy prior to gene therapy.

[0185] hepatosplenomegaly In some embodiments, methods of treating GCase deficiency, including Gaucher disease type 1 (GD1), using the AAV vectors of the present disclosure (including, but not limited to, the vector described herein as AAV3B-GBA clone 128) are effective in reducing the incidence, frequency, or severity of increased organ size or volume, particularly of the liver and spleen. Liver or spleen volume can be quantified using imaging techniques such as magnetic resonance imaging (MRI), X-ray computed tomography (CT), or ultrasound. In some embodiments, normal liver size can be defined as 2.5% of total body weight, and hepatomegaly can be defined as an increase in liver volume or mass (estimated from volume) greater than 1.25 times the normal value (N). In some embodiments, normal spleen size can be defined as 0.2% of total body weight, and splenomegaly can be defined as an increase in spleen volume or mass (estimated from volume) greater than 1 times the normal value (N). In some embodiments, the treatment is effective to reduce the frequency or degree of liver or spleen enlargement in a GD1 patient for up to, or at least about, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, or 180 days, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 months, or 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, or 6.0 years, or a range of times during and including any of the foregoing recited periods, after administration of an AAV vector of the disclosure.

[0186] In some embodiments, the disclosed methods for treating GD1 can reduce liver volume, for example, from a volume greater than 2.5 times (or a multiple of) normal (>2.5 MN) to a volume between 1.25 MN and 2.5 MN, or to a volume less than 1.25 MN (considered non-hepatomegaly), in an individual treated GD1 patient or averaged over a population of treated GD1 patients. In some embodiments, the treatment method reduces liver volume to or below 4.0, 3.9, 3.8, 3.7, 3.6, 3.5, 3.4, 3.3, 3.2, 3.1, 3.0, 2.9, 2.8, 2.7, 2.6, 2.5, 2.4, 2.3, 2.2, 2.1, 2.0, 1.9, 1.8, 1.7, 1.6, 1.5, 1.4, 1.3, 1.2, 1.1, 1.0, 0.9, 0.8, 0.7 MN in an individual treated GD1 patient or averaged over a population of treated GD1 patients. or to a volume value of about 4.0, 3.9, 3.8, 3.7, 3.6, 3.5, 3.4, 3.3, 3.2, 3.1, 3.0, 2.9, 2.8, 2.7, 2.6, 2.5, 2.4, 2.3, 2.2, 2.1, 2.0, 1.9, 1.8, 1.7, 1.6, 1.5, 1.4, 1.3, 1.2, 1.1, 1.0, 0.9, 0.8, 0.7 MN or less, or to a range of or integer values ​​therebetween encompassing any of the foregoing specifically recited values. In some of these embodiments, the GD1 patient was standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patient received standard of care ERT or SRT therapy prior to gene therapy.

[0187] In some embodiments, the treatment methods are effective to reduce the liver volume of a GD1 patient by at least or about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 50% or more compared to the liver volume before gene therapy or compared to the liver volume of a comparable (e.g., age- and sex-matched) control patient with GD1 or other forms of GCase deficiency, either in an individual GD1 patient treated or as an average for a population of treated GD1 patients. In some embodiments, the latter control group is standard of care naive or undergoing standard of care ERT or SRT therapy. In some non-limiting embodiments, the liver size of standard of care naive GD1 patients or GD1 patients undergoing standard of care ERT or SRT therapy is in the range of about 0.8-6 MN, or 1-5 MN, or 1.5-5 MN, or another value, such as 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, or 5.0 MN, or an integer value between or including any of the specifically recited values ​​above. In some of these embodiments, the GD1 patients were standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patients were undergoing standard of care ERT or SRT therapy prior to gene therapy. In other embodiments, the disclosed methods for treating GD1 can reduce the frequency or severity of liver pathologies, including liver fibrosis or portal hypertension.

[0188] In some embodiments, the disclosed methods for treating GD1 can reduce spleen volume, e.g., from a volume greater than 15 times (or multiples of) normal (>15 MN) to a volume of 10 MN to 15 MN, or 5 MN to 9 MN, or to a volume less than 5 MN, in an individual treated GD1 patient or averaged over a population of treated GD1 patients.In some embodiments, the treatment method reduces spleen volume by 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18.5, 18.0, 17.5, 17.0, 16.5, 16.0, 15.5, 15.0, 14.5, 14.0, 13.5, 13.0, 12.0, 14.5, 14.0, 15.5, 15.0, 15.5, 15.0, 16.5, 16.0, 16.5, 16.0, 17.5, 17 ... 0.5, 12.0, 11.5, 11.0, 10.5, 10.0, 9.5, 9.0, 8.5, 8.0, 7.5, 7.0, 6.5, 6.0, 5.5, 5.0, 4.5, 4.0, 4.0, 3.9, 3.8, 3.7, 3.6, 3.5, 3.4, 3.3, 3.2, 3.1, 3.0, 2.9, 2.8, 2.7, 2.6, 2.5, 2.4, 2.3, 2.2, 2.1, 2.0, 1.9, 1.8, 1.7, 1.6, 1.5, 1.4, 1.3, 1.2, 1.1, 1.0, 0.9, 0.8, 0.7MN or less , or about 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18.5, 18.0, 17.5, 17.0, 16.5, 16.0, 15.5, 15.0, 14.5, 14.0, 13.5, 13.0, 12.5, 12.0, 11.5, 11.0, 10.5, 10.0, 9.5, 9.0, 8.5, 8.0, 7.5, 7.0, 6.5, 6.0, 5 1.9, 1.8, 1.7, 1.6, 1.5, 1.4, 1.3, 1.2, 1.1, 1.0, 0.9, 0.8, 0.7 MN or less, or a range of integer values ​​therebetween or including any of the foregoing specifically recited values. In some of these embodiments, the GD1 patient was standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patient received standard of care ERT or SRT therapy prior to gene therapy.

[0189] In some embodiments, the treatment method provides for an improvement in spleen volume in a GD1 patient by at least or about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, or 9% compared to the spleen volume before gene therapy or compared to the spleen volume of a comparable (e.g., age- and sex-matched) control patient with GD1 or other forms of GCase deficiency, either in an individual GD1 patient treated or as an average for a population of treated GD1 patients. , 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80% or more reduction. In some embodiments, the latter control group is standard of care naive or is receiving standard of care ERT or SRT therapy. In some non-limiting embodiments, the spleen size of a standard of care naive GD1 patient or a GD1 patient receiving standard of care ERT or SRT therapy ranges from about 0.8 to 60 MN, or 1 to 50 MN, or 5 to 50 MN, or another value, such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, or 50 MN, or an integer value between or including any of the foregoing specifically recited values. In some of these embodiments, the GD1 patient was standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patient received standard of care ERT or SRT therapy prior to gene therapy. In other embodiments, the disclosed methods of treating GD1 may reduce the frequency or extent of lesions in the spleen detectable using imaging such as MRI or ultrasound, or may reduce the frequency of splenectomy in a population of treated GD1 patients compared to treatment-naive GD1 patients.

[0190] Bone findings In some embodiments, methods of treating GCase deficiency, including Gaucher disease type 1 (GD1), using the AAV vectors of the present disclosure (including, but not limited to, the vector described herein as AAV3B-GBA clone 128) are effective in reducing the incidence, frequency, or severity of bone manifestations of the disease process, including bone crisis, bone pain, bone marrow infiltration by Gaucher cells, loss of bone mineral density, and the development of lytic lesions, fractures, and avascular necrosis. In some embodiments, the treatment is effective to reduce the frequency or severity of bone findings during the progression of disease in a GD1 patient for up to, or at least about, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, or 180 days, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 months, or 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, or 6.0 years, or a range of times during and including any of the foregoing recited periods, after administration of an AAV vector of the disclosure.

[0191] Bone crisis in GD1 often presents as a sudden onset of intense pain accompanied by swelling and erythema, fever, and leukocytosis, often followed by severe bone damage, fracture, and potentially secondary osteoarthritis. In some embodiments, the disclosed methods for treating GD1 reduce the frequency of bone crisis over a 12-month period, for example, from two or more bone crisis events to one to zero in a 12-month period, in an individual treated GD1 patient or averaged over a population of treated GD1 patients. In some of these embodiments, the GD1 patient was standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patient received standard of care ERT or SRT therapy prior to gene therapy.

[0192] Even in the absence of a bone crisis, GD1 patients often experience bone pain ranging from mild to severe. In some embodiments, the disclosed methods for treating GD1 reduce the maximum pain experienced over a 30-day period, either in an individual treated GD1 patient or averaged over a population of treated GD1 patients, from extreme to severe, moderate to mild, very mild, or no pain, or from severe to moderate to mild, very mild, or no pain, or from moderate to mild, very mild, or no pain, or from mild to very mild, or no pain, or from very mild to no pain. In some of these embodiments, the GD1 patient was standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patient received standard of care ERT or SRT therapy prior to gene therapy. The maximum pain experienced by a GD1 patient over a 30-day period can be assessed using a standard pain scale.

[0193] One tissue space infiltrated by Gaucher cells is the bone marrow, whose burden can be quantified using methods standard in the art, such as magnetic resonance imaging or scintigraphy. In some embodiments, the disclosed methods for treating GD1 reduce the frequency or extent of bone marrow infiltration by Gaucher cells, as determined using one or more standard scoring systems, in an individual treated GD1 patient or as an average for a population of treated GD1 patients. Thus, for example, treating a GD1 patient with an AAV vector of the disclosure may, in some embodiments, reduce bone marrow infiltration on the Rosenthal scale from a score of greater than 7, such as 8-11, to a lower value, such as 4-7 or 1-3, or a value of 0. In other embodiments, treatment reduces bone marrow infiltration on the Dusseldorf scale from a score of greater than 6, such as 7 or 8, to a lower value, such as 4-6, 1-3, or 0. In other embodiments, treatment reduces bone marrow infiltration on the Terk scale from a score of greater than 2a / b, such as 3a / b, to a lower value, such as 2a / b, or a value of 1a / b or 0. In other embodiments, treatment reduces bone marrow involvement on the Vertebral Disc Ratio (VDR) scale from a score below 1.0 to a higher value, such as 1.0-1.5, or 1.5-2.0 or greater than 2.0. In other embodiments, treatment reduces bone marrow involvement on the Bone Marrow Burden (BMB) scale from a score above 12, such as 13-16, to a lower value, such as 8-12, 3-7, or 0-2. In other embodiments, treatment reduces bone marrow involvement on the Quantitative Chemical Shift Index (QCSI) fat fraction scale from a score below 0.20 to a higher value, such as 0.20-0.25, or 0.25-0.30, or greater than 0.30. In other embodiments, treatment reduces bone marrow involvement on the Spanish MRI scale from a score above 17, such as 18-24, to a lower value, such as 11-17, or 5-10, or 0-4. In other embodiments, treatment reduces bone marrow involvement on the Spanish MRI scale from a score above 17, such as 18-24, to a lower value, such as 11-17, or 5-10, or 0-4. 99m In another embodiment, treatment results in a decrease in bone marrow infiltration on the Tc-sestamibi scale from a score of greater than 6, such as 7-8, to a lower value, such as 5-6, 3-4, or 0-2, compared to a normal scintigraphic pattern. 99mTc-radioactive colloid scale bone marrow infiltration is reduced from severe to moderate, mild to normal, or moderate to mild to normal, or mild to normal. In some of these embodiments, the GD1 patient was standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patient received standard of care ERT or SRT therapy prior to gene therapy. Further information regarding bone marrow infiltration scoring scales can be found, for example, in Rosenthal DI, et al., J Bone Joint Surg Am 68:802-8 (1986); Poll LW, et al., Skeletal Radiol 9:496-503 (2001); Terk MR, et al., Skeletal Radiol 29:563-71 (2000); Vlieger EJ, et al., J Comput Assist Tomogr 26:843-8 (2002); Maas M, et al., Radiology 229:554-61 (2003); Poll LW, et al., Blood Cells Mol Dis 28:209-20 (2002).

[0194] Decreased bone mineral density (BMD), another bone manifestation of Gaucher disease, can be at least partially reversed by treatment with the disclosed AAV vectors, as quantified using techniques such as dual-energy X-ray absorptiometry (DEXA) and expressed as a T-score or Z-score (reflecting the standard deviation of BMD compared to the mean or age- and sex-matched controls, respectively, for young adults). Thus, for example, in some embodiments, the disclosed GD1 treatment methods can increase the Z-score, either in an individual treated GD1 patient or as an average across a population of treated GD1 patients, from a value below -1.5 to a value greater than -1.5, such as between -1.5 and -1.0, or between -1.0 and 0.0, or between 0.0 and +1.0. Alternatively, in some other embodiments, the disclosed methods of treating GD1 can increase T-scores, either in an individual treated GD1 patient or averaged over a population of treated GD1 patients, from less than -2.5 to greater than -2.5, such as between -2.5 and -1.0, or between -1.0 and 0.0, or greater than 0.0. In some of these embodiments, the GD1 patient was standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patient received standard of care ERT or SRT therapy prior to gene therapy.

[0195] In other embodiments, treatment of GD1 patients with the AAV vectors of the present disclosure is effective in reducing the frequency or severity of other bone manifestations of the disease process, including osteonecrosis, osteolysis, avascular osteonecrosis, medullary infarction, permanent deformation due to vertebral compression fractures, secondary arthropathy, development of Erlenmeyer flask deformity, reduced consumption of opioid and non-opioid analgesics, the need for joint replacement, and growth retardation in children (e.g., duration of growth below the 5th percentile), in individual treated GD1 patients or averaged over a population of treated GD1 patients. In some of these embodiments, the GD1 patients were standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patients received standard of care ERT or SRT therapy prior to gene therapy.

[0196] Tissue and plasma biomarkers Metabolic abnormalities caused by Gaucher disease, or more broadly, GCase deficiency, can result in significant increases in certain proteins and glycolipids in cells and tissues or the bloodstream. Some of these products are overexpressed by Gaucher cells, and some are by-products of incomplete degradation of GlcCer in lysosomes due to lack of GCase activity. After treating GD1 patients with either standard therapy or gene therapy, reduced levels of these products and by-products may be observed and may serve as biomarkers indicative of therapeutic efficacy. Thus, in some embodiments, methods of treating GCase deficiency, including Gaucher disease type 1 (GD1), using AAV vectors of the present disclosure (including, but not limited to, the vector described herein as AAV3B-GBA clone 128) are effective in reducing elevated biomarker levels in subjects with GD1 or GCase deficiency more broadly. In some embodiments, quantifying changes in biomarker levels in subjects after treatment with AAV vectors of the present disclosure indicates the extent of therapeutic efficacy.

[0197] Metabolic by-products containing glucosylsphingosine As a result of therapeutic GCase deficiency, as in GD1, cellular levels of GlcCer increase, become available as a substrate for other enzymes, and produce toxic by-products, levels of which can be reduced following the methods disclosed herein. For example, increased assimilation of GlcCer by glycosyltransferases can produce complex gangliosides, including GM3, which can be detected in the plasma and spleen of GD1 patients. See, e.g., DOI: 10.1016 / j.cca.2007.12.001. The enzyme β-glucosidase (GBA2) also acts on GlcCer to increase levels of the pro-apoptotic molecule Cer and transfer glucose from GlcCer to cholesterol to generate glycosyl-β-cholesterol (GlcChol). See, e.g., DOI:10.1194 / jlr.M064923; DOI:10.1016 / j.cbpa.2019.10.006. Furthermore, it has been reported that GlcCer, which accumulates in lysosomes, is converted by lysosomal acid ceramidase to its sphingoid base, glucosylsphingosine (GlcSph; also known as lyso-GL1, lyso-GB1, glucosphingosine, sphingosyl β-glucoside, and glucospsychosine), which can result in an average 200-fold increase in plasma levels of the by-product in symptomatic, untreated GD1 patients. See, e.g., DOI:10.1002 / 1873-3468.12104; DOI:10.1182 / blood-2011-05-352971. Methods for quantifying levels of GM3, Cer, GlcChol and GlcSph in plasma, serum or tissue samples from subjects before or after treatment or from healthy humans serving as controls are also known in the art.For example, methods for detecting and quantifying GlcSph using LC / MS-MS assays are described in Rolfs, A, et al., PLOS One 8(11):e79732(2013); Murugesan, V, et al., Am. J. Hematol. 91:1082-1089(2016)(DOI:10.1002 / ajh.24491); Beasley, J, et al., Clinica Chimica Acta 511:132-137(2020)(doi.org / 10.1016 / j.cca.2020.10.007); Stiles, AR, et al., Mol Genetics Metabol Rep 27:100729(2021)(doi.org / 10.1016 / j.ymgmr.2021.100729). In some embodiments, glucosylsphingosine concentration can be expressed in units of nanograms per milliliter (ng / mL) of plasma, serum, or homogenized tissue sample.

[0198] In some embodiments, methods of treating GCase deficiency, including GD1, using an AAV vector of the present disclosure (including, but not limited to, the vector described herein as AAV3B-GBA clone 128) are effective in reducing the amount of by-products produced from GlcCer, including GM3, Cer, GlcChol, or glucosylsphingosine, in serum, plasma, or homogenized tissue samples obtained from patients with GD1 or other forms of GCase deficiency. In some embodiments, treatment reduces the amount of GM3, Cer, GlcChol, or glucosylsphingosine in serum, plasma, or homogenized tissue samples obtained from the treated patient by at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 210, 220, 230, 240, 250, 260, 270, 280, 290, 310, 320, 330, 340, 350, 360, 370, 380, 390, 410, 420, 430, 440, 450, 460, 470, 480, 490, 510, 520, 530, 540, 550, 560, 570, 580, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 7 , 160, 170 or 180 days, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 or 18 months, or 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5 or 6.0 years, or within a period of time during and including any of the foregoing recited periods.

[0199] In some embodiments, the treatment methods are effective to reduce the amount of GM3, Cer, or GlcChol in serum, plasma, or homogenized tissue samples obtained from GD1 patients by at least or about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, in an individual treated GD1 patient or averaged over a population of treated GD1 patients, compared to the average amount of GM3, Cer, or GlcChol in serum, plasma, or homogenized tissue samples obtained from such patients prior to gene therapy, or compared to the average amount of GM3, Cer, or GlcChol in serum, plasma, or homogenized tissue samples of comparable (e.g., age- and sex-matched) control patients with GD1 or other forms of GCase deficiency. In some embodiments, the latter control group is standard of care naive or receives standard of care ERT or SRT therapy. In some of these embodiments, the GD1 patients were standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patients received standard of care ERT or SRT therapy prior to gene therapy.

[0200] In some embodiments, the treatment methods are effective to reduce the amount of glucosylsphingosine in serum, plasma, or homogenized tissue samples obtained from GD1 patients by at least or about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, in an individual treated GD1 patient or averaged over a population of treated GD1 patients, compared to the average amount of glucosylsphingosine in serum, plasma, or homogenized tissue samples obtained from such patients prior to gene therapy, or compared to the average amount of glucosylsphingosine in serum, plasma, or homogenized tissue samples of comparable (e.g., age- and sex-matched) control patients with GD1 or other forms of GCase deficiency. In some embodiments, the latter control group is standard of care naive or undergoing standard of care ERT or SRT therapy. In some embodiments, the amount of glucosylsphingosine present in serum, plasma, or homogenized tissue samples from standard of care naive GD1 patients or GD1 patients undergoing standard of care ERT or SRT therapy is in the range of about 3 ng / mL to 1000 ng / mL, 4 ng / mL to 600 ng / mL, 10 ng / mL to 500 ng / mL, 20 ng / mL to 400 ng / mL, 50 ng / mL to 300 ng / mL, 100 ng / mL to 300 ng / mL, or 140 ng / mL to 220 ng / mL, or an average of about 180 ng / mL, or about 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 320, 325, 340, 350, 360, 375, 380, 400, 425, 440, 450, 460, 475, 48 or another value such as 0, 500, 525, 540, 550, 560, 575, 580, 600, 650, 700, 750, 800, 850, 900, 950, 1,000, 1,500, or 2,000 ng / mL, or a range of integer values ​​therebetween or including any of the specifically recited values ​​above.In some of these embodiments, the GD1 patient was standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patient received standard of care ERT or SRT therapy prior to gene therapy.

[0201] In some embodiments, the treatment method includes increasing the amount of glucosylsphingosine in serum, plasma, or homogenized tissue samples obtained from GD1 patients to 1,500, 1,000, 900, 800, 750, 700, 650, 600, 550, 500, 450, 400, 350, 300, 250, 240, 250, 300, 350, 300, 450, 400, 550, 500, 650, 600, 750, 700, 850, 900, 950, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 3000, 3500, 3000, 3600, 3700, 4000, 4500, 4000, 5500, 5000, 6500, 6000, 7500, 8000, 9500, 10000, 12000, 14000, 15000, 16000, 17000, 18000, 19000, 20000, 21000, 22000, 24000, 25000, 26000, 27000, 280 30, 225, 220, 215, 210, 205, 200, 195, 190, 185, 180, 175, 170, 165, 160, 155, 150, 145, 140, 135, 130, 125, 120, 115, 110, 105, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1.5 or 1 ng / mL serum, plasma or homogenized tissue sample at or below about 1,500, 1,000, 900, 800, 750, 700, 650, 600, 550, 500, 450, 400, 350, 300, 250, 240, 230, 225, 220, 215, 210, 205, 200, 195, 190, 185, 180, 175, 170, 165, 160, 155, 150, 145 , 140, 135, 130, 125, 120, 115, 110, 105, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1.5, or 1 ng / mL or less, or to a range or integer value therebetween encompassing any of the foregoing specifically recited values. In some of these embodiments, the GD1 patient was standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patient received standard of care ERT or SRT therapy prior to gene therapy.

[0202] Chitotriosidase Among the proteins overexpressed by Gaucher cells in GD1 and secreted into the circulation is the enzyme chitotriosidase, the elevated levels of which serve as a biomarker for Gaucher disease. Chitotriosidase activity can reportedly be elevated by an average of 1,000-fold in the plasma of symptomatic, untreated GD1 patients. Methods for quantifying the level of chitotriosidase activity in plasma, serum, or tissue samples from subjects before or after treatment, or from healthy individuals serving as controls, are also known in the art, such as by measuring the amount of fluorescence produced by enzymatic cleavage of specific artificial fluorescent substrates, such as 4-methylumbelliferyl chitotrioside, 4'-deoxy-chitobiose-4-methylumbelliferone, 4-methylumbelliferyl-β-D-triacetylchitotriosidase, or others known in the art. For more information regarding this biomarker, see, e.g., DOI:10.1172 / JCI117084; DOI:10.1016 / S0074-7696(06)52001-7; DOI:10.1074 / jbc.M301804200; DOI:10.1016 / j.cbpa.2019.10.006; DOI:10.1007 / s10545-014-9711-x. In some embodiments, chitotriosidase activity can be expressed in units of mass per volume of fluorogenic substrate cleaved per hour or nanomoles per milliliter per hour (nmol / mL / hr).

[0203] In some embodiments, methods of treating GCase deficiency, including Gaucher disease type 1 (GD1), using the AAV vectors of the present disclosure (including, but not limited to, the vector described herein as AAV3B-GBA clone 128) are effective in reducing the amount and / or enzymatic activity of chitotriosidase protein in serum or plasma obtained from patients with GD1 or other forms of GCase deficiency. In some embodiments, the treatment is effective to reduce the amount and / or enzymatic activity of chitotriosidase protein in serum or plasma obtained from the treated patient for up to or at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, or 180 days, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 months, or 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, or 6.0 years, or a range of time periods during and including any of the foregoing recited periods, after administration of an AAV vector of the present disclosure.

[0204] In some embodiments, the disclosed methods for treating GD1 can reduce the amount of chitotriosidase enzyme activity in serum or plasma, e.g., from greater than 15,000 nmol / mL / hour to a lower value, such as 4,000-15,000 nmol / mL / hour or 600-4,000 nmol / mL / hour, or to a value less than 600 nmol / mL / hour, in an individual treated GD1 patient or averaged over a population of treated GD1 patients. In some of these embodiments, the GD1 patient was standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patient received standard of care ERT or SRT therapy prior to gene therapy.

[0205] In some embodiments, the treatment method is effective to reduce the amount of chitotriosidase enzyme activity in serum or plasma obtained from GD1 patients, either in an individual treated GD1 patient or averaged over a population of treated GD1 patients, by at least or about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, compared to the average amount of chitotriosidase enzyme activity in serum or plasma obtained from such patients prior to gene therapy, or compared to the average amount of chitotriosidase enzyme activity in serum or plasma of comparable (e.g., age- and sex-matched) control patients with GD1 or other forms of GCase deficiency. In some embodiments, the latter control group is standard-of-care naive or receives standard-of-care ERT or SRT therapy. In some embodiments, the amount of chitotriosidase enzyme activity in serum or plasma from standard of care treatment-naive GD1 patients or GD1 patients receiving standard of care ERT or SRT therapy is in the range of about 200 to 100,000 nmol / mL / hour, 400 to 80,000 nmol / mL / hour, 1,000 to 50,000 nmol / mL / hour, 2,000 to 40,000 nmol / mL / hour, 4,000 to 20,000 nmol / mL / hour, or 5,000 to 15,000 nmol / mL / hour, or is in the range of about 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 4000, 4100, 4200, 4300, 4400, 4500, 4600, 4700, 4800, 5000, 5100, 5200, 5300, 5400, 5500, 5600, 5700, 5800, 5900, 6000, 6100, The value may be another value such as 00, 900, 1,000, 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 11,000, 12,000, 13,000, 14,000, 15,000, 16,000, 17,000, 18,000, 19,000, 20,000, 25,000, 30,000, 40,000, 50,000, 60,000, 70,000 or 80,000 nmol / mL / hr, or a range of integer values ​​therebetween that encompasses or is an integer value between any of the foregoing specifically recited values.In some of these embodiments, the GD1 patient was standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patient received standard of care ERT or SRT therapy prior to gene therapy.

[0206] In some embodiments, the treatment method comprises increasing the amount of chitotriosidase enzyme activity in serum or plasma obtained from GD1 patients to 25,000, 20,000, 19,000, 18,000, 17,000, 16,000, 15,000, 14,000, 13,000, 12,000, 11,000, 10,000, 9,000, 8,000, 7,000, 6,000, 5,000, 4,000, 3,000, 2,000, 1,000, 900, 800, 700, 600, 500, 400, 300, 200, 100n ... The present invention is effective to reduce the blood glucose concentration to or below about 25,000, 20,000, 19,000, 18,000, 17,000, 16,000, 15,000, 14,000, 13,000, 12,000, 11,000, 10,000, 9,000, 8,000, 7,000, 6,000, 5,000, 4,000, 3,000, 2,000, 1,000, 900, 800, 700, 600, 500, 400, 300, 200, 100 nmol / mL / hour or less, or to a range or integer value therebetween including any of the foregoing specifically recited values. In some of these embodiments, the GD1 patient was standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patient received standard of care ERT or SRT therapy prior to gene therapy.

[0207] CCL18-PARC Another biomarker protein produced and secreted by Gaucher cells is the chemokine CCL18 / PARC (chemokine (C-C motif) ligand 18; lung and activation-regulated chemokine), which can be increased 20- to 50-fold in the plasma of symptomatic, untreated GD1 patients. Methods for quantifying levels of CCL18 / PARC in plasma, serum, or tissue samples from pre- or post-treatment subjects or healthy humans serving as controls (e.g., by ELISA using specific antibodies against the protein) are also known in the art. For more information regarding this biomarker, see, e.g., DOI:10.1016 / j.bbalip.2013.11.004; DOI:10.1182 / blood-2003-05-1612.

[0208] In some embodiments, methods of treating GCase deficiency, including Gaucher disease type 1 (GD1), using AAV vectors of the present disclosure (including, but not limited to, the vector described herein as AAV3B-GBA clone 128) are effective in reducing the amount of CCL18 in serum or plasma obtained from patients with GD1 or other forms of GCase deficiency. In some embodiments, the treatment is effective to reduce the amount of CCL18 in serum or plasma obtained from the treated patient for up to or at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, or 180 days, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 months, or 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, or 6.0 years, or a range of time periods during or including any of the foregoing recited periods, after administration of an AAV vector of the disclosure.

[0209] In some embodiments, the disclosed methods for treating GD1 can reduce the amount of CCL18 in serum or plasma, e.g., from greater than 1,000 ng / mL to a lower value, such as 237-1,000 ng / mL or 72-237 ng / mL, or to a value less than 72 ng / mL serum or plasma, in an individual treated GD1 patient or averaged over a population of treated GD1 patients. In some of these embodiments, the GD1 patient was standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patient received standard of care ERT or SRT therapy prior to gene therapy.

[0210] In some embodiments, the treatment methods are effective to reduce the amount of CCL18 in serum or plasma obtained from GD1 patients, either in an individual treated GD1 patient or averaged over a population of treated GD1 patients, by at least or about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, compared to the average amount of CCL18 in serum or plasma obtained from such patients prior to gene therapy, or compared to the average amount of CCL18 in serum or plasma of comparable (e.g., age- and sex-matched) control patients with GD1 or other forms of GCase deficiency. In some embodiments, the latter control group is standard-of-care naive or receives standard-of-care ERT or SRT therapy. In some embodiments, the amount of CCL18 in serum or plasma from a standard of care treatment-naive GD1 patient or a GD1 patient receiving standard of care ERT or SRT therapy is in the range of about 40-1,500 ng / mL, 100-1,200 ng / mL, 200-1,000 ng / mL, or 400-800 ng / mL, or is in the range of about 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 410, 420, 430, 440, 450, 460, 470, 480, 490, 510, 520, 530, 540, 550, 560, 570, 580, 590, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 8 , 240, 250, 260, 270, 280, 290, 300, 320, 325, 340, 350, 360, 375, 380, 400, 425, 440, 450, 460, 475, 480, 500, 525, 540, 550, 560, 575, 580, 600, 650, 700, 750, 800, 850, 900, 950, 1,000, 1,100, 1,200, 1,300, 1,400 or 1,500 ng / mL, or a range of integer values ​​encompassing or therebetween any of the specifically recited values ​​above. In some of these embodiments, the GD1 patient was standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patient received standard of care ERT or SRT therapy prior to gene therapy.

[0211] In some embodiments, the treatment method includes increasing the amount of CCL18 in serum or plasma obtained from GD1 patients to 1,500, 1,400, 1,300, 1,200, 1,100, 1,000, 950, 900, 850, 800, 750, 700, 650, 600, 550, 500, 450, 400, 350, 325, 300, 450, 400, 550, 500, 500, 650, 600, 750, 700, 750, 800, 850, 800, 950, 9 ... , 275, 250, 240, 230, 225, 220, 215, 210, 205, 200, 195, 190, 185, 180, 175, 170, 165, 160, 155, 150, 145, 140, 13 5,130,125,120,115,110,105,100,95,90,85,80,75,70,65,60,55,50,45,40,35,30,25,20,15,10,5ng / mL serum or plasma at or below about 1,500, 1,400, 1,300, 1,200, 1,100, 1,000, 950, 900, 850, 800, 750, 700, 650, 600, 550, 500, 450, 400, 350, 325, 300, 275, 250, 240, 230, 225, 220, 215, 210, 205, 200, 195, 190, 185, 180, 175, 170, 165, In some of these embodiments, the GD1 patient is standard of care naive prior to gene therapy as described herein, while in other embodiments, the GD1 patient is receiving standard of care ERT or SRT therapy prior to gene therapy.

[0212] Gaucher Disease Severity Score In some embodiments, methods of treating Gaucher disease type 1 (GD1) using the AAV vectors of the present disclosure (including but not limited to the vector described herein as AAV3B-GBA clone 128) are effective in reducing the severity of Gaucher disease in an individual treated GD1 patient or as an average for a population of treated GD1 patients, as measured using several Gaucher disease severity score indices known in the art. For example, in some embodiments, the methods of treating Gaucher disease disclosed herein include a method for determining the severity of Gaucher disease using the Zimran Severity Score Index (SSI) (described in DOI: 10.1016 / s0140-6736(89)90536-9 and Zimran A, et al., Gaucher disease. Clinical, laboratory, radiologic, and genetic features of 53 patients. Medicine 71:337-353 (1992)); the Gaucher Disease Severity Score Index for Type I Patients (GauSS-I) by Di Rocco et al. (described in DOI: 10.3324 / haematol.12379); or the Gaucher Disease Type I Severity Scoring System (GD-DS3) by Weinreb et al. (Weinreb, NJ, et al., Genetics Med 12(1):44-51 (2010) (other severity scoring indices may also be used), are effective in reducing the severity of Gaucher disease. In some embodiments, the treatment is effective in reducing the severity of Gaucher disease as measured using the GD1 Patient Gaucher Disease Severity Score Index for up to or at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, or 180 days, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 months, or 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, or 6.0 years, or a range of times during and including any of the foregoing recited periods, after administration of an AAV vector of the disclosure.

[0213] In some embodiments, the methods of treating Gaucher disease disclosed herein are effective to reduce the severity of Gaucher disease as determined using the Zimran Score Index (SSI) from severe to moderate or mild, or from moderate to mild, or to reduce the severity score using the same index from an integer value in the range of 26-51 points to a lower value such as 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0, or from an integer value in the range of 11-25 points to a lower value such as 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0 points. For example, in some embodiments, the methods of treating Gaucher disease disclosed herein are effective in reducing the severity of Gaucher disease, as determined using the Di Rocco GauSS-I scoring index, from an integer value in the range of 1 to 42 points to a lower value, such as 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0 points. In some embodiments, the methods of treating Gaucher disease disclosed herein are effective to reduce the severity of Gaucher disease as determined using the Weinreb GD-DS3 scoring index from severe to marked, moderate, mild, or borderline, or from marked to moderate, mild, or borderline, or from moderate to mild or borderline, or from mild to borderline, or to reduce the severity score using the same index from an integer value in the range of 10 to 19 points to a lower value such as 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0, or from an integer value in the range of 6 to 9 points to a lower value such as 8, 7, 6, 5, 4, 3, 2, 1, or 0, or from an integer value in the range of 3 to 6 points to a lower value such as 5, 4, 3, 2, 1, or 0, or from a value of 3 to 2, 1, or 0, or from a value of 2 to 1 or 0, or from a value of 1 to 0.

[0214] Other beneficial therapeutic effects In other embodiments, treatment of GD1 patients with the disclosed AAV vectors (including, but not limited to, the vector described herein as AAV3B-GBA clone 128) is effective in reducing the frequency or severity of other manifestations of the Gaucher disease process, including endocrine and metabolic disorders, neurological symptoms, and other symptoms, in individual treated GD1 patients or averaged over a population of treated GD1 patients. Thus, in some embodiments, the methods of treating GD1 disclosed herein are effective in reducing the incidence of anorexia, low body weight, elevated basal liver glucose, type 2 diabetes, low levels of high-density lipoprotein cholesterol, peripheral neuropathy, increased risk of developing Parkinson's disease, increased risk of multiple myeloma and non-myeloma, pulmonary infiltration by Gaucher cells and associated pulmonary fibrosis, restrictive lung disease associated with spinal deformity, pulmonary arterial hypertension, respiratory failure, renal glomerular infiltration by Gaucher cells and associated proteinuria and hematuria, yellow-brown hyperpigmentation due to skin complications, ocular symptoms, and myocardial or heart valve complications.

[0215] Prevention methods Among other embodiments, the present disclosure provides methods for preventing Gaucher disease, including type 1 Gaucher disease (GD1), or other types of GCase deficiency, by administering to a subject (such as a human subject) in need thereof a prophylactically effective amount of an AAV vector of the present disclosure (including, but not limited to, the vector described herein as AAV3B-GBA clone 128) or a pharmaceutical composition containing such an AAV vector. Also provided is the use of an AAV vector of the present disclosure in the manufacture of a medicament for use in the prophylactic methods disclosed herein. Additionally, provided is an AAV vector of the present disclosure or a pharmaceutical composition containing such an AAV vector for use in the prophylactic methods disclosed herein.

[0216] In some embodiments, administering to a subject a prophylactically effective amount of an AAV vector of the present disclosure (including, but not limited to, the vector described herein as AAV3B-GBA clone 128) or a pharmaceutical composition containing such an AAV vector is effective for preventing the onset or development of Gaucher disease in the subject; effective for preventing the onset or development of any deleterious effects of GCase deficiency in the subject; effective for preventing the onset or development of a decrease in the amount of GCase activity in the subject; effective for preventing the onset or development of at least one symptom or sign associated with Gaucher disease or GCase deficiency in the subject; effective for preventing the onset or development of at least one disorder or dysfunction of the body, organ, tissue or cell caused by Gaucher disease or GCase deficiency in the subject; and effective for preventing a decrease in quality of life caused by Gaucher disease or GCase deficiency in the subject that would have occurred in the absence of the prevention.

[0217] In some embodiments of the prevention methods described herein, the subject is a human subject with a homozygous or heterozygous deleterious mutation in the GBA gene, the presence of which is determined by genotyping prior to the onset of detectable symptoms or signs of Gaucher disease or other symptoms or signs associated with GCase deficiency. Methods of genotyping, such as RFLP analysis or gene or genome sequencing, are well known to those skilled in the art.

[0218] AAV vector composition, formulation, administration method, and dosage In addition to AAV vectors, the present disclosure provides compositions comprising such vectors and at least one pharmaceutically acceptable excipient, diluent, or carrier. Such vectors can be used, inter alia, in the methods of preventing and treating GD1, also described herein.

[0219] Compositions containing the AAV vectors of the present invention can be provided in aqueous solutions or other forms, such as suspensions, emulsions, and lyophilized cakes. The vector compositions can be formulated using any appropriate diluents and excipients necessary to achieve desired properties, such as pH, ionic strength, tonicity, stability, shelf life, resistance to freeze-thaw cycles, and lyophilization capacity, taking into account the method of administration. Exemplary diluents and carriers include, but are not limited to, sterile water for injection, ethanol, and glycerol. Exemplary excipients include, but are not limited to, salts, buffers, acids, bases, surfactants, sugars, sugar alcohols, and many others known in the art. Compositions containing the AAV vectors of the present disclosure for use in preventing or treating a disease or disorder in a subject, such as GD1, can be packaged in any suitable form, such as vials or pre-filled syringes. In some embodiments, kits are provided containing multiple vials containing a total amount of vector sufficient to achieve the desired total dose delivered to a particular subject, based on relevant variables such as the subject's disease severity, weight, and gender.

[0220] Compositions comprising the AAV vectors of the present disclosure can be administered by any suitable route of administration, non-limiting examples of which include systemic administration, direct administration to a tissue or organ, intravenous administration, intra-arterial administration, intralymphatic administration, intraperitoneal administration, intramuscular administration, intraparenchymal administration, intrathecal administration, intraventricular administration, or intracisternal administration, among others. In some embodiments, for example, when it is desired to preferentially target an AAV vector to the liver, a composition comprising such a vector can be administered into the portal vein.

[0221] Compositions comprising the AAV vectors of the present disclosure can be administered alone without other types of treatment, or can be administered simultaneously, contemporaneously, or at any suitable interval with standard of care treatment or other agents, compounds, drugs, treatments, or therapeutic regimens. In some embodiments, compositions comprising the AAV vectors of the present disclosure can be administered following prophylaxis with immunosuppressants or other immune adjuvants, such as steroids or tacrolimus, which can be followed by subsequent administration of immune adjuvants to control humoral and / or cellular immune responses to the gene therapy.

[0222] The vector composition can contain any suitable amount of AAV vector calculated to deliver a prophylactically or therapeutically effective amount of such vector to a subject, in an amount that is easily handled or administered to a subject and / or is not expected to cause discomfort or undesirable side effects in the subject.

[0223] In connection with the prophylactic and therapeutic methods provided by the present disclosure, AAV vectors and compositions comprising such vectors can be administered at any appropriate dose predicted or determined to be effective in achieving the desired degree of prophylaxis or treatment. In some embodiments, doses of AAV vectors of the present disclosure for preventing or treating Gaucher disease type 1 are quantified and expressed as vector genomes per kilogram of subject body weight (vg), abbreviated as "vg / kg." In some embodiments, exemplary effective doses of AAV vectors of the present disclosure, including, for example, AAV vectors comprising an AAV3B capsid and a genome comprising the nucleotide sequence of SEQ ID NO: 17, include at least or about 1 x 10 9 vg / kg, 1 × 10 10 vg / kg, 1 × 10 11 vg / kg, 1 × 10 12 vg / kg, 1 × 10 13 vg / kg, 1 × 10 14 vg / kg or 1×10 15 Other doses are possible, including, but not limited to, vg / kg or dose ranges between and including any of the specifically recited doses above.

[0224] Other objects, features, and advantages of the present invention will become apparent from the foregoing detailed description. It should be understood, however, that the detailed description and the following specific examples, while indicating particular embodiments of the present invention, are given by way of illustration only, since various changes, modifications, and equivalents within the spirit and scope of the invention will be apparent to those skilled in the art from the detailed description and examples, and are encompassed by the appended claims.

[0225] Unless otherwise indicated, the use of the term "or" with respect to one or more members of a series of embodiments is equivalent to "and / or" and is not necessarily mutually exclusive. Unless otherwise indicated, explicitly stated numerical ranges also represent ranges whose lower limit is derived from the lower or upper limit of any one explicitly stated range and whose upper limit is derived from the lower or upper limit of any other explicitly stated range. Thus, for example, an explicitly stated series of ranges such as "10 to 20, 20 to 30, 30 to 40, 40 to 50, 100 to 150, 200 to 250, 275 to 300" also represents 10 to 50, 50 to 100, 100 to 200, and 150 to 250, among many other ranges. Unless otherwise indicated, the use of the term "about" before a series of numerical values ​​or ranges is intended to modify not only the value or range immediately stated, but also all subsequent values ​​or ranges expressed in the same series. Thus, for example, the phrase "about 1, 2, or 3" is equivalent to "about 1, about 2, or about 3."

[0226] All publications and references cited herein, including but not limited to, articles, abstracts, patents, patent applications (whether published or unpublished), and biological sequences (including but not limited to those identified by specific database reference numbers), are hereby incorporated by reference in their entireties for all purposes to the same extent as if each individual publication or reference was specifically and individually indicated to be incorporated by reference. Any patent application to which this application directly or indirectly claims priority is also hereby incorporated by reference in its entirety.

[0227] Unless otherwise stated, the following examples describe experiments that have been or are being performed using standard techniques well known and routinely performed by those skilled in the art. The examples are intended to be illustrative and not limiting of the invention. [Example]

[0228] The following examples and figures are included to demonstrate preferred embodiments of the invention. It will be understood by those of skill in the art that the techniques disclosed in the examples or figures represent techniques discovered by the inventors to work well in practicing the invention and, as such, can be considered to constitute preferred ways of practicing it. However, in light of the present disclosure, those skilled in the art will understand that many changes can be made in the specific embodiments that are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

[0229] Example 1 Design and production of AAV vectors expressing GCase An AAV vector containing a transgene for expressing human beta-glucocerebrosidase (GCase) was designed and produced using standard techniques. The protein expressed by the vector is full-length wild-type human GCase, except that the native secretory signal peptide sequence was replaced with an immunoglobulin secretory signal peptide sequence. One vector genome (clone 118) contained the native human nucleotide sequence encoding the hGCase protein (minus the signal peptide), while the transgene in the other vector genome (clone 128) encoded the same protein but was modified to reduce the number of CpG motifs (96 CpG motifs in clone 118 compared to 66 CpG motifs in clone 128). Both genomes contained, from 5' to 3', the 5' ITR from AAV2, two copies of the enhancer region from the alpha 1-microglobulin / bikunin precursor (A1MB enh), one copy of the proximal enhancer region from the human albumin (hALB) gene, one copy of the core promoter region from the hALB gene (hALB pro), one copy of the human beta globin gene intron (without interrupting the coding sequence), the coding sequence for the IgVH signal peptide in frame with the coding sequence for the GCase enzyme (the IgVH signal peptide replaces the native signal peptide), a stop codon, the bovine growth hormone (bGH) gene polyadenylation (polyA) signal sequence (i.e., terminator), the modified TBP intron 2 sequence, and the 3' ITR from AAV2.

[0230] For the vector genome of clone 128, the complete sequence is reported as SEQ ID NO: 17 (including both ITRs), and the nominal start and end nucleotide numbers of each genome component are shown in Table 1 below.

[0231] [Table 1]

[0232] Additional polypeptide and nucleotide sequences for the vectors described herein are set forth in the sequence listing below.

[0233] To produce vector particles, HEK293 cells in suspension culture were transfected using a classical triple transfection method. HEK293 cells were expanded from a working cell bank aliquot through multiple passages, from shake flasks to wave bags to 250L-scale single-use bioreactors (SUBs). Cells were transfected by adding a transfection cocktail containing PEI and three different plasmids (pHelper for expressing AdV helper factors; pRepCap for expressing AAV3B capsid protein and AAV3B Rep protein; and a transgene plasmid). After 3 hours of transfection, the transfection was quenched by adding CDM4 medium, followed by a 72-hour incubation to allow the cells to produce AAV vectors. Vectors were recovered by lysing the cells with Triton X-100, adding domiphen bromide to aggregate host cell DNA, filtering the supernatant, and then purifying the vector in three steps: affinity chromatography, anion exchange chromatography, and tangential flow filtration. After harvesting and purification, the vectors were titered by quantitative PCR and then tested for efficacy and toxicity in vitro and in vivo.

[0234] Example 2 In vitro testing of AAVGCase vectors The efficacy of two vectors containing the clone 128 genome, one using an AAV3B capsid (AAV3B-GBA clone 128) and the other using an AAVDJ capsid (AAVDJ-GBA clone 128), was tested in vitro by transducing Huh7 cells, a human hepatoma cell line, and measuring GCase enzyme activity in a fluorescent substrate-based assay. Because AAV3B capsids are known to have low transduction efficiency in mouse liver tissue, potentially confounding the results of in vivo experiments described below, we tested vectors using the AAVDJ capsid. In Huh7 cells, both vectors demonstrated a dose-dependent increase in GCase enzyme activity (Figure 1).

[0235] Example 3 Testing AAV GCase vectors in a mouse model of Gaucher disease type 1 The efficacy of clone 128 vector genomes delivered by both AAV3B and AAVDJ capsids was tested in a D409V transgenic mouse animal model of Gaucher disease type 1. D409V knock-in mice express a mutant mouse GBA gene corresponding to the D409V mutation found in human GCase. Similar to the residual GCase levels seen in type 1 GD patients, GCase activity in D409V mice is approximately 10% of that of wild-type (WT) animals. Sphingolipid accumulation can be detected in serum and various organs, including the liver and spleen. The D409V mouse model is further described, for example, in Xu, YH, et al., Viable Mouse Models of Acid β-Glucosidase Deficiency, Am J Pathol. 2003 November;163(5):2093-2101 (DOI:10.1016 / s0002-9440(10)63566-3); Sun, Y, et al., Gaucher disease mouse models: point mutations at the acid β-glucosidase locus combined with low-level prosaposin expression lead to disease variants, J Lipid Res. 2005 October;46(10):2102-13 (DOI:10.1194 / jlr.M500202-JLR200).

[0236] Vectors in which AAV3B and AAVDJ capsids encapsulate the clone 128 vector genome may be referred to herein as "AAV3B-GBA" and "AAVDJ-GBA," respectively. Vector doses may alternatively be expressed using exponential or E notation. Thus, for example, "3 x 10 12 A dose of "3E12 vg / kg" has the same meaning as "3E12 vg / kg."

[0237] Materials and Methods Vector administration and sample collection AAV3B-GBA clone 128 vector (1E13 vg / kg) and AAVDJ-GBA clone 128 (1E12 vg / kg and 1E13 vg / kg) were administered as a single dose to 5-month-old male D409V homozygous knock-in transgenic mice (Jackson nLab #019106) via intravenous injection via the retro-orbital route. As a negative control, four test animals of the same type were administered saline. Five test animals were used for each vector dose. After 28 days, the test animals were euthanized, and serum and tissue samples were collected and analyzed. Tissue samples were snap-frozen and stored at -80°C until use. For IHC, tissues were fixed in 10% neutral buffered formalin and processed into paraffin sections.

[0238] DNA isolation Frozen tissue samples were used for DNA isolation using the phenol / chloroform DNA extraction method. Frozen tissue samples were pulverized into a lyophilized powder using a Covaris CP02 Cyroprep Pulverizer according to the manufacturer's instructions. Approximately 30 mg of each frozen tissue powder was transferred to a new tube and resuspended in 292.5 mL of TENS lysis buffer containing 1% SDS. Next, 7.5 mL of proteinase K was added to each tube and incubated at 56°C in a thermomixer shaking at 1000 rpm for 3 hours, vortexing for 15 seconds every 30 minutes. The samples were then cooled to room temperature and treated with RNase A for 5 minutes. Each sample was treated with 300 mL of phenol:chloroform:isoamyl alcohol (25:24:1) and vortexed for 20 seconds. The upper liquid phase was collected for DNA precipitation by adding approximately 0.5 times the upper phase volume of 7.5 M NH4OAc and 3 times the total volume of pure ethanol. Samples were cooled at -20°C for at least 2 hours and then centrifuged at 16,000g for 30 minutes at 4°C. The DNA pellet was washed with ice-cold 70% ethanol and resuspended in nuclease-free water. DNA concentration was measured with a Nanodrop spectrophotometer.

[0239] RNA isolation Frozen tissue powder was prepared as described in the previous section. Approximately 30 mg of tissue sample was homogenized in 1 mL Trizol in the presence of 5 mm stainless steel beads for 5 minutes using a Tissuelyzer II set at a frequency of 25 l / s. The lysate was transferred to a phasemaker tube, and 200 mL of chloroform was added. The sample was vortexed for 15 seconds, incubated for 5 minutes at room temperature, and centrifuged at 14,000 g for 5 minutes at 4°C. The clear supernatant was transferred to a new tube and treated with the Purelink RNA Mini Kit according to the manufacturer's instructions. After 20 minutes of DNAse treatment on the column, the sample was eluted with nuclease-free water. RNA concentration was measured using a Nanodrop spectrophotometer.

[0240] Vector genome copy number Quantification of VGC was performed using ddPCR with the following primer and probe sequences to amplify the GBA transgene in all samples. For the ddPCR assay, the annealing temperature was 60°C; the probe primer sequence was TTAGGAAAGGACAGTGGGAGTGGC (SEQ ID NO: 43); the forward primer sequence was AATGCGATGCAATTTTCCTCATT (SEQ ID NO: 44); the reverse primer sequence was TGCCAGCCATCTGTTGTT (SEQ ID NO: 45); the probe fluorophore was FAM; and the quencher was NFQ. DNA was diluted to 10 ng / mL. A 20 μl PCR reaction mixture containing ddPCR supermix, isolated gDNA, GBA primers and FAM probe (see above), housekeeping gene (ms) Tfrc primers, and VIC probe was prepared in an Airclean 600 PCR workstation cleaned with DNAZap and added to a ddPCR 96-well plate. Droplets were generated using a QX200 droplet generator. The plate was sealed with a PX1 PCR plate sealer. The PCR program was: 95°C for 10 minutes, [94°C for 30 seconds, 60°C for 1 minute] (×40 cycles), 98°C for 10 minutes, and a 4°C hold. Droplet counts and amplitudes were acquired using a QX200 reader and analyzed with QuantaSoft software to calculate DNA copy numbers. VGCs obtained from the FAM channel were normalized to μg of gDNA input or reported as VGCs per haploid genome by calculating the ratio of the FAM and VIC channels.

[0241] GBA transgene expression The isolated RNA samples were reverse transcribed using the iScript cDNA Synthesis Kit (Bio-Rad, catalog number 1708891) according to the manufacturer's protocol to generate cDNA libraries. 500 ng of total RNA was used in a 20 μL reaction. Reverse transcription was performed at 37°C for 60 minutes, followed by 95°C for 5 minutes. cDNA samples were stored at -20°C until RT-PCR analysis. Quantification of GBA transgene RNA expression was determined using ddPCR with the same GBA primers and probe described above and a housekeeping gene MmHprt primer probe. PCR reaction mixtures containing ddPCR Supermix (without dUTP) and the above primer probes were prepared in an Airclean 600 PCR workstation cleaned with DNAZap and added to a ddPCR 96-well plate. Droplet generation, PCR programming, and data acquisition were performed as described above, and VGC was normalized to the number of μg of gDNA or MmHprt.

[0242] GCase protein expression by LC-MS / MS Human recombinant GCase protein produced in vector-treated test animals was enriched from serum, PBMC, and liver and spleen tissue lysate samples using an antibody specifically binding to GCase and then quantified by liquid chromatography-tandem mass spectrometry (LC-MS / MS). Spleen and liver sections were prepared by adding M-PER plus protease inhibitors to the buffer to prepare 100 mg / mL tissue. The samples were processed for 7 minutes using a Next Advance Bullet Blender. Samples were analyzed in various volumes (20 μL serum and 200 μL tissue lysate) against a standard curve surrogate matrix of 1% BSA in PBS spiked with taliglucerase protein. The linear range of the assay was 0.25–1,000 ng / mL for tissue samples and 0.5–1,000 ng / mL for serum samples. Dual IP was performed using 2 μg of anti-GCase antibody plus biotin and streptavidin magnetic beads. Samples were processed using a Thermo KingFisher Flex and eluted with 30 mM HCl + 5% MeCl2. Samples were adjusted to pH 8.3 using 1 M Tris-HCl, reduced, alkylated, and digested overnight using Promega LysC-Trypsin. Samples were injected into a Thermo Altis MS or Sciex 6500E in 85 μL volumes using an OptiFlow system with trap-and-elute nanoflow LC conditions. LC-MS / MS assay data were acquired using a Sciex 6500 (SciexE) with Analyst 1.7.1 and HotFix 1 acquisition software or a Thermo Altis (Altis2) with Xcalibur 4.2.47 acquisition software. Specifically, serum samples were run on the Sciex 6500E, and data processing was completed using Sciex MultiQuant 3.0.3 software. Tissue samples were run in Altis2, and sample data processing was completed using Skyline v.21.1.0.146. Calibration curves were generated from the peak area ratios of the analyte peptide and the SIL peptide, and the concentrations of study samples were determined by back-calculating the peak area ratios against the standard curve in both software packages.LC-MS / MS data of tissue lysates were normalized to total protein weight.

[0243] GCase protein expression in ICH Paraffin sections were stained with anti-GCase antibody using an automated stainer (Leica Biosystems Bond Rx). Briefly, slides were degreased and treated with peroxide for 10 minutes. Next, slides were rinsed with deionized water and permeabilized with 0.3% Triton solution for 1 hour before incubation with primary anti-GCase antibody (Sigma-Aldrich) for 1 hour. The primary antibody was diluted 1:250 in Bond Primary Antibody Diluent. Slides were then washed and incubated with secondary antibody (Leica #DS9800) for 8 minutes. The presence of antibody was visualized by incubation with DAB (Leica #DS9800) for 10 minutes. Finally, slides were rinsed with water and dehydrated through graded ethanol to xylene before being cover-slipped and imaged on a slide scanner (Axio Scan Z1, Zeiss). Images were rendered using ZEN Blue software.

[0244] GCase activity assay Frozen tissue powder was prepared as described above. Approximately 20 mg of tissue sample was used to generate lysates containing stainless steel beads in lysis buffer (citrate phosphate buffer pH 5.4 containing 0.25% (w / w) sodium taurocholate, 0.25% Triton X-100, and protease inhibitors) using a Tissuelyzer II set at a frequency of 25 l / s for approximately 8 minutes. Protein concentration in the tissue lysates was measured using a BCA protein assay kit. In a 96-well black non-binding plate, 25 μg of tissue lysate and 10 μL of serum or glycerase standard were mixed with 3 mM synthetic GCase substrate (4-methylumbelliferyl β-D-glucopyranoside) in 0.2 M sodium acetate solution (pH 4) for 30 minutes at 37°C. The reaction was attenuated by adding 0.7 volumes of 1 M glycine pH 10. An Envision plate reader was used to acquire the fluorescence signal (excitation / emission wavelength: 355 / 450 nm). Values ​​were calculated by fitting a taliglucerase standard curve after subtracting the background signal.

[0245] GluSph assay The concentration of D-glucosyl-β1-1'-D-erythrosphingosine (GluSph) in serum and tissue samples from test animals was analyzed by LC-MS / MS. Proteins in the samples were precipitated with a mixture of 97.5 parts mobile phase A (acetonitrile:formic acid 100:0.5) and 2.5 parts mobile phase B (50 mM ammonium formate in methanol:deionized water:formic acid 60:40:0.5) (MPAB). GluSph was extracted, dried, and reconstituted. MPAB was selected as the standard surrogate matrix. Quality controls were performed with both the surrogate matrix and the actual matrix (serum, liver, and spleen homogenates). For tissue homogenization, the tissue was weighed, homogenization buffer (MPAB) was added at a ratio of 4:1 μL / mg, homogenized, and the supernatant was transferred to a new tube. A standard curve was run (0.005 ng / mL to 81.92 ng / mL). For sample preparation, 20 μL aliquots of standard, quality control, blank matrix, and sample were dispensed into a 96-well round-bottom plate, 20 μL of matrix or surrogate matrix was added, 120 μL of working internal standard (ISTD) solution in MPAB was added, vortexed, centrifuged, and the sample mixture was transferred to a new well of the plate. The liquid was removed by evaporation after incubation at 45°C, and the residue was reconstituted with 100 μL of MPAB, then vortexed and injected into an MDS-SCIEX / Applied Biosystems 5500 QTrap equipped with a Turbo-Ion Spray Interface. Surrogate standards were prepared in triplicate using MPAB at concentrations of 0.005, 0.01, 0.02, 0.04, 0.08, 0.16, 0.32, 0.64, 1.28, 2.56, 5.12, 10.24, 20.48, 40.96, and 81.92 ng / mL. Alternative matrix quality controls were performed in triplicate using MPAB at concentrations of 0.5, 1.25, 5, and 25 ng / mL. Alternative matrix and mouse tissue matrix were then added to the prepared quality controls. MPAB was used for the alternative matrix quality control, while serum and homogenized tissue were used for the matrix quality control. Quality controls met the ±20% acceptance criteria, with replicates passing within ±20% of the nominal concentration.To ensure stability across each assay, standard curves were run before the assay, after quality control, and again at the end of the assay. Calibration curve regression was 1 / ×. 2 The curve fitting was performed using SciexOS software with quadratic weighting. GluSph-d5 was used as an internal standard.

[0246] result Vector genome copy number The AAVDJ-GBA vector transduced the liver and spleen, as determined by quantifying vector genome copy numbers in tissue samples collected from test animals, with a dose-responsive trend in the liver (Figure 2). The AAV3B-GBA vector also transduced the liver, but less efficiently than AAVDJ-GBA (Figure 2). Normalizing vector genome copy numbers to the copy number of the mouse housekeeping gene Tfrc demonstrated that AAVDJ-GBA was 27-fold more efficient at transducing the liver than the same dose of transgene delivered by AAV3B capsid (1E13 vg / kg), confirming that AAVDJ capsids transduce mouse liver more efficiently than AAV3B (Figure 3). Transduction of the spleen by both vectors was evident when vector genome copy numbers were normalized to the amount of input gDNA, but minimal transduction was evident when vector genome copy numbers were normalized to copies of a housekeeping gene (which serves as a surrogate for the host cell's haploid genome) (Figure 3). Transduction data for individual test animals is provided below in Table 2.

[0247] GBA transgene expression GBA transgene mRNA expression, normalized to expression of the host cell housekeeping gene Hprt, was consistent with the pattern of vector transduction. Transgene expression in the livers of test animals administered the AAVDJ-GBA vector was significantly higher than that produced from the same dose of the AAV3B-GBA vector (Figure 4). No transgene expression was detected in the spleen from either vector (Figure 4). GBA transgene mRNA expression levels for individual test animals are provided in Table 2 below.

[0248] [Table 2]

[0249] GCase protein expression by LC-MS / MS Human GCase protein was quantified in samples from test animals administered the GBA vector using an immunoaffinity LC-MS / MS assay. Liver GCase protein levels resulting from treatment with the AAVDJ-GBA vector were dose-responsive, producing higher GCase levels in the liver compared with the same dose of the AAV3B-GBA vector, consistent with transgene mRNA expression (Figure 5A). This pattern was also reflected in GCase protein levels measured in serum samples from test animals (Figure 5C), suggesting that AAV-mediated delivery of the GBA expression cassette produces GCase in the liver and releases it into the bloodstream. Despite the absence of GBA mRNA expression, GCase protein was detected in spleen samples from test animals treated with both vectors (Figure 5B), suggesting that GCase was imported into the spleen from liver-derived bloodstream proteins. As with the liver, the amount of GCase produced by the AAVDJ-GBA vector in spleen samples was dose-dependent. GCase protein concentrations in serum and tissue samples from individual test animals are shown in Table 3 below.

[0250] GCase protein expression in ICH Human GCase protein was also studied by immunohistochemistry in test animals treated with both GBA vectors. Low-intensity positive staining was detected in hepatocytes, while high-intensity staining was detected in Kupffer cells located along the sinusoids (Figure 6). GCase protein staining intensity by ICH was higher with the AAVDJ-GBA vector compared to the same dose of the AAV3B-GBA vector, consistent with the hepatic GCase protein concentration determined by LC-MS / MS.

[0251] GCase activity in serum and tissues As measured using a fluorescent substrate assay, GCase activity in serum and tissue samples from test animals was increased after treatment with the AAVDJ-GBA and AAV3B-GBA vectors compared with vehicle controls (Figures 7A, 7B, and 7C). In the liver, both vectors produced higher GCase activity than vehicle-treated test animals (Figure 7A). While only the AAVDJ-GBA vector produced GCase activity levels above those of the negative control in the spleen (Figure 7B) and serum (Figure 7C), including the lowest dose tested (1E12 vg / kg). In serum, liver, and spleen, GCase activity produced by the AAVDJ-GBA vector was dose-responsive. Overall, these results indicate that the human GCase enzyme produced by the vector in the liver was functional.

[0252] Serum and tissue GluSph levels Glucosylsphingosine (GluSph) is a biomarker for Gaucher disease. GCase deficiency in this disease leads to the accumulation of glucosylceramide in lysosomes, which is then deacylated by acid ceramidase to form glucosylsphingosine. Restoring GCase activity, such as by factor replacement or gene therapy, is expected to reduce GluSph levels.

[0253] GluSph concentrations in serum and tissue samples from vector- and vehicle-treated test animals were determined by LC-MS / MS. D409V transgenic mice lack GCase activity and therefore have elevated GluSph levels in the liver, spleen, and serum. Treatment with AAVDJ-GBA or AAV3B-GBA vectors significantly reduced GluSph levels in the same tissues and serum compared with the levels prevalent in vehicle-treated test animals (Figures 8A, 8B, and 8C). Consistent with other results, treatment with AAVDJ-GBA resulted in a greater reduction in GluSph levels compared with the same dose of AAV3B-GBA vector. The reduction in GluSph levels for the AAVDJ-GBA vector was dose-dependent, with a dose of 1E12 vg / kg achieving a greater than 84% reduction in GluSph levels in the liver and spleen. Notably, the amount of GCase protein detected in the livers of test animals treated with 1E13 vg / kg of the AAV3B-GBA vector was only 6% of that in animals treated with the same dose of AAVDJ-GBA, whereas liver GluSph levels were reduced by over 70% (Figure 8A). Similar reductions in GluSph concentrations also occurred in the spleen (Figure 8B) and serum (Figure 8C). These results demonstrated that sphingolipid accumulation in the liver and spleen, one of the most important markers of type 1 Gaucher disease, can be reduced by treating an animal model of this disease with a vector designed to transduce the liver and produce enzymatically active hGCase protein that is secreted into the blood circulation.

[0254] [Table 3]

[0255] Example 4 Testing AAV GCase vectors in healthy non-human primates Extending the mouse studies, the AAV3B-GBA clone 128 vector and the AAVDJ-GBA clone 128 vector (referred to as AAV3B-GBA and AAVDJ-GBA, respectively, in this example and related figures) were injected intravenously into healthy cynomolgus monkeys, and samples were collected after necropsy to analyze the copy number of the vector genome in the transduced cells and the RNA and protein expression resulting from vector transduction.

[0256] Materials and Methods Vector administration and sample collection The AAV3B-GBA clone 128 vector was administered intravenously to cynomolgus monkeys at four escalating doses. Two males and one female received a dose of 3E12 vector genomes per kilogram of body weight (vg / kg); one male and two females received a dose of 1E13 vg / kg; one male and one female received a dose of 3E13 vg / kg; and one male and one female received doses of 5.3E13 vg / kg and 5.2E13 vg / kg, respectively. The AAVDJ-GBA clone 128 vector was administered intravenously to one male and one female monkey at a dose of 3E13 vg / kg. A total of four animals (two males and two females) received vehicle as a negative control. Animals were maintained on methylprednisolone throughout the study to suppress potential immune responses. Necropsies were performed approximately 30 days after administration. Serum samples and 100–200 mg tissue samples from the liver, spleen, and dorsal root ganglia were collected and stored at −80°C until use. For immunohistochemistry (IHC), tissues were fixed in 10% neutral buffered formalin and processed into paraffin blocks and sections.

[0257] DNA isolation Frozen tissue samples were used for DNA isolation using the phenol / chloroform DNA extraction method. Frozen tissue samples were pulverized into a lyophilized powder using a Covaris CP02 Cyroprep Pulverizer according to the manufacturer's instructions. Approximately 30 mg of each frozen tissue powder was transferred to a new tube and resuspended in 292.5 mL of TENS lysis buffer containing 1% SDS. 7.5 mL of proteinase K was then added to each tube and incubated at 56°C in a thermomixer shaking at 1000 rpm for 3 hours, vortexing for 15 seconds every 30 minutes. The samples were then cooled to room temperature and treated with RNase A for 5 minutes. Each sample was treated with 300 mL of phenol:chloroform:isoamyl alcohol (25:24:1) and vortexed for 20 seconds. The upper liquid phase was collected for DNA precipitation by adding approximately 0.5 times the upper phase volume of 7.5 M NH4OAc and 3 times the total volume of pure ethanol. Samples were cooled at -20°C for at least 2 hours and then centrifuged at 16,000g for 30 minutes at 4°C. The DNA pellet was washed with ice-cold 70% ethanol and resuspended in nuclease-free water. DNA concentration was measured with a Nanodrop spectrophotometer.

[0258] RNA isolation Frozen tissue powder was prepared as described in the previous section. Approximately 30 mg of tissue sample was homogenized in 1 mL Trizol in the presence of 5 mm stainless steel beads for 5 minutes using a Tissuelyzer II set at a frequency of 25 l / s. The lysate was transferred to a phasemaker tube, and 200 mL of chloroform was added. The sample was vortexed for 15 seconds, incubated for 5 minutes at room temperature, and centrifuged at 14,000 g for 5 minutes at 4°C. The clear supernatant was transferred to a new tube and treated with the Purelink RNA Mini Kit according to the manufacturer's instructions. After 20 minutes of DNAse treatment on the column, the sample was eluted with nuclease-free water. RNA concentration was measured using an anodrop spectrophotometer.

[0259] Vector genome copy number Genomic DNA (gDNA) was extracted from liver, spleen, and DRG, and vector genome copies (VGC) were determined by ddPCR of the GBA transgene to quantify vector transduction. VGC was normalized to either gDNA input or expression of the housekeeping gene Tfrc. For the ddPCR assay, the annealing temperature was 60°C, the probe primer sequence was TTAGGAAAGGACAGTGGGAGTGGC (SEQ ID NO: 43), the forward primer sequence was AATGCGATGCAATTCCTCATT (SEQ ID NO: 44), the reverse primer sequence was TGCCAGCCATCTGTTGTT (SEQ ID NO: 45), the probe fluorophore was FAM, and the quencher was NFQ. DNA was diluted to 10 ng / mL. A 20 μL PCR reaction mixture containing ddPCR supermix, isolated gDNA, GBA primers and FAM probe (see above), housekeeping gene (ms) Tfrc primers, and VIC probe was prepared on an Airclean 600 PCR workstation cleaned with DNAZap and added to a ddPCR 96-well plate. Droplets were generated using a QX200 droplet generator. The plate was sealed with a PX1 PCR plate sealer. The PCR program was: 95°C for 10 min, [94°C for 30 s, 60°C for 1 min] (×40 cycles), 98°C for 10 min, and a 4°C hold. Droplet counts and amplitudes were acquired by the QX200 reader and analyzed with QuantaSoft software to calculate DNA copy numbers. VGCs obtained from the FAM channel were normalized to μg of gDNA input or reported as VGCs per haploid genome by calculating the ratio of the FAM and VIC channels.

[0260] GBA transgene expression GBA mRNA expression from the transduced transgene was quantified by reverse transcription and ddPCR of RNA samples from liver, spleen, and DRG. Transgene mRNA levels were normalized to the expression of the housekeeping gene Hprt. Isolated RNA samples were reverse transcribed using the iScript cDNA Synthesis Kit (Bio-Rad, catalog no. 1708891) according to the manufacturer's protocol to generate cDNA libraries. 500 ng of total RNA was used in a 20 μL reaction. Reverse transcription was performed at 37°C for 60 minutes, followed by 95°C for 5 minutes. cDNA samples were stored at -20°C until RT-PCR analysis. Quantification of GBA transgene RNA expression was determined using ddPCR with the same GBA primers and probe described above and a primer probe for the housekeeping gene mfHprt. PCR reaction mixtures containing ddPCR Supermix (without dUTP) and the above primer probes were prepared in an Airclean 600 PCR workstation cleaned with DNAZap and added to a ddPCR 96-well plate. Droplet generation, PCR program, and data acquisition were performed as described above. VGC was normalized to the number of μg of gDNA or mfHPRT.

[0261] GCase protein expression by LC-MS / MS Human recombinant GCase protein produced in vector-treated test animals was enriched from serum, PBMC, and liver and spleen tissue lysate samples using an antibody specifically binding to GCase and then quantified by liquid chromatography-tandem mass spectrometry (LC-MS / MS). PBMC pellets were combined per vial in M-PER buffer plus protease inhibitors and lysed by bead milling in a Bullet Blender STORM 5 for 6 minutes. Spleen and liver sections were prepared by adding M-PER plus protease inhibitors to the buffer in an amount sufficient to prepare 50 mg / mL tissue. Samples were processed for 1.5 minutes using an OmniBead Ruptor Elite. Samples were analyzed in various volumes (50 μL serum, 200 μL tissue lysate, and 200-800 μL PBMC lysate) against a standard curve surrogate matrix of 1% BSA in PBS spiked with glycerase protein. The linear range of the assay was 0.25-1,000 ng / mL. Dual IP was performed using 2 μg of anti-GCase antibody plus biotin and streptavidin magnetic beads. Samples were processed using a Thermo KingFisher Flex and eluted with 30 mM HCl + 5% ACN. Samples were adjusted to pH 8.3 using 1 M Tris-HCl, reduced, alkylated, and digested overnight with Promega LysC-Trypsin. Samples were injected into a Thermo Altis MS system in an 85 μL volume using trap and elute nanoflow LC conditions. All data from the LC-MS / MS assay were acquired using Xcalibur v.4.1 on the Thermo Altis. Data processing was performed using Skyline v.21.2.0.369 and exported to Excel. A calibration curve was generated from the peak area ratios of the analyte peptide and SIL peptide, and the concentrations of the study samples were determined by back-calculating the peak area ratios against the standard curve. LC-MS / MS data for PBMC and tissue lysates were normalized to the total protein weight of the tissue and the total number of cells (in millions) harvested for the PBMC pellet.

[0262] GCase protein expression in ICH Paraffin sections of liver, spleen, and DRG were stained with anti-GCase antibody using an automated stainer (Leica Biosystems Bond Rx). Briefly, slides were dewaxed and treated with peroxide for 10 minutes. Next, slides were rinsed with deionized water and permeabilized with 0.3% Triton solution for 1 hour before incubation with primary anti-GCase antibody (Sigma-Aldrich) for 1 hour. The primary antibody was diluted 1:250 in Bond primary antibody diluent. Slides were then washed and incubated with secondary antibody (Leica #DS9800) for 8 minutes. The presence of antibody was visualized by incubation with DAB (Leica #DS9800) for 10 minutes. Finally, slides were rinsed with water and dehydrated through graded ethanol to xylene. After that, slides were cover-slipped and imaged using a slide scanner (Axio Scan Z1, Zeiss). Images were rendered using ZEN Blue software.

[0263] Capsid-neutralizing antibody titer To control for the possibility that the presence of neutralizing antibodies against the vector capsid might affect transduction efficiency, nAb titers against AAV3B in test animals were determined on the day of vector administration. To evaluate nAb titers, a cell-based transduction inhibition assay was performed. Briefly, HEK293T cells were seeded in a poly-D-lysine 96-well plate at 60K cells per well in 100 μL and incubated overnight at 37°C and 5% CO2. The following day, 10 μL of WT adenovirus was added to the cell plate ...

Claims

1. 1. A recombinant adeno-associated virus (AAV) vector genome comprising a nucleotide sequence encoding a beta-glucocerebrosidase (GCase) protein comprising a secretory signal peptide sequence and a mature polypeptide sequence, wherein the secretory signal peptide sequence is derived from a wild-type human GCase protein or a protein other than GCase.

2. 2. The AAV vector genome of claim 1, wherein the mature GCase polypeptide sequence is identical to the mature polypeptide sequence of a wild-type human GCase protein.

3. The AAV vector genome of claim 2 , wherein the secretory signal peptide sequence is derived from an immunoglobulin protein.

4. 2. The AAV vector genome of claim 1, wherein the mature GCase polypeptide sequence comprises the amino acid sequence of SEQ ID NO:40, and the secretory signal peptide sequence comprises the amino acid sequence of SEQ ID NO:38 or SEQ ID NO:

39.

5. 2. The AAV vector genome of claim 1, wherein the amino acid sequence of the GCase protein is provided by the amino acid sequence of SEQ ID NO:

16.

6. The AAV vector genome of any one of claims 1 to 5, wherein the nucleotide sequence encoding a GCase protein is wild-type or codon-optimized.

7. 7. The AAV vector genome of claim 6, wherein the codon-optimized nucleotide sequence has a reduced number of CpG dinucleotides compared to the wild-type nucleotide sequence.

8. The AAV vector genome of any one of claims 1 to 7, wherein the nucleotide sequence encoding a mature GCase polypeptide is at least 70% identical to the nucleotide sequence of SEQ ID NO:

13.

9. 9. The AAV vector genome of any one of claims 1 to 8, comprising at least one AAV inverted terminal repeat (ITR).

10. The AAV vector genome of any one of claims 1 to 9, further comprising a transcriptional control region operably linked to the nucleotide sequence encoding a GCase protein.

11. The AAV vector genome of claim 10, wherein the transcriptional control region is liver tissue-specific.

12. The AAV vector genome of claim 11, wherein the transcriptional control region comprises a promoter derived from the human albumin (ALB) gene and an enhancer derived from the human albumin (ALB) gene or the alpha-1-microglobulin / bikunin precursor (AMBP) gene.

13. The AAV vector genome of any one of claims 1 to 12, further comprising a transcription termination signal sequence.

14. The AAV vector genome of any one of claims 1 to 13, further comprising an intron or a post-transcriptional regulatory element (PRE).

15. In the order from 5' to 3', (a) a first AAV2 ITR, (b) a first copy of the AMBP gene enhancer sequence; (c) a second copy of the AMBP gene enhancer sequence; (d) an ALB gene enhancer sequence; (e) the ALB gene promoter sequence; (f) human beta globin (HBB) gene intron sequence; (g) a nucleotide sequence encoding a human GCase protein operably linked to the first and second copies of the AMBP enhancer, the ALB enhancer, and the ALB promoter, the GCase protein comprising a secretory signal peptide sequence and a mature polypeptide sequence; (h) the bovine growth hormone (bGH) gene transcription termination signal sequence; (i) a modified TBP intron 2 sequence; and (j) a second AAV2 ITR The AAV vector genome of any one of claims 1 to 14.

16. 16. The AAV vector genome of claim 15, wherein each of the first and second copies of the AMBP gene enhancer sequence comprises the nucleotide sequence of SEQ ID NO:8; or the ALB gene enhancer sequence comprises the nucleotide sequence of SEQ ID NO:9; or the ALB gene promoter sequence comprises the nucleotide sequence of SEQ ID NO:10; or the human beta globin (HBB) gene intron sequence comprises the nucleotide sequence of SEQ ID NO:11; or the nucleotide sequence encoding a human GCase protein comprises the nucleotide sequence of SEQ ID NO:41; or the bGH gene transcription termination signal sequence comprises the nucleotide sequence of SEQ ID NO:

14.

17. The AAV vector genome of any one of claims 1 to 16, wherein the nucleotide sequence of the vector genome comprises the nucleotide sequence of SEQ ID NO: 17 or a reverse complement thereof.

18. An AAV vector comprising the AAV vector genome and AAV capsid of any one of claims 1 to 17.

19. The AAV vector of claim 18, wherein the AAV capsid is liver-tropic.

20. The AAV capsids include AAV2, AAV3B, AAV5, AAV6, AAV7, AAV8, AAV9, AAV13, AAVrh. 74, AAVrh. 10, AAV-DJ, AAV-LK03, AAV-KP1, AAV-hu. Lvr01, AAV-hu. Lvr02, AAV-hu. Lvr03, AAV-hu. Lvr04, AAV-hu. Lvr05, AAV-hu. Lvr06, AAV-hu. Lvr07, AAV-Anc80, AAV-NP40, AAV-NP59, AAV-NP84, AAV-hu.

20. The AAV vector of claim 18 or 19, wherein the AAV capsid is selected from the group consisting of AAV-rh.37, AAV-rh.8, AAV-rh.64R1, RHM4-1, RHM15-1, RHM15-2, RHM15-3 / RHM15-5, RHM15-4 and RHM15-6, AAVHSC7, AAVHSC15 and AAVHSC17; or wherein the AAV capsid comprises a VP1 protein comprising the amino acid sequence of SEQ ID NO:1 or SEQ ID NO:

4.

21. 21. A method of treating a human subject in need of treatment for Gaucher disease type 1, comprising administering to the subject a therapeutically effective amount of an AAV vector according to any one of claims 18 to 20.

22. The therapeutically effective amount of the AAV vector is about 1×10 per kilogram of subject body weight. １０ ~1×10 １５ 22. The method of claim 21, wherein the AAV vector is administered intravenously to the subject in a composition having a pharmacologic acceptable excipient, at a dose ranging from 100 mg to 150 mg of vector genome (vg / kg).

23. 23. The method of claim 22, wherein the method is effective to increase the amount of active GCase protein in the subject's peripheral blood mononuclear cells (PBMCs) to at least 20 pg / 1E6 cells.

24. 23. The method of claim 22, which is effective in reducing the severity of a symptom or sign of Gaucher disease type 1 selected from the group consisting of hepatosplenomegaly, hepatomegaly, splenomegaly, anemia, neutropenia, pancytopenia, thrombocytopenia, monoclonal gammaglobulinemia, polyclonal gammaglobulinemia, anorexia, chronic fatigue, avascular osteonecrosis, bone pain, osteolysis, osteonecrosis, and osteopenia.

25. Use of an AAV vector according to any one of claims 18 to 20 in the manufacture of a medicament for treating or preventing Gaucher disease type 1 in a human subject.

26. A DNA plasmid comprising the nucleotide sequence of the AAV vector genome of any one of claims 1 to 17.

27. 27. A host cell for producing an AAV vector, comprising the DNA plasmid of claim 26.

28. 28. A method for producing an AAV vector, comprising culturing a host cell described in claim 27 under conditions sufficient for the production of an AAV vector, and purifying the AAV vector produced thereby.

29. 29. An AAV vector produced by the method of claim 28.

Images