Generation of brown adipocytes from human pluripotent stem cells

Abstract

Provided herein is a method for generating Gata6 positive brown adipose precursor cells and brown adipocytes and tissues therefrom.Furthermore, provided herein is a method for generating UCP1 positive organoids.Generally, this method comprises culturing brown adipose precursor cells in a medium that contains FGF signaling pathway activator, BMP signaling pathway activator, TGFβ activator, Wnt inhibitor and thyroid hormone receptor activator.

Description

[Technical field]

[0001] Claiming priority This application claims the benefit of U.S. Provisional Application No. 63 / 305,390, filed February 1, 2022, the entire contents of which are incorporated herein by reference.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically as an XML file named "29618-0376WO1_SL_ST26.xml". The size of the XML file, created on January 31, 2023, is 25,788 bytes. The material within the XML file is incorporated herein by reference in its entirety.

[0003] Generation of brown adipocytes from human pluripotent stem cells. [Background technology]

[0004] Our understanding of human brown adipose tissue (BAT) development is limited. Current in vitro models to study human BAT are mainly based on in vitro differentiated brown adipocytes from primary cell lines and stromal vascular cells (Samuelson and Vidal-Puig, 2020). Also, several protocols have been established to differentiate human pluripotent stem cells (hPSCs) into brown adipocytes using transgenic overexpression of transcription factors (Ahfeldt et al., 2012) or treatment with growth factors and small molecules (Takeda et al., 2017). Other reported methods rely on serum-based spontaneous differentiation or treatment of hPSCs with cytokine cocktails (Guenantin et al., 2017, Hafner et al., 2016, Nishio et al., 2012). Recently, protocols have also been reported that allow the generation of brown adipocytes from hPSCs by recapitulating developmental cues (Carobbio et al., 2021; Zhang et al., 2020). However, to date, a well-characterized roadmap of brown adipose lineage development is still lacking. Therefore, it has not been possible to benchmark these protocols against the normal trajectory of brown adipocyte differentiation in vivo. Summary of the Invention

[0005] Provided herein is a method for generating Gata6-positive brown adipocyte progenitor cells, the method comprising culturing PAX3-positive somite progenitor cells in a medium containing an effective amount of each of an FGF signaling pathway activator, a BMP signaling pathway activator, a TGFβ signaling pathway activator, a Wnt signaling pathway inhibitor, and a thyroid hormone receptor activator, under conditions and for a period of time sufficient for the PAX3-positive cells to differentiate into Gata6-positive brown adipocyte progenitor cells.

[0006] Provided herein is a method in which PAX3-positive somatic progenitor cells are generated by a method comprising culturing pluripotent cells, preferably induced pluripotent stem cells (iPSCs) or embryonic stem (ES) cells, in a medium containing an effective amount of each of a hepatocyte growth factor (HGF) signaling pathway activator, an insulin-like growth factor (IGF) signaling pathway activator, and a fibroblast growth factor (FGF) signaling pathway activator, a Wnt signaling pathway activator, and a bone morphogenetic protein (BMP) signaling pathway inhibitor, to generate PAX3-positive somatic progenitor cells.

[0007] Provided herein is a method further comprising culturing the PAX3-positive somatic progenitor cells in a medium containing an HGF signaling pathway activator and an IGF signaling pathway activator, but lacking an FGF signaling pathway activator and a BMP signaling pathway inhibitor, for 8 to 23 days.

[0008] In some embodiments, the method further comprises dissociating the PAX3-positive somatic progenitor cells after culturing the cells for 8-23 days. In some embodiments, the HGF signaling pathway activator comprises HGF. In some embodiments, the IGF signaling pathway activator comprises IGF-1. In some embodiments, the FGF signaling pathway activator comprises at least one of FGF-1, FGF-2, FGF-3, FGF-4, FGF-5, FGF-6, FGF-7, FGF-8, FGF-9, FGF-10, FGF-11, FGF-12, FGF-13, FGF-14, FGF-15, FGF-16, FGF-17, FGF-18, FGF-19, FGF-20, FGF-21, FGF-22, FGF-23, and combinations thereof. In some embodiments, the FGF signaling pathway activator comprises FGF-2. In some embodiments, the BMP signaling pathway inhibitor comprises at least one of LDN-193189, dorsomorphin, noggin, follistatin, cerberus, and combinations thereof. In some embodiments, the BMP signaling pathway inhibitor comprises LDN-193189. In some embodiments, the BMP signaling pathway activator comprises at least one of BMP2, BMP4, BMP7, and combinations thereof. In some embodiments, the Wnt signaling pathway inhibitor comprises at least one of C59, XAV939, IWR-1, JW74, JW55, G007-LK, MSC2504877, benzimidazolone, WNT974, RK-287107, E7499, IWP-L6, GNF-1331, GNF-6231, ETC-131, IWP-29, LGK947, ETC159, ETC-1922159, and combinations thereof. In some embodiments, the Wnt signaling pathway inhibitor comprises C59. In some embodiments, the TGFβ signaling pathway activator comprises at least one of TGFβ1, TGFβ2, TGFβ3, and combinations thereof. In some embodiments, the TGFβ signaling pathway activator comprises TGFβ1.In some embodiments, the thyroid hormone receptor activator comprises at least one of triiodothyronine (T3), T4, resmetirome, eprotirome, sobetirome, Sob-AM2, VK2809, MB07344, IS25 TG68, and combinations thereof. In some embodiments, the thyroid hormone receptor activator comprises T3. In some embodiments, the HGF signaling pathway activator in some methods is different from the HGF signaling pathway activator in other parts of the same method. In some embodiments, the IGF1 signaling pathway activator in some methods is different from the IGF1 signaling pathway activator in other parts of the same method. In some embodiments, the FGF2 signaling pathway activator in some methods is different from the FGF2 signaling pathway activator in other parts of the same method. In some embodiments, dissociating the PAX3-positive somatic progenitor cells comprises using one or more of type IV collagenase and trypsin-EDTA. In some embodiments, the method further comprises seeding the dissociated cells at a density of 60,000 to 100,000 cells / cm2. In some embodiments, the method further comprises culturing the Gata6 positive cells in an adipogenic differentiation medium to generate brown adipocytes. In some embodiments, the adipogenic differentiation medium comprises Dulbecco's Modified Eagle Medium (DMEM) high glucose medium supplemented with serum-free serum replacement, 1× insulin-transferrin-selenium (ITS), isobutylmethylxanthine (IBMX), l-ascorbic acid, T3, TGFβ inhibitor, dexamethasone, epidermal growth factor (EGF), hydrocortisone, and rosiglitazone.

[0009] Provided herein is an in vitro method for generating UCP1-positive, Gata6-positive, and / or Pparg-positive brown adipocyte organoids, comprising culturing PAX3-positive somite-like structures in a medium containing an effective amount of each of an FGF signaling pathway activator, a BMP signaling pathway activator, a TGFβ signaling pathway activator, a Wnt signaling pathway inhibitor, and triiodothyronine (T3) under conditions and for a period of time sufficient for the PAX3-positive somite-like structures to differentiate into UCP1-positive, Gata6-positive, and / or Pparg-positive brown adipocyte organoids.

[0010] Provided herein is a method in which PAX3-positive somite-like structures are generated by a method comprising culturing pluripotent cells, preferably induced pluripotent stem cells (iPSCs) or embryonic stem (ES) cells, in a medium containing an effective amount of each of a Wnt activator and a bone morphogenetic protein (BMP) inhibitor to generate PAX3-positive somite-like structures.

[0011] In some embodiments, the HGF signaling pathway activator comprises HGF. In some embodiments, the IGF signaling pathway activator comprises IGF-1. In some embodiments, the FGF signaling pathway activator comprises at least one of FGF-1, FGF-2, FGF-3, FGF-4, FGF-5, FGF-6, FGF-7, FGF-8, FGF-9, FGF-10, FGF-11, FGF-12, FGF-13, FGF-14, FGF-15, FGF-16, FGF-17, FGF-18, FGF-19, FGF-20, FGF-21, FGF-22, FGF-23, and combinations thereof. In some embodiments, the FGF signaling pathway activator comprises FGF-2. In some embodiments, the BMP signaling pathway inhibitor comprises at least one of LDN-193189, dorsomorphin, noggin, follistatin, cerberus, and combinations thereof. In some embodiments, the BMP signaling pathway inhibitor comprises LDN-193189. In some embodiments, the BMP signaling pathway activator comprises at least one of BMP2, BMP4, BMP7, and combinations thereof. In some embodiments, the Wnt signaling pathway inhibitor comprises at least one of C59, XAV939, IWR-1, JW74, JW55, G007-LK, MSC2504877, benzimidazolone, WNT974, RK-287107, E7499, IWP-L6, GNF-1331, GNF-6231, ETC-131, IWP-29, LGK947, ETC159, ETC-1922159, and combinations thereof. In some embodiments, the Wnt signaling pathway inhibitor comprises C59. In some embodiments, the TGFβ signaling pathway activator comprises at least one of TGFβ1, TGFβ2, TGFβ3, and combinations thereof, hi some embodiments, the TGFβ signaling pathway activator comprises TGFβ1.In some embodiments, the thyroid hormone receptor activator comprises at least one of triiodothyronine (T3), T4, resmetirome, eprotirome, sobetirome, Sob-AM2, VK2809, MB07344, IS25 TG68, and combinations thereof. In some embodiments, the thyroid hormone receptor activator comprises T3. In some embodiments, the method further comprises culturing the organoid in adipogenic differentiation medium to generate brown adipocyte organoids. In some embodiments, the adipogenic differentiation medium comprises Dulbecco's Modified Eagle Medium (DMEM) high glucose medium supplemented with serum-free serum replacement, 1× insulin-transferrin-selenium (ITS), isobutylmethylxanthine (IBMX), l-ascorbic acid, T3, TGFβ inhibitor, dexamethasone, epidermal growth factor (EGF), hydrocortisone, and rosiglitazone.

[0012] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs. Methods and materials are described herein for use in the present invention, and other suitable methods and materials known in the art can also be used. Materials, methods, and examples are merely illustrative and are not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.

[0013] Other features and advantages of the invention will become apparent from the following detailed description and drawings, and from the claims. [Brief description of the drawings]

[0014] [Figure 1A]Uniform manifold approximation projection (UMAP) embedding showing cell clusters identified using Leiden-based clustering on somite lineages of the mouse dataset. Color indicates the identified cell clusters. (BApre=brown adipocyte precursors FP=fibroblast precursors). [Figure 1B] UMAP embeddings of single cells isolated from the somite lineage of E11.5, E12.5, E13.5, E14.5, and E15.5 mouse embryos. Color indicates embryonic date. [Figure 1C] A track plot showing expression of markers of brown adipocyte differentiation in the clusters shown in A. Bar height indicated expression level in individual cells. [Figure 1D] 1 is a bar plot showing the number of cells in the indicated clusters at five time points. [Figure 1E] 13 is a STREAM plot showing the estimated developmental trajectories inferred by the STREAM algorithm. [Figure 1F] UMAP embedding showing the progression of biological processes from snapshot data using diffusion pseudotime. [Figure 1G] Immunofluorescence analysis of developing interscapular brown fat in mice. Images represent cross sections of mouse embryos at the level of the forelimbs showing the interscapular region. Adipocytes expressing perilipin (Plin1) begin to appear at embryonic day (E) 14.5, and perilipin is widely expressed in the interscapular fat at E15.5. Staining with Pparg antibody showing expression of Pparg starting at E13.5. Interscapular fat develops between muscle bundles stained using myosin heavy chain (Myhc) antibody. NT=neural tube. n>3. [Figure 2A] Pie chart showing the time progression of the percentage of Gata6 positive cells in the clusters shown on the right. [Figure 2B]Immunofluorescence analysis of developing interscapular fat in mice at embryonic day (E) 12.5-15.5. Images represent cross sections of mouse embryos at the level of the forelimbs showing the interscapular region. Presence of Gata6 positive and Pparg negative cells detected by antibody staining at E12.5. The expression domain of Gata6 expands and double positive cells are detected at E13.5. Gata6 expression is reduced at E14.5 and detected in only a few cells at E15.5 as the majority of cells become Pparg positive. Note expression Gata6 in hair follicles at E15.5. NT=neural tube. n>4. [Figure 2C] FIG. 1 is a schematic showing lineage tracing experiments in Gata6-CreERT2:Rosa26-tdTomato mice. A single dose of tamoxifen was injected into pregnant females at E12.5 and embryos were harvested at E15.5. Transverse sections at the forelimb level of E15.5 embryos were stained for anti-RFP antibody to detect tdTomato positive cells. Gata6 progeny were detected in the interscapular brown adipose tissue (BAT), lung (L), and heart (H). NT=neural tube (left panel). Enlarged image of a transverse section from the interscapular region showing brown adipose tissue stained with Pparg and RFP (tdTomato) antibodies (top right panel). High magnification image of brown adipocytes in the interscapular region showing double positive cells for Pparg and tdTomato. Arrows mark some of the double positive cells (bottom right panel). n≧3. [Figure 2D]Schematic diagram showing the lineage tracing strategy to label PAX7 progeny during mouse development. Pax7-Cre:Rosa26-mTmG embryos were analyzed at E14.5. Representative images showing Pax7 progeny at E14.5. Transverse sections at the forelimb level of E14.5 embryos were stained for anti-GFP antibodies to detect membrane GFP positive cells. GFP labeling identifies Pax7 progeny in the interscapular brown adipose tissue as well as skeletal muscle bundles (SkM) in the dorsal and limb regions. NT=neural tube (left panel). Transverse section of E14.5 Pax7-Cre:Rosa26-mTmG embryo showing the interscapular region stained with antibodies against Pparg and GFP to label brown adipocytes and Pax7 progeny (top right panel). Representative high magnification images showing double positive cells stained for nuclear Pparg and membranous GFP. Arrows mark double positive cells (bottom right panel). n>3. [Figure 2E] Transverse section of an E14.5 Pax7-Cre:Rosa26-mTmG embryo showing the interscapular region stained with GFP to label Pax7 progeny and with antibodies against Gata6 to label brown adipocyte precursors. Insert shows a magnified view. Arrows mark some of the double positive cells. NT=neural tube. n>3. [Figure 3A] Immunofluorescence analysis of human fetal tissues (upper panel - skin, lower panel - back muscle) isolated from the scapular region of 98-day-old fetuses. Antibody staining for MYHC shows the dermis and skeletal muscle bundles just beneath the medial section. EBF2 and GATA6 label progenitor cells. n > 3 sections. [Figure 3B] Immunofluorescence analysis of human fetal brown adipose tissue isolated from the scapular region of a 98 day old fetus. Immunofluorescence analysis confirming expression of UCP1 and PPARG in the tissue (left panel). Immunofluorescence analysis of serial sections of human fetal brown adipose tissue from a 98 day old fetus shown in the right panel. Antibody staining showing expression of GATA6 in brown adipocyte precursors and PPARG expression in the precursors and lipid droplets containing adipocytes (right panel). n>3 sections. [Figure 3C]Immunofluorescence analysis of human fetal brown adipose tissue isolated from the scapular region of 135-day-old fetuses. Expression of PLIN1, PPARG, UCP1 (upper panel), and GATA6 (lower panel) detected with specific antibodies. n≧3 sections. [Figure 4A] FIG. 1 is a schematic diagram illustrating the steps of differentiating human induced pluripotent stem cells (iPSCs) in monolayer culture into presomitic mesoderm (PSM), followed by somite-like stages and somite derivatives. Cells are reseeded between days 16-30 of differentiation to generate brown adipocytes. + indicates additional days after reseeding. [Figure 4B] Venus fluorescent signal in MSGN-Venus knock-in iPSC lines on day 2 of differentiation, n=4. [Figure 4C] Immunofluorescence analysis of the transcription factor TBX6 on day 2 of differentiation, n=4. [Figure 4D] Venus fluorescent signal in PAX3-Venus knock-in iPSC lines on day 8 of differentiation. n=7. [Figure 4E] FACS analysis quantification of PAX3-venus positive cells on day 8 of differentiation. Mean ± standard deviation. n=14. [Figure 4F] UMAP embedding showing cell clusters identified using Leiden-based clustering on human in vitro cultured cells at day 20. Color indicates the identified cell clusters. [Figure 4G] Machine learning classification of human in vitro cultured cells and mouse embryos. A k-NN classifier trained on a cluster of mouse clusters was used to predict the identity of human in vitro cultured progenitors. [Figure 4H] Machine learning classification of human in vitro cultured cells and mouse embryos. A k-NN classifier trained on clusters of E11.5, E12.5, E13.5, E14.5, and E15.5 mouse embryos was used to predict the identity of human in vitro culture time points at days 20, 40, and 60. [Figure 4I] Immunofluorescence analysis of transcription factors EBF2 and PAX7 on differentiation day 20. n=8. [Figure 4J]13 is a UMAP embedding showing the expression of signaling genes from a curated list. [Figure 4K] Immunofluorescence analysis of the transcription factor GATA6 after replating and culturing 20-day-old cultures for 4 days (+4 represents 4 days after replating) in HI medium or adipogenic BCTFT medium, n=5. [Figure 4L] Quantification of GATA6 positive cells in Figure 4G. Mean ± SD, n = 5, t test. p ≤ 0.001. [Figure 4M] RT-qPCR analysis for GATA6, PPARG, and MYOG on day 20 of differentiation and 4 days after replating in HI medium or adipogenic BCTFT medium (+4 represents 4 days after replating). Mean ± SD, n = 6-8, t test, p ≤ 0.0001. [Figure 5A] FIG. 1 outlines the targeting strategy used to generate UCP1-mCherry knock-in iPSC lines. [Figure 5B] Bright field and mCherry signal in iPSC-derived brown adipocyte cultures 40 days after reseeding, n>20. [Figure 5C] Quantification of mCherry positive cells in iPSC-derived brown adipocyte cultures 40 days after replating. Mean ± SD, n=7. [Figure 5D] Immunofluorescence staining with UCP1 and mCherry antibodies in brown adipocyte cultures derived from UCP1-mCherry knock-in iPSC lines 40 days after reseeding. Percentage of UCP1 and mCherry double positive cells out of all mCherry positive cells. n=10. [Figure 5E] Immunofluorescence staining with UCP1 and mCherry antibodies in brown adipocyte cultures derived from UCP1-mCherry knock-in iPSC lines 40 days after reseeding. Percentage of UCP1 and mCherry double positive cells from all mCherry positive cells. n=10. Immunofluorescence staining for PLIN1 antibody in brown adipocyte cultures derived from UCP1-mCherry knock-in iPSC lines 40 days after reseeding. n=6. [Figure 5F]Neutral lipid staining using 0.5 mM BODIPY in iPSC-derived brown adipocyte cultures 40 days after reseeding, n=3. [Figure 5G] RT-qPCR analysis of iPSC-derived brown adipocyte cultures 40 days after reseeding. Mean ± SD, n = 11–14. [Figure 5H] Immunofluorescence staining of mitochondria in iPSC-derived brown adipocyte cultures 40 days after replating, n=5. [Figure 5I] Representative transmission electron micrographs of iPSCs (left) and iPSC-derived brown adipocytes (center and right) demonstrating ultrastructural and mitochondrial features, n=3. [Figure 5J] Immunofluorescence staining of EBF2 (O) and GATA6 (P) in brown adipocyte cultures derived from iPSC-UCP1mCherry knock-in iPSCs on day 40 after reseeding, n=4. [Figure 5K] Immunofluorescence staining of EBF2 (O) and GATA6 (P) in brown adipocyte cultures derived from iPSC-UCP1mCherry knock-in iPSCs on day 40 after reseeding, n=4. [Figure 5L] Periodic acid staining on brown adipocyte precursors (day 20) and brown adipocytes (day 40 after reseeding). n=3. [Figure 5M] Representative transmission electron micrographs demonstrating glycogen accumulation in adipocytes derived from 40-day-old re-plated iPSCs, n=3. [Figure 6A] UMAP embedding showing cell clusters identified using Leiden-based clustering on human in vitro cultured cells at day 60. Color indicates the identified cell clusters. [Figure 6B] Machine learning classification of human in vitro cultured cells and mouse embryos. A k-NN classifier trained on the clusters of mouse clusters was used to predict the identity of the human in vitro culture clusters. [Figure 6C]11 is a merged UMAP embedding showing cell clusters identified using Leiden-based clustering on human in vitro cultured cells at days 20, 40, and 60. Color indicates the identified cell clusters. [Figure 6D] FIG. 11 is a merged UMAP embedding showing cellular time points for human in vitro cultured cells at days 20, 40, and 60. Color indicates culture day. [Figure 6E] 1 is a bar plot showing the percentage of cell clusters per time point. [Figure 6F] Track plots showing expression levels of maker genes for the brown adipocyte lineage in individual cells within the Leiden cluster shown in C (top) and at different ages shown in D (bottom). [Figure 6G] 1 is a graph showing how probability mass flows from precursor clusters to other clusters as time increases, based on the Waddington-OT transition matrix. [Figure 6H] FIG. 13 is a graph showing how probability mass flows from the brown adipocyte progenitor cluster to other clusters as time increases based on the Waddington-OT transition matrix. [Figure 7A] Comparison of track plots showing expression of marker genes for the brown adipocyte lineage in different stages of mouse embryos (left) and in different days of human cultures (right) in the clusters identified in Figure 1A and Figure 6C, respectively. [Figure 7B] Heatmap showing differentially expressed genes in undifferentiated human pluripotent stem cells (iPSCs), human fetal brown adipose tissue (fBAT), adipogenic cultures derived from 40-day-old re-seeded iPSCs (iPSC-BA), and iPSC-derived skeletal muscle (iPSC-SkM, as described in Al Tanoury et al. 2021). Scale bars represent log-normalized read counts. [Figure 7C]WikiPathway2019 human analysis of the top 200 differentially expressed genes (FDR<0.05, log2|FC|>6) in iPSC-BA compared to undifferentiated iPSCs. [Figure 7D] 1. Estimation of browning probability for iPSC-derived brown adipocytes (iPSC-BA), iPSC-derived skeletal muscle (iPSC-SkM), and human fetal brown adipose tissue (fBAT) using the PROFAT database. Numbers represent replicates. [Figure 7E] Heatmap comparing the transcriptome profiles of iPSC-derived brown adipocytes (iPSC-BA) in Zhang et al. 2020 (H9-d50), human fetal brown adipose tissue (fBAT), human embryonic stem cell-derived brown adipocytes, and iPSC-derived brown adipocytes in Carobbio et al. 2021 (KOLF2-C1-d25). [Figure 8A] RT-qPCR analysis of UCP1 in adipogenic cultures from 40-day-old re-plated iPSCs treated with 10 μM forskolin or vehicle control DMSO treatment for 4 hours. Relative gene expression is shown as the relative change to undifferentiated iPSCs. Mean ± SD, n=5, t-test, p≦0.01. [Figure 8B] Measurement of glycerol released in adipogenic cultures from 40 day old re-plated iPSCs in culture medium treated with 10 μM forskolin or vehicle control DMSO treatment for 4 hours. Glycerol amount normalized using total protein amount. Mean ± SD, n=4, t-test, p≦0.01. [Figure 8C] Measurement of fluorescence intensity of thermosensitive ERthermAC dye in iPSC-derived progenitors at day 20 of differentiation and in brown adipocytes 40 days after replating in response to 10 μM forskolin or vehicle control DMSO. Each data point represents the mean ± SD, n=3, t-test, p=0.0009. [Figure 8D]Seahorse assay to measure oxygen consumption rates in iPSC-derived progenitors at day 20 of differentiation and brown adipocytes 40 days after replating in response to 1.5 μM oligomycin, 10 μM forskolin, or vehicle control DMSO, and 1 μM rotenone and antimycin (Rot / AA), respectively. Adipocytes or progenitors were plated into XFe96 cell culture plates one week prior to the assay. Assay medium was prepared using Seahorse XF DMEM supplemented with 1 mM pyruvate, 2 mM glutamine, and 10 mM glucose. Oxygen consumption rates were normalized by the number of cells per well. Each data point represents the mean ± SD, n=3, t-test, p=0.015. [Figure 9A] Schematic diagram of cell isolation strategy for single-cell RNA sequencing. For embryonic days (E) 13.5 and 14.5, the dorsal interscapular region was separated with intact dermis and epidermis. For E15.5, the skin and underlying dermis were removed prior to cell dissociation. For each stage, tissue was isolated from two embryos. Tissues were enzymatically digested and then encapsulated using the inDrops platform. Bar graph showing the number of cells isolated from developing mouse embryos at each stage. Numbers represent the sum of two replicates from each time point. E = embryonic day. [Figure 9B] UMAP embeddings of single cells isolated from E11.5, E12.5, E13.5, E14.5, and E15.5 mouse embryos (50 PC dimensions, 28,244 cells). [Figure 9C] UMAP embedding showing cell clusters identified using Leiden-based clustering on E11.5, E12.5, E13.5, E14.5, E15.5 mouse embryonic single-cell data. [Figure 9D] Normalized confusion matrix showing the contribution of cells from different time points to the identified clusters. [Figure 9E] UMAP embedding showing expression of cluster-specific genes of the curated list. Scale represents log-normalized transcript counts. [Figure 9F]FIG. 1 is a dot plot showing expression of cluster-specific genes from the curated list. The scale represents log-normalized transcript counts. [Figure 10] Figure 10A is a UMAP embedding showing expression of cluster-specific genes of the curated list. The UMAP plot is colored by log-normalized transcript counts. Figure 10B is a graph showing probability mass flow from precursor clusters to other indicated clusters as time increases based on the Waddington-OT transition matrix. Figure 10C is a graph showing how probability mass flows from brown adipocyte precursor clusters to brown adipocyte clusters as time increases based on the Waddington-OT transition matrix. [Figure 11A] UMAP plot generated from mouse single-cell transcriptomics data from developing perivascular adipose tissue at embryonic day 18 as described in Angueira et al. 2021. Cells were clustered using Leiden clustering. [Figure 11B] UMAP plot generated from mouse single-cell transcriptomics data from developing mouse perivascular adipose tissue at embryonic day 18 as described in Angueira et al. 2021. Cells were clustered using Leiden clustering and cell clusters representing the adipocyte lineage were selected. [Figure 11C] UMAP plot showing gene expression patterns in adipogenic cells subsetted from single-cell transcriptomics data from developing perivascular adipose tissue at embryonic day 18 as described in Angueira et al. 2021. Scale represents log-normalized transcript counts. [Figure 11D] Heatmap showing gene expression patterns in adipogenic cells subsetted from single-cell transcriptomics data from developing perivascular adipose tissue at embryonic day 18 as described in Angueira et al. 2021 and the mouse dataset generated in this study. Scale represents log-normalized transcript counts. [Figure 11E] Classifier-based machine learning classification of perivascular adipocytes. A kNN classifier trained on mouse single cell clusters was used to predict the identity of cell clusters described in the study of Angueira et al. 2021. Heatmap shows the percentage of mouse cluster assignments for adipocytes, preadipocytes, and precursors identified in perivascular adipose tissue. BA = brown adipocytes, and BApre = brown adipocyte precursors identified in this study. [Figure 11F] Transverse sections at the forelimb level of E15.5 embryos stained for Dpp4 and keratin 14 (Krt14) antibodies to detect cells from the BApre cluster. NT = neural tube, n > 4. [Figure 11G] Transverse sections from the interscapular region of E15.5 embryos showing co-expression of Ly6a / Sca1 and Cd34 using antibody staining. NT = neural tube, n > 4. [Figure 12A] Transverse sections of Gata6-CreERT2:Rosa26-tdTomato E15.5 embryos at the forelimb level showing the contribution of Gata6-Cre tdTomato positive cells in brown fat and muscle regions. n>3. [Figure 12B] Two representative images of RFP-positive Gata6-tdTomato and Myh11-positive smooth muscle cells in E15.5 embryos at the forelimb level. Insets show enlarged images, n≧3. [Figure 12C] Transverse sections of Gata6-CreERT2:Rosa26-tdTomato embryos at the forelimb level showing tdTomato and Dpp4 double positive cells at E13.5 and E15.5. n≧3. [Figure 13]Figure 13A is a flow cytometry analysis of differentiating iPSC cultures at day 2 to measure the percentage of Mesogenin-Venus positive cells. Mean ± standard deviation, n=4. Figure 13B is a schematic showing the gene targeting strategy to generate PAX3-Venus knock-in iPSC lines. Figure 13C is a representative flow cytometry plot showing the gating strategy to quantify PAX3-Venus positive cells at day 8 of differentiation. Figure 13D is a UMAP embedding showing the expression of cluster-specific genes of a curated list in human cultures at day 20. [Figure 14A] Flow cytometry analysis of differentiating iPSC cultures on day 2 to measure the percentage of Mesogenin-Venus positive cells. Mean ± SD, n=4. [Figure 14B] FIG. 1 is a schematic showing the gene targeting strategy to generate PAX3-Venus knock-in iPSC lines. [Figure 14C] Representative flow cytometry plots showing the gating strategy for quantifying PAX3-Venus positive cells at differentiation day 8. [Figure 14D] UMAP embedding showing expression of cluster-specific genes of a curated list in human cultures at day 20. [Figure 15A] UMAP embedding showing cell clusters identified using Leiden-based clustering in human cultures at day 40. Color indicates the identified cell clusters. [Figure 15B] 13 is a UMAP embedding showing expression of cluster-specific genes of a curated list in day 40 human cultures. [Figure 15C] Machine learning classification of human in vitro cultured cells and mouse embryos. A k-NN classifier trained on a cluster of mouse clusters was used to predict the identity of human in vitro cultured precursors and brown adipocyte precursors. [Figure 16A] 13 is a UMAP embedding showing expression of cluster-specific genes of a curated list in day 60 human cultures. [Figure 16B]Projection of cell identity resulting from clustering analysis of individual time points onto the UMAP of the combined dataset of the three time points. [Figure 17A] Integrated UMAP embeddings of single cells isolated from human cultures at day 20, day 40, and day 60, and from E11.5, E12.5, E13.5, E14.5, and E15.5 mouse embryos. Colors indicate both human and mouse clusters. [Figure 17B] Integrated UMAP embeddings of single cells isolated from day 20, 40, and 60 human cultures, and E11.5, E12.5, E13.5, E14.5, and E15.5 mouse embryos. Colors indicate mouse clusters (left) and human clusters (right). [Figure 17C] Integrated UMAP embeddings of single cells isolated from human cultures at days 20, 40, and 60, and from E11.5, E12.5, E13.5, E14.5, and E15.5 mouse embryos. Colors indicate mouse embryonic day (left) and human culture day (right). [Figure 18] Matrix scatter plot showing transcriptional overlap between brown fat-specific genes in iPSC-derived brown adipocytes (iPSC-BA) in Zhang et al (H9-d50), human fetal brown adipose tissue (fBAT), human embryonic stem cell-derived brown adipocytes, and iPSC-derived brown adipocytes in Carobbio et al (KOLF2-C1-d25). [Figure 19A] 1 shows a schematic diagram of the cell culture and organoid methods of the present disclosure. [Figure 19B] 1 shows a description of the cell culture methods of the present disclosure organized by steps and days. [Figure 20] Shown are four images of 4-month brown adipose tissue (BAT) organoids that were cryosectioned and stained with phalloidin to label lipid droplets, and images are shown in inverse color. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0015] Brown adipocytes (BA) represent a special type of mammalian adipocyte that can separate nutrient catabolism from ATP production and dissipate energy as heat. This mechanism is physiologically important in mammals, allowing non-oscillatory thermogenesis to regulate body temperature in response to cold exposure. BA activity in humans shows an inverse correlation with body mass index and percentage of total body fat mass. Increasing brown fat activity, either by drug therapy or cell therapy approaches, is considered a promising approach for the treatment of metabolic syndrome and obesity. Thus, the generation of brown adipocytes from human pluripotent stem cells has great potential for cell therapy and drug discovery.

[0016] A novel differentiation method for obtaining functional BAs from human pluripotent stem cells is provided herein. The method includes a treatment step with signaling cues identified using FGF2, BMP7, TGFb1, Wnt inhibitors, and triiodothyronine to generate GATA6-positive adipocyte precursors after dissociation and reseeding of the cultures. These precursors can then be highly efficiently differentiated into BAs expressing the characteristic marker UCP1 after culture in adipogenic differentiation medium. BAs differentiated under these conditions are functional and respond to adrenergic stress by lipolysis, heat production, and increased oxygen consumption compared to normal BAs. This protocol leads to the production of 2D cultures highly enriched in BAs and BA precursors that can be used for drug screening or cell therapy.

[0017] definition Unless specifically defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in cell culture, molecular genetics, and biochemistry).

[0018] As used herein, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Thus, for example, reference to a "disease," a "disease state," or a "nucleic acid" is a reference to one or more such embodiments and includes equivalents thereof known to those of skill in the art, and so forth.

[0019] As used herein, the term "about" or "approximately" in the context of a numerical value or range means ±10% of the recited or claimed numerical value or range, unless the context requires a more specific range.

[0020] As used herein, "effective," when referring to an amount of a therapeutic compound, refers to that amount of the compound, when used in the methods disclosed herein, that is sufficient to effect a desired therapeutic response without undue adverse side effects (e.g., toxicity, irritation, or allergic response), commensurate with a reasonable benefit / risk ratio.

[0021] "Reference" means a standard or control condition.

[0022] As used herein, the terms "subject," "patient," "individual," and the like are not intended to be limiting and are generally interchangeable. A subject is a mammal in need of such treatment, e.g., a human having a metabolic disorder.

[0023] As used herein, a "symptom" associated with a disorder includes any clinical or laboratory symptom associated with the disorder, and is not limited to those that can be felt or observed by a subject.

[0024] As used herein, "treating" includes, for example, inhibiting, regressing, or halting the progression of a disorder. Treatment also includes ameliorating one or more symptoms of a disorder. As used herein, "inhibiting" disease progression or disease complications in a subject means preventing or reducing the rate, frequency, or risk of disease progression and / or disease complications in a subject. The terms "preventing" and "prevention" refer to the implementation of a treatment protocol on a clinically asymptomatic individual susceptible or predisposed to a particular adverse condition, disorder, or disease, thus reducing the risk of developing the condition and / or its underlying cause.

[0025] The transitional term "comprising" is synonymous with "including," "containing," or "characterized by" and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. In contrast, the transitional phrase "consisting of" excludes any element, step, or ingredient not specified in the claim. The transitional phrase "consisting essentially of" limits the scope of the claim to certain materials or steps, "and which do not materially affect the basic and novel characteristic(s)" of the claimed invention.

[0026] Other features and advantages of the present invention will be apparent from the following description of the preferred embodiments thereof, and from the claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below.

[0027] A method for generating Gata6-positive brown adipose precursor cells The present disclosure provides a method for generating BAT cells, preferably human BAT cells, from precursor cells, such as paraxial mesoderm (presomitic mesoderm) (PAM) cells. PAM cells exhibit characteristics of paraxial mesoderm precursor cells. In one embodiment, PAM cells are characterized by the following properties: a) they express one, two, or all three of the biomarkers PAX3, Myf5, and optionally Pax7, which are characteristic of paraxial mesoderm progenitor cells; b) They are pluripotent cells capable of differentiating, under appropriate culture conditions in vivo and / or in vitro, into at least the brown adipose, endothelial, skeletal, dermal, and muscle cell lineages.

[0028] Optionally, they may have long-term self-renewal properties, e.g., they may be maintained in culture for over six months. The pluripotency of PAM cells can be tested in vitro, e.g., by in vitro differentiation into adipose, skeletal, skin, or muscle cell lineages, using the protocols described below, particularly in the Examples.

[0029] In some embodiments, the precursor cells, e.g., paraxial mesoderm cells, are preferably induced pluripotent stem (iPS) cells or embryonic stem (ES) cells, e.g., induced paraxial mesoderm (iPAM) cells derived from human pluripotent stem cells. Methods for obtaining and generating PAM cells are known in the art, see, e.g., WO2013030243 and Chal et al. 2015, Loh et al., Cell. 2016 Jul 14;166(2):451-67, Shelton et al., Stem Cell Reports. 2014 Sep 9;3(3):516-529, Xi et al., Cell Rep. 2017 Feb 7;18(6):1573-1585, Choi et al. Cell Rep. 2016 Jun 7;15(10):2301-12, and Hosoyama et al., Stem Cells Transl Med. 2014 May;3(5):564-74.

[0030] In some embodiments, the method comprises culturing iPS or ES cells in the presence of one Wnt activator, such as a Wnt ligand, a GSK3 beta inhibitor, or a member of the R-spondin family, or both a Wnt activator and a BMP inhibitor, such as an ALK inhibitor. In some embodiments, progenitor cells, such as autologous or primary cells, isolated from a subject are differentiated using the medium described, and a method for isolating CD34+ BAT progenitor cells from a subject's skeletal muscle is described in U.S. Pre-Grant Publication No. 20160303100.

[0031] Studying the development of the brown adipose lineage has proven complex due to the difficulty in identifying intermediate stages of differentiation. Single-cell sequencing techniques, together with lineage tracing methods, now provide a powerful approach to explore cell states during the differentiation program. Disclosed herein is the characterization of interscapular mouse brown fat development using scRNAseq. We analyzed the development of a paraxial mesoderm-derived cell population in the dorsal trunk at the forelimb level of mouse embryos that contain interscapular brown fat. This analysis identified a previously unrecognized stage of brown adipocyte differentiation characterized by the expression of the transcription factor Gata6. Using bioinformatics tools and lineage tracing analysis in mice, we reveal that these cells originate from a multipotent fibroblast precursor population and give rise to Pparg-positive preadipocytes that differentiate into UCP1-positive brown adipocytes (Figures 1E, 2B).

[0032] Our data also suggest that signaling cues known to be important for brown adipogenesis, such as Wnt inhibition and BMP activation, act at the Gata6-positive precursor stage. We show that Bmp4 / 7 and Bmpr1a / 2 are enriched in Gata6-positive precursors, consistent with the established role of Bmp in promoting brown adipogenesis (Schulz et al., 2013; Tseng et al., 2008). We also observed transient expression of Wnt inhibitors Sfrp1, 2, and 4, as well as Dkk2, in Gata6-positive precursors, consistent with the well-known anti-adipogenic effect of Wnt signaling (Bagchi and MacDougald, 2021; Longo et al., 2004). Thyroid hormone and FGF / IGF1 / PI3K pathways, which play a role in thermogenesis and control of brown fat development and physiology, were also activated in Gata6 precursors (Mullur et al., 2014; Ohta and Itoh, 2014). We modified a protocol to result in highly efficient generation of functional human brown adipocytes in vitro using defined serum-free culture conditions. scRNAseq analysis of human cells differentiating in vitro shows that they recapitulate a developmental sequence highly similar to that observed in mice in vivo. This sequence leads to the production of GATA6-positive brown adipocyte precursors, which then give rise to PPARG-positive preadipocytes and finally to UCP1-positive adipocytes that exhibit functional properties characteristic of brown adipocytes.

[0033] Our analysis using the STREAM or Waddington OT pipeline suggests that brown adipocyte precursors share common precursors with other somitic-derived mesenchymal lineages such as dermis, muscle connective tissue, cartilage precursors, and smooth muscle (Figure 1E) (Chen et al., 2019; Schiebinger et al., 2019). In contrast, in our dataset, the skeletal muscle cluster is clearly separated from the mesenchymal cluster. This is consistent with the early branching of Pax7-expressing multipotent precursors into the skeletal muscle lineage by E11.5, as revealed by lineage tracing experiments in mice (Lepper and Fan, 2010). Lineage tracing analysis in mice demonstrated that interscapular brown fat is derived from Pax3 / Myf5+ and Pax3 / Pax7 / Myf5+ cells (Sebo et al., 2018). Our lineage tracing experiments confirm that some of the mouse interscapular brown fat originates from Pax7-expressing precursors that can give rise to a Gata6-positive brown adipocyte precursor population (Lepper and Fan, 2010; Sanchez-Gurmaches and Guertin, 2014). These early Pax7 precursors may correspond to En1-positive cells of the median cutaneous muscle plate previously identified in mice (Atit et al., 2006). We reanalyzed a scRNAseq dataset of developing mouse periaortic BAT and observed a population of Gata6-positive BA precursors closely related to those identified in interscapular BAT (Angueira et al., 2021). Interestingly, periaortic BAT receives little contribution from PAX3+ cells and no contribution from Myf5+ cells (Sanchez-Gurmaches and Guertin, 2014). This therefore suggests that different embryonic populations may contribute to the Gata6-positive brown adipocyte precursors.

[0034] Gata6 (GATA binding protein 6) is a zinc finger transcription factor that plays an essential role in the development of extraembryonic tissues (Koutsourakis et al., 1999). Its null mutation in mice results in lethality shortly after implantation. Gata6 has also been implicated in the development of several organs, including the heart, lung, intestine, pancreas, and skin, but its expression during brown fat development has not been reported so far (Freyer et al., 2015; Morrisey et al., 1996). However, Gata6 was identified in silico in the ProFat database as a transcription factor that potentially regulates the expression of brown fat-specific genes such as Zic1 and TCA cycle enzymes such as citrate synthase (Cs) (Cheng et al., 2018). Also, a GATA recognition motif was identified in ATACseq data of human adipocytes during in vitro differentiation (Zhang et al., 2020). In cardiomyocytes, GATA-6 was shown to associate with Ppara to regulate the expression of the glucose transporter Glut4 (Yao et al., 2012). Collectively, these data suggest that Gata6 may play a role in regulating energy metabolism in differentiating brown adipocytes.

[0035] Our transcriptome analysis of brown adipocyte lineage development in mice identified signaling cues that allowed us to modify our paraxial mesoderm development protocol to generate brown fat from hPSCs. This also provided us with a benchmark against which differentiating hPSCs could be compared. Comparison of differentiated human adipocytes generated in vitro in our protocol with those generated by two other recently published protocols (Carobbio et al., 2021; Zhang et al., 2020) suggests that the transcriptional signature of adipocytes generated in our conditions is closer to endogenous fetal brown adipocytes. In humans, BAT activity is inversely correlated with body mass index and percentage of total body fat (Cypess et al., 2009; Saito et al., 2009). Furthermore, ectopic BAT transplants result in improved glucose metabolism in diabetic or obese mice (Gunawardana and Piston, 2012; Stanford et al., 2013). Thus, our study may aid in the development of cell therapy strategies involving transplants of in vitro generated human brown adipocytes for the treatment of obesity, metabolic syndrome, and diabetes.

[0036] As described herein, the method for generating BAT and / or BA progenitor cells from source cells, such as embryonic stem cells (ESCs) or induced pluripotent stem cells (iPSCs), can include an induction step of culturing PAX3-positive progenitors, preferably in an adherent or organoid state, in the presence of a cocktail comprising FGF2 / BMP7 / TGBb1 / Wnt inhibitor / T3, an example of which is shown in Figure 19A. BA progenitor cells and / or BAT are particularly suitable for cell therapy applications.

[0037] Adhesion state In some embodiments, Gata6 positive cells are produced by the following method: In some embodiments, human induced pluripotent stem cells (iPSCs) are enzymatically dissociated into single cells and plated at 10,000-50,000 cells / cm in cell culture dishes in feeder-free maintenance medium supplemented with ROCK inhibitor. 2 In some embodiments, the cells are seeded at a density of 100-200 μg / ml. In some embodiments, the cells are treated with basal medium supplemented with insulin-transferrin-selenium, GSK3 inhibitor, and BMP inhibitor (presomitic mesoderm / PSM medium) for 2-5 days to generate small pluripotent colonies. In some embodiments, over the next 3 days, the cells are cultured in basal medium supplemented with insulin-transferrin-selenium, GSK3 inhibitor, and BMP inhibitor, as well as FGF activator. To differentiate the cells into PAX3-positive somite precursors, in some embodiments, the cells are treated with high glucose medium supplemented with serum-free medium, non-essential amino acid supplement, synthetic basal medium, HGF activator, IGF activator, FGF activator, and BMP inhibitor for 1-5 days. In some embodiments, the cells are further treated with Wnt activator to differentiate into PAX3-positive somite precursors. In some embodiments, PAX3 positive cells are further differentiated into Pax7 and EBF2 positive progenitors in high glucose medium supplemented with serum-free medium, non-essential amino acid supplement, synthetic basal medium, HGF activator, IGF activator for 5-30 days. To generate brown adipocyte precursors, in some embodiments, cells are dissociated into single cells using enzymes in PBS, filtered, and plated at 30,000-150,000 cells / cm on cell culture dishes. 2and treated for 1-10 days in high glucose medium supplemented with serum-free medium, insulin-transferrin-selenium, FGF activator, PROCN inhibitor (Wnt inhibitor), BMP activator, TGFβ activator, and thyroid hormone receptor activator (collectively, adipocyte precursor medium). In some embodiments, after 4-6 days, cells are cultured for 20-50 days in high glucose medium supplemented with serum-free medium, insulin-transferrin-selenium, phosphodiesterase inhibitor, antioxidant (e.g., vitamin C), thyroid hormone receptor activator, TGFβ inhibitor, corticosteroid, EGF activator, second corticosteroid, and insulin sensitizer (collectively, adipogenic differentiation medium), with the adipogenic differentiation medium being changed every 2-3 days.

[0038] In some embodiments, human induced pluripotent stem cells (iPSCs) are dissociated into single cells using Accutase and plated at 30,000-33,000 cells / cm on Matrigel-coated dishes in mTESR-1 supplemented with 10 μM Y-27632. 2In some embodiments, the cells are seeded at a density of 100-200 μg / ml. In some embodiments, the cells are allowed to generate small pluripotent colonies and treated with DMEM / F12 GlutaMAX supplemented with 1% ITS, 3 μM CHIR99021, and 0.5 μM LDN-193189 (PSM medium) for three days. In some embodiments, for the next three days, the cells are cultured in DMEM / F12 GlutaMAX supplemented with 1% ITS, 3 μM CHIR99021, 0.5 μM LDN-193189, and 20 ng / ml FGF-2. To differentiate the cells into PAX3-positive somite precursors, in some embodiments, the cells are treated with Dulbecco's Modified Eagle Medium (DMEM) high glucose medium supplemented with 15% KSR, 1× non-essential amino acid (NEAA) solution, 0.01 mM bME, 10 ng / ml HGF, 2 ng / ml IGF-1, 20 ng / ml FGF-2, and 0.1 μM LDN-193189 for 2 days. In some embodiments, the PAX3-positive cells are differentiated into PAX7 and EBF2-positive precursors for an additional 8-23 days in DMEM high glucose supplemented with 15% KSR, 1× NEAA, 0.01 mM bME, 10 ng / ml HGF, and 2 ng / ml IGF-1. To generate brown adipocyte precursors, in some embodiments, cells are dissociated into single cells using collagenase type IV and trypsin-EDTA in PBS, filtered through a 30 μm filter, and plated on Matrigel-coated dishes at 60,000-100,000 cells / cm. 2 and treated with DMEM high glucose supplemented with 5% KSR, 1% ITS, 2 ng / ml FGF-2, 20 nM C59, 20 ng / ml BMP7, 10 ng / ml TGFb1, 2 nM T3 (adipocyte precursor medium) for 4-6 days. In some embodiments, after 4-6 days, cells are cultured in DMEM high glucose supplemented with 5% KSR, 1% ITS, 500 μM IBMX, 25.5 μg / ml L-ascorbic acid, 2 nM T3, 5 μM TGFb inhibitor SB431542, 1 μM dexamethasone, 10 ng / ml EGF, 4 μg / ml hydrocortisone, 1 μM rosiglitazone (adipogenic differentiation medium) for 30-40 days, with the adipogenic differentiation medium being changed every 2-3 days.

[0039] Recombinant proteins, activators / agonists, and antagonists / inhibitors are typically supplemented with the medium at 0.1 ng / mL to 1 mg / mL each. Small compound / molecule activators or inhibitors are typically supplemented at 1 nM to 1 mM each. Cultures are then changed to adipogenic differentiation medium and refreshed every 2-3 days. Adipogenic differentiation medium includes DMEM-based medium containing serum replacement supplements, 1× insulin-transferrin-selenium (ITS, Gibco), as known in the art or described herein, and further containing 0.5 mM isobutylmethylxanthine (IBMX), 125 nM indomethacin, 1 nM triiodothreonine (T3), 5 mM dexamethasone, and 1 mM rosiglitazone (see also the related adipogenic cocktail described in Sharma et al, PO2014 and US20150030662).

[0040] Organoid / somitoid state Methods for producing BA and / or BAT in 3D are provided herein. In some embodiments, BA containing organoids can be obtained from source cells, e.g., ESCs or iPSCs, e.g., human iPSCs, by a protocol that includes an induction step of culturing PAX3-positive precursors with FGF2 / BMP7 / TGBb1 / Wnt inhibitor / T3 treatment as described in the above protocol. Briefly, in some embodiments, iPSC cultures are dissociated into single cells using enzymes and aggregated into non-adherent plates to form 3D structures. These structures, called somitoids, are cultured in basal medium supplemented with insulin-transferrin-selenium, GSK3 inhibitor, and serum-supplemented basal medium containing BMP inhibitor (presomitic mesoderm / PSM medium) to generate PAX3-expressing somite-like structures and dermomyoderm cells. In some embodiments, cells are further treated with Wnt activator to generate PAX3-expressing somite-like structures. In some embodiments, somitoids are then cultured for 2-15 days in high glucose medium supplemented with serum-free medium, insulin-transferrin-selenium, FGF activator, PROCN inhibitor (Wnt inhibitor), BMP activator, TGFβ activator, and thyroid hormone receptor activator (collectively, adipocyte precursor medium). In some embodiments, to differentiate Gata6-positive progenitors into lipid vesicles containing BAs, somitoids are cultured for 20-40 days in adipogenic differentiation medium (serum-free medium, high glucose medium supplemented with basal medium containing insulin-transferrin-selenium, phosphodiesterase inhibitors, antioxidants (e.g., vitamin C), thyroid hormone receptor activators, TGFβ inhibitors, corticosteroids, EGF activators, a second corticosteroid, and an insulin sensitizer (collectively, adipogenic differentiation medium). This method leads to the production of three-dimensional organoids that are highly enriched in UCP1-positive BAs. These organoids act as glucose sinks and serve as substrates to be transplanted into patients for cellular therapy of obesity, type II diabetes, or metabolic syndrome.

[0041] Methods for producing BA and / or BAT in 3D are provided herein. In some embodiments, BA containing organoids can be obtained from source cells, e.g., ESCs or iPSCs, e.g., human iPSCs, by a protocol that includes an induction step of culturing GATA6+BA precursors with FGF2 / BMP7 / TGBb1 / T3 treatment as described in the above protocol. Briefly, in some embodiments, iPSC cultures are dissociated into single cells using Accutase and aggregated in non-adhesive U-bottom plates to form 3D structures. These structures, called somitoids, are cultured for 11 days in DMEM / F12 GlutaMAX (PSM medium) supplemented with 1% ITS, 3 μM CHIR99021, and 0.5 μM LDN-193189 supplemented with 5% FCS to generate PAX3-expressing somite-like structures and panniculus carnosus cells. In some embodiments, somitoids are then cultured for 4-12 days in DMEM high glucose supplemented with 5% KSR, 1% ITS, 2 ng / ml FGF-2, 20 nM C59, 20 ng / ml BMP4, 10 ng / ml TGFb1, 2 nM T3 (adipocyte precursor medium). In some embodiments, somitoids are cultured for 20-40 days in adipogenic differentiation medium (DMEM high glucose supplemented with 5% KSR, 1% ITS, 500 μM IBMX, 25.5 μg / ml L-ascorbic acid, 2 nM T3, 5 μM TGFb inhibitor SB431542, 1 μM dexamethasone, 10 ng / ml EGF, 4 μg / ml hydrocortisone, 1 μM rosiglitazone) to differentiate the precursors into lipid vesicles containing BAs. The method leads to the production of 3D organoids highly enriched in UCP1-positive BAs, which act as glucose sinks and serve as substrates for transplantation into patients for cellular therapy of obesity, type II diabetes, or metabolic syndrome.

[0042] Recombinant proteins, activators / agonists, and antagonists / inhibitors are typically supplemented with the medium at 0.1 ng / mL to 1 mg / mL each. Small compound / molecule activators or inhibitors are typically supplemented at 1 nM to 1 mM each. Cultures are then changed to adipogenic differentiation medium and refreshed every 2-3 days. Adipogenic differentiation medium comprises a DMEM-based medium containing serum replacement supplements, 1X insulin-transferrin-selenium (ITS, Gibco), as known in the art or described herein, and further containing 0.5 mM isobutylmethylxanthine (IBMX), 125 nM indomethacin, 1 nM triiodothreonine (T3), 5 mM dexamethasone, and 1 mM rosiglitazone (see also the related adipogenic cocktail described in Sharma et al, PO2014 and US20150030662).

[0043] Wnt activators and inhibitors The method can include the use of an agonist or activator of the canonical Wnt / beta-catenin signaling pathway, which is characterized by the Wnt-dependent inhibition of glycogen synthase kinase 3β (GSK-3β), resulting in the stabilization of β-catenin, which then translocates to the nucleus and acts as a transcription factor. As used herein, the term "activator" refers to a molecule, such as an antibody, protein, nucleic acid, or small molecule, that enhances Wnt signaling activity. For example, for the canonical Wnt / β-catenin signaling pathway, this activity can be measured by Wnt reporter activity using established multimers of LEF / TCF binding site reporters, and / or inhibition of GSK-3β, and / or activation of canonical Wnt target genes such as T, Tbx6, Msgn1, or Axin2.

[0044] In some embodiments, the GSK-3β inhibitor activates the Wnt pathway. Inhibitors of GSK-3β are known in the art and include lithium chloride (LiCl), purvalanol A, olomoucine, alsterpaullone, kenpaullone, the maleimide derivatives SB216763 (3-(2,4-dichlorophenyl)-4-(1-methyl-1H-indol-3-yl)-1H-pyrrole-2,5-dione) and SB415286 (3-[(3-chloro-4-hydroxyphenyl)amino]-4-(2-nitrophenyl)-1H-pyrrole-2,5-dione). 2,5-dione), benzyl-2-methyl-1,2,4-thiadiazolidine-3,5-dione (TDZD-8), 2-thio(3-iodobenzyl)-5-(1-pyridyl)-[1,3,4]-oxadiazole (GSK3 inhibitor II), 2,4-dibenzyl-5-oxothiadiazolidine-3-thione (OTDZT), (2′Z,3′E)-6-bromoindirubin-3′-oxime (BIO), α4 dibromoacetophenone (i.e., Tau protein kinase I (TPK I) inhibitors), 2-chloro-1-(4,5-dibromo-thiophen-2-yl)-ethanone, N-(4-methoxybenzyl)-N'-(5-nitro-1,3-thiazol-2-yl)urea (AR-A014418), and indirubins (e.g., indirubin-5-sulfonamide; indirubin-5-sulfonic acid (2-hydroxyethyl)-amide indirubin-3'-monoxime; 5-iodo-indirubin-3'-monoxime; 5-fluoroindirubin; 5,5'-dibromoindirubin; 5-nitroindirubin; 5-chloroindirubin; 5-methylindirubin;5-bromoindirubin), 4-benzyl-2-methyl-1,2,4-thiadiazolidine-3,5-dione (TDZD-8), 2-thio(3-iodobenzyl)-5-(1-pyridyl)-[1,3,4]-oxadiazole (GSK3 inhibitor II), 2,4-dibenzyl-5-oxothiadiazolidine-3-thione (OTDZT), (2′Z,3′E)-6-bromoindirubin-3′-oxime (BIO), α4 dibromoacetophenone (i.e., Tau protein kinase I (TPK I) inhibitors), 2-chloro-1-(4,5-dibromo-thiophen-2-yl)-ethanone, (vi) N-(4-methoxybenzyl)-N′-(5-nitro-1,3-thiazol-2-yl)urea (AR-A014418), and H-KEAPPAPPQSpP-NH2 (L803), or its cell-permeable derivative Myr-N-GKEAPPAPPQSpP-NH2 (L803-mts). Other GSK3β inhibitors are disclosed in Patent Nos. 6,417,185, 6,489,344, 6,608,063, and published U.S. applications Nos. 201603750062, 0040138273, 20040106574, 20040077707, 20040034037, 20030216574, and 20030130289.

[0045] Other activators of Wnt signaling include WAY-316606 (SFRP inhibitor) Bodine et al., Bone. 2009 Jun;44(6):1063-8, (hetero)arylpyrimidines (Gilbert et al., Bioorg Med Chem Lett. 2010 Jan 1;20(1):366-70), IQ1 (PP2A activator) Miyabayashi et al., Proc Natl Acad Sci US A. 2007 Mar 27;104(13):5668-73(2007), QS11 (ARFGAP1 activator) Zhang et al., Proc Natl Acad Sci US A. 2007 May 1;104(18):7444-8, SB-216763 (GSK3 inhibitor) Coghlan et al., Chem Biol. 2000 Oct;7(10):793-803(2000), CHIR99021 (6-[[2-[[4-(2,4-dichlorophenyl)-5-(5-methyl-1H-imidazol-2-yl)-2-pyrimidinyl]amino]ethyl]amino]-3-pyridinecarbonitrile, a GSK3 inhibitor), DCA (beta-catenin activator) Pai et al., Mol Biol Cell. 2004 May;15(5):2156-63, and 2-amino-4-[3,4-(methylenedioxy)benzyl-amino]-6-(3-methoxyphenyl)pyrimidine (AMBMP) Liu et al., Inflamm Res. 2016 Jan;65(1):61-9. Wnt activators may be effective in the methods provided herein in the range of 0.1 micromolar to 10 micromolar. For example, the Wnt activators described herein can be used at concentrations of 0.2 μM, 0.3 μM, 0.4 μM, 0.5 μM, 0.6 μM, 0.7 μM, 0.8 μM, 0.9 μM, 1.0 μM, 1.1 μM, 1.2 μM, 1.3 μM, 1.4 μM, 1.5 μM, 1.6 μM, 1.7 μM, 1.8 μM, 1.9 μM, 2.0 μM, 3 μM, 4 μM, 5 μM, 6 μM, 7 μM, 8 μM, 9 μM, 10 μM, and any concentration therebetween.

[0046] Natural or modified forms of Wnt ligands can also be used as Wnt activators in the form of purified or recombinant proteins. Wnt ligands include a large family of Wnt activators, including but not limited to Wnt-1, Wnt-2, Wnt-2b, Wnt-3a, Wnt-4, Wnt-5a, Wnt-5b, Wnt-6, Wnt-7a, Wnt-7a / b, Wnt-7b, Wnt-8a, Wnt-8b, Wnt-9a, Wnt-9b, Wnt-10a, Wnt-10b, Wnt-11, Wnt-16b, Wnt-3. The R-spondin family, including R-spondin1, R-spondin2, R-spondin3, and R-spondin4, are potent Wnt signaling enhancers through binding to LGR4 / 5 surface receptors. Natural or modified synthetic polypeptide fragments generated from known Wnt activator polypeptide sequences can also be potential Wnt activators. When the activator of Wnt signaling pathway is protein, it can be purified protein or recombinant protein or synthetic protein.Alternatively, the conditioned medium produced from the cell line that is engineered to express one or several Wnt ligands can be used as Wnt activator.Wnt signaling can also be activated by blocking the negative regulator of Wnt signaling, such as Axin and APC, using RNA interference.

[0047] In some embodiments, the methods disclosed herein use Wnt inhibitors. The terms "Wnt antagonist", "Wnt inhibitor" and "inhibitor of Wnt signaling" are used interchangeably herein to mean an agent that antagonizes, inhibits, suppresses or negatively regulates Wnt regulation of cellular activity. Similarly, the phrases "antagonizing Wnt signaling" and "inhibiting Wnt signaling" are used interchangeably herein to mean antagonizing, inhibiting or otherwise negatively regulating Wnt regulation of cellular activity. Wnt inhibitors may act anywhere along the Wnt signaling pathway to antagonize Wnt signaling. For example, Wnt inhibitors may antagonize the activation of Wnt co-receptors, for example, by blocking Wnt binding, or they may antagonize the activity of proteins in Wnt-responsive intracellular signaling cascades, for example, Wnt / β-catenin, Wnt / PCP or Wnt / Ca2+ signaling pathways, for example, by promoting β-catenin degradation or preventing translocation of stabilized β-catenin to the nucleus. Wnt inhibitors can include small molecule inhibitors and small proteins.

[0048] Non-limiting examples of Wnt inhibitors include members of the Dkk family (Dickkopf proteins), including Dkk-1, Dkk-2, Dkk-3, Dkk-4, Soggy-1 / DkkL1. Further examples of Wnt inhibitors include secreted frizzled-related proteins (sFRPs), including sFRP-1, sFRP-, sFRP-3, sFRP-4, and sFRP-5. Further examples of Wnt inhibitors include porcupine inhibitors. Other examples of Wnt inhibitors include APCDD1, APCDD1L, draxin, IWP, IWP-2, IWP-4, ginsenoside Rh4, M2912, KY-05009, ICG-001, INCB28060 / INC280 / NVP-INC280, IWR-1-endo, KY02111, FH535, WIKI4, CCT251545, salinomycin, prodigiosin, IQ-1, KYA1797K, NCB-0846, PNU-74654, LF3, iCRT14, adavivint, PRI-724, triptonide, M435-1279, and resibufogeni. Wnt inhibitors include LGK974, C59, ETC-159, JW55, RCM-1, MSAB, Ant1.4Br / Ant1.4Cl, niclosamide, apicularen, bafilomycin, XAV939, IWR, G007-LK, G244-LM, lanatoside C, pyrvinium, NSC668036, 2,4-diamino-quinazoline, quercetin, isoquercitrin, ICG-001, PKF115-584, BC2059 / tegavivint, schizocaol D, IGFBP-4, LMBR1L, Notum, SOST / sclerostin, USAG1, WIF-1. Wnt inhibitors can be effective in the methods provided herein in the range of 0.1 micromolar to 10 micromolar. For example, the Wnt inhibitors described herein can be used at concentrations of 0.2 μM, 0.3 μM, 0.4 μM, 0.5 μM, 0.6 μM, 0.7 μM, 0.8 μM, 0.9 μM, 1.0 μM, 1.1 μM, 1.2 μM, 1.3 μM, 1.4 μM, 1.5 μM, 1.6 μM, 1.7 μM, 1.8 μM, 1.9 μM, 2.0 μM, 3 μM, 4 μM, 5 μM, 6 μM, 7 μM, 8 μM, 9 μM, 10 μM, and any concentration therebetween.

[0049] BMP activators and inhibitors Bone morphogenetic protein (BMP) activators or agonists refer to molecules, e.g., antibodies, proteins, nucleic acids, or small molecules, that enhance BMP signaling activity. Typically, BMP signaling pathway agonists / activators bind to or directly activate components of biological pathways in which BMPs are involved, e.g., BMP receptor proteins (e.g., BMP1-type receptors ALK2 and / or ALK3) or downstream SMAD proteins. Examples of known BMP signaling activators include BMP7, BMP4, and BMP2. BMP activators can be effective in the methods provided herein in the range of 1 ng / ml to 1000 ng / ml. For example, the BMP activator described herein can be used at 1ng / ml, 10ng / ml, 100ng / ml, 200ng / ml, 300ng / ml, 400ng / ml, 500ng / ml, 600ng / ml, 700ng / ml, 800ng / ml, 900ng / ml, 1000ng / ml, and any concentration therebetween. Bone morphogenetic protein (BMP) antagonist or inhibitor refers to a molecule, such as an antibody, protein, nucleic acid, or small molecule, that inhibits or attenuates the biological activity of the BMP signaling pathway, either by directly interacting with BMP or by acting on a component of the biological pathway in which BMP is involved, such as a BMP receptor protein (e.g., BMP I type receptor ALK2 and / or ALK3) or a downstream SMAD protein. Typically, a compound is considered to be an inhibitor of the BMP signaling pathway if the level of phosphorylated Smad1, 5, or 8 is reduced after culturing cells in the presence of the compound compared to cells cultured in the absence of the compound. The level of phosphorylated Smad protein can be measured by Western blot using an antibody specific for the phosphorylated form of the Smad protein.

[0050] Examples include LDN-193189 (DM3189), a derivative of noggin, chordin, or dorsomorphin, which are inhibitors of the transduction activity of BMP type 1 receptors ALK2 and / or ALK3. Noggin, chordin, follistatin, and gremlin block BMP signaling by sequestering secreted BMP and preventing it from binding to its receptor. The inhibitor of the BMP signaling pathway can be a BMP antagonist, a compound that blocks BMP type 1 and / or type II receptor activity (BMPI / type II receptor inhibitor), an inhibitor of BMP type 1 and / or type II gene expression, or a molecule that inhibits any downstream step of the BMP signaling pathway. The inhibitor of BMP signaling can be a natural or synthetic compound. When the inhibitor of the BMP signaling pathway is a protein, it can be a purified protein or a recombinant protein or a synthetic protein. Non-limiting examples of BMP inhibitors include A77-01, A83-01, LDN193189 dihydrochloride, dorsomorphin dihydrochloride, DMG-1, SB505124, ML347, M4K2163, K02288, DMH1, DMH2, dorsomorphin, noggin, follistatin, and cerberus.

[0051] It is well known in the art that inhibitors of BMP I type receptors can block BMP signaling pathways.See, for example, Yu et al., Nat Chem Biol. 2008.

[0052] In one non-limiting example, the inhibitor of the BMPI type receptor is dorsomorphin, a compound generated by structure-activity studies (Cuny GD et al., 2008), e.g., LDN-193189, or any derivative thereof. Dorsomorphin (6-[4-(2-piperidin-1-yl-ethoxy)phenyl]-3-pyridin-4-yl-pyrazolo[1,5-a]pyrimidine), also known as Compound C, specifically inhibits BMP I type receptors (ALK2, 3, and 6) (Yu PB et al., 2008). For additional BMP inhibitors, see 2013030243, which is incorporated by reference in its entirety. BMP inhibitors may be effective in the methods provided herein in the range of 1 nM to 1000 nanomolar. For example, the BMP inhibitors described herein may be used at 1 nM, 10 nM, 100 nM, 200 nM, 300 nM, 400 nM, 500 nM, 600 nM, 700 nM, 800 nM, 900 nM, 1000 nM, and any concentration therebetween.

[0053] Hepatocyte growth factor (HGF) activators / agonists Hepatocyte growth factor signaling pathway agonist / activator is a molecule, such as an antibody, a protein, a nucleic acid, or a small molecule, that enhances HGF signaling activity. Typically, HGF signaling pathway agonist / activator binds to or directly activates c-Met proto-oncogene (HGFR) receptor. Examples of known HGF signaling activators include hepatocyte growth factor scatter factor (HGF-SF), HGF mutants as further described in U.S. Patent Nos. 5,227,158, 5,316,921, and 5,328,837, and HGFR-activating antibodies such as MAb DO-24, 6E10, or 3D6, as described in Pietronave et al, Am J Physiol Heart Circ Physiol. 2010 Apr; 298(4): H1155-65 and US08 / 884,669. Among the intracellular signaling pathways transduced by HGFR activation are the MAPK, STAT3, and PI3K / Akt signaling axes. These intracellular pathways can be monitored for transduction cascade activation using biochemical reporter assays, as known in the art. HGF signaling activity can be measured by biological assays such as mitogenic, motogenic, or morphogenic activity as a result of HGF binding to the HGF receptor. In particular, c-MET activation can result in the disruption of cadherin-based cell-cell contacts and promote cell motility as evidenced by the cell scattering phenotype first described with MDCK cells treated with HGF (Zhu et al., Cell Growth Differ. 1994 Apr; 5(4): 359-66). HGF activators can be effective in the methods provided herein in the range of 1-1000 ng / ml. For example, the HGF activators described herein can be used at concentrations of 1 ng / ml, 10 ng / ml, 100 ng / ml, 200 ng / ml, 300 ng / ml, 400 ng / ml, 500 ng / ml, 600 ng / ml, 700 ng / ml, 800 ng / ml, 900 ng / ml, 1000 ng / ml, and any concentration therebetween.

[0054] Insulin-like growth factor (IGF) activators / agonists Insulin-like growth factor signaling pathway agonists / activators are molecules, such as antibodies, proteins, nucleic acids, or small molecules, that enhance IGF signaling activity. Examples of known IGF activators include IGF-1 (e.g., somatomedin C), MGF, IGF-2, and insulin, demethylasteriquinone B-1 (DMAQ-B1; Salituro et al., Recent Prog Horm Res 2001;56:107-26). Typically, IGF signaling pathway agonists / activators bind to or directly activate IGF1 receptor (IGF1Ra, b), and / or insulin receptor (IR), and / or insulin receptor-related receptor IR-related receptor (IRR). IGF signaling leads to the activation of several intracellular pathways, including the RAS-MAP kinase pathway, PI3K / AKT, and PI3K / mTor signaling pathways. These intracellular pathway activities can be monitored using biochemical reporter assays and transduction cascade activation, as known in the art. IGF activators may be effective in the methods provided herein in the range of 1-1000ng / ml. For example, the IGF activators described herein may be used at 1ng / ml, 10ng / ml, 100ng / ml, 200ng / ml, 300ng / ml, 400ng / ml, 500ng / ml, 600ng / ml, 700ng / ml, 800ng / ml, 900ng / ml, 1000ng / ml, and any concentration therebetween.

[0055] Fibroblast Growth Factor Activators / Agonists Fibroblast growth factor signaling pathway agonists / activators are molecules, such as antibodies, proteins, nucleic acids, or small molecules, that enhance FGF signaling activity. Examples of FGF signaling pathway agonists / activators are the natural or recombinant protein ligands including the 23 identified FGF ligands, such as FGF-1, FGF-2, FGF-3, FGF-4, FGF-5, FGF-6, FGF-7, FGF-8, FGF-9, FGF-10, FGF-11, FGF-12, FGF-13, FGF-14, FGF-15, FGF-16, FGF-17, FGF-18, FGF-19, FGF-20, FGF-21, FGF-22, and FGF-23. FGF activators bind to and / or activate one or several FGF receptors (FGFR1-4) leading to activation of several signaling pathways including RAS-MAPK, PI3K-AKT, PLCγ, and STAT signaling pathways. These intracellular pathway activities can be monitored using biochemical reporter assays and transduction cascade activation as known in the art. FGF activators can be effective in the methods provided herein in the range of 1-1000 ng / ml. For example, the FGF activators described herein can be used at 1 ng / ml, 10 ng / ml, 100 ng / ml, 200 ng / ml, 300 ng / ml, 400 ng / ml, 500 ng / ml, 600 ng / ml, 700 ng / ml, 800 ng / ml, 900 ng / ml, 1000 ng / ml, and any concentration therebetween.

[0056] TGFβ activators and inhibitors A TGFβ signaling pathway activator is a molecule, e.g., an antibody, protein, nucleic acid, or small molecule, that enhances TGFβ signaling activity. Typically, a TGFβ agonist / activator binds to or activates a TGF-β receptor (TGF-βR). Examples of TGFβ activators include, but are not limited to, TGFβ1, TGFβ2, and TGFβ3. TGFβ activators can be effective in the methods provided herein in the range of 1-1000ng / ml. For example, the TGFβ activators described herein can be used at 1ng / ml, 10ng / ml, 100ng / ml, 200ng / ml, 300ng / ml, 400ng / ml, 500ng / ml, 600ng / ml, 700ng / ml, 800ng / ml, 900ng / ml, 1000ng / ml, and any concentration therebetween.

[0057] A TGFβ signaling pathway inhibitor is a molecule, such as an antibody, protein, nucleic acid, or small molecule, that inhibits TGFβ signaling activity. Typically, TGFβ inhibitors bind to or block the TGF-β receptor (TGF-βR). Examples of TGFβ inhibitors include, but are not limited to, SB431542, A83-01, RepSox, SB525334, SB505124, LY364947, galunisertib, D4476, GW788388, SD208, R268712, IN1130, SM16, A77-01, and AZ12799734. TGFβ inhibitors can be effective in the methods provided herein in the range of 0.1 to 10 micromolar. For example, the TGFβ inhibitors described herein can be used at concentrations of 0.1 μM, 0.2 μM, 0.3 μM, 0.4 μM, 0.5 μM, 0.6 μM, 0.7 μM, 0.8 μM, 0.9 μM, 1.0 μM, 1.1 μM, 1.2 μM, 1.3 μM, 1.4 μM, 1.5 μM, 1.6 μM, 1.7 μM, 1.8 μM, 1.9 μM, 2.0 μM, 3 μM, 4 μM, 5 μM, 6 μM, 7 μM, 8 μM, 9 μM, 10 μM, and any concentration therebetween.

[0058] Thyroid hormone receptor activators / agonists A thyroid hormone receptor activator is a molecule, such as an antibody, a protein, a nucleic acid, or a small molecule, that enhances thyroid hormone receptor signaling activity.Typically, a thyroid hormone receptor agonist / activator binds to or activates a thyroid hormone receptor.Examples of thyroid hormone receptor agonists / activators include, but are not limited to, triiodothyronine (T3), T4, resmetirome, eprotirome, sobetirome, Sob-AM2, VK2809, MB07344, IS25, and TG68.

[0059] Methods for using Gata6-positive brown fat precursors The Gata6-positive brown adipose precursors (BA, or BAT) produced using the methods described herein can be used in several different ways. For example, the cells can be used in transplantation protocols in which BAT cells are transplanted into a subject to treat metabolic disorders such as diabetes, insulin resistance, obesity, hypertension, insulin resistance disorders, or fatty liver. The cells can optionally be derived from induced pluripotent stem (iPS) cells or embryonic stem (ES) cells, cells obtained from the subject itself (e.g., autologous), or can be derived from allogeneic cells. The Gata6-positive brown adipose precursor cells can be transplanted into at least one of the following areas where BAT is already present: the supraclavicular region, the nape of the neck, above the scapula, along the spinal cord, near the proximal branch of the sympathetic nervous system that ends in the BAT depot, around the kidney, kidney capsule, liver, skin, or other sites. The Gata6-positive brown adipose precursor cells can be suspended in a suitable transplantation medium, such as phosphate-buffered saline or other saline. The cell transplant mixture can be injected into the target location via a syringe with a needle ranging from 30 to 18 gauge, the gauge of the needle depending on factors such as the overall viscosity of the fat cell suspension. Preferably, needles ranging from 22 to 18 gauge and 30 to 27 gauge can be used. See, for example, US20170000827, Liu et al., Cell Res 23, 851-854 (2013), and US20170014455, which are incorporated herein by reference in their entireties.In some embodiments, the cells are present in a biocompatible semi-solid or gel matrix suitable for implantation, e.g., a hydrogel matrix, such as hyaluronic acid-based hydrogels (see Tharp et al., Diabetes. 2015 Nov;64(11):3713-24; Tharp and Stahl, Front Endocrinol(Lausanne). 2015;6:164; Vaicik et al., J. Mater. Chem. B, 2015,3,7903-7911), collagen / alginate microparticles (Yao et al., Biofabrication,4(4):045003(2012)), or adipose tissue-derived soluble extracellular matrix (sECM) and methylcellulose (MC) (see Kim et al., PLoS ONE 11(10):e0165265). See also Cho et al., Cell Transplat 16(4):421-434 (2007). These hydrogels and compositions comprising the Gata6-positive brown adipose progenitor cells described herein are also within the scope of the present disclosure.

[0060] In some embodiments, the methods described herein include treating a metabolic-related indication in a subject with Gata6-positive brown adipose precursor cells or cells derived from Gata6-positive brown adipose precursor cells, such as diabetes, insulin resistance, obesity, hypertension, insulin resistance disorders, or fatty liver. The terms "treatment," "treating," and the like are used herein to generally mean obtaining a desired pharmacological and / or physiological effect. The effect may be prophylactic in terms of completely or partially preventing a disease or its symptoms, and / or therapeutic in terms of partially or completely curing a disease and / or side effects caused by the disease. As used herein, "treatment" encompasses any treatment of a disease in a mammal, including (a) preventing a disease from occurring in a subject who may be predisposed to the disease but has not yet been diagnosed as having it, (b) inhibiting a disease, i.e., arresting its development, or (c) relieving a disease, i.e., causing regression of the disease. The therapeutic agent may be administered before, during, or after the onset of a disease or injury. Of particular interest is the treatment of ongoing disease, where the treatment stabilizes or reduces the undesirable clinical symptoms of the patient. Such treatment is desirably performed before complete loss of function in the affected tissue. The subject therapies are desirably administered during, and in some cases after, the symptomatic stage of the disease. In some embodiments, the cells will be administered by injection, transplantation, infusion, implant, or any combination thereof.

[0061] Screening Method (Test Compound) In addition to their use in transplantation, the Gata6 positive brown adipose precursor cells obtained using the present method can also be used for in vitro screening of drugs to determine their effect on BAT, including, for example, thermogenesis assay. Thus, included herein are methods for screening test compounds, e.g., polypeptides, polynucleotides, inorganic or organic large or small molecule test compounds, to identify agents useful for treating metabolic disorders such as diabetes, insulin resistance, obesity, hypertension, insulin resistance disorders, or fatty liver. The present method can be used to identify whether a test compound affects BAT, e.g., to increase BAT number or activity, or to decrease BAT number or activity. In some embodiments, the method used to identify whether a test compound affects BAT includes testing for increased UCP1 expression. In some embodiments, the method used to identify whether a test compound affects BAT includes testing for glycerol release. In some embodiments, the method used to identify whether a test compound affects BAT includes testing for increased oxygen consumption. In some embodiments, the method used to identify whether a test compound affects BAT includes testing for increased temperature. In some embodiments, the method used to determine whether a test compound affects BAT includes measuring cellular metabolic and thermogenic capacity, including measuring glycolysis, mitochondrial respiration, lipid synthesis, beta-oxidation, and mitochondrial uncoupling. In some embodiments, the method used to determine whether a test compound affects BAT includes measuring responses to RNA and protein expression of BAT-specific genes.

[0062] As used herein, "small molecule" refers to a low molecular weight organic or inorganic molecule of less than about 3,000 Daltons. Generally, small molecules useful in the present invention have a molecular weight of less than 3,000 Daltons (Da). The small molecule can be, for example, at least about 100 Da to about 3,000 Da (e.g., about 100 to about 3,000 Da, about 100 to about 2500 Da, about 100 to about 2,000 Da, about 100 to about 1,750 Da, about 100 to about 1,500 Da, about 100 to about 1,250 Da, about 100 to about 1,000 Da, about 100 to about 750 Da, about 100 to about 500 Da, about 200 to about 1500, about 500 to about 1000, about 300 to about 1000 Da, or about 100 to about 250 Da).

[0063] The test compound may be, for example, a natural product or a member of a combinatorial chemical library. A diverse set of molecules should be used to cover a variety of features, such as charge, aromaticity, hydrogen bonding, flexibility, size, side-chain length, hydrophobicity, and rigidity. Suitable combinatorial techniques for synthesizing small molecules are known in the art, including "split and pool" or "parallel" synthesis techniques, solid-phase and solution-phase techniques, and encoding techniques (see, for example, Czarnik, Curr. Opin. Chem. Bio. 1:60-6 (1997)), as exemplified by, for example, Obrecht and Villalgordo, Solid-Supported Combinatorial and Parallel Synthesis of Small-Molecular-Weight Compound Libraries, Pergamon-Elsevier Science Limited (1998). In addition, some small molecule libraries are commercially available. Some suitable small molecule test compounds are listed in U.S. Pat. No. 6,503,713, the entire contents of which are incorporated herein by reference.

[0064] The libraries screened using the methods of the present invention can contain various types of test compounds. A given library can contain a set of structurally related or unrelated test compounds. In some embodiments, the test compounds are peptides or peptidomimetic molecules. In some embodiments, the test compounds are nucleic acids.

[0065] In some embodiments, test compounds and libraries thereof can be obtained by systematically varying the structure of a first test compound, e.g., a first test compound that is structurally similar to a known natural binding partner of a target polypeptide, or a first small molecule identified as capable of binding to a target polypeptide, using, e.g., methods known in the art or described herein, and correlating the structure with the resulting biological activity, e.g., structure-activity relationship studies. As one skilled in the art will appreciate, there are a variety of standard methods for creating such structure-activity relationships. Thus, in some cases, the work may be primarily empirical, while in other cases, the three-dimensional structure of an endogenous polypeptide or a portion thereof can be used as a starting point for the rational design of a small molecule compound(s). For example, in one embodiment, a general library of small molecules is screened, e.g., using the methods described herein.

[0066] In some embodiments, a test compound is applied to a test sample containing Gata6 positive brown fat precursor cells or tissue brown fat cells obtained using the methods described herein, and one or more effects of the test compound are evaluated. For example, the method can evaluate the ability of a test compound to change the expression of one or more of UCP-1, Dio2, Cidea2, FABP4, C / ebp, Cox7a1, Cox7a2, Cox8a, Zic1, Ebf2, Cd34, and / or Prdm16, and / or the proliferation of BAT precursors, and / or fat storage, as assessed, for example, by Oil Red O staining and lipid dyes, and / or BAT thermogenic activity, and / or BAT metabolic activity, as assessed by measuring glycolysis, mitochondrial respiration, lipid synthesis, beta-oxidation, and mitochondrial uncoupling.

[0067] The method for evaluating each of these effects is known in the art.For example, the ability to regulate the expression of protein can be evaluated at gene or protein level, for example, using quantitative PCR or immunoassay method.In some embodiments, high-throughput methods, such as protein or gene chips known in the art (see, for example, Griffiths et al., Eds. Modern genetic Analysis, 1999, Chapter 12 Genomics in WH Freeman and Company; Ekins and Chu, Trends in Biotechnology, 1999, 17:217-218; MacBeath and Schreiber, Science 2000, 289(5485):1760-1763; Simpson, Proteins and Proteomics: A Laboratory Manual, Cold Spring Harbor Laboratory Press; 2002; Hardiman, Microarrays Methods and Applications: Nuts & Bolts, DNA Press, 2003) can be used to detect the effect on BAT.The ability to modulate signaling through the VEGFR2, atrial natriuretic peptide receptor (NPR), beta 3 adrenergic receptor (β3-AR), OxR1, BMPRII, Alk7 (Acvr1c), FGFR, and / or Irisin receptor signaling pathways can be assessed, for example, using genetically encoded reporter assays and / or using biochemical assays for known intracellular transduction pathway transduction including p38, PKC, Pi3K, and phospho-SMAD (see, e.g., Tchivileva et al., Mol Immunol. 2009 Jul;46(11-12):2256-2266; Kumar et al., 1356(2):221-228, 1997; Moshinsky et al., J Biomol Screen. 2003 Aug;8(4):447-52; Zilberberg et al., BMC Cell Biol. 2007;8:41; Logeart-Avramoglou et al., Anal Biochem. 2006 Feb 1;349(1):78-86). In some embodiments, differentiation of iPSCs into brown adipocytes can be determined by using cells expressing a reporter. For example, a UCP1-mCherry construct can be introduced immediately 5' to the start codon of UCP1 separated by P2A to create a fluorescent human iPSC reporter line using CRISPR-Cas9.

[0068] Thermogenesis assays may include exposing cells to a GPR120 activator (e.g., a thermogenic inducer, including but not limited to, GW9508 (see Quesada-Lopez et al., Nat Commun. 2016 Nov 17;7:13479) or Berberine (see Zhang et al., Nat Commun. 2014 Nov 25;5:5493), or exposure to cold temperature.

[0069] Test compounds screened by the methods described herein and determined to increase expression of UCP-1, Dio2, Cidea2, FABP4, C / ebp, Ebf2, and / or Prdm16, and / or increase proliferation of BAT precursors, and / or increase fat storage and lipolysis as assessed, for example, by Oil Red O staining, and / or increase BAT mitochondrial content, and / or increase BAT thermogenic activity, and / or increase BAT metabolic activity can be considered candidate compounds for treating a metabolic disorder.

[0070] Alternatively, the method can be used to identify compounds that reduce BAT activity, for example, to promote weight gain or to treat conditions associated with increased BAT activity, hypermetabolism, underweight, or weight loss associated with chronic disease. Test compounds screened by the methods described herein and determined to reduce expression of UCP-1, Dio2, Cidea2, FABP4, C / ebp, Ebf2, and / or Prdm16, and / or reduce proliferation of BAT precursors, and / or reduce fat storage and lipolysis, as assessed, for example, by Oil Red O staining, and / or reduce BAT mitochondrial content, and / or reduce BAT thermogenic activity, and / or reduce BAT metabolic activity, can be considered candidate compounds for treating conditions associated with increased BAT activity, hypermetabolism, underweight, or weight loss associated with chronic disease.

[0071] For example, a candidate compound screened in an in vivo model of a disorder, e.g., a metabolic disorder such as diabetes, insulin resistance, obesity, hypertension, insulin resistance disorder, or fatty liver, and determined to have a desired effect on the disorder, e.g., one or more symptoms of the disorder, can be considered a candidate therapeutic. A candidate therapeutic is a therapeutic when screened in a clinical setting. The candidate compounds, candidate therapeutics, and therapeutics can be optionally optimized and / or derivatized and formulated with physiologically acceptable excipients to form a pharmaceutical composition.

[0072] Test compounds identified as "hits" in the Gata6 positive brown fat progenitor screen (e.g., test compounds that increase expression of UCP-1, increase BAT proliferation, increase Oil Red O staining, or increase expression of UCP-1, Dio2, Cidea2, FABP4, C / ebp, Ebf2, and / or Prdm16, and / or increase BAT precursor proliferation, and / or increase fat stores as assessed, for example, by Oil Red O staining, and / or increase BAT mitochondrial content, and / or increase BAT thermogenic activity, and / or increase BAT metabolic activity) can be selected and systematically modified to optimize binding affinity, avidity, specificity, or other parameters, e.g., using rational design. Such optimization can also be screened for using the methods described herein. Thus, in one embodiment, the invention comprises screening a first library of compounds using methods known in the art and / or described herein, identifying one or more hits within the library, subjecting the hits to systematic structural variations to generate a second library of compounds structurally related to the hits, and screening the second library using the methods described herein.

[0073] Test compounds identified as hits can be considered candidate therapeutic compounds useful for treating metabolic disorders such as diabetes, insulin resistance, obesity, hypertension, insulin resistance disorders, or fatty liver. A variety of techniques useful for determining the structure of a "hit" can be used in the methods described herein, such as NMR, mass spectrometry, gas chromatography with electron capture detectors, fluorescence and absorption spectroscopy. Thus, the invention also includes compounds identified as "hits" by the methods described herein, as well as methods for their administration and use in treating, preventing, or delaying the onset or progression of the disorders described herein.

[0074] Test compounds identified as candidate therapeutic compounds can be further screened by administration to animal models of metabolic disorders such as diabetes, insulin resistance, obesity, hypertension, insulin resistance disorders, or fatty liver, as described herein. The animals can be monitored for changes in the disorder, e.g., for improvement of a parameter of the disorder, e.g., a parameter associated with clinical outcome. In some embodiments, the parameter is weight and the improvement would be weight loss. In some embodiments, the subject is a human, e.g., a human with obesity, and the parameter is weight loss. In some embodiments, the subject is a human with a metabolic disorder, such as diabetes, insulin resistance, hypertension, insulin resistance disorders, or fatty liver, or an animal model thereof, and the parameter is improved glycemic control, improved insulin sensitivity, improved blood pressure control, or improved liver enzyme levels. In this context, "improved" means returning to or near normal levels. EXAMPLES

[0075] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.

[0076] Experimental procedure Maintenance of human induced pluripotent stem cells NCRM1 (NIH CRM control iPSC line (male)) human iPSCs and other cell lines were routinely cultured on Matrigel (Corning, 354263) coated culture plates (Corning, 353046) in mTeSR (Stemcell Technologies, 85850). Confluent cultures were dissociated into single cells using Accutase (Corning, 25-058-C). Cells were seeded at a density of 56,000 cells / cm2 on Matrigel coated culture plates in mTeSR supplemented with 10 μM Y-27632 dihydrochloride (R&D Systems, 1254 / 10) for routine maintenance of iPSC lines. The next day, medium was replaced with mTeSR only and medium was changed daily. Cultures were made confluent every 4 days and passaged as described above. For freezing, cultures were dissociated into single cells with Accutase and frozen in NutriFreez D10 cryopreservation medium (Biological Industries, 01-0020-50).

[0077] differentiation iPSCs were differentiated into presomitic mesoderm as previously described (Chal et al., 2016). Briefly, confluent maintenance cultures were dissociated into single cells using Accutase (Corning, 25-058-C) and cells were seeded at a density of 30,000–33,000 cells / cm2 onto Matrigel (Corning, 354263)-coated culture plates (Corning, 353046) in mTeSR (Stemcell Technologies, 85850) supplemented with 10 μM Y-27632 dihydrochloride (R&D Systems, 1254 / 10). The next day, cells formed small compact colonies. On day 0 of differentiation, cells were treated with CL medium [DMEM / F12 GlutaMAX (Thermo Fisher Scientific, 10565042) + 1% insulin-transferrin-selenium (Gibco, 41400045) + 3 μM CHIR99021 (R&D Systems, 4423) + 0.5 μM LDN-193189 (Stemgent, 04-0074)] to induce presomitic mesoderm. Cells were treated with CL medium for 3 days and the medium was refreshed daily. On day 3 of differentiation, cells were changed to CLF medium [CL medium + 20 ng / ml FGF-2 (PeproTech, 450-33)]. Cells were treated with CLF medium for 3 days and the medium was refreshed daily.

[0078] To further differentiate the presomitic mesoderm cells into the predestined panniculus carnosus, the cells were changed to HIFL medium [DMEM high glucose (Thermo Fisher Scientific, 11965-118) + penicillin / streptomycin (Life Technologies, 15140122) + 15% KnockOut™ serum replacement (Life Technologies, 10828-028) + NEAA (Thermo Fisher Scientific, 11140-050) + 0.01 mM 2-mercaptoethanol (Life Technologies, 21985-023) + 10 ng / ml HGF (PeproTech, 315-23) + 2 ng / ml IGF-1 (PeproTech, 250-19) + 20 ng / ml FGF-2 (PeproTech, 450-33) + 0.5 μM LDN-193189 (Stemgent, 04-0074)]. Cells were treated with HIFL for 2 days, with medium changed daily. To direct PAX3-expressing dermomyocyte cells to myogenic and non-myogenic lineages, cells were switched to HI medium (HIFL medium without FGF-2 and LDN-193189) and medium was changed daily.

[0079] On days 16-30 of differentiation, cells were reseeded to allow differentiation of cells into the brown adipocyte lineage. Cultures were dissociated into single cells using 2.5 mg / ml collagenase (type IV, Thermo Fisher Scientific, 17104019) and 0.05% trypsin EDTA (Thermo Fisher Scientific, 25200-056) in PBS (Gibco, 14190), filtered through a 30 μm (CellTrics, 04-0042-2316) filter, and resuspended in BCTFT medium [DMEM high glucose (Thermo Fisher Scientific, 11965-118) + penicillin / streptomycin (Life Technologies, 15140122) + 5% KnockOut™ serum replacement (Life Cells were seeded onto Matrigel-coated plates at a density of 60,000–100,000 cells / cm2 in BCTFT+1% insulin-transferrin-selenium (Gibco, 41400045) + 10 ng / ml FGF-2 (PeproTech, 450-33) + 10 ng / ml BMP7 (Thermo Fisher Scientific, PHC9544) + 20 nM Porcine inhibitor II, C59 (Millipore Sigma, 500496) + 10 ng / ml TGFb1 (PeproTech, 100-21-10) + 2 nM 3,3′,5-triiodo-L-thyronine sodium salt (Sigma-Aldrich, T6397). Cells were treated with BCTFT for 4–6 days and the medium was refreshed daily. Adipocyte precursors were either frozen for later use or differentiated into adipocytes. For freezing, cultures were dissociated into single cells using 0.05% trypsin EDTA (Thermo Fisher Scientific, 25200-056) in PBS (Gibco, 14190) and cells were frozen in NutriFreez D10 cryopreservation medium (Biological Industries, 01-0020-50).

[0080] To differentiate adipocyte precursors into adipocytes, cells were cultured in adipogenic medium [DMEM high glucose (Thermo Fisher Scientific, 11965-118) + penicillin / streptomycin (Life Technologies, 15140122) + 5% KnockOut™ serum replacement (Life Technologies, 10828-028) + 1% insulin-transferrin-selenium (Gibco, 41400045) + 500 μM IBMX (3-isobutyl-1-methylxanthine, Sigma-Aldrich, I7018) + 25.5 μg / ml L-ascorbic acid (Sigma-Aldrich, A4544) + 2 nM T3 (3,3',5-triiodo-L-thyronine sodium salt, Sigma-Aldrich, T6397) + 5 μM TGFb inhibitor SB431542 (Selleck, The cells were cultured for 30–40 days in 100 mM NaCl (Sigma-Aldrich, S1067) + 1 μM dexamethasone (Sigma-Aldrich, D4902) + 10 ng / ml EGF (Peprotech, AF-100-15) + 4 μg / ml hydrocortisone (Sigma-Aldrich, H0888) + 1 μM rosiglitazone (Sigma-Aldrich, R2408)]. The medium was changed every 3 days.

[0081] To perform functional assays and immunofluorescence analysis, 30-40 day old replated cultures were dissociated with 2.5mg / ml collagenase (type IV, Thermo Fisher Scientific, 17104019) and 0.05% trypsin EDTA (Thermo Fisher Scientific, 25200-056) in 1x phosphate buffered saline (Gibco, 14190) and cells were seeded into plates of the appropriate format required for the assay.

[0082] Human fetal tissue Human fetal tissues were obtained by the University of Washington Birth Defects Research Laboratory (BDRL) under a protocol approved by the University of Washington Institutional Review Board. BAT tissues were isolated from the interscapular and scapular regions at estimated postconceptional ages of 98 (H28540), 115 (H28572), 122 (H28560), 125 (H28626), and 135 days. Before processing, tissues were rinsed in 1× Hank's Balanced Salt Solution (HBSS, Thermo Fisher Scientific, 14185052). For immunofluorescence analysis, tissues were fixed overnight at 4°C with 4% paraformaldehyde (Electron Microscopy Sciences, 15710), washed three times with 1× phosphate-buffered saline (PBS, Sigma-Aldrich, P5493), and stored in PBS supplemented with 0.1% sodium azide (Sigma-Aldrich, 71290) at 4°C until further processing. For bulk mRNA sequencing, tissues were snap frozen in liquid nitrogen and stored at −80°C until further processing.

[0083] Mouse strains Pax7-iCre / +;Rosa26-mTmG / + embryos were generated by timed mating of Rosa26-mTmG / mTmG (Muzumdar et al., 2007) males with Pax7-iCre / + females, and embryos were harvested at E14.5. Gata6-EGFPCreERT2 mice were generated by knocking an EGFPCreERT2 cassette into the endogenous Gata6 locus as previously reported (Donati et al., 2017). They were crossed with Rosa26-fl / STOP / fl-tdTomato mice (Madisen et al., 2010). For lineage tracing experiments, pregnant females were injected intraperitoneally with 50 μg / g tamoxifen (Sigma) at E12.5, and embryos were harvested at E15.5. For experiments other than lineage tracing, wild-type CD1 IGS mice (Charles River) were used.

[0084] Generation of UCP1-mCherry and PAX3-Venus reporter lines The UCP1 gene was targeted using CRISPR-Cas9 system-based genome editing to generate a reporter NCRM1 iPSC line already modified at the PAX7 locus and transduced with Venus. To target the UCP1 locus, a single guide RNA (sense strand encoding gRNA=CACCGGGTTTGCTGCCCGGCGGAC (SEQ ID NO:1), antisense strand encoding gRNA=AAACGTCCGCCGGGCAGCAAACCC) (SEQ ID NO:2) targeting the 5' region of the gene was designed using the MIT Crispr Design Tool (crispr.mit.edu). The guide RNA was cloned into PSpCas9(BB)-2A-GFP(PX458) (Addgene, 48138) following the protocol from Ran et al., 2013. The final vector was sequenced to ensure that no mutations were generated during cloning. To generate a targeting vector for homology-dependent repair, we cloned 1 kb long homology sequences (HA) flanking the nuclear localization sequence (NLS) region from the H2B gene sequence, the fluorescent protein mCherry sequence, and the self-cleaving P2A peptide sequence (5'HA-H2B-mCherry-P2A-3'HA) in a pUC19 vector backbone using Gibson Assembly (New England Biolabs (NEB), E5510S). To mutate the PAM site of the guide RNA, the assembled targeting vector was mutated using site-directed mutagenesis with In-Fusion HD Cloning Plus (Takara, 638909). NCRM1 iPSCs were transfected with both the guide RNA vector (PSpCas9(BB)-2A-GFP) and the targeting vector (pUC19-5'HA-H2B-mCherry-P2A-3'HA) using Lipofectamine™ Stem Transfection Reagent (Thermo Fisher Scientific, STEM00001).24 hours after transfection, cells were sorted using flow cytometry (S3 cell sorter, Biorad) for GFP-positive cells and seeded at low density for clonal expansion in Matrigel (Corning, #354263) coated culture plates (Corning, 353046) in mTeSR (Stemcell Technologies, 85850) supplemented with 10 μM Y-27632 dihydrochloride (R&D Systems, 1254 / 10) and penicillin / streptomycin (Life Technologies, 15140122). After small colonies appeared, colonies were subcultured and genotyped using PCR for targeted homozygous insertion of H2B-mCherry-P2A at the UCP1 locus in front of the transcription start site. Positive clones were sequenced and clones without unwanted mutations were further verified using immunofluorescence and RT-qPCR. Two positive clones were differentiated into adipocytes and the expression of UCP1 in mitochondria and mCherry in the nucleus was confirmed. We followed a similar strategy to generate human PAX3-Venus iPSC lines using CRISPR / Cas9 technology. We generated a Venus knock-in allele by inserting a Venus sequence before the coding sequence of exon 1. Guide RNAs targeting the 5' region of the gene (sense strand encoding gRNA=5'-CCGGCCAGCGTGGTCATCCTGGG-3' (SEQ ID NO: 3), antisense strand encoding gRNA=5'-TGCCCCCAGGATGACCACGCTGG-3' (SEQ ID NO: 4)) were designed using the MIT Crispr Design Tool (crispr.mit.edu). A targeting plasmid (pBSKS-2A-3xNLS) was designed to contain the NLS sequence, 1.5 kb of the 5' genomic region of the PAX3 gene, 1 kb of the 3' sequence, and the 2A sequence. The targeting vector together with the Cas9 plasmid was electroporated into cells by nucleofection, and clones were subcultured and genotyped using PCR for targeted homozygous insertion of NLS-Venus-2A at the PAX3 locus.

[0085] RNA extraction, reverse transcription, and real-time quantitative PCR Samples were taken and RNA was extracted using NucleoSpin® RNA kit (Macherey and Nagel, 740955) according to the manufacturer's instructions. DNA digestion was performed on-column and RNA quality and concentration were measured using Nanodrop. For reverse transcription, 1ug ​​of RNA was brought to a 20ul reaction volume and cDNA was generated using iScript™ cDNA synthesis kit (Bio-Rad, 1708891). Typically, cDNA was diluted 1:10 with nuclease-free water. For real-time quantitative PCR, 3.5ul of cDNA, 1.5ul of 10μM forward and reverse primer mix (300μM forward and reverse primers), and 5ul of iTaq™ Universal SYBR® Green Supermix (Bio-Rad, 172-5124) were used in a 10ul reaction volume. Three technical replicates were performed for each sample and gene primer set. PCR primers were designed using primer 3, typically spanning the splice junction as far as possible. Primers were verified for amplification efficiency and specificity using standard curves and melting curves, respectively. PCR was performed on a Bio-Rad CFX384 thermocycler with the following cycling program: an initial denaturation step (95°C for 1 min), 40 cycles of amplification and SYBR green signal detection (denaturation at 95°C for 5 s, annealing / extension, and plate read at 60°C for 40 s), followed by a final round of gradient annealing from 65°C to 95°C to generate a dissociation curve. Relative gene expression was calculated using the ΔΔCt method, with RPL37A (ribosomal protein L37a) used as a housekeeping gene. A list of qPCR primers is provided. [Table 1]

[0086] Cultured cells: Cells were cultured on Matrigel-coated plastic culture plates (Corning, #353046), glass-bottom 24-well plates (Cellvis, P24-1.5HN), μ-dish 35 mm (Ibidi, 81156), or μ-plate 24-well black (Ibidi, 82406). Cultures were washed with 1× phosphate-buffered saline (PBS, Sigma-Aldrich, P5493) and fixed with 4% paraformaldehyde (Electron Microscopy Sciences, 15710) for 20 min at room temperature. Cultures were washed with PBS and stored in PBS supplemented with 0.2% sodium azide (Sigma-Aldrich, 71290) until used for immunostaining.

[0087] Mouse tissues: Mouse embryos were dissected at different stages in Hank's Balanced Salt Solution (HBSS) (Gibco, 14185-052). After several washes with HBBS, embryos were fixed in 4% paraformaldehyde (Electron Microscopy Sciences, 15710) overnight at 4 °C. Embryos were then washed with PBS and transferred to a 15% sucrose solution in PBS (Sigma-Aldrich, 84097) overnight at 4 °C, followed by incubation in a 30% sucrose solution overnight at 4 °C. Embryos were then embedded in Tissue-Tek OCT compound (VWR, 25608-930) and stored at -80 °C until sectioning. Sections of 10-20 μm thickness were cut and stored at -20 °C until used for immunostaining.

[0088] Fixed cells or sections were permeabilized with 1% Triton-X (Millipore Sigma, T8787) for 10 min at room temperature. Samples were washed with PBS and incubated in blocking solution [PBS supplemented with 3% donkey serum (Jackson ImmunoResearch, 017-000-121) and 0.1% Triton-X] for 1 h at room temperature. Samples were then incubated with primary antibodies diluted in blocking solution at 4°C overnight. The next day, samples were washed three times for 5 min with PBS. Samples were then incubated with secondary antibodies and Hoechst 33342 (ThermoFisher Scientific, H3570) diluted in blocking solution for 1 h at room temperature, followed by washing three times for 5 min each with PBS. Cultured cell samples were stored in PBS until imaging. Mouse tissue slides were mounted using Fluoromount aqueous mounting medium (Sigma-Aldrich, F4680) and stored at 4°C until analysis. Samples were imaged using an EVOS FL imaging system (Thermo Fisher Scientific) or an LSM780 confocal microscope (Zeiss). A list of primary and secondary antibodies is provided. [Table 2] [Table 3]

[0089] Lipid staining iPSC-BA cultures were washed with 1x phosphate buffered saline (PBS, Sigma-Aldrich, P5493) and fixed with 4% paraformaldehyde (Electron Microscopy Sciences, 15710) for 20 min at room temperature. Cells were then incubated with 0.5 mM BODIPY™ (Invitrogen™, D3922) in PBS for 20 min at room temperature. Cells were washed three times with PBS and visualized using an EVOS FL imaging system (Thermo Fisher Scientific).

[0090] Seahorse assay The oxygen consumption of live iPSC-BA and progenitor cells was measured using an Agilent Seahorse XFe96 analyzer according to the manufacturer's instructions. 30,000 iPSC-BA and progenitor cells were cultured on Matrigel (Corning, 354263)-coated Seahorse XF96 cell culture microplates (Agilent Technologies, 101085-004). Assay medium was prepared using Seahorse XF DMEM (Agilent Technologies, 103575-100) supplemented with 1 mM pyruvate (Agilent Technologies, 103578-100), 2 mM glutamine (Agilent Technologies, 103579-100), and 10 mM glucose (Agilent Technologies, 103577-100). Basal respiration was measured in triplicate in assay medium. The cells were then treated with 1.5 μM oligomycin (Tocris, 4110) and measurements were performed in triplicate. The cells were then treated with 10 μM forskolin (Sigma-Aldrich, F6886) or DMSO (Sigma-Aldrich, D2650) and the oxygen consumption rate (OCR) was measured for 70 min (12 measurements). The cells were then treated with 1 μM rotenone (Sigma-Aldrich, R8875) and antimycin A (Sigma-Aldrich, A8674) for triplicate measurements to block the electron transport chain. The cells were then washed with 1× phosphate buffered saline (PBS, Sigma-Aldrich, P5493) and fixed with 4% paraformaldehyde (Electron Microscopy Sciences, 15710) for 10 min at room temperature. Seahorse XF96 cell culture microplates were imaged for DAPI and mCherry using a GE INCELL Analyzer 2200 widefield high content imager. Custom code was used in Fiji to automatically segment cells and quantitate the number of DAPI and mCherry positive cells. OCR data from each well was normalized to the number of DAPI positive cells in each well. Four replicates were performed. Each experiment consisted of 40 technical replicates for each cell type.

[0091] Thermogenesis assay iPSC-BA and iPSC progenitors were cultured on Matrigel (Corning, 354263) coated 96-well black clear bottom plates (Corning, 3603) and incubated in DMEM / H containing 250 nM ERthermAC (Sigma, SCT057) for 30 min at 37 °C. After washing with PBS, fresh 90 μl DMEM / H without phenol red was added before imaging. Fluorescence in stained cells was detected with a GloMax Discover Multimode Detection System (Promega) using an excitation of 520 nm and an emission at 590 nm. The temperature inside the machine was equilibrated at 25 °C. After measuring basal fluorescence at three points, 10 μl of forskolin (final concentration 10 μM, F6886, Sigma) was added to initiate thermogenesis. 10 μl of PBS was added to the vehicle control group. Fluorescence was recorded every 5 min for 120 min. Results were interpreted as relative intensities (intensities were normalized to basal measurements).

[0092] Electron microscopy iPSC-BAs were rinsed with 0.1 M phosphate buffer (pH 7.5) and fixed for 2 days in 2.5% glutaraldehyde (Sigma, G7651) in 0.1 M phosphate buffer at 4 °C. Samples were washed with 0.1 M phosphate buffer and fixed in 1% osmic acid in 0.1 M phosphate buffer at room temperature for 1 h. Dehydration by successive incubations in 50%, 70%, 80%, 95%, and 100% ethanol was performed before incubation in propylene oxide for 30 min. Samples were impregnated by incubation in propylene oxide / araldite (1:1 v / v) for 60–90 min, propylene oxide / araldite (1:2 v / v) for 1 h, and 100% araldite overnight at 4 °C. Samples were finally incubated in araldite and polymerized at 56 °C for 24 h. Ultrathin sections (85 nm) were cut on a supercutting Leica EM UC. Sections were contrasted with 2% uranyl acetate for 8 min and lead citrate (Reynolds) for 8 min. All photographs were taken with a Zeiss EM 900 microscope and a GATAN camera (Orius SC 1000).

[0093] Glycerol release assay iPSC-BA were cultured in (Corning, 354263) coated 96-well culture plates (Genesee Scientific, 25-109). Cells were serum starved for 16 hours and cultured in serum-free DMEM / F12 GlutaMAX (Thermo Fisher Scientific, 10565042) containing 0.5% BSA. The next day, cells were washed with KRB-HEPES buffer [118.5 mM NaCl, 4.75 mM KCl, 1.92 mM CaCl2, 1.19 mM KH2PO4, 1.19 mM MgSO4, 25 mM NaHCO3, 6 mM glucose, and 10 mM HEPES, pH 7.4] containing 4% fatty acid-free BSA (Bioworld, 22070017-1). Cells were treated with DMSO or 10 μM forskolin in KRB-HEPES buffer supplemented with 4% fatty acid-free BSA for 4 hours at 37°C and 5% CO2. Cell culture medium was collected for glycerol measurement using free glycerol reagent (Sigma-Aldrich, F6428) according to the manufacturer's instructions. A standard curve was generated using glycerol standard solution (Sigma-Aldrich, G7793). Test samples, standards, and water controls were incubated with free glycerol reagent for 5 minutes at 37°C and absorbance was recorded at A540 using a spectrophotometer. To normalize with total protein content, Bradford assay was performed using DC protein assay (Biorad, 500-0116) according to the manufacturer's protocol.

[0094] Periodic acid-Schiff staining To stain glycogen in differentiating iPSC-BAs, cells were treated with periodic acid Schiff stain (Sigma, 395B). iPSC-BAs were fixed with 4% paraformaldehyde (Electron Microscopy Sciences, 15710) at room temperature for 15 min. Fixed cells were washed several times with distilled water and immersed in periodic acid solution at room temperature for 5 min. Cells were then washed with distilled water and incubated with Schiff's reagent at room temperature for 15 min. Cells were washed with running tap water for 5 min. Stained cells were visualized in bright field using an EVOS FL imaging system (Thermo Fisher Scientific).

[0095] Bulk mRNA sequencing The UCP1-mCherry knock-in line was differentiated into brown adipocytes as described above. Cells were harvested on day +40 of differentiation and RNA was extracted using the NucleoSpin® RNA kit (Macherey and Nagel, 740955) according to the manufacturer's instructions. DNA digestion was performed on-column and RNA quality and concentration were measured using Nanodrop. Human fetal tissue was harvested as described above and RNA was extracted using the NucleoSpin® RNA kit according to the manufacturer's instructions.

[0096] RNA library preparation and sequencing reactions were performed at GENEWIZ, LLC. (South Plainfield, NJ, USA). Received RNA samples were quantified using a Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA) and RNA integrity was checked using an Agilent TapeStation 4200 (Agilent Technologies, Palo Alto, CA, USA). RNA sequencing libraries were prepared using the NEBNext Ultra II RNA Library Preparation Kit for Illumina using the manufacturer's instructions (NEB, Ipswich, MA, USA). Briefly, mRNA was initially enriched with Oligod(T) beads. The enriched mRNA was fragmented at 94°C for 15 min. First and second strand cDNA were then synthesized. The cDNA fragments were end-repaired and adenylated at the 3' end, and universal adaptors were ligated to the cDNA fragments, followed by indexing and library enrichment by PCR with limited cycles. Sequencing libraries were validated on an Agilent TapeStation (Agilent Technologies, Palo Alto, CA, USA) and quantified using a Qubit 2.0 Fluorometer (Invitrogen, Carlsbad, CA) and quantitative PCR (KAPA Biosystems, Wilmington, MA, USA).

[0097] Sequencing libraries were clustered onto a single lane of a flow cell. After clustering, the flow cell was loaded into an Illumina HiSeq instrument (4000 or equivalent) according to the manufacturer's instructions. Samples were sequenced using a 2 x 150 bp paired-end (PE) configuration. Image analysis and base calling were performed by HiSeq Control Software (HCS). Raw sequence data (.bcl files) generated from the Illumina HiSeq were converted to fastq files and demultiplexed using Illumina's bcl2fastq 2.17 software. One mismatch was allowed for index sequence identification.

[0098] For bulk RNA-seq data analysis, we performed quality control of sequence data (FastQ files) using FastQC (v0.11.9) and mapped sequenced reads to the human reference genome (GRCh38 release 101 from ENSEMBL) using the STAR RNA-seq aligner (v2.7.3a) (Dobin et al., 2013). Mapped reads were quantified using featureCounts (v2.0.1) (Liao et al., 2014). Starting from raw gene counts, normalization and differential expression analysis were performed in the R environment (v3.6.0) using the DESeq2 package (v 1.22.2) (Love et al., 2014). Genes were defined as differentially expressed if the false discovery rate was less than 0.05. Gene Ontology (GO) enrichment analysis was performed on the differentially expressed genes using EnrichR ( Kuleshov et al., 2016 ) with the WikiPathway 2019 Human resource selected.

[0099] To quantify the thermogenic potential of each sample, we relied on the ProFAT ​​web tool (Cheng et al., 2018). Starting from the raw count matrix, bar plots and heat maps representing the fat browning capacity of each sample were generated as standard outputs of ProFAT.

[0100] To generate heat maps of genes of interest (associated with muscle, pluripotency, and brown adipose tissue), we used normalized read counts generated by DESeq2. To calculate up- or down-regulation, we calculated the log difference of the mean of biological replicates relative to the baseline value (average of all conditions) for each gene.

[0101] Single-cell RNA sequencing Preparation of single cell suspension Single-cell analysis of differentiating iPSCs and mouse embryonic cells was performed using inDrops as previously reported (Klein et al.).

[0102] UCP1-mCherry iPSC lines were differentiated into brown adipocytes as described above. Cultures were harvested at day 20 of primary differentiation and at days 20 and 40 after replating.

[0103] Cultures were washed with PBS (Gibco, 14190) and dissociated into single cells using 2.5mg / ml collagenase (type IV, Thermo Fisher Scientific, 17104019) and 0.05% trypsin EDTA (Thermo Fisher Scientific, 25200-056) in PBS for 5-15 minutes at 37°C. Dissociated cells were passed through a 70μm cell strainer (Celltreat, 229483) followed by a 30μm cell strainer (CellTrics, 04-0042-2316), spun at 300g for 5 minutes, and resuspended in DMEM (Thermo Fisher Scientific, 11965-118) + 5% fetal bovine serum (VWR, 89510-186). Cells were again spun at 300g for 5 min and resuspended in DMEM + 5% fetal bovine serum, 2-3 times to remove debris. Final resuspension was made in PBS + 0.1% bovine serum albumin (Gibco, 15260-037). Cell density was adjusted to 200,000 cells / ml. On day 20, 2500 cells were harvested from each sample. For samples 20 days after reseeding and 40 days after reseeding, at least 3000 cells were harvested from each sample from two independent differentiations.

[0104] To analyze mouse embryonic tissues, embryos were harvested from wild-type CD1 IGS mice (Charles River) at embryonic day (E) 11.5, 12.5, 13.5, 14.5, and 15.5. For each stage, dorsal tissues were dissected from the back to the rib cage at the level of the forelimbs. Whenever possible, the neural tube / spinal cord and dorsal root ganglia were removed. For E15.5, the epidermis and underlying dermis were removed before dissociating the tissue. Dissected tissues were washed several times in Hank's Balanced Salt Solution (HBSS, Thermo Fisher Scientific, 14170112). The tissue was transferred to a microcentrifuge tube containing 200 μl of 2.5 mg / ml collagenase (type IV, Thermo Fisher Scientific, 17104019) and 0.05% trypsin EDTA (Thermo Fisher Scientific, 25200-056) in PBS (Gibco, 14190), cut into small pieces using scissors, and incubated at 37 °C for 15 min with intermittent shaking. The tissue was mechanically dissociated by triturating several times using a wide-bore 1 ml pipette. The resulting cell suspension was mixed with HBBS + 10% FBS, filtered through a 30 μm cell strainer, and spun at 300 g for 5 min. To remove red blood cells, the cell pellet was resuspended and incubated in RBC lysis solution (Qiagen, 158902) for 5 min at room temperature. The cells were washed 2-3 times with HBSS + 10% FBS to remove debris. Final suspensions were made in PBS + 0.1% BSA. Cell density was adjusted to 200,000 / ml. For each stage, cells were harvested from two litters of embryos. For E11.5-14.5 embryos, 3000 cells were encapsulated and sequenced from each embryo. For E15.5, 5000 cells were harvested and sequenced from each embryo.

[0105] Encapsulation, sequencing, and analysis Single cells were encapsulated using inDrops technology as previously reported (Klein et al.). Cells were barcoded using v3 sequencing adapters and sequenced on an Illumina NextSeq 500 using the NextSeq 75 High Output Kit using standard Illumina sequencing primers, 61 cycles for read 1, 14 cycles for read 2, and 8 cycles each for index read 1 and index read 2. Sequencing FASTQ files were processed according to the indrops.py pipeline (available at github.com / indrops / indrops). Single-cell transcriptomes were mapped to mouse (GRCm38 / mm10) and human (GRCh38 / hg19) reference transcriptomes. Samtools version 1.3.1, rsem version 1.3.0, and Bowtie version 1.2.2 were used with the parameter -e 100.

[0106] A weighted histogram of transcript counts per cell barcode versus cell barcode abundance was used to identify transcripts derived from abundant cell barcodes. Only transcript counts derived from abundant cell barcodes were included in downstream analysis. Basic filtering parameters were used to exclude cells expressing less than 500 genes and genes expressed in less than 3 cells. Filtered counts were normalized by the total number of counts for each biological sample. The top 1000 variable genes were identified according to Satija 2015. Cell doublets were identified and filtered using Scrublet (PMID:30954476). For each cell, the percentage of counts attributable to mitochondrial genes was determined and cells with a high percentage were filtered. Cell cycle was scored as in Tirosh et al. 2016 (PMID:27806376). Each cell was given a cell cycle score based on the expression of G2 / M and S phase markers. Cells not expressing markers from G2 / M and S phase were identified as being in G0 / G1 phase. Sources of variation between libraries were regressed using the bkknn batch correction function (PMID:31400197). Single-cell data were projected into a low-dimensional space by principal component analysis (PCA). Neighborhood graphs were embedded using UMAP (McInnes et al., 2018). Cell clusters were identified using the Leiden graph clustering method [PMID:30914743, Blondel et al., 2008]. Differentially expressed genes were identified by Wilcoxon rank-sum tests by comparing cells in each cluster with cells in all other clusters.

[0107] Track plots were created using each gene and plotted as filled line plots where y is the gene processed expression value and x is each of the cells (Wolf et al., 2018). Stream: The Stream pipeline was used to lay out the trajectories within each dataset. Original code and documentation: (Chen et al., 2019) Neuronal cells were removed from the datasets analyzed in Stream because their developmental origin is distinct from the other clusters.

[0108] Trajectory inference analysis was performed using Cellrank (Lange et al., 2022). The Waddington-OT kernel (Schiebinger et al., 2019) was used to infer the temporal coupling of cells from different samples collected independently at various time points. Transition matrices were calculated to indicate the amount of mass transported from one cell type to another from the start and end points.

[0109] Single-cell RNA sequencing data from mouse E18 periaortic (pVAT) brown adipose tissue as described in Angueira et al. 2021 were processed through the same processing pipeline as above. Cell state prediction of single-cell clusters from pVAT as described in Angueira et al. 2021 was performed using a kNN classifier trained on single-cell clusters from our E13.5–E15.5 mice (Diaz-Cuadros et al., 2020).

[0110] Example 1: Single-cell transcriptome analysis of the mouse embryonic dorsal trunk captures somite lineage development. In mice, interscapular brown adipose tissue (BAT) develops between the dermis, trapezius, pectoralis, and deep dorsal muscle bundles. To characterize the developmental trajectory of brown fat during development, we isolated dorsal tissue at the forelimb level at E11.5, E12.5, E13.5, E14.5, and E15.5 (Figure 9A) and performed single-cell RNA sequencing (scRNAseq). At stages E11.5-E14.5, the isolated dorsal tissue includes epidermis, dermis, mesenchyme, interscapular brown fat, and skeletal muscle. At E15.5, to enrich for BAT precursors, we removed the epidermis and underlying dermis before dissociation. Using the inDrops workflow (Klein et al., 2015), we generated single-cell transcriptomes from at least 4000 cells per stage, yielding a final dataset of 28244 cells after quality control filtering. Uniform manifold approximation projection (UMAP)-based two-dimensional embedding showed that cells from different time points largely separated based on transcriptional similarity, rather than embryonic age (Figure 9B-D). Using the Leiden clustering algorithm, we identified 17 clusters representing somitic and non-somitic cell types present in the dorsal trunk region of mouse embryos (Figure 9C). We manually annotated the cell types corresponding to the different clusters using well-established marker genes for various lineages. Among somite derivatives, we observed clusters of cells derived from the dermomyocyte, including brown adipocytes (Cidea, Ucp1), skeletal muscle (Myog, Ttn, Actn2, Myh3), and dermal fibroblasts (Twist2, Dpt, Crabp1) (Figure ​(Figure9E-F). ​Furthermore, we could annotate clusters of smooth muscle cells (Cnn1, Acta2), muscle connective tissue (Ngfr, Osr1, Osr2), cartilage (Cnmd, Col2a1), endothelial cells (Cdh5, Kdr), and meninges (Foxc1, Cldn11, Aldh1a2) (Figure ​(Figure9E-F). ​(Figure9E-F). Among non-somitic cells, we found macrophages (Csf1r, C1qb), mast cells (Srgn, Kit), neutrophils (Ngp, Lccn2), Schwann cells (Sox10, Mpz), and epidermal cells (Krt5, Krt14) (Figure 9E-F).In conclusion, single-cell transcriptomics analysis captured the major panniculus derivatives, including cells of the brown adipocyte lineage, present in the mouse dorsal trunk during embryonic development.

[0111] Example 2: Characterization of the developmental trajectory of brown adipocyte precursors in the developing stem Most of the somite-derived cells, except for endothelial and skeletal muscle cells, are located closely together on the UMAP embedding, suggesting that they have related transcriptional signatures (Figure 9B-C). This large group of cells forms a single continuous ensemble that includes clusters corresponding to cartilage, bone, smooth muscle, connective tissue, dermis, and brown adipocytes. These cell types all arise from fibroblast precursors, which may explain the similarity of their transcriptomes. We extracted the clusters representing this group of cells from our previous analysis and reanalyzed this new dataset in detail. The majority of the cells belonged to a large central cluster already present at E11.5, which we refer to as fibroblast precursors (FP) (Figure 1A-B). Cells in this cluster expressed markers classically associated with fibroblasts, including Pdgfra or Hic1 (Figure 1C). Differential gene expression analysis of the clusters showed that the differentially expressed genes of the FP cluster did not contain any characteristic lineage markers. Moreover, the FP clusters are linked to all different predestined fates, suggesting that they correspond to a multipotent progenitor population. The FP clusters are linked to a cluster of promising brown adipocytes, which we call brown adipocyte precursors (BAPre) (Figure 1A). These cells expressed brown adipocyte precursor markers such as Ebf2, Cebpa, and Pparg (Figure 1C, Figure 10A). The BAPre clusters are associated with clusters of brown adipocytes characterized by the expression of Cidea or Ucp1 (Wang et al., 2014) (Figure 1C, Figure 10A). The BAPre clusters are first detected at day 13.5, and their size increases progressively until E15.5, whereas the brown adipocyte clusters are first detected at E15.5 (Figure 1D). Pseudotime analysis supported the existence of a developmental trajectory of the brown adipocyte lineage, starting from FP cells, followed by BAPre and finally brown adipocytes (Figure 1F). To further characterize the developmental trajectories arising from the FP clusters, we performed analyses using the STREAM pipeline ( Chen et al., 2019 ), which confirmed these inferred phylogenetic relationships between the clusters ( Figure 1E ).These conclusions are further supported by analyses using the Waddington OT pipeline, which characterizes ancestor / descendant sequences based on cell-to-cell transition probability and gene expression similarity (Schiebinger et al., 2019) (Figure S10B-C). These analyses demonstrate that cartilage, bone, tendon, connective tissue, dermis, and brown adipocytes all arise from the FP cluster, and that the brown adipocyte cluster is derived from the BAPre cluster (Figure 1E-F).

[0112] This developmental trajectory of the brown adipose lineage was confirmed by immunohistochemistry of sections of the dorsal region of the developing mouse brachial trunk with markers of the adipocyte lineage. Immunofluorescence analysis of E12.5–E15.5 embryos confirmed expression of Ebf2 not only in the prescapular brown adipose region but also in skeletal muscle and precartilage (Figure 1G) (Wang et al., 2014). Developing adipocyte precursors expressing Pparg, presumably corresponding to BAPre, began to appear at E13.5 and developed between the dermis and myosin heavy chain (MyHC) expressing muscle fibers (Figure 1G). Perilipin 1 (Plin1) staining showed that a small number of preadipocytes began to accumulate lipid vesicles at E14.5. An increased number of lipid-containing immature adipocytes appeared by E15.5 (Figure 1G).

[0113] Angueira et al. (2021) recently identified precursors that give rise to brown adipocytes in mouse periaortic (pVAT) brown adipocytes analyzed by scRNAseq at E18 and perinatal stages (Angueira et al., 2021). We reanalyzed our E18 dataset, which included 16,967 single-cell transcriptomes. Following UMAP embedding and Leiden clustering, we identified 13 clusters representing cell types described in the original study (Figure 11A). After manual annotation of adipocyte clusters, we first identified a cluster of fibroblast precursors (Pdgfra), followed by BAPre (Pparg) and a trajectory similar to that observed for the somitic lineage of brown adipocytes (Cidea) (Figure 11B-C). Pi16, Cd34, and Ly6a, identified as brown adipocyte precursor markers in the Angueira report, were also differentially expressed in the precursor populations identified in our study, but they were only detected after E13.5, suggesting that the FP population matures over time (Figure 11D). Using a machine learning classifier trained on the Angueira dataset, we confirmed the similarity between the precursors identified in the two studies and the predestined fate of brown adipocytes. However, the preadipocyte cluster identified in our study appears to correspond to a more immature stage of BA lineage differentiation, since it is closer to our FP cluster, compared to the BAPre cluster of our mouse dataset (Figure 11E). Immunofluorescence analysis at E15.5 confirmed the expression of adipocyte precursor markers Dpp4, Cd34, and Ly6a in the periphery of developing brown adipose tissue in the interscapular depot (Figure 11F-G). Their location suggested that they may correspond to precursor cells involved in the generation of mature brown fat. Taken together, these data suggest that brown adipocytes in the interscapular region originate from a multipotent population of fibroblast precursors expressing markers such as Pdgfra, which gives rise to an immature population of lineage-restricted precursors (BAPre) that appear around E13.5. Around E15.5, this population begins to give rise to brown adipocytes identified by specific markers such as Cidea.

[0114] Example 3: Gata6 marks an early brown adipose tissue precursor The transcription factor Gata6 has previously been associated with the brown adipocyte lineage (Cheng et al., 2018; Wang et al., 2014), but its developmental expression has not been characterized. In our dataset, we observed a striking restriction of Gata6 expression to the brown adipocyte and smooth muscle lineages (Figure 1C). Extraction of Gata6-expressing cells from the mouse dataset shows that the majority of these cells belong to these two lineages, with the majority belonging to the FP cluster (Figure 2A). Gata6-expressing cells are first detected in the FP, then in the BApre, and in the brown adipocyte and smooth muscle clusters. Gata6 expression progressively decreased during brown adipocyte differentiation (Figure 1C). These observations were confirmed at the protein level by immunofluorescence analysis, which showed that Gata6 was detected within the presumptive brown fat region beneath the dermis at E12.5 (Figure 2B). Differentiating Pparg-positive immature adipocytes as well as Pparg-negative adipocyte precursors expressed Gata6 at E14.5 (Figure 2B). At E15.5, most Pparg-positive cells in the forming interscapular BAT downregulated Gata6 protein. Strong expression of Gata6 was still observed in Pparg-negative cells in the periphery of BAT, likely corresponding to brown adipocyte precursors (Figure 2B). Downregulation of both Gata6 mRNA and protein in brown adipocytes at E15.5 suggests that Gata6 is transiently expressed during brown adipocyte differentiation and is downregulated in more mature brown adipocytes. Similar expression of Gata6 during brown adipocyte differentiation was observed in the Angueira dataset (Figure 11C).

[0115] To experimentally demonstrate that Gata6 is expressed by precursors that give rise to brown adipocytes, we labeled Gata6-expressing cells during embryonic development using the Gata6-CreERT2:Rosa26-tdTomato mouse line (Donati et al., 2017). We induced recombination using tamoxifen injection at E12.5 and analyzed the contribution of labeled cells to brown adipose tissue at E15.5 (Figure 2C). Immunofluorescence analysis of tdTomato, which labels the progeny of Gata6-expressing cells, confirmed that they give rise to cardiac and pulmonary blastema at E12.5, as expected (Figure 2C). Among somite-derived cells, tdTomato-positive cells were found mainly in the interscapular BAT region and not in other somite derivatives such as skeletal muscle, cartilage, or endothelial cells (Figure 12A). TdTomato-positive cells were not detected in skeletal muscle, and we did not observe any overlap with the CD31+ population of endothelial cells in brown adipose tissue (Figure 2C, Figure 12A). TdTomato-positive cells in interscapular BAT were also stained positive for Pparg at E15.5, confirming that these cells were adipocytes (Figure 2C). We also found rare cells next to blood vessels in interscapular brown adipose tissue where tdTomato expression showed some overlap with Myh11 staining (Figure 12B). Surprisingly, however, the number of such potential smooth muscle cells labeled was much lower than expected from the scRNAseq analysis. These cells may correspond to recently identified brown adipocyte precursors derived from the vascular smooth muscle lineage (Shamsi et al., 2021). We also observed cells expressing both TdTomato and Dpp4 at the periphery of the forming brown adipose population, supporting the expression of Gata6 by brown adipose precursors (Figure 12C). In conclusion, lineage tracing analysis argues that Gata6-expressing cells present at E12.5 in the mouse dorsal trunk belong primarily to the brown adipocyte lineage.

[0116] To further investigate the origin of these Gata6 precursors, we analyzed the contribution of Pax7 progeny to Gata6-positive brown fat precursors at E14.5 using the Pax7-Cre:Rosa26-mTmG mouse strain (Hutcheson et al., 2009). As expected, dorsal, ventral and limb skeletal muscles, as well as Pparg-expressing potential brown fat cell precursors, were identified as Pax7 progeny (Figure 2D). Membrane GFP also labeled Gata6-positive cells in the brown fat region, indicating that these cells originate from an early Pax7-expressing population (Figure 2E). Taken together, our experiments indicate that Pax7-positive somite precursors give rise to a Gata6-positive precursor population that differentiates into brown fat cells.

[0117] To further investigate whether Gata6 expression is conserved in human brown adipogenesis, we performed immunofluorescence analysis on 98-day-old and 135-day-old (estimated postconception age) human fetal tissues from the interscapular and suprascapular regions. We detected EBF2 and GATA6 expression in cells adjacent to skeletal muscle tissue (detected by MYHC antibody) beneath the dorsal dermis and dispersed between the deeper dorsal muscle bundles at day 98 of development (Figure 3A). Similar to mice, EBF2 was expressed in a broader area of ​​the dermis and deeper muscle regions. We also observed some lipid-filled UCP1- and PPARG-positive adipocytes in the deeper muscle regions (Figure 3B-C). In these regions, we detected PPARG- and GATA6-double positive cells, supporting the presence of GATA6-positive brown adipocyte precursors in humans (Figure 3B-C). More mature brown adipocytes, identified by the presence of lipid droplets, expression of PLIN1, and high expression of PPARG, do not express GATA6, suggesting that GATA6 expression is also restricted to early stages of brown adipocyte development in humans.

[0118] Example 4: Recapitulation of human brown fat development in vitro from pluripotent stem cells We next decided to take advantage of the characterization of mouse brown fat development to report the design of a differentiation protocol aimed at recapitulating this process from human pluripotent stem cells. We previously developed efficient protocols for the differentiation of human paraaxial mesoderm and skeletal muscle from iPSCs in vitro (Chal et al., 2016, Chal et al., 2015, Diaz-Cuadros et al., 2020). Since brown adipocytes are derived mainly from the paraxial mesoderm and share common precursors with skeletal muscle of the panniculus carnosus, we first aimed to recapitulate the development of Pax-3 positive panniculus carnosus cells in vitro. To achieve this, we first treated human iPSCs with the Wnt agonist CHIR and the BMP inhibitor LDN under serum-free conditions to differentiate them into presomitic mesoderm (PSM) (Figure 4A). At days 2-3, the majority of cells expressed presomitic mesoderm (PSM) markers MSGN1 (95±0.4%) and TBX6 (Figure 4B-C, Figure 13A), indicating that they had acquired a PSM predestined fate. To further differentiate PSM cells into panniculus cells, we treated the cultures with IGF, FGF, HGF, and LDN (Chal et al., 2016, Chal et al., 2015). To monitor cell differentiation toward a panniculus fate, we used CRISPR-Cas9 to knock in the Venus fluorescent reporter at the PAX3 locus in the NCRM1 iPSC line (Figure 13B). We used this reporter line to track the appearance of PAX3 in differentiating cells in vitro. At day 8, differentiating cells began to express PAX3, indicating the appearance of panniculus / panniculus cells (Figure 4D). 45±6.7% of the cells in the cultures were PAX3 positive at this stage (Figure 4E, Figure S13C). We further differentiated these cultures in medium containing HGF and IGF because this treatment promotes differentiation of somite PAX7 progenitor cells (Chal et al., 2016, Chal et al., 2015). In these cultures, PAX7 appeared around day 14, and by day 20, approximately 20-30% of the mononuclear population expressed PAX7 (Figure 4I) (Al Tanoury et al., 2020).To investigate the cellular composition of such cultures, we performed scRNAseq analysis at day 20. We analyzed 1671 cells and observed a major cluster containing cells expressing fibroblast markers such as PDGFRA, HIC1, and EBF2 (Figure 4F, Figure 13D). This cluster also contained a subpopulation of PAX7-positive cells associated with a smaller cluster corresponding to differentiating myogenic cells (MYOD1, MYH3) (Figure 13D). A small cluster of neural cells expressing SOX2 was also observed at this stage. Using a machine learning classifier trained on a mouse dataset, we observed that the identity of this human precursor cluster was related to the mouse FP cluster (Figure 4G). Interestingly, using a classifier trained on mouse embryonic time points, we found that these d20 human cultures were more closely related to mouse E11.5 cells (Figure 4H). In mouse embryos, Pax7-expressing cells can give rise to both skeletal muscle and brown fat by E11.5, after which they contribute exclusively to the myogenic lineage (Lepper and Fan, 2010). In d20 cultures, the majority of cells in the FP cluster expressing EBF2 were negative for PAX7 at the mRNA and protein levels, suggesting that the two populations have already separated or are in the process of separating.

[0119] To promote the brown adipogenic fate in these cultures, we next sought to identify potential signaling pathways involved in brown adipogenesis from the mouse dataset. Mouse knockout experiments have identified BMP activation and Wnt inhibition as key signals required for brown adipocyte development (Atit et al., 2006; Longo et al., 2004; Tseng et al., 2008). However, these studies have not precisely defined the time frame in which these cues are present during development. We observed expression of BMP ligands (Bmp7, Bmp4) and Wnt signaling antagonists (Sfrp1, Sfrp2, Sfrp4, Dkk2) primarily at the FP stage in the mouse dataset (Figure 4J, Figure 14). Expression of these secreted cues was downregulated in more mature cells of the brown adipocyte lineage. These data suggest that BMP activation and Wnt inhibition are significantly required at the FP stage. We also performed differential gene expression analysis of mouse dorsal stem scRNAseq datasets. Using KEGG pathway analysis, we identified several pathway-specific genes that were differentially expressed in the FP cluster (Figure 14A). These included genes involved in TGF beta signaling (Tgfbr2, Gdf10), thyroid hormone signaling (Creb3l1, Gnas, Gpx7, Creb5, Hsp90b1), and the FGF / PI3K-AKT pathway (Akt1, Igf1, Fgfr1) (Figure 14A-C).

[0120] Therefore, to recapitulate the sequence of signaling cues to which brown adipocyte precursors are exposed during in vivo differentiation, we dissociated primary cultures around day 20 of differentiation to remove myofibers and reseeded the cells for 4–6 days in medium containing BMP7, Wnt antagonist C-59, TGFb1, FGF2, and triiodothyronine (BCTFT medium) (Figure 4A). Strikingly, after culturing the cells in BCTFT medium, we saw a large increase in the number of GATA6-expressing cells compared to cells cultured in medium containing HGF and IGF (Figure 4K–L). The cells also showed upregulation of GATA6 and PPARG, as well as downregulation of MYOG mRNA, suggesting that BCTFT medium can promote adipogenic predestination while suppressing myogenic predestination (Figure 4M).

[0121] Following differentiation of iPSCs into brown adipocytes, we used CRISPR-Cas9 to generate a UCP1-mCherry fluorescent human iPSC reporter line. In this knock-in line, the mCherry construct was introduced immediately 5' to the start codon of UCP1, separated by a P2A peptide. Thus, the reporter is produced from the same transcript as UCP1 and targeted to the nucleus using an H2B tag (Figure 5A). The recombinant locus in the reporter iPS line was sequenced to verify correct integration. Using this reporter line, we further differentiated GATA6-positive precursors derived in BCTFT medium. We treated precursor cultures with an adipogenic cocktail containing 3-isobutyl-1-methylxanthine, ascorbic acid, triiodothyronine, the TGFb inhibitor SB431542, dexamethasone, EGF, hydrocortisone, and rosiglitazone for an additional 20–40 days (Figure 4A) (Hafner et al., 2016). In cultures examined after 40 days of differentiation, large UCP1-positive lipid-filled adipocytes began to appear, and adipocyte numbers steadily increased over the following 20 days. We quantified the number of UCP1-containing mature adipocytes by counting the number of UCP1-mCherry-positive cells at day 60 of differentiation. Cultures contained 46 ± 12% UCP1-mCherry-positive cells (Figure 5B–C). Using immunohistochemistry, we showed that 95% of mCherry-positive cells expressed UCP1 (Figure 5D). PLIN1 and BODIPY staining confirmed that iPSC-derived brown adipocytes (iPSC-BA) contained multilocular lipid droplets (Figure 5E-F). We further confirmed the expression of brown adipocyte markers such as UCP1, PPARG, CIDEA, and PLIN1 after 60 days of differentiation using RT-qPCR in culture (Figure 5G).

[0122] iPSC-BA contain abundant mitochondria, a hallmark of brown adipocytes, as revealed by immunofluorescence of mitochondrially encoded cytochrome c oxidase II (MT-CO2) and electron microscopy analysis at 60 days of differentiation (Figure 5H-I). These cultures contained a proportion of UCP1-negative cells that expressed EBF2 and / or GATA6 cells, suggesting that these cells may correspond to brown adipocyte progenitors (Figure 5J-K). Periodic acid staining and electron microscopy showed glycogen accumulation in many cells at this stage, a hallmark of differentiating brown adipocytes (Figure 5L-M) (Mayeuf-Louchart et al., 2019). Thus, our protocol recapitulated a similar developmental trajectory observed for brown adipocyte differentiation in mouse embryos and led to efficient differentiation of human iPSCs into UCP1-expressing brown adipocytes under serum-free culture conditions.

[0123] Example 5: scRNAseq analysis of in vitro differentiated human brown adipogenic lineages To further characterize iPSC differentiation into adipocytes, we performed scRNAseq of cultures at 40 days (d40) and 60 days (d60) of differentiation. After quality control and filtering, we analyzed 2744 and 5322 cells from d40 and d60 samples, respectively. UMAP projections followed by Leiden clustering analysis show that at d40, the majority of cells belong to a large cluster expressing fibroblast markers such as PDGFRA and HIC1 (Figure 15A-B). Using a machine learning classifier trained on the mouse dataset, we confirmed that this cluster, which we called precursors, is most similar to the mouse FP cluster (Figure 15C). We also detected a cluster of cells expressing BAPre markers (EBF2, CEBPA, PPARG) with the classifier that are most similar to the brown adipocyte precursor and brown adipocyte clusters. As observed in the mouse dataset, these two clusters also show expression of GATA6. We also observed a small cluster of skeletal muscle cells (MYOD1) and a cluster of neural cells (SOX2). At this stage, expression of PAX7 was not detectable. At d60, we still observed a large fibroblast cluster expressing markers such as PDGFRA and HIC1 (Figure 6A-B). Comparison with the mouse dataset using the classifier shows that it is closest to the FP cluster (Figure 6C). This cluster is associated with a cluster expressing GATA6, EBF2, and PPARG, suggesting that it is similar to the mouse BAPre cluster. Although the classifier analysis shows that it is more similar to the FP cluster, it shows similarity to the mouse brown adipocyte precursor and brown adipocyte clusters, suggesting that it corresponds to immature cells of the brown adipocyte lineage. We also identified a cluster of brown adipocytes (CEBPA, CIDEA, UCP1), which is most similar to the mouse brown adipocyte cluster based on the classifier analysis (Figure 6B). Small distinct clusters of cartilage (SOX9), smooth muscle (CNN1, ACTA2), and neurons (SOX2) were also observed (FIG. 16A).

[0124] We next merged the three time points (d20, d40, and d60) to generate a UMAP projection and performed a Leiden clustering analysis on this combined dataset (Figure 6D-E). We found that the cell types identified in the clustering analysis of the individual time points were mostly merged into a single cluster defined by cell identity, not age, as identified in this new analysis (Figure 6D-E, Figure 16B). As observed in the mouse dataset, the largest cluster corresponds to a progenitor cluster that is associated with a more mature predestined cluster. This suggests that the in vitro generated progenitor cluster represents a population of multipotent precursors similar to the mouse FP cluster. This cluster, like the FP cluster in the mouse dataset, is already present at d20 and is maintained during later stages (Figure 6F). Waddington OT analysis of the developmental trajectory of cells during differentiation in vitro suggests that the precursor cluster contributes to the brown adipocyte precursor and smooth muscle clusters observed at d40 and d60, as well as the cartilage identified at d60 (Figure 6G). It also indicates that the d60 brown adipocyte cluster is likely derived from the brown adipocyte precursor cluster (Figure 6H).

[0125] To further establish the identity of the in vitro differentiated cells, we directly compared the d60 human cultures to the mouse scRNaseq dataset. The list of expressed mouse genes was converted to their human orthologues, and the two datasets were integrated and analyzed together using UMAP projection followed by Leiden clustering. Human and mouse cells identified as fibroblast precursors, BAPre, and brown adipocytes were found in the same clusters in the integrated dataset, indicating similarity between in vitro differentiated human cells and the mouse brown adipocyte lineage differentiating in vivo (Figure 17A-C). Clusters of other lineages, such as cartilage or smooth muscle, also contained both mouse and human cells. A side-by-side comparison of the expression of specific markers of brown adipocyte differentiation in the same clusters in mouse and human cells shows very similar expression patterns (Figure 7A). Finally, we used classifiers trained on the mouse dataset to compare each time point analyzed in vitro to each of the different mouse embryonic ages analyzed. This suggests that d40 cells are closer to E14.5-15.5, and d60 are closer to E15.5 (Figure 4G).

[0126] The single cell dissociation required for scRNAseq destroys mature lipid-filled brown adipocytes. This cell is absent from the scRNA dataset because it is a large floating cell and, moreover, cannot be encapsulated using the microfluidics platform used for the Indrops pipeline. Thus, we detected only about 1% of cells expressing UCP1 transcripts in the d60 scRNAseq dataset, whereas counting UCP1-mCherry positive cells using fluorescence microscopy in d60 cultures gives an estimate of about 40-50% positive cells. Nevertheless, our scRNAseq analysis suggests that in d60 cultures, about 40% of the cells belong to the BAPre and brown adipocyte clusters, and another 40% of the cells are in the precursor cluster. Thus, roughly 80% of the cells in the scRNAseq dataset represent different stages of brown adipocyte lineage differentiation. Taken together, this suggests that the majority of the d60 cultures (possibly up to 80-90%) correspond to cells that are at various stages of brown adipocyte lineage differentiation. In conclusion, this analysis suggests that a developmental trajectory of the brown adipocyte lineage highly similar to that observed in mouse interscapular fat in vivo can be recapitulated in vitro from human iPS cells, resulting in the production of immature brown adipocytes roughly equivalent to those in E15.5 mouse embryos.

[0127] To molecularly characterize iPSC-BA, which is mostly lost during dissociation in scRNAseq analysis, we performed bulk mRNA sequencing of undifferentiated iPSCs and cultures at 60 days of differentiation. In parallel, as a reference for differentiated adipocytes, we analyzed human fetal BAT (fBAT) isolated from fetuses at postconception ages of 115, 122, and 125 days from the interscapular and scapular regions. As an outgroup, we used bulk RNAseq data from iPSC-derived skeletal muscle cultures (iPSC-SkM) (Al Tanoury et al., 2021). Brown adipocyte-specific genes such as UCP1, CIDEA, PARGC1A, and DIO2 were specifically expressed in iPSC-BA and human fetal BAT (Figure 7A). Markers for precursors identified in this study, such as GATA6 and DPP4, were also detected, suggesting the presence of adipocyte precursors in the differentiating cultures (Figure 7A). The top 200 differentially expressed genes in iPSC-BAs corresponded to the human WikiPathways related to "PPARG signaling pathway", "estrogen receptor pathway", and "thermogenesis" (Figure 7B). When analyzed using the ProFat database (Cheng et al., 2018), the browning probability of iPSC-BAs was comparable to fetal brown adipocytes (Figure 7C). Recently, two studies have described the directed differentiation of brown adipocytes from hPSCs (Carobbio et al. 2021, Zhang et al., 2020). Comparison of our iPSC-BA with terminally differentiated adipocytes from two studies (50-day-old adipocytes from Zhang et al. (H9-d50) and 25-day-old adipocytes from Carobbio et al. (KOLF2-C1-d25)) showed that cells differentiated according to our protocol exhibited a higher degree of similarity to the gene expression profile of human fetal BAT and brown adipocytes (Figure 7D, Figure 18).

[0128] Example 6: Function of iPSC-derived brown adipocytes Next, we sought to investigate the functional potential of iPSC-BAs generated in vitro. In general, brown adipocytes are characterized by their potential to generate heat in response to beta-adrenergic stimulation and downstream activation of the cAMP pathway (Wang and Seale, 2016). This activation can be mimicked by treatment with forskolin, which activates cAMP signaling (Kriszt et al., 2017; Wang et al., 2020; Zhang et al., 2020). To test the ability of iPSC-BAs to respond to adrenergic stress, we used forskolin in 40-day-old reseeded adipogenic cultures. Cells treated with forskolin for 4 hours show increased UCP1 mRNA levels compared to vehicle-treated cells (Figure 7E). Forskolin treatment also induces lipolysis of stored triglycerides into fatty acids and glycerol. To evaluate the lipolytic activity of cells, we measured the amount of glycerol released in the medium after forskolin treatment. Compared to vehicle control-treated cells, forskolin-treated cells showed increased glycerol release, indicating that the cells underwent lipolysis (Figure 7F). Brown adipocytes can utilize free fatty acids to induce proton leak and perform thermogenesis. To measure the ability of iPSC-BAs to generate heat, we used ERThermAC, a thermosensitive vital fluorescent dye (Wang et al., 2020). As the temperature increases, the cells show lower ERthermAC fluorescence intensity. We preincubated iPSC-BAs with ERThermAC, treated them with PBS or forskolin, and measured the fluorescence intensity of the dye over time. We observed a reduction in dye intensity in forskolin-treated cells compared to vehicle-treated cells (Figure 7G). In contrast, no change in intensity was observed for the BA precursor in either condition. Overall, our data demonstrate that, like normal human brown adipocytes, iPSC-BAs induce UCP1 expression, undergo lipolysis, and generate thermogenesis in response to forskolin activation.

[0129] The process of thermogenesis is driven by the flow of protons through UCP1 in the inner mitochondrial membrane. To investigate whether forskolin-induced thermogenesis in iPSC-BAs is related to proton leak in mitochondria, we measured the oxygen consumption rate (OCR) using a Seahorse metabolic flux analyzer in 40-day-old reseeded cultures (Figure 7H). Treatment with oligomycin, an ATP synthase inhibitor, reduced OCR in cells. Interestingly, when iPSC-BAs were treated with forskolin together with oligomycin, OCR increased, suggesting increased proton leak leading to higher oxygen consumption (Figure 6D). In contrast, progenitors showed lower basal respiration levels and no increase in OCR upon forskolin treatment. As expected, inhibition of the electron transport chain using rotenone (mitochondrial complex I inhibitor) or antimycin (mitochondrial complex III inhibitor) led to a decrease in OCR (Figure 7H). These analyses support the functionality of in vitro differentiated human iPSC-BAs.

[0130] Example 7: Generation of UPC-1 positive organoids iPSC cultures were dissociated into single cells and aggregated on non-adherent U-bottom plates to form 3D structures. Structures were cultured for 11 days in DMEM / F12 GlutaMAX supplemented with 1% ITS, 3 μM CHIR99021, and 0.5 μM LDN-193189 supplemented with 5% FCS (PSM medium) to generate PAX3-expressing somite-like structures and panniculus carnosus cells. PAX3-expressing somite-like structures and panniculus carnosus cells were then cultured for 4–12 days in DMEM high glucose supplemented with 5% KSR, 1% ITS, 2 ng / ml FGF-2, 20 nM C59, 20 ng / ml BMP4, 10 ng / ml TGFb1, 2 nM T3 (adipocyte precursor medium). To differentiate the precursors into lipid vesicles containing BAs, organoids were cultured for 20-40 days in adipogenic differentiation medium (DMEM high glucose supplemented with 5% KSR, 1% ITS, 500 μM IBMX, 25.5 μg / ml L-ascorbic acid, 2 nM T3, 5 μM TGFb inhibitor SB431542, 1 μM dexamethasone, 10 ng / ml EGF, 4 μg / ml hydrocortisone, 1 μM rosiglitazone). The resulting brown adipose tissue (BAT) organoids were cryosectioned and stained with phalloidin (Figure 20). Lipid droplets were labeled and images are shown in inverted contrast.

[0131] Other embodiments While the present invention has been described in conjunction with its detailed description, it is to be understood that the foregoing description is intended to be illustrative, and not limiting, of the scope of the invention as defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

[0132] References Ahfeldt,T.,Schinzel,R.T.,Lee,Y.K.,Hendrickson,D.,Kaplan,A.,Lum,D.H.,Camahort,R.,Xia,F.,Shay,J.,Rhee,E.P.,et al.(2012).Programming human pluripotent stem cells into white and brown adipocytes.Nat Cell Biol 14,209-219.10.1038 / ncb2411. Al Tanoury,Z.,Rao,J.,Tassy,O.,Gobert,B.,Gapon,S.,Garnier,J.M.,Wagner,E.,Hick,A.,Hall,A.,Gussoni,E.,and Pourquie,O.(2020).Differentiation of the human PAX7-positive myogenic precursors / satellite cell lineage in vitro.Development.10.1242 / dev.187344. Al Tanoury,Z.,Zimmermann,J.,Rao,J.,Siero,D.,McNamara,H.M.,Cherrrier,T.,and al.,E.(2021).Prednisolone rescues Duchenne Muscular Dystrophy phenotypes in human pluripotent stem cells-derived skeletal muscle in vitro PNAS in press. An,Y.,Wang,G.,Diao,Y.,Long,Y.,Fu,X.,Weng,M.,Zhou,L.,Sun,K.,Cheung,T.H.,Ip,N.Y.,et al.(2017).A Molecular Switch Regulating Cell Fate Choice between Muscle Progenitor Cells and Brown Adipocytes.Dev Cell 41,382-391 e385.10.1016 / j.devcel.2017.04.012. Angueira,A.R.,Sakers,A.P.,Holman,C.D.,Cheng,L.,Arbocco,M.N.,Shamsi,F.,Lynes,M.D.,Shrestha,R.,Okada,C.,Batmanov,K.,et al.(2021).Defining the lineage of thermogenic perivascular adipose tissue.Nat Metab 3,469-484.10.1038 / s42255-021-00380-0. Atit,R.,Sgaier,S.K.,Mohamed,O.A.,Taketo,M.M.,Dufort,D.,Joyner,A.L.,Niswander,L.,and Conlon,R.A.(2006).Beta-catenin activation is necessary and sufficient to specify the dorsal dermal fate in the mouse.Dev Biol 296,164-176.10.1016 / j.ydbio.2006.04.449. Bagchi,D.P.,and MacDougald,O.A.(2021).Wnt Signaling:From Mesenchymal Cell Fate to Lipogenesis and Other Mature Adipocyte Functions.Diabetes 70,1419-1430.10.2337 / dbi20-0015. Carobbio,S.,Guenantin,A.C.,Bahri,M.,Rodriguez-Fdez,S.,Honig,F.,Kamzolas,I.,Samuelson,I.,Long,K.,Awad,S.,Lukovic,D.,et al.(2021).Unraveling the Developmental Roadmap toward Human Brown Adipose Tissue.Stem cell reports 16,641-655.10.1016 / j.stemcr.2021.01.013. Chal,J.,Al Tanoury,Z.,Hestin,M.,Gobert,B.,Aivio,S.,Hick,A.,Cherrier,T.,Nesmith,A.P.,Parker,K.K.,and Pourquie,O.(2016).Generation of human muscle fibers and satellite-like cells from human pluripotent stem cells in vitro.Nature protocols 11,1833-1850.10.1038 / nprot.2016.110. Chal,J.,Oginuma,M.,Al Tanoury,Z.,Gobert,B.,Sumara,O.,Hick,A.,Bousson,F.,Zidouni,Y.,Mursch,C.,Moncuquet,P.,et al.(2015).Differentiation of pluripotent stem cells to muscle fiber to model Duchenne muscular dystrophy.Nat Biotechnol 33,962-969.10.1038 / nbt.3297. Chal,J.,and Pourquie,O.(2009).Patterning and Differentiation of the Vertebrate Spine.Cold Spring Harbor Monograph The Skeletal System,41-116. Chal,J.,and Pourquie,O.(2017).Making muscle:skeletal myogenesis in vivo and in vitro.Development 144,2104-2122.10.1242 / dev.151035. Chen,H.,Albergante,L.,Hsu,J.Y.,Lareau,C.A.,Lo Bosco,G.,Guan,J.,Zhou,S.,Gorban,A.N.,Bauer,D.E.,Aryee,M.J.,et al.(2019).Single-cell trajectories reconstruction,exploration and mapping of omics data with STREAM.Nature communications 10,1903.10.1038 / s41467-019-09670-4. Cheng,Y.,Jiang,L.,Keipert,S.,Zhang,S.,Hauser,A.,Graf,E.,Strom,T.,Tschop,M.,Jastroch,M.,and Perocchi,F.(2018).Prediction of Adipose Browning Capacity by Systematic Integration of Transcriptional Profiles.Cell reports 23,3112-3125.10.1016 / j.celrep.2018.05.021. Christ,B.,Huang,R.,and Scaal,M.(2007).Amniote somite derivatives.Dev Dyn. Cypess,A.M.,Lehman,S.,Williams,G.,Tal,I.,Rodman,D.,Goldfine,A.B.,Kuo,F.C.,Palmer,E.L.,Tseng,Y.H.,Doria,A.,et al.(2009).Identification and importance of brown adipose tissue in adult humans.The New England journal of medicine 360,1509-1517.10.1056 / NEJMoa0810780. Diaz-Cuadros , M. , Wagner , DE , Budjan , C. , Hubaud , A. , Tarazona , OA , Donelly , S. , Michaut , A. , Al Tanoury , Z. , Yoshioka-Kobayashi , K. , Niino , Y. , et al 580.113-118.10.1038 / s41586-019-1885-9. Donati, G., Rognoni, E., Hiratsuka, T., Liakath-Ali, K., Hoste, E., Kar, G., Kayikci, M., Russell, R., Kretzschmar, K., Mulder, KW, et al properties.Nat Cell Biol 19.603–613.10.1038 / ncb3532. Freyer, L., Schroter, C., Saiz, N., Schrode, N., Nowotschin, S., Martinez-Arias, A., and Hadjantonakis, AK(2015). 15.38.10.1186 / s12861-015-0086-5. Guenantin,A.C.,Briand,N.,Capel,E.,Dumont,F.,Morichon,R.,Provost,C.,Stillitano,F.,Jeziorowska,D.,Siffroi,J.P.,Hajjar,R.J.,et al.(2017).Functional Human Beige Adipocytes From Induced Pluripotent Stem Cells.Diabetes 66,1470-1478.10.2337 / db16-1107. Gunawardana,S.C.,and Piston,D.W.(2012).Reversal of type 1 diabetes in mice by brown adipose tissue transplant.Diabetes 61,674-682.10.2337 / db11-0510. Hafner,A.L.,Contet,J.,Ravaud,C.,Yao,X.,Villageois,P.,Suknuntha,K.,Annab,K.,Peraldi,P.,Binetruy,B.,Slukvin,II,et al.(2016).Brown-like adipose progenitors derived from human induced pluripotent stem cells:Identification of critical pathways governing their adipogenic capacity.Sci Rep 6,32490.10.1038 / srep32490. Hasty,P.,Bradley,A.,Morris,J.H.,Edmondson,D.G.,Venuti,J.M.,Olson,E.N.,and Klein,W.H.(1993).Muscle deficiency and neonatal death in mice with a targeted mutation in the myogenin gene.Nature 364,501-506.10.1038 / 364501a0. Heaton,J.M.(1972).The distribution of brown adipose tissue in the human.J Anat 112,35-39. Hutcheson,D.A.,Zhao,J.,Merrell,A.,Haldar,M.,and Kardon,G.(2009).Embryonic and fetal limb myogenic cells are derived from developmentally distinct progenitors and have different requirements for beta-catenin.Genes Dev 23,997-1013.10.1101 / gad.1769009. Kablar,B.,Krastel,K.,Tajbakhsh,S.,and Rudnicki,M.A.(2003).Myf5 and MyoD activation define independent myogenic compartments during embryonic development.Dev Biol 258,307-318.10.1016 / s0012-1606(03)00139-8. Klein,A.M.,Mazutis,L.,Akartuna,I.,Tallapragada,N.,Veres,A.,Li,V.,Peshkin,L.,Weitz,D.A.,and Kirschner,M.W.(2015).Droplet barcoding for single-cell transcriptomics applied to embryonic stem cells.Cell 161,1187-1201.10.1016 / j.cell.2015.04.044. Koutsourakis,M.,Langeveld,A.,Patient,R.,Beddington,R.,and Grosveld,F.(1999).The transcription factor GATA6 is essential for early extraembryonic development.Development 126,723-732. Kriszt,R.,Arai,S.,Itoh,H.,Lee,M.H.,Goralczyk,A.G.,Ang,X.M.,Cypess,A.M.,White,A.P.,Shamsi,F.,Xue,R.,et al.(2017).Optical visualisation of thermogenesis in stimulated single-cell brown adipocytes.Sci Rep 7,1383.10.1038 / s41598-017-00291-9. Lepper,C.,and Fan,C.M.(2010).Inducible lineage tracing of Pax7-descendant cells reveals embryonic origin of adult satellite cells.Genesis 48,424-436.10.1002 / dvg.20630. Lidell,M.E.(2019).Brown Adipose Tissue in Human Infants.Handb Exp Pharmacol 251,107-123.10.1007 / 164_2018_118. Longo,K.A.,Wright,W.S.,Kang,S.,Gerin,I.,Chiang,S.H.,Lucas,P.C.,Opp,M.R.,and MacDougald,O.A.(2004).Wnt10b inhibits development of white and brown adipose tissues.J Biol Chem 279,35503-35509.10.1074 / jbc.M402937200. Madisen,L.,Zwingman,T.A.,Sunkin,S.M.,Oh,S.W.,Zariwala,H.A.,Gu,H.,Ng,L.L.,Palmiter,R.D.,Hawrylycz,M.J.,Jones,A.R.,et al.(2010).A robust and high-throughput Cre reporting and characterization system for the whole mouse brain.Nat Neurosci 13,133-140.10.1038 / nn.2467. Mayeuf-Louchart,A.,Lancel,S.,Sebti,Y.,Pourcet,B.,Loyens,A.,Delhaye,S.,Duhem,C.,Beauchamp,J.,Ferri,L.,Thorel,Q.,et al.(2019).Glycogen Dynamics Drives Lipid Droplet Biogenesis during Brown Adipocyte Differentiation.Cell reports 29,1410-1418 e1416.10.1016 / j.celrep.2019.09.073. Merklin,R.J.(1974).Growth and distribution of human fetal brown fat.Anat Rec 178,637-645.10.1002 / ar.1091780311. Morrisey,E.E.,Ip,H.S.,Lu,M.M.,and Parmacek,M.S.(1996).GATA-6:a zinc finger transcription factor that is expressed in multiple cell lineages derived from lateral mesoderm.Dev Biol 177,309-322.10.1006 / dbio.1996.0165. Mullur,R.,Liu,Y.Y.,and Brent,G.A.(2014).Thyroid hormone regulation of metabolism.Physiol Rev 94,355-382.10.1152 / physrev.00030.2013. Muzumdar,M.D.,Tasic,B.,Miyamichi,K.,Li,L.,and Luo,L.(2007).A global double-fluorescent Cre reporter mouse.Genesis 45,593-605.10.1002 / dvg.20335. Nishio,M.,Yoneshiro,T.,Nakahara,M.,Suzuki,S.,Saeki,K.,Hasegawa,M.,Kawai,Y.,Akutsu,H.,Umezawa,A.,Yasuda,K.,et al.(2012).Production of functional classical brown adipocytes from human pluripotent stem cells using specific hemopoietin cocktail without gene transfer.Cell Metab 16,394-406.10.1016 / j.cmet.2012.08.001. Ohta,H.,and Itoh,N.(2014).Roles of FGFs as Adipokines in Adipose Tissue Development,Remodeling,and Metabolism.Frontiers in endocrinology 5,18.10.3389 / fendo.2014.00018. Saito,M.,Okamatsu-Ogura,Y.,Matsushita,M.,Watanabe,K.,Yoneshiro,T.,Nio-Kobayashi,J.,Iwanaga,T.,Miyagawa,M.,Kameya,T.,Nakada,K.,et al.(2009).High incidence of metabolically active brown adipose tissue in healthy adult humans:effects of cold exposure and adiposity.Diabetes 58,1526-1531.10.2337 / db09-0530. Samuelson,I.,and Vidal-Puig,A.(2020).Studying Brown Adipose Tissue in a Human in vitro Context.Frontiers in endocrinology 11,629.10.3389 / fendo.2020.00629. Sanchez-Gurmaches,J.,and Guertin,D.A.(2014).Adipocytes arise from multiple lineages that are heterogeneously and dynamically distributed.Nature communications 5,4099.10.1038 / ncomms5099. Schiebinger,G.,Shu,J.,Tabaka,M.,Cleary,B.,Subramanian,V.,Solomon,A.,Gould,J.,Liu,S.,Lin,S.,Berube,P.,et al.(2019).Optimal-Transport Analysis of Single-Cell Gene Expression Identifies Developmental Trajectories in Reprogramming.Cell 176,928-943 e922.10.1016 / j.cell.2019.01.006. Schulz,T.J.,Huang,P.,Huang,T.L.,Xue,R.,McDougall,L.E.,Townsend,K.L.,Cypess,A.M.,Mishina,Y.,Gussoni,E.,and Tseng,Y.H.(2013).Brown-fat paucity due to impaired BMP signalling induces compensatory browning of white fat.Nature 495,379-383.10.1038 / nature11943. Schulz,T.J.,and Tseng,Y.H.(2013).Brown adipose tissue:development,metabolism and beyond.Biochem J 453,167-178.10.1042 / BJ20130457. Seale,P.,Bjork,B.,Yang,W.,Kajimura,S.,Chin,S.,Kuang,S.,Scime,A.,Devarakonda,S.,Conroe,H.M.,Erdjument-Bromage,H.,et al.(2008).PRDM16 controls a brown fat / skeletal muscle switch.Nature 454,961-967.10.1038 / nature07182. Seale,P.,Kajimura,S.,Yang,W.,Chin,S.,Rohas,L.M.,Uldry,M.,Tavernier,G.,Langin,D.,and Spiegelman,B.M.(2007).Transcriptional control of brown fat determination by PRDM16.Cell Metab 6,38-54.10.1016 / j.cmet.2007.06.001. Sebo,Z.L.,Jeffery,E.,Holtrup,B.,and Rodeheffer,M.S.(2018).A mesodermal fate map for adipose tissue.Development 145.10.1242 / dev.166801. Shamsi,F.,Piper,M.,Ho,L.L.,Huang,T.L.,Gupta,A.,Streets,A.,Lynes,M.D.,and Tseng,Y.H.(2021).Vascular smooth muscle-derived Trpv1(+)progenitors are a source of cold-induced thermogenic adipocytes.Nat Metab 3,485-495.10.1038 / s42255-021-00373-z. Stanford,K.I.,Middelbeek,R.J.,Townsend,K.L.,An,D.,Nygaard,E.B.,Hitchcox,K.M.,Markan,K.R.,Nakano,K.,Hirshman,M.F.,Tseng,Y.H.,and Goodyear,L.J.(2013).Brown adipose tissue regulates glucose homeostasis and insulin sensitivity.J Clin Invest 123,215-223.10.1172 / JCI62308. Takeda,Y.,Harada,Y.,Yoshikawa,T.,and Dai,P.(2017).Direct conversion of human fibroblasts to brown adipocytes by small chemical compounds.Sci Rep 7,4304.10.1038 / s41598-017-04665-x. Tseng,Y.H.,Kokkotou,E.,Schulz,T.J.,Huang,T.L.,Winnay,J.N.,Taniguchi,C.M.,Tran,T.T.,Suzuki,R.,Espinoza,D.O.,Yamamoto,Y.,et al.(2008).New role of bone morphogenetic protein 7 in brown adipogenesis and energy expenditure.Nature 454,1000-1004.10.1038 / nature07221. van Marken Lichtenbelt,WD,Vanhommerig,JW,Smulders,NM,Drossaerts,JM,Kemerink,GJ,Bouvy,ND,Schrauwen,P.,and Teule,GJ(2009).Cold-activated brown adipose tissue in healthy men.The New England journal of medicine 360,1500-1508.10.1056 / NEJMoa0808718. Virtanen,KA,Lidell,ME,Orava,J.,Heglind,M.,Westergren,R.,Niemi,T.,Taittonen,M.,Laine,J.,Savisto,NJ,Enerback,S.,and Nuutila,P.(2009).Functional brown adipose tissue in healthy adults. 360,1518-1525.10.1056 / NEJMoa0808949. Wang,CH,Lundh,M.,Fu,A.,Kriszt,R.,Huang,TL,Lynes,MD,Leiria,LO,Shamsi,F.,Darcy,J.,Greenwood,BP,et al.(2020).CRISPR-engineered human brown-like adipocytes prevent diet-induced obesity and ameliorate metabolic syndrome. translational medicine 12.10.1126 / scitranslmed.aaz8664. Wang,W.,Kissig,M.,Rajakumari,S.,Huang,L.,Lim,H.W.,Won,K.J.,and Seale,P.(2014).Ebf2 is a selective marker of brown and beige adipogenic precursor cells.Proc Natl Acad Sci U S A 111,14466-14471.10.1073 / pnas.1412685111. Wang,W.,and Seale,P.(2016).Control of brown and beige fat development.Nat Rev Mol Cell Biol 17,691-702.10.1038 / nrm.2016.96. Wolf,F.A.,Angerer,P.,and Theis,F.J.(2018).SCANPY:large-scale single-cell gene expression data analysis.Genome Biol 19,15.10.1186 / s13059-017-1382-0. Yao,C.X.,Xiong,C.J.,Wang,W.P.,Yang,F.,Zhang,S.F.,Wang,T.Q.,Wang,S.L.,Yu,H.L.,Wei,Z.R.,and Zang,M.X.(2012).Transcription factor GATA-6 recruits PPARalpha to cooperatively activate Glut4 gene expression.J Mol Biol 415,143-158.10.1016 / j.jmb.2011.11.011.

[0133] Zhang,L.,Avery,J.,Yin,A.,Singh,A.M.,Cliff,T.S.,Yin,H.,and Dalton,S.(2020).Generation of Functional Brown Adipocytes from Human Pluripotent Stem Cells via Progression through a Paraxial Mesoderm State.Cell stem cell 27,784-797 e711.10.1016 / j.stem.2020.07.013.

Claims

1. An in vitro method for generating Gata6-positive brown adipocyte progenitor cells, the method comprising culturing PAX3-positive somite progenitor cells in a medium containing an effective amount of each of an FGF signaling pathway activator, a BMP signaling pathway activator, a TGFβ signaling pathway activator, a Wnt signaling pathway inhibitor, and a thyroid hormone receptor activator, under conditions and for a period of time sufficient for the PAX3-positive cells to differentiate into Gata6-positive brown adipocyte progenitor cells.

2. 2. The method of claim 1, wherein the PAX3 positive somatic progenitor cells are generated by a method comprising culturing pluripotent cells, preferably induced pluripotent stem cells (iPSCs), or embryonic stem (ES) cells, in a medium comprising an effective amount of each of a hepatocyte growth factor (HGF) signaling pathway activator, an insulin-like growth factor (IGF) signaling pathway activator, and a fibroblast growth factor (FGF) signaling pathway activator, a Wnt signaling pathway activator, and a bone morphogenetic protein (BMP) signaling pathway inhibitor, to generate PAX3 positive somatic progenitor cells.

3. 3. The method of claim 1 or 2, further comprising culturing the PAX3 positive somatic progenitor cells in medium comprising an HGF signaling pathway activator and an IGF signaling pathway activator, but lacking an FGF signaling pathway activator and a BMP signaling pathway inhibitor, for 8 to 23 days.

4. 4. The method of claim 3, further comprising dissociating the PAX3-positive somatic progenitor cells after culturing the cells for 8-23 days.

5. The method of claim 2 , wherein the HGF signaling pathway activator comprises HGF.

6. The method of claim 2, wherein the IGF signaling pathway activator comprises IGF-1.

7. 3. The method of claim 1 or 2, wherein the FGF signaling pathway activator comprises at least one of FGF-1, FGF-2, FGF-3, FGF-4, FGF-5, FGF-6, FGF-7, FGF-8, FGF-9, FGF-10, FGF-11, FGF-12, FGF-13, FGF-14, FGF-15, FGF-16, FGF-17, FGF-18, FGF-19, FGF-20, FGF-21, FGF-22, FGF-23, and combinations thereof.

8. The method of claim 1 or 2, wherein the FGF signaling pathway activator comprises FGF-2.

9. 3. The method of claim 2, wherein the BMP signaling pathway inhibitor comprises at least one of LDN-193189, dorsomorphin, noggin, follistatin, cerberus, and combinations thereof.

10. The method of claim 2, wherein the BMP signaling pathway inhibitor comprises LDN-193189.

11. The method of claim 1 , wherein the BMP signaling pathway activator comprises at least one of BMP2, BMP4, BMP7, and combinations thereof.

12. 2. The method of claim 1, wherein the Wnt signaling pathway inhibitor comprises at least one of C59, XAV939, IWR-1, JW74, JW55, G007-LK, MSC2504877, benzimidazolone, WNT974, RK-287107, E7499, IWP-L6, GNF-1331, GNF-6231, ETC-131, IWP-29, LGK947, ETC159, ETC-1922159, and combinations thereof.

13. The method of claim 1 , wherein the Wnt signaling pathway inhibitor comprises C59.

14. 2. The method of claim 1, wherein the TGFβ signaling pathway activator comprises at least one of TGFβ1, TGFβ2, TGFβ3, and combinations thereof.

15. The method of claim 1 , wherein the TGFβ signaling pathway activator comprises TGFβ1.

16. 2. The method of claim 1, wherein the thyroid hormone receptor activator comprises at least one of triiodothyronine (T3), T4, resmetirom, eprotirom, sobetirom, Sob-AM2, VK2809, MB07344, IS25 TG68, and combinations thereof.

17. 2. The method of claim 1, wherein the thyroid hormone receptor activator comprises T3.

18. The method of claim 3, wherein the HGF signaling pathway activator of claim 3 is different from the HGF signaling pathway activator of claim 2.

19. The method of claim 3, wherein the IGF1 signaling pathway activator of claim 3 is different from the IGF1 signaling pathway activator of claim 2.

20. The method of claim 2, wherein the FGF2 signaling pathway activator of claim 2 is different from the FGF2 signaling pathway activator of claim 1.

21. 5. The method of claim 4, wherein dissociating the PAX3 positive somatic progenitor cells comprises using one or more of type IV collagenase and trypsin EDTA.

22. Dissociated cells at 60,000-100,000 cells / cm ２ 13. The method of claim 12, further comprising seeding at a density of

23. The method of claim 1, further comprising culturing the Gata6 positive cells in an adipogenic differentiation medium to generate brown adipocytes.

24. 18. The method of claim 17, wherein the adipogenic differentiation medium comprises Dulbecco's Modified Eagle's Medium (DMEM) High Glucose Medium supplemented with serum-free serum replacement, 1x insulin-transferrin-selenium (ITS), isobutylmethylxanthine (IBMX), l-ascorbic acid, T3, TGFβ inhibitor, dexamethasone, epidermal growth factor (EGF), hydrocortisone, and rosiglitazone.

25. 1. An in vitro method for generating UCP1-positive, Gata6-positive, and / or Pparg-positive brown adipocyte organoids, the method comprising culturing a PAX3-positive somite-like structure in a medium containing an effective amount of each of an FGF signaling pathway activator, a BMP signaling pathway activator, a TGFβ signaling pathway activator, a Wnt signaling pathway inhibitor, and triiodothyronine (T3) under conditions and for a period of time sufficient for the PAX3-positive somite-like structure to differentiate into a UCP1-positive, Gata6-positive, and / or Pparg-positive brown adipocyte organoid.

26. 26. The method of claim 25, wherein the PAX3-positive somite-like structures are generated by a method comprising culturing pluripotent cells, preferably induced pluripotent stem cells (iPSCs) or embryonic stem (ES) cells, in a medium comprising an effective amount of each of a Wnt activator and a bone morphogenetic protein (BMP) inhibitor to generate PAX3-positive somite-like structures.

27. 26. The method of claim 25, wherein the Wnt signaling pathway activator comprises at least one of Wnt-1, Wnt-2, Wnt-2b, Wnt-3a, Wnt-4, Wnt-5a, Wnt-5b, Wnt-6, Wnt-7a, Wnt-7a / b, Wnt-7b, Wnt-8a, Wnt-8b, Wnt-9a, Wnt-9b, Wnt-10a, Wnt-10b, Wnt-11, Wnt-16b, Wnt-3, R-spondin-1, R-spondin-2, R-spondin-3, R-spondin-4, and combinations thereof.

28. 26. The method of claim 25, wherein the Wnt signaling pathway activator comprises CHIR99021.

29. 27. The method of claim 26, wherein the BMP signaling pathway inhibitor comprises at least one of LDN-193189, dorsomorphin, noggin, follistatin, cerberus, and combinations thereof.

30. The method of claim 26, wherein the BMP signaling pathway inhibitor comprises LDN-193189.

31. 26. The method of claim 25, wherein the FGF signaling pathway activator comprises at least one of FGF-1, FGF-2, FGF-3, FGF-4, FGF-5, FGF-6, FGF-7, FGF-8, FGF-9, FGF-10, FGF-11, FGF-12, FGF-13, FGF-14, FGF-15, FGF-16, FGF-17, FGF-18, FGF-19, FGF-20, FGF-21, FGF-22, FGF-23, and combinations thereof.

32. The method of claim 25, wherein the FGF signaling pathway activator comprises FGF-2.

33. 26. The method of claim 25, wherein the BMP signaling pathway activator comprises at least one of BMP2, BMP4, BMP7, and combinations thereof.

34. 26. The method of claim 25, wherein the Wnt signaling pathway inhibitor comprises at least one of C59, XAV939, IWR-1, JW74, JW55, G007-LK, MSC2504877, benzimidazolone, WNT974, RK-287107, E7499, IWP-L6, GNF-1331, GNF-6231, ETC-131, IWP-29, LGK947, ETC159, ETC-1922159, and combinations thereof.

35. 26. The method of claim 25, wherein the Wnt signaling pathway inhibitor comprises C59.

36. 26. The method of claim 25, wherein the TGFβ signaling pathway activator comprises at least one of TGFβ1, TGFβ2, TGFβ3, and combinations thereof.

37. 26. The method of claim 25, wherein the TGFβ signaling pathway activator comprises TGFβ1.

38. 26. The method of claim 25, wherein the thyroid hormone receptor activator comprises at least one of triiodothyronine (T3), T4, resmetirom, eprotirom, sobetirom, Sob-AM2, VK2809, MB07344, IS25 TG68, and combinations thereof.

39. 26. The method of claim 25, wherein the thyroid hormone receptor activator comprises T3.

40. 26. The method of claim 25, further comprising culturing the organoids in an adipogenic differentiation medium to generate brown adipocyte organoids.

41. 41. The method of claim 40, wherein the adipogenic differentiation medium comprises Dulbecco's Modified Eagle's Medium (DMEM) High Glucose Medium supplemented with serum-free serum replacement, 1x insulin-transferrin-selenium (ITS), isobutylmethylxanthine (IBMX), 1-ascorbic acid, T3, TGFβ inhibitor, dexamethasone, epidermal growth factor (EGF), hydrocortisone, and rosiglitazone.

Images