Novel protein compositions and their use in dairy formulations - Patents.com

JP2025507085A5Pending Publication Date: 2026-03-16フィックス44 ラブズ プライベート リミテッド
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2023-03-09
Publication Date
2026-03-16

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

The present invention discloses a milk protein-containing composition comprising at least one milk protein; at least a first protein; at least a second protein; and at least a linker comprising an amino acid sequence encoded by a nucleotide sequence that is at least 80% similar to a sequence selected from the group consisting of SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, and SEQ ID NO:21.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] The invention described herein generally relates to novel protein compositions that can be used in dairy formulations. In particular, the invention relates to recombinant fusion proteins that can be used as sweet, savory, animal-free dairy alternatives, and methods for producing such recombinant proteins. Description of sequence listing This application has been filed with a Sequence Listing in electronic format. The filed Sequence Listing, entitled Sequence.ST25.txt, was created on March 9, 2023 and has a size of 12,288 bytes. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety. [Background technology]

[0002] Milk is considered a rich source of nutrients and is usually consumed with sugar in many milk-based beverages and other foods. With the world population estimated to exceed 9 billion consumers by 2050 (United Nations, 2013), the demand for nutrients, of which dairy products are a major component, is likely to increase. As demand for dairy products increases, the dairy industry (along with other animal protein producing industries) has negative environmental impacts, and vegan plant protein-based alternatives to dairy products often do not meet protein needs to the same extent (Alcorta et al, 2021). In parallel, sugar is usually added to various milks, milk-based beverages, or other foods to impart sweetness and desirable aromas. Although milk is considered a rich source of nutrition, there is growing concern worldwide about its simultaneous consumption with carbohydrate sugars, which are feared to cause obesity, diabetes, dental caries, and / or hyperlipidemia. Some of the natural sugars in natural dairy products, such as lactose, can cause intolerances, such as lactose intolerance. Over the past decade, it has been widely observed that there is an increasing trend towards using artificial low-calorie sweeteners such as saccharin, aspartame, cyclamate, sucralose, neotame, and acesulfame potassium as substitutes. However, even these artificial sweeteners have been proven to have certain adverse health effects such as dizziness, headaches, psychological challenges, gastrointestinal problems, and mood changes. This has created a great demand for sweet proteins identified and obtained from nature. Taste receptors on the tongue identify molecules that perfectly match a certain structure (common to carbohydrate sugars, artificial low-calorie sweeteners, and sweet proteins) and send a signal to the brain indicating that it identifies it as a "sweet" tasting compound.

[0003] Sucrose, table sugar, is considered to have a sweetness perception rating of 1 according to standard conventions, and other sweet substances are rated relative to this. Among the sweet proteins of particular interest are thaumatin, monellin and brazzein, which have been rated as 3000, 3000 and 2000 times sweeter than sucrose (Ming and Hellekant, 1994). The enormous sweetening capacity of these proteins or proteins with similar structure or properties also highlights their potential impact when used appropriately. These concerns have prompted the development of fusion proteins that can replace milk proteins and carbohydrates and offer nutritional and clinical advantages. Thus, it is contemplated that one or more proteins may be expressed via recombinant expression of the intended gene sequence in a microbial system, fused in a chain or tandem with one or more sweet proteins using one or more linkers to form a fusion protein, which not only serves as a rich source of protein, but also as a low-calorie, non-carbohydrate sweetener, overcoming otherwise associated health concerns. Summary of the Invention

[0004] Although the present subject matter relates to a protein composition consisting of a fusion protein, it should be understood that the present application is not limited to the specific compositions described, since there may be multiple possible embodiments not expressly set forth in this disclosure. It should also be understood that the terms used herein are merely for the purpose of describing implementations or versions or embodiments, and are not intended to limit the scope of the present subject matter. This Summary is provided to introduce aspects relating to protein compositions comprising fusion proteins. This Summary is not intended to identify essential features of the claimed subject matter, nor is it intended for use in determining or limiting the scope of the subject matter. The present invention is based on the discovery that by constructing a fusion gene with components encoding one or more proteins present in milk together with one or more sweet proteins naturally derived from plants, a fusion protein molecule is obtained that functions not only as a rich protein source but also as a low-calorie sweet protein, thereby overcoming the otherwise associated health concerns posed by the alternative sweeteners currently used. The composition thus obtained not only retains the original nutritional properties of the target dairy-based beverages and foods, but also imparts the desired taste and / or aroma, stability and solubility, while ensuring the avoidance of possible health concerns currently widespread worldwide. The milk protein portion of the resulting fusion protein will perform the same nutritional and functional properties as those performed by the animal-derived milk protein, and also serve as a replacement for all its applications and products derived therefrom. Furthermore, the sweet protein portion of the resulting fusion protein will function to replace / reduce lactose or other sugars in dairy applications and products derived therefrom, while at the same time increasing the total protein content of such products.

[0005] In one embodiment, the present invention provides a recombinant fusion protein comprising: a) at least a first protein; b) at least a second protein; and c) at least a linker comprising an amino acid sequence encoded by a nucleotide sequence that is 80% similar to a sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10. In one embodiment, the present invention provides a recombinant fusion protein comprising at least a first protein comprising an amino acid sequence having at least 80% sequence identity to a polypeptide encoded by a nucleotide sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7; at least a second protein comprising an amino acid sequence having at least 80% sequence identity to a polypeptide encoded by a nucleotide sequence selected from the group consisting of SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, and SEQ ID NO:13; and at least a linker comprising an amino acid sequence encoded by a nucleotide sequence that is 80% similar to a sequence selected from the group consisting of SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, and SEQ ID NO:21.

[0006] In one embodiment, the present invention provides a recombinant fusion protein comprising at least a first protein comprising an amino acid sequence having at least 80% sequence identity to a polypeptide encoded by a nucleotide sequence set forth in SEQ ID NO:1; at least a second protein comprising an amino acid sequence having at least 80% sequence identity to a polypeptide encoded by a nucleotide sequence set forth in SEQ ID NO:2; and at least a linker comprising an amino acid sequence encoded by a nucleotide sequence that is 80% similar to a sequence selected from the group consisting of SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:20, and SEQ ID NO:21. In at least one embodiment, the linker is an inert peptide linker. In one embodiment, the present invention provides a recombinant fusion protein comprising: a first protein comprising an amino acid sequence having at least 90% sequence identity to a polypeptide encoded by a nucleotide sequence set forth in SEQ ID NO:1; a second protein comprising an amino acid sequence having at least 90% sequence identity to a polypeptide encoded by a nucleotide sequence set forth in SEQ ID NO:2; and a linker comprising an amino acid sequence encoded by a nucleotide sequence that is at least 80% similar to a sequence selected from the group consisting of SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, and SEQ ID NO:21.

[0007] In one embodiment, the present invention provides a recombinant fusion protein comprising: a first protein comprising an amino acid sequence having at least 95% sequence identity to a polypeptide encoded by a nucleotide sequence set forth in SEQ ID NO:1; a second protein comprising an amino acid sequence having at least 95% sequence identity to a polypeptide encoded by a nucleotide sequence set forth in SEQ ID NO:2; and a linker comprising an amino acid sequence encoded by a nucleotide sequence that is at least 80% similar to a sequence selected from the group consisting of SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, and SEQ ID NO:21. In one embodiment, the linker is an inert peptide linker, consisting of a repeating sequence of amino acids. In one embodiment, the first protein is selected from the group comprising dairy proteins, non-dairy bovine proteins, and non-bovine proteins. In one embodiment the milk protein is a recombinantly expressed protein selected from the group comprising α-lactalbumin, β-lactoglobulin, κ-casein, α-casein, β-casein, lactoferrin, and the like.

[0008] In an exemplary embodiment, the milk protein is recombinant β-lactoglobulin. In one embodiment the second protein is selected from the group comprising low calorie non-carbohydrate sweeteners, or non-dairy bovine proteins, or non-bovine proteins of microbial, animal, vegetable or recombinant origin. In one embodiment, the low calorie non-carbohydrate sweetener is selected from the group consisting of brazzein, thaumatin, monellin, curculin, mabinlin, miraculin, neoculin, pentadin, and combinations thereof. In an exemplary embodiment, the low calorie sweetener is brazzein. In one embodiment, the dairy protein and low-calorie non-carbohydrate sweetener are produced in a microbial system. In one embodiment, the recombinant fusion protein comprises any combination of one or more of the first proteins listed with one or more second proteins from any source using one or more linkers.

[0009] In one embodiment, the fusion protein comprises any combination of one or more of the first proteins listed with one or more second proteins from any source in both directions using one or more linkers. In one embodiment, the fusion protein comprises at least one milk protein; at least one low-calorie sweet protein; and at least one inert peptide linker. In another embodiment, at least one dairy protein is fused to a low-calorie, non-carbohydrate, sweet protein using an inert peptide linker. In another embodiment, the fusion protein comprises at least one non-dairy bovine protein; at least one low-calorie sweet protein; and at least one inert peptide linker. In another embodiment, at least one non-dairy bovine protein is fused to a low-calorie, non-carbohydrate sweetener using an inert peptide linker.

[0010] In another embodiment, the fusion protein comprises at least one non-dairy, non-bovine protein; at least one low-calorie, sweet protein; and at least one inert peptide linker. In another embodiment, at least one non-dairy non-bovine protein is fused to a low-calorie non-carbohydrate sweetener using an inert peptide linker. In an exemplary embodiment, a fusion protein comprising the milk protein β-lactoglobulin is fused to brazzein using a flexible 12 amino acid chain inactive connecting peptide. In another embodiment, the inert peptide linker is selected from a flexible linker or a rigid linker, or a combination thereof. In another embodiment, the flexible peptide linker is (SGG) n It has the properties of SAG, where n=1-10. In another embodiment, the flexible peptide linker is (G) n where n=3~10. In another embodiment, the flexible peptide linker is (GGGGS) n where n=1 to 10.

[0011] In another embodiment, the rigid peptide linker is A(EAAAK) n It has the properties of A, where n=1 to 10. In another embodiment, the linker is a combination of one or more of the flexible and rigid inactive linker peptide chains described above. In another embodiment, the peptide linker is (SGG) n SAG-A (EAAAK) n A-(GGGGS) n where n=1 to 10. In another embodiment, the first and second proteins are linked in reverse orientation by an inert linker. In an exemplary embodiment, a fusion protein comprising the milk protein β-lactoglobulin is fused to brazzein using a rigid 17 amino acid chain inert peptide linker. In one embodiment, a recombinant fusion protein is provided comprising at least one first protein; at least one second protein; and at least one inert peptide linker, wherein the at least one first protein is fused to the second protein using the inert peptide linker. In another aspect, provided herein is a nucleic acid molecule encoding a recombinant fusion protein described herein.

[0012] In another aspect, provided herein is an expression vector comprising a nucleic acid sequence encoding a recombinant fusion protein described herein. In some embodiments, the dairy proteins and sweet proteins are produced in a microbial system. In another embodiment, the bovine milk protein or non-bovine protein is attached to the sweet protein via an inert linker. In another aspect, the present disclosure provides a) at least one recombinant fusion protein in the range of 0.1% to 8%; b) at least one non-fusion protein in the range of 1% to 10%; c) at least one additive in the range of 0.1% to 5%; A composition comprising: At least one recombinant fusion protein comprises a first protein, a second protein, and a linker having an amino acid sequence encoded by a nucleotide sequence that is 80% similar to a sequence selected from the group consisting of SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, and SEQ ID NO:21; A composition is provided.

[0013] In one embodiment, the at least one non-fusion protein is selected from the group consisting of proteins of microbial, animal, plant origin, or recombinantly expressed proteins. In one embodiment, the recombinant protein is mixed with at least one additive selected from the group consisting of carbohydrates, lipids, fats, ash, micronutrients, vitamins, etc. to obtain a dairy alternative with a similar mouthfeel. In one embodiment, the fat is of vegetable origin, microbial origin, fermentation origin, or the like. In one embodiment, the oil of vegetable origin is selected from the group consisting of sunflower oil, corn oil, soybean oil, palm fruit oil, palm kernel oil, safflower oil, linseed oil, rice bran oil, cottonseed oil, olive oil, canola oil, linseed oil, coconut oil, algae oil, and microbially produced fats. In one embodiment, the fat is obtained from the fermentation of an oil substrate of vegetable origin using microorganisms. In one embodiment, the recombinant composition comprises a fusion protein in which three proteins are linked by two linkers. In one embodiment, the recombinant fusion protein or composition is used in the formulation of dairy and related products. In one embodiment, the recombinant fusion protein is mixed with vegetable fat, ash, and water to provide a tasty dairy alternative beverage.

[0014] In one embodiment, the recombinant fusion protein can be used in other dairy products such as ice cream, frozen desserts, cakes, coffee creamers, etc. In one embodiment, the recombinant fusion protein can be used in, but not limited to, vegan protein supplements. In one aspect, provided herein is a method for producing a recombinant fusion protein comprising fermenting a recombinant host cell capable of producing said recombinant fusion protein. Further aspects, advantages, features and objects of the present invention will become apparent from the detailed description of the illustrative embodiments. It will be understood that the features of the present invention can be combined in various combinations without departing from the scope of the invention, which is defined by the following detailed description. To provide an understanding of embodiments of the present invention, reference is made to the accompanying drawings, which are not necessarily drawn to scale, and in which reference numerals designate components of exemplary embodiments of the present invention. The above and other features of the present invention as claimed, its nature and various advantages will become more apparent when considered in conjunction with the following detailed description, in which: [Brief description of the drawings]

[0015] [Figure 1A-1B] FIG. 1 shows the fusion of a representative protein A with a protein B using a representative peptide bond C according to one embodiment of the present invention. [Diagram 2] 1 is a vector map of an integrative vector used to produce the fusion proteins provided herein, according to a representative embodiment of the present invention. [Figure 3A-3D] 1 is an example of the representation of various gene cassettes according to an exemplary embodiment of the present invention. [Figure 4] 13 is a gel image of the expression of recombinant fusion proteins beta-lactoglobulin-L1-brazzein, brazzein-L1-beta-lactoglobulin, beta-lactoglobulin-L2-brazzein, and brazzein-L2-beta-lactoglobulin. [Diagram 5] 13 is a gel image of the expression of recombinant fusion proteins β-lactoglobulin-L3-brazzein, β-lactoglobulin-L4-brazzein. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0016] The present invention will now be described with reference to the accompanying embodiments, which are not intended to limit the scope and breadth of the invention. The descriptions given are purely by way of example and illustration. The embodiments herein and their various features and advantageous details are described with reference to non-limiting embodiments in the following description. Descriptions of well-known components and processing techniques are omitted so as not to unnecessarily obscure the embodiments herein. The examples used herein are merely intended to facilitate understanding of how the embodiments herein can be practiced and further enable those skilled in the art to practice the embodiments herein. Therefore, these examples should not be interpreted as limiting the scope of the embodiments herein. The foregoing description of specific embodiments fully reveals the general nature of the embodiments herein, and others, by applying current knowledge, can easily modify and / or adapt such specific embodiments for various applications without departing from the general concept, and therefore such adaptations and modifications should and are intended to be understood within the meaning and range of equivalents of the disclosed embodiments. It should be understood that the expressions or terms used herein are for the purpose of description and not for the purpose of limitation. Thus, although the embodiments herein are described in terms of preferred embodiments, those skilled in the art will understand that the embodiments herein can be practiced with modifications within the spirit and scope of the embodiments described herein.

[0017] Some embodiments of the present invention illustrating all of the features are now described in detail. The words "comprising," "having," "containing," and "including," as well as other forms thereof, are intended to be equivalent in meaning and open ended in that the items following any of these words are not meant to be an exhaustive listing of such items, nor are they meant to be limited to only the listed items. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, the preferred methods and materials are described here. In one aspect of the present invention, a protein composition comprising a fusion protein for incorporation into dairy and related products is disclosed to overcome the problems in the prior art and provide various advantages which are detailed in the following sections.

[0018] As used in the present specification and claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. For example, the term "article" may include a plurality of articles unless the context clearly dictates otherwise. Those skilled in the art will appreciate that elements in the figures are illustrated for simplicity and clarity and have not necessarily been drawn to scale. For example, the dimensions of some elements in the figures may be exaggerated relative to other elements to enhance understanding of the invention. There may be additional components described in the foregoing applications that are not depicted in one of the drawings described. Where such components are described but not depicted in a drawing, the absence of such a drawing should not be construed as an omission of such design from this specification. Although detailed embodiments of the present invention are disclosed herein as necessary, it should be understood that the disclosed embodiments are merely exemplary of the present invention, which may be implemented in various forms. Therefore, the specific structural and functional details disclosed herein are not to be construed as limiting, but merely as a basis for the claims and as a representative basis for teaching those skilled in the art to variously use the present invention in substantially any suitable detailed structure. Furthermore, the terms and phrases used herein are not intended to be limiting, but rather to provide an easily understandable description of the present invention.

[0019] The present invention focuses on creating fusion proteins using selected proteins and / or low-calorie sweet proteins by using inert peptide linkers to obtain proteins with sweet taste, stability and solubility while ensuring the avoidance of possible health concerns that are currently widespread worldwide. Taste receptors on the tongue identify molecules that perfectly match a specific structure (common to carbohydrate sugars, artificial low-calorie sweeteners, and sweet proteins) and deliver a signal to the brain indicating that it tastes sweet. Sweet proteins are typically about 50-200 amino acids in length and have a molecular weight of about 6.5-30 Kda (Zhao et al, 2021). Thus, provided herein is a recombinant fusion protein comprising at least one first protein; at least one second protein; and at least one inert peptide linker, wherein the at least one first protein is fused to the second protein using an inert peptide linker. The present disclosure also provides methods for producing the recombinant fusion protein and compositions comprising the same.

[0020] Milk is composed of two major protein classes: caseins (αS1-casein, αS2-casein, β-casein and κ-casein) and whey proteins (β-lactoglobulin and α-lactalbumin). Caseins are known to interact with each other to give rise to sub-micelles and micelles that play an important role in the stability and nutritional properties of milk. αS1-casein, αS2-casein and β-casein molecules remain embedded inside, while κ-casein partially protrudes from the micellar structure. Whey proteins remain suspended and do not participate in the formation of micelles. As used herein, a "milk protein" is any protein, or fragment or variant thereof, typically found in the milk of one or more mammals. In some embodiments, the milk proteins described herein are casein proteins, such as κ-casein, para-κ-casein, β-casein, α-S1-casein, and α-S2-casein. In one aspect of the present invention, a protein composition comprising a fusion protein for incorporation into dairy and related products is disclosed to overcome the problems in the prior art and provide various advantages which are detailed in the following sections.

[0021] Thus, the present invention in one embodiment focuses on creating fusion proteins using selected proteins and / or low-calorie sweet proteins by using inert peptide linkers to achieve one or more goals of the resulting protein, such as sweetness, stability and solubility. By constructing a fusion gene having components encoding one or more proteins present in milk along with one or more naturally derived sweet proteins from plants, a fusion protein molecule is obtained that will function not only as a rich protein source, but also as a low-calorie sweet protein, thereby overcoming otherwise associated health concerns posed by alternative sweeteners currently in use. The compositions thereby not only preserve the original nutritional properties of the target milk-based beverages and foods, but also impart the desired taste and / or aroma, stability and solubility, while ensuring the avoidance of potential health concerns currently prevalent worldwide. The milk protein portion of the resulting fusion protein will provide the same nutritional and functional properties as those provided by animal-derived milk proteins and will serve as a suitable replacement for all of the applications and products derived therefrom. Additionally, the sweet protein portion of the resulting fusion protein will function to increase the total protein content of such products while functioning to replace / reduce lactose or other sugars.

[0022] In the following description, for purposes of explanation, specific details are set forth in order to facilitate an understanding of the invention. However, it will be apparent to one skilled in the art that the invention may be practiced without these details. Those skilled in the art will appreciate that the embodiments of the invention, some of which are described below, may be incorporated into a number of systems. In view of the above, the present invention discloses a protein composition comprising a fusion protein in which two proteins are linked by a linker. The composition includes a fusion protein in which two proteins are linked by one linker, or the composition includes a fusion protein in which three proteins are linked by two linkers, or the fusion protein includes any combination of one or more of the first proteins listed and one or more second proteins from any source, using one or more linkers. A fusion protein molecule is obtained by constructing a fusion gene with components encoding one or more proteins present in milk together with one or more sweet proteins naturally derived from a plant. This involves the use of an inert peptide linker that has the desired level of flexibility and stability required during translation and serves as a bridge connecting the two resulting proteins synthesized as a fusion protein. Typically, the inert peptide linker is composed of at least 4 amino acids that confer one or more of the following to the fusion protein: A) flexible properties, or B) rigid properties, or C) improved solubility, or D) increased stability.

[0023] This composition thereby not only preserves the original nutritional properties of the target milk-based beverages and foods, but also imparts the desired taste and / or aroma, stability and solubility, while ensuring the avoidance of possible health concerns currently prevalent worldwide. The milk protein portion of the resulting fusion protein will perform the same nutritional and functional properties as those performed by animal-derived milk proteins and will also serve as a suitable replacement for all of its applications and products derived therefrom. Furthermore, the sweet protein portion of the resulting fusion protein will function to increase the total protein content of such products, while functioning to replace / reduce lactose or other sugars. In one exemplary embodiment of the invention, a composition is provided comprising a fusion protein comprising the milk protein β-lactoglobulin fused to brazzein using a flexible 12 amino acid chain inert peptide linker. Attached Figures 1A and 1B show a representative fusion of Protein A and Protein B using a representative inert peptide linkage according to one embodiment of the present invention. Protein A can be a dairy protein, a non-dairy bovine protein, a non-bovine protein of microbial, animal or plant origin, or a recombinant protein. Protein B is a low-calorie non-carbohydrate sweetener, or a dairy protein, or a non-dairy bovine protein, or a non-bovine protein of microbial, animal or plant origin, or a recombinant protein.

[0024] Accompanying FIG. 2 shows examples of vectors used to drive expression. According to an embodiment, the gene was cloned into pPICZA, an integrative vector containing the Pichia pastoris alcohol oxidase promoter, alcohol oxidase terminator, and Zeocin resistance gene. An integrative vector (illustrated in FIG. 2) containing a methanol inducible promoter (AOX1, FLD1, MOX1, DAS1, etc.), an alpha mating signal element, a Zeocin resistance cassette, and a terminator. A further example of a vector used herein is an integrative vector containing a constitutive promoter, an alpha mating signal element, a Zeocin resistance cassette, and a terminator. As above, but Zeocin is replaced with kanamycin resistance. Similarly, the alpha mating element is replaced with any signal element that drives expression into the extracellular compartment.

[0025] Expression Organisms: The recombinant molecules of the above embodiments may be expressed in microbial systems used for recombinant molecules, such as bacteria-Escherichia coli, Bacillus subtilis, Cyanobacteria, etc. Some examples of fungal expression hosts are Aspergillus niger, Aspergillus nidulans, Trichoderma reesei, Penicillium sps. Some examples of yeasts are Saccharomyces cerevisiae, Candida albicans, Kluyveromyces lactis, Kluyveromyces marxianus, Yarrowia sps, etc., and examples of methylotrophic yeasts are Pichia pastoris, Hansenula polymorpha, Candida boidini. Transformation: Transformation protocols such as chemical transformation using lithium acetate and LiCl, transfection, electroporation, PEG-mediated transformation, Agrobacterium-mediated transformation can be used.

[0026] Proteins of interest: Milk Proteins:- Some examples of milk proteins that may be used in the present invention include kappa casein, alpha-S1-casein, alpha-S2-casein, beta-casein, beta-lactoglobulin, alpha-lactalbumin, transferrin. Other Animal Proteins - Some examples of other proteins in the present invention include ovalbumin, ovotransferrin, ovomucoid. Beta-lactoglobulin Bovine beta-lactoglobulin is the major whey protein of bovine milk that is part of some embodiments of the present invention. The gene sequence is set forth below. CTGATTGTTACCCAGACCATGAAGGGTCTGGACATTCAAAAAGTTGCGGGCACCTGGTACAGCCTGGCGATGGCGGCGAGCGACATCAGCCTGCTGGATGCGCAGAGCGCGCCGCTGCGTGTG TATGTTGAGGAACTGAAGCCGACCCCGGAGGGCGACCTGGAAATTCTGCTGCAGAAATGGGAGAACGATGAATGCGCGCAGAAGAAGATCATTGCGGAGAAAACCAAGATCCCGGCGGTGTTC AAGATTGACGCGCTGAACGAAAACAAAGTGCTGGTTCTGGACACCGATTACAAAAAGTATCTGCTGTTTTGCATGGAGAACAGCGCGGAGCCGGAACAGAGCCTGGTGTGCCAATGCCTGGTT CGTACCCCGGAAGTGGACGATGAGGCGCTGGAAAAATTCGATAAGGCGCTGAAAGCGCTGCCGATGCACATCCGTCTGAGCTTTAACCCGACCCAGCTGGAGGAACAATGCCACATT [SEQ ID NO: 1]

[0027] Alpha-lactalbumin Alpha-lactalbumin is a bovine milk whey protein that is part of some embodiments of the present invention. The gene sequence is set forth below. GAACAATTGACTAAGTGTGAAGTTTTTAGAGAGTTGAAGGATTTGAAAGGTTACGGTGGTGTTTCTTTGCCAGAGTGGGTTTGTACTACTTTCCATACTTCTGGTTACGATACTCAAGCTATCGTTCAAAACAACGATTCTACTGAATACGGTTTGTTCCAAATTAACAATAAGATTTGGTGTAAAGAT GATCAAAACCCTCACTCTTCTAACATTTGTAACATCTCTTGTGATAAGTTCTTGGATGATGATTTGACTGATGATATTATGTGTGTTAAGAAAATTTTGGATAAGGTTGGTATTAATTACTGGTTGGCTCATAAGGCTTTGTGTTCTGAAAAATTGGATCAATGGTTGTGTGAGAAATTGTAA [SEQ ID NO: 2]

[0028] Kappa casein Kappa casein is the major casein in bovine milk proteins and is responsible for stabilizing milk micelles, which is part of some embodiments of the present invention. CAAGAACAAAACCAAGAGCAACCAATCAGATGTGAAAAGGATGAGAGATTTTTCTCTGATAAGATCGCTAAGTACATCCCAATCCAATATGTTTTGTCTAGATACCCTTCTTACGGTTTGAATTACTAC CAACAAAAGCCTGTTGCTTTGATTAACAACCAATTCTTGCCATACCCTTACTATGCTAAACCAGCTGCTGTTAGATCCCCTGCTCAAATTTTGCAATGGCAAGTTTTGTCTAACACTGTTCCAGCAAAG TCTTGTCAAGCTCAACCTACTACTATGGCTAGACATCCACACCCTCATTTGTCTTTCATGGCTATTCCACCTAAGAAAAACCAAGATAAGACTGAAATCCCAACTATTAATACTATTGCTTCTGGAGAG CCAACTTCTACTCCTACTATTGAAGCTGTTGAGTCTACTGTTGCTACTTTGGAGGCTTCTCCTGAAGTTATTGAGTCTCCACCTGAGATTAATACTGTTCAAGTTACTTCTACTGCTGTTTAA [SEQ ID NO: 3]

[0029] αS1 casein Alpha S1 casein is another major casein and is a major component of cow's milk, which is part of some embodiments of the present invention. [SEQ ID NO:4]

[0030] αS2 casein Alpha S2 casein is a casein protein and is a component of bovine milk. This is part of some embodiments of the present invention. [SEQ ID NO:5]

[0031] Beta-casein Beta-casein is the major casein protein and is a component of cow's milk, which is part of some embodiments of the present invention. [SEQ ID NO:6]

[0032] Ovalbumin Ovalbumin is the major protein found in egg white, accounting for about 55% of the total protein, which is part of some embodiments of the present invention.

[0033] Sweet Proteins: Examples of low-calorie non-carbohydrate sweeteners include brazzein, thaumatin, monellin, mabinlin, miraculin, curculin, neoculin, and pentadin. Brazzein is used herein as the low-calorie non-carbohydrate sweetener. Brazzein is a sweet protein from the plant species Pentadiplandra brazzeana, which is about 2000 times sweeter than sucrose on a molar basis. Two forms have been identified in nature. The major form begins with a pyroglutamic acid residue and is 54 amino acids long, while the minor form begins with the next amino acid, aspartic acid, and is 53 amino acids long. The minor form has been reported to have a better sweetening capacity, so the minor form was selected from Uniprot ID P56552 (sequence shown below), codon-optimized for Pichia pastoris, and synthesized.

[0034] Brazzain Brazzein is a sweet protein found in extracts of the plant Pentadiplandra brazzeana. It is 2000 times sweeter than sucrose on a molar basis. This is part of some embodiments of the present invention. GATAAGTGCAAGAAAGTCTATGAAAACTACCCAGTATCCAAATGTCAACTGGCTAACCAGTGCAATTATGACTGCAAGCTTGACAAGCACGCGAGGAGTGGGGAGTTTTTACGACGAGAAACGCAATCTACAGTGTATTTGCGATTACTGTGAATAT [SEQ ID NO: 8] Thaumatin Thaumatin is a sweet protein found in the fruit Thaumatococcus daniellii. It is 100,000 times sweeter than sucrose on a molar basis. This is part of some embodiments of the present invention. ATGGCCGCCACCACTTGCTTCTTCTTCCTCTTCCCCTTCCTCCTCCTCCTCACGCTCTCCCGCGCTGCCACCTTCGAGATCGTCAACCGCTGCTCCTACACCGTGTGGGCGGCCGCCTCCAAAGGCGACGCCGCCCTGGACGCCGGCGGCCGCCAGCTCAACTCGGGAGAGTCCTGGACCATCAACGTAGAACCCGGCACCAACGGTGGCAAAATCTGGGCCCGCACCGACTGCTATTTCGACGACAGCGGCAGCGGCATCTGCAAGACCGGCGACTGCGGCGGCCTCCTCCGGTGCAAGCGCTTCGGCCGGCCGCCCACCACGCTGGCGGAGTTCTCGCTCAACCAGTACGGCAAGGACTACATCGACATCTCCAACATCAAAGGCTTCAACGTGCCGATGGACTTCAGCCCGACCACGCGCGGCTGCCGCGGGGTGCGGTGCGCCGCCGACATCGTGGGGCAGTGCCCGGCGAAGCTGAAGGCGCCGGGGGGTGGTTGCAACGATGCGTGCACCGTGTTCCAGACGAGCGAGTACTGCTGCACCACGGGGAAGTGCGGGCCGACGGAGTACTCGCGCTTCTTCAAGAGGCTTTGCCCGGACGCGTTCAGTTATGTCCTGGACAAGCCAACCACCGTCACCTGCCCCGGCAGCTCCAACTACAGGGTCACTTTCTGCCCTACTGCCCTTGAACTTGAAGACGAGTAA[SEQ ID NO:9]

[0035] Monellin ATGGGAGAGTGGGAAATTATCGATATTGGTCCCTTCACCCAAAACTTGGGAAAGTTTGCTGTTGACGAGGAAATAAAATCGGACAGTACGGGAAGACTCACTTTCAACAAGGTCATTAGGCCTTGATGAAGAAAACAATCTACGAGAACGAAGGCTTTAGAGAGATTAAGGGTACGAATATCAACTGTACGTGTATGCTTCCGATAAACTTTTCAGAGCCGATATCTCTGAGACTACAAGACTAGGGCAGGAAATTGCTCAGTTTAACGGACCTGTTCCTCACCGTAG[sequence number 10] ミラクリン ACAACAATGAAGGAATTAACAATGCTCTCTCTCTCGTTCTTCTTCGTCTCTGCATTGTTGGCAGCAGCGGCCAACCCACTGCTTAGTGCAGCGGATTCGGCACCCAATCCGGTTCTTGACATAGACGGAGAGAAACTCCGGACGGGGACCAATTATTACATTGTGCCGGTGCTCCGCGACCATGGCGGCGGCCTTACAGTATCCGCCACCACCCCCAACGGCACCTTCGTTTGTCCACCCAGAGTTGTCCAAACACGAAAGGAGGTCGACCACGATCGCCCCCTCGCTTTCTTTCCAGAGAACCCAAAGGAAGACGTTGTTCGAGTCTCCACCGATCTCAACATCAATTTCTCGGCGTTCATGCCCTGTCGTTGGACCAGTTCCACCGTGTGGCGGCTCGACAAATACGATGAATCCACGGGGCAGTACTTCGTGACCATCGGCGGTGTCAAAGGAAACCCAGGTCCCGAAACCATTAGTAGCTGGTTTAAGATTGAGGAGTTTTGTGGTAGTGGTTTTTACAAGCTTGTTTTCTGTCCCACCGTTTGTGGTTCCTGCAAAGTAAAATGCGGAGATGTGGGCATTTACATTGATCAGAAGGGAAGAAGGCGTTTGGCTCTCAGCGATAAACCATTCGCATTCGAGTTCAACAAAACCGTATACTTCTAATTGGGTTTGGGGGTGGTTTTTCCAATCACATCTCATGTATGATCAGCTCCATTATCGATCTGCATAATTATAATTAATAAGGAAGCTTTT [SEQ ID NO: 11]

[0036] Crucullin ATGGCGGCCAAGTTCTTCTCACCATTCTTGTCACCTTTGCGGCCGTCGCTAGCCTTGGCATGGCCGACAGTGTCCTGCTCCGGCAAACTCTGTATGCGGCCACTCCCTCAGTCGGGCAGTATACCTTAACCATACAAAACAACTGCAACCTGGTGAAATACCAGCACGGGAGCAGATCTGGGCTAGCGACACTGACGGGCAGGCTCCCAATGCCGCCTCACATTGCGGAGTGACGGGAACCTCATTATCTACGACGACAACAACATGGTCGTGTGGGGAGCGACTGCTGGGGGGAACAACGCAGTATGCTCTTGTTCTCAGCAGATGGCCTTTGTCATCTATGGCCCGGTTTTGGCCCCTTGGCCTTAATGGGTGCCGCAGTCTTAATGGTGAAATCACAGTTGCTAAGGATTCTACTGAACCACAACATGAGGATATTAAAGATCAGAGTTGCTAAGGTTAGCAAATCACAGTTGCTAAGGATTCTACTGAACCACAACATGAGGATATTAAAGATGGTGTTATTAATAATTAA[sequence number 12] ネオクリン [SEQ ID NO: 13]

[0037] Linker: A linker is a peptide molecule used to link two protein molecules to improve solubility, stability, and / or expression. Drugs such as Enbrel®, Ontak®, Orencia®, Amevive®, Arcalyst®, and Nplate® contain multiple proteins connected via linkers and are approved by the FDA. Linkers can be classified as flexible or rigid linkers (Chen et al., 2013; Smith et al. 2003). Flexible linkers are mainly composed of small amino acids such as glycine, alanine, and serine, and provide relatively high folding freedom by forming disordered loops (Argos, 1990). For example, an "L1-type linker" as used herein is composed of the amino acids (SGG) n It is composed of SAG [the corresponding nucleotide sequence is SEQ ID NO: 14].

[0038] A noted limitation of flexible linkers is the lack of rigid character. There are examples in the literature where the use of flexible linkers results in relatively lower yields / reduced biological activity (Amet et al., 2009; Maeda et al., 1997). Many α-helix-forming linkers have been used in the literature to construct recombinant fusion proteins (Amet et al., 2009; Bai and Shen, 2006). For example, the "L2-type linker" used herein is a linker consisting of the amino acid A (EAAAK) n A [the corresponding nucleotide sequence is SEQ ID NO: 15]. As demonstrated in the literature, the flexible and rigid linkers can also be further modified to achieve the required yield / biological activity (Chen et al., 2013). For example, the "L3-type linker" used herein is a nucleotide sequence consisting of the amino acids KKKR (SGG) n SAGKREAEA [the corresponding nucleotide sequence is SEQ ID NO: 16], and an "L4-type linker" as used herein is composed of the amino acids (KKKR). n (EAEA) n [The corresponding nucleotide sequence is SEQ ID NO:17].

[0039] L1-type linker SEQ ID NO:14 (TCTGGTGGG) n AGCGCGGGT In the formula, n=1~10 L2-type linker SEQ ID NO:15 GCT(GAAGCAGCTGCGAAA) n GCA In the formula, n=1~10 L3-type linker SEQ ID NO:16 AAAAAAAAAAGA(TCTGGTGGG) n AGCGCGGGTAAAAGA GAGGCTGAAGCT In the formula, n=1~10 L4-type linker SEQ ID NO:17 (AAAAAAAAAGA) n (GAGGCTGAAGCT) n In the formula, n=1~10 L5-type linker SEQ ID NO:18 (GGG) n In the formula, n=3~10 L6-type linker SEQ ID NO:19 (GGGGGTGGGGGTTCT) n In the formula, n=1~10 L7-type linker SEQ ID NO:20 GCT(GAAGCAGCTGCGAAA) 4 GCTTTGGAAGCT (GAAGCAGCTGCGAAA) 4 GCT L8-type linker SEQ ID NO:21 (CCAGCT) n CCA n=3~10

[0040] As is evident from the linkers mentioned above, they are composed of a repeating sequence of amino acids. This particular repeating sequence is repeated "n" times, where "n" can range from 1 to 10, although the length and properties of the linker sequence can be modified as necessary. An optimal number of repeats is essential to maintain the functionality and stability of the protein. If the proteins are too close together, the 3D structure and therefore the functionality can be affected. If they are too far apart, the stability of the recombinant molecule can be affected. Brazzein protein has four internal disulfide bridges: Cys4-Cys52, Cys16-Cys37, Cys22-Cys47, and Cys26-Cys49. These internal disulfide bridges make brazzein the most heat-stable sweet protein. This property is important because most artificial sweeteners cannot withstand the high temperatures used in baking and other cooking practices. As is evident, a very short linker with only one or two repeat motifs would cause steric hindrance from the first protein, since one of the disulfide bridges is close to both the N-terminus and the C-terminus, and therefore the correct conformation of the brazzein protein is stabilized by the Cys4-Cys52 disulfide bridge. This could be true for both orientations of the recombinant molecule. Therefore, in our example, we used n=3, which maintains a suitable spacing, so as not to affect the formation of the disulfide bridges and thus the structure of the brazzein protein.

[0041] Vector: The genes were cloned into the integrative vector pPICZA, which contains the Pichia pastoris alcohol oxidase promoter, alcohol oxidase terminator, and zeocin resistance gene. Signal peptide: alpha mating signal factor - The pro region of the yeast alpha mating factor is a secretion signal factor that is widely used for the expression of recombinant proteins in the extracellular compartment. In some embodiments, a signal factor optimized for extracellular secretion in Pichia pastoris is used. The sequence is listed below: SEQ ID NO:22 ATGAGATTTCCTTCAATTTTTACTGCTGTTTTATTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAG AAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCT Human serum albumin signaling factor The human serum albumin signal factor is another signal peptide commonly used for protein expression in Pichia pastoris. The signal factor sequence is listed below. SEQ ID NO:23 ATGAAGTGGGTCACCTTCATTTCCTTGCTGTTCTTGTTCTCTTCCGCTTACTCT

[0042] Pre-Ost1-α signaling factor In some embodiments, the pro region of the α mating factor is fused to Pre-Ost1 and used as the signal peptide. SEQ ID NO:24 ATGAGGCAGGTTTGGTTCTCTTGGATTGTGGGATTGTTCCTATGTTTTTTCAACGTGTCTTCTGCTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGAT TTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCT 3A-3D show representations of various gene cassettes according to one embodiment of the present invention. Figure 3A shows a representation of a gene cassette in which AOX1 is used as a vector and alpha mating signal factor is the signal peptide used for recombinant protein expression. β-lactoglobulin (protein A) is linked to brazzein (protein B) via an "L1-type linker" and vice versa. The "L1-type linker" can be replaced by an "L2-type linker" within the same gene cassette. Figure 3B shows a representation of a gene cassette in which AOX1 is used as a vector and alpha mating signal factor is the signal peptide used for recombinant protein expression. Beta casein (protein A) is linked to brazzein (protein B) via an "L1 type linker" and vice versa. The "L1 type linker" can be replaced with an "L2 type linker" within the same gene cassette. Figure 3C shows a representation of a gene cassette in which AOX1 is used as a vector and human serum albumin signal factor (HAS-SP) is the signal peptide used for recombinant protein expression. β-lactoglobulin (protein A) is linked to brazzein (protein B) via an "L1-type linker" and vice versa. The "L1-type linker" can be replaced by an "L2-type linker" within the same gene cassette. Figure 3D shows a representation of a gene cassette in which AOX1 is used as a vector and human serum albumin signal factor (HAS-SP) is the signal peptide used for recombinant protein expression. β-casein (protein A) is linked to brazzein (protein B) via an "L1-type linker" and vice versa. The "L1-type linker" can be replaced with an "L2-type linker" within the same gene cassette.

[0043] Figure 4 shows gel images of the expression of β-lactoglobulin-L1-brazzein, brazzein-L1-β-lactoglobulin, β-lactoglobulin-L2-brazzein, and brazzein-L2-β-lactoglobulin according to one embodiment of the present invention. In Figure 4, lane 1 is blank, lane 2 is blank, lane 3 is milk protein standard, lane 4 is β-lactoglobulin-L1-brazzein, lane 5 is brazzein-L1-β-lactoglobulin, lane 6 is β-lactoglobulin-L2-brazzein, and lane 7 is brazzein-L2-β-lactoglobulin.

[0044] Figure 5 shows gel images of the expression of β-lactoglobulin-L3-brazzein, β-lactoglobulin-L4-brazzein according to one embodiment of the present invention. In Figure 5, lane 1 is blank, lane 2 is blank, lane 3 is blank, lane 4 is milk protein standard, lane 5 is β-lactoglobulin-L3-brazzein, β-lactoglobulin-L4-brazzein. The present invention is further described in the light of the following exemplary materials and methods, which are provided for illustrative purposes only and should not be construed as limiting the scope of the present invention. The following experiments can be scaled up to industrial / commercial scale, and the results obtained can be extrapolated to industrial scale. Additional materials and methods that can be used for any method and composition are also known in the art.

[0045] composition In some embodiments, the following compositions may be prepared using the recombinant fusion protein molecules. Non-limiting examples of compositions include: 1. Milk protein is linked to sweet protein and combined with fat and ash, where the ash contains essential minerals. 2. The non-dairy protein is linked to sweet protein and combined with fat and ash, where the ash contains essential minerals. 3. Dairy and non-dairy proteins are linked to sweet proteins and combined with fat and ash, where the ash contains essential minerals. 4. The milk protein is linked to another milk protein. 5. The dairy protein is linked to a non-dairy protein. 6. The non-dairy protein is linked to a non-dairy protein.

[0046] protein In some embodiments, the following proteins are used in the protein compositions of the invention. Non-limiting examples of proteins include: 1. The milk proteins kappa casein, alpha S1 casein, alpha S2 casein, beta casein, beta lactoglobulin, alpha lactalbumin, transferrin, and ovalbumin. 2. Sweet proteins – thaumatin, monellin, mabinlin, miraculin, curculin, neoculin and pentadin. fat In some embodiments, the following fats are used in the compositions of the present invention: Non-limiting examples of fats include: Vegetable-based oils, such as sunflower oil, corn oil, soybean oil, palm fruit oil, palm kernel oil, safflower oil, linseed oil, rice bran oil, cottonseed oil, olive oil, canola oil, linseed oil, coconut oil; algal oils, microbially produced fats, and fats obtained from microbial fermentation of vegetable-based oil substrates.

[0047] ash In some embodiments, edible ash is used in the compositions of the present invention. mineral Non-limiting examples of minerals are calcium, phosphorus and magnesium. vector In embodiments, the following vectors are used in the protein compositions of the invention. Non-limiting examples of vectors are listed below. 1. An integrative vector containing a methanol-inducible promoter (such as AOX1, FLD1, MOX1, DAS1), an alpha mating signal element, a zeocin resistance cassette, and a terminator. 2. An integrative vector containing a constitutive promoter, an alpha mating signal element, a Zeocin resistance cassette, and a terminator. 3. A vector similar to those described in 1 and 2 above in which zeocin is replaced by kanamycin resistance. 4. Vectors similar to those described in 1-3 above in which the α mating factor is replaced by any signal factor that drives expression into the extracellular compartment.

[0048] Expression Organisms According to an embodiment of the present invention, the recombinant molecule in the above embodiment is preferably used in a microbial system, e.g. Bacteria - E. coli, Bacillus subtilis, Cyanobacteria, etc. Fungal expression hosts – Aspergillus niger, Aspergillus nidulans, Trichoderma reesei, Penicillium spp. Yeasts – Saccharomyces cerevisiae, Candida albicans, Kluyveromyces lactis, Kluyveromyces marxianus, Yarrowia species, etc. Methylotrophic yeasts – Pichia pastoris, Hansenula polymorpha, Candida boidinii It can be expressed in Transformation Transformation protocols such as chemical transformation using lithium acetate and LiCl, transfection, electroporation, PEG-mediated transformation, Agrobacterium-mediated transformation, etc. can be used. EXAMPLES

[0049] The following examples are included to illustrate certain embodiments of the present disclosure. The techniques disclosed in the examples represent techniques that the inventors have discovered to work well in the methods and processes of the present disclosure. However, those skilled in the art should understand in light of the present disclosure that many changes can be made to the specific embodiments disclosed and still obtain the same or similar results without departing from the spirit and scope of the present disclosure. Therefore, all matters described or shown in the examples are to be interpreted as illustrative and not limiting. Recombinant Vectors Briefly described here are exemplary recombinant vectors pPICZA-β-lactoglobulin-L1-brazzein, pPICZA-brazzein-L1-β-lactoglobulin, pPICZA-β-lactoglobulin-L2-brazzein, pPICZA-brazzein-L2-β-lactoglobulin, pPICZA-β-lactoglobulin-L3-brazzein, pPICZA-brazzein-L3-β-lactoglobulin, pPICZA-β-lactoglobulin-L4-brazzein, pPICZA-brazzein-L4-β-lactoglobulin.

[0050] The gene of interest was synthesized with a signal peptide of choice. The two genes were fused together using a linker by overlap PCR. The sequence of the linker was designed into the overlap PCR primers. The fusion construct was cloned into the EcoRI and NotI sites of pPICZA and transformed into E. coli NEB5 competent cells by standard protocols. Transformants were selected on 25 μg / ml Zeocin LB agar medium. Transformants were confirmed by restriction digestion and sequencing. host organism A derivative of the Pichia pastoris strain BG16 is designated and referred to herein as PX-1. Strain construction Plasmids selected for Pichia transformation were isolated in large quantities by midi-prep. 40 μg of plasmid DNA was linearized with SacI / PmeI enzymes and 5–10 μg of linearized vector was used to transform the above PX-1 strain by electroporation. The transformation protocol is briefly as follows: 100 ml of YPD medium was inoculated with 20–50 ul of inoculum of PX-1 strain and grown overnight until the OD was 1–1.3. The cells were harvested and washed twice with cold sterile milliQ water. In the next step, they were washed with 2 ml of 1 M sorbitol and finally resuspended in 200 μl of 1 M sorbitol. The cells were kept on ice and used for electroporation the same day. 80 μl of competent cells were mixed with 5–10 μg of linearized DNA and electroporated using the conditions preset for Pichia pastoris electroporation in a Bio-Rad electroporator. Immediately after electroporation, 1 ml of 1 M sorbitol was added and incubated at 30°C for 1 h. Then, 1 ml of YPD was added to the culture and further incubated at 30°C for 2-3 h with shaking. Colonies were selected on YPD-Zeocin plates with various concentrations (100-2000 μg / ml). Integration-positive colonies were confirmed by colony PCR.

[0051] Expression A single colony was inoculated into 10 ml of BMGY medium (1% yeast extract, 2% peptone, 100 mM potassium phosphate at pH 6.0, 1.34% yeast nitrogen base, 4 × 10-5% biotin, 1% glycerol), grown for 24 h, and then transferred to BMMY (1% yeast extract, 2% peptone, 100 mM potassium phosphate at pH 6.0, 1.34% YNB, 4 × 10-5% biotin, 0.5% methanol) medium for induction until the final OD was 1-2. 0.5% methanol was added to the culture every 24 h. Samples were harvested at 24, 48, and 72 h and visualized on SDS page for expression. Positive samples were then scaled up sequentially to 500 ml flasks, 1 ml flasks, and 8 L fermenters. Fermentation tank conditions A glycerol stock of the strain was inoculated into 50 mL of YPD broth in a 250 mL baffled flask. This inoculum was then used to inoculate 100 ml of GYP (1% yeast extract, 2% peptone, and 2% glycerol) as the acclimation stage. This was then used to inoculate 250 ml of BSM (4% glycerol, 2.7% orthophosphate, 1.8% K2SO4, 1.4% MgSO4·7H2O, 0.413% KOH, 0.116% CaSO4·2H2O). This culture was then inoculated into an 8 L fermenter containing BSM medium and the pH was maintained at 5 for the growth phase and 6 for the induction phase. The temperature was maintained at 30 for the growth phase and 24 for the induction phase.

[0052] Protein purification The culture supernatant was first processed through microfiltration to remove cells and other particulate matter, and the permeate was then concentrated using UF / DF and subsequently lyophilized to obtain the powdered protein. Taste Testing A double-blind study was conducted with 20 participants to analyze the sweetness index of the samples. A 30g / L sucrose solution at 20°C was used as the reference solution, with a sweetness index of 1. Participants were required to taste the samples and rate their sweetness index relative to the sucrose standard of 1.

[0053] Example 1 Construction of recombinant vectors for expression of recombinant fusion proteins Briefly described here are some exemplary recombinant vectors: pPICZA-β-lactoglobulin-L1-brazzein, pPICZA-brazzein-L1-β-lactoglobulin, pPICZA-β-lactoglobulin-L2-brazzein, pPICZA-brazzein-L2-β-lactoglobulin, pPICZA-β-lactoglobulin-L3-brazzein, pPICZA-brazzein-L3-β-lactoglobulin, pPICZA-β-lactoglobulin-L4-brazzein, pPICZA-brazzein-L4-β-lactoglobulin. The gene of interest was synthesized with a selected signal peptide. The two genes were fused together using a linker by overlap PCR. The sequence of the linker was designed within the overlap PCR primers. The fusion construct was cloned into the EcoRI and NotI sites of pPICZA and transformed into E. coli NEB5 competent cells by standard protocols. Transformants were selected on 25 μg / ml Zeocin LB agar medium. Transformants were confirmed by restriction digestion and sequencing.

[0054] host organism Pichia pastoris strain - a derivative of BG16 obtained from Atum Biosciences. Strain Construction - Plasmids selected for Pichia transformation were isolated in large quantities by midi prep protocol. 40 μg of plasmid DNA was linearized with SacI / PmeI enzymes and 5-10 μg of linearized vector was used for transformation of the above PPS-9016 strain by electroporation. The transformation protocol is briefly as follows: 100 ml of YPD medium was inoculated with 20-50 ul of inoculum of PX-1 strain and grown overnight until OD was 1-1.3. Cells were harvested and washed twice with chilled sterile milliQ water. In the next step, they were washed with 2 ml of 1 M sorbitol and finally resuspended in 200 μl of 1 M sorbitol. Cells were kept on ice and used for electroporation the same day. 80 μl of competent cells were mixed with 5-10 μg of linearized DNA and electroporated using the conditions preset for Pichia pastoris electroporation in a Bio-Rad electroporator. Immediately after electroporation, 1 ml of 1 M sorbitol was added and incubated at 30°C for 1 h. Then, 1 ml of YPD was added to the culture and further incubated at 30°C for 2-3 h with shaking. Colonies were selected on YPD-Zeocin plates with various concentrations (100-2000 μg / ml). Integration-positive colonies were confirmed by colony PCR.

[0055] Example 2 Expression of recombinant fusion proteins A single colony was inoculated into 10 ml of BMGY medium (1% yeast extract, 2% peptone, 100 mM potassium phosphate at pH 6.0, 1.34% yeast nitrogen base, 4 × 10-5% biotin, 1% glycerol), grown for 24 h, and then transferred to BMMY (1% yeast extract, 2% peptone, 100 mM potassium phosphate at pH 6.0, 1.34% YNB, 4 × 10-5% biotin, 0.5% methanol) medium for induction until the final OD was 1-2. 0.5% methanol was added to the culture every 24 h. Samples were harvested at 24, 48, and 72 h and visualized on SDS page for expression. Positive samples were then scaled up sequentially to 500 ml flasks, 1 ml flasks, and 8 L fermenters. Fermenter conditions: A glycerol stock of the strain was inoculated into 50 mL of YPD broth in a 250 mL baffled flask. This inoculum was then used to inoculate 100 ml of GYP (1% yeast extract, 2% peptone, and 2% glycerol) as the acclimation stage. This was then used to inoculate 250 ml of BSM (4% glycerol, 2.7% orthophosphate, 1.8% K2SO4, 1.4% MgSO4·7H2O, 0.413% KOH, 0.116% CaSO4·2H2O). This culture was then inoculated into an 8 L fermenter containing BSM medium and the pH was maintained at 5 for the growth phase and 6 for the induction phase. The temperature was maintained at 30°C for the growth phase and 24°C for the induction phase.

[0056] Example 3 Isolation and purification of fusion proteins The culture supernatant was first processed through microfiltration to remove cells and other particulate matter, and the permeate was then concentrated using UF / DF and lyophilized to obtain a protein powder. Example 4 Determination of recombinant fusion protein preference Taste test - A double-blind study was conducted with 20 participants to analyze the sweetness index of the samples. A 30g / L sucrose solution at 20°C was used as the reference solution with a sweetness index of 1. Participants were required to taste the samples and rate their sweetness index relative to the sucrose reference of 1. The above description is merely a preferred embodiment of the present invention, and is not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included in the scope of the present invention.

[0057] Throughout this specification the word "comprise" or variations such as "comprises" or "comprising" should be understood to mean the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of other elements, integers or steps, or group of elements, integers or steps. The use of the phrase "at least" or "at least one" connotes the use of one or more elements or components or amounts that may be used in embodiments of the disclosure to achieve one or more desired objectives or results. The numerical values ​​referred to for various physical parameters, dimensions, or quantities are merely approximations, and unless specifically stated to the contrary herein, values ​​higher / lower than the numerical value assigned to the parameter, dimension, or quantity are assumed to be within the scope of the present disclosure.

[0058] Although considerable emphasis has been placed herein on particular features of the disclosure, it will be understood that various modifications may be made and many changes may be made in the preferred embodiments without departing from the principles of the disclosure. These and other modifications in the nature of the disclosure or the preferred embodiments will be apparent to those skilled in the art from the disclosure herein, and it is therefore to be clearly understood that the foregoing descriptive matter is to be interpreted merely as illustrative of the disclosure and not as limiting.

Claims

1. a.) A polypeptide encoded by a nucleotide sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7, and at least a first protein comprising an amino acid sequence having at least 80% sequence identity with that polypeptide; b.) A polypeptide encoded by a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8, 9, 10, 11, 12, and 13, and at least a second protein comprising an amino acid sequence having at least 80% sequence identity with that polypeptide; c.) At least a linker comprising an amino acid sequence encoded by a nucleotide sequence that is at least 80% similar to a sequence selected from the group consisting of SEQ ID NOs: 14, 15, 16, 17, 18, 19, 20, and 21 Recombinant fusion proteins containing these proteins.

2. The recombinant fusion protein according to claim 1, wherein the first protein is selected from the group comprising milk protein, non-milk bovine protein, and non-bovine protein of microbial, animal, and plant origin.

3. The recombinant fusion protein according to claim 2, wherein the milk protein is a recombinant expression protein selected from the group comprising α-lactalbumin, β-lactoglobulin, κ-casein, α-casein, β-casein, lactoferrin, and the like.

4. The recombinant fusion protein according to claim 2, wherein the milk protein is recombinant β-lactoglobulin.

5. The recombinant fusion protein according to claim 1, wherein the second protein is selected from the group comprising a low-calorie, non-carbohydrate sweetener, a non-dairy bovine protein, or a non-bovine protein of microbial, animal, or plant origin.

6. The recombinant fusion protein according to claim 5, wherein the low-calorie, non-carbohydrate sweetener is selected from the group consisting of blazein, thaumatin, monellin, curculin, mavinlin, miraculin, neocrine, pentadine, and combinations thereof.

7. The recombinant fusion protein according to claim 6, wherein the low-calorie, non-carbohydrate sweetener is blazein.

8. The recombinant fusion protein according to claim 1, wherein a first protein is fused with a second protein using an inactive peptide linker comprising amino acids encoded by a nucleotide sequence that is at least 80% similar to a sequence selected from the group consisting of SEQ ID NOs: 14, 15, 16, 17, 18, 19, 20, and 21.

9. The recombinant fusion protein according to claim 1, wherein the orientations of the first protein and the second protein are interchangeable.

10. An expression vector comprising a nucleic acid molecule encoding a recombinant fusion protein according to any one of claims 1 to 9.

11. a) with at least one recombinant fusion protein; b) with at least one non-fusion protein; c) At least one additive and A composition comprising, At least one recombinant fusion protein, A polypeptide encoded by a nucleotide sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7, comprising at least a first protein having an amino acid sequence having at least 80% sequence identity with the polypeptide, A polypeptide encoded by a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8, 9, 10, 11, 12, and 13, and at least a second protein comprising an amino acid sequence having at least 80% sequence identity with the polypeptide, A composition comprising at least a linker having an amino acid sequence encoded by a nucleotide sequence that is at least 80% similar to a sequence selected from the group consisting of SEQ ID NOs: 14, 15, 16, 17, 18, 19, 20, and 21.

12. a) The presence of at least one recombinant fusion protein is in the range of 0.1% to 8%; b) The presence of at least one non-fusion protein is in the range of 1% to 10%; c) The amount of at least one additive is in the range of 0.1% to 5%. The composition according to claim 11.

13. The composition according to claim 11, wherein at least one non-fusion protein is selected from the group consisting of microbial, animal, plant, or recombinant expression proteins.

14. The composition according to claim 11, wherein the first protein of the recombinant fusion protein is selected from the group comprising milk protein, non-milk bovine protein, and non-bovine protein.

15. The composition according to claim 14, wherein the milk protein of the recombinant fusion protein is selected from the group comprising α-lactalbumin, β-lactoglobulin, κ-casein, α-casein, β-casein, lactoferrin, and the like.

16. The composition according to claim 11, wherein the second protein is selected from the group comprising a low-calorie, non-carbohydrate sweet protein, or a non-dairy bovine protein, or a non-bovine protein of microbial, animal, or plant origin, or a recombinant expression protein.

17. The composition according to claim 16, wherein the low-calorie, non-carbohydrate sweet protein is selected from the group consisting of blazein, thaumatin, monellin, curculin, mavinlin, miraculin, neocrine, pentazin, and combinations thereof.

18. The composition according to claim 11, wherein at least one additive is selected from the group consisting of lipids, fats, ash, micronutrients, vitamins, water, and the like.

19. The composition according to any one of claims 11 to 18, wherein the composition is used in the formulation of dairy products and related products.