Compositions and methods for treating diseases associated with pathogenic FUS variants

Abstract

The present invention relates to the field of antisense oligonucleotides used to reduce the expression of selected alleles of the FUS gene that encode the protein FUS, or variants thereof. The present invention also provides pharmaceutical compositions and methods for treating the effects of diseases associated with pathogenic FUS genetic variants by administration of therapeutic compositions comprising antisense oligonucleotides and AONs targeted to FUS, or variants thereof.

Description

[Technical field]

[0001] Technical Field The present invention relates to antisense oligonucleotides (AONs) that reduce expression of the FUS gene, which encodes the FUS RNA-binding protein (also known as Fused in Sarcoma). The present invention provides methods for selectively reducing expression of specific alleles of the FUS transcript by administration of AONs to reduce expression of FUS containing pathogenic variants associated with neurodegenerative diseases. [Background technology]

[0002] Background technology The following background art discussion is intended merely to facilitate an understanding of the present invention. This discussion is not an admission or acknowledgement that any of the material mentioned is or was part of common general knowledge as of the priority date of this application.

[0003] FUS

[0004] FUS encodes a ubiquitously expressed 526 amino acid protein that belongs to the FET family of RNA-binding proteins. FUS is primarily localized in the nucleus under normal physiological conditions, but translocates to the cytoplasm and functions in nucleocytoplasmic transport. FUS functions in diverse cellular processes including transcription, pre-mRNA splicing, RNA transport and translation regulation. FUS also participates in DNA repair mechanisms, including both homologous recombination during DNA double-strand break repair and homologous recombination in nonhomologous end joining. In addition, FUS plays a role in the formation of paraspeckles, which provide cellular defense against various types of stress.

[0005] Up to 10% of individuals affected with amyotrophic lateral sclerosis (ALS) have at least one other affected family member and are defined as having familial ALS (fALS); almost all of these cases are found to be inherited in an autosomal dominant manner. The remaining 90-95% of ALS cases occur in people with no previous family history, and these individuals are said to have sporadic ALS (sALS). Pathogenic variants in FUS are responsible for approximately 5% of fALS cases and less than 1% of sALS cases.

[0006] Currently, over 50 autosomal dominant FUS variants have been identified in ALS patients. The majority are missense mutations, but in rare cases, insertions, deletions, splicing and nonsense mutations have been reported. Many of the pathogenic variants are clustered within the nuclear localization signal, leading to redistribution of FUS to the cytoplasm. Others occur in the prion-like domain and 3'UTR, glycine- and arginine-rich regions. Variants within some regions appear to increase the tendency of the protein to form solid aggregates, indicating different pathological mechanisms operative in FUS-associated ALS.

[0007] FUS is autoregulated to repress the expression of exon 7, with one mechanism involving the protein binding to its own pre-mRNA. A frameshift in a splice variant that skips exon 7 results in a premature stop codon that subjects the transcript to nonsense-mediated decay. In FUS-ALS (FUS-amyotrophic lateral sclerosis) and FUS-FTD (FUS-frontotemporal dementia), mislocalization of FUS to the cytoplasm may impair autoregulation and lead to overexpression.

[0008] Impaired cellular function could also be a direct consequence of pathogenic FUS variants that have been reported to cause splicing defects, DNA damage and impair FUS autoregulation.In addition, there are indications that the disease propagation mechanism in FUS-ALS may be mediated by its prion-like protein domain.

[0009] The extent to which loss- or gain-of-function mechanisms cause disease in FUS-ALS remains a matter of debate. The FUS loss-of-function theory posits that the redistribution of FUS into the pathological cytoplasm renders it unable to carry out its functions in the nucleus. Evidence from mouse models suggests that loss of FUS is insufficient to cause ALS. However, this finding was contradicted when using a Drosophila FUS knockdown model, in which knockdown of the FUS orthologue Cabeza resulted in neuronal degeneration and motor defects.

[0010] There is strong evidence for a gain-of-function mechanism operating in FUS-ALS. Transgenic mouse models overexpressing wild-type human FUS have been reported to have a malignant phenotype of motor neuron degeneration and evidence of FUS accumulation in the cytoplasm. There is debate as to whether toxicity is primarily mediated directly by FUS aggregates or through an increase in soluble FUS in the cytoplasm following its redistribution. Cytoplasmic FUS distribution also alters stress granule dynamics. The aggregating nature of FUS is not purely pathological but is important in normal cellular function. Some have proposed that FUS aggregation may be a compensatory mechanism that protects cells from a potentially toxic increase in soluble cytoplasmic FUS.

[0011] Pathogenic FUS variants are associated with early-onset and juvenile ALS, which manifests as relentlessly progressive muscle atrophy and weakness, with effects on respiratory muscles that limit survival in most cases to less than 3 years after disease onset. Current treatment options are based on symptom management and respiratory support, with the only approved drug therapy extending survival by only a few months or providing only modest benefit in some patients. There are no effective treatments that slow or stop disease progression.

[0012] Due to strong evidence of gain-of-function toxicity caused by FUS aggregation, overexpression or cytoplasmic mislocalization, knockdown of FUS is generally considered an acceptable therapeutic strategy for treating patients with pathogenic FUS mutations. Several patients have received investigational FUS-targeted AONs on the basis of rescue use in treatment (ION363), which is currently undergoing phase 3 clinical trials (NCT04768972). Because FUS plays a major role in several DNA repair mechanisms, is involved in the regulation and splicing of many other genes, and plays a role in defense against cellular stress, there is concern that knocking down FUS may pose a future health risk by failing to perform these roles. For this reason, strategies have been pursued to selectively knock down one FUS allele over another, which could be targeted against alleles encountered by the patient's pathogenic variant.

[0013] Allele-selective knockdown strategy

[0014] FUS-ALS is a dominant disease, and the majority of affected patients have a deleterious variant in only one of their two alleles. This makes the AON-based allele-specific approach to FUS knockdown a viable strategy for treating these patients. Because FUS is autoregulated at its protein level, it may be possible to utilize AONs to selectively knockdown the expression of pre-mRNA and mRNA containing pathogenic variants, while leaving enough normal mRNA present to produce physiologically healthy amounts of protein.

[0015] This allele-selective strategy uses a gapmer-based AON design that exploits the endogenous enzyme RNase H. RNase H is a non-sequence-specific endonuclease that catalyzes the cleavage of the RNA strand in a DNA / RNA heteroduplex. Gapmers consist of a DNA-based core that is compatible with RNase H activity flanked by several bases (wings) that can be extensively modified and do not need to be compatible with RNase H activity. Gapmers may be directly targeted to regions of RNA where there is variation between alleles, and the variation is utilized to provide selectivity to the target allele. A number of properties of gapmers that can increase selectivity to the target allele can be modified, with effects that generally must be experimentally determined. Modifications can include the number, arrangement and base composition of mismatches between the gapmer and the target RNA, window (gap) or wing length, as well as changes in the length and chemistry of the molecule.

[0016] FUS-ALS is relatively rare, with at least 50 autosomal dominant ALS-associated mutations in FUS reported. Given the large number of pathogenic variants, each of which is extremely rare, it is economically unfeasible for pharmaceutical companies to invest resources in developing allele-specific treatments for each one; for this reason, common variants in FUS have been targeted.

[0017] FUS proteinopathy

[0018] Reducing expression of FUS alleles containing pathogenic variants has applications in the prevention and treatment of diseases associated with FUS proteinopathies, such as in FUS-ALS and FUS-FTLD or other neurological conditions where patients may have pathogenic FUS mutations. Expression of FUS alleles containing pathogenic variants may also have applications in the prevention and treatment of the following diseases: amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD) and essential tremor (ET).

[0019] It is against this background that the present invention has been developed, and in particular, aims to provide a means for alleviating FUS proteinopathy in diseases associated with pathogenic FUS genetic variants. Summary of the Invention [Means for solving the problem]

[0020] Summary of the Invention The present invention is directed to compounds, particularly AONs, targeted to nucleic acids encoding FUS.Embodiments of the present invention relate to AONs capable of binding to FUS pre-mRNA or mRNA.

[0021] Generally, according to a first aspect of the present invention, there is provided an antisense oligonucleotide targeted to a nucleic acid molecule encoding a FUS pre-mRNA or mRNA, the antisense oligonucleotide having (a) a nucleobase sequence selected from the list consisting of SEQ ID NO:1 to SEQ ID NO:34 or a variant thereof; or (b) a nucleobase sequence that is complementary to at least one or more contiguous nucleobases in a target FUS pre-mRNA or mRNA to which SEQ ID NO:1 to SEQ ID NO:34 or a variant thereof similarly binds, the antisense oligonucleotide inhibits expression of at least one allele of the FUS gene or a FUS gene variant thereof, and the antisense oligonucleotide is substantially isolated or purified.

[0022] In one embodiment, the allele comprises a pathogenic variant in the FUS gene, hi another embodiment, the pathogenic variant is a genetic change that increases a subject's susceptibility or predisposition to a disease.

[0023] In another embodiment, the disease is selected from the group consisting of ALS, FTD, ET.Preferably, the disease is selected from the group consisting of ALS or FTD.Preferably, the disease is selected from the group consisting of FUS-ALS or FUS-FTD.

[0024] In another embodiment, the antisense oligonucleotide binds to a region of the transcript contained within exon 3, exon 4 or the 3'UTR on FUS. Preferably, the antisense oligonucleotide binds to a region of the transcript that includes CV (rs741810), CV2 (rs1052352), or CV3 (rs4889537).

[0025] In another embodiment, the antisense oligonucleotides selectively knock down expression of one allele of the pre-mRNA and / or mRNA of FUS or a FUS variant, while leaving sufficient normal mRNA present to produce substantial amounts of protein.

[0026] In another embodiment, the antisense oligonucleotide induces RNase H-mediated degradation of FUS pre-mRNA and / or FUS mRNA.

[0027] In another embodiment, the antisense oligonucleotide is a thiophosphoramidate morpholino oligomer (TMO) chimera.

[0028] In another embodiment, the antisense oligonucleotides are thiophosphoramidate morpholino oligomer (TMO) chimeras having a gapmer design comprising TMO and phosphorothioate DNA or DNA subunits.

[0029] In another embodiment, the antisense oligonucleotide is a peptide-thiophosphoramidate morpholino oligomer (TMO) chimeric conjugate.

[0030] In another embodiment, the antisense oligonucleotide is selected from the list consisting of SEQ ID NOs: 1 to 12. Preferably, the antisense oligonucleotide is SEQ ID NO: 2, 4, 5, 8, or 11.

[0031] According to another aspect of the present invention, there is provided a method for inducing selective knockdown of selected alleles of FUS pre-mRNA and mRNA, the method comprising the steps of: (a) providing one or more of the antisense oligonucleotides described in any one of claims 1 to 14; and (b) binding the oligomer(s) to a target nucleic acid site.

[0032] According to another aspect of the present invention, there is provided a composition for treating, preventing or ameliorating the effects of a disease associated with a pathogenic variant in the FUS gene, the composition comprising: (a) one or more antisense oligonucleotides according to the first aspect of the invention; and (b) one or more therapeutically acceptable carriers and / or diluents.

[0033] According to another aspect of the present invention, there is provided a pharmaceutical composition for treating, preventing, or ameliorating the effects of a disease associated with a pathogenic variant in the FUS gene, the pharmaceutical composition comprising: (a) one or more antisense oligonucleotides of the first aspect of the invention; and (b) one or more pharma- ceutically acceptable carriers and / or diluents.

[0034] According to another aspect of the present invention, there is provided a method of treating, preventing, or ameliorating the effects of a disease associated with a pathogenic variant in the FUS gene, comprising administering to a subject an effective amount of a pharmaceutical composition of the present invention.

[0035] In one embodiment, pathogenic variant is a genetic change that increases the subject's susceptibility or predisposition to disease.In another embodiment, the disease is selected from the group consisting of ALS, FTD or ET.Preferably, the disease is selected from the group consisting of ALS or FTD.Preferably, the disease is selected from the group consisting of FUS-ALS or FUS-FTD.

[0036] According to another aspect of the present invention, there is provided a method for treating, preventing or alleviating the effects of disease associated with pathogenic variants in FUS gene in a patient identified by biomarker, comprising: (a) testing the subject for the presence of biomarkers associated with disease associated with FUS proteinopathy, the patient may respond to FUS suppression; and (b) administering to the subject an effective amount of the pharmaceutical composition of the present invention if the subject is found to express the biomarker.Preferably, the disease is selected from the group consisting of ALS or FTD.Preferably, the biomarker is a pathogenic variant in FUS gene.

[0037] According to another aspect of the present invention, there is provided a method for reducing expression of a selected FUS allele in a subject and / or reducing overexpression of FUS caused by autoregulation in a subject, comprising administering to the subject an effective amount of a pharmaceutical composition of the present invention.

[0038] According to another aspect of the present invention, there is provided a method of (a) reducing expression of a selected FUS allele in a subject; and / or (b) reducing overexpression of FUS caused by autoregulation in a subject, the method comprising administering to a subject an effective amount of a pharmaceutical composition comprising one or more antisense oligonucleotides according to the first aspect of the present invention; and one or more pharma- ceutically acceptable carriers and / or diluents.

[0039] According to another aspect of the invention there is provided an expression vector comprising one or more antisense oligonucleotides according to the first aspect of the invention.

[0040] According to another aspect of the invention there is provided a cell comprising an antisense oligonucleotide according to the first aspect of the invention.

[0041] According to another aspect of the invention there is provided use of an antisense oligonucleotide according to the first aspect of this invention for the manufacture of a medicament for treating, preventing or ameliorating the effects of a disease associated with a pathogenic variant in the FUS gene.

[0042] According to another aspect of the present invention there is provided a use of an antisense oligonucleotide according to the first aspect of this invention for treating, preventing or ameliorating the effects of a disease associated with a pathogenic variant in the FUS gene, preferably the disease is selected from the group consisting of ALS or FTD.

[0043] According to another aspect of the invention there is provided a kit for treating, preventing or ameliorating the effects of a disease associated with a pathogenic FUS variant in a subject, the kit comprising at least an antisense oligonucleotide according to the first aspect of the invention packaged in a suitable container together with instructions for its use.

[0044] Further features of the present invention are described in more detail in the following description of several non-limiting embodiments thereof, which description is included solely for purposes of illustrating the present invention and should not be understood as a limitation on the broad summary, disclosure or description of the invention set forth above.

[0045] The following description is provided with reference to the accompanying drawings, in which: [Brief description of the drawings]

[0046] [Figure 1] FIG. 1 shows FUS expression measured via PCR and agarose gel electrophoresis with densitometry in fibroblast cell lines homozygous for each CV transfected with FUS CV-targeted AONs (series 1). Cells transfected with L3K for 24 hours at 50 nM and 12.5 nM. (a) AONs targeted to CV1. (b) AONs targeted to CV2. (c) AONs targeted to CV3. Error bars are standard error (n=2).

[0047] [Diagram 2] Figure 2 shows the percentage of desired (non-targeted) alleles in CV2 heterozygous fibroblasts after 24 h incubation with 100 nM FUS CV2-targeted AONs or controls, as measured using droplet digital PCR. The distance of the additional mismatch refers to the number of bases away from the CV, and the type of mismatch is noted as the base in the AON followed by the base in the target RNA. Error bars are standard error (n > 2).

[0048] [Diagram 3] Figure 3 shows total FUS mRNA expression in CV2 heterozygous fibroblast cells 24 hours after transfection with 100 nM FUS CV2-targeted AONs or controls. Measured via RT-PCR, agarose gel electrophoresis and densitometry analysis. Additional mismatch distance refers to the number of bases away from the CV, and the type of mismatch is noted by the base in the AON followed by the base in the target RNA. Error bars are standard error (n=3).

[0049] [Figure 4] Figure 4 shows the percentage of desired allele and total FUS expression in CV2 heterozygous fibroblasts 3 days after transfection with CV2-targeted AONs CV2b and CV2e, with 2'-O methyl gapmer AONs with PS modifications only in the wings or throughout, and with TMO gapmers. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0050] Detailed Description The present invention provides prophylactic or therapeutic methods for mitigating or slowing further progression of symptoms of diseases associated with FUS proteinopathies (including ALS and FTD) using AON therapy. More specifically, the present invention provides isolated or purified AONs targeting a nucleic acid molecule encoding a FUS pre-mRNA or mRNA, the AON having (a) a nucleobase sequence selected from the list comprising SEQ ID NO:1 to SEQ ID NO:34, inclusive, or variants thereof, or (b) a nucleobase sequence that is complementary to at least one or more contiguous nucleobases in the target FUS pre-mRNA or mRNA to which SEQ ID NO:1 to SEQ ID NO:34, inclusive, or variants thereof also bind, and (c) the AON inhibits expression of human FUS or a variant thereof.

[0051] For convenience, the following section generally outlines the various meanings of terms used herein. Following this discussion, general aspects relating to the compositions, pharmaceutical uses and methods of the present invention are discussed, followed by specific examples that demonstrate the properties of various embodiments of the present invention and how they can be employed.

[0052] 1.Definition The meanings of certain terms and phrases used in the specification, examples, and appended claims are provided below. In the event of an apparent discrepancy between a term's usage in the art and its definition provided herein, the definition provided herein shall control.

[0053] Those skilled in the art will understand that the invention described herein tolerates variations and modifications other than those specifically described. The present invention includes all such variations and modifications. The present invention also includes all of the steps, features, formulations and compounds referred to or shown herein, individually or collectively, and any and all combinations of steps or features or any two or more thereof.

[0054] Each document, reference, patent application or patent cited in this specification is expressly incorporated herein by reference in its entirety, meaning that it should be read and considered by the reader as part of the specification. It is only for the sake of brevity that the documents, references, patent applications or patents cited in this specification are not repeated in this specification. However, neither the cited materials nor the information contained therein should be understood as common general knowledge.

[0055] Manufacturers' instructions, descriptions, product specifications, and product sheets for any products described in this specification or in any document incorporated by reference herein are hereby incorporated by reference and may be employed in the practice of this invention.

[0056] The present invention is not intended to be limited in scope by any of the specific embodiments described herein. These embodiments are intended for illustrative purposes only. Functionally equivalent products, formulations and methods are clearly within the scope of the invention described herein.

[0057] Except in the case of functional examples or unless otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood to be modified in all instances by the term "about." When used in connection with percentages, the term "about" can mean ±1%.

[0058] The invention described herein may include one or more ranges of values ​​(e.g., size, concentration, etc.). A range of values ​​is understood to include all values ​​within the range, including the values ​​that define the range, and the values ​​adjacent to the range that produce the same or substantially the same results as the values ​​that immediately adjacent to the values ​​that define the boundaries of the range. For example, those skilled in the art will understand that a 10% variation in the upper or lower limit of a range may be entirely appropriate and is encompassed by the present invention. More specifically, the variation in the upper or lower limit of a range will be 5% or as generally recognized in the art, whichever is greater.

[0059] In this application, the use of the singular includes the plural unless specifically stated otherwise. In this application, the use of "or" means "and / or" unless specifically stated otherwise. Furthermore, the use of the term "including" as well as other forms such as "includes" and "included" is non-limiting. Also, terms such as "element" or "component" encompass both elements and components that contain one unit and elements and components that contain more than one subunit, unless specifically stated otherwise. Also, the use of the term "moiety" may include a portion of a moiety or the entirety of a moiety.

[0060] Throughout this specification, unless the context requires otherwise, the words "comprise" or variations such as "comprises" or "comprising" will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers.

[0061] The term "administering" as used herein refers to placing a composition in a subject by a method or route that results in at least partial localization of the composition at its desired site of action so that the desired effect occurs.The compounds or compositions described herein may be administered by any suitable route known in the art, including, but not limited to, oral or parenteral routes, including intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), pulmonary, nasal, rectal, and topical (including buccal and sublingual) administration.

[0062] The term "FUS common variant" as used herein refers to a variant in the FUS gene or FUS protein. Preferably, the variant is common and occurs in the human population. More preferably, the variant occurs frequently in the human population.

[0063] Other definitions for selected terms used herein can be found within the detailed description of the invention and may be applied throughout. Unless otherwise defined, all other scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0064] Features of the present invention will now be discussed with reference to the following non-limiting descriptions and examples.

[0065] 2. Embodiment Embodiments of the present invention generally relate to improved antisense compounds specifically designed to suppress expression of FUS, and methods or uses thereof. Pathogenic variants in FUS are implicated in diseases associated with FUS proteinopathies, such as ALS and FTD.

[0066] Without being bound by theory, the present invention is based on the understanding that suppressing the expression of FUS containing pathogenic variants in patients who are heterozygous for pathogenic FUS variants can have the effect of slowing down the progression of symptoms and / or improving the survival of these patients.This is because FUS pathogenic variants can cause FUS mislocalization in the cytoplasm, splicing defects, DNA damage, and impair FUS autoregulation.Pathogenic FUS variants are associated with several neurological conditions, including ALS and FTD.Therefore, it is hypothesized that suppressing FUS alleles containing pathogenic variants can slow down the progression of symptoms and / or improve the survival rate of patients suffering from diseases associated with FUS pathogenic variants, including ALS and FTD.

[0067] A. Antisense Oligonucleotides The invention provides one or more isolated or purified AONs targeting nucleic acid molecules encoding FUS pre-mRNA and mRNA, the AONs having a nucleobase sequence selected from the list including SEQ ID NO:1 to SEQ ID NO:34 (as set forth in Tables 1 and 2 below), inclusive, where the AONs inhibit expression of human FUS or variants thereof. In one example, the AON is a thiophosphoramidate morpholino oligomer (TMO) chimera (gapmer): the wings are morpholino 3'-thiophosphoramidates, and the gap is a 2'-deoxynucleoside 3'-thiophosphate with a 2'-deoxynucleoside base at the 3' end. In another example, the AON is a 2'O-methoxyethyl chimera (gapmer).

[0068] Preferably, the AON targets a FUS common variant selected from the group consisting of CV1 (rs741810), CV2 (rs1052352), and CV3 (rs4889537).

[0069] More generally, the invention relates to an isolated or purified antisense oligonucleotide targeted to a nucleic acid molecule encoding a FUS pre-mRNA or mRNA, the AON comprising: a. a nucleic acid sequence selected from the list including SEQ ID NO: 1 to SEQ ID NO: 34, inclusive; or b. Nucleic acid base sequences that are complementary to at least one or more consecutive nucleobases in the target FUS pre-mRNA or mRNA to which SEQ ID NO:1 to SEQ ID NO:34, inclusive, also bind. having c.AON provides antisense oligonucleotides that inhibit the expression of human FUS or its variants.

[0070] Preferably, the AON targets a FUS common variant (FUS CV) provided in Table 1. [Table 1-1] [Table 1-2] The reference point (0) is set at the first base of the 5' and 3' splice sites; thus, "+" refers to a nucleotide bond within an exon and "-" indicates a nucleotide bond within an intron.

[0071] In one example, the AON targets a region of FUS CV2 provided in Table 2. [Table 2] The reference point (0) is set at the first base of the 5' and 3' splice sites; thus, "+" refers to a nucleotide bond within an exon and "-" indicates a nucleotide bond within an intron.

[0072] In any of the AONs of the invention, uracil (U) in the sequences provided herein may be replaced with thymine (T). In any of the AONs of the invention, thymine (T) in the sequences provided herein may be replaced with uracil (U).

[0073] Certain AONs of the invention are designed to complement preferred sequences within exons 3, 4 and 15 in the human FUS pre-mRNA and mRNA. In a preferred embodiment, the AONs of the invention are designed to complement preferred sequences within exons 3 or 4 of the human FUS pre-mRNA and / or mRNA. In a further preferred embodiment, the AONs of the invention are designed to selectively knock down expression of one allele of the pre-mRNA and / or mRNA in patients who are heterozygous for one of the FUS common variants. In a further preferred embodiment, the AONs of the invention are designed to induce RNase H-mediated degradation of the FUS pre-mRNA and / or FUS mRNA. Most preferably, the AONs of the invention are selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 34.

[0074] The terms "antisense oligomer" and "antisense compound" and "antisense oligonucleotide" or "AON" are used interchangeably and refer to a linear sequence of cyclic subunits, each carrying a base-pairing moiety linked by an intersubunit bond, which hybridizes to a target sequence in a nucleic acid (typically RNA) by Watson-Crick base pairing to form a nucleic acid:oligomer heteroduplex within the target sequence. The cyclic subunits are based on ribose or another pentose sugar, or in a preferred embodiment, on a morpholino group (see description of morpholino oligomers below). The oligomer may have exact or near sequence complementarity to the target sequence; variations in sequence near the ends of the oligomer are generally preferred over variations in the interior. Also contemplated are peptide nucleic acids (PNAs), locked nucleic acids (LNAs), and 2'-O-methyl oligonucleotides, among other antisense agents known in the art.

[0075] The term "oligonucleotide" includes polynucleotides such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), where RNA is prepared or obtained by transcription of a DNA template. According to the present invention, nucleic acids can exist as single- or double-stranded, linear or covalently closed circular molecules.

[0076] "Isolated" refers to a material that is substantially or essentially free from components that normally accompany it in its natural state. For example, "isolated polynucleotide" or "isolated oligonucleotide" as used herein may refer to a polynucleotide that is purified or removed from the sequences that are on either side of it in its natural state, for example, a DNA fragment that is removed from the sequences that flank the fragment in the genome. When the term "isolating" refers to a cell, it refers to the purification of the cell (e.g., fibroblast, lymphoblast) from the source subject (e.g., a subject with a polynucleotide repeat disease). In the context of mRNA or protein, "isolating" refers to the recovery of the mRNA or protein from the source, e.g., a cell.

[0077] An AON can be said to be "directed to" or "targeted against" the target sequence to which it hybridizes. In certain embodiments, the target sequence includes a region that includes the polyadenylation site and surrounding regions. The target sequence is typically a region that includes the AUG start codon of an mRNA, a translation suppressor oligomer, or a splice site, splice suppressor oligomer (SSO), of a pre-processed mRNA. In the case of a splice site, the target sequence can include an mRNA sequence that has from 1 to about 25 base pairs at its 5' end downstream of the normal splice acceptor junction in the pre-processed mRNA. A preferred target sequence is any region of a pre-processed mRNA that includes the splice site or is entirely contained within an exon coding sequence, or spans the splice acceptor or donor site. An oligomer is more generally said to be "targeted against" a biologically relevant target, such as a protein, virus, or bacterium, when it is targeted to the target nucleic acid in the manner described above.

[0078] "Sufficient length" or "sufficient sequence complementarity" as used herein refers to an AON that is complementary to at least one, more typically 1-30, consecutive nucleobases in the target FUS pre-mRNA and / or FUS mRNA. In some embodiments, an antisense having sufficient length includes at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 consecutive nucleobases in the target FUS pre-mRNA and / or FUS mRNA. In other embodiments, an antisense having sufficient length includes at least 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive nucleobases in the target FUS pre-mRNA and / or FUS mRNA. Preferably, the oligonucleotide having sufficient length is about 10 to about 50 nucleotides in length, including 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, and 40 oligonucleotides, or more nucleotides. In one embodiment, the oligonucleotide having sufficient length is 10 to about 30 nucleotides in length. In another embodiment, the oligonucleotide having sufficient length is 15 to about 25 nucleotides in length. In yet another embodiment, the oligonucleotide having sufficient length is 20 to 30, or 20 to 50 nucleotides in length. In yet another embodiment, the oligonucleotide having sufficient length is 22 to 28, 25 to 28, 24 to 29, or 25 to 30 nucleotides in length.

[0079] In certain embodiments, the AON has sufficient sequence complementarity with the target RNA to block a region of the target RNA (e.g., FUS pre-mRNA and / or mRNA) in an effective manner. In some other embodiments, the target RNA is a target pre-mRNA (e.g., FUS pre-mRNA and / or mRNA) and the invention induces RNase H-mediated degradation of the FUS pre-mRNA and / or FUS mRNA.

[0080] The terms "complementary" or "complementarity" as used herein are used in reference to polynucleotides (i.e., a sequence of nucleotides) related by the base-pairing rules. For example, the sequence 5'-AGT-3' is complementary to the sequence '-TCA-5'. Complementarity may be "partial," in which only a portion of the bases of the nucleic acids match according to the base-pairing rules; or there may be "complete" or "total" complementarity between the nucleic acids. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. Thus, a "complementary" sequence, as used herein, refers to an oligonucleotide sequence having some complementarity to a target RNA or DNA sequence.

[0081] For the purposes of this invention, the complement of a nucleotide sequence is a nucleotide sequence that would be capable of forming a double-stranded DNA or RNA molecule having the represented nucleotide sequence and further, a nucleotide sequence that can be derived from the represented nucleotide sequence by replacing a nucleotide by its complementary nucleotide according to Chargaff's rules (A<>T;G<>C;A<>U) and reading in the 5' to 3' direction, i.e., in the reverse direction of the represented nucleotide sequence. It also includes synthetic analogs of DNA / RNA (e.g., 2'F-ANA oligos).

[0082] The term "homology" or "identity" refers to the degree of complementarity. There may be partial homology or complete sequence identity between an oligonucleotide sequence and the complementary sequence of a target RNA or DNA. A partially identical sequence is an oligonucleotide that at least partially hybridizes to a target RNA or DNA, resulting in the formation of a partial heteroduplex and partial or total degradation of the target RNA or DNA. A completely identical sequence is an oligonucleotide that completely hybridizes to a target RNA or DNA, resulting in the formation of a complete heteroduplex and partial or total degradation of the target RNA or DNA.

[0083] In certain embodiments, the AON may be 100% complementary to the target sequence, or may contain mismatches, e.g., to accommodate variants, so long as the heteroduplex formed between the oligonucleotide and the target sequence is stable enough to withstand the action of cellular nucleases and other degradation modes that may occur in vivo. Thus, certain oligonucleotides may have about or at least about 70% sequence complementarity, e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence complementarity between the oligonucleotide and the target sequence.

[0084] Mismatches, if present, are typically less unstable toward the terminal regions of the hybrid duplex compared to the central region. The number of mismatches tolerated is expected to depend on the length of the oligonucleotide, the percentage of G:C base pairs in the duplex, and the position of the mismatch in the duplex, according to well-understood principles of duplex stability. Such AONs are not necessarily 100% complementary to the target sequence, but are effective for stably and specifically binding to the target sequence, so that the cleavage factor binding to the target pre-RNA is modulated.

[0085] The stability of the duplex formed between the AON and the target sequence is a correlation between the binding Tm and the susceptibility of the duplex to cleavage by cellular enzymes. The Tm of an oligonucleotide to a complementary sequence RNA can be measured by conventional methods, for example, as described by Hames et al., Nucleic Acid Hybridization, IRL Press, (1985), 107-108, or as described by Miyada CG and Wallace RB, (1987), Methods Enzymol. 154, 94-107. In certain embodiments, the AON may have a binding Tm to a complementary sequence RNA above body temperature, preferably above about 45°C or 50°C. Also included are Tms in the range of 60-80°C or higher.

[0086] Further examples of variants include AONs having about or at least about 70% sequence identity or homology, e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity or homology over the entire length of any of SEQ ID NOs: X-Y.

[0087] In a preferred embodiment, the AONs of the invention are designed to complement suitable sequences within exons 3 and 4 of the human FUS pre-mRNA and direct RNase H-mediated degradation of the transcript.

[0088] Certain AONs of the invention are designed to complement preferred sequences within exons 3, 4 and 15 in the human FUS pre-mRNA and / or mRNA. In a preferred embodiment, the AONs of the invention are designed to complement preferred sequences within exons 3 and 4 of the human FUS pre-mRNA. In a further preferred embodiment, the AONs of the invention are designed to selectively knock down expression of one allele of the pre-mRNA and / or mRNA, where the patient is heterozygous for the FUS common variant. In a further preferred embodiment, the AONs of the invention are designed to induce RNase H-mediated degradation of the FUS pre-mRNA and / or FUS mRNA. Most preferably, the AONs of the invention are selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 34.

[0089] The AON is preferably selected from those provided in Table 1 or Table 2. For example, the AON for use in the present invention is selected from the list comprising SEQ ID NOs: 1-34. Most preferably, the AON is selected from the list comprising SEQ ID NOs: 1-12. More preferably, the AON is selected from the list comprising SEQ ID NOs: 2, 4, 5, 8 and 11.

[0090] B.How to use The present invention further provides a method for inhibiting expression of FUS, comprising the steps of: (a) providing one or more of the AONs described herein; and (b) binding the oligomer(s) to the target nucleic acid site The present invention provides a method comprising:

[0091] More specifically, the AON may be selected from those set forth in Table 1 or Table 2. The sequence is preferably selected from the group consisting of any one or more of SEQ ID NOs: 1 to 34, and combinations or cocktails thereof, including sequences capable of hybridizing to such sequences under stringent hybridization conditions, sequences complementary thereto, sequences containing modified bases, modified backbones, and functional truncations or extensions thereof that have or modulate RNA processing activity in the FUS gene transcript.

[0092] Preferably, the AONs used in the present invention are selected from the list comprising SEQ ID NOs: 1 to 12. Most preferably, the AONs are selected from the list comprising SEQ ID NOs: 2, 4, 5, 8 and 11.

[0093] In a preferred embodiment, the AON used in the methods of the invention induces RNase H-mediated degradation of FUS pre-mRNA and / or mRNA.

[0094] (1) A therapeutic strategy combining AONs (SEQ ID NOs: 1-34) designed to reduce FUS expression reduces the impact of pathogenic FUS variants. In one aspect, the present invention aims to provide a means for alleviating FUS proteinopathy or disease in a subject suffering from a disease associated with a pathogenic FUS variant.

[0095] Target Sequences and Selective Hybridization An oligomer and a DNA, cDNA or RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides that can hydrogen bond with each other. Thus, "specifically hybridizable" and "complementary" are terms used to indicate a sufficient degree of complementarity or pairing between an oligomer and a DNA, cDNA or RNA target so that stable and specific binding occurs. It is understood in the art that the sequence of an AON does not necessarily have to be 100% complementary to that of its target sequence to be specifically hybridizable. An AON is specifically hybridizable when there is a sufficient degree of complementarity to avoid non-specific binding of the AON to non-target sequences under conditions where the binding of the compound to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA product and where specific binding is desired, i.e., in the case of in vivo assays or therapeutic treatments, under physiological conditions, and in the case of in vitro assays, under the conditions under which the assay is performed.

[0096] Selective hybridization may be under low, medium or high stringency conditions, but is preferably under high stringency. Those skilled in the art recognize that the stringency of hybridization is influenced by conditions such as salt concentration, temperature, or organic solvents, in addition to base composition, length of complementary strands, and number of nucleotide base mismatches between hybridizing nucleic acids. Stringent temperature conditions generally include temperatures above 30°C, typically above 37°C, preferably above 45°C, preferably at least 50°C, typically 60°C to 80°C or higher. Stringent salt conditions are usually less than 1000 mM, typically less than 500 mM, preferably less than 200 mM. However, the combination of parameters is more important than the measure of any single parameter. An example of stringent hybridization conditions is 65° C. and 0.1×SSC (1×SSC=0.15 M NaCl, 0.015 M sodium citrate pH 7.0). Thus, the AONs of the invention may comprise oligomers that selectively hybridize to the sequences provided in Table 1 or Table 2.

[0097] Tm is the temperature at which 50% of a target sequence hybridizes to a complementary polynucleotide at a given ionic strength and pH. Such hybridization can occur when the AON has "near" or "substantial" complementarity to the target sequence, as well as exact complementarity.

[0098] Typically, selective hybridization occurs when there is at least about 55% identity with the nucleotide of antisense oligomer over a stretch of at least about 14 nucleotides, preferably at least about 65%, more preferably at least about 75%, and most preferably at least about 90%, 95%, 98% or 99% identity.The length of homology comparison can be over a longer stretch as described, and in certain embodiments, often over a stretch of at least about 9 nucleotides, generally at least 12 nucleotides, more generally at least about 20 nucleotides, and often over at least about 21, 22, 23 or 24 nucleotides, at least about 25, 26, 27 or 28 nucleotides, at least about 29, 30, 31 or 32 nucleotides, at least about 36 or more nucleotides.

[0099] Thus, in some embodiments, the AON sequence of the present invention has preferably at least 75%, more preferably at least 85%, more preferably at least 86, 87, 88, 89 or 90% homology with the sequence shown in the sequence listing herein. More preferably, there is at least 91, 92, 93, 94 or 95%, more preferably at least 96, 97, 98% or 99% homology. Generally, the shorter the length of the antisense oligomer, the greater the homology required to achieve selective hybridization. As a result, when the AON of the present invention is composed of less than about 30 nucleotides, the percentage of identity is preferably greater than 75%, preferably greater than 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95%, 96, 97, 98% or 99% compared to the AON described in the sequence listing herein. Nucleotide homology comparisons can be performed by sequence comparison programs such as the GCG Wisconsin Bestfit program or GAP (Deveraux et al., 1984, Nucleic Acids Research 12, 387-395). In this way, sequences of similar or substantially different length to those cited herein can be compared by inserting gaps into the alignment, such gaps being determined, for example, by the comparison algorithm used by GAP.

[0100] The AON of the present invention may have regions with reduced homology to the target sequence and regions with exact homology to the target sequence. It is not necessary that the oligomer has exact homology over its entire length. For example, the oligomer may have a continuous stretch of at least 4 or 5 bases identical to the target sequence, preferably a continuous stretch of at least 6 or 7 bases identical to the target sequence, more preferably a continuous stretch of at least 8 or 9 bases identical to the target sequence. The oligomer may have a stretch of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 bases identical to the target sequence. The remaining stretches of the oligomer sequence may be intermittently identical to the target sequence; for example, the remaining sequence may have identical bases followed by non-identical bases followed by identical bases. Alternatively (or similarly), the oligomeric sequence may have several stretches of identical sequence (e.g., 3, 4, 5 or 6 bases) interspersed with stretches of less than perfect homology. Such sequence mismatches preferably result in little or no loss of cleavage modification activity.

[0101] Physiological Responses In one embodiment, the method of the invention induces a physiological response in a subject. Preferably, the method reduces expression of a selected FUS allele.

[0102] The term "modulate" or "modulates" includes "increasing" or "decreasing" one or more quantifiable parameters, as appropriate, by a defined amount and / or a statistically significant amount. The terms "increase" or "increasing," "enhance" or "enhancement," or "stimulate" or "stimulating" generally refer to the ability of one or more AONs or compositions to produce or cause a greater physiological response (i.e., a downstream effect) in a cell or subject compared to the response caused by either no AON or a control compound.

[0103] "Enhance" or "enhancement", or "increase" or "increasing", or "stimulate" or "stimulating" generally refers to the ability of one or more antisense compounds or compositions to produce or cause a greater physiological response (i.e., downstream effect) in a cell or subject compared to the response caused by either no antisense compound or a control compound.The amount of "increase" or "enhancement" is typically a "statistically significant" amount, and can include an increase of 1.1, 1.2, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, or even higher (e.g., 500, 1000-fold) (including all integers and decimals between and greater than 1), for example, 1.5, 1.6, 1.7, 1.8, etc.) than the amount caused by no antisense compound (absence of drug) or a control compound.

[0104] The term "reducing" or "reducing" generally refers to the ability of one or more AONs or compositions to produce or cause a reduced physiological response (i.e., downstream effect) in a cell or subject, compared to the response caused by either no AON or a control compound. The term "reducing" or "inhibiting" may generally refer to the ability of one or more antisense compounds of the present invention to "reducing" a relevant physiological or cellular response, such as a symptom of a disease or condition described herein, as measured according to techniques conventional in the diagnostic field. A relevant physiological or cellular response (in vivo or in vitro) will be apparent to one skilled in the art and may include a reduction in the symptoms or pathology of a FUS-related condition. A "reduction" in response can be statistically significant as compared to the response produced without the antisense compound or with a control composition and can include a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% reduction, including all integers therebetween.

[0105] The relevant physiological or cellular response (in vivo or in vitro) is clear to those skilled in the art and can include a reduction in the amount of FUS expression. An "increased" or "enhanced" amount is typically a statistically significant amount and can include an increase of 1.1, 1.2, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, or more times (e.g., 500, 1000 times) (including all integers and decimals between and greater than 1, e.g., 1.5, 1.6, 1.7, 1.8) of the amount produced without AON (absence of drug) or by a control compound. The term "reduce" or "inhibit" may generally relate to the ability of one or more AONs or compositions to "reduce" the relevant physiological or cellular response, e.g., the symptoms of a disease or condition described herein, when measured according to techniques conventional in the diagnostic field. Relevant physiological or cellular responses (in vivo or in vitro) will be apparent to one of skill in the art and can include a reduction in symptoms or pathology of diseases associated with FUS proteinopathy, such as ALS, FTLD, AD. A "reducing" response may be statistically significant compared to the response produced by no AON or a control composition and can include a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% reduction, including all integers therebetween.

[0106] Modified AON In some embodiments, AONs have the chemical composition of naturally occurring nucleic acid molecules, i.e., they contain no modified or substituted bases, sugars, or intersubunit linkages.

[0107] In a preferred embodiment, the AON of the present invention is a non-naturally occurring nucleic acid molecule, or an "oligonucleotide analog". For example, a non-naturally occurring nucleic acid may contain one or more non-natural bases, sugars, and / or intersubunit linkages, e.g., modified or substituted bases, sugars, and / or linkages, compared to those found in naturally occurring nucleic acid molecules. Exemplary modifications are described below. In some embodiments, a non-naturally occurring nucleic acid contains more than one type of modification, e.g., sugar and base modifications, sugar and linkage modifications, base and linkage modifications, or base, sugar, and linkage modifications. For example, in some embodiments, the AON contains a non-natural (e.g., modified or substituted) base. In some embodiments, the AON contains a non-natural (e.g., modified or substituted) sugar. In some embodiments, the AON contains a non-natural (e.g., modified or substituted) intersubunit linkage. In some embodiments, the AON contains more than one type of modification or substitution, e.g., non-natural bases and / or non-natural sugars, and / or non-natural intersubunit linkages.

[0108] Thus, non-naturally occurring AONs include (i) modified backbone structures, such as backbones other than the standard phosphodiester bond found in naturally occurring oligonucleotides and polynucleotides, and / or (ii) modified sugar moieties, such as morpholino moieties instead of ribose or deoxyribose moieties. Oligonucleotide analogs support bases that can hydrogen bond to standard polynucleotide bases by Watson-Crick base pairing, where the analog backbone presents bases in a manner that allows such hydrogen bonding in a sequence-specific manner between the oligonucleotide analog molecule and the bases in standard polynucleotides (e.g., single-stranded RNA or single-stranded DNA).Preferred analogs have substantially uncharged phosphorus-containing backbones.

[0109] One method for producing AONs is methylation of the 2' hydroxyribose position, and incorporation of a phosphorothioate backbone produces molecules that superficially resemble RNA but are much more resistant to nuclease degradation, although those of skill in the art will recognize other forms of suitable backbones that can be used for purposes of the present invention.

[0110] To avoid degradation of pre-mRNA / mRNA during duplex formation with antisense oligomers, the AONs used in the present method can be adapted to minimize or prevent cleavage by endogenous RNase H. Antisense molecules that do not activate RNase H can be made according to known techniques (see, for example, U.S. Patent No. 5,149,797). Such antisense molecules may be deoxyribonucleotide or ribonucleotide sequences and simply contain any structural modifications that sterically hinder or prevent RNase H binding to duplex molecules that contain the oligonucleotide as a member, without such structural modifications substantially preventing or disrupting duplex formation. Since the portions of the oligonucleotides involved in duplex formation are substantially different from the portions involved in RNase H binding to them, a large number of antisense molecules are available that do not activate RNase H. This property is highly desirable, since treatment of RNA with unmethylated oligomers, either in cells or in crude extracts containing RNase H, results in degradation of pre-mRNA:AON duplexes. Any form of modified AON that can bypass or not induce such degradation can be used in the methods of the invention. Nuclease resistance can be achieved by modifying the AON of the invention to include partially unsaturated aliphatic hydrocarbon chains and one or more polar or charged groups, such as carboxylic acid groups, ester groups, and alcohol groups.

[0111] An example of an AON that is not cleaved by cellular RNase H when duplexed with RNA is a 2'-O-methyl derivative. Such 2'-O-methyl-oligoribonucleotides are stable in cellular environments and animal tissues, and their duplexes with RNA have higher Tm values ​​than their ribo or deoxyribo counterparts. Alternatively, the nuclease-resistant AON of the present invention may have at least one of the last 3'-terminal nucleotides fluorinated. As a further alternative, the nuclease-resistant AON of the present invention has phosphorothioate bonds linking at least two of the last 3'-terminal nucleotide bases, and preferably has phosphorothioate bonds linking the last four 3'-terminal nucleotide bases.

[0112] Reduced RNA cleavage can also be achieved with alternative oligonucleotide chemistries (see, e.g., U.S. Patent No. 5,149,797). For example, AONs can be used with thiophosphoramidate morpholino oligomer (TMO) chimeras, phosphoramidate or phosphorodiamidate morpholino oligomers (PMO); PMO-X; PPMO; peptide nucleic acid (PNA); locked nucleic acid (LNA) and derivatives such as alpha-L-LNA, 2'-amino LNA, 4'-methyl LNA and 4'-O-methyl LNA; ethylene bridged nucleic acid (ENA) and its derivatives; phosphorothioate oligomers; tricyclo-DNA oligomers (tcDNA). ;tricyclophosphorothioate oligomers;2'O-methyl modified oligomers (2'-Ome);2'-O-methoxyethyl (2'-MOE);2'-fluoro, 2'-fluoroarabino (FANA);unlocked nucleic acid (UNA);hexitol nucleic acid (HNA);cyclohexenyl nucleic acid (CeNA);2'-amino (2'-NH2);2'-O-ethyleneamine, or any combination of the above as mixmers or as gapmers. The major benefit of PMOs is their increased safety profile. Due to the neutral charge of PMOs, they are less susceptible to protein interactions, reducing platelet activation and immune activation. This also reduces degradation by nucleases. They have also been used safely in DMD patients for more than 5 years.

[0113] In one embodiment, the modified AON of the present invention may be conjugated to a peptide. Preferably, the AON is a PTMO, i.e., a TMO oligonucleotide chemically conjugated to a peptide moiety via amide, maleimide or click chemistry (preferably using copper-free click chemistry, e.g., using copper-free click chemistry via a cyclooctyne bond), and includes a suitable linker, e.g., a cleavable or pH-sensitive linker. The peptide moiety may be attached via either the 3' or 5' end. Most preferably, the peptide moiety is a peptide that can improve the ability of the AON to penetrate the cell and reach the nucleus. For example, the peptide moiety may be a peptide selected from a library of arginine-rich peptides, cationic peptides and / or peptides derived from the genomes of biologically diverse microorganisms (Hoffman et al., Sci Rep, 8, 1, 12538). The peptide may or may not contain unnatural amino acids and / or chemically modified amino acids.

[0114] Cell-penetrating peptides have been added to phosphorodiamidate morpholino oligomers to enhance intracellular uptake and nuclear localization. As shown in Jearawiriyapaisarn et al. (2008), Mol. Ther., 16(9), 1624-1629, various cell-penetrating peptides have been shown to affect uptake efficiency and target tissue specificity. The terms "cell-penetrating peptide" and "CPP" are used interchangeably and refer to cationic cell-penetrating peptides, which are also referred to as transport peptides, carrier peptides, or peptide transduction domains. As shown herein, the peptides have the ability to induce cell penetration in 100% of the cells of a given cell culture population, and when administered systemically, allow the transfer of macromolecules in multiple tissues in vivo. Peptides can also enhance intracellular uptake after local delivery to tissues or organs.

[0115] To further improve delivery efficacy, the above modified nucleotides are often conjugated to the sugar or nucleobase moiety with fatty acids / lipids / cholesterol / amino acids / carbohydrates / polysaccharides / nanoparticles, etc. These conjugated nucleotide derivatives can also be used to construct AONs to induce exon skipping. Alternative splicing induced by antisense oligomers of human FUS gene transcripts can use oligoribonucleotides, PNA, 2'-Ome or 2'-MOE modified bases in phosphorothioate backbones. 2'-OMe AONs are used in oligo design for their efficient uptake in vitro when delivered as cationic lipoplexes, but these compounds are susceptible to nuclease degradation and are not considered ideal for in vivo or clinical applications. When alternative chemistry is used to generate the AONs of the present invention, uracil (U) in the sequences provided herein may be replaced with thymine (T).

[0116] For example, such an antisense molecule may be an oligonucleotide in which at least one or all of the phosphate residues forming the bridge between nucleotides are modified phosphates, such as methyl phosphonates, methyl phosphorothioates, phosphoromorpholidates, phosphoropiperazidates and phosphoramidates. For example, every other phosphate residue forming the bridge between nucleotides may be modified as described. In another non-limiting example, such an antisense molecule is a molecule in which at least one or all of the nucleotides contain a 2' lower alkyl moiety (e.g., Ci-C4, straight or branched, saturated or unsaturated alkyl, such as methyl, ethyl, ethenyl, propyl, 1-propenyl, 2-propenyl, and isopropyl). For example, every other nucleotide may be modified as described.

[0117] Specific examples of AONs useful in the present invention include oligonucleotides containing modified backbones or non-natural intersubunit linkages.

[0118] Oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. Modified oligonucleotides that do not have a phosphorus atom in the internucleoside backbone can also be considered to be oligonucleosides.

[0119] In other antisense molecules, both the sugar and the internucleoside linkages, i.e., the backbone of the nucleotide units, are replaced with novel groups. The base units are maintained for hybridization with appropriate nucleic acid target compounds. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is called a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of the oligonucleotide is replaced with an amide-containing backbone, specifically an aminoethylglycine backbone. The nucleobases are retained and are directly or indirectly linked to the aza nitrogen atoms of the amide portion of the backbone.

[0120] Modified oligonucleotides may also contain one or more substituted sugar moieties.Oligonucleotides may also contain modified or substituted nucleic acid bases (often referred to simply as "bases" in the art).Oligonucleotides containing modified or substituted bases include those in which one or more of the purine or pyrimidine bases most commonly found in nucleic acids are replaced with less common or unnatural bases.

[0121] Purine bases contain a pyrimidine ring fused to an imidazole ring; adenine and guanine are the two most commonly found purine nucleobases in nucleic acids. These may be substituted with other naturally occurring purines, including, but not limited to, N6-methyladenine, N2-methylguanine, hypoxanthine, and 7-methylguanine.

[0122] Pyrimidine base comprises a 6-membered pyrimidine ring; cytosine, uracil and thymine are the most commonly found pyrimidine bases in nucleic acid. They may be replaced with other naturally occurring pyrimidines, including but not limited to 5-methylcytosine, 5-hydroxymethylcytosine, pseudouracil and 4-thiouracil. In one embodiment, the oligonucleotide described herein contains thymine base instead of uracil.

[0123] Other modified or substituted bases include, but are not limited to, 2,6-diaminopurine, orotic acid, agmatidine, lysidine, 2-thiopyrimidines (e.g., 2-thiouracil, 2-thiothymine), G-clamps and derivatives thereof, 5-substituted pyrimidines (e.g., 5-halouracil, 5-propynyluracil, 5-propynylcytosine, 5-aminomethyluracil, 5-hydroxymethyluracil, 5-aminomethylcytosine, 5-hydroxymethylcytosine, Super T), 7-deazaguanine, 7-deazaadenine, 7-aza-2,6-diaminopurine, 8-aza-7-deazaguanine, 8-aza-7-deazaadenine, 8-aza-7-deaza-2,6-diaminopurine, Super G, Super A, and N4-ethylcytosine, or its derivatives; N2-cyclopentylguanine (cPent-G), N2-cyclopentyl-2-aminopurine (cPent-AP), and N2-propyl-2-aminopurine (Pr-AP), pseudouracil, or its derivatives; and degenerate or universal bases, non-existent bases such as 2,6-difluorotoluene or abasic sites (e.g. 1-deoxyribose, 1,2-dideoxyribose, 1-deoxy-2-O-methylribose; or pyrrolidine derivatives with ring oxygen replaced by nitrogen (azaribose)). Examples of derivatives of Super A, Super G and Super T can be found in U.S. Patent No. 6,683,173 (Epoch Biosciences). cPent-G, cPent-AP and Pr-AP have been shown to reduce immunostimulatory effects when incorporated into siRNA (Peacock H. et al. J. Am. Chem. Soc. 2011, 133, 9200). Pseudouracil is a naturally occurring isomeric version of uracil, which is a C-glycoside rather than the regular N-glycoside as in the case of uridine. Synthetic mRNAs containing pseudouridine may have improved safety profiles compared to mPvNAs containing uridine (see WO2009127230).

[0124] Certain modified or substituted nucleobases are particularly useful for increasing the binding affinity of the AONs of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C and are currently the preferred base substitution, even more particularly when combined with 2'-O-methoxyethyl sugar modifications.

[0125] In some embodiments, modified or substituted nucleobases are useful for facilitating the purification of AONs.For example, in certain embodiments, AONs may contain three or more (e.g., 3, 4, 5, 6 or more) consecutive guanine bases.In certain AONs, a series of three or more consecutive guanine bases may cause oligonucleotide aggregation, complicating purification.In such AONs, one or more consecutive guanines may be replaced with inosine.Replacing one or more guanines in a series of three or more consecutive guanine bases with inosine can reduce the aggregation of AONs, thereby facilitating purification.

[0126] In one embodiment, another modification of the AON includes chemically linking one or more moieties or conjugates to the oligonucleotide that enhance the activity, cellular distribution or intracellular uptake of the oligonucleotide. Such moieties include, but are not limited to, lipid moieties, such as cholesterol moieties, cholic acid, thioethers, such as hexyl-5-tritylthiol, thiocholesterol, aliphatic chains, such as dodecanediol or undecyl residues, phospholipids, such as dihexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-26lycerol-3-H-phosphonate, polyamines or polyethylene glycol chains, or adamantane acetic acid, palmityl moieties, or octadecylamine or hexylaminocarbonyloxycholesterol moieties.

[0127] Not all positions in a given compound need to be uniformly modified, and indeed more than one of the modifications described above may be incorporated into a single compound, or even into a single nucleoside in an oligonucleotide.The present invention also includes AONs that are chimeric compounds.A "chimeric" antisense compound or "chimera" in the context of this invention is an antisense molecule, specifically an oligonucleotide, that contains two or more chemically distinct regions, each composed of at least one monomeric unit, i.e., in the case of oligonucleotide compounds, nucleotides.These oligonucleotides typically contain at least one region that is modified to confer increased resistance to nuclease degradation, increased intracellular uptake, and an additional region for increased binding affinity to target nucleic acid.

[0128] The antisense molecule used according to the present invention can be conveniently and conventionally produced by well-known solid phase synthesis technology.The equipment for such synthesis is sold by several vendors, including, for example, Applied Biosystems (Foster City, Calif.).One method for synthesizing oligonucleotides on modified solid support is described in U.S. Patent No. 4,458,066.

[0129] In another non-limiting example, such an AON is a molecule in which at least one, or all, of the nucleotides contain a 2' lower alkyl moiety (e.g., C1-C4 straight or branched, saturated or unsaturated alkyl, such as methyl, ethyl, ethenyl, propyl, 1-propenyl, 2-propenyl, and isopropyl, etc.). For example, every other nucleotide may be modified as described.

[0130] While the AONs described above are preferred forms of AONs of the invention, the invention includes other oligomeric antisense molecules, including but not limited to oligomer mimetics, as described below.

[0131] Modified oligomers may also contain one or more substituted sugar moieties. Oligomers may also include modifications or substitutions of nucleobases (often referred to in the art simply as "bases"). Certain nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-methylcytosine substitutions, even more specifically when combined with 2'-O-methoxyethyl sugar modifications, have been shown to increase the stability of nucleic acid duplexes by 0.6-1.2°C. In one embodiment, at least one pyrimidine base of the oligonucleotide comprises a 5-substituted pyrimidine base, where the pyrimidine base is selected from the group consisting of cytosine, thymine, and uracil. In one embodiment, the 5-substituted pyrimidine base is 5-methylcytosine. In another embodiment, at least one purine base of the oligonucleotide comprises an N-2, N-6 substituted purine base. In one embodiment, the N-2, N-6 substituted purine base is 2,6-diaminopurine.

[0132] In one embodiment, the AON comprises one or more 5-methylcytosine substitutions, either alone or in combination with another modification, such as a 2'-O-methoxyethyl sugar modification, hi yet another embodiment, the AON comprises one or more 2,6-diaminopurine substitutions, either alone or in combination with another modification.

[0133] In some embodiments, the AON is chemically linked to one or more moieties, such as polyethylene glycol moieties or conjugates, such as arginine-rich cell-penetrating peptides, that enhance the activity, cellular distribution, or intracellular uptake of the AON. In one exemplary embodiment, an arginine-rich polypeptide is covalently coupled to the 3' or 5' end of the antisense compound at its N- or C-terminal residue. In another exemplary embodiment, the antisense compound is also comprised of morpholino subunits and a phosphorus-containing intersubunit linkage that connects the morpholino nitrogen of one subunit to the 5' exocyclic carbon of an adjacent subunit.

[0134] In another aspect, the invention provides expression vectors that incorporate the AONs described above, such as the AONs of SEQ ID NOs: 1-34. In some embodiments, the expression vector is a modified retroviral or non-retroviral vector, such as an adeno-associated viral vector.

[0135] Assays for measuring the activity of AONs The activity of AON and its variants can be assayed according to conventional techniques in the art.For example, the form and expression level of the isoforms of the RNA and protein investigated can be evaluated by any of a variety of well-known methods for detecting the isoforms and / or expression of transcribed nucleic acid or protein.Non-limiting examples of such methods include RT-PCR of RNA isoforms followed by size separation of PCR products, nucleic acid hybridization methods such as Northern blot and / or nucleic acid array; fluorescent in situ hybridization for detecting RNA transcripts inside cells; nucleic acid amplification methods; immunological methods for detecting proteins; protein purification methods; and protein function or activity assays.

[0136] RNA expression levels can be assessed by preparing RNA / cDNA (i.e., transcribed polynucleotides) from cells, tissues, or organisms, and then hybridizing the RNA / cDNA with a reference polynucleotide that is the complement of the nucleic acid to be assayed or a fragment thereof. The cDNA may be amplified, if necessary, using any of a variety of polymerase chain reaction or in vitro transcription methods prior to hybridization with the complementary polynucleotide; preferably, the cDNA is not amplified. The expression of one or more transcripts can also be detected using quantitative PCR to assess the level of expression of the transcripts.

[0137] Methods for Producing AONs The AONs used according to the present invention can be conveniently produced through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by a number of vendors, including, for example, Applied Biosystems (Foster City, Calif.). One method for synthesizing oligomers on modified solid supports is described in U.S. Pat. No. 4,458,066.

[0138] Any other means for such synthesis known in the art can be used in addition or alternatively.It is well known to use similar techniques to prepare oligomers such as phosphorothioates and alkylated derivatives.In one such automated embodiment, diethyl phosphoramidite is used as starting material and can be synthesized as described by Beaucage, et al., (1981) Tetrahedron Letters, 22:1859-1862.

[0139] The AONs of the present invention are synthesized in vitro and do not include antisense compositions of biological origin, nor genetic vector constructs designed to direct the synthesis of antisense oligomers in vivo. The molecules of the present invention may also be mixed with, encapsulated with, conjugated to, or otherwise associated with other molecules, molecular structures, or mixtures of compounds to aid in uptake, distribution, and / or absorption, such as, for example, liposomes, receptor-targeting molecules, oral, rectal, topical formulations, or other formulations.

[0140] vector Also included are vector delivery systems capable of expressing the oligomeric FUS-targeting sequences of the present invention, for example, vectors expressing polynucleotide sequences comprising any one or more of SEQ ID NOs: 1-34 described herein.

[0141] "Vector" or "nucleic acid construct" refers to a polynucleotide molecule, preferably a DNA molecule, such as one derived from a plasmid, bacteriophage, yeast or virus, into which a polynucleotide can be inserted or cloned. The vector preferably contains one or more unique restriction sites and is capable of autonomous replication in a defined host cell, such as a target cell or tissue or a precursor cell or tissue thereof, or is capable of integration into the genome of a defined host such that the cloned sequence can be replicated.

[0142] Thus, the vector may be an autonomously replicating vector, i.e. a vector that exists as an extrachromosomal entity and its replication is independent of chromosomal replication, such as a linear or closed circular plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any means for ensuring self-replication. Alternatively, the vector may be one that, when introduced into a host cell, is integrated into the genome and replicates together with the chromosome(s) into which it is integrated.

[0143] C. Treatment Method The AONs of the present invention can also be used as prophylactic or therapeutic agents that can be utilized for the purpose of treating diseases. Thus, in one embodiment, the present invention provides AONs that bind to selected targets in FUS pre-mRNA and mRNA and reduce the expression of FUS as described herein, in a therapeutically effective amount, mixed with a pharma- ceutically acceptable carrier, diluent, or excipient.

[0144] Pathogenic FUS variants can result in cytoplasmic mislocalization of FUS, splicing defects, DNA damage, and altered cellular stress responses. Without being bound by theory, reducing expression of FUS mRNA containing pathogenic variants through administration of the AONs of the invention can result in a reduction in cytoplasmic aggregation of FUS and other FUS-related pathologies.

[0145] An "effective amount" or "therapeutically effective amount" refers to an amount of a therapeutic compound, such as an antisense oligomer, administered to a mammalian subject, either in a single dose or as part of a series, effective to produce the desired therapeutic effect.

[0146] Thus, the present invention provides a pharmaceutical, prophylactic, or therapeutic composition for treating, preventing, or ameliorating the effects of a disease associated with a FUS pathogenic variant, comprising: a) one or more AONs described herein, and b) one or more pharma- ceutically acceptable carriers and / or diluents; A composition comprising:

[0147] Preferably, the disease associated with a FUS pathogenic variant is ALS or FTD.

[0148] Also provided are methods for treating, preventing, or ameliorating the effects of a disease associated with FUS proteinopathy, comprising administering to a subject an effective amount of one or more AONs or a pharmaceutical composition comprising one or more AONs described herein.

[0149] Also provided are methods for treating, preventing, or ameliorating the effects of FUS-ALS or FUS-FTD, comprising administering to a subject an effective amount of one or more AONs or a pharmaceutical composition comprising one or more AONs described herein.

[0150] The method of the present invention can be administered in combination with an additional treatment to treat, prevent, or slow the progression of diseases and symptoms associated with FUS proteinopathy. The additional treatment can include AONs directed to other targets associated with diseases associated with FUS proteinopathy. For example, the additional treatment can include AONs directed to SOD1.

[0151] In further embodiments, genetic biomarkers or other biomarkers can be used to identify patients who are most likely to respond well to FUS suppression via the AON of the present invention.Structural variants of genes related to the risk of ALS disease have been identified in the ALS gene and surrounding gene regions.These variants can be used as genetic biomarkers to identify patients who may respond to the method of the present invention.Non-genetic biomarkers can also be used to identify patients who may respond to the method of the present invention.

[0152] The present invention provides a method for treating, preventing, or ameliorating the effects of ALS, FTD in a subject identified by a biomarker, comprising: a) testing a subject for the presence of a biomarker associated with ALS patients that may respond to FUS inhibition; and b) if the subject is found to express the biomarker, administering to the subject an effective amount of one or more AONs described herein or a pharmaceutical composition comprising one or more AONs. The present invention provides a method comprising:

[0153] Also provided herein is the use of the purified and isolated AONs described herein to treat, prevent, or ameliorate the effects of a disease associated with a FUS pathogenic variant.

[0154] Also provided herein are uses of the purified and isolated AONs described herein to treat, prevent, or ameliorate the effects of ALS, FTD.

[0155] Preferably, the AONs used in the present invention are selected from the list of AONs provided in Tables 1 or 2, or more preferably, selected from SEQ ID NOs: 1-12.

[0156] The present invention also provides methods of treatment comprising (1) a combination of AONs designed to reduce expression of FUS alleles (SEQ ID NOs: 1-34) containing pathogenic variants, thereby reducing the impact of disease associated with FUS pathogenic variants. In one embodiment, the present invention aims to provide a means for alleviating FUS proteinopathy in subjects suffering from disease associated with FUS-ALS or FUS-FTD.

[0157] The composition may contain about 1 nM to 1000 μM of each of the desired antisense oligomer(s) of the present invention. Preferably, the composition may contain about 1 μM to 500 μM, 10 μM to 500 μM, 50 μM to 750 μM, 10 μM to 500 μM, 1 μM to 100 μM, 1 μM to 50 μM, preferably 25 μM to 100 μM of each of the antisense oligomer(s) of the present invention. The composition may also preferably contain about 1 nM to 500 nM, 10 nM to 500 nM, 50 nM to 750 nM, 10 nM to 500 nM, 1 nM to 100 nM, 1 nM to 50 nM, most preferably 50 nM to 100 nM of each of the antisense oligomer(s) of the present invention.

[0158] The compositions may contain about 1 nM, 2 nM, 3 nM, 4 nM, 5 nM, 6 nM, 7 nM, 8 nM, 9 nM, 10 nM, 20 nM, 50 nM, 75 nM, 100 nM, 150 nM, 200 nM, 250 nM, 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM, 950 nM or 1000 nM of each of the desired antisense oligomer(s) of the invention.

[0159] The present invention further provides one or more AONs adapted to be useful in the prophylactic or therapeutic treatment, prevention or alleviation of symptoms of a disease or condition associated with a FUS pathogenic variant, in a form suitable for delivery to a subject.

[0160] The phrase "pharmaceutical acceptable" refers to molecular entities and compositions that are physiologically acceptable and typically do not cause allergic or similarly undesirable reactions, such as stomach upset, when administered to a subject. The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which a compound is administered. Such pharmaceutical carriers may be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, and the like. As carriers, particularly for injectable solutions, preferably water or saline solution and aqueous dextrose and glycerol solutions are employed. Suitable pharmaceutical carriers are described in Martin, Remington's Pharmaceutical Sciences, 18th Ed., Mack Publishing Co., Easton, PA, (1990).

[0161] The pharmaceutical composition comprising one or more AONs can be administered to the subject within the scope of treatment regimen.For example, the pharmaceutical composition can be administered hourly, 3 times daily, twice daily, once daily, once every 2 days, once every 3 days, once weekly, once every 2 weeks, once monthly, once every 2 months, once every 6 months, and once yearly.The suitable regimen can be determined by those skilled in the art based on the nature of the condition to be treated.

[0162] D. Pharmaceutical manufacturing In one embodiment, the present invention provides the use of AON that binds to the selected target in FUS RNA for producing the medicament for treating, preventing or alleviating the effect of the disease associated with FUS pathogenic variant.Therefore, the use of one or more AONs described herein for producing the medicament for treating, preventing or alleviating the effect of the disease associated with FUS pathogenic variant is provided.Preferably, the disease is ALS or FTD.

[0163] The invention provides the use of a purified and isolated antisense oligonucleotide according as described herein for the manufacture of a medicament for treating, preventing, or ameliorating the effects of a disease associated with a disease associated with a FUS pathogenic variant.

[0164] The present invention also provides the use of a purified and isolated antisense oligonucleotide described herein for the manufacture of a medicament for treating, preventing, or ameliorating the effects of ALS or FTD.

[0165] Also provided is the use of one or more AONs described herein for the manufacture of a medicament for treating, preventing, or ameliorating the effects of a disease associated with a FUS pathogenic variant in a subject expressing a biomarker associated with a patient likely to respond to FUS inhibition.

[0166] Preferably, the AON used to manufacture the medicament is selected from the list of AONs provided in Tables 1 or 2, or more preferably, is selected from SEQ ID NOs: 1-12. Preferably, the AONs are SEQ ID NOs: 2, 4, 5, 8 and 11.

[0167] E. Pharmaceutical Compositions In one aspect of the present invention, pharmaceutical compositions are provided that contain a therapeutically effective amount of one or more AONs of the present invention together with pharma- ceutically acceptable diluents, preservatives, solubilizers, emulsifiers, adjuvants, and / or carriers. Such compositions contain diluents of various buffer contents (e.g., Tris HCl, acetate, phosphate), pH and ionic strength, as well as additives such as detergents and solubilizers (e.g., Tween® 80, Polysorbate 80), antioxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g., Thimersol, benzyl alcohol) and bulking agents (e.g., lactose, mannitol). Materials may be incorporated into microparticle preparations of polymeric compounds, such as polylactic acid, polyglycolic acid, or may be incorporated into liposomes. Hyaluronic acid may also be used. Such compositions may affect the systemic condition, stability, release rate in vivo, and clearance rate in vivo of proteins and derivatives present. See, e.g., Martin, Remington's Pharmaceutical Sciences, 18th Ed. (1990, Mack Publishing Co., Easton, PA 18042) pages 1435-1712, which is incorporated herein by reference. The compositions may be prepared in liquid form or may be in the form of a dry powder, e.g., lyophilized.

[0168] It is understood that the pharmaceutical composition provided by the present invention can be administered by any means known in the art.Preferably, the pharmaceutical composition for administration is administered by injection, orally, topically, or by pulmonary or nasal route.AON is more preferably delivered by intravenous, intraarterial, intraperitoneal, intramuscular or subcutaneous administration route.The appropriate route can be determined by those skilled in the art as appropriate for the condition of the subject under treatment.Vascular or extravascular circulation, blood or lymphatic system, and cerebrospinal fluid are some non-limiting sites where AON can be introduced.Direct CNS delivery can be adopted, for example, intraventricular or intrathecal administration can be used as administration route.

[0169] Formulations for topical administration include those in which the oligomer of the present disclosure is mixed with topical delivery agents such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants.Lipids and liposomes include neutral (e.g., dioleoyl phosphatidyl DOPE ethanolamine, dimyristoyl phosphatidyl choline DMPC, distearolyphosphatidyl choline), negative (e.g., dimyristoyl phosphatidyl glycerol DMPG) and cationic (e.g., dioleoyl tetramethylaminopropyl DOTAP and dioleoyl phosphatidyl ethanolamine DOTMA).For topical or other administration, the oligomer of the present disclosure may be encapsulated in or complexed with liposomes, particularly with cationic liposomes.Alternatively, the oligomer may be complexed with lipids, particularly with cationic lipids. Fatty acids and esters, their pharma- ceutical acceptable salts, and their uses are further described in U.S. Patent No. 6,287,860, filed May 20, 1999, and / or U.S. patent application Ser. No. 09 / 315,298.

[0170] In certain embodiments, the AONs of the present disclosure can be delivered by transdermal methods (e.g., via incorporating the AONs in an emulsion, which is optionally packaged in a liposome). Such transdermal and emulsion / liposome-mediated delivery methods have been described in the art for delivery of AONs, for example, in U.S. Patent No. 6,965,025.

[0171] The AONs described herein can also be delivered via implantable devices. The design of such devices is an art-recognized process, for example, using synthetic implant designs, for example, as described in U.S. Patent No. 6,969,400.

[0172] Compositions and formulations for oral administration include powders or granules, microparticles, nanoparticles, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or mini-tablets. Thickeners, flavorings, diluents, emulsifiers, dispersing aids or binders may be desirable. Oral formulations are those in which the oligomers of the present disclosure are administered in combination with one or more penetration enhancers, surfactants and chelating agents. Surfactants include fatty acids and / or their esters or salts, bile acids and / or their salts. Bile acids / salts and fatty acids and their uses are further described in U.S. Pat. No. 6,287,860. In some embodiments, the present disclosure provides combinations of penetration enhancers, such as fatty acids / salts in combination with bile acids / salts. Exemplary combinations are sodium salts of lauric acid, capric acid and UDCA. Additional penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. The oligomers of the present disclosure may be delivered orally in granular form, including spray-dried particles, or may be complexed to form microparticles or nanoparticles. Oligomer complexing agents and their uses are further described in U.S. Patent No. 6,287,860. Oral formulations for oligomers and their preparations are described in detail in U.S. Patent No. 6,887,906, filed May 20, 1999, 09 / 315,298 and / or U.S. Patent No. 20030027780.

[0173] Compositions and formulations for parenteral, intrathecal, or intraventricular administration may include sterile aqueous solutions, which may also contain buffers, diluents, and other suitable additives, including but not limited to penetration enhancers, carrier compounds and other pharma- ceutically acceptable carriers or excipients.

[0174] Delivery of therapeutically useful amounts of AONs can be achieved by previously published methods. For example, intracellular delivery of AONs can be via a composition comprising an admixture of AONs with an effective amount of a block copolymer. An example of this method is described in US patent application US20040248833. Other methods of delivery of AONs to the nucleus are described in Mann CJ et al. (2001) Proc, Natl. Acad. Science, 98(1) 42-47, and Gebski et al. (2003) Human Molecular Genetics, 12(15): 1801-1811. Methods for introducing nucleic acid molecules into cells by expression vectors, either as naked DNA or complexed to lipid carriers, are described in US6,806,084.

[0175] In certain embodiments, the AONs of the present invention and therapeutic compositions comprising same can be delivered by transdermal methods (e.g., by incorporating the AONs, for example, in an emulsion, such AONs being optionally packaged in liposomes). Such transdermal and emulsion / liposome-mediated delivery methods have been described in the art for delivery of AONs, for example, in U.S. Patent No. 6,965,025.

[0176] It may be desirable to deliver AON in colloidal dispersion system.Colloidal dispersion system includes macromolecule complex, nanocapsule, microsphere, bead, and lipid-based system including oil-in-water emulsion, micelle, mixed micelle, and liposome or liposome formulation.These colloidal dispersion systems can be used to prepare therapeutic pharmaceutical composition.

[0177] Liposomes are artificial membrane vesicles that are useful as delivery vehicles in vitro and in vivo. These formulations may have net cationic, anionic, or neutral charge characteristics, making them useful for in vitro, in vivo, and ex vivo delivery methods. It has been shown that large unilamellar vesicles can encapsulate a substantial percentage of aqueous buffer containing large macromolecules. RNA and DNA can be encapsulated within the aqueous interior and delivered to cells in a biologically active form (Fraley, et al., 1981, Trends Biochem. Sci., 6, 77).

[0178] For liposomes to be efficient gene transfer vehicles, the following characteristics should be present: (1) high efficiency encapsulation of the AON of interest without compromising its biological activity; (2) preferential and substantial binding to target cells compared to non-target cells; (3) high efficiency delivery of the aqueous contents of the vesicles to the cytoplasm of target cells; and (4) accurate and effective expression of genetic information (Mannino, et al., 1988 Biotechniques, 6, 682). The composition of liposomes is usually a combination of phospholipids, especially high phase transition temperature phospholipids, usually with steroids, especially cholesterol. Other phospholipids or other lipids may also be used. The physical properties of liposomes depend on pH, ionic strength, and the presence of divalent cations. Cationic liposomes are positively charged liposomes that are believed to interact with negatively charged DNA molecules to form stable complexes. Liposomes that are pH sensitive or negatively charged are believed to take up DNA rather than complex with it. Both cationic and non-cationic liposomes have been used to deliver DNA into cells.

[0179] Liposomes also include "sterically stabilized" liposomes, which term, as used herein, refers to liposomes that contain one or more specialized lipids that, when incorporated into liposomes, provide enhanced circulation lifespan compared to liposomes that lack such specialized lipids.Examples of sterically stabilized liposomes are those in which a portion of the vesicle-forming lipid portion of the liposome contains one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as polyethylene glycol (PEG) moieties.Liposomes and their uses are further described in US6,287,860.

[0180] AONs can be introduced into cells using art-recognized techniques (e.g., transfection, electroporation, fusion, liposomes, colloidal polymer particles, and viral and non-viral vectors, as well as other means known in the art). The delivery method selected depends at least on the cells to be treated and the location of the cells, and will be clear to those skilled in the art. For example, localization can be achieved by liposomes with specific markers on the surface to direct the liposomes, direct injection into tissues containing target cells, uptake mediated by specific receptors, etc.

[0181] As is known in the art, AONs can be delivered using methods including, for example, liposome-mediated uptake, lipid conjugates, polylysine-mediated uptake, nanoparticle-mediated uptake, and receptor-mediated endocytosis, as well as additional non-endocytic delivery modalities such as microinjection, permeabilization (e.g., streptolysin-O permeabilization, anionic peptide permeabilization), electroporation, and a variety of non-invasive non-endocytic delivery methods known in the art (see Dokka and Rojanasakul, Advanced Drug Delivery Reviews 44, 35-49, incorporated by reference in its entirety).

[0182] The AON may also be combined with other pharma- ceutically acceptable carriers or diluents to produce pharmaceutical compositions.Suitable carriers and diluents include isotonic saline, such as phosphate-buffered saline.The composition may be formulated for parenteral, intramuscular, intravenous, subcutaneous, intraocular, oral, or transdermal administration.

[0183] The described routes of administration are intended merely as a guide; a skilled artisan can readily determine the optimum route of administration and any dosage for any particular animal and condition.

[0184] Several approaches have been attempted to introduce functional new genetic material into cells both in vitro and in vivo (Friedmann (1989) Science, 244, 1275-1280). These approaches include incorporation of the gene to be expressed into modified retroviruses (Friedmann (1989) supra; Rosenberg (1991) Cancer Research 51(18), suppl.: 5074S-5079S); incorporation into nonretroviral vectors (Rosenfeld, et al. (1992) Cell, 68, 143-155; Rosenfeld, et al. (1991) Science, 252, 431-434); or delivery of the transgene linked to a heterologous promoter-enhancer element via liposomes (Friedmann (1989) supra; Brigham, et al. (1989) Am. J. Med. Sci., 298, 278-281; ​​Nabel, et al. (1990) Science, 249, 1285-1288; Hazinski, et al. (1991) Am. J. Resp. Cell Molec. Biol., 4:206-209; and Wang and Huang (1987) Proc. Natl. Acad. Sci. (USA), 84, 7851-7855); coupling to ligand-specific cation-based transport systems (Wu and Wu (1988) J. Biol. Chem., 263, 14621-14624) or the use of naked DNA, expression vectors (Nabel et al. (1990), supra; Wolff et al. (1990) Science, 247, 1465-1468). Direct injection of a transgene into a tissue results in only localized expression (Rosenfeld (1992) supra; Rosenfeld et al. (1991) supra; Brigham et al. (1989) supra; Nabel (1990) supra; and Hazinski et al. (1991) supra).Brigham et al. group ((1989) Am. J. Med. Sci. 298, 278-281 and Clinical Research (1991) 39 (abstract)) reported in vivo transfection of mouse lungs alone after either intravenous or intratracheal administration of DNA-liposome complexes. Examples of review articles on human gene therapy procedures are Anderson, (1992) Science 256, 808-813; Barteau et al. (2008), Curr Gene Ther., 8(5), 313-23; Mueller et al. (2008). Clin Rev Allergy Immunol., 35(3), 164-78; Li et al. (2006) Gene Ther., 13(18), 1313-9; Simoes et al. (2005) Expert Opin Drug Deliv., 2(2), 237-54.

[0185] The AONs of the invention encompass any pharma- ceutically acceptable salts, esters, or salts of such esters, or any other compounds capable of providing (directly or indirectly) biologically active metabolites or residues thereof upon administration to an animal, including a human. Thus, by way of example, the present disclosure is also directed to prodrugs and pharma- ceutically acceptable salts of the compounds of the invention, pharma- ceutically acceptable salts of such prodrugs, and other bioequivalents.

[0186] The term "pharmaceutical acceptable salt" refers to physiologically and pharma- ceutical acceptable salts of compounds of the present invention: that is, salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. In the case of oligomers, preferred examples of pharma- ceutically acceptable salts include, but are not limited to, (a) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, and the like; (b) acid addition salts formed with inorganic acids such as, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, and the like; (c) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like; and (d) salts formed from elemental anions such as chloride, bromide, and iodine. The pharmaceutical compositions of the present invention can be administered in several ways, depending on whether local or systemic treatment is desired and on the area to be treated. Administration may be local (including ocular and mucosal, as well as rectal delivery), pulmonary, for example, by inhalation or insufflation of powder or aerosol (such as by nebulizer, intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, for example, intrathecal or intraventricular administration. For oral administration, oligomers having at least one 2'-O-methoxyethyl modification are believed to be particularly useful. Preferably, AONs are delivered via subcutaneous or intravenous routes.

[0187] The pharmaceutical preparation of the present invention can be conveniently provided in unit dosage form, and it can be prepared according to conventional techniques well known in the pharmaceutical industry.Such techniques include the step of bringing active ingredient into association with pharmaceutical carrier(s) or excipient(s).Generally, the preparation is prepared by bringing active ingredient into association uniformly and intimately with liquid carrier or finely divided solid carrier or both, and then shaping the product as necessary.

[0188] The following examples are to be construed as merely illustrative, and not limiting of the remainder of the disclosure in any way. These examples are included solely for the purpose of illustrating the present invention. They should not be construed as limitations on the broad summary, disclosure or description of the invention detailed above. Without further elaboration, it is believed that one skilled in the art can, using the preceding description, utilize the present invention to its fullest extent. In the preceding and following examples, all temperatures are set forth in uncorrected degrees Celsius; all parts and percentages are by weight unless otherwise specified. EXAMPLES

[0189] Example 1 Experimental strategy background A strategy was adopted in which the selection of common variants (CVs) in the FUS gene that occur frequently in the population was selected. For each CV, AONs could be optimized to maximize selectivity for each allele. To be suitable for allele-specific AON treatment targeting the CV, the patient would need to be heterozygous for one of the selected CVs. The DNA of patients with confirmed pathogenic variants in FUS could be sequenced to determine their genotype in the selected CV in the FUS gene. Long-read sequencing or other methods could be utilized to determine the alleles that the pathogenic variant encounters in relation to its heterozygous CV. Then, a suitable CV-targeting AON could be selected for the patient that would selectively knock down the allele containing the pathogenic variant. This means that one out of a handful of AONs may be applicable to treat the majority of FUS-ALS or FUS-FTD patients. Those that are not heterozygous for one of the CVs could be offered an alternative FUS-targeting AON treatment that knocks down both alleles equally.

[0190] FUS common variant analysis

[0191] The most common type of variant is a single nucleotide polymorphism (SNP), which is a change in a single base in the genome. We selected CVs that are located within the exons of FUS rather than in introns, which allowed for easier analysis in the cell lines used for screening (which do not contain pathogenic FUS variants).

[0192] Common variants in FUS were analyzed using data from the 1000 Genomes Project. There were three CVs in the exonic regions of the FUS gene: a synonymous variant in exon 3 (CV1), a synonymous variant in exon 4 (CV2) and a SNP in the 3' untranslated region of exon 15 (CV3). In Table 3, the rs number, nucleotide, minor allele frequency and the proportion of people in the dataset who were heterozygous for each variant can be seen.

[0193] [Table 3]

[0194] The genotypes of each of the individuals in the 1000 Genomes dataset were analyzed using SPSS to determine the proportion of people in each population who were heterozygous for one or two of the selected FUS CVs. All populations had a higher proportion of people who were heterozygous for CV2 rather than CV1 or CV3. The differences were small in European, American, and Asian populations, but large in African populations due to the much smaller minor allele frequencies of CV1 and CV3. All three variants are in linkage disequilibrium (LD) with each other, but CV1 and CV3 are in higher LD than either one with CV2. This means that there is little benefit in terms of additional coverage of the population when targeting both CV1 and CV3 compared to targeting either one alone. Targeting CV2 in addition to either CV1 or CV3 increased the proportion of the population that was heterozygous for at least one variant to 10.6% (Table 4).

[0195] [Table 4]

[0196] Example 2 Series 1 gapmer design A first round of gapmers was designed to target each of the three FUS CVs with perfect complementarity to one allele and a single mismatch to the other allele. Gapmers consist of a 10-base DNA core flanked by 5-base wings on either side of the 2'-O-methyl modifying RNA bases with a phosphorothioate backbone. Six AONs were designed for each CV; three were perfectly complementary to the ancestral allele and three were perfectly complementary to the minor allele. The three gapmers differed in the position where the CV was located within the DNA core at positions 2, 6 or 9 of the core from the 5' end. The AON coordinates and sequences can be seen in Table 5. A scrambled control gapmer was used to act as a control for allele selectivity (SEQ ID NO: 35: ACCUUATCCAATAGCGCCUC) plus a gapmer targeted to another region of exon 3 (Table 6). The nomenclature of the AONs is based on that described by Mann, CJ, et al., Improved antisense oligonucleotide induced exon skipping in the mdx mouse model of muscular dystrophy. The Journal of Gene Medicine, 2002. 4(6): p. 644-654, which includes the species, gene, exon number, acceptor or donor targeting and annealing coordinates, where "-" indicates the location of the intron and "+" specifies the location of the exon from the splice site, as described herein. AONs were ordered from TriLink Biotechnologies, Inc. (San Diego, CA, USA) or ChemGenes Corporation (Wilmington, MA, USA).

[0197] [Table 5]

[0198] [Table 6]

[0199] material and method

[0200] Selection of cell lines for screening

[0201] Several human fibroblast cell lines were sequenced using Sanger sequencing to determine their genotypes in the three FUS CVs. Three cell lines that differed in their genotypes in the CVs were selected for use in the screen. The genotypes of each cell line in the FUS CVs can be seen in Table 7. Each cell line was transfected with a gapmer targeted to the FUS CV at a range of concentrations, and RNA was collected 24 hours after transfection. FUS RNA levels were measured using RT-PCR, visualized using agarose gel electrophoresis, and quantified via densiometric analysis using TBP as a housekeeping gene.

[0202] [Table 7]

[0203] Transfection of fibroblasts

[0204] Normal human dermal fibroblasts were propagated prior to transfection according to established techniques by seeding 15,000 cells into 24-well plates in 10% FBS DMEM and incubating for 24 hours at 37° C. All AONs were transfected using Lipofectamine 3000 (3 μl per ml transfection volume) (Life Technologies, Melbourne, Australia) according to the manufacturer's protocol, and AON-transfected cells were incubated for 24 hours.

[0205] Transcript analysis

[0206] RNA was extracted using the MagMAX-96 Total RNA Isolation Kit with DNase treatment (Life Technologies) according to the manufacturer's instructions. RT-PCR was performed using the One-step Superscript III RT-PCR kit with Platinum Taq polymerase (Life Technologies) according to the manufacturer's instructions. Products were amplified across exons 1-6 of FUS (SEQ ID NO:37 forward: GTACTCAGCGGTGTTGGAAC, SEQ ID NO:38 reverse: CCACTACTCATGGAGGATTG) with a temperature profile of 30 min at 55°C, 2 min at 94°C, followed by 22 cycles of 30 s at 94°C, 30 s at 58°C, and 1 min at 68°C. Where applicable, results were normalized to transcript levels of an unrelated housekeeping control gene (TBP) amplified across exons 2-3 using the following primers (SEQ ID NO:39 forward: AGCGCAAGGGTTTCTGGTTT, reverse: SEQ ID NO:40 GGAGTCATGGGGGAGGGATA).

[0207] PCR products were fractionated on 2% agarose gels in Tris-acetate-EDTA buffer and images were acquired with a gel documentation system (Vilber Lourmat, Eberhardzell, Germany). Densitometric analysis was performed using Image J. The percentage of transcript knockdown was determined by normalization to housekeeping genes and comparison with control treated or untreated samples.

[0208] Example 3 Results of Series 1 CV1-targeted gapmer screen Fibroblast cell lines (Hom1 and Hom2) were treated with AONs targeting CV1 (SEQ ID NO: 1-6) or control sequences including a scrambled control (CVscr) (SEQ ID NO: 35) and a selectivity control (ns control (nsCtrl)) targeting a region in exon 3 identical in each allele (SEQ ID NO: 36) at concentrations of 50 nM and 12.5 nM in two independent experiments and harvested 24 hours later. Both cell lines treated with gapmers targeting FUS CV1 showed reduced FUS mRNA expression. All gapmers with 100% complementarity to the A allele (SEQ ID NO: 1-3) induced greater knockdown of FUS in cell lines homozygous A at the CV position than in cell lines homozygous C. Similarly, all gapmers with 100% complementarity to the C allele (SEQ ID NO: 4-6) induced greater FUS knockdown in homozygous C cell lines than in homozygous A cell lines (Figure 1a). A dose response could be seen with all CV-targeted gapmers, with FUS expression being less when treated with 50 nM than when treated with 12.5 nM. Of note, a control gapmer (ns control) (SEQ ID NO: 36) targeting a region of the FUS transcript that did not contain a SNP, acting as a control for selectivity, caused greater knockdown in homozygous C cell lines than in homozygous A cell lines in both experiments. This could indicate either a reduced transfection efficiency of the homozygous A cell line (Hom2) or differences between the cell lines in the rate or efficiency of any of the cellular processes involved.

[0209] CV1b (SEQ ID NO:2) showed the greatest selectivity for the A allele resulting in the greatest difference between FUS expression in the two homozygous cell lines at 50 nM, with the homozygous A cell line expressing 14% and the homozygous C cell line expressing 44% of the levels seen in untreated control cells. CV1a (SEQ ID NO:1) also showed some selectivity for the A allele. Cells treated with CV1c (SEQ ID NO:3) expressed similar levels of FUS in both cell lines.

[0210] AONs targeting the C allele showed less discrimination between the alleles, with AONs CV1e (SEQ ID NO:5) and CV1f (SEQ ID NO:6) knocking down FUS to a similar extent in both cell lines. CV1d (SEQ ID NO:4) showed the greatest difference in FUS expression between cell lines, at 32% of untreated control levels in the homozygous A cell line and 14% in the homozygous C cell line at 50 nM. However, this may not represent true selectivity at all, as FUS levels in ns control (SEQ ID NO:36) treated cells were measured to be 24% and 8% of untreated control levels.

[0211] Example 4 Series 1 CV2-targeted gapmer screening Fibroblast cell lines (Hom1 and Hom2) were treated with CV2-targeted AONs (SEQ ID NOs: 7-12) or control sequences (SEQ ID NOs: 35 and 36) at concentrations of 50 nM and 12.5 nM in two independent experiments and harvested after 24 hours. FUS expression was analyzed. This can be seen in Figure 2b. A dose response can be seen for all CV2-targeted gapmers, with less FUS expression when treated at 50 nM than when treated at 12.5 nM. For gapmers with 100% complementarity to the C allele (SEQ ID NOs: 7-9), CV2b (SEQ ID NO: 8) showed the greatest difference in FUS expression levels between homozygous cell lines in two experiments, with FUS reduced to 21% of control levels at 50 nM in homozygous C cell lines and only 58% in homozygous T cell lines. CV2c (SEQ ID NO: 9) also showed some selectivity for the C allele, with greater knockdown in homozygous C cell lines. In contrast, cells treated with CV2a (SEQ ID NO: 7) produced slightly greater FUS knockdown in homozygous T cell lines. This does not indicate any selectivity for the T allele, but again there was a difference in FUS knockdown levels between the two cell lines in cells treated with the ns control, which needs to be taken into account when interpreting the results. Among the gapmers targeting the T allele, CV2e (SEQ ID NO: 5) showed the greatest difference in expression between homozygous cell lines. This difference was only slightly lower than that of CV2d (SEQ ID NO: 10) and CV2f (SEQ ID NO: 12).

[0212] Example 5 Series 1 CV3-targeted gapmer screening Fibroblast cell lines (Hom1 and Hom2) were treated with AONs targeting CV3 (SEQ ID NO: 13-18) or control sequences (SEQ ID NO: 35 and 36) at concentrations of 50 nM and 12.5 nM in two independent experiments and harvested after 24 hours. Gapmers targeting CV3 did not reduce FUS expression to the same extent as seen with AOs targeting CV1 and CV2, and some did not show greater knockdown than seen in cells treated with scrambled controls. Expression was essentially knocked down to levels similar to those seen in previous experiments with a control oligo (ns control) targeting exon 3 (SEQ ID NO: 36), indicating that this was not due to poor transfection efficiency. With the exception of the ns control oligo (SEQ ID NO: 36), no clear dose response was seen across most treatments. Furthermore, there was no trend toward reduced expression levels in homozygous cell lines with 100% complementarity to the transfected gapmer, as seen with CV1 and CV2.

[0213] Example 6 Design of CV2 series 2 gapmers with additional mismatches A second series of gapmers was designed to target CV2. Data from the first series of gapmers showed that centrally placed mismatches improved selectivity between alleles. CV2b (SEQ ID NO: 8) was selected to target the C allele, and CV2e (SEQ ID NO: 11) was selected to target the T allele, and a second series of gapmers was designed with extra mismatches added around these sequences. These two AONs are identical except that single base changes were placed in the center of the DNA gap of the molecule at 6 of the 10 positions from the 5' end.

[0214] Addition of additional mismatches

[0215] Mismatched base pairs are those that do not follow the Watson-Crick base pairing rules (guanine-cytosine and adenine-thymine). A mismatch is defined as a transversion if it is formed by non-complementary pyrimidine / purine bases. Those formed by purine / purine or pyrimidine / pyrimidine pairs are transversions (Modrich, P., DNA MISMATCH CORRECTION. Annual Review of Biochemistry, 1987. 56(1): p. 435-466). Mismatches can cause major changes in the structure and stability of the nucleic acid duplex, especially in the case of purine transversions (Rossetti, G., et al., The structural impact of DNA mismatches. Nucleic Acids Research, 2015. 43(8): p. 4309-4321). DNA usually exists in a double stranded duplex held together by hydrogen bonds in the base pairing model described by Watson and Crick, which is the most stable structure, but fluctuations do occur. DNA breathing refers to the temporary opening of nucleic acid base pairs due to conformational or thermal fluctuations below the melting temperature of the duplex. This results in the formation of a less stable temporary structure. This is an important mechanism that allows access of polymerases and other DNA regulatory proteins to the DNA encoding templates placed inside the DNA duplex (Phelps, C., et al., Single-molecule FRET and linear dichroism studies of DNA breathing and helicase binding at replication fork junctions. Proceedings of the National Academy of Sciences of the United States of America, 2013. 110(43): p. 17320-17325).Using NMR spectroscopy and molecular dynamics simulations, the structural modifications and frequency of breathing for canonical base pairs and DNA mismatches, respectively, were characterized. The breathing propensity of canonical base pairs was measured to be relatively low, <0.2% for C / G and <3% for A / T. This can vary significantly with the mismatched base pair, with some, e.g., C / C, having a low breathing propensity of about 1%. In contrast, G / G and A / A have a breathing propensity of >40%, with other mismatches lying somewhere in between (see Rossetti et al.).

[0216] In some cases, a single mismatch in a DNA / RNA heteroduplex can result in a several-fold decrease in cleavage by RNase H (Giles, RV, et al., Single base discrimination for ribonuclease H-dependent antisense effects within intact human leukaemia cells. Nucleic Acids Research, 1995. 23(6): p. 954-961). Single mismatch discrimination for cleavage by RNase H is highly dependent on the nature of the SNP and the surrounding nucleotides. The addition of extra mismatches in gapmers designed to target specific alleles can, in some cases, enhance discrimination between the two alleles. In other cases this does not happen and the opposite effect may even be seen (Magner, D., et al., Influence of mismatched and bulged nucleotides on SNP-preferential RNase H cleavage of RNA-antisense gapmer heteroduplexes. Scientific Reports, 2017. 7(1): p. 12532). The position of the mismatch within the DNA window and its position in relation to the position of another mismatch may also affect RNase H activity.

[0217] Eight new AONs were designed to target each FUS allele (SEQ ID NOs: 19-34) by leaving CV2 at the same position and adding an extra mismatch. Mismatches were added at various positions (1, 2, 3 or 4 bases away from CV2) and with different nucleotides selected for the mismatch based on the amount of breathing (high or low) that should be tolerated. The AON sequences and properties can be seen in Table 8.

[0218] [Table 8]

[0219] Example 7 Series 2 CV2-targeted gapmer screening A human fibroblast cell line heterozygous for CV2 was used for screening. Using a subset of AONs, it was determined that the concentration and time point that conferred the greatest selectivity was 24 hours after transfection at a concentration of 100 nM. In multiple experiments, droplet digital PCR was used to quantitate the ratio of each allele present in treated cells at this concentration and time point. Droplet digital PCR analysis was performed using a BioRad QX200 system and One-Step RT-ddPCR Advanced Kit for Probes. Primers amplified FUS with a forward primer in exon 4 and a reverse primer crossing the exon 4 / 5 junction (SEQ ID NO: 41: Forward: CTATGGAACTCAGTCAACTCC, SEQ ID NO: 42: Reverse: GAACTGCTACCGTAACTTCC) at a temperature profile of 50°C for 50 minutes, 95°C for 10 minutes, followed by 40 cycles of 95°C for 30 seconds and 55°C for 1 minute, and finally 98°C for 10 minutes. Quantification of transcripts containing a T in CV2 was performed using a probe containing a Hex fluorophore and an Iowa Black quencher (Probe 1: CCTCCT + AT + C +Quantification of transcripts containing a C in CV2 was performed using a probe containing a FAM fluorophore and an Iowa Black quencher (probe 2: CTCCT + AC + C + CTGGCTA). Probes were purchased from Integrated DNA Technologies. Controls were performed with RNA from cell lines homozygous for each allele in FUS CV2 to confirm the absence of signal from the other allele for each probe.

[0220] In cells treated with AON CV2b (SEQ ID NO:8) for 24 hours (100% complementarity to the C allele and one mismatch to the T allele), 72% of the FUS transcripts were of the T-containing allele in CV (Figure 2). The proportion of T alleles present in cells treated with CV2b1 and CV2b2 (SEQ ID NO:19 and 20) was only slightly higher at 73.3 and 73.7%. Some of the AOs with additional mismatches (CV2b3, CV2b7 and CV2b8) (SEQ ID NO:21, 25, 26) resulted in a significant reduction in allele-selective knockdown compared to cells treated with SEQ ID NO:8, with the T allele measuring 66.7, 63.5 and 63.1% of the transcripts.

[0221] In cells treated with AON CV2e (SEQ ID NO: 11) (100% complementarity to the T allele and one mismatch to the C allele), 81.1% of the FUS transcripts were of the C allele (Figure 2). All of the additional mismatches reduced the proportion of C allele transcripts to a range from 66.1% with CV2e8 (SEQ ID NO: 34) to 72.5% with CV2e5 (SEQ ID NO: 31).

[0222] Total FUS expression after 24 h incubation at 100 nM was quantified using RT-PCR and agarose gel electrophoresis followed by densitometric analysis (Figure 3). For AONs with perfect complementarity to their target allele and only one mismatch from the non-target allele (SEQ ID NOs: 8 and 11), total FUS levels were 31% and 23% of the levels seen in control-treated cells (treated with transfection reagent in the absence of AONs). When additional mismatches were added, total FUS levels ranged from 71% to 130% of control levels. Since FUS is autoregulated by its protein levels, it may be upregulated in response to AON-mediated knockdown. Example 8 Chemical comparison of CV2-targeted AONs AONs CV2b and CV2e targeted to CV2 were synthesized as 2'O-methyl gapmers with PS modifications throughout and as thiophosphoramidate morpholino oligomer (TMO) chimeras (gapmers): a 5-base morpholino 3'-thiophosphoramidate wing, a 10-base 2'-deoxynucleoside 3'-thiophosphate gap with a 2'-deoxynucleoside base at the 3' end, and tested in three experiments in a human fibroblast cell line heterozygous for CV2. Cells were transfected using Lipofectamine 3000 at concentrations of 25 nM and 10 nM. Three days after transfection, cells were harvested and FUS transcripts were analyzed by ddPCR and RT-PCR and agarose gel electrophoresis. In cells transfected with CV2e (TMO gapmer) targeted to reduce expression of the T allele at 25 nM, 86% of the transcripts after 3 days were of the C allele (Figure 4a). In cells transfected with CV2b (TMO gapmer) targeted to reduce expression of the C allele at 25 nM, 78% of the transcripts after 3 days were of the T allele (Figure 4b). The proportion of transcripts of the desired allele was significantly lower when cells were transfected with 2'-O-methyl gapmer AONs. Total FUS expression after 3 days of treatment with AON CV2e at 25 nM was 62% of the control level (Figure 4c), indicating that overall expression of the C allele was slightly increased compared to that in control cells treated with L3K, while expression of the T allele was reduced to approximately 17% of the control level (Figure 4d). Total FUS expression after 3 days of treatment with AON CV2b at 10 nM was 61% of control levels (Figure 4c), indicating that overall expression of the T allele was only slightly reduced to 93% of control cells treated with L3K, whereas expression of the C allele was reduced to approximately 29% of the levels in the control (Figure 4d). Sequence Listing Due to limitations in the WIPO sequence listing software that prevent applicants from entering sequences containing both uracil and thymine bases (such as many of the sequences of the present invention), all uracil bases in the sequences were converted to thymine bases to make the sequence listing available and entered into the WIPO sequence listing software, with the molecule type classified as "DNA." However, where there are differences in information between the sequences in the body of the specification and the sequences listed in the sequence listing file, the body of the specification is the master reference for sequences and information relating to the present invention.

Claims

1. 1. An antisense oligonucleotide targeted to a nucleic acid molecule encoding a FUS pre-mRNA or mRNA, comprising: The antisense oligonucleotide comprises: a. a nucleobase sequence selected from the list consisting of SEQ ID NO: 1 to SEQ ID NO: 34 or a variant thereof; or b. A nucleobase sequence that is complementary to at least one or more consecutive nucleobases in a target FUS pre-mRNA or mRNA to which SEQ ID NO:1 to SEQ ID NO:34 or variants thereof also bind. having said antisense oligonucleotide inhibits expression of at least one allele of the FUS gene or a variant of the FUS gene; The antisense oligonucleotide is substantially isolated or purified.

2. The antisense oligonucleotide of claim 1 , wherein the allele comprises a pathogenic variant of the FUS gene.

3. The antisense oligonucleotide of claim 2 , wherein the pathogenic variant is a genetic change that increases a subject's susceptibility or predisposition to a disease.

4. The method of claim 3, wherein the disease is selected from the group consisting of ALS, FTD, and ET.

5. 5. The method of claim 4, wherein the disease is selected from the group consisting of ALS or FTD.

6. The method of claim 5, wherein the disease is selected from the group consisting of FUS-ALS or FUS-FTD.

7. 2. The antisense oligonucleotide of any one of the preceding claims, which binds to a region of a transcript contained within exon 3, exon 4 or the 3'UTR on FUS.

8. The antisense oligonucleotide of claim 7 , wherein the antisense oligonucleotide binds to a region of the transcript that includes CV (rs741810), CV2 (rs1052352), or CV3 (rs4889537).

9. 2. The antisense oligonucleotide of any one of the preceding claims, which selectively knocks down expression of one allele of the pre-mRNA and / or mRNA of FUS or a FUS variant thereof, while leaving sufficient normal mRNA present to produce substantial amounts of protein.

10. 4. The antisense oligonucleotide of any one of the preceding claims, which induces RNase H-mediated degradation of the FUS pre-mRNA and / or FUS mRNA.

11. 2. The antisense oligonucleotide of any one of the preceding claims, which is a thiophosphoramidate morpholino oligomer (TMO) chimera.

12. The antisense oligonucleotide of claim 11, wherein the thiophosphoramidate morpholino oligomer (TMO) chimera has a gapmer design comprising a TMO and a phosphorothioate DNA or DNA subunit.

13. 13. The antisense oligonucleotide of claim 11 or 12, which is a peptide-thiophosphoramidate morpholino oligomer (TMO) chimeric conjugate.

14. The antisense oligonucleotide according to any one of the preceding claims, selected from the list consisting of SEQ ID NOs: 1 to 12.

15. The antisense oligonucleotide of claim 14, which is SEQ ID NO: 2, 4, 5, 8, or 11.

16. 1. A method for inducing selective knockdown of selected alleles of FUS pre-mRNA and mRNA, comprising: a) providing one or more of the antisense oligonucleotides according to any one of claims 1 to 15; and b) binding said oligomer(s) to a target nucleic acid site. A method comprising:

17. 1. A composition for treating, preventing, or ameliorating the effects of a disease associated with a pathogenic variant in the FUS gene, comprising: a) one or more antisense oligonucleotides according to any one of claims 1 to 15; and b) one or more therapeutically acceptable carriers and / or diluents A composition comprising:

18. 1. A pharmaceutical composition for treating, preventing, or ameliorating the effects of a disease associated with a pathogenic variant in the FUS gene, comprising: a) one or more antisense oligonucleotides according to any one of claims 1 to 15; and b) one or more pharma- ceutically acceptable carriers and / or diluents 13. A pharmaceutical composition comprising:

19. 20. A method of treating, preventing, or ameliorating the effects of a disease associated with a pathogenic variant in the FUS gene, comprising administering to said subject an effective amount of the pharmaceutical composition of claim 18.

20. 20. The method of claim 19, wherein the pathogenic variant is a genetic change that increases the subject's susceptibility or predisposition to the disease.

21. 21. The method of claim 20, wherein the disease is selected from the group consisting of ALS, FTD or ET.

22. 22. The method of claim 21, wherein the disease is selected from the group consisting of ALS or FTD.

23. 23. The method of claim 22, wherein the disease is selected from the group consisting of FUS-ALS or FUS-FTD.

24. 1. A method for treating, preventing, or ameliorating the effects of a disease associated with a pathogenic variant in the FUS gene in a patient identified by a biomarker, comprising: a) testing a subject for the presence of a biomarker associated with a disease associated with FUS proteinopathy, in which the patient is likely to respond to FUS inhibition; and b) if said subject is found to express said biomarker, administering to said subject an effective amount of a pharmaceutical composition according to any one of claims 18. A method comprising:

25. 25. The method of claim 24, wherein the disease is selected from the group consisting of ALS or FTD.

26. 25. The method of claim 24, wherein the biomarker is a pathogenic variant in the FUS gene.

27. A method for reducing expression of a selected FUS allele in a subject and / or reducing overexpression of FUS caused by autoregulation in a subject, comprising administering to the subject an effective amount of a pharmaceutical composition described in claim 18.

28. (1) A method for reducing expression of a selected FUS allele in a subject; and / or (2) A method for reducing overexpression of FUS caused by autoregulation in a subject And, (a) one or more antisense oligonucleotides according to any one of claims 1 to 15; (b) one or more pharma- ceutically acceptable carriers and / or diluents; administering to said subject an effective amount of a pharmaceutical composition comprising A method comprising:

29. An expression vector comprising one or more antisense oligonucleotides according to any one of claims 1 to 15.

30. A cell comprising the antisense oligonucleotide according to any one of claims 1 to 15.

31. Use of an antisense oligonucleotide according to any one of claims 1 to 15 for the manufacture of a medicament for treating, preventing or ameliorating the effects of a disease associated with a pathogenic variant in the FUS gene.

32. Use of the antisense oligonucleotide of any one of claims 1 to 15 for treating, preventing or ameliorating the effects of a disease associated with a pathogenic variant in the FUS gene.

33. 33. The use according to claim 31 or 32, wherein the disease is selected from the group consisting of ALS or FTD.

34. A kit for treating, preventing or ameliorating the effects of a disease associated with a pathogenic FUS variant in a subject, comprising at least an antisense oligonucleotide according to any one of claims 1 to 15 packaged in a suitable container together with instructions for its use.

Images