Optimized sequences for enhanced tRNA expression and / or nonsense suppression

Abstract

The present disclosure relates to nucleic acids, compositions, and methods for treating diseases or disorders associated with premature stop codons. Certain aspects of the disclosure relate to polynucleotides, vectors, and host cells, and uses thereof.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No. 63 / 307,338, filed February 7, 2022, the contents of which are incorporated herein by reference in their entirety.

[0002] Government Interests This invention was made with government support under 5R01HL153988 awarded by the National Institutes of Health. The Government has certain rights in this invention.

[0003] The present invention relates to anticodon-editing tRNA-based agents and methods for treating disorders associated with premature stop codons. [Background technology]

[0004] The genetic code is composed of nucleotide triplets, called codons, that specify the amino acids to be added during protein synthesis. Of the 64 nucleotide combinations that compose codons, 61 code for the insertion of amino acids into the growing polypeptide chain on the ribosome, and three (TAA, TAG, and TGA) are reserved as signals for translation termination. Mutations (commonly single-base substitutions) that result in the conversion of a codon that originally coded for an amino acid into one of the stop codons are called nonsense mutations, resulting in a premature stop codon (PTC) in the protein-coding sequence. The truncated protein product resulting from a gene containing a PTC often results in loss of protein function. Nonsense mutations account for 10-15% of all genetic lesions leading to disease and result in nearly 1000 severe genetic disorders 6For example, approximately 12% of the cystic fibrosis (CF) community is affected by nonsense mutations in the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) protein. These nonsense "Class I" mutations are notoriously difficult to treat because the CFTR protein is not expressed, rendering the disease ineffective against available CFTR modulator and corrector therapies. 7 PTC therapeutic strategies targeting mRNA degradation and the transcriptional and translational processes involved in the production of CFTR protein would be beneficial.

[0005] To that end, an anticodon editing (ACE)-tRNA nonsense suppression platform has been developed. This ACE-tRNA platform offers significant advantages over other PTC readthrough strategies, as it results in seamless, codon-specific PTC suppression. The safety of this platform as a therapeutic is supported by ribosome profiling studies showing that ACE-tRNA exhibits minimal readthrough of endogenous translation termination codons, suggesting a low proteotoxicity burden. To deliver tRNA to the cell type of interest, viral transduction, DNA electroporation, ribonucleoprotein complexes, and nanoparticle complex formulation methods may be used. However, all of these methods, while promising, are at least partially dependent on the efficiency of the DNA or RNA cargo to suppress PTCs. Summary of the Invention

[0006] tRNA sequences and expression cassettes have been developed that exhibit improved efficiency of PTC inhibition, which in some aspects can address the problems mentioned above.

[0007] In one aspect, the disclosure provides a nucleic acid comprising: (i) nucleotides 1-55 of a modified sequence selected from SEQ ID NOs: 1-39 and 41-79 set forth in Table 1A or 1B, or (ii) selected from SEQ ID NOs: 81-90 set forth in Table 1C, a coding segment encoding a transfer RNA (tRNA), and optionally a 3' trailer segment.

[0008] In a second aspect, the disclosure provides a nucleic acid comprising an optional 5' leader segment, a coding segment encoding a tRNA, and a 3' trailer segment comprising nucleotides 129-132 of a modified sequence selected from SEQ ID NOs: 92-95 and 97-106 as shown in Table 2A or 2B.

[0009] In a third aspect, the disclosure provides a nucleic acid comprising: (i) a 5' leader segment comprising nucleotides 1-55 of a modified sequence selected from SEQ ID NOs: 1-39 and 41-79 set forth in Table 1A or 1B, or (ii) selected from SEQ ID NOs: 81-90 set forth in Table 1C; a coding segment encoding a tRNA; and a 3' trailer segment comprising nucleotides 129-132 of a modified sequence selected from SEQ ID NOs: 92-95 and 97-106 set forth in Table 2A or 2B.

[0010] In a fourth aspect, the present disclosure provides a nucleic acid comprising any one of the sequences provided herein, or an optimized portion of any one of the sequences provided herein, alone or in combination with a sequence encoding a tRNA.

[0011] In general, the nucleic acid can be at least 120 nucleotides (nt) in length (e.g., about 120 to about 500 nt, about 130 to about 400 nt, about 140 to about 300 nt, and about 150 to about 200 nt). In some embodiments, at least two of the 5' leader segment, the coding segment, and the 3' trailer segment are heterologous to each other or are not from the same gene. In some embodiments, the nucleic acid may include a modified sequence selected from SEQ ID NOs: 1-39, 41-79, 81-90, 92-95, 97-106, 152, 153-162, 164-177, 179-194, 196-210, and 228-251 shown in Table 1A, 1B, 1C, 2A, 2B, 9, or 10. In some embodiments, the nucleic acid further includes a tabulator sequence. The tabulator sequence can include any suitable sequence. In one embodiment, the tabulator sequence encodes a ribozyme. In one embodiment, the tabulator sequence encodes a self-cleaving ribozyme.

[0012] In other embodiments, the nucleic acid can include nucleotides 56-128 of a modified sequence selected from SEQ ID NOs: 108-111, 113-117, 118-131, and 133-146, as set forth in one of Tables 3, 4, 5, 6, and 7. For example, the nucleic acid can include a modified sequence as set forth in one of Tables 3, 4, 5, 6, and 7.

[0013] Each of the above nucleic acids may further comprise an upstream control element (UCE) operably linked to the 5' end of the 5' leader segment. In some embodiments, the upstream control element comprises a U6 promoter or an H1 promoter (such as those in Table 8), or a sequence selected from SEQ ID NOs: 148-151. In each of the above nucleic acids, the tRNA can be an anticodon-edited tRNA (ACE-tRNA).

[0014] The present disclosure also provides an expression cassette or expression vector comprising any one of the nucleic acids provided herein. Also provided herein is a host cell comprising the nucleic acid, or the expression cassette, or the expression vector. Also provided is one or more progeny of the host cell. Additionally provided is a tRNA encoded by the above-mentioned nucleic acid.

[0015] The nucleic acids can be used in methods to express a tRNA, such as an ACE-tRNA, in a cell.

[0016] The expressed tRNA can have the function of restoring the PTC to an amino acid during translation of the mRNA. To that end, the method includes (i) contacting a cell of interest with the nucleic acid molecule described above, and (ii) maintaining the cell under conditions that allow expression of the tRNA. The cell can have a mutant nucleic acid that includes one or more PTCs. In that case, the wild-type nucleic acid encodes a fully functional polypeptide. Using this method, the expressed tRNA rescues one or more PTCs to restore expression of the polypeptide or improve the functional activity of the polypeptide in the cell. For example, the polypeptide can be the cystic fibrosis transmembrane conductance regulator (CFTR), and the mutant nucleic acid encodes a truncated CFTR. In one example, the mutant nucleic acid has a Trp-to-Stop PTC. The tRNA translates the Trp-to-Stop PTC to Leu.

[0017] Host cells containing one or more of the nucleic acids described herein are within the scope of the present invention.

[0018] The above-mentioned nucleic acids can be used in methods for treating disorders such as PTC-related disorders. Accordingly, the present invention also provides pharmaceutical formulations comprising (i) the nucleic acid or expression cassette or expression vector or tRNA provided herein, and (ii) a pharma- ceutical acceptable carrier.

[0019] Also provided is a method of treating a disease, such as a disease associated with PTC, in a subject in need thereof, comprising administering to the subject a nucleic acid or expression cassette or expression vector or tRNA provided herein, or a pharmaceutical composition as described above.

[0020] Examples of diseases include cystic fibrosis, Duchenne and Becker muscular dystrophies, retinoblastoma, neurofibromatosis, ataxia telangiectasia, Tay-Sachs disease, Wilms' tumor, hemophilia A, hemophilia B, Menkes disease, Ullrich's disease, β-thalassemia, von Willebrand disease types 2A and 3, Robinow syndrome, brachydactyly type B (shortened fingers and metacarpals), genetic susceptibility to mycobacterial infections, inherited retinal diseases, inherited bleeding tendencies, hereditary blindness, congenital sensorineural deafness, and colonic enteric ganglion cell deficiencies. agangliosis), and inherited neurodevelopmental disorders including sensorineural deafness, intestinal ganglion cell deficiencies, peripheral neuropathy, and central hypomyelination, Liddle syndrome, xeroderma pigmentosum, Fanconi anemia, anemia, hypothyroidism, p53-related cancer, esophageal cancer, bone cancer, ovarian cancer, hepatocellular carcinoma, breast cancer, hepatocellular carcinoma, fibrous histiocytoma, ovarian cancer, SRY sex reversal, triosephosphate isomerase anemia, diabetes mellitus, rickets, Hurler syndrome, Dravet syndrome, spinal muscular dystrophy, Usher syndrome, aniridia, congenital choroideremia, ocular coloboma, retinitis pigmentosa, dystrophic epidermolysis bullosa, pseudoxanthoma elasticum, Alagille snydrome, Waardenburg-Scher syndrome, childhood neuronal ceroid lipofuscinosis, cystinosis, X-linked nephrogenic diabetes insipidus, and polycystic kidney disease. In some examples, the eye disease is selected from the group consisting of cone dystrophy, Stargardt's disease (STGD1), cone-rod dystrophy, retinitis pigmentosa (RP), increased susceptibility to age-related macular degeneration, congenital stationary night blindness 2 (CSNB2), congenital stationary night blindness 1 (CSNB1), Best's disease, VMD, and Leber's congenital amaurosis (LCA16). The treatment method can be performed using any suitable method, including viral delivery (e.g., lentivirus, poxvirus, herpes simplex virus I, adenovirus, adeno-associated virus, etc.), nanoparticles, electroporation, polyethyleneimine (PEI), receptor-targeted polyplexes, liposomes, or hydrodynamic injection.

[0021] The details of one or more embodiments of the disclosure are set forth in the description below. Other features, objects, and advantages of the disclosure will become apparent from the description and the claims. [Brief description of the drawings]

[0022] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0023] [Figure 1A-1C] Figure 1A: Human tRNA expression and processing. (Figure 1A) Diagram of a human tRNA gene with a degenerate weak TATA box region (TATA), a transcription start site (TSS), a mature tRNA sequence containing A- and B-box promoter sequences, an anticodon, an intron and a variable loop, and a 5'-upregulatory element (5'UCE) containing a 3'-trailer followed by a poly-thymidine (pT) transcription terminator. (Figure 1B) Human tRNA transcription begins with the binding of transcription factor IIIC (TFIIIC) to the middle A- and B-box regions of the tRNA gene. TFIIIC recruits transcription factor IIIB (TFIIIB), which is composed of B-related factor (BRF1), B double prime 1 (BDP1), and TATA box binding protein (TBP). TFIIIB recruits RNA polymerase III (Pol III) for transcription initiation. The 3'-trailer and transcription terminator regions are also thought to be important for transcription, since it is known that the transcriptional machinery undergoes multiple rounds of tRNA transcription after the initial assembly, depending on the 3'-region of the tRNA gene (Figure 1C) pre-tRNA shown as a cloverleaf diagram. [Figure 2A-2C] (FIG. 2A) Maps of the ACE-tRNA plasmid used in screening assays for the 5' upstream regulatory element, (FIG. 2B) t-stem and sticky stem mutants, and (FIG. 2C) 3' trailer are shown. [Figure 3A-3C]tRNA T-stem variants and numbering are shown. (Figure 3A) T-stem variants covering a range of putative tRNA-EF1a interaction strengths to optimize ACE-tRNA function. For the ArgTGA, LeuTGA, and GlyTGA libraries, the T-stem of each tRNA was mutated to match the variants outlined in the table presented herein. Sequence variants are taken from Saks ME et al., RNA. 2011, 17(6):1038-1047. (Figure 3B) All tRNA T-stem are numbered as shown in the cloverleaf T-stem structure with a canonical numbering scheme. (Figure 3C) Suppression efficiency of ACE-tRNALeu UGA T-stem variants in 16HBE14o-cells. [Figure 4] 2 shows the ArgTGA ACE-tRNA cloverleaf structure with the "sticky stem" mutation sites indicated. The original ArgTGA (oArgTGA) sequence (GGCUCUGGUGGCGCAAUGGAUAGCGCAUUGGACUUCAAAUUCAAAGGUUGUGGGUUCGAGUCCCACCAGAGUCG, SEQ ID NO: 264) is shown in the cloverleaf structure with base pair mutations indicated with arrows indicating the location of the GC or CG mutations. The sticky stem library contains all combinations of any of the oArgTGA base pairs or GC / CG mutations listed. [Diagram 5] 2 shows the LeuTGA ACE-tRNA cloverleaf structure with the "sticky stem" mutation sites indicated. The original LeuTGA (oLeuTGA) sequence (ACCAGAAUGGCCGAGUGGUUAAGGCGUUGGACUUCAGAUCCAAUGGAUUCAUAUCCGCGUGGGUUCGAACCCACUUCUGGUA, SEQ ID NO: 265) is shown in the cloverleaf structure with base pair mutations indicated with arrows indicating the location of the GC or CG mutations. The sticky stem library contains all combinations of either the oLeuTGA base pairs or GC / CG mutations listed. [Figure 6]The types of RNA polymerase III promoters are shown. Type II RNA Pol III promoters are used to express tRNA genes in humans. Intragenic box A and box B sequences recruit TFIIIC, which then recruits TFIIIB, which then recruits RNA Pol III (Figure 1B). Type III RNA Pol III promoters express other genes, including U6 and H1 RNA. Type III promoters do not require any intragenic sequences and are therefore often used to express exogenous RNAs, including CRISPR guide RNAs, siRNAs, and shRNAs, that do not contain native A or B boxes. Type III promoters have been used to express human nonsense suppressor tRNAs, but many of the endogenous human 55bp 5'-leaders result in higher nonsense suppression activity in vivo. [Figure 7A-7C] Assembly of a 55 bp 5' leader library is shown. (Figure 7A) The parental high-throughput cloning and screening vector for the tRNA 5' region contains a cloning site immediately 5' to the original ArgTGA tRNA sequence / original 3' trailer sequence. (Figure 7B) Human tRNAs designated with names such as "tRNA-Ala-AGC-1-1" (where Ala is the three letter amino acid code for the tRNA isotype, AGC is the anticodon, the first 1 corresponds to the numeric ID of the unique tRNA transcript or "isodecoder", and the second 1 corresponds to the locus ID - for tRNAs with multiple identical copies, this locus ID represents the specific gene copy in the genome). (Figure 7C) Cloning of these different 55 bp 5' upstream regulatory elements. [Figure 8A-8G] We show that addition of a tRNA transcript tabulator to the 3' end of an ACE-tRNA results in ACE-tRNA-dependent expression of an RNA target for quantification by RT-qPCR. [Figure 8A] The tRNA transcript tabulator (TTT) in the tRNA gene is shown. [Figure 8B]1 shows the use of a self-cleaving ribozyme as a TTT (cleavage site indicated by an arrow). [Figure 8C] ACE-tRNA cannot be directly quantified via real-time reverse transcription quantitative PCR (RT-qPCR) without extensive processing because it contains many modified nucleotides that inhibit reverse transcriptase, whereas TTT does not contain any modifications that inhibit reverse transcriptase. [Fig. 8D-8G] We show that TTT abundance is directly proportional to ACE-tRNA abundance and that quantification of the tRNA transcript counter serves as a surrogate for quantification of each of the ACE-tRNA sequences tested: ACE-tRNAArg TGA (Figure 8D), ACE-tRNALeu TGA (Figure 8E), ACE-tRNAGly TGA (Figure 8F), and ACE-tRNATrp TGA (Figure 8G). [Figure 9A-9E] It is shown that the optimized ACE-tRNA expression cassette exhibits higher peak levels of PTC inhibition (higher Supmax) and / or exhibits lower levels of DNA delivery (lower DD50) required to reach maximum PTC inhibition. [Figure 9F] A curve fit was applied to the equation shown in Figure 9E, providing a table of fitted data for the plots displayed in Figures 9A, 9B, 9C, and 9D. [Figure 10A-10E] We show that the optimized ACE-tRNA retains its fidelity in translation. [Figure 10A] A pcDNA3.1(+) plasmid encoding a superfolder green fluorescent protein (sfGFP) with a TGA stop codon at amino acid position 150 and a C-terminal Strep-8xHistidine-Strep tag was cotransfected into HEK293T cells together with a plasmid encoding four copies of the ACE-tRNA under investigation. [Figure 10B-10C] Eluted sfGFP protein was resolved on a 10–20% gradient SDS-PAGE gel and stained with SimplyBlue Safestain (Thermo Fisher Scientific) Coomassie stain. [Figure 10D] The mass of each peptide containing an amino acid at position 150 of sfGFP was determined, and the amino acid with the most consistent mass for position 150 of the peptide was determined. Because trypsin cleaves after arginine and lysine, the peptide with arginine at position 150 (LEYNFNSHR, SEQ ID NO:252) differs from the peptide with other amino acids shown here (LEYNFNSHXVYITADK, SEQ ID NO:253). The arginine in the peptide shown as R, the other amino acids shown as X. [Figure 10E] The peptide abundance of each amino acid incorporated at position 150, tabulated and expressed as a percentage, is shown, demonstrating that translation fidelity was largely retained after optimization of the ACE-tRNA sequence. [Figure 10F] A table showing the percentage of each amino acid incorporated at position 150 of sfGFP-TGA-150 as determined by mass spectrometry and shown in Figure 10E is shown. [Figures 11A-11C] 1 shows the determination of the applicability of the best 5′-UCE, 3′-trailer, and t-stem sequences for the improvement of all ACE-tRNAs. [Figure 11A] , Lueck et al., Nature communications 10, 822, 2019 show that the top ACE-tRNA sequence for each isoacceptor / stop codon family was cloned along with the original 5'-UCE, 3'-trailer, and t-stem to reference the improved sequence. [Figure 11B] To determine the applicability of the top 5'-UCE and 3'-trailer sequences to improve all ACE-tRNA sequences, each top ACE-tRNA sequence for each isoacceptor / stop codon family from Lueck et al., 2019 was cloned adjacent to the top 5'-UCE and 3'-trailer sequences determined in this study. [Figure 11C]To determine the applicability of the top t-stem sequences to improve all ACE-tRNA sequences, we show that each top ACE-tRNA sequence for each isoacceptor / stop codon family from Lueck et al., 2019 was cloned using the top t-stem sequences determined in this study. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0024] The present disclosure relates to tRNAs, such as ACE-tRNA, RNAs comprising expression cassettes or expression vectors, and related delivery and uses for the treatment of disorders such as those associated with PTC or nonsense mutations.

[0025] Due to the high prevalence and unifying mechanism of disease-causing nonsense mutations, there have been significant efforts to identify drugs for the treatment of PTC. Natural and synthetic aminoglycosides have been the main focus of these efforts, but they are either of limited use due to ototoxicity and nephrotoxicity with long-term use or suffer from low read-through efficiency. 8~11 Non-aminoglycoside small molecules (i.e., tyrosine, ataluren) have also been identified as promising PTC lead-through compounds with reduced toxicity. 12~13 A major drawback of all small molecule readthrough compounds developed so far is the suppression of the PTC by the near-cognate tRNA, which often results in the conversion of nonsense mutations to missense mutations. Non-selective incorporation of amino acids at PTC positions has the potential to affect protein folding, trafficking, and function, necessitating further therapeutic intervention, i.e., promotion of folding and / or trafficking. 14 In addition, some of these compounds were shown to be effective in inhibiting the proliferation and proliferation of primary human cells. 15Ataluren showed surprisingly low efficacy of CFTR PTC inhibition in this and other patient populations, resulting in the failure of phase 3 clinical trials (Act DMD phase 3 clinical trial, NCT01826487; Act CF, NCT02139306). A promising new eukaryotic ribosome-selective glycoside lead compound, ELOX-2, has been approved by Elox Pharmaceuticals. 16 However, despite significant interest, there are currently no FDA-approved therapeutics for the treatment of CF caused by nonsense mutations.

[0026] ACE-tRNA ACE-tRNA is an engineered tRNA molecule whose sequence is engineered to effectively and therapeutically revert the PTC back to the original missing or different amino acid. Such engineered tRNAs allow for the "reediting" of disease-causing nonsense codons to specific amino acids. The small size of these tRNA molecules, with the tRNA and promoter together amounting to only about 300 bp, allows them to be expressed immediately. To that end, oligonucleotides can be synthesized to contain the structural components of tRNA genes that function in human cells. The sequence of this oligonucleotide can be designed based on known sequences that allow a specific tRNA to recognize a nonsense or other specific mutation by substitutions made within the anticodon region of the tRNA. Examples of ACE-tRNAs include those described in WO2021 / 252354, WO2019 / 090154, WO2019 / 090169, and Lueck, JDet al. Nature communications 10,822,2019. The contents of each of these documents, including the ACE-tRNA sequences provided therein, are incorporated by reference.

[0027] Generally, tRNA has a general four-arm structure including a T-arm, a D-arm, and an anticodon arm, and an acceptor arm (see FIG. 1C of the present application and FIG. 2 of WO2019 / 090169). The T-arm is composed of a "T-stem" and a "TΨC loop". In certain embodiments, the T-stem is modified to increase the stability of the tRNA. In certain embodiments, the tRNA has a modified T-stem that increases the biological activity for suppressing the termination site compared to the endogenous T-stem sequence.

[0028] tRNAs, such as ACE-tRNA, can be used to suppress PTCs. However, there are potential drawbacks to effective suppression of PTCs. For example, there has been concern that PTC suppression strategies may result in readthrough of actual native stop codons in vivo, and that global native stop codon readthrough is harmful. However, several cellular mechanisms are in place to limit both normal stop readthrough and its damaging effects. More specifically, multiple in-frame stop codons are frequently found during normal translation termination, increasing the probability of translation termination in the presence of efficient PTC suppressors. Furthermore, at least two cellular mechanisms are in place for the identification and degradation of proteins at erroneous translation termination: specialized ubiquitin ligase and ribosome-associated pathways. There is evidence that native stop codons at gene ends have surrounding sequence landscapes that promote enhanced termination efficiency, and that the termination complexes found at PTCs are different from those at "real" termination sites. Unexpectedly, the discovery that endogenous stop codon readthrough is common in animals and not deleterious suggests that suppression of PTC is a viable therapeutic approach. Indeed, preliminary data from ribosome profiling suggests that "real" stop tRNA readthrough is rare. tRNAs such as ACE-tRNAs useful in the present disclosure can be made according to the strategies described in WO2021 / 252354, WO2019 / 090154, WO2019 / 090169, and Lueck, J. D. et al., Nature communications 10, 822 (2019). Using this strategy, an extensive library of ACE-tRNAs has been created for the effective rescue of PTC in cell culture.

[0029] A novel high-throughput screening (HTS) platform was developed for the generation of a library of ACE-tRNAs for the efficient rescue of CFTR PTCs in cell culture. To do this, human tRNA sequences were engineered to no longer suppress their cognate codons but instead suppress the disease-causing PTCs, resulting in a full-length functional CFTR protein. 1 Anticodon editing strategies have been explored in the past for the suppression of PTCs in β-thalassemia and Duchenne muscular dystrophy. 17~18 However, in both of these cases, only a single tRNA was targeted for anticodon editing, whereas the ACE-tRNA screen tested all possible suppressor tRNAs for each PTC. Suppressor tRNAs are also widely used in the field of genetic code expansion (GCE) for the incorporation of non-standard amino acids into proteins. To that end, GCE suppressor tRNAs have been used in mammalian cells. 19 , D. melanogaster 20 , C. elegans 21 , and zebrafish 22 It has been stably expressed in Bacillus subtilis without any adverse effects.

[0030] This screen successfully selected ACE-tRNAs that efficiently promoted the suppression of the CF-causing PTCs W1282X and R1162X (see Example 1). One study showed that the W1282L mutation resulted in >80% of WT CFTR activity. 23 , the ACE-tRNALeuUGA hit was found to be of high quality.

[0031] The ultimate goal of studying these ACE-tRNAs is to show that they are safe and effective and to develop methods for their delivery as therapeutics, such as in vivo CFTR PTC suppression for the treatment of nonsense mutations that cause CF. Multiple means for the delivery of ACE-tRNAs are being pursued, including viral transduction, DNA electroporation, ribonucleoprotein complexes, and nanoparticle complex formulation methods, all of which may depend on the efficacy of the tRNA cargo.

[0032] Optimal sequences for efficient transcription and processing of tRNA As disclosed herein, tRNAs such as ACE-tRNAs are suitable for PTC treatment. The tRNA gene is transcribed into tRNA by type 2 RNA polymerase (Pol) III recognition of internal promoter elements (A-box and B-box, FIG. 1), and the tRNA is flanked by a short (<50 bp) 5' flanking region and a 3' transcription termination element consisting of a short run of thymidine nucleotides (about 4 thymidines, T). Most tRNA genes are 72-76 bp in length, and therefore the entire tRNA expression cassette can consist of only about 125 bp.

[0033] To give tRNAs the best chance of realizing their full therapeutic potential, the present disclosure provides sequences that optimize already promising tRNA hits to increase their efficacy. As disclosed herein, these optimized sequences can result in enhanced RNA expression and, in the case of ACE-tRNA, enhanced nonsense mutation suppression. Example sequences are shown in Tables 1A, 1B, 1C, 2A, 2B, 3-7, and 9.

[0034] There are various sequence elements involved in tRNA production (transcription) and translation functions that can be optimized. RNA polymerase III utilizes type 2 intragenic promoter elements (A and B boxes, Figure 1A) to drive expression of tRNA genes in eukaryotes. 31Although the A and B boxes are sufficient for type 2 promoter function, expression of tRNA is regulated and enhanced by a sequence approximately 50 bp immediately 5' to the gene (the 5'-flanking sequence). 32~33 Transcription of tRNA is terminated by a short stretch of thymidine nucleotides (≤4 thymidines, T) 31 Initially, precursor tRNAs are synthesized with short 5'-leader and 3'-trailer sequences (Figure 1B), which are removed by the action of several nucleases. 5'-end processing by the endonuclease RNaseP is generally considered to be the first step in the tRNA processing pathway. 34 This is the first step.

[0035] The 5'-flanking sequences may be important for the production of active tRNAs, not only because 5'-transcriptional regulators affect the amount of tRNA transcribed, but also because the 5'-leader sequence affects the efficiency of cleavage by RNase P and the tRNA maturation process. 35 The 3' end processing of pre-tRNA is usually followed by 5' end processing by exonuclease 36~38 and RNase Z endonuclease 39 Both the length and identity of the first nucleotide of the 3'-trailer affect the efficiency of 3' processing. 40 Shorter 3'-trailers beginning with G or A are usually processed more efficiently. 40 However, no firm rules have been established.

[0036] Similar to the 5'-leader, cleavage of the 3'-trailer is important for pre-tRNA maturation. Following 3'-end processing, a 3' CCA trinucleotide is ligated, and the tRNA is then modified with an average of 8 (per tRNA) of the >90 known tRNA post-transcriptional modifications (Figure 1C). 41 .

[0037] After production of the mature tRNA, it is recognized by its cognate aminoacyl-tRNA synthetase (aaRS) and charged with the correct amino acid. Both ArgRS and LeuRS contain an anticodon binding / recognition domain. 42 From the initial ACE-tRNA screen, it is evident that converting the anticodon of ACE-tRNA from a standard anticodon to a nonsense-suppressing anticodon disrupts the ACE-tRNA / aaRS interaction (Figure 1C). It is hypothesized that optimizing the anticodon loop can enhance favorable interactions with the aaRS and increase the charging of ACE-tRNA, resulting in increased participation of ACE-tRNA in translation and PTC suppression.

[0038] Screening a library of mutants in the anticodon loop of nonsense suppression tRNAs has been shown to significantly increase the efficiency of nonsense suppression in GCE. 5、27~28、30、43 After an aminoacylated ACE-tRNA is charged with its cognate tRNA, it is transported to the ribosome by EF-1a, which recognizes both the charged amino acid and the T-stem to facilitate proper tRNA transport and release to the ribosome. 44~46 The tRNA can then enter the A site of the ribosome and repress the PTC, allowing translation of, for example, the full-length CFTR protein.

[0039] As an example, the pre-tRNA, shown in FIG. 1C as a cloverleaf diagram, is the initial product of tRNA transcription containing a 5'-leader, possibly an intron, and a 3'-trailer. The 5'-leader is removed by the action of RNase P endonuclease, the intron (if present) is spliced ​​out, and the 3'-trailer is removed by the action of RNase Z endonuclease or other exonucleases. Nucleobases are modified by enzymatic activities before the mature tRNA performs its intracellular function in the translation apparatus. The identity of the tRNA anticodon loop is often important for recognition and charging by the cognate aminoacyl-tRNA synthetase (aaRS). This region of the tRNA represents a potential site of functional improvement, since this region must be altered for a functional nonsense suppressor tRNA. After charging of the tRNA by its analog aaRS, the aminoacylated tRNA is transported to the ribosome by elongation factor 1α (EF1a). Since EF1a is known to interact with the t-stem or t-arm of tRNA, this region represents another potential site for improvement of tRNA function. In general, the thermodynamic stability of tRNAs is thought to be closely related to their intracellular stability and half-life, so increasing the ratio of GC to AT content in base pair stems (D-stem, anticodon stem, T-stem, and acceptor stem) and variable loops (if applicable) may increase stability, leading to longer tRNA half-life, higher intracellular pools of tRNA, and increased nonsense suppression.

[0040] Reference Array / Original Array Shown below is an exemplary sequence encoding ACE-tRNA ArgTGA (i.e., tRNA-Tyr-GTA-5-1) and its components including the 55 bp 5' leader, tRNA coding region (bold), and 4 bp 3' trailer region (italic), and RNA Pol III terminator. The tRNA coding region includes the anticodon loop, anticodon (underlined), and T-stem. This sequence is used as a reference or original sequence to describe other mutant or variant sequences that terminate tRNAs and their various components. [Sequence Table 1] TIFF2025507324000002.tif14170 [Table 1]

[0041] In Tables 2-7 and 9 shown below, components from this reference / original sequence are shown either underlined (e.g., 5' leader sequences), or in bold (e.g., 3' trailer sequences), or with the prefix "o" to indicate original. In some of these tables, the reference / original sequence is listed last, while others are modified sequences or variants.

[0042] As shown in Example 8, the original 5' leader is comparable to or superior to the U6 and H1 promoters in enhancing expression of genes, such as tRNA genes. Thus, this and other 5' leader segments described herein can be used as enhancing elements (e.g., promoters or enhancers) to enhance expression of genes, such as tRNA genes.

[0043] In addition to the above components or sequences, the tRNA coding sequence can further include a tabulator sequence. Such a tabulator sequence is also called a "tRNA transcript tabulator" or a "tRNA transcript counter". As disclosed herein (e.g., FIG. 8 and Example 9), the tRNA transcript tabulator allows for the quantification of tRNA-dependent expression of an RNA target by suitable means, such as RT-qPCR.

[0044] The tabulator sequence may comprise any suitable sequence. In one embodiment, the tabulator sequence encodes a ribozyme. In one embodiment, the tabulator sequence encodes a self-cleaving ribozyme. Below is an exemplary sequence encoding an ArgTGA tRNA transcript with a tabulator sequence. From the 5' to 3' end, four portions are included: a 55 bp 5' leader (Tyr-GTA-5-1), an ACE-tRNA ArgTGA (bold), a tRNA transcript tabulator (underlined, SEQ ID NO: 262), and an RNA Pol.III terminator. [Sequence Table 2] TIFF2025507324000004.tif21170

[0045] Expression cassettes and expression vectors The present disclosure also provides an expression cassette comprising or consisting of the above-mentioned nucleic acid. If such a nucleic acid does not already comprise a promoter, the expression cassette may further comprise a promoter. Thus, an expression cassette according to the present invention comprises, in a 5' to 3' direction, a promoter, an upstream control element, a 5' leader segment (e.g., nucleotides 1-55 of the modified sequence shown in Table 1A or 1B), a coding segment encoding a tRNA, a 3' trailer segment (e.g., nucleotides 129-132 of the modified sequence shown in Table 2A or 2B), and optionally a terminator or other elements. The expression cassette can allow for easy transfer of a target gene into an organism, preferably a cell, preferably a diseased cell.

[0046] The expression cassette of the present disclosure is preferably contained in a vector. Thus, the vector of the present disclosure allows cells to be transformed with a target gene or a combination of multiple genes while achieving high expression or activity of the target gene. Correspondingly, the present disclosure provides a host cell comprising an expression cassette according to the present disclosure or a nucleic acid according to the present disclosure. The nucleic acid may also comprise a promoter or enhancer to allow expression of the target gene.

[0047] Introduction of nucleic acid encoding tRNA into cells Exogenous genetic material (e.g., a nucleic acid, an expression cassette, or an expression vector encoding one or more therapeutic tRNAs) can be introduced into a target cell of interest in vivo by gene transfer methods such as transfection or transduction to provide a genetically modified cell. A variety of expression vectors (i.e., vehicles for facilitating the delivery of exogenous genetic material to a target cell) are known to those skilled in the art. As used herein, "exogenous genetic material" refers to either natural or synthetic nucleic acids or oligonucleotides that are not naturally found in a cell, or, if it is naturally found in a cell, it is not transcribed or expressed at a biologically significant level by the cell. Thus, "exogenous genetic material" includes, for example, non-naturally occurring nucleic acids that can be transcribed into tRNAs.

[0048] As used herein, "transfection of a cell" refers to the acquisition of new genetic material by a cell through the incorporation of added nucleic acid (DNA, RNA, or hybrids thereof). Thus, transfection refers to the introduction of nucleic acid into a cell using physical or chemical methods. Several transfection techniques are known to those skilled in the art, including calcium phosphate nucleic acid co-precipitation, strontium phosphate nucleic acid co-precipitation, DEAE-dextran, electroporation, cationic liposome-mediated transfection, and tungsten particle-facilitated microparticle bombardment. In contrast, "transduction of a cell" refers to the process of transferring nucleic acid into a cell using a DNA or RNA virus. RNA viruses (i.e., retroviruses) for transferring nucleic acid into a cell are referred to herein as transducing chimeric retroviruses. The exogenous genetic material contained within the retrovirus is integrated into the genome of the transduced cell. A cell transduced with a chimeric DNA virus (e.g., an adenovirus carrying a cDNA encoding a therapeutic agent) may not have the exogenous genetic material integrated into its genome, but may express exogenous genetic material that is retained extrachromosomally within the cell.

[0049] Typically, exogenous genetic material may include a heterologous gene (encoding a therapeutic RNA or protein) along with a promoter that controls transcription of the new gene. A promoter characteristically has a specific nucleotide sequence required to initiate transcription. Optionally, the exogenous genetic material further includes additional sequences (i.e., enhancers) required to obtain the desired gene transcription activity. For the purposes of this discussion, an "enhancer" is simply any non-translated DNA sequence that works in continuity with a coding sequence (in cis) to alter the basal transcription level dictated by the promoter. Exogenous genetic material may be introduced into the cell genome immediately downstream of the promoter such that the promoter and coding sequence are operably linked to allow transcription of the coding sequence. Retroviral expression vectors may include exogenous promoter elements to control transcription of the inserted exogenous gene. Such exogenous promoters include both constitutive and inducible promoters.

[0050] Naturally occurring constitutive promoters control the expression of essential cellular functions. As a result, genes under the control of a constitutive promoter are expressed under all conditions of cell growth. Exemplary constitutive promoters include the promoters of the following genes that code for certain constitutive or "housekeeping" functions: hypoxanthine phosphoribosyltransferase (HPRT), dihydrofolate reductase (DHFR), adenosine deaminase, phosphoglycerol kinase (PGK), pyruvate kinase, phosphoglycerol mutase, actin promoter, ubiquitin, elongation factor-1, and other constitutive promoters known to those skilled in the art. In addition, many viral promoters function constitutively in eukaryotic cells. These include, among others, the early and late promoters of SV40, the long terminal repeats (LTRs) of Moloney leukemia virus and other retroviruses, and the thymidine kinase promoter of herpes simplex virus. Thus, any of the above constitutive promoters can be used to control the transcription of a heterologous gene insert.

[0051] Genes under the control of inducible promoters are expressed only in the presence of, or are expressed more by, an inducing agent (e.g., transcription under the control of the metallothionein promoter is greatly increased in the presence of certain metal ions). Inducible promoters contain a response element (RE) that stimulates transcription when their inducer is bound. Examples include REs for serum factors, steroid hormones, retinoic acid, and cyclic AMP. Promoters containing specific REs can be selected to obtain an inducible response, and in some cases the RE itself can be attached to different promoters, thereby conferring inducibility to the recombinant gene. Thus, by selecting the appropriate promoter (constitutive vs. inducible, strong vs. weak), it is possible to control both the presence and the level of expression of the therapeutic agent in the recombinant cell. When a gene encoding a therapeutic agent is under the control of an inducible promoter, delivery of the therapeutic agent in situ is triggered by exposing the recombinant cell in situ to conditions to allow transcription of the therapeutic agent, for example, by injecting a specific inducer of the inducible promoter that controls transcription of the agent. For example, in situ expression by genetically modified cells of a therapeutic agent encoded by a gene under the control of a metallothionein promoter is enhanced by contacting the genetically modified cells in situ with a solution containing the appropriate (i.e., inducing) metal ion.

[0052] Thus, the amount of therapeutic agent delivered in situ is regulated by controlling factors such as: (1) the nature of the promoter used to direct transcription of the inserted gene (i.e., whether the promoter is constitutive or inducible, strong or weak), (2) the number of copies of the exogenous gene inserted into the cells, (3) the number of transduced / transfected cells administered (e.g., implanted) to the patient, (4) the size of the implant (e.g., graft or encapsulated expression system), (5) the number of implants, (6) the length of time the transduced / transfected cells or implants are left in place, and (7) the rate of production of the therapeutic agent by the genetically engineered cells. Selection and optimization of these factors for delivery of a therapeutically effective dose of a particular therapeutic agent is deemed to be within the scope of one of ordinary skill in the art without undue experimentation, taking into account the factors disclosed above and the clinical profile of the patient.

[0053] In addition to at least one promoter and at least one heterologous nucleic acid encoding a therapeutic agent, the expression vector may contain a selection gene, e.g., a neomycin resistance gene, to facilitate selection of cells transfected or transduced with the expression vector. Alternatively, cells are transfected with two or more expression vectors, at least one vector containing a gene encoding a therapeutic agent and the other vector containing a selection gene. Selection of a suitable promoter, enhancer, selection gene, and / or signal sequence is deemed to be within the scope of one of ordinary skill in the art without undue experimentation.

[0054] The tRNA construct or coding sequence of the present disclosure can be inserted into any type of target cell or host cell.In the context of an expression vector, the vector can be easily introduced into a host cell, such as a mammalian, bacterial, yeast, or insect cell, by any method in the art.For example, the expression vector can be transferred into a host cell by physical, chemical, or biological means.

[0055] Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, etc. Methods for producing cells containing vectors and / or exogenous nucleic acids are well known in the art. See, e.g., Sambrook et al. (2012, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York).

[0056] Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors. Viral vectors, particularly retroviral vectors, have become the most widely used method for inserting genes into mammalian, e.g., human cells. Other viral vectors can be derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses, and adeno-associated viruses, etc. See, for example, U.S. Patent Nos. 5,350,674 and 5,585,362.

[0057] Chemical means for introducing polynucleotides into host cells include macromolecule complexes, nanocapsules, microspheres, beads, and colloidal dispersion systems such as lipid systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).

[0058] The addition of DNA-binding proteins such as transcription factor A mitochondrial (TFAM) can be used to condense DNA and shield the charge. Due to their small size and compact shape, the DNA:protein (DNP) complexes can then be delivered to cells by cell-penetrating peptides, PEG derivatives, liposomes, or electroporation. In some cases, the DNA-binding proteins can encode nuclear localization signals to actively transport DNP from the cytoplasm to the nucleus where the DNA vector is transcribed.

[0059] When a non-viral delivery system is utilized, an exemplary delivery vehicle is a liposome. The use of lipid formulations is contemplated for the introduction of nucleic acids into a host (in vitro, ex vivo, or in vivo). In another aspect, the nucleic acid may be associated with a lipid. The nucleic acid associated with a lipid may be encapsulated in the aqueous interior of the liposome, dispersed within the lipid bilayer of the liposome, bound to the liposome via a linking molecule associated with both the liposome and the oligonucleotide, entrapped in the liposome, complexed with the liposome, dispersed in a solution containing lipid, mixed with lipid, combined with lipid, contained as a suspension in lipid, contained in or complexed with micelles, or otherwise associated with lipid. The lipid, lipid / DNA, or lipid / expression vector associated compositions are not limited to any particular structure in solution. For example, they may exist in a bilayer structure as micelles, or may have a "collapsed" structure. They may also simply be dispersed in solution and may form aggregates that are not uniform in size or shape. Lipids are fatty substances that can be naturally occurring or synthetic lipids. For example, lipids include the lipid droplets that occur naturally in the cytoplasm, as well as a class of compounds that contain long-chain aliphatic hydrocarbons and their derivatives, including fatty acids, alcohols, amines, aminoalcohols, and aldehydes.

[0060] Lipids suitable for use can be obtained from commercial sources. For example, dimyristyl phosphatidylcholine ("DMPC") can be obtained from Sigma, St. Louis, MO, dicetyl phosphate ("DCP") can be obtained from K & K Laboratories (Plainview, NY), cholesterol ("Choi") can be obtained from Calbiochem-Behring, dimyristyl phosphatidylglycerol ("DMPG") and other lipids can be obtained from Avanti Polar Lipids, Inc. (Birmingham, AL). Stock solutions of lipids in chloroform or chloroform / methanol can be stored at about -20°C. Chloroform is used as the only solvent because it evaporates more easily than methanol.

[0061] "Liposome" is a generic term that encompasses a variety of single and multilamellar lipid vesicles formed by the formation of enclosed lipid bilayers or aggregates. Liposomes can be characterized as having a vesicular structure with a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of a closed structure, trapping water and dissolved solutes between the lipid bilayers (Ghosh et al., 1991 Glycobiology 5:505-10). However, compositions that have structures in solution that differ from the usual vesicular structures are also encompassed. For example, lipids may adopt micellar structures or simply exist as heterogeneous aggregates of lipid molecules. Lipofectamine-nucleic acid complexes are also contemplated.

[0062] The nucleic acid molecules described herein can be administered via electroporation, such as by the method described in U.S. Patent No. 7,664,545, the contents of which are incorporated herein by reference. Electroporation can be performed by the methods and / or devices described in U.S. Patent Nos. 6,302,874, 5,676,646, 6,241,701, 6,233,482, 6,216,034, 6,208,893, 6,192,270, 6,181,964, 6,150,148, 6,120,493, 6,096,020, 6,068,650, and 5,702,359, the contents of which are incorporated herein by reference in their entirety. Electroporation can be performed via a minimally invasive device.

[0063] A minimally invasive electroporation device ("MID") can be an apparatus for injecting the above-mentioned compositions and associated fluids into body tissue. The device can include a hollow needle, a DNA cassette, and a fluid delivery means, and the device is adapted to activate the fluid delivery means in use to inject DNA into body tissue simultaneously (e.g., automatically) during the insertion of the needle into the body tissue. This has the advantage that the ability to gradually inject DNA and associated fluids while the needle is being inserted leads to a more uniform distribution of fluids through the body tissue. The pain experienced during injection can be reduced due to the distribution of the injected DNA over a larger area.

[0064] The MID can inject the composition into tissue without the use of a needle. The MID can inject the composition as a small stream or jet with such force that the composition penetrates the surface of the tissue and enters the underlying tissue and / or muscle. The force behind the small stream or jet can be provided by a compressed gas, such as carbon dioxide, expanding through a micro-orifice for a fraction of a second. Examples of minimally invasive electroporation devices and their methods of use are described in published U.S. Patent Application No. 2008 / 0234655, U.S. Patent No. 6,520,950, U.S. Patent No. 7,171,264, U.S. Patent No. 6,208,893, U.S. Patent No. 6,009,347, U.S. Patent No. 6,120,493, U.S. Patent No. 7,245,963, U.S. Patent No. 7,328,064, and U.S. Patent No. 6,763,264, the contents of each of which are incorporated herein by reference. The MID can include an injector that creates a high-velocity jet of liquid that painlessly penetrates tissue. Such needle-free injectors are commercially available. Examples of needle-free injectors that may be utilized herein include those described in U.S. Patent Nos. 3,805,783, 4,447,223, 5,505,697, and 4,342,310, the contents of each of which are incorporated herein by reference.

[0065] The desired composition in a form suitable for direct or indirect electrotransport may be introduced (e.g., injected) into the tissue to be treated using a needleless syringe, typically by contacting the tissue surface with the syringe and actuating delivery of a jet of agent, actuated with sufficient force to cause the composition to penetrate the tissue. For example, if the tissue to be treated is a mucosa, skin, or muscle, the agent is jetted toward the mucosa or skin surface with sufficient force to cause the agent to penetrate the stratum corneum and penetrate into the dermis layer, or into the underlying tissue and muscle, respectively.

[0066] Needleless injectors are well suited for delivering compositions to any type of tissue, particularly skin and mucous membranes.In some embodiments, needleless injectors can be used to propel the liquid containing the composition to the surface and into the skin or mucous membrane of a subject.Representative examples of different types of tissues that can be treated using the methods disclosed herein include pancreas, larynx, nasopharynx, hypopharynx, oropharynx, lips, larynx, lung, heart, kidney, muscle, breast, colon, prostate, thymus, testis, skin, mucosal tissue, ovary, blood vessel, or any combination thereof.

[0067] The MID may have needle electrodes that electroporate tissue. For example, applying pulses between multiple pairs of electrode arrays, set in a rectangular or square pattern, provides improved results over applying pulses between a pair of electrodes. US Patent No. 5,702,359, entitled "Needle Electrodes for Mediated Delivery of Drugs and Genes," discloses a needle array in which multiple pairs of needles can apply pulses during a treatment regimen. In that application, which is incorporated herein by reference as fully set forth, the needles are arranged in a circular array, but have connectors and switching devices that allow for applying pulses between opposing pairs of needle electrodes. A pair of needle electrodes for delivering recombinant expression vectors to cells may also be used. Such devices and systems are described in US Patent No. 6,763,264, the contents of which are incorporated herein by reference. Alternatively, a single needle device may be used that allows injection and electroporation of DNA through a single needle similar to a normal injection needle, and applies pulses of lower voltage than those delivered by currently used devices, reducing the electric sensation experienced by the patient.

[0068] The MID may include one or more electrode arrays. The array may include two or more needles of the same or different diameters. The needles may be evenly or unevenly spaced. The needles may be between 0.005 inches and 0.03 inches, 0.01 inches and 0.025 inches, or 0.015 inches and 0.020 inches. The needles may be 0.0175 inches in diameter. The needles may be spaced 0.5 mm, 1.0 mm, 1.5 mm, 2.0 mm, 2.5 mm, 3.0 mm, 3.5 mm, 4.0 mm, or more apart.

[0069] The MID may consist of a pulse generator and a composition injector with two or more needles that deliver the composition and electroporation pulses in a single step. The pulse generator may allow flexible programming of pulse and injection parameters via a flash card operated personal computer, as well as comprehensive recording and storage of electroporation and patient data. The pulse generator may deliver pulses of various voltages for a short period of time. For example, the pulse generator may deliver three 15 volt pulses of 100 ms duration. An example of such a MID is the ELGEN1000 system described in U.S. Patent No. 7,328,064, the contents of which are incorporated herein by reference.

[0070] The MID may be a CELLECTRA (INOVIO Pharmaceuticals) device and system, which is a modular electrode system that facilitates the introduction of macromolecules such as DNA into cells of selected tissues of the body or plant. The modular electrode system may include a plurality of needle electrodes, a hypodermic needle, an electrical connector that provides a conductive link from a programmable constant current pulse controller to the plurality of needle electrodes, and a power source. An operator may grasp the plurality of needle electrodes attached to a support structure and firmly insert them into selected tissues within the body or plant. The macromolecule is then delivered to the selected tissue via the hypodermic needle. A programmable constant current pulse controller is activated and a constant current electrical pulse is applied to the plurality of needle electrodes. The applied constant current electrical pulse facilitates the introduction of the macromolecule into cells between the plurality of electrodes. Cell death due to overheating of the cells is minimized by limiting power dissipation in the tissue by the constant current pulse. The Cellectra device and system are described in U.S. Pat. No. 7,245,963, the contents of which are incorporated herein by reference. The MID may be an ELGEN1000 system (INOVIO Pharmaceuticals). The ELGEN1000 system may comprise a device providing a hollow needle and a fluid delivery means, the device being adapted to activate the fluid delivery means in use to inject a fluid, which is a composition described herein, into the body tissue simultaneously (e.g., automatically) during the insertion of the needle into the body tissue. The advantage is that the ability to gradually inject the fluid while the needle is being inserted leads to a more uniform distribution of the fluid through the body tissue. It is also believed that the pain experienced during injection is reduced due to the distribution of the volume of the fluid injected over a larger area.

[0071] Furthermore, the automatic injection of fluid facilitates automatic monitoring and registration of the actual dose of fluid injected. This data can be stored by the control unit for documentation purposes if desired.

[0072] It should be understood that the injection rate can be either linear or non-linear, and the injection can be performed after the needles are inserted through the skin of the subject to be treated and while they are further inserted into body tissue, such as tumor tissue, skin tissue, liver tissue, and muscle tissue.

[0073] The device further comprises needle insertion means for guiding the insertion of the needle into the body tissue. The rate of fluid injection is controlled by the rate of needle insertion. This has the advantage that both needle insertion and fluid injection can be controlled, so that the insertion rate can be adapted to the injection rate as required. It also makes it easier for the user to operate the device. If required, means can be provided for automatically inserting the needle into the body tissue.

[0074] The user can choose when to start the injection of the fluid. Ideally, however, the injection starts when the tip of the needle reaches the muscle tissue, and the device may include means for sensing when the needle is inserted deep enough to start the injection of the fluid. This means that the device can be prompted to automatically start the injection of the fluid when the needle reaches a desired depth (usually the depth where the muscle tissue begins). The depth where the muscle tissue begins can be a preset needle insertion depth, such as a value of 4 mm, which is considered sufficient for the needle to pass through the skin layer.

[0075] The sensing means may include an ultrasonic probe. The sensing means may include means for sensing changes in impedance or resistance. In this case, the means may not be adapted to record the depth of the needle in the body tissue, but rather to sense changes in impedance or resistance as the needle moves through different types of body tissue and into the muscle. Either of these alternative means provides a relatively accurate and easy to operate means of sensing that injection may commence. The depth of needle insertion may be further recorded if required and used to control the injection of the fluid such that the amount of fluid injected is determined as the depth of needle insertion is recorded.

[0076] The device may further comprise a base for supporting the needle and a housing for receiving the base therein, the base being movable relative to the housing such that the needle is stored within the housing when the base is in a first rearward position relative to the housing and the needle extends from the housing when the base is in a second forward position within the housing. This is advantageous for a user as the housing can be lined up on a patient's skin and then the needle can be inserted into the patient's skin by moving the housing relative to the base.

[0077] As mentioned above, it is desirable to achieve a controlled rate of fluid injection so that the fluid is evenly distributed over the length of the needle as it is inserted into the skin. The fluid delivery means may include a piston drive means adapted to inject the fluid at a controlled rate. The piston drive means may be actuated, for example, by a servo motor. However, the piston drive means may be actuated by axial movement of the base relative to the housing. It will be appreciated that alternative means for fluid delivery may be provided. Thus, for example, a closed container that can be squeezed for fluid delivery at a controlled or uncontrolled rate may be provided instead of a syringe and piston system.

[0078] The above-mentioned device can be used for any type of injection. However, it is envisaged to be particularly useful in the field of electroporation, and therefore can further comprise a means for applying a voltage to the needle. This allows the needle to be used not only for injection, but also as an electrode during electroporation. This is particularly advantageous as it means that the electric field is applied to the same area as the injected fluid. Traditionally, electroporation has had the problem that it is very difficult to precisely align the electrode with the previously injected fluid, and therefore users have tended to inject a larger volume of fluid than is required over a larger area, and to apply the electric field over a higher area to try to ensure an overlap between the injected material and the electric field. As described herein, both the volume of the injected fluid and the size of the applied electric field can be reduced while still achieving a good match between the electric field and the fluid.

[0079] Regardless of the method used to introduce exogenous nucleic acid into a host cell, various assays can be performed to confirm the presence of the recombinant nucleic acid sequence in the host cell. Such assays include "molecular biological" assays well known to those of skill in the art, such as Southern and Northern blotting, RT-PCR and PCR, "biochemical" assays, such as detecting the presence or absence of a particular peptide by immunological means (ELISA and Western blot), or other assays well known to those of skill in the art.

[0080] Disease Conditions and Treatment Methods Certain embodiments of the present disclosure provide methods of treating a disease or disorder, such as associated with PTC, in a mammal (such as a human), comprising administering to the mammal a vector encoding a therapeutic agent (e.g., a tRNA, such as ACE-tRNA) described herein. Certain embodiments of the present disclosure provide the use of a therapeutic agent or a vector encoding a therapeutic agent described herein for the preparation of a medicament useful for treating a disease in a mammal.

[0081] Diseases or disorders associated with PTCs include, but are not limited to, Duchenne muscular dystrophy and Becker muscular dystrophy variants caused by PTCs of dystrophin, retinoblastoma caused by PTCs of RBI, neurofibromatosis caused by PTCs of NF1 or NF2, ataxia telangiectasia caused by PTCs of ATM, Tay-Sachs disease caused by PTCs of HEXA, cystic fibrosis caused by PTCs of CFTR, Wilms tumor caused by PTCs of WT1, hemophilia A caused by PTCs of factor VIII, hemophilia B caused by PTCs of factor IX, p53-related cancers caused by PTCs of p53, Menkes disease, Ullrich disease, β-thalassemia caused by PTCs of beta-globin, Willebrand factor von Willebrand disease types 2A and 3 due to PTC of IFNGR1, Robinow syndrome, brachydactyly type B (shortened fingers and metacarpals), genetic susceptibility to mycobacterial infections due to PTC of IFNGR1, hereditary retinal disease due to PTC of CRX, hereditary bleeding tendency due to PTC of coagulation factor X, hereditary blindness due to PTC of rhodopsin, congenital sensorineural deafness and enteric ganglion cell deficiency due to PTC of SOX10, and hereditary neurodevelopmental disorders including sensorineural deafness, enteric ganglion cell deficiency, peripheral neuropathy, and central hypomyelination due to PTC of SOX10, Liddle syndrome, xeroderma pigmentosum, Fanconi anemia, anemia, hypothyroidism, p53-related cancers (e.g., p53 squamous cell carcinoma) cell carcinoma), p53 hepatocellular carcinoma, p53 ovarian cancer), esophageal cancer, bone cancer, ovarian cancer, hepatocellular carcinoma, breast cancer, hepatocellular carcinoma, fibrous histiocytoma, ovarian cancer, SRY sex reversal, triosephosphate isomerase anemia, diabetes mellitus, and rickets. In one embodiment, the present disclosure includes compositions and methods for treating cystic fibrosis by reversing the effects of an existing mutation associated with a nonsense mutation by introduction of a tRNA of the present disclosure. Additional disorders include Hurler syndrome, Dravet syndrome, spinal muscular dystrophy, Usher syndrome, aniridia, congenital choroideremia, ophthalmic coloboma, retinitis pigmentosa, dystrophic epidermolysis bullosa, pseudoxanthoma elasticum, Alagille syndrome, Waardenburg-Scher syndrome, childhood neuronal ceroid lipofuscinosis, cystinosis, X-linked nephrogenic diabetes insipidus, and polycystic kidney disease.

[0082] Diseases or disorders associated with PTC that can be treated by the molecules and methods described herein also include several eye diseases. Examples of diseases and genes with specific mutations include: Cone dystrophies (Stargardt disease (STGD1), cone-rod dystrophy, retinitis pigmentosa (RP), and increased susceptibility to age-related macular degeneration): KCNV2 Glu143X; KCNV2 Glu306X; KCNV2 Gln76X; KCNV2 Glu148X; CACNA2D4; Tyr802X; CACNA2D4; Arg628X; RP2, Arg120X; Rho, Ser334X; Rpe65, Arg44X; PDE6A, and Lys455X; Congenital stationary night blindness 2 (CSNB2): CACNA1F, Arg958X; CACNA1F, and Arg830X; Congenital stationary night blindness 1 (CSNB1): TRPM1, Gln11X; TRPM1, Lys294X; TRPM1, Arg977X; TRPM1, Ser882X; NYX, and W350X; Best disease or BVMD, BEST1, Tyr29X; BEST1, Arg200X; BEST1, and Ser517X; Leber congenital amaurosis (LCA): KCNJ13, Trp53X; KCNJ13, Arg166X; CEP290, Arg151X; CEP290, Gly1890X; CEP290, Lys1575X; CEP290, Arg1271X; CEP290, Arg1782X; CRB1, Cys1332X; GUCY2D, Ser448X; GUCY2D, Arg41091X; LCA5, Gln279X; RDH12, Tyr194X; RDH12, Glu275X; SPATA7, Arg108X; TULP1, and Gln301X; Usher syndrome 1: USH1C, Arg31X; PCDH15, Arg3X; PCDH15, Arg245X; PCDH15, Arg643X; PCDH15, Arg929X; IQCB1, Arg461X; IQCB1, Arg489X; PDE6A, Gln69X; ALMS1, Ser999X; ALMS1, Arg3804X; Aniridia: Pax6 adn Gly194X; Ocular coloboma: Pax2 and Arg139X; Lamb1, Arg524X; Congenital choroideremia: REP1 and Gln32X.

[0083] According to one aspect, a cell expression system for expressing a therapeutic agent in a mammalian recipient is provided. The expression system (also referred to herein as a "genetically modified cell") comprises a cell and an expression vector for expressing a therapeutic agent. Expression vectors include, but are not limited to, viruses, plasmids, and other vehicles for delivering heterologous genetic material to cells. Thus, the term "expression vector" as used herein refers to a vehicle for delivering heterologous genetic material to cells. Specifically, the expression vector may be a CEDT or MC mini vector as described in WO2021 / 252354. Other examples of expression vectors include recombinant adenovirus, adeno-associated virus, or lentivirus or retrovirus vectors.

[0084] The expression vector further comprises a promoter for controlling the transcription of the heterologous gene. The promoter may be an inducible promoter. The expression system is suitable for administration to a mammalian recipient. The expression system may comprise a plurality of non-immortalized genetically modified cells, each cell containing at least one gene encoding at least one therapeutic agent.

[0085] The cell expression system can be formed in vivo. According to yet another aspect, a method for treating a mammalian recipient in vivo is provided. The method includes introducing an expression vector for expressing a heterologous gene product into the patient's cells in situ, such as via intravenous administration. To form the expression system in vivo, an expression vector for expressing a therapeutic agent is introduced into the mammalian recipient vein in vivo.

[0086] According to yet another aspect, a method for treating a mammalian recipient in vivo is provided. The method includes introducing a targeted therapeutic agent into a patient in vivo. The expression vector for expressing a heterologous gene may include an inducible promoter for controlling the transcription of the heterologous gene product. Thus, the in situ delivery of the therapeutic agent is controlled by exposing the cells to conditions that induce the transcription of the heterologous gene in situ.

[0087] The present disclosure provides methods for treating a disease in a subject (e.g., a mammal) by administering to a cell or patient an expression vector encoding a tRNA, e.g., an ACE-tRNA. With respect to gene therapy methods, one skilled in the art of molecular biology and gene therapy will be able to determine, without undue experimentation, the appropriate dose and route of administration of the expression vector used in the novel methods of the present disclosure.

[0088] In certain embodiments, the agents and methods described herein can be used to treat / manage diseases such as those caused by PTC, including, but not limited to, Duchenne and Becker muscular dystrophy, retinoblastoma, neurofibroma, ataxia telangiectasia, Tay-Sachs disease, cystic fibrosis, Wilms' tumor, hemophilia A, hemophilia B, Menkes disease, Ullrich's disease, β-thalassemia, von Willebrand disease types 2A and 3, Robinow syndrome, brachydactyly type B (shortened fingers and metacarpals), genetic susceptibility to mycobacterial infections, inherited retinal diseases, inherited bleeding tendencies, hereditary blindness, congenital sensorineural hearing loss, and intestinal nerve disorders. These include hereditary neurodevelopmental disorders including dysganglionosis, sensorineural hearing loss, intestinal dysganglionosis, peripheral neuropathy and central dysmyelination, Liddle syndrome, xeroderma pigmentosum, Fanconi anemia, anemia, hypothyroidism, p53-related cancers (e.g., p53 squamous cell carcinoma, p53 hepatocellular carcinoma, p53 ovarian cancer), esophageal cancer, bone cancer, ovarian cancer, hepatocellular carcinoma, breast cancer, hepatocellular carcinoma, fibrous histiocytoma, ovarian cancer, SRY sex reversal, triosephosphate isomerase anemia, diabetes mellitus and rickets. This therapy is advantageous in that it provides improved stop codon suppression specificity. In some embodiments, the therapeutic tRNAs of the present disclosure can target a specific stop codon, e.g., TGA, thus reducing off-target effects at stop codons unrelated to the disease. This therapy is also advantageous in that it provides amino acid specificity. In some embodiments, the expressed tRNA can be engineered to specifically replace the amino acid lost through the insertion of a disease stop codon, thus negating any spurious effects on protein stability, folding and trafficking.

[0089] In certain embodiments, the system is modular and therefore can be "personalized" for any possible disease, such as PTC disease. For example, there are nine individual tryptophan tRNAs recognized by Trp synthase in the human genome, all of which suppress the mRNA UGG codon. Thus, each of these nine Trp tRNAs offers an opportunity for codon re-editing resistance (UGG → UGA). Furthermore, given their proximity to the stop codon in the genetic code, mutations of arginine codons to PTC nonsense codons are common in diseases. There are more than 30 Arg tRNAs that can be tested for codon editing resistance and suppression efficacy. And tRNAs that code for arginine are viable therapeutics for all Arg->PTC mutations, regardless of gene. In fact, 35% of LCAs are caused by nonsense mutations, and the majority of them stop at arginine. A further advantage of the present disclosure is that the entire system (tRNA + promoter sequence) is compact, providing easy expression and cell-specific delivery.

[0090] formulation Once the cassette, vector, or other form of therapeutic agent produced according to the present disclosure has been produced and purified in sufficient quantity, the process of the present disclosure may further include its formulation, for example, as a therapeutic DNA composition. Therapeutic DNA compositions include therapeutic DNA molecules encoding tRNAs as provided herein. Such compositions may include a therapeutically effective amount of DNA in a form suitable for administration by a desired route, for example, an aerosol, an injectable composition, or a formulation suitable for oral, mucosal, or topical administration. Formulation of DNA as a conventional pharmaceutical preparation may be performed using standard pharmaceutical formulation chemistry and methodology available to those skilled in the art.

[0091] Any pharma- ceutically acceptable carrier or excipient may be used. Auxiliary substances such as wetting or emulsifying agents, pH buffering substances, etc. may be present in the excipient or vehicle. These excipients, vehicles and auxiliary substances are generally pharmaceuticals that can be administered without undue toxicity and, in the case of vaccine compositions, do not induce an immune response in the individual receiving the composition. A suitable carrier may be liposomes.

[0092] Pharmaceutically acceptable excipients include, but are not limited to, liquids such as water, saline, polyethylene glycol, hyaluronic acid, glycerol, and ethanol. Pharmaceutically acceptable salts can also be included, for example, inorganic acid salts such as hydrochloride, hydrobromide, phosphate, sulfate, and organic acid salts such as acetate, propionate, malonate, benzoate. It is also preferred, but not required, that the preparation can contain a pharma-ceutically acceptable excipient as a stabilizer, particularly for peptides, proteins, or other similar molecules, if the composition includes them. Examples of suitable carriers that also function as stabilizers for peptides include, but are not limited to, pharmaceutical grades of dextrose, sucrose, lactose, trehalose, mannitol, sorbitol, inositol, dextran, and the like. Other suitable carriers include, but are not limited to, starch, cellulose, sodium or calcium phosphate, citric acid, tartaric acid, glycine, high molecular weight polyethylene glycol (PEG), and combinations thereof. A thorough discussion of pharma- ceutically acceptable excipients, vehicles and auxiliary substances is provided in REMINGTON'S PHARMACEUTICAL SCIENCES (Mack Pub. Co., NJ 1991), which is incorporated herein by reference.

[0093] The agents (e.g., nucleic acids, expression cassettes, or expression vectors) of the present disclosure can be administered to provide relief of at least one symptom associated with a disease (e.g., a genetic disease such as cystic fibrosis). The dosage will vary depending on a variety of factors, including but not limited to the selected composition, the particular disease, the weight, physical condition, and age of the subject, and whether prevention or treatment is achieved. Such factors can be readily determined by a clinician using animal models or other test systems well known in the art.

[0094] The present disclosure contemplates treating a disease or disorder by administration of an agent, such as a tRNA or expression vector disclosed in the present disclosure. Administration of a therapeutic agent according to the present disclosure may be continuous or intermittent, depending, for example, on the physiological condition of the recipient, whether the purpose of administration is therapeutic or prophylactic, and other factors known to those skilled in the art. Administration of an agent of the present disclosure may be essentially continuous over a preselected period of time, or may be in a series of spaced doses. Both local and systemic administration are contemplated.

[0095] One or more suitable unit dosage forms having a therapeutic agent of the present disclosure, which may optionally be formulated for sustained release (e.g., using microencapsulation), as discussed below, may be administered by a variety of routes, including parenterally, including intravenous and intramuscular routes, as well as by direct injection into diseased tissue. The formulations may, where appropriate, be conveniently provided in discrete unit dosage forms and may be prepared by any of the methods well known in the art of pharmacy. Such methods may include the step of bringing the therapeutic agent into association with a liquid carrier, a solid matrix, a semi-solid carrier, a finely divided solid carrier, or a combination thereof, and then, where appropriate, incorporating or shaping the product into the desired delivery system.

[0096] When the therapeutic agents of the present disclosure are prepared for administration, they may be combined with a pharma- ceutically acceptable carrier, diluent, or excipient to form a pharmaceutical formulation, or unit dosage form. The total active ingredient in such a formulation comprises 0.1-99.9% by weight of the formulation. A pharma- ceutically acceptable carrier may be a carrier, diluent, excipient, and / or salt that is compatible with the other ingredients of the formulation and is not deleterious to the recipient thereof. The active ingredient for administration may be present as a powder or granules, as a solution, suspension, or emulsion.

[0097] The pharmaceutical formulation containing the therapeutic agent of the present disclosure can be prepared by procedures known in the art using well-known and easily available ingredients.The therapeutic agent of the present disclosure can also be formulated as a solution suitable for parenteral administration, for example, by intramuscular, subcutaneous or intravenous route.The pharmaceutical formulation of the therapeutic agent of the present disclosure can also take the form of an aqueous or anhydrous solution or dispersion, or alternatively the form of an emulsion or suspension.

[0098] Thus, the therapeutic agent may be formulated for parenteral administration (e.g., by injection, e.g., bolus injection or continuous infusion), and may be provided in unit dose form in ampoules, prefilled syringes, small volume infusion containers, or in multi-dose containers with added preservatives. The active ingredient may take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing, and / or dispersing agents. Alternatively, the active ingredient may be in powder form, obtained by aseptic isolation of a sterile solid or by lyophilization from solution, for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.

[0099] It is to be understood that the unit content of active ingredient(s) contained in an individual aerosol dose of each dosage form need not itself constitute an effective amount for treating a particular indication or disease, since the required effective amount may be achieved by administration of multiple dosage units. Moreover, an effective amount may be achieved either individually or in a series of administrations using subdoses in the dosage form.

[0100] The pharmaceutical formulations of the present disclosure may contain, as optional ingredients, pharma- ceutically acceptable carriers, diluents, solubilizers or emulsifiers, and salts of the type well known in the art. Specific, non-limiting examples of carriers and / or diluents useful in the pharmaceutical formulations of the present disclosure include water and physiologically acceptable buffered saline solutions, such as phosphate buffered saline pH 7.0-8.0 and water.

[0101] Nanoparticle Composition In some embodiments, the pharmaceutical compositions disclosed herein are formulated as lipid nanoparticles (LNPs), such as those described in WO2020 / 263883, WO2013 / 123523, WO2012 / 170930, WO2011 / 127255 and WO2008 / 103276; and US2013 / 0171646, each of which is incorporated herein by reference in its entirety. Thus, the present disclosure provides a nanoparticle composition comprising (i) a lipid composition comprising a delivery agent, and (ii) at least one nucleic acid, such as a DNA encoding RNA or tRNA, e.g., a cassette or vector. In such nanoparticle compositions, the lipid composition disclosed herein can encapsulate the nucleic acid.

[0102] Nanoparticle compositions are typically submicrometer size and can include lipid bilayers. Nanoparticle compositions include lipid nanoparticles (LNPs), liposomes (e.g., lipid vesicles), and lipoplexes. For example, nanoparticle compositions can be liposomes with lipid bilayers with diameters of 500 nm or less.

[0103] Nanoparticle compositions include, for example, lipid nanoparticles, liposomes, and lipoplexes. In some embodiments, the nanoparticle composition is a vesicle comprising one or more lipid bilayers. In certain embodiments, the nanoparticle composition comprises two or more concentric bilayers separated by aqueous compartments. The lipid bilayers may be functionalized and / or crosslinked to each other. The lipid bilayers may comprise one or more ligands, proteins, or channels.

[0104] In one embodiment, the lipid nanoparticle comprises an ionized lipid, a structured lipid, a phospholipid, and a nucleic acid of interest. In some embodiments, the LNP comprises an ionized lipid, a PEG-modified lipid, a sterol, and a structured lipid. In some embodiments, the LNP has a molar ratio of about 20-60% ionized lipid, about 5-25% structured lipid, about 25-55% sterol, and about 0.5-15% PEG-modified lipid.

[0105] In some embodiments, the LNPs have a polydispersity value of less than 0.4. In some embodiments, the LNPs have a net neutral charge at neutral pH. In some embodiments, the LNPs have an average diameter of 50-150 nm. In some embodiments, the LNPs have an average diameter of 80-100 nm.

[0106] As generally defined herein, the term "lipid" refers to a small molecule with hydrophobic or amphiphilic properties. Lipids can be naturally occurring or synthetic. Examples of lipid classes include, but are not limited to, fats, waxes, sterol-containing metabolites, vitamins, fatty acids, glycerolipids, glycerophospholipids, sphingolipids, glycolipids, and polyketides, and prenol lipids. In some cases, the amphiphilic properties of some lipids allow them to form liposomes, vesicles, or membranes in aqueous media.

[0107] In some embodiments, the lipid nanoparticles may include ionized lipids. As used herein, the term "ionized lipid" has its usual meaning in the art and may refer to lipids that include one or more charged moieties. In some embodiments, the ionized lipid may be positively or negatively charged. The ionized lipid may be positively charged, in which case it may be referred to as a "cationic lipid". In certain embodiments, the ionized lipid molecule may include an amine group and may be referred to as an ionized amino lipid. As used herein, a "charged moiety" is a chemical moiety that has a formal electronic charge, for example, monovalent (+1 or -1), divalent (+2 or -2), trivalent (+3 or -3), etc. The charged moiety may be anionic (i.e., negatively charged) or cationic (i.e., positively charged). Examples of positively charged moieties include amine groups (e.g., primary, secondary, and / or tertiary amines), ammonium groups, pyridinium groups, guanidine groups, and imidizolium groups. In certain embodiments, the charged moiety can include an amine group. Examples of negatively charged groups or precursors thereof include carboxylate groups, sulfonate groups, sulfate groups, phosphonate groups, phosphate groups, hydroxyl groups, etc. The charge of the charged moiety can in some cases be changed by environmental conditions, for example, a change in pH can change the charge of the moiety and / or make the moiety charged or uncharged. In general, the charge density of the molecule can be selected as desired.

[0108] In some embodiments, the ionizable lipid is an ionizable amino lipid, sometimes referred to as an "ionizable cationic lipid", and in one embodiment, the ionizable amino lipid may have a positively charged hydrophilic head and a hydrophobic tail connected via a linker structure. In addition, the ionizable lipid may also be a lipid containing a cyclic amine group. In one embodiment, the ionizable lipid may be selected from, but is not limited to, the ionizable lipids described in WO2013 / 086354 and WO2013 / 116126, the contents of each of which are incorporated herein by reference in their entirety. In yet another embodiment, the ionizable lipid may be selected from, but is not limited to, the formula CLI-CLXXXXII of U.S. Patent No. 7,404,969, each of which is incorporated herein by reference in its entirety.

[0109] In one embodiment, the lipid may be a cleavable lipid as described in WO2012 / 170889, which is incorporated by reference in its entirety. In one embodiment, the lipid may be synthesized by methods known in the art and / or methods described in WO2013 / 086354, the contents of each of which are incorporated by reference in their entirety.

[0110] Nanoparticle compositions can be characterized by various methods. For example, microscopy (e.g., transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of nanoparticle compositions. Dynamic light scattering or potentiometry (e.g., potentiometric titration) can be used to measure zeta potential. Dynamic light scattering can also be used to determine particle size. Instruments such as the Zetasizer Nano ZS (Malvern Instruments Ltd, Malvern, Worcestershire, UK) can also be used to measure multiple properties of nanoparticle compositions, such as particle size, polydispersity index, and zeta potential. The size of nanoparticles can help combat biological responses, such as, but not limited to, inflammation, or increase the biological effect of polynucleotides. As used herein, "size" or "average size" in the context of nanoparticle compositions refers to the average diameter of the nanoparticles.

[0111] In one embodiment, the nucleic acids described herein can be formulated in lipid nanoparticles having a diameter of about 10 to about 100 nm. In one embodiment, the nanoparticles have a diameter of about 10 to 500 nm. In one embodiment, the nanoparticles have a diameter greater than 100 nm. In some embodiments, the maximum dimension of the nanoparticle composition is 1 μm or less (e.g., 1 μm, 900 nm, 800 nm, 700 nm, 600 nm, 500 nm, 400 nm, 300 nm, 200 nm, 175 nm, 150 nm, 125 nm, 100 nm, 75 nm, 50 nm, or less).

[0112] The nanoparticle composition may be relatively homogeneous. The polydispersity index may be used to indicate the homogeneity of the nanoparticle composition, e.g., the particle size distribution of the nanoparticle composition. A small (e.g., less than 0.3) polydispersity index generally indicates a narrow particle size distribution. The nanoparticle composition may have a polydispersity index of about 0 to about 0.25, e.g., 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of the nanoparticle composition disclosed herein may be about 0.10 to about 0.20.

[0113] The zeta potential of a nanoparticle composition can be used to indicate the electrokinetic potential of the composition. For example, the zeta potential can describe the surface charge of the nanoparticle composition. Nanoparticle compositions with a relatively low positive or negative charge are generally desirable, since more highly charged species can cause undesirable interactions with cells, tissues, and other elements in the body. In some embodiments, the zeta potential of the nanoparticle compositions disclosed herein can be about -10 mV to about +20 mV, about -10 mV to about +15 mV, about 10 mV to about +10 mV, about -10 mV to about +5 mV, about -10 mV to about 0 mV, about -10 mV to about -5 mV, about -5 mV to about +20 mV, about -5 mV to about +15 mV, about -5 mV to about +10 mV, about -5 mV to about +5 mV, about -5 mV to about 0 mV, about 0 mV to about +20 mV, about 0 mV to about +15 mV, about 0 mV to about +10 mV, about 0 mV to about +5 mV, about +5 mV to about +20 mV, about +5 mV to about +15 mV, or about +5 mV to about +10 mV.

[0114] The term "encapsulation efficiency" of nucleic acid / polynucleotide describes the amount of nucleic acid / polynucleotide encapsulated by or otherwise associated with a nanoparticle composition after preparation, compared to the initial amount provided. As used herein, "encapsulation" can refer to complete, substantial, or partial enclosure, confinement, surrounding, or envelopment. It is desirable for the encapsulation efficiency to be high (e.g., approaching 100%). The encapsulation efficiency can be measured, for example, by comparing the amount of nucleic acid / polynucleotide in a solution containing the nanoparticle composition before and after dissolving the nanoparticle composition with one or more organic solvents or detergents.

[0115] Fluorescence can be used to measure the amount of free polynucleotide in solution. For the nanoparticle compositions described herein, the encapsulation efficiency of the nucleic acid / polynucleotide can be at least 50%, for example, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency can be at least 80%. In certain embodiments, the encapsulation efficiency can be at least 90%.

[0116] The amount of nucleic acid / polynucleotide present in the pharmaceutical composition disclosed herein may depend on multiple factors, such as the size of the nucleic acid / polynucleotide, the desired target and / or application, or other properties of the nanoparticle composition, as well as the properties of the nucleic acid / polynucleotide. For example, the amount of nucleic acid / polynucleotide useful in a nanoparticle composition may depend on the size (expressed as length or molecular weight), sequence, and other characteristics of the nucleic acid / polynucleotide. The relative amount of nucleic acid / polynucleotide in the nanoparticle composition may also vary. The relative amounts of lipid composition and nucleic acid / polynucleotide present in the lipid nanoparticle composition of the present disclosure may be optimized according to efficacy and tolerability considerations.

[0117] In addition to providing nanoparticle compositions, the present disclosure also provides methods of producing lipid nanoparticles comprising encapsulating a polynucleotide, such methods comprising using any of the pharmaceutical compositions disclosed herein and producing lipid nanoparticles according to methods of producing lipid nanoparticles known in the art. See, e.g., Wang et al. (2015) "Delivery of oligonucleotides with lipid nanoparticles" Adv. Drug Deliv. Rev. 87:68-80; Silva et al. (2015) "Delivery Systems for Biopharmaceuticals. Part I: Nanoparticles and Microparticles" Curr. Pharm. Technol. 16:940-954; Naseri et al. (2015) "Solid Lipid Nanoparticles and Nanostructured Lipid Carriers: Structure, Preparation and Application" Adv. Pharm. Bull. 5:305-13; Silva et al. (2015) "Lipid nanoparticles for the delivery of biopharmaceuticals" Curr. Pharm. Biotechnol. 16:291-302, and references cited therein.

[0118] Lipid nanoparticle formulations typically include one or more lipids. In some embodiments, the lipid is an ionizable lipid (e.g., an ionizable amino lipid), which is also referred to in the art as an "ionizable cationic lipid". In some embodiments, the lipid nanoparticle formulation further includes other components, including phospholipids, structural lipids, molecules that can reduce particle aggregation, such as PEG or PEG-modified lipids.

[0119] Exemplary ionizable lipids include any one of compounds 1-342 disclosed herein, DLin-MC 3 -DMA(MC 3)、DLin-DMA、DLenDMA、DLin-D-DMA、DLin-K-DMA、DLin-M-C2-DMA、DLin-K-DMA、DLin-KC2-DMA、DLin-KC 3 -DMA、DLin-KC4-DMA、DLin-C2K-DMA、DLin-MP-DMA、DODMA、98N12-5、C 12-200, DLin-C-DAP, DLin-DAC, DLinDAP, DLinAP, DLin-EG-DMA, DLin-2-DMAP, KL10, KL22, KL25, Octyl-CLinDMA, Octyl-CLinDMA(2R), Octyl-CLinDMA(2S), and any combination thereof. Other exemplary ionizable lipids include (13Z,16Z)-N,N-dimethyl-3-nonyldocosa-13,16-dien-1-amine (L608), (20Z,23Z)-N,N-dimethylnonacosa-20,23-dien-10-amine, (17Z,20Z)-N,N-dimethylhexacosa-17,20-dien-9-amine, (16Z,19Z)-N5N-dimethylpentacosa-16,19-dien-8-amine, (13Z,16Z)-N,N-dimethyldocosa -13,16-dien-5-amine, (12Z,15Z)-N,N-dimethylhenicosa-12,15-dien-4-amine, (14Z,17Z)-N,N-dimethyltricosa-14,17-dien-6-amine, (15Z,18Z)-N,N-dimethyltetracosa-15,18-dien-7-amine, (18Z,21Z)-N,N-dimethylheptacosa-18,21-dien-10-amine, (15Z,18Z)-N,N-dimethyltetracosa-15,18-dien-5 -amine, (14Z,17Z)-N,N-dimethyltricosa-14,17-dien-4-amine, (19Z,22Z)-N,N-dimethyloctacosa-19,22-dien-9-amine, (18Z,21Z)-N,N-dimethylheptacosa-18,21-dien-8-amine, (17Z,20Z)-N,N-dimethylhexacosa-17,20-dien-7-amine, (16Z,19Z)-N,N-dimethylpentacosa-16,19-dien-6-amine, (22Z,2 5Z)-N,N-Dimethylheptacosa-22,25-dien-10-amine, (21Z,24Z)-N,N-Dimethyltriaconta-21,24-dien-9-amine, (18Z)-N,N-Dimethylheptacosa-18-en-10-amine, (17Z)-N,N-Dimethylhexacosa-17-en-9-amine, (19Z,22Z)-N,N-Dimethyloctacosa-19,22-dien-7-amine, N,N-Dimethylheptacosa-10-amine, (20Z,23Z)-N-ethyl-N-methylnonacosa-20,23-dien-10-amine, 1-[(11Z,14Z)-l-nonylicosa-11,14-dien-l-yl]pyrrolidine, (20Z)-N,N-dimethylheptacosa-20-en-10-amine, (15Z)-N,N-dimethylheptacosa-15-en-10-amine, (14Z)-N,N-dimethylnonacosa-14-en-10-amine, (17Z)-N,N-dimethylnonacosa-17-en-10-amine, (24Z)-N,N-dimethyltritriacont -24-en-10-amine, (20Z)-N,N-dimethylnonacos-20-en-10-amine, (22Z)-N,N-dimethylhentriacont-22-en-10-amine, (16Z)-N,N-dimethylpentacos-16-en-8-amine, (12Z,15Z)-N,N-dimethyl-2-nonylhenicosa-12,15-dien-1-amine, N,N-dimethyl-l-[(lS,2R)-2-octylcyclopropyl]eptadecan-8-amine, l-[(1S,2R)-2-hexylcyclopropyl]-N,N-dimethylnonadecane -10-amine, N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]nonadecan-10-amine, N,N-dimethyl-21-[(1S,2R)-2-octylcyclopropyl]henicosan-10-amine, N,N-dimethyl-l-[(lS,2S)-2-{[(1R,2R)-2-pentylcyclopropyl]methyl}cyclopropyl]nonadecan-10-amine, N,N-dimethyl-l-[(1S,2R)-2-octylcyclopropyl]hexadecan-8-amine, N,N-dimethyl-[(lR,2S)-2-undec ... N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]tetradecane-5-amine, N,N-dimethyl-3-{7-[(lS,2R)-2-octylcyclopropyl]heptyl}dodecane-1-amine, 1-[(1R,2S)-2-heptylcyclopropyl]-N,N-dimethyloctadecane-9-amine, 1-[(1S,2R)-2-decylcyclopropyl]-N,N-dimethylpentadecan-6-amine, N,N-dimethyl-1-[(lS,2R)-2-octylcyclopropyl]pentadecan-8-amine, N,N-dimethyl-1-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-3-(octyloxy)propan-2-amine, SN,N-dimethyl-1-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-3-(octyloxy)propan-2-amine, 1-{2-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-1-[(octyloxy)methyl]ethyl}pyrrolidine, (2S)-N,N-dimethyl-1-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-3-[(5Z)-oct-5-en-1-yloxy] 1-{2-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-1-[(octyloxy)methyl]ethyl}azetidine, (2S)-1-(hexyloxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-2-amine, (2S)-1-(heptyloxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-2-amine, N,N-dimethyl-1-(nonyloxy)- 3-[(9Z,12Z)-Octadeca-9,12-dien-1-yloxy]propan-2-amine, N,N-dimethyl-1-[(9Z)-octadec-9-en-1-yloxy]-3-(octyloxy)propan-2-amine;(2S)-N,N-dimethyl-1-[(6Z,9Z,12Z)-octadeca-6,9,12-trien-1-yloxy]-3-(octyloxy)propan-2-amine, (2S)-1-[(11Z,14Z)-icosa-11,14-dien-1-yloxy]-N,N-dimethyl-3-(pentyloxy)propan-2-amine )propan-2-amine, (2S)-1-(hexyloxy)-3-[(11Z,14Z)-icosa-11,14-dien-l-yloxy]-N,N-dimethylpropan-2-amine, 1-[(11Z,14Z)-icosa-11,14-dien-l-yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine, 1-[(13Z,16Z)-docosa-13,16-dien-l-yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine, (2S)-1-[(13Z,16Z)-docosa-13,16-dien-1-yloxy]-3-(hexyloxy)-N,N-dimethylpropan-2-amine, (2S)-1-[(13Z)-docos-13-en-1-yloxy]-3-(hexyloxy)-N,N-dimethylpropan-2-amine, 1-[(13Z)-docos-13-en-1-yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine, 1-[(9Z)-hexadec-9-en-1-yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine, (2R)-N,N-dimethyl-H(1-methoyloctyl)oxy]-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-2-amine, (2R)-1-[(3,7-dimethyloctyl)oxy]-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-2-amine, N,N-dimethyl-1-(octyloxy)-3-({8-[(1S,2S)-2-{[(1R,2R)-2-pentylcyclopropyl]methyl}cyclopropyl]octyl}oxy)propan-2-amine, N,N-dimethyl-1-{[8-(2-octylcyclopropyl)octyl]oxy}-3-(octyloxy)propan-2-amine, and (11E,20Z,23Z)-N,N-dimethylnonacosa-11,20,2-trien-10-amine, and any combination thereof.

[0120] Phospholipids include, but are not limited to, glycerophospholipids such as phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidy glycerol, and phosphatidic acid. Phospholipids also include phosphosphingolipids such as sphingomyelin. In some embodiments, the phospholipid is DLPC, DMPC, DOPC, DPPC, DSPC, DUPC, 18:0 diether PC, DLnPC, DAPC, DHAPC, DOPE, 4ME 16:0 PE, DSPE, DLPE, DLnPE, DAPE, DHAPE, DOPG, and any combination thereof. In some embodiments, the phospholipid is MPPC, MSPC, PMPC, PSPC, SMPC, SPPC, DHAPE, DOPG, and any combination thereof. In some embodiments, the amount of phospholipid (e.g., DSPC) in the lipid composition ranges from about 1 mol% to about 20 mol%.

[0121] Structured lipids include sterols and lipids containing sterol moieties. In some embodiments, the structured lipids include cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, α-tocopherol, and mixtures thereof. In some embodiments, the structured lipid is cholesterol. In some embodiments, the amount of structured lipid (e.g., cholesterol) in the lipid composition ranges from about 20 mol% to about 60 mol%.

[0122] PEG-modified lipids include PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (e.g., PEG-CerC 1PEG-CerC4 or PEG-CerC20), PEG-modified dialkylamine, and PEG-modified 1,2-diacyloxypropan-3-amine. Such lipids are also referred to as PEGylated lipids. For example, the PEG lipid can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG DMPE, PEG-DPPC, or PEG-DSPE lipid. In some embodiments, the PEG-lipid is 1,2-dimyristoyl-sn-glycerol methoxypolyethylene glycol (PEG-DMG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)] (PEG-DSPE), PEG-disterylglycerol (PEG-DSG), PEG-dipalmetoleyl, PEG-dioleyl, PEG-distearyl, PEG-diacylglycamide (PEG-DAG), PEG-dipalmitoylphosphatidylethanolamine (PEG-DPPE), or PEG-l,2-dimyristyloxylpropyl-3-amine (PEG-c-DMA). In some embodiments, the PEG moiety has a size of about 1000, 2000, 5000, 10,000, 15,000, or 20,000 daltons. In some embodiments, the amount of PEG-lipid in the lipid composition ranges from about 0 mol% to about 5 mol%.

[0123] In some embodiments, the LNP formulations described herein can further comprise a permeability enhancer molecule. Non-limiting permeability enhancer molecules are described in US2005 / 0222064, which is incorporated herein by reference in its entirety.

[0124] The LNP formulation can further contain a phosphate conjugate. The phosphate conjugate can increase the in vivo circulation time and / or increase the targeted delivery of the nanoparticle. The phosphate conjugate can be made, for example, by the methods described in WO2013 / 033438 or US2013 / 0196948. The LNP formulation can also contain a polymer conjugate (e.g., a water-soluble conjugate), for example, as described in US2013 / 0059360, US2013 / 0196948, and US2013 / 0072709. Each of the references is incorporated herein by reference in its entirety.

[0125] The LNP formulation can include a conjugate to enhance delivery of the nanoparticle in a subject. Furthermore, the conjugate can inhibit phagocytic clearance of the nanoparticle in a subject. In some embodiments, the conjugate can be a "self" peptide designed from the human membrane protein CD47 (e.g., the "self" particle described in Rodriguez et al., Science 2013339, 971-975, which is incorporated herein by reference in its entirety). As shown by Rodriguez et al., the self peptide delayed macrophage-mediated clearance of the nanoparticle, enhancing delivery of the nanoparticle.

[0126] The LNP formulation can include a carbohydrate carrier. By way of non-limiting example, the carbohydrate carrier can include, but is not limited to, anhydro-modified phytoglycogen or glycogen-type materials, phytoglycogen octenyl succinate, phytoglycogen beta dextrin, anhydro-modified phytoglycogen beta dextrin (e.g., WO2012 / 109121, which is incorporated by reference in its entirety).

[0127] LNP formulations can be coated with surfactants or polymers to improve delivery of the particles, in some embodiments, LNPs can be coated with hydrophilic coatings, such as, but not limited to, PEG coatings and / or coatings with a neutral surface charge, as described in US2013 / 0183244, which is incorporated by reference in its entirety.

[0128] LNP formulations can be engineered to alter the surface properties of the particles so that lipid nanoparticles can penetrate mucosal barriers, as described in U.S. Patent No. 8,241,670 or WO 2013 / 110028, each of which is incorporated herein by reference in its entirety. LNPs designed to penetrate mucus can include polymeric materials (i.e., polymer cores) and / or polymer-vitamin conjugates and / or triblock copolymers. Polymeric materials can include, but are not limited to, polyamines, polyethers, polyamides, polyesters, polycarbamates, polyureas, polycarbonates, poly(styrenes), polyimides, polysulfones, polyurethanes, polyacetylenes, polyethylenes, polyethyleneimines, polyisocyanates, polyacrylates, polymethacrylates, polyacrylonitriles, and polyarylates.

[0129] LNPs engineered to penetrate mucus can also include surface altering agents, including, but not limited to, anionic proteins (e.g., bovine serum albumin), surfactants (e.g., cationic surfactants such as dimethyldioctadecyl-ammonium bromide), sugars or sugar derivatives (e.g., cyclodextrins), nucleic acids, polymers (e.g., heparin, polyethylene glycols, and poloxamers), mucolytic agents (e.g., N-acetylcysteine, mugwort, bromelain, papain, clerodendrum, acetylcysteine, bromhexine, carbocysteine, eprazinone, mesna, ambroxol, sobrerol, domiodol, letosteine, stepronin, tiopronin, gelsolin, thymosin b4 dornase alpha, neltenexin, erdosteine), and various DNases, including rhDNase. In some embodiments, the mucus-penetrating LNPs may be hypotonic formulations that include a mucosal-penetration-enhancing coating. The formulation can be hypotonic with respect to the epithelium to which it is being delivered. Non-limiting examples of hypotonic formulations can be found, for example, in WO2013 / 110028, which is incorporated by reference in its entirety.

[0130] In some embodiments, the nucleic acids described herein can be formulated for controlled release and / or targeted delivery. As used herein, "controlled release" refers to a pharmaceutical composition or compound release profile that matches a particular release pattern to produce a therapeutic outcome. In one embodiment, the nucleic acid can be encapsulated in a delivery agent described herein and / or known in the art for controlled release and / or targeted delivery. As used herein, the term "encapsulation" means to surround, encircle, or encase. When referring to the formulation of the nucleic acid of the present disclosure, encapsulation can be substantial, complete, or partial. The term "substantially encapsulated" means that at least 50, 60, 70, 80, 85, 90, 95, 96, 97, 98, 99, or more than 99% of the pharmaceutical composition or compound of the present disclosure can be enclosed, surrounded, or encased within the delivery agent. By "partially encapsulated" it is meant that less than 10, 10, 20, 30, 40 or 50 of a pharmaceutical composition or compound of the present disclosure may be surrounded, surrounded, or encased within the delivery agent.

[0131] In some embodiments, the nucleic acid composition can be formulated for sustained release. As used herein, "sustained release" refers to a pharmaceutical composition or compound that is adapted to a release rate over a certain period of time. The period of time can include, but is not limited to, hours, days, weeks, months, and years. As non-limiting examples, the sustained release nanoparticle compositions described herein can be formulated as disclosed in WO2010 / 075072, US2010 / 0216804, US2011 / 0217377, US2012 / 0201859, and US2013 / 0150295, each of which is incorporated herein by reference in its entirety. In some embodiments, nanoparticle compositions can be formulated to be target specific, such as those described in WO2008 / 121949, WO2010 / 005726, WO2010 / 005725, WO2011 / 084521, WO2011 / 084518, US2010 / 0069426, US2012 / 0004293, and US2010 / 0104655, each of which is incorporated by reference in its entirety.

[0132] Administration The above-described therapeutic agents and compositions can be used to treat, protect against, and / or prevent disease in a subject in need thereof by administering to the subject one or more compositions described herein.

[0133] Such medicaments and compositions can be administered in dosages and by techniques well known to those skilled in the medical arts, taking into consideration factors such as the age, sex, weight, and condition of the particular subject, as well as the route of administration. The dosage of the composition can be 1 μg to 10 mg of active ingredient / kg body weight / dose, and can be 20 μg to 10 mg of ingredient / kg body weight / dose.

[0134] The agent or composition can be administered prophylactically or therapeutically. In therapeutic applications, the agent or composition is administered to a subject in need thereof in an amount sufficient to induce a therapeutic effect. An amount sufficient to accomplish this is defined as a "therapeutically effective dose." Amounts effective for this use will depend, for example, on the particular composition of the administered composition regimen, the method of administration, the stage and severity of the disease, the overall health of the subject, and the judgment of the prescribing physician.

[0135] The agent or composition can be administered by methods well known in the art, such as those described in Donnelly et al. (Ann. Rev. Immunol. 15:617-648 (1997)), U.S. Pat. No. 5,580,859, U.S. Pat. No. 5,703,055, and U.S. Pat. No. 5,679,647, all of which are incorporated herein by reference in their entirety. The nucleic acid, such as DNA, of the composition can be complexed to particles or beads that can be administered to an individual using, for example, a vaccine gun. Those skilled in the art will know that the selection of a pharma- ceutical acceptable carrier, including a physiologically acceptable compound, depends, for example, on the route of administration of the expression vector. The composition can be delivered via a variety of routes. Exemplary delivery routes include parenteral administration, e.g., intradermal, intramuscular, or subcutaneous delivery. Other routes include oral, intranasal, and intravaginal routes of administration. In the case of the nucleic acid of the composition, particularly DNA, the composition can be delivered to the interstitial space of the tissue of an individual (U.S. Pat. Nos. 5,580,859 and 5,703,055, the contents of all of which are incorporated herein by reference in their entirety). The composition can also be administered into muscle, or via intradermal or subcutaneous injection, or transdermally, such as by iontophoresis. Epidermal administration of the composition can also be used. Epidermal administration can include mechanically or chemically irritating the outermost layer of the epidermis to stimulate an immune response to the irritant (U.S. Pat. No. 5,679,647).

[0136] In one embodiment, the composition can be formulated for administration via the nasal cavity. Formulations suitable for intranasal administration, where the carrier is a solid, can include, for example, a coarse powder having a particle size ranging from about 10 to about 500 microns, which is administered in the manner of snuffing, i.e., rapid inhalation through the nasal cavity from a container of powder held close to the nose. The formulation can be a nasal spray, nasal drops, or aerosol administration by nebulizer. The formulation can include an aqueous or oily solution of the composition.

[0137] The composition may be a liquid preparation, such as a suspension, syrup or elixir. The composition may also be a preparation for parenteral, subcutaneous, intradermal, intramuscular or intravenous administration (e.g., injectable administration), such as a sterile suspension or emulsion.

[0138] The compositions can be incorporated into liposomes, microspheres or other polymer matrices (U.S. Pat. No. 5,703,055; Gregoriadis, Liposome Technology, Vols. Ito III (2nd ed. 1993), the contents of which are incorporated herein by reference in their entirety). Liposomes can be composed of phospholipids or other lipids and can be non-toxic, physiologically acceptable and metabolizable carriers that are relatively easy to make and administer.

[0139] The tRNA or the nucleic acid molecule encoding the tRNA may be administered by a variety of routes, including oral, parenteral, sublingual, transdermal, rectal, transmucosal, topical, inhalation, buccal, intrapleural, intravenous, intraarterial, intraperitoneal, subcutaneous, intramuscular, intranasal, intrathecal, and intraarticular, or combinations thereof. For veterinary use, the composition may be administered in a suitably acceptable formulation in accordance with normal veterinary practice. Veterinarians can easily determine the most appropriate dosing regimen and route of administration for a particular animal. The composition may be administered by conventional syringes, needleless injection devices, "microparticle gene guns," or other physical methods such as electroporation ("EP"), "hydrodynamic methods," or ultrasound.

[0140] The tRNA or a nucleic acid molecule encoding the tRNA may be delivered to a mammal by several well-known techniques, including injection with or without in vivo electroporation, liposome-mediated, nanoparticle-facilitated, recombinant vectors such as recombinant adenovirus, recombinant adenovirus-associated virus, and recombinant vaccinia. The tRNA or a nucleic acid molecule encoding the tRNA may be delivered by injection, such as DNA injection, and in vivo electroporation.

[0141] Electroporation Administration of the composition via electroporation can be accomplished using an electroporation device that can be configured to deliver a pulse of energy to the desired mammalian tissue that is effective to form reversible pores in the cell membrane, preferably the pulse of energy is a constant current similar to a preset current input by the user. The electroporation device can include an electroporation component and an electrode assembly or a handle assembly. The electroporation component can include or incorporate one or more of the various elements of an electroporation device, including a controller, a current waveform generator, an impedance tester, a waveform logger, an input element, a status reporting element, a communication port, a memory component, a power source, and a power switch. Electroporation can be accomplished using an in vivo electroporation device, such as a CELLECTRA EP system or an ELGEN electroporator, to facilitate transfection of cells with plasmids.

[0142] The electroporation component may function as one element of an electroporation device, and other elements are separate elements (or components) that communicate with the electroporation component. The electroporation component may function as multiple elements of an electroporation device, which may communicate with yet other elements of the electroporation device that are separate from the electroporation component. The elements of the electroporation device that are part of one electromechanical or mechanical device may not be limited, as the elements can function as one device or as separate elements that communicate with each other. The electroporation component may be capable of delivering a pulse of energy that produces a constant current in the desired tissue, and includes a feedback mechanism. The electrode assembly may include an electrode array having multiple electrodes in a spatial arrangement, the electrode assembly receives the pulse of energy from the electroporation component and delivers it to the desired tissue via the electrodes. At least one of the multiple electrodes is neutral during delivery of the pulse of energy, measures the impedance in the desired tissue, and communicates the impedance to the electroporation component. The feedback mechanism may receive the measured impedance and adjust the pulse of energy delivered by the electroporation component to maintain a constant current.

[0143] The multiple electrodes can deliver pulses of energy in a distributed pattern. The multiple electrodes can deliver pulses of energy in a distributed pattern through control of the electrodes under a programmed sequence, the programmed sequence being input by a user into the electroporation component. The programmed sequence can include multiple pulses delivered in sequence, each pulse of the multiple pulses being delivered by at least two active electrodes with one indifferent electrode that measures impedance, and each subsequent pulse of the multiple pulses being delivered by a different one of the at least two active electrodes with one indifferent electrode that measures impedance.

[0144] The feedback mechanism may be implemented by either hardware or software. The feedback mechanism may be implemented by an analog closed loop circuit. The feedback occurs every 50 μβ, 20 μβ, 10 or 1 μβ, but is preferably real-time feedback or instantaneous (i.e., substantially instantaneous, as determined by available techniques for determining response time). The indifferent electrode may measure the impedance in the desired tissue and communicate the impedance to the feedback mechanism, which responds to the impedance and adjusts the pulse of energy to maintain the constant current at a value similar to the preset current. The feedback mechanism may maintain the constant current continuously and instantaneously during the delivery of the pulse of energy.

[0145] Examples of electroporation devices and electroporation methods that can facilitate the delivery of the compositions described herein include those described in US7245963 and US2005 / 0052630, the contents of which are incorporated herein by reference in their entirety.Other electroporation devices and electroporation methods known in the art can also be used to facilitate the delivery of the compositions.See, for example, US9452285, US7245963, US5273525, US6110161, US6958060, US6939862, US6697669, US7328064 and US2005 / 0052630.

[0146] definition A nucleic acid or polynucleotide refers to a DNA molecule (e.g., cDNA or genomic DNA), an RNA molecule (e.g., mRNA), or a DNA or RNA analog. A DNA or RNA analog can be synthesized from nucleotide analogs. A nucleic acid molecule can be single-stranded or double-stranded, but is preferably double-stranded DNA.

[0147] "Non-natural" or "engineered" or recombinant nucleic acid refers to a nucleic acid whose structure is not identical to that of any naturally occurring nucleic acid, but may in some embodiments include a fragment of a naturally occurring genomic nucleic acid. Thus, the term encompasses, for example, (a) a nucleic acid that has a sequence of a portion of a naturally occurring nucleic acid molecule, but is not flanked by both sequences that flank that portion of the naturally occurring molecule, (b) a nucleic acid that is incorporated into a vector or into the genomic DNA of a prokaryotic or eukaryotic organism in such a manner that the resulting molecule is not identical to any naturally occurring vector or genomic DNA, (c) a separate molecule such as a cDNA, a genomic fragment, a fragment produced by polymerase chain reaction (PCR), or a restriction fragment that does not occur in nature, and (d) a recombinant nucleotide sequence that does not occur in nature, or (e) an engineered nucleotide sequence that does not occur in nature. The nucleic acid described above can be used to express the tRNA of the present disclosure. For this purpose, the nucleic acid can be operably linked to a suitable regulatory sequence to generate an expression vector.

[0148] A "recombinant nucleic acid" is a combination of nucleic acid sequences that are joined together using recombinant techniques and procedures used to join nucleic acid sequences together.

[0149] The terms "heterologous" DNA molecule and "heterologous" nucleic acid, as used herein, refer to a molecule that is derived from a source foreign to a particular host cell, or that, if derived from the same source, is modified from its original form, respectively. Thus, a heterologous gene in a host cell includes a gene that is endogenous to a particular host cell, but that has been modified, for example, by the use of shuffling or recombination. When used to describe two nucleic acid segments, these terms mean that the two nucleic acid segments are not from the same gene, or that, if they form the same gene, one or both of them have been modified from their original form. These terms also include non-naturally occurring multiple copies of a naturally occurring DNA molecule. Thus, these terms refer to a nucleic acid segment that is foreign or heterologous to the cell, or that is homologous to the cell, but is in a location within the host cell nucleic acid where that element is not normally found. The exogenous DNA segment is expressed to produce an exogenous RNA or polypeptide. A "homologous DNA molecule" is a DNA molecule that is naturally associated with the host cell into which it is introduced.

[0150] A vector refers to a nucleic acid molecule that can transport another nucleic acid to which it is linked. A vector may or may not be capable of autonomous replication, or may or may not be capable of integration into a host DNA. Examples of vectors include plasmids, cosmids, or viral vectors. A vector contains a nucleic acid in a form suitable for expression of a nucleic acid of interest in a host cell. Preferably, a vector contains one or more regulatory sequences operably linked to the nucleic acid sequence to be expressed.

[0151] "Regulatory sequences" include promoters, enhancers, and other expression control elements (e.g., polyadenylation signals). Regulatory sequences include sequences that direct constitutive expression of nucleotide sequences, as well as tissue-specific regulatory sequences and / or inducible sequences. The design of an expression vector may depend on factors such as the choice of the host cell to be transformed, the level of expression of the desired protein or RNA, and the like. The expression vector can be introduced into a host cell to produce the RNA or polypeptide of interest. A promoter is defined as a DNA sequence that directs RNA polymerase to bind to DNA and initiate RNA synthesis. A strong promoter is one that initiates RNA at high frequency.

[0152] A "promoter" is a nucleotide sequence that initiates and regulates transcription of a polynucleotide. Promoters can include inducible promoters (expression of a polynucleotide sequence operably linked to the promoter is induced by an analyte, cofactor, regulatory protein, etc.), repressible promoters (expression of a polynucleotide sequence operably linked to the promoter is repressed by an analyte, cofactor, regulatory protein, etc.), and constitutive promoters. The term "promoter" or "control element" is intended to include full-length promoter regions as well as functional (e.g., transcription or translation controlling) segments of these regions.

[0153] "Operably linked" refers to an arrangement of elements such that the components so described are configured to perform their normal functions. Thus, a given promoter operably linked to a nucleic acid sequence can affect the expression of that sequence if the appropriate enzymes are present. The promoter need not be contiguous with the sequence, so long as it functions to direct its expression. Thus, for example, intervening untranslated but transcribed sequences can be present between the promoter sequence and the nucleic acid sequence, and the promoter sequence can still be considered "operably linked" to the coding sequence. Thus, the term "operably linked" is intended to encompass any spacing or orientation of the promoter element and DNA sequence of interest that allows initiation of transcription of the DNA sequence of interest upon recognition of the promoter element by the transcription complex.

[0154] As used herein, "expression cassette" refers to a nucleic acid sequence capable of directing the expression of a particular nucleotide sequence in a suitable host cell, which may include a promoter operably linked to the nucleotide sequence of interest, which may be operably linked to a termination signal. It may also include sequences necessary for proper translation of the nucleotide sequence. The coding region usually encodes an RNA or protein of interest. The expression cassette containing the nucleotide sequence of interest may be chimeric. The expression cassette may also be naturally occurring but obtained in a recombinant form useful for heterologous expression. The expression of the nucleotide sequence in the expression cassette may be under the control of a constitutive promoter or a regulatable promoter that initiates transcription only when the host cell is exposed to some specific stimulus. In the case of a multicellular organism, the promoter may also be specific to a particular tissue or organ, or developmental stage. In certain embodiments, the promoter is a PGK, CMV, RSV, HI or U6 promoter (Pol II and Pol III promoters).

[0155] A "nucleic acid fragment" is a portion of a given nucleic acid molecule. The term "substantial identity" of a polynucleotide sequence means that the polynucleotide comprises a sequence having at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79%, or at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%, or at least 90%, 91%, 92%, 93%, or 94%, or even at least 95%, 96%, 97%, 98%, or 99% sequence identity compared to a reference sequence using one of the alignment programs described using standard parameters.

[0156] As used herein, a "reference sequence" or "original sequence" is a defined sequence used as a basis for sequence comparison. A reference sequence can be a subset or the entirety of a specified sequence, for example, as a segment of a full-length cDNA or gene sequence or an isolated nucleic acid sequence.

[0157] As used herein, "minivector" refers to a mini-sized circular DNA vector system, e.g., a double-stranded circular DNA (e.g., minicircle) or a closed linear DNA molecule (e.g., CEDT), lacking a bacterial replication origin and an antibiotic selection gene and having a size of about 100 bp to about 5 kbp. It can be obtained, for example, by site-specific recombination of a parental plasmid, by removing the plasmid sequences outside the recombination sites. It includes, for example, a nucleic acid molecule having only a promoter and a transgene expression cassette containing a nucleic acid sequence of interest, which can be, for example, a tRNA for suppressing PTC, and importantly, is not a sequence of bacterial origin.

[0158] The term "subject" includes humans and non-human animals. A preferred subject for treatment is a human. As used herein, the terms "subject" and "patient" are used interchangeably, regardless of whether the subject has received or is currently receiving any form of treatment. As used herein, the term "subject" can refer to any vertebrate, including, but not limited to, mammals (e.g., cows, pigs, camels, llamas, horses, goats, rabbits, sheep, hamsters, guinea pigs, cats, dogs, rats, and mice, non-human primates (e.g., monkeys such as cynomolgus monkeys and chimpanzees), and humans). In one embodiment, the subject is a human. In another embodiment, the subject is an experimental non-human animal or an animal suitable as a disease model.

[0159] PTC or nonsense mutation associated disease or disorder, PTC-associated disease, or PTC-associated disease refers to any condition caused or characterized by one or more nonsense mutations that change an amino acid codon to a PTC by a single base substitution, resulting in a defective, truncated protein.

[0160] As used herein, "treat" or "treatment" refers to the administration of a compound or agent to a subject having or at risk of developing a disorder with the intent to cure, alleviate, ameliorate, relieve, delay the onset of, prevent, or ameliorate the disorder, symptoms of the disorder, pathology secondary to the disorder, or predisposition to the disorder. Terms such as "prevent," "preventing," "prevention," "prophylactic treatment," and the like refer to reducing the probability of developing a disorder or condition in a subject who does not have the disorder or condition but is at risk of or susceptible to developing the disorder or condition. "Amelioration" generally refers to a reduction in the number or severity of signs or symptoms of a disease or disorder.

[0161] The terms "prevent", "preventing", and "prevention" generally refer to a reduction in the occurrence of a disease or disorder in a subject. Prevention may be complete, e.g., the complete absence of a disease or disorder in a subject. Prevention may also be partial, e.g., the occurrence of a disease or disorder in a subject is less than would have occurred without the embodiments of the present disclosure. "Preventing" a disease generally refers to inhibiting the complete onset of the disease.

[0162] The term "pharmaceutical composition" refers to a combination of an active agent and an inert or active carrier that makes the composition particularly suitable for diagnostic or therapeutic use in vivo or ex vivo. A "pharmaceutical acceptable carrier" does not cause undesired physiological effects after administration to or on a subject. A carrier in a pharmaceutical composition should also be "acceptable" in the sense that it should be compatible with the active ingredient and be able to stabilize it. One or more solubilizing agents may be utilized as pharmaceutical carriers to deliver the active compound. Examples of pharmaceutical acceptable carriers include, but are not limited to, biocompatible vehicles, adjuvants, additives, and diluents to achieve a composition that can be used as a dosage form. Other examples of carriers include colloidal silicon oxide, magnesium stearate, cellulose, and sodium lauryl sulfate.

[0163] The term "about" generally refers to plus or minus 10% of the indicated numerical value. For example, "about 10%" may indicate a range of 9% to 11%, and "about 1" may mean 0.9 to 1.1. Other meanings of "about" may be apparent from the context, such as rounding, so for example, "about 1" may mean 0.5 to 1.4.

[0164] Recitation of ranges of values ​​herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, and unless otherwise indicated herein, each separate value is incorporated herein as if it were individually recited herein. EXAMPLES

[0165] Example 1 A library of nonsense suppressor tRNAs (ACE-tRNAs) was developed using a novel high-throughput cloning (HTC) and screening (HTS) method to replace the anticodons of human tRNA genes with PTC codons (UAG, UAA, and UGA). 1 To generate the library, the ACE-tRNA gene was efficiently cloned into an HTC plasmid containing a NanoLuc luciferase (NLuc; Promega, Madison WI) expression cassette with an in-frame PTC. The all-in-one plasmid was then transfected into HEK293 cells, and luminescence, which quantitatively reports on PTC suppression, was measured in a 96-well format. 1 Although the ACE-tRNA library was generated to target all possible PTCs that arise as a result of a single nucleotide change from an amino acid codon, the hits selected for optimization in the experiments outlined in this example were the R1162X and W1282X mutations in CFTR due to their high prevalence, and therefore the ACE-tRNA library was generated to target all possible PTCs that arise as a result of a single nucleotide change from an amino acid codon. Arg UGA and ACE-tRNA Leu UGA. ACE-tRNA in HEK293 cells Arg UGA and ACE-tRNA Leu Screening the UGA tRNA family revealed multiple hits for each family.

[0166] To maintain seamless readthrough of the PTC by the correct amino acid, the fidelity of the aaRS-tRNA interaction must be maintained after anticodon editing. To determine whether the fidelity of the cognate aaRS-ACE-tRNA interaction is maintained, mass spectrometry was performed to examine amino acid incorporation. Results confirmed specific inhibition of the PTC by the cognate amino acid of each ACE-tRNA type, resulting in seamless PTC inhibition. 1 .

[0167] After determining the identity and specificity of the ACE-tRNA hits with the NLuc reporter, we identified ACE-tRNA in 16HBE14o-cells engineered to contain the R1162X and W1282X mutations. Arg UGA and ACE-tRNA Leu We performed assays to demonstrate that UGA suppresses endogenous PTCs encoded in the genomic context of the complete CFTR gene. pMuLE platform 47 Using the PiggyBac transposon / transposase system based on ACE-tRNA and a novel tRNA multimerization system (PB Donkey), Arg UGA or ACE-tRNA Leu We generated 16HBE14o- cells containing either the R1162X or W1282X mutation that stably express either eight copies of UGA. These cell lines were used to determine both the levels of CFTR transcript present and the level of rescued CFTR function.

[0168] Nonsense-mediated decay (NMD) is a surveillance system in eukaryotic cells that degrades mRNAs containing PTCs 48 It is hypothesized that efficient expression of ACE-tRNA hits increases PTC-containing CFTR transcript expression by inhibiting NMD. Gene-specific qRTPCR was performed on mRNA isolated from W1282X cells stably expressing eight copies of each ACE-tRNA or containing an empty PB Donkey insert. 8×ACE-tRNA Leu Stable expression of UGA alone led to a large increase in steady-state CFTR mRNA levels in W1282X 16HBE14o cells, whereas ACE-tRNA Trp It was found that expression of 8xACE-tRNA in R1162X 16HBEo- cells had limited effect. Arg The use of chamber assays was also performed to demonstrate functional rescue of CFTR function following stable expression of UGA alone.

[0169] It was surprising to see rescue of CFTR function after addition of forskolin and IBMX in the absence of measurable CFTR function in cells containing empty PB Donkey inserts. The results demonstrate that ACE-tRNA expressed at low levels can inhibit NMD and promote functional rescue of CFTR expression in the endogenous CFTR genomic context. To lower the hurdles associated with delivery of ACE-tRNA, assays were performed to optimize the transcriptional and translational elements associated with their in vivo function.

[0170] Example 2 These ACE-tRNA hits can be developed into therapeutic leads, such as by further increasing the efficiency of in vivo production, maturation, and / or translation activity.

[0171] Because the 5′-flanking sequence is important for PTC suppression efficiency after expression of ACE-tRNA from DNA in vivo 24 , human tRNA Tyr An ACE-tRNA DNA expression cassette was generated that contained 55 bp of 5'-flanking sequence from the gene. Removal of the flanking sequence was found to result in reduced nonsense suppression activity against PTC-containing CFTR, highlighting the importance of this transcriptional element for efficient PTC suppression in vivo. It is hypothesized that the human tRNA flanking sequence may result in higher ACE-tRNA suppression efficiency, either due to increased positive regulation of tRNA transcription or due to increased 5'-end processing by RNase P.

[0172] Experiments were carried out to increase the efficiency of the ACE-tRNA translation element. As previously described, the T-stem has been shown to be important for efficient transport and release of aminoacylated tRNA to the ribosome by the EF-1a homologue EF-Tu. 44~46 ACE-tRNA TrpUGA is a poorly performing ACE-tRNA amino acid family and we have identified the best ACE-tRNA family to enhance translation efficiency. Trp The T-stem of the UGA hit was altered. Studies with misacylated bacterial tRNAs have shown that the EF-1a homologue EF-Tu displays considerable affinity for both the esterified amino acid and the tRNA body. 44、49~50 . yeast tRNA Phe Biochemical experiments using base pair mutations in the T-stem of tRNA revealed that the sequences 49-65, 50-64, and 51-63 base pairs in the T-stem (see Figure 3B for numbering) are primarily responsible for the sequence-specific binding of this tRNA to the prokaryotic EF-1a homologue, EF-Tu. 51~52 For further screening, ACE-tRNA Trp We selected a set of single and multiple substitutions at base pairs 49-65, 50-64, and 51-63 in the T stem of UGA (Figure 3A). These mutations provide a wide range of EF-Tu affinity for each tRNA of E. coli. 45 ACE-tRNA Trp The library of T-stem mutants was cloned into the same HTC plasmid used for the original screen. Screening of the resulting mutants in HEK293 cells confirmed that ACE-tRNA TRP Several T-stem mutants that increase the efficiency of UGA nonsense suppression were identified.

[0173] Addition of the 52-62 CG pair, previously shown to increase tRNA efficiency in E. coli 45 Adding this mutation to the best performing initial mutants (TS-21, TS-9, etc.; Figures 3A and 3C) resulted in the most efficient ACE-tRNAs. Trp UGA T-stem mutants were generated and the original ACE-tRNA TrpIt was unexpectedly found that ACE-tRNA was approximately three times more efficient than UGA. The results presented in Figure 3 demonstrate that increasing the transcription and processing of ACE-tRNA and adjusting the translation elements can increase their PTC suppression efficiency in vivo.

[0174] Example 3 This example describes the experimental design and method to determine the optimal sequence for efficient transcription and processing of ACE-tRNA from a DNA cassette. To maximize the efficiency of nonsense suppression following DNA in vivo, an assay was performed to determine the optimal sequence for the transcription element in the ACE-tRNA DNA cassette. It is hypothesized that increasing the effectiveness of each ACE-tRNA expression "unit" by enhancing transcription and processing could reduce the amount of ACE-tRNA required for treatment.

[0175] 3.1 To improve the expression and processing of ACE-tRNA in vivo, Arg Determination of optimal 5'-flanking sequences for UGA. When constructing the first HTC plasmid, tRNA Tyr gene 24 We used the 5'-flanking sequence from ACE-tRNA expression cassette. The inclusion of this 5'-flanking sequence in the ACE-tRNA expression cassette may be important for efficient nonsense suppression. Although relatively little is known about the function of the 5'-flanking sequence, especially in humans, it is possible that elements of the 5'-flanking sequence may be involved in tissue-specific expression of tRNA genes. 32 , the efficiency of RNase P cleavage may depend on the pre-tRNA structure. 53 It was hypothesized that by screening the 5'-flanking sequences from the most highly expressed tRNAs, it would be possible to simultaneously optimize both ACE-tRNA transcription and 5'-end processing in human bronchial cells.

[0176] To generate a library of 5'-flanking sequences, 1000 bp sequences immediately upstream of 48 of the most highly expressed human tRNA genes are cloned. 54 The 5'-flanking sequences were ordered as double-stranded DNA eBlocks (IDT, USA) with SapI type II restriction enzyme recognition sequences at both ends. SapI was chosen because there are few 5'-flanking sequences that already contain the recognition sequence for this restriction enzyme. The ccdB negative selection cassette adjacent to the SapI recognition site is used to select the ACE-tRNA Arg It replaces the 5'-leader position in the original HTC plasmid containing UGA (Figure 2).

[0177] The Golden Gate reaction for assembling the 5'-flanking sequence HTS library is carried out in a 96-well PCR plate, as previously described. 11 μL of the Golden Gate reaction is transformed into DH5α chemically competent cells (New England Biolabs, USA) in deep welled 96-well plates and grown in 2 mL of Luria Bertani broth supplemented with 100 μg / mL ampicillin for 20 h at 37 °C with shaking at 300 rpm. Overnight cultures of E. coli are miniprepped with PureLink Pro 96-well purification kit (ThermoFisher, USA) and diluted to 125 ng / μL. HTS is performed in 16HBE14o-cells after transfection of each 5'-flanking sequence HTS library member using Lipofectamine 3000 in black 96-well cell culture blocks. Luminescence from Nluc-TGA is used as an indicator of ACE-tRNA-dependent PTC suppression efficiency. Inhibition of PTC by individual 5'-flanking sequence HTS library members is averaged across three wells for each experiment, and all clones are repeated in this manner more than three times. Each plate also contains 16HBE14o-cells transfected with a "blank" HTC plasmid that does not contain ACE-tRNA to serve as a control for transfection efficiency and baseline PTC read-through. All values ​​are compared as the ratio of ACE-tRNA emission to baseline nonsense read-through emission ± standard deviation. The most efficient 5'-flanking sequence is the library member with the highest emission ratio to baseline.

[0178] 3.2 ACE-tRNA for improved in vivo processing Arg UGA and ACE-tRNA Leu Determination of optimal 3'-trailer sequence of UGA The length and sequence of the 3'-trailer have been shown to affect the efficiency of RNase Z and 3' exonuclease processing. 36~40The sequences of the 3'-trailer used in the initial HTC plasmids, as well as the 5'-flanking sequences, were taken from previous studies with nonsense suppressor tRNAs used in GCE. 24 Detailed examination of the selected 3'-trailer sequence indicates that it has suboptimal processing capabilities. 40 To optimize the 3'-trailer sequence, create a library of all possible 4 nucleotide long 3'-trailer sequences cloned between the tRNA and a polyT transcription terminator. This 256 member library is Arg UGA and ACE-tRNA Leu As well as probing the sequence specificity for the 3' end processing of the UGA hits, the optimal length of the 3' trailer can also be determined as the library contains the 4 nucleotide sequences NNNT, NNTT and NTTT.

[0179] Each of these sequences shortens the trailer by one nucleotide on average by effectively starting the polyT terminator one nucleotide earlier. Libraries were constructed and tested as above, with some notable differences. The restriction endonuclease BbsI was used due to its 4 bp overhang and slightly higher efficiency, the HTC plasmid was modified such that a ccdB negative selection cassette is between the tRNA and the polyT transcription terminator, and the insert in this case is an oligo annealed as in Lueck et al., Nat Commun 2019,10(1),822. As above, the most efficient 3' trailer sequence library member can be determined as the one with the highest emission ratio over baseline.

[0180] Example 4 This example describes the experimental design and methods to determine optimal sequences for efficient aminoacylation and transport of ACE-tRNA, both for expression from a DNA cassette and for delivery as RNA.

[0181] Previous efforts with GCE have demonstrated the importance of optimizing the translational elements of suppressor tRNAs. 2、4~5、27~30、43 Optimization of the translation elements of ACE-tRNAs is important because they can affect the efficiency of ACE-tRNAs delivered by any method. The experimental design and methods disclosed herein optimize the anticodon loops of ACE-tRNAs for efficient charging by their cognate aminoacyl-tRNA synthetases and their T-stems for efficient transport by EF-1a.

[0182] 4.1 ACE-tRNA to improve aminoacylation efficiency by cognate aminoacyl-tRNA synthetases Arg UGA and ACE-tRNA Leu Determination of the optimal anticodon loop sequence of UGA As described above in Example 3.2, the ACE-tRNA cloned into the center of each of these ACE-tRNAs Arg UGA and ACE-tRNA Leu A library of all possible non-anticodon nucleotides for the UGA anticodon loop is created. This is achieved by inserting a BbsI-flanked ccdB negative selection cassette between nucleotides 31 and 39 of each ACE-tRNA hit. The 256-member anticodon loop library is ordered as complementary oligos (IDT, USA) and cloned into the anticodon loop HTC plasmid. As above, the most efficient anticodon loop library members are determined as those with the highest emission ratio over baseline.

[0183] 4.2 ACE-tRNA to improve transport to the ribosome by EF-1a Arg UGA and ACE-tRNA Leu Determination of the optimal T-stem sequence of UGA Optimization of the T-stem of nonsense suppressor tRNA for GCE improved nonsense suppression efficiency by 5-25 fold. To optimize the T-stem, ACE-tRNA was screened.Trp The three most efficient T-stem sequences from UGA (Figure 3) were Arg UGA and ACE-tRNA Leu Use with UGA hits. As above, the most efficient T-stem library members are determined as those with the highest emission ratios over baseline.

[0184] Varying the tRNA body (anticodon loop and T-stem) has the potential to affect the translation fidelity of ACE-tRNA hits. ACE-tRNAs containing optimized T-stem and anticodon loops Arg UGA and ACE-tRNA Leu To verify the translational fidelity of UGAs, we co-transfect them with pcDNA3.1 histidinol dehydrogenase carrying a C-terminal 8xHis-Strep tag for protein purification. The purified proteins are subjected to mass spectrometry and show uniform site-specific PTC suppression as previously reported. 1 If the translation fidelity of any of the most efficient library members is compromised, the next most efficient member is used instead.

[0185] For PTC reporter suppression, ACE-tRNA in the DNA expression cassette in 16HBE14o- Arg UGA and ACE-tRNA Leu Using the UGA reads, CFTR mRNA expression and channel function are assessed as outlined above in Example 1. The best anticodon loop and T-stem sequences are identified using the ACE-tRNA Arg UGA and ACE-tRNA Leu The UGAs are combined in a lead RNA construct and delivered to 16HBE14o-cells, resulting in PTC reporter repression, CFTR mRNA expression, and channel function as outlined in Example 1 above.

[0186] Example 5 Using the experimental design and methods described above, 5' leader, 3' trailer, t-stem mutants, and sticky stem mutants that confer enhanced tRNA expression or nonsense suppression were screened and identified.

[0187] First, an assay was performed to identify 5' leaders that resulted in greater PTC suppression than the control or original 5' leader. Briefly, 55 bp upstream of each human tRNA was ordered as a pair of single-stranded DNA oligos (386 members), annealed, and cloned into a 5' upstream regulatory element (5'UCE) screening plasmid via a high-throughput Golden Gate cloning strategy using SapI restriction enzyme (Figure 2A).

[0188] A related library of 55 bp 5' upstream leaders was assembled as shown in Figures 7A, 7B, and 7C. The parental high-throughput cloning and-screening vector for the tRNA 5' region contains a cloning site immediately 5' to the original ArgTGA tRNA sequence / original 3' trailer sequence (Figure 7A). All human tRNAs are designated as "tRNA-Ala-AGC-1-1" (where Ala is the three-letter amino acid code for the tRNA isotype, AGC is the anticodon, the first 1 corresponds to the numeric ID of the unique tRNA transcript or "isodecoder", and the second 1 corresponds to the locus ID - for tRNAs with multiple identical copies, this locus ID represents the specific gene copy in the genome). Scanning the entire human genome returned 386 predicted tRNAs with unique 55 bp sequences immediately upstream of the tRNA (Figure 7B).

[0189] To determine the effect of these different sequences on the function of ACE-tRNA, each unique 55 bp 5' upstream regulatory element (UCE, also called 5' upstream transcription element) was synthesized as a complementary oligonucleotide and annealed to provide an overhang for Golden Gate cloning into the parent vector (Figures 7A and 7C). The designations in Tables 1A and 1B correspond to the original tRNA from which the 5' sequence was derived.

[0190] The Golden Gate reaction was transformed into chemically competent NEB 5-α cells and miniprepped with Macherey-Nagel Nucleospin96 transfection grade kit. DNA concentration was normalized to 50 ng / μL and mixed 1:1 (v / v) with 150 ng / μL of carrier plasmid (pUC57mini) and transfected into 16HBE14o- or HEK293T cells using lipofectamine2000 reagent. Cells were incubated at 4°C for 2 h at 4°C for 1 h at 20°C. 2 After 24 h in the incubator, PTC rescue was determined using the Nano-Glo Dual Luciferase Reporter Assay System, using firefly luciferase (Fluc) as a transfection control and PTC-containing nanoluciferase (Nluc) as a PTC read-through control. The mean normalized inhibition ratio was obtained as follows: Mean normalized inhibition ratio = (PTC-nanoluciferase luminescence [+ACE-tRNA] / firefly luminescence) / (PTC-nanoluciferase luminescence [without ACE-tRNA] / firefly luminescence).

[0191] Those results, which show a higher ratio than the original ratio, are shown in Tables 1A and 1B. [Table 2] TIFF2025507324000006.tif239170TIFF2025507324000007.tif181170Note: 1. 5' leader sequence-oArgTGA-o3' trailer sequence (the o prefix indicates the origin). 2. The last highlighted line contains the original 55bp 5' leader sequence. [Table 3] TIFF2025507324000009.tif241170TIFF2025507324000010.tif143170Note: 1. 5' leader sequence-oArgTGA-o3' trailer sequence (the o prefix indicates the origin). 2. The last line contains the original 55bp 5' leader sequence.

[0192] The above assay was also performed to examine an 850 bp version of the 55 bp 5' UCE sequence (extending further 5' to the original tRNA gene). Those results, which exhibit a higher ratio than the original ratio, are shown in Table 1C below. [Table 4] TIFF2025507324000012.tif215170TIFF2025507324000013.tif215170TIFF2025507324000014.tif212170TIFF2025507324000015.tif225170Note: The last line is the original 55 bp 5' leader sequence. *Average normalized inhibition ratio = (PTC-nanoluciferase luminescence [+ACE-tRNA] / firefly luminescence) / (PTC-nanoluciferase luminescence [without ACE-tRNA] / firefly luminescence)

[0193] Example 6 Assays were performed to identify 3' trailers in a similar manner. Briefly, 3' processing (256 members) and long 3' trailer (389 members) libraries were ordered as outlined above and cloned into the 3' trailer screening plasmid (Figure 2C). The 3' trailer libraries were transformed, prepared, transfected, and assayed for PTC suppression as outlined above. The average normalized suppression ratio was obtained as follows: Mean normalized inhibition ratio = (PTC-nanoluciferase luminescence [+ACE-tRNA] / firefly luminescence) / (PTC-nanoluciferase luminescence [without ACE-tRNA] / firefly luminescence).

[0194] Those results, which show a higher ratio than the original ratio, are shown in Tables 2A and 2B. [Table 5] Notes: 1. The last line contains the original 4bp 3' trailer sequence. 2. o5' leader sequence-oArgTGA-3' trailer sequence (the o prefix indicates the origin). [Table 6] Notes: 1. The last line contains the original 4 bp 3' trailer sequence. 2. o5' leader sequence-oArgTGA-3' trailer sequence (the o prefix indicates the origin).

[0195] Example 7 Assays were performed to identify t-stem and sticky stem mutants that result in enhanced tRNA expression or suppression of nonsense mutations in the manner described above. Briefly, ArgTGA t-stem (28 members), ArgTGA sticky stem (128 members), LeuTGA t-stem (28 members), LeuTGA sticky stem (128 members), and GlyTGA t-stem (28 members) libraries were ordered as pairs of single-stranded DNA oligos, annealed, and cloned via a high-throughput Golden Gate cloning strategy into the ACE-tRNA screening plasmid using BbsI restriction enzyme (Figure 2B). ACE-tRNA libraries were transformed, prepared, and transfected into 16HBE14o- cells and assayed for PTC suppression as described above. The average normalized suppression ratio was obtained as follows: Mean normalized inhibition ratio = (PTC-nanoluciferase luminescence [+ACE-tRNA] / firefly luminescence) / (PTC-nanoluciferase luminescence [without ACE-tRNA] / firefly luminescence)

[0196] With respect to Table 5, these results are shown in Tables 3-7, which exhibit higher ratios than the original ratios, except that the original GlyTGA T-stem sequence was the best t-stem among those tested. [Table 7] Notes: 1. The last line contains the original T-stem sequence. 2. o 5' leader sequence-ArgTGA t-stem variant-o 3' trailer sequence (o prefix indicates original). [Table 8] Notes: 1. The last line contains the original T-stem sequence. 2. o 5' leader sequence-LeuTGA t-stem variant-o 3' trailer sequence (o prefix indicates original). [Table 9] Notes: 1. The line contains the original T-stem sequence 2. o 5' leader sequence-GlyTGA t-stem variant-o 3' trailer sequence (o prefix indicates original). [Table 10] Notes: 1. The last line contains the original ArgTGA sequence. 2. o 5' leader sequence-ArgTGA sticky stem mutant-o 3' trailer sequence (o prefix indicates original). [Table 11] Notes: 1. The last line contains the original LeuTGA sequence. 2. o 5' leader sequence-LeuTGA sticky stem mutant-o 3' trailer sequence (o prefix indicates original).

[0197] Example 8 In the manner described above, an assay was performed to compare the effect of the U6 and H1 promoters with that of the original 5' leader. The results are shown in Table 8. The results show that the original 5' leader is comparable to or superior to the U6 and H1 promoters. The results also show that the 5' leader of tRNA-Cys-GCA-12-1 is far superior to the original 5' leader as well as the U6 and H1 promoters. Therefore, this and other 5' leader segments described herein can be used as enhancing elements to enhance expression of genes, such as tRNA genes. [Table 12]

[0198] Example 9 In this example, assays were performed to examine tRNA genes, each of which was tagged with a "tRNA transcript tabulator" or a "tRNA transcript counter." Figure 8A shows a tRNA gene with such a transcription tabulator.

[0199] As shown in Figure 8, the addition of a tRNA transcription tabulator to the 3' end of ACE-tRNA allowed ACE-tRNA-dependent expression of RNA targets to be quantified by RT-qPCR. Transcription of an RNA pol III promoter-free sequence added to the 3' end of ACE-tRNA upstream of the p(T) transcription terminator is dependent on the transcription of ACE-tRNA. This is shown as "tRNA transcription tabulator" (TTT) within the context of the tRNA gene (Figure 8A). A self-cleaving ribozyme was chosen as TTT, which self-cleaves itself from the tRNA after transcription. ACE-tRNA and ribozyme TTT are transcribed as a single transcript before the ribozyme cleaves the backbone (cleavage site is indicated by an arrow, Figure 8B). ACE-tRNA cannot be directly quantified via real-time reverse transcription quantitative PCR (RT-qPCR) without extensive processing, as it contains many modified nucleotides that inhibit reverse transcriptase (Figure 8C). Quantification of the tRNA transcription counter serves as a surrogate for quantification of ACE-tRNA, since TTT abundance is directly proportional to ACE-tRNA abundance and TTT does not contain any modifications that inhibit reverse transcriptase. A TTT sequence was cloned downstream of each ACE-tRNA sequence, as shown in Figure 8D-G. Depending on the ACE-tRNA, either the 5'-UCE, t-stem, or sticky stem sequence was varied. Each construct was transfected into 16HBE14o-cells using Lipofectamine LTX with PLUS reagent (Thermo Fisher Scientific) according to the manufacturer's instructions. Cells were harvested in Buffer RLT (Qiagen) and total RNA was purified. Total RNA was subjected to relative quantification by RT-qPCR using probes directed against TTT and TATA binding protein (TBP, an endogenous control transcript). The amount of TTT relative to TBP for each ACE-tRNA sequence was determined by the quantification of the ACE-tRNA. Arg TGA (Figure 8D), ACE-tRNA Leu TGA (Figure 8E), ACE-tRNA Gly TGA (Figure 8F), and ACE-tRNATrp TGA (Figure 8G).

[0200] Example 10 Additional assays were performed to identify mutants with combinations of two or more of the optimal 5'- and 3'-flanking sequences, anticodon loops, and T-stem sequences described above. The mutants and results are shown in Tables 9 and 10 below and in FIG. 9.

[0201] As shown in Figure 9, the optimized ACE-tRNA expression cassette induced a higher peak level of PTC inhibition (higher Sup max ) and / or maximum PTC inhibition (lower DD 50 ) exhibits a lower level of DNA delivery required to reach the target concentration. Two sets of two-fold serial dilution series (starting at 75ng / uL and 50ng / uL, respectively) of the original and optimized ACE-tRNA cassettes in pUC57mini tRNA Dest were made, mixed with pNanoReporter2.0 TGA (without tRNA cassette, 25ng / uL) and transfected into HEK293T cells. The obtained data were fitted to the hyperbolic model described above using nonlinear regression (Prism7.3) to obtain the Sup max corresponds to the maximal level of nonsense suppression displayed by ACE-tRNA, and DD 50 (Delivered DNA) corresponded to the concentration of DNA (ng / uL) required for a half-maximal nonsense suppression response.

[0202] The specific optimized ACE-tRNA sequences and original ACE-tRNA sequences in the DNA constructs used herein are also shown in Table 9 below. Table 9 includes a set of sequences containing the best sequences shown in either Table 1A, 1B, 2A, 2B, 3, 4, 5, 6, or 7, which were combined together with a single fully optimized ACE-tRNA sequence and tested for optimal function. In this table, the original ACE-tRNA sequence is shown in italics. The top fully optimized ACE-tRNA sequence is shown in bold. [Table 13] TIFF2025507324000025.tif246170TIFF2025507324000026.tif237170TIFF2025507324000027.tif225170TIFF2025507324000028.tif251170TIFF2025507324000029.tif239170TIFF2025507324000030.tif250170TIFF2025507324000031.tif237170TIFF2025507324000032.tif187170Legend: 1. Italics: Original ACE-tRNA sequence 2. Bold: Top fully optimized ACE-tRNA sequence

[0203] Additional optimized and original ACE-tRNA sequences and data are also shown in Table 10 below. In this table, lines 2-18 are the sequences from Lueck et al., Nat Commun 2019,10(1),822. They are the top sequences of each ACE-tRNA family (isoacceptor / stop codon) flanked by the original 5' and 3' sequences from that study. These serve as the reference / parent sequences for the following sequences.

[0204] The sequences with the "5p3p" prefix (lines 19-30) use the same ACE-tRNA sequence as above, but replace the 5' and 3' sequences with the best ones discovered and disclosed herein. These correspond to the 5' and 3' sequences used in those bolded sequences in Table 9 "Best Combinations". However, these sequences differ from the sequences listed in Table 9 "Best Combinations" because for the sequences listed in lines 19-30, only the 5' and 3' sequences were changed, and nothing was changed within the ACE-tRNA sequence.

[0205] The sequence with the "TV10" prefix (lines 31-39) has the same 5' and 3' sequences as the "parent" sequence, but the t-stem in the ACE-tRNA sequence has been modified. Because t-stem version 10 performed better for several Arg, Gly, and Leu sequences, it was decided to replace the native t-stem in all ACE-tRNAs with this sequence.

[0206] SerACE-tRNA was improved by both 5p3p and TV10, and since SerACE-tRNA has particularly high activity and may be prone to many mutations, 5p3p and TV10 were also examined together. [Table 14] TIFF2025507324000034.tif250170TIFF2025507324000035.tif239170TIFF2025507324000036.tif246170TIFF2025507324000037.tif34170

[0207] Example 11 In this example, an assay was performed to demonstrate that the optimized ACE-tRNA retains its fidelity in translation.

[0208] A pcDNA3.1(+) plasmid encoding a superfolder green fluorescent protein (sfGFP) with a TGA stop codon at amino acid position 150 and a C-terminal Strep-8xHistidine-Strep tag was co-transfected into HEK293T cells together with a plasmid encoding four copies of the ACE-tRNA under investigation (Figure 10A). Two days after transfection, cells were harvested and completely lysed with a Dounce homogenizer in PBS supplemented with a protease inhibitor cocktail. Full-length sfGFP was purified via the C-terminal Strep-8xHis-Strep tag using Strep-Tactin XT Superflow resin (IBA Lifesciences) according to the manufacturer's instructions. Eluted sfGFP proteins were separated on a 10–20% gradient SDS-PAGE gel and stained with SimplyBlue Safestain (Thermo Fisher Scientific) Coomassie stain (Figure 10B–C). sfGFP was excised from the gel and subjected to trypsin digestion, followed by mass spectrometry of the resulting peptide masses. The mass of each peptide containing amino acids at position 150 of sfGFP (Figure 10D) was determined, and the amino acid with the most consistent mass for position 150 of that peptide was determined. Because trypsin cleaves after arginine and lysine, peptides with arginine at position 150 differ from other amino acids shown herein (arginine in peptides is shown as R, other amino acids as X). For each purified protein, the amount of each amino acid incorporated at position 150 (peptide abundance) was tabulated and expressed as a percentage (Figure 10E).

[0209] For all ACE-tRNAs considered herein, >97% of the amino acids incorporated into the PTC (site 150) were cognate amino acids (i.e., amino acids specified by the identity of the parent tRNA from which the ACE-tRNA was derived). These results indicate that translational fidelity was largely retained after optimization of the ACE-tRNA sequence.

[0210] References 1.Lueck,J.D.;Yoon,J.S.;Perales-Puchalt,A.;Mackey,A.L.;Infield,D.T.;Behlke,M.A.;Pope,M.R.;Weiner,D.B.;Skach,W.R.;McCray,P.B.,Jr.;Ahern,C.A.,Engineered transfer RNAs for suppression of premature termination codons.Nat Commun 2019,10(1),822. 2.Chatterjee,A.;Sun,S.B.;Furman,J.L.;Xiao,H.;Schultz,P.G.,A versatile platform for single-and multiple-unnatural amino acid mutagenesis in Escherichia coli.Biochemistry 2013,52(10),1828-37. 3.Serfling,R.;Lorenz,C.;Etzel,M.;Schicht,G.;Bottke,T.;Morl,M.;Coin,I.,Designer tRNAs for efficient incorporation of non-canonical amino acids by the pyrrolysine system in mammalian cells.Nucleic Acids Res 2018,46(1),1-10. 4.Guo,J.;Melancon,C.E.,3rd;Lee,H.S.;Groff,D.;Schultz,P.G.,Evolution of amber suppressor tRNAs for efficient bacterial production of proteins containing nonnatural amino acids.Angew Chem Int Ed Engl 2009,48(48),9148-51. 5.Rauch,B.J.;Porter,J.J.;Mehl,R.A.;Perona,J.J.,Improved Incorporation of Noncanonical Amino Acids by an Engineered tRNA(Tyr)Suppressor.Biochemistry 2016,55(3),618-28. 6.Keeling,K.M.;Xue,X.;Gunn,G.;Bedwell,D.M.,Therapeutics based on stop codon readthrough.Annu Rev Genomics Hum Genet 2014,15,371-94. 7.Rowe,S.M.;Miller,S.;Sorscher,E.J.,Cystic fibrosis.N Engl J Med 2005,352(19),1992-2001. 8.Shalev,M.;Baasov,T.,When Proteins Start to Make Sense:Fine-tuning Aminoglycosides for PTC Suppression Therapy.Medchemcomm 2014,5(8),1092-1105. 9.Baradaran-Heravi,A.;Balgi,A.D.;Zimmerman,C.;Choi,K.;Shidmoossavee,F.S.;Tan,J.S.;Bergeaud,C.;Krause,A.;Flibotte,S.;Shimizu,Y.;Anderson,H.J.;Mouly,V.;Jan,E.;Pfeifer,T.;Jaquith,J.B.;Roberge,M.,Novel small molecules potentiate premature termination codon readthrough by aminoglycosides.Nucleic Acids Res 2016,44(14),6583-98. 10.Schacht,J.,Antioxidant therapy attenuates aminoglycoside-induced hearing loss.Ann N Y Acad Sci 1999,884,125-30. 11.Sabbavarapu,N.M.;Shavit,M.;Degani,Y.;Smolkin,B.;Belakhov,V.;Baasov,T.,Design of Novel Aminoglycoside Derivatives with Enhanced Suppression of Diseases-Causing Nonsense Mutations.ACS Med Chem Lett 2016,7(4),418-23. 12.Bedwell,D.M.;Kaenjak,A.;Benos,D.J.;Bebok,Z.;Bubien,J.K.;Hong,J.;Tousson,A.;Clancy,J.P.;Sorscher,E.J.,Suppression of a CFTR premature stop mutation in a bronchial epithelial cell line.Nat Med 1997,3(11),1280-4. 13.Mutyam,V.;Du,M.;Xue,X.;Keeling,K.M.;White,E.L.;Bostwick,J.R.;Rasmussen,L.;Liu,B.;Mazur,M.;Hong,J.S.;Falk Libby,E.;Liang,F.;Shang,H.;Mense,M.;Suto,M.J.;Bedwell,D.M.;Rowe,S.M.,Discovery of Clinically Approved Agents That Promote Suppression of Cystic Fibrosis Transmembrane Conductance Regulator Nonsense Mutations.Am J Respir Crit Care Med 2016,194(9),1092-1103. 14.Xue,X.;Mutyam,V.;Tang,L.;Biswas,S.;Du,M.;Jackson,L.A.;Dai,Y.;Belakhov,V.;Shalev,M.;Chen,F.;Schacht,J.;R,J.B.;Baasov,T.;Hong,J.;Bedwell,D.M.;Rowe,S.M.,Synthetic aminoglycosides efficiently suppress cystic fibrosis transmembrane conductance regulator nonsense mutations and are enhanced by ivacaftor.Am J Respir Cell Mol Biol 2014,50(4),805-16. 15.Zomer-van Ommen,D.D.;Vijftigschild,L.A.;Kruisselbrink,E.;Vonk,A.M.;Dekkers,J.F.;Janssens,H.M.;de Winter-de Groot,K.M.;van der Ent,C.K.;Beekman,J.M.,Limited premature termination codon suppression by read-through agents in cystic fibrosis intestinal organoids.J Cyst Fibros 2016,15(2),158-62. 16.Leubitz,A.;Frydman-Marom,A.;Sharpe,N.;van Duzer,J.;Campbell,K.C.M.;Vanhoutte,F.,Safety,Tolerability,and Pharmacokinetics of Single Ascending Doses of ELX-02,a Potential Treatment for Genetic Disorders Caused by Nonsense Mutations,in Healthy Volunteers.Clin Pharmacol Drug Dev 2019,8(8),984-994. 17.Temple,G.F.;Dozy,A.M.;Roy,K.L.;Kan,Y.W.,Construction of a functional human suppressor tRNA gene:an approach to gene therapy for beta-thalassaemia.Nature 1982,296(5857),537-40. 18.Kiselev,A.V.;Ostapenko,O.V.;Rogozhkina,E.V.;Kholod,N.S.;Seit Nebi,A.S.;Baranov,A.N.;Lesina,E.A.;Ivashchenko,T.E.;Sabetskii,V.A.;Shavlovskii,M.M.;Rechinskii,V.O.;Kiselev,L.L.;Baranov,V.C.,[Suppression of nonsense mutations in the Dystrophin gene by a suppressor tRNA gene].Mol Biol(Mosk)2002,36(1),43-7. 19.Chin,J.W.,Expanding and reprogramming the genetic code of cells and animals.Annu Rev Biochem 2014,83,379-408. 20.Elliott,T.S.;Bianco,A.;Chin,J.W.,Genetic code expansion and bioorthogonal labelling enables cell specific proteomics in an animal.Curr Opin Chem Biol 2014,21,154-60. 21.Greiss,S.;Chin,J.W.,Expanding the genetic code of an animal.J Am Chem Soc 2011,133(36),14196-9. 22.Liu,J.;Hemphill,J.;Samanta,S.;Tsang,M.;Deiters,A.,Genetic Code Expansion in Zebrafish Embryos and Its Application to Optical Control of Cell Signaling.J Am Chem Soc 2017,139(27),9100-9103. 23.Xue,X.;Mutyam,V.;Thakerar,A.;Mobley,J.;Bridges,R.J.;Rowe,S.M.;Keeling,K.M.;Bedwell,D.M.,Identification of the amino acids inserted during suppression of CFTR nonsense mutations and determination of their functional consequences.Hum Mol Genet 2017,26(16),3116-3129. 24.Ye,S.;Kohrer,C.;Huber,T.;Kazmi,M.;Sachdev,P.;Yan,E.C.;Bhagat,A.;RajBhandary,U.L.;Sakmar,T.P.,Site-specific incorporation of keto amino acids into functional G protein-coupled receptors using unnatural amino acid mutagenesis.J Biol Chem 2008,283(3),1525-33. 25.Mukai,T.;Kobayashi,T.;Hino,N.;Yanagisawa,T.;Sakamoto,K.;Yokoyama,S.,Adding l-lysine derivatives to the genetic code of mammalian cells with engineered pyrrolysyl-tRNA synthetases.Biochem Biophys Res Commun 2008,371(4),818-22. 26.Hancock,S.M.;Uprety,R.;Deiters,A.;Chin,J.W.,Expanding the genetic code of yeast for incorporation of diverse unnatural amino acids via a pyrrolysyl-tRNA synthetase / tRNA pair.J Am Chem Soc 2010,132(42),14819-24. 27.Wang,L.;Schultz,P.G.,A general approach for the generation of orthogonal tRNAs.Chem Biol 2001,(9),883-90. 28.Rogerson,D.T.;Sachdeva,A.;Wang,K.;Haq,T.;Kazlauskaite,A.;Hancock,S.M.;Huguenin-Dezot,N.;Muqit,M.M.;Fry,A.M.;Bayliss,R.;Chin,J.W.,Efficient genetic encoding of phosphoserine and its nonhydrolyzable analog.Nat Chem Biol 2015,11(7),496-503. 29.Hughes,R.A.;Ellington,A.D.,Rational design of an orthogonal tryptophanyl nonsense suppressor tRNA.Nucleic Acids Res 2010,38(19),6813-30. 30.Ellefson,J.W.;Meyer,A.J.;Hughes,R.A.;Cannon,J.R.;Brodbelt,J.S.;Ellington,A.D.,Directed evolution of genetic parts and circuits by compartmentalized partnered replication.Nat Biotechnol 2014,32(1),97-101. 31.Dieci,G.;Fiorino,G.;Castelnuovo,M.;Teichmann,M.;Pagano,A.,The expanding RNA polymerase III transcriptome.Trends Genet 2007,23(12),614-22. 32.Gonos,E.S.;Goddard,J.P.,The role of the 5’-flanking sequence of a human tRNA(Glu) gene in modulation of its transcriptional activity in vitro.Biochem J 1990,272(3),797-803. 33.Schaack,J.;Sharp,S.;Dingermann,T.;Burke,D.J.;Cooley,L.;Soll,D.,The extent of a eukaryotic tRNA gene.5’-and 3’-flanking sequence dependence for transcription and stable complex formation.J Biol Chem 1984,259(3),1461-7. 34.Walker,S.C.;Engelke,D.R.,Ribonuclease P:the evolution of an ancient RNA enzyme.Crit Rev Biochem Mol Biol 2006,41(2),77-102. 35.Levinger,L.;Vasisht,V.;Greene,V.;Bourne,R.;Birk,A.;Kolla,S.,Sequence and structure requirements for Drosophila tRNA 5’-and 3’-end processing.J Biol Chem 1995,270(32),18903-9. 36.Piper,P.W.;Straby,K.B.,Processing of transcripts of a dimeric tRNA gene in yeast uses the nuclease responsible for maturation of the 3’termini upon 5 S and 37 S precursor rRNAs.FEBS Lett 1989,250(2),311-6. 37.Copela,L.A.;Fernandez,C.F.;Sherrer,R.L.;Wolin,S.L.,Competition between the Rex1 exonuclease and the La protein affects both Trf4p-mediated RNA quality control and pre-tRNA maturation.Rna 2008,14(6),1214-27. 38.Ozanick,S.G.;Wang,X.;Costanzo,M.;Brost,R.L.;Boone,C.;Anderson,J.T.,Rex1p deficiency leads to accumulation of precursor initiator tRNAMet and polyadenylation of substrate RNAs in Saccharomyces cerevisiae.Nucleic Acids Res 2009,37(1),298-308. 39.Vogel,A.;Schilling,O.;Spath,B.;Marchfelder,A.,The tRNase Z family of proteins:physiological functions,substrate specificity and structural properties.Biol Chem 2005,386(12),1253-64. 40.Nashimoto,M.,Distribution of both lengths and 5’terminal nucleotides of mammalian pre-tRNA 3’trailers reflects properties of 3’processing endoribonuclease.Nucleic Acids Res 1997,25(6),1148-54. 41.Phizicky,E.M.;Hopper,A.K.,tRNA biology charges to the front.Genes Dev 2010,24(17),1832-60. 42.Perona,J.J.;Hadd,A.,Structural diversity and protein engineering of the aminoacyl-tRNA synthetases.Biochemistry 2012,51(44),8705-29. 43.Chatterjee,A.;Xiao,H.;Yang,P.Y.;Soundararajan,G.;Schultz,P.G.,A tryptophanyl-tRNA synthetase / tRNA pair for unnatural amino acid mutagenesis in E.coli.Angew Chem Int Ed Engl 2013,52(19),5106-9. 44.LaRiviere,F.J.;Wolfson,A.D.;Uhlenbeck,O.C.,Uniform binding of aminoacyl-tRNAs to elongation factor Tu by thermodynamic compensation.Science 2001,294(5540),165-8. 45.Saks,M.E.;Sanderson,L.E.;Choi,D.S.;Crosby,C.M.;Uhlenbeck,O.C.,Functional consequences of T-stem mutations in E.coli tRNAThrUGU in vitro and in vivo.RNA 2011,17(6),1038-47. 46.Schrader,J.M.;Chapman,S.J.;Uhlenbeck,O.C.,Tuning the affinity of aminoacyl-tRNA to elongation factor Tu for optimal decoding.Proc Natl Acad Sci U S A 2011,108(13),5215-20. 47.Albers,J.;Danzer,C.;Rechsteiner,M.;Lehmann,H.;Brandt,L.P.;Hejhal,T.;Catalano,A.;Busenhart,P.;Goncalves,A.F.;Brandt,S.;Bode,P.K.;Bode-Lesniewska,B.;Wild,P.J.;Frew,I.J.,A versatile modular vector system for rapid combinatorial mammalian genetics.J Clin Invest 2015,125(4),1603-19. 48.Kurosaki,T.;Maquat,L.E.,Nonsense-mediated mRNA decay in humans at a glance.J Cell Sci 2016,129(3),461-7. 49.Asahara,H.;Uhlenbeck,O.C.,The tRNA specificity of Thermus thermophilus EF-Tu.Proc Natl Acad Sci U S A 2002,99(6),3499-504. 50.Dale,T.;Sanderson,L.E.;Uhlenbeck,O.C.,The affinity of elongation factor Tu for an aminoacyl-tRNA is modulated by the esterified amino acid.Biochemistry 2004,43(20),6159-66. 51.Sanderson,L.E.;Uhlenbeck,O.C.,The 51-63 base pair of tRNA confers specificity for binding by EF-Tu.Rna 2007,13(6),835-40. 52.Schrader,J.M.;Chapman,S.J.;Uhlenbeck,O.C.,Understanding the sequence specificity of tRNA binding to elongation factor Tu using tRNA mutagenesis.J Mol Biol 2009,386(5),1255-64. 53.Zeng,W.;Vu,G.P.;Bai,Y.;Chen,Y.C.;Trang,P.;Lu,S.;Xiao,G.;Liu,F.,RNase P-associated external guide sequence effectively reduces the expression of human CC-chemokine receptor 5 and inhibits the infection of human immunodeficiency virus 1.Biomed Res Int 2013,2013,509714. 54.Zhang,Z.;Ye,Y.;Gong,J.;Ruan,H.;Liu,CJ;Xiang,Y.;Cai,C.;Guo,AY;Ling,J.;Diao,L.;Weinstein,JN;Han,L.,Global analysis of tRNA and translation factor expression reveals a dynamic landscape of translational regulation in human cancers.Commun Biol 2018,1,234.

[0211] The foregoing examples and description of preferred embodiments should be understood as illustrating, rather than limiting, the present disclosure as defined by the claims. As will be readily understood, numerous variations and combinations of the features described above can be utilized without departing from the present disclosure as defined by the claims. Such variations are not considered to be departures from the scope of the present disclosure, and all such variations are intended to be included within the scope of the following claims. All references cited herein are incorporated by reference in their entirety.

Claims

1. A non-naturally occurring nucleic acid comprising a modified sequence selected from SEQ ID NOs: 152, 154-162, 164-177, 179-194, 196-210 and 228-251 as set forth in Table 9 or 10.

2. The nucleic acid of claim 1 , further comprising a tabulator sequence.

3. The nucleic acid of claim 2 , wherein the tabulator sequence encodes a ribozyme.

4. The nucleic acid described in claim 1, further comprising an upstream control element (UCE) operably linked to the 5' end of the 5' leader segment.

5. 5. The nucleic acid of claim 4, wherein the upstream regulatory element comprises a U6 promoter or an H1 promoter, or a sequence selected from SEQ ID NOs: 148-151 shown in Table 8.

6. The nucleic acid described in claim 1, wherein the tRNA is an anticodon-edited tRNA (ACE-tRNA).

7. An expression cassette or vector comprising the nucleic acid of any one of claims 1 to 6.

8. A nucleic acid according to any one of claims 1 to 6, or An expression cassette or vector comprising the nucleic acid of any one of claims 1 to 6. A host cell, or a progeny of said host cell, comprising:

9. 10. A pharmaceutical formulation comprising: (i) a nucleic acid according to any one of claims 1 to 6, or an expression cassette or vector comprising the nucleic acid according to any one of claims 1 to 6; and (ii) a pharmaceutically acceptable carrier.

10. 1. A method for expressing or introducing a tRNA into a cell, comprising: (i) contacting the cell with a nucleic acid according to any one of claims 1 to 6, or an expression cassette or vector comprising a nucleic acid according to any one of claims 1 to 6; (ii) maintaining the cells under conditions that allow expression of the tRNA.

11. For use in a method of treating a disease associated with PTC in a subject in need thereof. The nucleic acid according to claim 6 . An expression cassette or vector comprising the nucleic acid according to any one of claims 1 to 6, or a pharmaceutical composition comprising the nucleic acid or the expression cassette or vector And, The method comprises administering to the subject the nucleic acid, expression cassette or vector, or pharmaceutical composition.

12. The diseases include cystic fibrosis, Duchenne and Becker muscular dystrophy, retinoblastoma, neurofibromatosis, ataxia-telangiectasia, Tay-Sachs disease, Wilms' tumor, hemophilia A, hemophilia B, Menkes disease, Ullrich's disease, β-thalassemia, von Willebrand disease types 2A and 3, Robinow syndrome, brachydactyly type B (shortened fingers and metacarpals), genetic susceptibility to mycobacterial infections, inherited retinal diseases, inherited bleeding tendencies, hereditary blindness, congenital sensorineural deafness, and colonic intestinal ganglion cell deficiency. agangliosis), and inherited neurodevelopmental disorders including sensorineural hearing loss, intestinal ganglionic deficiency, peripheral neuropathy and central hypomyelination, Liddle syndrome, xeroderma pigmentosum, Fanconi anemia, anemia, hypothyroidism, p53-related cancer, esophageal cancer, bone cancer, ovarian cancer, hepatocellular carcinoma, breast cancer, hepatocellular carcinoma, fibrous histiocytoma, ovarian cancer, SRY sex reversal, triosephosphate isomerase anemia, diabetes mellitus, rickets, Hurler syndrome, Dravet syndrome, spinal muscular dystrophy, Usher syndrome, aniridia, choroideremia, ophthalmopathy, retinitis pigmentosa, dystrophic epidermolysis bullosa, pseudoxanthoma elasticum, Alagille syndrome 12. The nucleic acid, expression cassette or vector or pharmaceutical composition for use according to claim 11, wherein the nucleic acid, expression cassette or vector is selected from the group consisting of: X-linked nephrogenic diabetes insipidus, McArdle's disease, polycystic kidney disease, Waardenburg-Schar syndrome, childhood neuronal ceroid lipofuscinosis, cystinosis, X-linked nephrogenic diabetes insipidus, McArdle's disease and polycystic kidney disease.

13. 13. The nucleic acid, expression cassette or vector or pharmaceutical composition for use according to claim 12, wherein the disease is an ocular genetic disease selected from the group consisting of cone dystrophy, Stargardt disease (STGD1), cone-rod dystrophy, retinitis pigmentosa (RP), increased susceptibility to age-related macular degeneration, congenital stationary night blindness 2 (CSNB2), congenital stationary night blindness 1 (CSNB1), Best's disease, VMD, and Leber's congenital amaurosis (LCA16).

14. 13. The nucleic acid, expression cassette or vector or pharmaceutical composition for use according to claim 12, wherein the administering is carried out using viral delivery, nanoparticles, electroporation, polyethyleneimine (PEI), receptor-targeted polyplexes, liposomes, or hydrodynamic injection.

Images