Compositions and methods for modulating nuclear factor of activated T cells (NFAT) activity in T cells

Abstract

The present invention relates to a method for regulating nuclear factor of activated T cells (NFAT) activity and / or restoring suppressed NFAT activity in T cells of a subject in need thereof. In another aspect, the present invention provides various herbal compositions for regulating NFAT activity in T cells of a subject in need thereof. TIFF2025507857000004.tif139148

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority under 35 U.S.C. §119(e) to U.S. Provisional Patent Application No. 63 / 315,163, filed March 1, 2022, which is incorporated by reference in its entirety.

[0002] Sequence Listing This application contains a Sequence Listing in XML format, which is incorporated herein by reference in its entirety. Created on Feb. 15, 2023, the XML file is named 047162_7355WO1_SequenceListing.xml and is 3000 bytes in size. [Background technology]

[0003] 2. Background of the Invention Nuclear factor of activated T cells (NFAT) is a family of transcription factors consisting of five members, namely NFATc1, NFATc2, NFATc3, NFATc4, and NFAT5. NFAT is well known to regulate immune response. At least one member of the NFAT family is expressed in most cells of the immune system. In addition, NFAT is also known to be involved in the development of the heart, skeletal muscle, and nervous system. NFAT has been investigated as a drug target for several different diseases and disorders, such as inflammatory bowel disease and some types of cancer. There is also an unmet need in the art to develop compositions and methods for regulating NFAT activity. The present invention addresses this need. Summary of the Invention

[0004] In one aspect, the present invention provides a method for enhancing nuclear factor of activated T cells (NFAT) activity and / or restoring suppressed NFAT activity in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of at least one herbal composition selected from the group of herbal compositions described elsewhere herein.

[0005] In another aspect, the present invention provides a method of enhancing the efficacy of chimeric antigen receptor T cell (CAR T) immunotherapy in a subject, the method comprising administering to the subject a therapeutically effective amount of at least one herbal composition selected from the group of herbal compositions described elsewhere herein.

[0006] In yet another aspect, the present invention provides a method of enhancing efficacy of immune checkpoint blockade therapy in a subject, the method comprising administering to the subject a therapeutically effective amount of at least one herbal composition selected from the group of herbal compositions described elsewhere herein.

[0007] In yet another aspect, the present invention provides an herbal composition for modulating NFAT activity in T cells of a subject in need thereof, the herbal composition being selected from the group of compositions described elsewhere herein.

[0008] In yet another aspect, the present invention provides a method for enhancing the effectiveness of a vaccine in a subject, the method comprising administering to the subject a therapeutically effective amount of at least one herbal composition selected from the group of herbal compositions described elsewhere herein.

[0009] In certain embodiments, the herbal composition is at least one selected from the group consisting of: (a) herbal extract PHY906, comprising the herbal extracts of Scutellaria baicalensis (S), Glycyrrhiza uralensis (G), Paeonia lactiflora (P), and Ziziphus jujuba (Z), a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (b) an herbal extract of S, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (c) an herbal extract containing an extract of S, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (d) an herbal extract of G, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (e) an herbal extract, including an extract of G, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (f) an herbal extract of P, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; and (g) an herbal extract, including an extract of P, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (h) an herbal extract of Z, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; and (i) An herbal extract comprising an extract of Z, a fraction thereof, or any active chemicals present in the herbal extract or a fraction thereof.

[0010] In certain embodiments, the active chemical in the herbal extract of S or a fraction thereof is at least one selected from the group consisting of oroxylin A 7-O-β-D-glucuronide, baicalein, oroxylin A, baicalin, an isomer of baicalin, chrysin 6-C-arabinoside 8-C-glucoside, acteoside, vicizulin I 2'-O-glucoside, and chrysin.

[0011] In certain embodiments, the active chemical in the herbal extract of G or a fraction thereof is at least one selected from the group consisting of liquiritigenin, isoliquiritigenin, liquiritin, isoliquiritin, licochalcone A, and glycycoumarin.

[0012] In certain embodiments, the active chemical in the herbal extract of P or a fraction thereof is at least one selected from the group consisting of gallic acid, 4-o-methylpaeoniflorin, 4-o-methylpaeoniflorin isomer, 6'-O-galloylpaeoniflorin, albiflorin, and paeoniflorin.

[0013] In certain embodiments, the herbal composition is administered orally to the subject.

[0014] In certain embodiments, the herbal composition is formulated as one selected from the group consisting of a pill, a tablet, a capsule, a soup, a tea, a concentrate, a dragee, a liquid, a drop, and a gelatin capsule.

[0015] In certain embodiments, the therapeutically effective amount of the herbal composition is from about 20 mg / day to about 2 g / day.

[0016] In a particular embodiment, the therapeutically effective amount of the herbal composition is about 1,600 mg / day.

[0017] In certain embodiments, the method induces protein phosphorylation of the downstream cascade of the T cell receptor (TCR) and inhibits SH2-containing phosphatase 2 (SHP2) activity.

[0018] In certain embodiments, the herbal composition is administered at a time selected from prior to, concurrently with, and after administration of immune checkpoint inhibitor therapy or chimeric antigen receptor T (CAR T) cell therapy or a vaccine.

[0019] In certain embodiments, the immune checkpoint inhibitor therapy comprises administering at least one immune checkpoint inhibitor selected from the group consisting of ipilimumab, pembrolizumab, nivolumab, durvalumab, avelumab, dostallimab-gxly, cemiplimab-rwlc, toripalimab, camrelizumab, tislelizumab, pemplimab, zimberelimab, sintilimab, and atezolizumab.

[0020] In certain embodiments, the method comprises: a) enhancing the efficacy of CAR T cell therapy; b) enhancing the efficacy of immune checkpoint inhibitor therapy, and c) Increasing the effectiveness of vaccines It is advantageous for the at least one selected from the group consisting of:

[0021] In certain embodiments, the methods are used for cancer chemoprevention.

[0022] In certain embodiments, the composition further comprises a pharma- ceutically acceptable carrier.

[0023] In certain embodiments, the subject is a mammal, hi certain embodiments, the subject is a human subject. [Brief description of the drawings]

[0024] The following detailed description of specific embodiments of the invention will be better understood when read in conjunction with the accompanying drawings. For the purpose of illustrating the invention, specific embodiments are shown in the drawings. It should be understood, however, that the invention is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings. [Figure 1A]Figures 1A-1F illustrate the effects of YIV-906 and its component herbs, namely Glycyrrhiza uralensis Fisch (G), Paeonia lactiflora Pall (P), Scutellaria baicalensis Georgi (S), and Ziziphus jujuba Mill (Z), on the NFAT-mediated transcriptional activity of Jurkat cells incubated with wild-type Raji cells in the absence or presence of Staphylococcal superantigen E (SEE). The effects of YIV-906 and its single herbs on the NFAT-mediated transcriptional activity of Jurkat cells incubated with Raji cells in the absence (Figure 1A) and presence (Figure 1B) of SEE are compared. Furthermore, the effect of the combination of two herbs on the NFAT-mediated transcription activity of Jurkat cells incubated with Raji cells in the absence (Fig. 1C) and presence (Fig. 1D) of SEE is also shown. In addition, the effect of YIV-906, minus one herb -G, -P, -S, and -Z on the NFAT-mediated transcription activity of Jurkat cells incubated with Raji cells in the absence (Fig. 1E) and presence (Fig. 1F) of SEE is also shown. Equal amounts of water extracts up to 320ug / ml were added to Jurkat cells. Jurkat cells were stably transfected with NFAT luciferase reporter together with Raji cells for 24 hours in the absence or presence of Staphylococcal superantigen E (SEE) (10ng / ml) and then luciferase activity was measured. [Figure 1B] See legend to Figure 1A. [Figure 1C] See legend to Figure 1A. [Figure 1D] See legend to Figure 1A. [Figure 1E] See legend to Figure 1A. [Figure 1F] See legend to Figure 1A. [Figure 2A]Figures 2A-2F illustrate the effects of YIV-906 and its component herbs, namely Glycyrrhiza uralensis fischii (G), Paeonia lactiflora Paul (P), Scutellaria baicalensis George (S), and Ziziphus jujuba Mill (Z), on the NFAT-mediated transcriptional activity of PD1-overexpressed Jurkat cells incubated with PD-L1-overexpressed Raji cells in the absence or presence of SEE. The effects of YIV-906 and its single herbs on the NFAT-mediated transcriptional activity of Jurkat-PD1 cells incubated with Raji-PD-L1 cells in the absence (Figure 2A) and presence (Figure 2B) of SEE are shown. The effect of the combination of two herbs on the NFAT-mediated transcription activity of Jurkat-PD1 cells incubated with Raji-PD-L1 cells in the absence (Figure 2C) and presence (Figure 2D) of SEE is also shown. In addition, the effect of YIV-906, minus one herb -G, -P, -S, and -Z on the NFAT-mediated transcription activity of Jurkat-PD1 cells incubated with Raji-PD-L1 cells in the absence (Figure 2E) and presence (Figure 2F) of SEE is also shown. Equal amounts of water extracts up to 320ug / ml were added to Jurkat-PD1 cells. Jurkat-PD1 cells were stably transfected with NFAT luciferase reporter together with Raji-PD-L1 cells for 24 hours in the absence or presence of SEE (10ng / ml), and then luciferase activity was measured. [Figure 2B] See legend to Figure 2A. [Figure 2C] See legend to Figure 2A. [Figure 2D] See legend to Figure 2A. [Figure 2E] See legend to Figure 2A. [Figure 2F] See legend to Figure 2A. [Figure 3A]3A-3D are graphs showing the effect of YIV-906 on the T activation marker CD69 of PD1-overexpressed Jurkat cells when incubated with non-PD-L1-overexpressed Raji or PD-L1-overexpressed Raji. Shown is the effect of YIV-906 on the median fluorescence (FIG. 3A) and population (FIG. 3B) of Jurkat PD1 cells when incubated with wild-type Raji cells in the absence or presence of SEE antigen. Also shown is the effect of YIV-906 on the median fluorescence (FIG. 3C) and population (FIG. 3D) of Jurkat PD1 cells when incubated with PD-L1-overexpressing Raji cells in the absence or presence of SEE antigen. Water extracts of YIV-906 up to 320ug / ml were added to Jurkat-PD1 cells along with wild-type or PD-L1-overexpressing Raji cells in the absence or presence of SEE (3ng / ml, 10ng / ml) for 24 hours. CD69 expression was measured by flow cytometry. In flow cytometry, FITC-conjugated anti-CD69 was used to measure CD69 protein expression on the membrane of Jurkat cells, and PE-conjugated anti-PD1 was used to gate Jurkat PD1 cells from the mixture of Jurkat / Raji cells. [Figure 3B] See legend to Figure 3A. [Figure 3C] See legend to Figure 3A. [Figure 3D] See legend to Figure 3A. [Figure 4A] Figures 4A-4D show the chemical structures of pure compounds selected from YIV-906 competent herbs, namely, S (Figure 4A), P (Figure 4B), Z (Figure 4C), and G (Figure 4D), to examine their effects on NFAT activity in Jurkat cells. [Figure 4B] See legend to Figure 4A. [Figure 4C] See legend to Figure 4A. [Figure 4D] See legend to Figure 4A. [Figure 5A]Figures 5A-5D illustrate the effect of S compounds on NFAT-mediated transcriptional activity of PD1-overexpressed Jurkat cells incubated with PD-L1-overexpressed Raji cells in the absence or presence of SEE. The effect of S compounds on NFAT-mediated transcriptional activity of Jurkat-PD1 cells incubated with wild-type Raji in the absence (Figure 5A) and presence (Figure 5B) of SEE is shown. The effect of S compounds on NFAT-mediated transcriptional activity of Jurkat-PD1 cells incubated with Raji-PD-L1 cells in the absence (Figure 5C) and presence (Figure 5D) of SEE is also shown. Up to 40uM of S compounds were added to Jurkat-PD1 cells. Jurkat-PD1 cells were stably transfected with an NFAT luciferase reporter along with wild-type Raji cells or Raji-PD-L1 cells for 24 hours in the absence or presence of Staphylococcal Superantigen E (SEE) (10 ng / ml), after which luciferase activity was measured. Figures 5E-5H illustrate the effect of P compounds on the NFAT-mediated transcriptional activity of PD1-overexpressed Jurkat cells incubated with PD-L1-overexpressed Raji cells in the absence or presence of Staphylococcal Superantigen E (SEE). The effect of P compounds on the NFAT-mediated transcriptional activity of Jurkat-PD1 cells incubated with wild-type Raji in the absence (Figure 5E) and presence of SEE (Figure 5F) is shown. Effect of P compounds on NFAT-mediated transcriptional activity of Jurkat-PD1 cells incubated with Raji-PD-L1 cells in the absence (Figure 5C) and presence (Figure 5H) of SEE. P compounds up to 160uM were added to Jurkat-PD1 cells. Jurkat-PD1 cells were stably transfected with an NFAT luciferase reporter together with wild-type Raji or Raji-PD-L1 cells for 24 hours in the absence or presence of SEE (10ng / ml), after which luciferase activity was measured. [Figure 5B] See legend to Figure 5A. [Figure 5C] See legend to Figure 5A. [Figure 5D] See legend to Figure 5A. [Figure 5E] See legend to Figure 5A. [Figure 5F] See legend to Figure 5A. [Figure 5G] See legend to Figure 5A. [Figure 5H] See legend to Figure 5A. [Figure 6A] Figures 6A-6D illustrate the effects of G and Z compounds on NFAT-mediated transcriptional activity of PD1-overexpressed Jurkat cells incubated with wild-type Raji cells or PD-L1-overexpressed Raji cells in the absence or presence of SEE. The effects of G and Z compounds on NFAT-mediated transcriptional activity of Jurkat-PD1 cells incubated with wild-type Raji in the absence (Figure 6A) and presence (Figure 6B) of SEE are shown. The effects of S compounds on NFAT-mediated transcriptional activity of Jurkat-PD1 cells incubated with Raji-PD-L1 cells in the absence (Figure 6C) and presence (Figure 6D) of SEE are also shown. Up to 40uM of G and Z compounds were added to Jurkat-PD1 cells. Jurkat-PD1 cells were stably transfected with an NFAT luciferase reporter together with wild-type Raji or Raji-PD-L1 cells in the absence or presence of Staphylococcal superantigen E (SEE) (10 ng / ml) for 24 h, after which luciferase activity was measured. [Figure 6B] See legend to Figure 6A. [Figure 6C] See legend to Figure 6A. [Figure 6D] See legend to Figure 6A. [Figure 7A]7A-7F illustrate the effects of YIV-906, S, and S compounds on NFAT-mediated transcriptional activity of Jurkat-PD1 cells and T cell receptor-αβ (TCRαβ) knockout Jurkat-PD1 cells. Detection of TCRαβ in Jurkat-PD1 cells (FIG. 7A) and Jurkat-PD1 TCRαβ knockout cells (FIG. 7B) by using FITC-conjugated anti-TCRαβ and flow cytometry is shown. The effects of YIV-906 (FIG. 7C), S (FIG. 7C), and S compounds (FIG. 7D) on NFAT-mediated transcriptional activity of Jurkat-PD1 cells are shown. The effects of YIV-906 (FIG. 7E), S (FIG. 7E), and S compounds (FIG. 7F) on NFAT-mediated transcriptional activity of Jurkat-PD1 TCRαβ knockout cells are also shown. [Figure 7B] See legend to Figure 7A. [Figure 7C] See legend to Figure 7A. [Figure 7D] See legend to Figure 7A. [Figure 7E] See legend to Figure 7A. [Figure 7F] See legend to Figure 7A. [Figure 8]Figures 8A-8D are Western blot analyses showing the effect of fractions of YIV-906 (Figure 8A), single-species herb (Figure 8B), YIV-906 (Figure 8B), P (Figure 8C), and S (Figure 8D) on protein phosphorylation of the T cell receptor signaling cascade, including Lck, Fyn, Zap70, LAT, and Pyk2. YIV-906, S, and P were fractionated using a C18 solid-phase extraction column by elution with water and increasing percentages of acetonitrile / methanol (A / M). All eluted fractions were dried and reconstituted in water to equal concentrations of 100 mg / ml. Jurkat cells were treated with equal doses of 320ug / ml of YIV-906 (Figure 8A), single herb (Figure 8A), YIV-906 fraction (Figure 8B), P fraction (Figure 8C), and S fraction (Figure 8D) for 45 minutes. Western blot analysis was used to measure protein phosphorylation using specific antibodies. GAPDH was used to normalize protein loading. [Figure 9A] Figures 9A-9B show the chemical identification of P (Figure 9A) and S (Figure 9B) fractions after C18 column fractionation and their effect on protein phosphorylation of Lck, Zap70, Lat, Fyn / Src, Pyk2. Equal concentrations of 10mg / ml were used for LC-MS analysis. Equal concentrations (320ug / ml) and 45 minutes were used to treat Jurkat cells for Western blot analysis. Chemicals identified (putative) based on their mass and the mass of their fragments are listed under each fraction. Chemicals that were not identified were not included in the figures. Fractions that were able to induce phosphorylation of specific proteins are indicated with an upward red arrow. [Figure 9B] See legend to Figure 9A. [Figure 10] Figure 10 shows the effect of S and P compounds on protein phosphorylation of the T cell receptor signaling cascade, including Lck, Fyn, Zap70, LAT, and Pyk2. Jurkat cells were treated with S and P compounds for 45 minutes. Western blot analysis was used to measure protein phosphorylation with specific antibodies. [Figure 11] Figures 11A-11D illustrate the effect of YIV-906 and its constituents on SHP2 activity. Figure 11A illustrates the effect of YIV-906 with or without β-glucuronidase treatment on SHP2 activity. Figure 11B shows the effect of 1 mg / ml YIV-906 and its constituent herbs G, P, S, and Z on SHP2 activity. Figure 11C shows the effect of 40 uM of G compound on SHP2 activity. Figure 11D shows the effect of 40 uM of S compound on SHP2 activity. SHP2 activity was measured by p-nitrophenyl phosphate (pNPP) colorimetric assay. In this assay, pNPP was used as a substrate, and SHP2 activity was reflected by an increase in absorbance at 450 nm. [Figure 12] Figures 12A-12B illustrate the effect of the combination of YIV-906 and Nivolumab on NFAT-mediated transcriptional activity of PD1-overexpressed Jurkat cells incubated with wild-type Raji cells or PD-L1-overexpressed Raji cells in the presence of 10ng / ml (Figure 12A) or 30ng / ml (Figure 12B) of Staphylococcal Superantigen E (SEE). Jurkat-PD1 cells were treated with 18ug / ml of biosimilar Nivolumab for 24 hours, and then 160ug / ml of YIV-906 water extract and wild-type Raji cells or Raji-PD-L1 cells were added to Jurkat PD1 cells for another 24 hours, after which luciferase activity was measured. [Figure 13A]Figures 13A-13F illustrate the effects of YIV-906, S, and S compounds on the NFAT-mediated transcriptional activity of Jurkat cells induced by the interaction of a chimeric antigen receptor (CAR-CD19-CD3z) on Jurkat cells with CD19 on Raji cells. The effects of YIV-906 (Figure 13A), S (Figure 13A), and S compounds (Figure 13B) on the NFAT-mediated transcriptional activity of Jurkat-PD1 cells with a chimeric antigen receptor (CAR-CD19-CD3z) are shown. The effects of YIV-906 (Figure 13C), S (Figure 13C), and S compounds (Figure 13D) on the NFAT-mediated transcriptional activity of Jurkat-PD1 cells with a chimeric antigen receptor (CAR-CD19-CD3z) and incubated with wild-type Raji cells are also shown. Effects of YIV-906 (Figure 13E), S (Figure 13E), and S compound (Figure 13F) on NFAT-mediated transcriptional activity of Jurkat-PD1 cells bearing chimeric antigen receptor (CAR-CD19-CD3z) and incubated with Raji-PD-L1 cells. YIV-906, S water extract up to 320ug / ml, and 40uM S compound were added to Jurkat-PD1-CAR-CD19 cells. Jurkat-PD1-CAR-CD19 cells were stably transfected with NFAT luciferase reporter together with wild-type Raji cells or Raji-PD-L1 cells for 24 hours, and then luciferase activity was measured. [Figure 13B] See legend to Figure 13A. [Figure 13C] See legend to Figure 13A. [Figure 13D] See legend to Figure 13A. [Figure 13E] See legend to Figure 13A. [Figure 13F] See legend to Figure 13A. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0025] Detailed Description of the Invention Reference will now be made in detail to certain aspects of the disclosed subject matter. While the disclosed subject matter will be described in conjunction with the enumerated claims, it will be understood that the exemplified subject matter is not intended to limit the claims to the disclosed subject matter.

[0026] definition As used herein, each of the following terms has the meaning associated with it in this section.

[0027] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, exemplary methods and materials are described.

[0028] Generally, the nomenclature used herein and the laboratory procedures in pharmacology, natural products chemistry, and organic chemistry are those well known and commonly used in the art.

[0029] As used herein, the articles "a" and "an" refer to one or to more than one (i.e., at least one) of the grammatical object of the article. For example, "an element" means one element or more than one element.

[0030] The term "about" as used herein allows for some variability in values ​​or ranges, for example, within 10%, within 5%, or within 1% of a stated value or the boundaries of a stated range, and includes the exact value or range stated.

[0031] The term "substantially" as used herein means a majority or majority, such as at least about 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 99.99%, or at least about 99.999% or more, or 100%. The term "substantially free" as used herein means having no or an insignificant amount of a substance such that the amount of a substance present does not affect the material properties of a composition that includes the substance, and thus the composition is free of about 0 wt% to about 5 wt% of a substance, or about 0 wt% to about 1 wt%, or about 5 wt% or less, or about 4.5 wt%, about 4 wt%, about 3.5 wt%, about 5 wt%, about 6 wt%, about 7 wt%, about 8 wt%, about 9 wt%, about 10 wt%, about 15 wt%, about 20 wt%, about 25 wt%, about 30 wt%, about 40 wt%, about 5 ... %, about 3 wt%, about 2.5 wt%, about 2 wt%, about 1.5 wt%, about 1 wt%, about 0.9 wt%, about 0.8 wt%, about 0.7 wt%, about 0.6 wt%, about 0.5 wt%, about 0.4 wt%, about 0.3 wt%, about 0.2 wt%, about 0.1 wt%, about 0.01 wt%, or about 0.001 wt% or less. The term "substantially free" can mean having an insignificant amount such that the composition is about 0 wt% to about 5 wt% of a substance, or about 0 wt% to about 1 wt%, or about 5 wt% or less, or about 4.5 wt%, about 4 wt%, about 3.5 wt%, about 3 wt%, about 2.5 wt%, about 2 wt%, about 1.5 wt%, about 1 wt%, about 0.9 wt%, about 0.8 wt%, about 0.7 wt%, about 0.6 wt%, about 0.5 wt%, about 0.4 wt%, about 0.3 wt%, about 0.2 wt%, about 0.1 wt%, about 0.01 wt%, or about 0.001 wt% or less, or about 0 wt%.

[0032] As used herein, the term "cancer" is defined as a disease characterized by rapid and uncontrollable proliferation of abnormal cells.Cancer cells can spread locally or through bloodstream and lymphatic system to other body parts.Examples of various cancers include, but are not limited to, bone cancer, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, kidney cancer, liver cancer, brain cancer, lymphoma, leukemia, and lung cancer.

[0033] In one aspect, the terms "co-administered" and "co-administration" in relation to a subject refer to administering the compound and / or composition of the present disclosure to a subject together with a compound and / or composition that can also treat or prevent the disease or disorder contemplated herein.In certain embodiments, the compound and / or composition that is co-administered is administered separately or in any kind of combination as part of a single therapeutic approach.The compound and / or composition that is co-administered can be formulated in any kind of combination as a mixture of solid and liquid in the form of various solid, gel and liquid formulations, as well as liquid formulations.

[0034] As used herein, the term "extract" refers to a concentrated preparation or solution of a compound or drug derived from a naturally occurring source, such as a herb or other plant material. Extracts can be prepared by several processes, including steeping the herb in solution, or drying and grinding the herb into a powder and dissolving the powder in a solution. Extracts may be further concentrated by removing a portion of the solvent after dissolving an amount of the desired compound in the solution. Extracts may also be strained or centrifuged to remove any solid material from the solution.

[0035] As used herein, the term "inhibit" refers to measurably decreasing or completely preventing the expression, stability, function, or activity of a molecule, reaction, interaction, gene, and / or protein. An inhibitor is, for example, a compound that binds to, partially or completely blocks, reduces, prevents, delays activation, inactivates, reduces sensitivity, or downregulates the stability, expression, function, and activity of a protein and / or gene, e.g., an antagonist.

[0036] As used herein, the term "pharmaceutical composition" or "composition" refers to a mixture of at least one compound useful within the scope of the present disclosure and a pharma- ceutical composition facilitates administration of the compound to a subject.

[0037] As used herein, the term "pharmaceutically acceptable" refers to a substance, such as a carrier or diluent, that does not abrogate the biological activity or properties of a compound useful within the scope of the present disclosure and is relatively non-toxic, i.e., the substance may be administered to a subject without causing undesired biological effects or interacting in a deleterious manner with any of the components of the composition in which it is contained.

[0038] As used herein, the term "pharmaceutical acceptable carrier" refers to a pharmaceutically acceptable substance, composition, or carrier, such as a liquid or solid bulking agent, stabilizer, dispersing agent, suspending agent, diluent, excipient, thickener, solvent, or encapsulating material, involved in carrying or transporting a compound useful within the scope of the present disclosure into or to a subject so that it can perform its intended function. Typically, such constructs are carried or transported from one organ or part of the body to another organ or part of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation, including the compounds useful within the scope of the present disclosure, and not harmful to the subject. Some examples of substances which may serve as pharma- ceutically acceptable carriers include sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives, such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository wax; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as propylene glycol; polyhydric alcohols such as glycerin, sorbitol, mannitol, and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffers such as magnesium hydroxide and aluminum hydroxide; surfactants; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; phosphate buffers; and other non-toxic compatible substances used in pharmaceutical preparations. As used herein, "pharmaceutically acceptable carriers" also include any and all coatings, antibacterial and antifungal agents, absorption delaying agents, and the like, that are compatible with the activity of the compounds useful within the scope of the present disclosure and are physiologically acceptable to the subject. Supplementary active compounds may also be admixed into the composition. "Pharmaceutically acceptable carriers" may further include pharmaceutically acceptable salts of the compounds useful within the scope of the present disclosure.Other additional ingredients that may be included in pharmaceutical compositions used in the practice of the present disclosure are known in the art and described, for example, in Remington's Pharmaceutical Sciences (Genaro, Ed., Mack Publishing Co., 1985, Easton, Pa.), which is incorporated herein by reference.

[0039] As used herein, the term "YIV-906" refers to an herbal composition including Glycyrrhiza uralensis Fisch (G), Paeonia lactiflora Paul (P), Scutellaria baicalensis George (S), and Ziziphus jujuba Mill (Z). YIV-906 can refer to a specific composition including S, G, P, and Z in a ratio of 3:2:2:2, prepared under standard operating procedures that include, for example, hot water extraction of S, G, P, and Z in some embodiments.

[0040] As used herein, the terms "prevent", "prevention" or "preventing" refer to any method for partially or completely preventing or delaying the onset of one or more symptoms or characteristics of a disease, disorder, and / or condition, such as cancer. Prevention refers to not developing clinical symptoms of a disease state, i.e., inhibiting the onset of disease in a subject who may be exposed to or susceptible to a disease state, but who has not yet experienced or shown symptoms of the disease state. Prevention may be administered to a subject who does not show signs of a disease, disorder, and / or condition. In some embodiments, delaying the onset of one or more symptoms or characteristics of a disease or disorder means that, when a recurrence of the disease or disorder or one or more symptoms of the disease or disorder occurs, the disease or disorder or one or more symptoms of the disease or disorder recurs at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% later than the disease or disorder or one or more symptoms of the disease or disorder would recur in the absence of administration of YIV-906.

[0041] As used herein, the terms "subject," "patient," or "individual" to which administration is contemplated include, but are not limited to, humans (i.e., male or female of any age group, e.g., pediatric subjects (e.g., infants, children, adolescents) or adult subjects (e.g., young adults, middle-aged adults, or elderly adults)), and / or other primates (e.g., cynomolgus monkeys, rhesus monkeys); mammals, including commercially significant mammals such as cows, pigs, horses, sheep, goats, cats, and / or dogs; and / or birds, including commercially significant birds such as chickens, ducks, geese, quail, and / or turkeys.

[0042] As used herein, the term "therapeutically effective amount" refers to the amount of the compound of the present disclosure that, when administered to a patient, treats, minimizes, and / or alleviates the symptoms of a disease or disorder.The amount of the compound of the present disclosure that corresponds to a "therapeutically effective amount" will vary depending on the compound, the disease state and its severity, and the age of the patient to be treated, etc.The therapeutically effective amount can be determined routinely by those skilled in the art, taking into account their own knowledge and this disclosure.

[0043] As used herein, the term "treatment" or "treating" is defined as the application or administration of a therapeutic agent, i.e., a compound useful within the scope of this disclosure (alone or in combination with another pharmaceutical agent), to a subject, or the application or administration of a therapeutic agent to a tissue or cell line isolated (e.g., for diagnostic or ex vivo uses) from a subject having cancer, symptoms of cancer, or the potential for developing cancer, with the intent to cure, heal, alleviate, ameliorate, alter, treat, palliate, ameliorate, or affect the cancer, symptoms of cancer, or the potential for developing cancer. Such treatments may be individualized or modified based on knowledge obtained from the field of pharmacogenomics.

[0044] Ranges: Throughout this disclosure, various aspects of the disclosure may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the disclosure. Thus, the description of a range should be considered to have specifically disclosed all possible subranges as well as individual numerical values ​​within that range. For example, the description of a range such as 1-6 should be considered to have specifically disclosed subranges such as 1-3, 1-4, 1-5, 2-4, 2-6, 3-6, and the individual and partial numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.

[0045] Furthermore, throughout this document, values ​​expressed in range format should be interpreted flexibly and include not only the numerical values ​​explicitly recited as the boundaries of the range, but also all of the individual numerical values ​​or subranges subsumed within the range as if each numerical value and subrange were explicitly recited. For example, the range "about 0.1% to about 5%" or "about 0.1% to 5%" should be interpreted to include not only about 0.1% to about 5%, but also the individual values ​​(e.g., 1%, 2%, 3%, and 4%) and subranges (e.g., 0.1% to 0.5%, 1.1% to 2.2%, 3.3% to 4.4%) within the range shown. The statement "about X to Y" has the same meaning as "about X to about Y" unless otherwise specified. Similarly, the statement "about X, Y, or about Z" has the same meaning as "about X, about Y, or about Z" unless otherwise specified.

[0046] In the methods described herein, acts may be performed in any order unless a temporal or operational order is explicitly recited. Moreover, specified acts may also be performed simultaneously unless express claim language recites that they be performed separately. For example, a claimed act of performing X and a claimed act of performing Y may be performed simultaneously in a single operation, and the resulting process is within the literal scope of the claimed process.

[0047] The following abbreviations are used herein: cGMP Current GMP (Standards for manufacturing management and quality control of pharmaceuticals, etc.) CAR Chimeric Antigen Receptor NFAT activated T cell nuclear factor TCR T cell receptor SHP2 SH2-containing phosphatase 2 SEE Staphylococcal superantigen E G. Glycyrrhiza uralensis Fish, also known as Chinese licorice P. Paeonia lactiflora Paul, also known as Chinese peony Scutellaria baicalensis George, also known as Scutellaria or Scutellaria Z. Ziziphus jujube Mill., also known as red jujube or Chinese jujube

[0048] YIV-906 is derived from a traditional Chinese herbal formulation and is composed of four herbs, namely, Glycyrrhiza uralensis fischii (G), Paeonia lactiflora Paul (P), Scutellaria baicalensis George (S), and Ziziphus jujuba Mill (Z). Historically, YIV-906 was used to treat gastrointestinal symptoms including diarrhea, nausea, and vomiting. Herein, using a cell culture model of Jurkat cells-Staphylococcal superantigen E (SEE)-Raji cells, we demonstrate that YIV-906 can promote T cell activation with upregulation of CD69 by modulating nuclear factor of activated T cells (NFAT) activity. Without wishing to be bound by any theory, this may be due to YIV-906 being able to modulate SHP2 activity, leading to increased protein phosphorylation of the T cell receptor signaling cascade, including Lck, Fyn, Zap70, LAT, and Pyk2. G, S, and their compounds showed inhibitory effects on SHP2. P, S, and their compounds can induce protein phosphorylation of T cell receptor signaling cascade. The S and S flavonoids of YIV-906 have been found to play an important role in regulating NFAT activity. Importantly, YIV-906 can enhance anti-PD1 effects to restore the reduced NFAT activity of Jurkat cells-PD1 cells when incubated with Raji-PD-L1 cells. In addition, YIV-906 can also enhance NFAT activity induced by the interaction of chimeric antigen receptor (CAR-CD19-CD3z) on Jurkat cells with CD19 on Raji cells. It is demonstrated herein that YIV-906 and some of its components can regulate T cell activation to enhance the efficacy of immune checkpoint blockade therapy, CAR T cell therapy, and vaccines.

[0049] composition In one aspect, the present invention provides an herbal composition for modulating NFAT activity in T cells in a subject in need thereof.

[0050] In certain embodiments, the composition comprises the herbal extract PHY906, which comprises the herbal extracts of Scutellaria baicalensis (S), Glycyrrhiza uralensis (G), Paeonia lactiflora (P), and Ziziphus jujuba (Z), a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof.

[0051] In certain embodiments, the composition comprises an herbal extract of S, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof. In certain embodiments, the composition comprises an herbal extract comprising an extract of S, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof.

[0052] In certain embodiments, the composition comprises an herbal extract of G, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof. In certain embodiments, the composition comprises an herbal extract comprising an extract of G, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof.

[0053] In certain embodiments, the composition comprises an herbal extract of P, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof. In certain embodiments, the composition comprises an herbal extract comprising an extract of P, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof.

[0054] In certain embodiments, the composition comprises an herbal extract of Z, a fraction thereof, or any active chemical present in the herbal extract or fraction thereof. In certain embodiments, the composition comprises an herbal extract comprising an extract of Z, a fraction thereof, or any active chemical present in the herbal extract or fraction thereof.

[0055] In certain embodiments, the composition further comprises one or more pharma- ceutically acceptable carriers.

[0056] In certain embodiments, the composition is formulated in the form of a pill, tablet, capsule, soup, tea, concentrate, dragee, liquid, drop, or gelatin capsule for oral administration.

[0057] In certain embodiments, the compositions are used to facilitate immune checkpoint blockade therapy for the treatment of cancer, to facilitate CAR T cell therapy for the treatment of cancer, to enhance the efficacy of vaccination, and / or as a cancer chemoprevention agent.

[0058] method In another aspect, the present invention provides a method for enhancing NFAT activity and / or restoring suppressed NFAT activity in T cells of a subject in need thereof.In addition, the present invention also includes a method for enhancing the effectiveness of chimeric antigen receptor T cell (CAR T) immunotherapy in a subject; a method for enhancing the effectiveness of immune checkpoint blockade therapy in a subject; a method for enhancing the effectiveness of vaccine in a subject; and a method for cancer chemoprevention.

[0059] In certain embodiments, the method comprises administering to a subject an effective amount of herbal extract PHY906, comprising herbal extracts of Scutellaria baicalensis (S), Glycyrrhiza uralensis (G), Paeonia lactiflora (P), and Ziziphus jujuba (Z), a fraction thereof, or any active chemical present in the herbal extract or fraction thereof.

[0060] In certain embodiments, the method comprises administering to a subject an effective amount of an herbal extract of S, a fraction thereof, or any active chemical present in the herbal extract or fraction thereof. In certain embodiments, the method comprises administering to a subject an effective amount of an herbal extract comprising an extract of S, a fraction thereof, or any active chemical present in the herbal extract or fraction thereof. In certain embodiments, the active chemical in the herbal extract of S or a fraction thereof is at least one selected from the group consisting of oroxylin A 7-O-β-D-glucuronide, baicalein, oroxylin A, baicalin, an isomer of baicalin, chrysin 6-C-arabinoside 8-C-glucoside, acteoside, vicissin I 2'-O-glucoside, and chrysin, or any combination thereof.

[0061] In certain embodiments, the method comprises administering to a subject an effective amount of the herbal extract of G, a fraction thereof, or any active chemical present in the herbal extract or fraction thereof.In certain embodiments, the method comprises administering to a subject an effective amount of the herbal extract comprising the extract of G, a fraction thereof, or any active chemical present in the herbal extract or fraction thereof.In certain embodiments, the active chemical in the herbal extract of G or fraction thereof is at least one selected from the group consisting of liquiritigenin, isoliquiritigenin, liquiritin, isoliquiritin, licochalcone A, and glycycoumarin.

[0062] In certain embodiments, the method comprises administering to a subject an effective amount of an herbal extract of P, a fraction thereof, or any active chemical present in the herbal extract or fraction thereof. In certain embodiments, the method comprises administering to a subject an effective amount of an herbal extract comprising an extract of P, a fraction thereof, or any active chemical present in the herbal extract or fraction thereof. In certain embodiments, the active chemical in the herbal extract of P or fraction thereof is at least one selected from the group consisting of gallic acid, 4-o-methylpaeoniflorin, 4-o-methylpaeoniflorin isomer, 6'-O-galloylpaeoniflorin, albiflorin, paeoniflorin, or any combination thereof.

[0063] In certain embodiments, the methods induce protein phosphorylation of the downstream cascade of the TCR and inhibit SHP2 activity.

[0064] In certain embodiments, the methods described herein are used to enhance the efficacy of anti-cancer / immunotherapeutic agents including ipilimumab, pembrolizumab, nivolumab, durvalumab, avelumab, dostallimab-gxly, cemiplimab-rwlc, toripalimab, camrelizumab, tislelizumab, pemplimab, zimberelimab, sintilimab, atezolizumab, and chimeric antigen receptor T cells (CAR T cells), or any combination thereof.

[0065] In certain embodiments, the methods of the present invention are directed to treating cancer, e.g., melanoma, Merkel cell carcinoma (MCC), basal cell carcinoma (BCC), squamous cell carcinoma (including, e.g., head and neck squamous cell carcinoma (HNSCC), esophageal squamous cell carcinoma (ESCC), and cutaneous squamous cell carcinoma (CSCC)), lymphoma (including, e.g., Hodgkin lymphoma, classical Hodgkin lymphoma (cHL), and large B cell lymphoma), lung cancer (including, e.g., non-small cell lung cancer (NSCLC), small cell lung cancer (SCLC), and extensive stage small cell lung cancer (ES-SCLC)), liver cancer (hepatocellular carcinoma (HCC), and / or esophageal squamous cell carcinoma (ES-SCLC)), and / or esophageal squamous cell carcinoma (ES-SCLC). It is used to treat the following cancers: pancreatic cancer, renal cell carcinoma (RCC), colon cancer, colorectal cancer (CRC), mesothelioma, gastric cancer, gastroesophageal junction cancer, esophageal cancer (including esophageal adenocarcinoma), cervical cancer, endometrial cancer (including mismatch repair deficient (dMMR) recurrent or progressive endometrial cancer), bladder cancer (including urothelial carcinoma), breast cancer (including triple-negative breast cancer (TNBC)), mismatch repair deficient cancers, microsatellite instability high (MSI) cancers, and cancers with high tumor mutation burden (TMB).

[0066] In certain embodiments, the method comprises orally administering to the subject the herbal extract in the form of a pill, tablet, capsule, soup, tea, concentrate, dragee, liquid, drops, and gelatin capsule.

[0067] In certain embodiments, the herbal composition further comprises a pharma- ceutically acceptable carrier.

[0068] In certain embodiments, the therapeutically effective amount of the herbal composition is from about 20 mg / day to about 2 g / day.

[0069] In a particular embodiment, the therapeutically effective amount of the herbal composition is about 1,600 mg / day.

[0070] In certain embodiments, the herbal composition is administered at a time selected from prior to, concurrently with, and after administration of one or more immunotherapeutic agents or vaccines.

[0071] In certain embodiments, the subject is a mammal, hi certain embodiments, the subject is a human subject.

[0072] Administration / Dosage / Formulation Dosage regimen may affect what constitutes an effective amount.Therapeutic formulations may be administered to subjects either before or after the onset of the disease or disorder contemplated in the present disclosure.Furthermore, several divided doses, as well as staggered doses, may be administered each day or sequentially, or the dose may be continuously infused or bolus infused.Furthermore, the dosage of therapeutic formulations may be proportionally increased or decreased as required by the exigencies of the treatment or prophylactic situation.

[0073] Administration of the compositions of the present disclosure to a patient, preferably a mammal, more preferably a human, may be carried out using known procedures at dosages and for periods of time effective to treat the disease or disorder contemplated in the present disclosure. The effective amount of the therapeutic compound required to achieve a therapeutic effect may vary depending on factors such as the extent of the disease or disorder in the patient; the age, sex, and weight of the patient; and the ability of the therapeutic compound to treat the disease or disorder contemplated in the present disclosure. Dosage regimens may also be adjusted to achieve an optimal therapeutic response. For example, several divided doses may be administered each day, or the dose may be proportionally reduced as required by the exigencies of the therapeutic situation. A non-limiting example of an effective dose range of the therapeutic compounds of the present disclosure is from about 1 mg / kg body weight / day to about 1,000 mg / kg body weight / day. Pharmaceutical compositions useful in practicing the present disclosure may be administered to deliver a dose of 1 ng / kg / day to 100 mg / kg / day. One of skill in the art would be able to investigate the relevant factors and make the determination regarding the effective amount of the therapeutic compound without undue experimentation.

[0074] In particular, the selected dosage level will depend on a variety of factors, including the activity of the particular compound used, the time of administration, the rate of excretion of the compound, the duration of treatment; other drugs, compounds, or substances used in combination with the compound; the age, sex, weight, condition, general health, and prior medical history of the patient being treated; and similar factors well known in the medical arts.

[0075] A medical practitioner, such as a physician or veterinarian, having ordinary skill in the art can easily determine and prescribe the effective amount of the pharmaceutical composition required. For example, the physician or veterinarian can start the dosage of the compound of the present disclosure used in the pharmaceutical composition at a level lower than required to achieve the desired therapeutic effect, and gradually increase the dosage until the desired effect is achieved.

[0076] In certain embodiments, it is advantageous to formulate compound in unit dosage form to facilitate administration and uniform dosage.As used herein, unit dosage form refers to a physically separate unit suitable as a unitary dosage for the patient to be treated, each unit containing a predetermined amount of therapeutic compound calculated to produce desired therapeutic effect in association with required pharmaceutical vehicle.The unit dosage form of the present disclosure is determined by and directly depends on (a) the unique characteristics of therapeutic compound and the individual therapeutic effect to be achieved, and (b) the inherent constraints of the technology of compounding / formulating such therapeutic compound to treat the disease or disorder contemplated in the present disclosure.

[0077] In certain embodiments, the composition of the present disclosure is formulated with one or more pharma- ceutically acceptable excipients or carriers.In other embodiments, the pharmaceutical composition of the present disclosure comprises a therapeutically effective amount of the compound of the present disclosure and a pharma- ceutically acceptable carrier.In yet another embodiment, the compound of the present disclosure is the only biologically active agent (i.e., can treat cancer) in the composition.In yet another embodiment, the compound of the present disclosure is the only biologically active agent (i.e., can treat cancer) in a therapeutically effective amount in the composition.

[0078] The carrier may be a solvent or dispersion medium, including, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, etc.), suitable mixtures thereof, and vegetable oils. Proper fluidity can be maintained, for example, by the use of a coating agent such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. Prevention of microbial activity can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, and thimerosal. In many cases, it is preferable to include an isotonic agent, for example, sugar, sodium chloride, or polyalcohols such as mannitol and sorbitol, in the composition. Prolonged absorption of an injectable composition can be achieved by including an agent that delays absorption, for example, aluminum monostearate or gelatin, in the composition.

[0079] In certain embodiments, the compositions of the present disclosure are administered to patients in dosages ranging from 1 to 5 times a day or more. In other embodiments, the compositions of the present disclosure are administered to patients in dosage ranges including, but not limited to, daily, every 2 days, once every 3 days to once a week, and once every 2 weeks. It is readily apparent to those skilled in the art that the frequency of administration of the various combination compositions of the present disclosure will vary from individual to individual depending on many factors including, but not limited to, age, disease or disorder being treated, sex, general health, and other factors. Thus, the present disclosure should not be construed as being limited to any particular dosing regimen, and the exact dosage and composition administered to any patient will be determined by the attending physician, taking into account all other factors related to the patient.

[0080] The compounds and / or compositions of the present disclosure for administration may be present in the range of about 1 mg to about 10,000 mg, about 20 mg to about 9,500 mg, about 40 mg to about 9,000 mg, about 75 mg to about 8,500 mg, about 150 mg to about 7,500 mg, about 200 mg to about 7,000 mg, about 400 mg to about 6,000 mg, about 500 mg to about 5,000 mg, about 750 mg to about 4,000 mg, about 1,000 mg to about 3,000 mg, about 1,000 mg to about 2,500 mg, about 20 mg to about 2,000 mg, and any and all integer or sub-increments therebetween. In certain embodiments, the dose of the compounds and / or compositions of the present disclosure is about 800 mg.

[0081] In certain embodiments, the present disclosure is directed to a pharmaceutical composition in a container comprising a container containing a therapeutically effective amount of a compound of the present disclosure, alone or in combination with a second pharmaceutical agent; and instructions for using the compound to treat, prevent, or alleviate one or more symptoms of a disease or disorder contemplated by the present disclosure.

[0082] The preparations may be used in admixture with conventional excipients, i.e., pharma- ceutically acceptable organic or inorganic carrier substances suitable for oral, parenteral, nasal, intravenous, subcutaneous, enteral, or any other suitable mode of administration known in the art. Pharmaceutical preparations may be sterilized and, if desired, may be admixed with auxiliary substances, such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorants, flavorings, and / or aromatic substances. These may also be admixed with other active substances, if desired.

[0083] The route of administration of any of the compositions of the present disclosure includes oral, nasal, rectal, intravaginal, parenteral, buccal, sublingual, or topical. The compounds for use in the present disclosure may be formulated for administration by any suitable route, for example, oral or parenteral, for example, transdermal, transmucosal (e.g., sublingual, lingual, (trans)oral, (trans)urethral, ​​vaginal (e.g., vaginal and perivaginal), (intram)nasal and (trans)rectal), intravesical, intrapulmonary, intraduodenal, intragastric, intrathecal, subcutaneous, intramuscular, intradermal, intraperitoneal, intraarterial, intravenous, intrabronchial, inhalation, and topical administration.

[0084] Suitable compositions and dosage forms include, for example, tablets, capsules, caplets, pills, gelatin capsules, troches, dispersions, suspensions, liquids, syrups, granules, beads, transdermal patches, gels, powders, pellets, magmas, lozenges, creams, pastes, plasters, lotions, disks, suppositories, liquid sprays for nasal or oral administration, dry powder or aerosolized formulations for inhalation, and compositions and formulations for intravesical administration. It should be understood that the formulations and compositions that may be useful in the present disclosure are not limited to the specific formulations and compositions described herein.

[0085] Oral route For oral application, soup, tea, concentrate, tablet, dragee, liquid, drop, suppository, or capsule, caplet, and gelatin capsule are particularly suitable.Composition for oral use may be prepared according to any method known in the art, and such composition may contain one or more active substances selected from the group consisting of inert and non-toxic pharmaceutical excipients suitable for manufacturing tablets.Such excipients include, for example, inert diluents such as lactose; granulating and disintegrating agents such as cornstarch; binding agents such as starch; and lubricants such as magnesium stearate.Tablets may be uncoated or may be coated by known techniques to improve appearance or to delay the release of active ingredients.Formulation for oral use may also be provided as hard gelatin capsules in which active ingredients are mixed with inert diluents.

[0086] For oral administration, the compounds of the present disclosure may be in the form of tablets or capsules prepared by conventional means using pharma- ceutically acceptable excipients, such as binders (e.g., polyvinylpyrrolidone, hydroxypropylcellulose, or hydroxypropylmethylcellulose); fillers (e.g., corn starch, lactose, microcrystalline cellulose, or calcium phosphate); lubricants (e.g., magnesium stearate, talc, or silica); disintegrants (e.g., sodium starch glycolate); or wetting agents (e.g., sodium lauryl sulfate). If desired, tablets may be coated using suitable methods and coating materials, such as the OPADRY™ film coating system available from Colorcon (West Point, Pa.) (e.g., OPADRY™ OY type, OYC type, organic enteric OY-P type, aqueous enteric OY-A type, OY-PM type, and OPADRY™ white, 32K18400). Liquid formulations for oral administration may be in the form of solutions, syrups, or suspensions. These liquid preparations may be prepared by conventional means with pharma-ceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, methylcellulose, or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters, or ethyl alcohol); and preservatives (e.g., methyl or propyl p-hydroxybenzoates or sorbic acid).

[0087] Granulation techniques are well known in the pharmaceutical field for modifying starting powders of active ingredients or other particulate matter. Typically, these powders are mixed with a binder material to form larger, more durable, free-flowing masses or granules, and are called "granulations". For example, the "wet" granulation method using a solvent is usually characterized by mixing the powder with a binder material and wetting it with water or an organic solvent under conditions that result in the formation of a wet granulated mass (the solvent must then be evaporated from the mass).

[0088] Typically, melt granulation consists in using materials that are solid or semi-solid at room temperature (i.e., have a relatively low softening or melting point range) to facilitate the granulation of powdered or other materials in the essentially absence of added water or other liquid solvents. The low melting solids liquefy when heated to a temperature in the melting point range and act as binders or granulation media. The liquefied solids spread over the surfaces of the powdered materials they come into contact with and, upon cooling, form a solid granulated mass in which the original materials are bound together. The resulting melt granulation may then be fed to a tablet press or encapsulated to prepare an oral dosage form. Melt granulation improves the dissolution rate and bioavailability of active substances (i.e., drugs) by forming solid dispersions or solid solutions.

[0089] No. 5,169,645 discloses directly compressible wax-containing granules with improved flow properties. These granules are obtained when wax is mixed in the melt with certain flow improving additives, followed by cooling and granulating the mixture. In certain embodiments, only the wax itself melts in the molten combination of wax and additives, and in other cases, both the wax and additives melt.

[0090] The present disclosure also includes multi-layer tablets that include a layer to provide delayed release of one or more compounds of the present disclosure and another layer to provide immediate release of a drug for treating a disease or disorder contemplated by the present disclosure. By using a wax / pH-sensitive polymer mixture, a gastric insoluble composition can be obtained in which the active ingredient is entrapped to ensure its delayed release.

[0091] Parenteral Administration As used herein, "parenteral administration" of pharmaceutical compositions includes any route of administration characterized by physical penetration into the tissue of a subject and administration of pharmaceutical compositions through an opening in tissue.Thus, parenteral administration includes, but is not limited to, administration of pharmaceutical compositions by injection of the composition, application of the composition through a surgical incision, and application of the composition through a non-surgical wound that penetrates tissue.In particular, parenteral administration is intended to include, but is not limited to, subcutaneous injection, intravenous injection, intraperitoneal injection, intramuscular injection, intrasternal injection, and infusion techniques of kidney dialysis.

[0092] A formulation of a pharmaceutical composition suitable for parenteral administration comprises the active ingredient combined with a pharma- ceutically acceptable carrier, such as sterile water or sterile isotonic saline. Such formulations may be prepared, packaged, or sold in a form suitable for bolus or continuous administration. Injectables may be prepared, packaged, or sold in unit dosage form, for example, in ampoules or in multi-dose containers containing a preservative. Formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable sustained-release or biodegradable formulations. Such formulations may further comprise one or more additional components, including, but not limited to, suspending agents, stabilizing agents, or dispersing agents. In one embodiment of a formulation for parenteral administration, the active ingredient is provided in dry (i.e., powdered or granular) form and is reconstituted with a suitable vehicle (e.g., sterile pyrogen-free water), and the reconstituted composition is administered parenterally.

[0093] These pharmaceutical compositions may be prepared, packaged, or sold in the form of a sterile injectable aqueous or oily suspension or solution. The suspension or solution may be formulated according to known techniques and may contain, in addition to the active ingredient, additional ingredients such as dispersants, wetting agents, or suspending agents described herein. Such sterile injectable solutions may be prepared using non-toxic parenterally acceptable diluents or solvents, such as water or 1,3-butanediol. Other acceptable diluents and solvents include, but are not limited to, Ringer's solution, isotonic sodium chloride solution, and fixed oils such as synthetic mono- or diglycerides. Other parenterally administrable formulations that are useful include those that contain the active ingredient in microcrystalline form, in liposomal preparations, or as a component of biodegradable polymer systems. Compositions for sustained release or implantation may include pharma- ceutically acceptable polymeric or hydrophobic materials, such as emulsions, ion exchange resins, sparingly soluble polymers, or sparingly soluble salts.

[0094] Controlled Release Formulations and Drug Delivery Systems In certain embodiments, the formulations of the present disclosure may be short-term, rapid offset, and controlled, e.g., sustained release, delayed release, and pulsed release formulations, but are not limited to such.

[0095] The term sustained release is used in its conventional sense to mean a drug formulation that provides for gradual release of drug over an extended period of time and that can, although not necessarily, result in substantially constant blood levels of drug over an extended period of time, which may be a month or longer and should be a longer release than the same amount of agent administered in bolus form.

[0096] For sustained release, the compound can be formulated with a suitable polymeric or hydrophobic material that provides the compound with sustained release properties.Thus, the compound useful in the disclosed method can be administered, for example, in the form of microparticles by injection, or in the form of wafers or disks by implantation.

[0097] In one embodiment of the disclosure, the compounds of the disclosure are administered to a patient, alone or in combination with another pharmaceutical agent, using a sustained release formulation.

[0098] The term delayed release is used herein in its conventional sense to refer to a drug formulation that provides for release of the drug only after some delay following drug administration, and which may, but does not necessarily, include a delay period of from about 10 minutes up to about 12 hours.

[0099] The term pulsatile release is used herein in its conventional sense to refer to a drug formulation that provides for the release of drug in a manner that results in a pulsatile plasma profile of the drug following drug administration.

[0100] The term immediate release is used in its conventional sense to refer to a drug formulation that provides for release of the drug immediately following drug administration.

[0101] As used herein, short-term means any period of time after drug administration up to and including about 8 hours, about 7 hours, about 6 hours, about 5 hours, about 4 hours, about 3 hours, about 2 hours, about 1 hour, about 40 minutes, about 20 minutes, about 10 minutes, or about 1 minute, and any or all integer or sub-increments thereof.

[0102] As used herein, rapid offset means any period of time following drug administration up to and including about 8 hours, about 7 hours, about 6 hours, about 5 hours, about 4 hours, about 3 hours, about 2 hours, about 1 hour, about 40 minutes, about 20 minutes, about 10 minutes, or about 1 minute, and any and all integer or sub-integer increments thereof.

[0103] dosage The therapeutically effective amount or therapeutically effective dose of the compounds of the present disclosure will vary depending on the age and weight of the patient, the current medical condition of the patient, and the progression of the disease or disorder contemplated in the present disclosure. Those skilled in the art will be able to determine the appropriate dosage depending on these and other factors.

[0104] A suitable dose of the disclosed compound, composition, or extract may range from about 0.01 mg / day to about 5,000 mg / day, such as from about 0.1 mg / day to about 1,000 mg / day, such as from about 1 mg / day to about 500 mg / day, such as from about 5 mg / day to about 250 mg / day. The dose may be administered in a single dose or multiple doses, such as from 1 to 5 or more times per day. When multiple doses are used, the amount of each dose may be the same or different. For example, a dose of 1 mg / day may be administered in two doses of 0.5 mg, spaced about 12 hours apart.

[0105] In various embodiments, the amount or dose of the herbal composition administered can be about 0.5 mg / kg to about 5000 mg / kg, about 1 mg / kg to about 2500 mg / kg, about 5 mg / kg to about 1000 mg / kg, or about 10 mg / kg to about 1000 mg / kg. In various embodiments, the amount or dose of the YIV-906 herbal extract administered can be about 0.01 mg / kg, about 0.5 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 6 mg / kg, about 7 mg / kg, about 8 mg / kg, about 9 mg / kg, about 10 mg / kg, about 20 mg / kg, about 30 mg / kg, about 40 mg / kg, about 50 mg / kg, about 60 mg / kg, about 70 mg / kg, about 80 mg / kg, about 90 mg / kg, about 100 mg / kg. , about 120mg / kg, about 140mg / kg, about 160mg / kg, about 180mg / kg, about 200mg / kg, about 200mg / kg, about 220mg / kg, about 240mg / kg, about 260mg / kg, about 280mg / kg, about 300mg / kg , about 320mg / kg, about 340mg / kg, about 360mg / kg, about 380mg / kg, about 400mg / kg, about 420mg / kg, about 440mg / kg, about 460mg / kg, about 480mg / kg, about 500mg / kg, about 520mg / kg , about 540mg / kg, about 560mg / kg, about 580mg / kg, about 600mg / kg, about 620mg / kg, about 640mg / kg, about 660mg / kg, about 680mg / kg, about 700mg / kg, about 720mg / kg, about 740mg / kg , about 760mg / kg, about 780mg / kg, about 800mg / kg, about 820mg / kg, about 840mg / kg, about 860mg / kg, about 880mg / kg, about 900mg / kg, about 920mg / kg, about 940mg / kg, about 960mg / kg , about 980mg / kg, about 1000mg / kg, about 1020mg / kg, about 1040mg / kg, about 1060mg / kg, about 1080mg / kg, about 1100mg / kg, about 1120mg / kg, about 1140mg / kg, about 1160mg / kg, About 1180mg / kg, about 1200mg / kg, about 1220mg / kg, about 1240mg / kg, about 1260mg / kg, about 1280mg / kg, about 1300mg / kg, about 1320mg / kg, about 1340mg / kg, about 1360mg / kg,Approximately 1380mg / kg, approximately 1400mg / kg, approximately 1420mg / kg, approximately 1440mg / kg, approximately 1460mg / kg, approximately 1480mg / kg, approximately 1500mg / kg, approximately 1520mg / kg, approximately 1540mg / kg, approximately 1560mg / kg, approximately 1580mg / kg, approximately 1600mg / kg, approximately 1620mg / kg, approximately 1640mg / kg, approximately 1660mg / kg, approximately 1680mg / kg, approximately 1700mg / kg, approximately 1720mg / kg, approximately 1740mg / kg, approximately 1760m g / kg, about 1780 mg / kg, about 1800 mg / kg, about 1820 mg / kg, about 1840 mg / kg, about 1860 mg / kg, about 1880 mg / kg, about 1900 mg / kg, about 1920 mg / kg, about 1940 mg / kg, about 1960 mg / kg, about 1980 mg / kg, about 2000 mg / kg, about 2500 mg / kg, about 3000 mg / kg, about 3500 mg / kg, about 4000 mg / kg, about 4500 mg / kg, or about 5000 mg / kg. These amounts of the herbal extract can be administered using any of the dosing regimens described herein.

[0106] In various embodiments, the amount or dose of any immune checkpoint inhibitor or immunotherapeutic agent described herein can be about 0.01 mg / kg to about 50 mg / kg, about 0.05 mg / kg to about 30 mg / kg, or about 1 mg / kg to about 20 mg / kg. In various embodiments, the amount or dose of any immune checkpoint inhibitor or immunotherapeutic agent described herein can be 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 0.7 mg / kg, 0.8 mg / kg, 0.9 mg / kg, 1 mg / kg, 1.2 mg / kg, 1.4 mg / kg, 1.6 mg / kg, 1.8 mg / kg, 2 mg / kg, 2.2 mg / kg, 2. 4mg / kg, 2.6mg / kg, 2.8mg / kg, 3mg / kg, 3.2mg / kg, 3.4mg / kg, 3.6mg / kg, 3.8mg / kg, 4mg / kg, 4.2mg / kg, 4.4mg / kg, 4.6mg / kg, 4.8mg / k g, 5mg / kg, 5.2mg / kg, 5.4mg / kg, 5.6mg / kg, 5.8mg / kg, 6mg / kg, 6.2mg / kg, 6.4mg / kg, 6.6mg / kg, 6.8mg / kg, 7mg / kg, 7.2mg / kg, 7.4mg / kg, 7.6mg / kg, 7.8mg / kg, 8mg / kg, 8.2mg / kg, 8.4mg / kg, 8.6mg / kg, 8.8mg / kg, 9mg / kg, 9.2mg / kg, 9.4mg / kg, 9.6mg / kg, 9.8mg / kg, 10mg / kg, 10.2mg / kg, 10.4mg / kg, 10.6mg / kg, 10.8mg / kg, 11mg / kg, 11.2mg / kg, 11.4mg / kg, 11.6mg / kg, 11.8mg / kg, 12mg / kg, 12.2mg / kg, 12.4mg / kg, 12.6mg / kg, 12.8mg / kg, 13mg / kg, 13.2mg / kg, 13.4mg / kg, 13.6mg / kg, 13.8mg / kg, 14mg / kg, 14.2mg / kg, 14.4mg / kg, 14.6mg / kg, 14.8mg / kg, 15mg / kg, 15.2mg / kg, 15.4mg / kg, 15.6mg / kg, 15.8mg / kg, 16mg / kg, 16.2mg / kg, 16.4mg / kg, 16.6mg / kg, 16.8mg / kg、17mg / kg、17.2mg / kg、17.4mg / kg、17.6mg / kg、17.8mg / kg、18mg / kg、18.2mg / kg、18.4mg / kg、18.6mg / kg、18.8mg / kg、19mg / kg、19.2mg / kg、19.4mg / kg、19.6mg / kg、19.In some embodiments, the maximum daily dosage or maximum daily administered dose of any immune checkpoint inhibitor or immunotherapeutic agent described herein can be about 10 mg, about 20 mg, about 30 mg, about 40 mg, about 50 mg, about 60 mg, about 70 mg, about 80 mg, about 90 mg, about 100 mg, about 100 mg, about 120 mg, about 140 mg, about 160 mg, about 180 mg, about 200 mg, about 220 mg, about 240 mg, about 260 mg, about 280 mg, about 300 mg, about 320 mg, about 340mg, about 360mg, about 380mg, about 400mg, about 420mg, about 440mg, about 460mg, about 480mg, about 500mg, about 520mg, about 540mg, about 560mg, about 580mg, about 600mg, about 620mg, about 640 mg, about 660mg, about 680mg, about 700mg, about 720mg, about 740mg, about 760mg, about 780mg, about 800mg, about 820mg, about 840mg, about 860mg, about 880mg, about 900mg, about 920mg, about 940mg, about 960mg, about 980mg, about 1000mg, about 1020mg, about 1040mg, about 1060mg, about 1080mg, about 1100mg, about 1120mg, about 1140mg, about 1160mg, about 1180mg, about 1200mg, about 1220mg , about 1240mg, about 1260mg, about 1280mg, about 1300mg, about 1320mg, about 1340mg, about 1360mg, about 1380mg, about 1400mg, about 1420mg, about 1440mg, about 1460mg, about 1480mg, about 15 The amount of the glycerol may be about 1000 mg, about 1520 mg, about 1540 mg, about 1560 mg, about 1580 mg, about 1600 mg, about 1620 mg, about 1640 mg, about 1660 mg, about 1680 mg, about 1700 mg, about 1720 mg, about 1740 mg, about 1760 mg, about 1780 mg, about 1800 mg, about 1820 mg, about 1840 mg, about 1860 mg, about 1880 mg, about 1900 mg, about 1920 mg, about 1940 mg, about 1960 mg, about 1980 mg, or about 2000 mg.

[0107] In some embodiments, the herbal composition and a single immunotherapeutic agent are the only therapeutically active agents in the pharmaceutical composition.

[0108] It is understood that the amount of compound administered daily can be, in non-limiting examples, administered every day, every other day, every second day, every third day, every fourth day, or every fifth day. For example, for every other day administration, a dose of 5 mg / day can be administered starting on Monday, a first subsequent dose of 5 mg / day can be administered on Wednesday, a second subsequent dose of 5 mg / day can be administered on Friday, and so on.

[0109] If the patient's condition improves, at the discretion of the physician, administration of the inhibitors of the present disclosure is optionally continued; alternatively, the dose of drug administered is temporarily reduced or temporarily discontinued for a period of time (i.e., a "drug holiday"). The length of the drug holiday can range anywhere from 2 days to 1 year, including, by way of example only, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, 35 days, 50 days, 70 days, 100 days, 120 days, 150 days, 180 days, 200 days, 250 days, 280 days, 300 days, 320 days, 350 days, or 365 days. Dose reductions during drug holidays can range from 10% to 100%, including, by way of example only, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.

[0110] Once the patient's condition has improved, a maintenance dose is administered as necessary.The dosage or frequency of administration or both are then reduced as a function of the disease or disorder until the improved condition is maintained.In certain embodiments, the patient requires intermittent treatment on a long-term basis in the event that symptoms and / or infection recur.

[0111] The compounds for use in the methods of the present disclosure may be formulated in unit dosage form. The term "unit dosage form" refers to a physically discrete unit suitable as a unitary dosage for a patient undergoing treatment, each unit containing a predetermined amount of active material calculated to produce a desired therapeutic effect, optionally in association with a suitable pharmaceutical carrier. The unit dosage form may be for a single daily administration or for one of multiple daily administrations (e.g., about 1-5 or more times per day). When multiple daily administrations are used, the unit dosage form may be the same or different for each administration.

[0112] The toxicity and therapeutic efficacy of such treatment regimens are optionally measured in experimental animals, including, but not limited to, LD 50 (a dose lethal to 50% of the population) and ED 50 This involves the measurement of the dose that is therapeutically effective in 50% of the population. The dose ratio between toxic and therapeutic effects is the therapeutic index, and the LD 50 and ED 50 The dosage range for use in humans is expressed as a ratio of ED 50 It is preferred that the dosage be within a range of circulating concentrations that include and are minimally toxic. The dosage can optionally vary within this range depending upon the dosage form employed and the route of administration utilized.

[0113] The practice of the present disclosure employs, unless otherwise specified, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology well within the skill of the art. Such techniques are fully described in such publications as "Molecular Cloning: A Laboratory Manual", second edition (Sambrook, 1989); "Oligonucleotide Synthesis" (Gait, 1984); "Animal Cell Culture" (Freshney, 1987); "Methods in Enzymology" "Handbook of Experimental Immunology" (Weir, 1996); "Gene Transfer Vectors for Mammalian Cells" (Miller and Calos, 1987); "Current Protocols in Molecular Biology" (Ausubel, 1987); "PCR: The Polymerase Chain Reaction", (Mullis, 1994); "Current Protocols in Immunology" (Coligan, 1991). These techniques are applicable to the production of the polynucleotides and polypeptides of the present disclosure and therefore may be considered when making and practicing the present disclosure. Techniques that are particularly useful for particular embodiments are discussed in the sections below.

[0114] Those skilled in the art will recognize or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific procedures, aspects, claims, and examples described herein. Such equivalents are considered to be within the scope of this disclosure and are encompassed by the claims appended hereto. For example, it should be understood that variations in reaction conditions, including but not limited to reaction times, reaction scales / volumes, and experimental reagents, using art-recognized substitutions and no more than routine experimentation, are within the scope of this application.

[0115] Whenever values ​​and ranges are provided herein, it should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the disclosure. Thus, all values ​​and ranges encompassed within these values ​​and ranges are intended to be encompassed within the scope of the disclosure. Moreover, all values ​​falling within these ranges, as well as the upper or lower limits of the range of values, are also contemplated by the present application. The description of a range should be considered to have specifically disclosed all possible subranges and individual numerical values ​​within that range, and, where appropriate, sub-integer numbers of numerical values ​​within the range. For example, the description of a range such as 1-6 should be considered to have specifically disclosed subranges such as 1-3, 1-4, 1-5, 2-4, 2-6, 3-6, and the like, as well as the individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This is true regardless of the breadth of the range. EXAMPLES

[0116] The present disclosure will be further described in detail by referring to the following experimental examples.These examples are provided only for illustration and are not intended to be limiting unless otherwise specified.Therefore, the present disclosure should not be interpreted as being limited to the following examples in any way, but rather as embracing any and all variations that become apparent as a result of the teachings provided herein.

[0117] Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the disclosed compounds and practice the claimed methods. Thus, the following examples specifically illustrate preferred embodiments of the disclosure, and are not to be construed as limiting in any way the remainder of the disclosure.

[0118] Methods and Materials: Preparation of herbal extracts PHY906 is composed of a conventional hot water extract of four medicinal herbs, namely Scutellaria baicalensis George (S), Paeonia lactiflora Paul (P), Glycyrrhiza uralensis Fish (G), and Ziziphus jujuba Mill (Z), in a ratio of 3:2:2:2, respectively, prepared by standard operating procedures. The extract contains a complex mixture of multiple phytochemicals with multiple biological and pharmacological properties. At present, it is not possible to identify relevant biologically active subpopulations of phytochemicals from the entire mixture. For this reason, advanced chemical and biological metrics were used to characterize the PHY906 product.

[0119] The raw ingredients of PHY906 are preselected to meet strict specifications set by PhytoCeutica as accepted by Taiwanese herbalist Sun Ten Pharmaceuticals. PHY906 extract is composed of >75% low molecular weight phytochemical compounds less than 1000 amu, 10% polymeric components including proteins, nucleic acids, and complex carbohydrates, and 5% water. Additionally, 10% by weight of insoluble cellulose as an excipient is added during the spray drying stage of production. Heavy metals (Pb, Hg, Cd, As) are all less than 0.5 ppm, and mercury and cadmium are less than 0.03 ppm as detected by atomic absorption spectrometry. Pesticide levels (BHC, DDT, PCNB) are less than 0.2 ppm by LC-MS or GC-MS. Total bacterial count is 260 cfu / g, while E. coli and Salmonella species are not detected. More than 90% by weight of PHY906 can be re-extracted, excluding the water content (5%) and insoluble starch excipients (10%). The final PHY906 liquid extract (100 mg / ml) is stable for 18 hours at room temperature, and properly stored bulk dry extract (vacuum packed, protected from light, 4°C) appears to be stable for more than 3 years.

[0120] LC-MS method LC-MS analysis of the chemical profile of metabolites of PHY906 LC-MS analysis was performed using an Agilent 1200 series HPLC coupled with an AB SCIEX 4000 QTRAP mass spectrometer. Separation was performed using an Alltima™ HP HPLC column (5 mm, 4.6×250 mm). The mobile phase was acetonitrile (A) and water with 0.1% formic acid (B) with the following gradient elution: 0 min, 5% A; 10 min, 20% A; 20 min, 25% A; 40 min, 30% A; 45 min, 35% A; 55 min, 45% A; 60 min, 70% A; 62 min, 90% A; 67 min, 90% A; 68 min, 5% A; and 75 min, 5% A. The flow rate was 1.0 mL / min and the column temperature was set at 30° C. ESI negative mode mass spectrometry with a scan speed of 4000 amu / s was performed with the following ionization parameters: CAD: high; TEM: 550.00 °C; GS1: 55.00; GS2: 50.00; ihe: on; IS: -4250.00; DP: -40.00; CES 0.00; CE: -5.00. The mass range for detection was 120-800 amu. Peaks were compared and clustering analysis was performed using a custom program built into the MZmine software.

[0121] cell line RPMI1640+5%FBS+50ug / ml kanamycin, incubation at 37℃, 5%CO2 were the cell culture and experimental conditions. Jurkat (T lymphoblast) cells were transfected with pcDNA-PD1-Dyk DNA and then selected by G418 (200ug / ml). Raji (B lymphocyte) cells were transfected with pcDNA-PD-L1-Dyk DNA and then selected by G418 (600ug / ml). Anti-PD1-PE (biolegend, #A17188B) or anti-PD-L1 (CD274)-APC (invitrogen, #17-5983-42) were used to confirm the expression of PD1 or PD-L1 on Jurkat or Raji cells using a laser flow cytometer (BD, Accuri 6 plus). Jurkat-PD1 cells were transfected with NFAT luciferase reporter DNA with four repeated NFAT response elements: ggaggaaaaactgtttcatacagaaggcgt (SEQ ID NO: 1) oligos inserted into pGL4 vector (Promega) and then selected with 0.1ug / ml puromycin. Jurkat-PD1 NFAT-luc TCRαβ knockout cells were generated using CRISPR / Cas9 technology. The targeting DNA sequences for TCRa and TCRb were, respectively: TIFF2025507857000002.tif4128 and TIFF2025507857000003.tif4128. Anti-TCRαβ (Biolegend) was used to confirm knockout of TCRαβ. CAR-CD19-CD3ζ vector was transfected into Jurkat-PD1 NFAT-luc and GFP-positive cells were sorted using a flow cytometer. Jurkat-PD1 NFAT-luc CAR-CD19-CD3ζ clones were selected when NFAT luciferase activity was increased by co-culture with wild Raji cells.

[0122] Stimulation of Jurkat cells against NFAT 2×10 275ul of 10 wild-type Raji cells or Raji-PD-L1 cells, or neither 6 Jurkat-PD1 cells were seeded in round-bottom 96-well plates. In some experiments, InVivoSIM anti-human PD-1 (Nivolumab biosimilar) (BioXcell, #SIM0003) 18ug / ml was added to the cells for 2 or 24 hours before treatment with drugs and SEE. 25ul of control medium or 25ul of 5x concentration of YIV-906 or other drugs were added to the wells. Then, 25ul of SEE (Toxin Technology, #ET404) (5x10ng / ml) was added to the wells. After overnight incubation at 37°C, 5% CO2, the cells were lysed using luciferase lysis buffer. Luciferase buffer containing luciferin was added to generate luminescence. Luminescence was recorded using a luminescence microplate reader.

[0123] Flow cytometry analysis 4×10 5 2 × 10 cells / ml in 24-well plates with or without wild-type Raji or Raji-PD-L1 cells. 5 Jurkat-PD1 cells at 10 / ml were treated with YIV-906 in the presence or absence of SEE (10 ng / ml and 30 ng / ml) for 48 hours. Cells were stained with anti-CD69-FITC (biolegend, #310904) and anti-PD1-PE (biolegend, #A17188B) mixed in PBS+1% BSA. Jurkat-PD1 cells were gated from the mixed cells using anti-PD1-PE. CD69 expression in the FITC channel was expressed as median fluorescence or as a percentage (%) of the total Jurkat cell population using a laser flow cytometer (BD, Accuri 6 plus).

[0124] Western blot analysis 10 6Jurkat-PD1 cells were plated in 24-well plates at 1000g / ml and treated with YIV-906 or its component herbs for 45 min. After spinning down the cells at 1000g for 10 min, red blood cells were lysed with 1 ml of BD pharm lyse on ice. Cells were harvested by centrifugation at 1000g for 10 min. 2 × 10 cells were used for each staining sample. 6Cells were used. Cells were prepared using 2x protein loading buffer (Tris pH 6.8 1M, SDS 1%, glycerol, B-mercaptoethanol, bromophenol blue, distilled water). The samples were then heated to 95°C for 5 min to denature the proteins prior to Western blotting. Proteins were separated by electrophoretic mobility using SDS polyacrylamide gel electrophoresis (10% Mini-Protean TGX™ precast protein gels, BioRad). Protein extracts were deposited into wells containing gels at 10 μL per well. Transfer was performed in 1x running buffer (Tris / glycine / SDS) at 180V for 50 min. Protein transfer to PVDF membrane was performed in transfer buffer (Tris-CAPS AX, methanol, SDS 10%, distilled water) at 75V for 1 h. The non-specific binding sites on the PVDF membrane were blocked with blocking solution (3% milk powder and 1×TBS-T) for 30 minutes. The PVDF membrane was then incubated overnight at 4° C. with primary antibodies against the protein of interest. The information for the primary antibodies is as follows: P-Lck-Y394 (Biolegend, #933101), P-Zap70-Y319 (Cell signaling, #2717), P-LAT-Y191 (Cell signaling, #3584), P-SRC(Fyn)Y416 (Cell, signaling, #6943), P-Pyk2-Y402 (Cell signaling, #3291), GAPDH (Cell Signaling, #5174). The membrane was washed with TBS-T 1X and incubated with the secondary antibody, horseradish peroxidase-conjugated anti-rabbit IgG 1:5000 (ThermoFisher Scientific, #A27036), for the immunoglobulin corresponding to the primary antibody for 1 hour at room temperature. The membrane was washed with TBS-T 1X. Protein bands were detected using chemiluminescence (Super Signal West Dura, Thermo Scientific Cat. No. PI34076) and images were developed by an X-ray film processor (Fuji Super RX-N).Densitometric scanning was performed using an Epson V600 scanner. The total intensity of immunoreactive bands was quantified using Image-J. GAPDH was used as an internal control for normalization.

[0125] Example 1: YIV-906 was able to regulate nuclear factor of activated T cells (NFAT) activity in T cells. To investigate the effect of YIV-906 on T cell activation, a cell culture model of Jurkat cells-Staphylococcal superantigen E (SEE)-Raji cells was established. In this cell culture model, Jurkat cells (T cells) were stably transfected with nuclear factor of activated T cells (NFAT) luciferase reporter DNA and PD1 DNA. To stimulate, Jurkat cells-PD1 cells were co-cultured overnight with wild-type Raji cells at a ratio of 1:2, together with 1ng / ml-10ng / ml SEE, in the absence or presence of YIV-906 or its components added to the mixed cells. NFAT activity was reflected in luciferase activity as a measure of chemiluminescence. From the aforementioned cell culture model, it was concluded that YIV-906 could regulate NFAT either in the absence (Figure 1A) or presence (Figure 1B) of SEE. YIV-906 in the range of 80ug / ml to 320ug / ml was able to enhance NFAT activity by 2-fold. When YIV-906 was compared (at equal concentrations) with its component herbs, namely, Glycyrrhiza uralensis fischii (G), Paeonia lactiflora Paul (P), Scutellaria baicalensis George (S), and Zizypha jujuba Mill (Z), for NFAT-mediated transcriptional activity in Jurkat cells, S showed a very similar dose response to YIV-906 both in the absence and presence of SEE (Figure 1A and Figure 1B). G and P were able to modulate NFAT activity in the absence or presence of SEE but not by more than 20% (Figure 1A and Figure 1B). Z had no effect on NFAT activity (Figure 1A and Figure 1B). When two-herb or three-herb combinations were compared (Figures 1C-1F), only the combinations containing S showed approximately two-fold enhanced NFAT activity in the absence or presence of SEE. Thus, it was demonstrated herein that YIV-906 could regulate nuclear factor of activated T cells (NFAT) activity in Jurkat cells, and that although S plays a key role in regulating NFAT, G and P may play minor roles in regulating NFAT.

[0126] Example 2: YIV-906 could regulate the nuclear factor of activated T cells (NFAT) activity of T cells, which was suppressed due to the interaction between PD-1 and PD-L1. To study the effect of PD1-PD-L1 on NFAT activity during T cell activation, Jurkat-PD1 cells were co-cultured with PD-L1-overexpressing Raji cells at a 1:2 ratio for 2 h and then with 1 ng / ml to 10 ng / ml SEE overnight in the absence or presence of YIV-906 or its components added to the mixed cells. Combinations including YIV-906, S, and S had similar effects on the basal NFAT activity of Jurkat-PD1 cells incubated with either wild-type Raji cells (Figure 1A, 1C-1F) or PD-L1-overexpressing Raji cells (Figure 2A, 2C-2F). The interaction between PD1 on Jurkat cells and PD-L1 on Raji cells inhibited NFAT activity of Jurkat cells by 50% (Figure 1B vs. Figure 2B). The combination containing YIV-906, S, and S was able to restore the suppressed NFAT activity in Jurkat-PD1 cells (Figures 2A, 2C-2F). G had a slight effect on NFAT activity in the above conditions (Figures 2A-2F).

[0127] Example 3: YIV-906 was able to induce CD69 expression, a T cell activation marker Because YIV-906 was able to regulate NFAT activity, a key transcription factor for T cell activation, the effect of YIV-906 on T cell activation was further studied using CD69 as a T cell marker. As shown in Figure 3A-3D, YIV-906 could enhance the protein expression of CD69, as indicated by the increase in median fluorescence and percentage (%) of the population exhibiting high CD69 staining of Jurkat-PD1 cells when incubated with wild-type Raji cells in the absence of SEE or in the presence of 3 ng / ml or 10 ng / ml of SEE (Figure 3A and 3B). When Jurkat-PD1 cells were co-cultured with Raji-PD-L1 cells in the absence of SEE or in the presence of 3 ng / ml or 10 ng / ml of SEE, YIV-906 could increase CD69 expression of Jurkat-PD1 cells. Thus, YIV-906 could regulate NFAT activity of T cells, thereby resulting in more potent T cell activation. YIV-906 could also help restore T cell activation even under the interaction of PD1 and PD-L1.

[0128] Example 4: The pure compound YIV-906 could regulate the NFAT activity of T cells. Pure compounds present in the constituent herbs of YIV-906 were selected to investigate their effects on NFAT in Jurkat cells (Figures 4A-4D). Among the seven selected compounds derived from S. cerevisiae, oroxylin A 7-O-β-D-glucuronide, baicalein, oroxylin A, and chrysin were able to modulate the basal NFAT activity of Jurkat-PD1 cells incubated with either wild-type Raji cells or PD-L1-overexpressing Raji cells (Figures 5A and 5C), although their optimal doses were different. A higher dose (40uM) was required for oroxylin A 7-O-β-D-glucuronide to achieve a two-fold increase in NFAT activity, whereas baicalein, oroxylin A, and chrysin only required 10uM-2.5uM to exert similar effects on NFAT. In the presence of SEE, oroxylin A 7-O-β-D-glucuronide, baicalein, oroxylin A, and chrysin showed similar dose responses as those shown for basal NFAT activity, however, baicalein, oroxylin A, and chrysin had the ability to inhibit SEE-induced NFAT activity at 20-40 uM (Figures 5B and 5D).

[0129] In the absence of SEE, liquiritigenin (40 uM), isoliquiritigenin (10 uM), liquiritin (20 uM), isoliquiritin (40 uM), licochalcone A (10–20 uM), and glycicumarin (10 uM) derived from G could have some modulatory effects on the basal NFAT activity of Jurkat-PD1 cells incubated with either wild-type or PD-L1-overexpressing Raji cells (Figures 6A and 6C). In the presence of SEE, liquiritigenin (40 uM), isoliquiritin (40 uM), licochalcone A (10 uM), and glycycoumarin (20 uM) derived from G were able to modulate the NFAT activity of Jurkat-PD1 cells incubated with either wild-type Raji cells or PD-L1-overexpressing Raji cells by up to approximately 30-50% (Figure 6B and 6D). At 40 uM, isoliquiritigenin and licochalcone showed inhibition on the NFAT activity of Jurkat cells in the presence of SEE (Figure 6B and 6D). Magnoflorine derived from Z showed inhibition on the NFAT activity of Jurkat cells in the presence of SEE (Figure 6B and 6D).

[0130] Example 5: The effects of YIV-906, S, and its components on NFAT did not require TCRαβ. To investigate whether YIV-906 and its components could directly activate TCR activity, which then leads to NFAT activation, we used CRISPR / Cas9 technology to knock out (KO) TCRαβ from Jurkat-PD1 cells (Figures 7A and 7B). Jurkat-PD1 TCRαβ KO cells were unresponsive to SEE when co-cultured with wild-type Raji cells. As shown in Figures 7C-F, YIV-906, S, and S components (oroxylin A 7-O-β-D-glucuronide, baicalein, oroxylin A, and chrysin) had very similar effects on NFAT activity in Jurkat-PD1 and Jurkat-PD1 TCRαβ KO cells. The optimal dose for regulation may be different in different compounds. These results suggested that the action of YIV-906 and its components on NFAT may not be mediated by TCR.

[0131] Example 6: YIV-906 and its component herbs could induce protein phosphorylation in the downstream cascade of the T cell receptor To verify whether YIV-906 and its components could have a direct effect downstream of TCR, the effects of YIV-906 and its components on protein phosphorylation of the downstream cascade of T cell receptor, including Lck, Zap70, LAT, Fyn, and Pyk2 in Jurkat cells, were investigated using Western blot analysis. As shown in Figure 8A, treatment with 320ug / ml YIV-906 for 45 minutes could induce phosphorylation of Lck, Zap70, LAT, Fyn, and Pyk2. By comparing single species of herbs at an equal concentration of 320ug / ml, it was found that S and P of YIV-906 played a major role to induce the above protein phosphorylation. After fractionation of YIV-906 using a C18 column, a relatively high activity of inducing protein phosphorylation could be found in the 60% and 15% acetonitrile / methanol (A / M) fractions (Figure 8B). For P, the 15% A / M fraction could induce the phosphorylation of all these proteins. Some activity for phosphorylation of different proteins could be found in the water, 30%, 45%, 100% A / M fractions of P (Figure 8C). LCMS analysis revealed that 4-o-methyl-paeoniflorin or its isomers could be present in the 15% A / M fraction of P (Figure 9A). Chemicals present in the water, 30%, 45%, 100% A / M fractions of P could also contribute to specific protein phosphorylation, as shown as red upward arrows (Figure 9A). For S, large protein phosphorylation activity was found in the 45%, 60%, and 75% A / M fractions, with some selectivity (Figure 8D). The 45% A / M fraction of S had a stronger effect on P-Zap70-Y319, whereas the 60% A / M fraction of S had a stronger effect on P-Lck-Y39, P-LAT-Y191, P-SRC(Fyn)-Y416, and P-Pyk2-Y402 (Figure 8D). Chemicals present in these S fractions are listed in Figure 9B, and these chemicals may contribute to specific protein phosphorylation, as indicated as upward arrows in Figure 9B.These chemicals, P and S, may have different selectivities for their targets.

[0132] Example 7: S and P compounds were able to induce protein phosphorylation in the downstream cascade of the T cell receptor Several chemicals derived from S or P were investigated for their ability to induce protein phosphorylation of downstream cascades of T cell receptor, including Lck, Zap70, LAT, Fyn, and Pyk2 in Jurkat cells using Western blot analysis. Baicalein at 40 uM could strongly induce protein phosphorylation of all proteins investigated (Figure 10). Baicalin and oroxylin A 7-O-β-D-glucuronide (OA-7-S) at 40 uM showed some induction effect on P-Zap70-Y319, P-SRC(Fyn)-Y416, and P-Pyk2-Y402 (Figure 10). Albifolin and paeonifolin had some effect on the induction of P-Zap70-Y319 and P-Pyk2-Y402 (Figure 10). These compounds had the potential to activate T cells by stimulating the downstream cascade of the TCR.

[0133] Example 8: YIV-906 was able to regulate SHP2 activity in T cells SHP2 (SH2-containing phosphatase 2, protein tyrosine phosphatase) is immediately downstream of PD1. When PD1 binds to PD-L1, PD-1 phosphorylates its immunoreceptor inhibitory tyrosine motif (ITIM) and immunoreceptor tyrosine switch motif (ITSM) to recruit and activate SHP2. Activated SHP2 initiates T cell inactivation by dephosphorylating TCR downstream cascade proteins such as Zap70. By interfering with PD1 action, the inhibitor has the potential to promote T cell activation and further improve cancer treatment. As shown in Figure 11A, YIV-906 exhibited an inhibitory effect on SHP2 enzyme activity. G and S of YIV-906 were found to be important herbs involved in SHP2 inhibition (Figure 11B). Glycyrrhetinic acid and glycyrrhetinic acid derived from G had relatively higher inhibitory effects on SHP2 than other G compounds (Figure 11C). Baicalin, oroxylin A 7-O-β-D-glucuronide, wogonoside, baicalein, chrysin, and oroxylin A derived from S showed inhibitory effects on SHP2 (Figure 11D).

[0134] Example 9: YIV-906 could further enhance the effect of anti-PD1 antibody in enhancing NFAT activity of T cells Because YIV-906 could enhance the antitumor activity of anti-PD1 against tumors in animal models, we analyzed whether YIV-906 could cooperate with anti-PD1 to enhance NFAT activity for T cell activation. As shown above, co-culture of Jurkat-PD1 cells with Raji-PD-L1 cells in the presence of 10 ng / ml or 30 ng / ml SEE inhibited NFAT activity in Jurkat cells by 50%, compared with the NFAT activity exhibited by Jurkat-PD1 cells and wild-type Raji cells. YIV-906 and anti-PD1 (antibody produced from the nivolumab clone) restored the suppressed NFAT activity (due to the interaction between PD1 and PD-L1) in Jurkat-PD1 cells (Figures S12A and S12B). In summary, YIV-906 did not have the effect of anti-PD1, but YIV-906 and anti-PD1 induced stronger NFAT activity in Jurkat PD1 cells (Figures 12A and 12B). Thus, YIV-906 has the potential to enhance immune checkpoint blockade therapy for the treatment of cancer.

[0135] Example 10: YIV-906 could regulate NFAT activity of T cells induced by chimeric antigen receptor It is well known that MHC-antigen-TCR interaction recruits CD3 receptor to transmit signals to NFAT. Chimeric antigen receptor (CAR) is composed of antigen recognition domain, extracellular hinge region, transmembrane domain, and costimulatory domain, such as immunoreceptor tyrosine-based activation motif (ITAM) of CD3ζ (zeta). Once chimeric antigen receptor (CAR) binds to its target, the signal is transmitted to ITAM of CD3ζ, which further stimulates its downstream cascade, resulting in NFAT activation. Since MHC-antigen-TCR interaction or CAR-target interaction share the same downstream cascade for NFAT activation, and YIV-906 has the ability to enhance MHC-antigen-TCR-induced NFAT response, we asked whether YIV-906 can also regulate CAR-induced NFAT activity. Jurkat-PD1 NFAT luciferase receptor cells were stably transfected with CAR-CD19-CD3ζ (zeta) DNA expressing a CAR targeting CD19. NFAT activity could be stimulated by co-cultured Jurkat-PD1-CAR-CD19-CD3ζ and Raji, which naturally expresses CD19 on the cell surface.

[0136] As shown in Figure 13A-B, YIV-906, S, and S components (oroxylin A 7-O-β-D-glucuronide, baicalein, oroxylin A, and chrysin) had very similar effects on the NFAT activity of Jurkat-PD1 CAR-CD19 cells and Jurkat-PD1 cells. When Jurkat-PD1 CAR-CD19 cells were cocultured with Raji, approximately 40-fold NFAT activity could be induced. Under these conditions, YIV-906, S, and S compounds (oroxylin A 7-O-β-D-glucuronide, wogonoside, baicalein, oroxylin A, and chrysin) were able to modulate the NFAT activity triggered by the interaction of the chimeric antigen receptor (CAR-CD19-CD3ζ) on Jurkat cells with CD19 on Raji cells (Figure 13C-D). The interaction of PD1 with PD-L1 could suppress the NFAT activity induced by the interaction of chimeric antigen receptor (CAR-CD19-CD3ζ) on Jurkat cells with CD19 on Raji cells (Figure 13E-13F), while YIV-906, S, and S compounds (oroxylin A 7-O-β-D-glucuronide, wogonoside, baicalein, oroxylin A, and chrysin) could restore this suppressed NFAT activity (Figure 13F). The optimal dose for regulation could be different in different compounds. These results suggested that YIV-906 and its components have the potential to facilitate CAR T cell therapy for cancer treatment.

[0137] Example 11: In summary, YIV-906 could regulate the NFAT activity of T cells by inhibiting SHP2 and inducing TCR downstream protein phosphorylation. Multiple herbs, namely G, P, S, and their compounds, are involved, which may have different targets with different potencies. It is shown that YIV-906 and some of its components could be used to regulate T cell activation to facilitate immune checkpoint blockade therapy or CAR T cell therapy to treat cancer in patients. Since T cell activation is a very important step for vaccines to induce immune responses, YIV-906 and some of its components could also serve as adjuvants to enhance the efficacy of vaccination.

[0138] Enumerated Aspects The following listed aspects are provided, the numbering of which should not be construed as indicating importance.

[0139] Aspect 1 provides: 1. A method of enhancing nuclear factor of activated T cells (NFAT) activity and / or restoring inhibited NFAT activity in a subject in need thereof, comprising: (a) herbal extract PHY906, comprising the herbal extracts of Scutellaria baicalensis (S), Glycyrrhiza uralensis (G), Paeonia lactiflora (P), and Ziziphus jujuba (Z), a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (b) an herbal extract of S, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (c) an herbal extract containing an extract of S, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (d) an herbal extract of G, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (e) an herbal extract, including an extract of G, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (f) an herbal extract of P, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; and (g) Herbal extracts, including extracts of P, fractions thereof, or any active chemicals present in the herbal extracts or fractions thereof. The method comprises administering to the subject a therapeutically effective amount of at least one herbal composition selected from the group consisting of:

[0140] Aspect 2 provides: 2. The method of embodiment 1, wherein the active chemical in the S herbal extract or fraction thereof is at least one selected from the group consisting of oroxylin A 7-O-β-D-glucuronide, baicalein, oroxylin A, baicalin, an isomer of baicalin, chrysin 6-C-arabinoside 8-C-glucoside, acteoside, vicizulin I 2'-O-glucoside, and chrysin.

[0141] Aspect 3 provides: The method of embodiment 1-2, wherein said active chemical in said G herbal extract or fraction thereof is at least one selected from the group consisting of liquiritigenin, isoliquiritigenin, liquiritin, isoliquiritin, licochalcone A, and glycycoumarin.

[0142] Aspect 4 provides: 4. The method of embodiment 1-3, wherein the active chemical in the P herbal extract or fraction thereof is at least one selected from the group consisting of gallic acid, 4-o-methylpaeoniflorin, 4-o-methylpaeoniflorin isomer, 6'-O-galloylpaeoniflorin, albiflorin, and paeoniflorin.

[0143] Aspect 5 provides the following: The method of any one of embodiments 1 to 4, wherein the herbal composition is administered orally to the subject.

[0144] Aspect 6 provides the following: The method of embodiment 1-5, wherein the herbal composition is formulated as one selected from the group consisting of pills, tablets, capsules, soups, teas, concentrates, dragees, liquids, drops, and gelatin capsules.

[0145] Aspect 7 provides the following: The method of any one of the preceding claims, wherein the therapeutically effective amount of said herbal composition is from about 20 mg / day to about 2 g / day.

[0146] Aspect 8 provides the following: The method of any one of the preceding claims, wherein the therapeutically effective amount of said herbal composition is about 1,600 mg / day.

[0147] Aspect 9 provides the following: The method of any one of embodiments 1 to 8, which induces protein phosphorylation in the downstream cascade of the T cell receptor (TCR) and inhibits SH2-containing phosphatase 2 (SHP2) activity.

[0148] Aspect 10 provides the following: The method of embodiment 1-9, wherein said herbal composition is administered at a time selected from prior to, concurrently with, and after administration of immune checkpoint inhibitor therapy or chimeric antigen receptor T (CAR T) cell therapy or a vaccine.

[0149] Aspect 11 provides the following: 11. The method of embodiments 1-10, wherein said immune checkpoint inhibitor therapy comprises administering at least one immune checkpoint inhibitor selected from the group consisting of ipilimumab, pembrolizumab, nivolumab, durvalumab, avelumab, dostallimab-gxly, cemiplimab-rwlc, toripalimab, camrelizumab, tislelizumab, pemplimab, zimberelimab, sintilimab, and atezolizumab.

[0150] Aspect 12 provides the following: (a) enhancing the efficacy of said CAR T cell therapy; (b) enhancing the efficacy of said immune checkpoint inhibitor therapy; and (c) enhancing the efficacy of said vaccine. The method of any one of embodiments 1 to 11, wherein the method is advantageous for at least one selected from the group consisting of:

[0151] Aspect 13 provides the following: 13. The method of embodiments 1 to 12, which is used for cancer chemoprevention.

[0152] Aspect 14 provides the following: 1. A method of enhancing efficacy of chimeric antigen receptor T cell (CAR T) immunotherapy in a subject, comprising: (a) herbal extract PHY906, comprising the herbal extracts of Scutellaria baicalensis (S), Glycyrrhiza uralensis (G), Paeonia lactiflora (P), and Ziziphus jujuba (Z), a fraction thereof, or any active chemicals present in said herbal extract or fraction thereof; (b) an herbal extract of S, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (c) an herbal extract containing an extract of S, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (d) an herbal extract of G, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (e) an herbal extract, including an extract of G, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (f) an herbal extract of P, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; and (g) Herbal extracts, including extracts of P, fractions thereof, or any active chemicals present in the herbal extracts or fractions thereof. The method comprises administering to the subject a therapeutically effective amount of at least one herbal composition selected from the group consisting of:

[0153] Aspect 15 provides the following: 1. A method of enhancing efficacy of immune checkpoint blockade therapy in a subject, comprising: (a) herbal extract PHY906, comprising the herbal extracts of Scutellaria baicalensis (S), Glycyrrhiza uralensis (G), Paeonia lactiflora (P), and Ziziphus jujuba (Z), a fraction thereof, or any active chemicals present in said herbal extract or fraction thereof; (b) an herbal extract of S, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (c) an herbal extract containing an extract of S, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (d) an herbal extract of G, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (e) an herbal extract, including an extract of G, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (f) an herbal extract of P, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; and (g) Herbal extracts, including extracts of P, fractions thereof, or any active chemicals present in the herbal extracts or fractions thereof. The method comprises administering to the subject a therapeutically effective amount of at least one herbal composition selected from the group consisting of:

[0154] Aspect 16 provides the following: 1. A method of enhancing vaccine efficacy in a subject, comprising: (a) herbal extract PHY906, comprising the herbal extracts of Scutellaria baicalensis (S), Glycyrrhiza uralensis (G), Paeonia lactiflora (P), and Ziziphus jujuba (Z), a fraction thereof, or any active chemicals present in said herbal extract or fraction thereof; (b) an herbal extract of S, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (c) an herbal extract containing an extract of S, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (d) an herbal extract of G, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (e) an herbal extract, including an extract of G, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (f) an herbal extract of P, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; and (g) Herbal extracts, including extracts of P, fractions thereof, or any active chemicals present in the herbal extracts or fractions thereof. The method comprises administering to the subject a therapeutically effective amount of at least one herbal composition selected from the group consisting of:

[0155] Aspect 17 provides the following: The method of any one of embodiments 1 to 16, wherein the subject is a mammal.

[0156] Aspect 18 provides the following: The method of any one of embodiments 1 to 17, wherein the subject is a human subject.

[0157] Aspect 19 provides the following: 1. An herbal composition for modulating NFAT activity in T cells of a subject in need thereof, comprising: (a) herbal extract PHY906, comprising the herbal extracts of Scutellaria baicalensis (S), Glycyrrhiza uralensis (G), Paeonia lactiflora (P), and Ziziphus jujuba (Z), a fraction thereof, or any active chemicals present in said herbal extract or fraction thereof; (b) an herbal extract of S, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (c) an herbal extract containing an extract of S, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (d) an herbal extract of G, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (e) an herbal extract, including an extract of G, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (f) an herbal extract of P, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (g) an herbal extract, including an extract of P, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (h) an herbal extract of Z, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; and (i) an herbal extract comprising an extract of Z, a fraction thereof, or any active chemicals present in the herbal extract or a fraction thereof; The herbal composition comprising at least one selected from the group consisting of:

[0158] Aspect 20 provides the following: The composition of embodiment 19, wherein the herbal composition is administered orally to the subject.

[0159] Aspect 21 provides the following: 21. The composition of embodiment 19-20, wherein the herbal composition is formulated as one selected from the group consisting of pills, tablets, capsules, soups, teas, concentrates, dragees, liquids, drops, and gelatin capsules.

[0160] Aspect 22 provides the following: The composition of any one of embodiments 19 to 21, further comprising a pharma- ceutically acceptable carrier.

[0161] The recitation of a list of elements in any definition of a variable herein includes a definition of that variable as any single element or combination (or subcombination) of the listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment, or that embodiment in combination with any other embodiment or portion thereof.

[0162] The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated by reference in their entirety. Although the present disclosure is made with reference to certain embodiments, it is apparent that other embodiments and variations of the present disclosure may be devised by those skilled in the art without departing from the true spirit and scope of the present disclosure. The appended claims are intended to be construed to include all such embodiments and equivalent variations.

Claims

1. 1. A method of enhancing nuclear factor of activated T cells (NFAT) activity and / or restoring inhibited NFAT activity in a subject in need thereof, comprising: (a) herbal extract PHY906, comprising the herbal extracts of Scutellaria baicalensis (S), Glycyrrhiza uralensis (G), Paeonia lactiflora (P), and Ziziphus jujuba (Z), a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (b) an herbal extract of S, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (c) an herbal extract containing an extract of S, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (d) an herbal extract of G, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (e) an herbal extract, including an extract of G, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (f) an herbal extract of P, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; and (g) Herbal extracts, including extracts of P, fractions thereof, or any active chemicals present in the herbal extracts or fractions thereof. The method comprises administering to the subject a therapeutically effective amount of at least one herbal composition selected from the group consisting of:

2. 2. The method of claim 1, wherein the active chemical in the S herbal extract or fraction thereof is at least one selected from the group consisting of oroxylin A 7-O-β-D-glucuronide, baicalein, oroxylin A, baicalin, an isomer of baicalin, chrysin 6-C-arabinoside 8-C-glucoside, acteoside, vicizulin I 2'-O-glucoside, and chrysin.

3. 2. The method of claim 1, wherein the active chemical in the G herbal extract or fraction thereof is at least one selected from the group consisting of liquiritigenin, isoliquiritigenin, liquiritin, isoliquiritin, licochalcone A, and glycycoumarin.

4. 2. The method of claim 1, wherein the active chemical in the P herbal extract or fraction thereof is at least one selected from the group consisting of gallic acid, 4-o-methylpaeoniflorin, 4-o-methylpaeoniflorin isomer, 6'-O-galloylpaeoniflorin, albiflorin, and paeoniflorin.

5. 10. The method of claim 1, wherein the herbal composition is administered orally to the subject.

6. 2. The method of claim 1, wherein the herbal composition is formulated as one selected from the group consisting of pills, tablets, capsules, soups, teas, concentrates, dragees, liquids, drops, and gelatin capsules.

7. 10. The method of claim 1, wherein the therapeutically effective amount of said herbal composition is from about 20 mg / day to about 2 g / day.

8. 8. The method of claim 7, wherein the therapeutically effective amount of the herbal composition is about 1,600 mg / day.

9. The method of claim 1, which induces protein phosphorylation in the downstream cascade of the T cell receptor (TCR) and inhibits SH2-containing phosphatase 2 (SHP2) activity.

10. 2. The method of claim 1, wherein the herbal composition is administered at a time selected from prior to, concurrently with, and after administration of immune checkpoint inhibitor therapy or chimeric antigen receptor T (CAR T) cell therapy or a vaccine.

11. 11. The method of claim 10, wherein the immune checkpoint inhibitor therapy comprises administering at least one immune checkpoint inhibitor selected from the group consisting of ipilimumab, pembrolizumab, nivolumab, durvalumab, avelumab, dostallimab-gxly, cemiplimab-rwlc, toripalimab, camrelizumab, tislelizumab, pemplimab, zimberelimab, sintilimab, and atezolizumab.

12. (a) enhancing the efficacy of said CAR T cell therapy; (b) enhancing the efficacy of said immune checkpoint inhibitor therapy; and (c) enhancing the efficacy of said vaccine.

11. The method of claim 10, wherein the method is advantageous for at least one selected from the group consisting of:

13. 13. The method of claim 1, used for chemoprevention of cancer.

14. 1. A method of enhancing efficacy of chimeric antigen receptor T cell (CAR T) immunotherapy in a subject, comprising: (a) herbal extract PHY906, comprising herbal extracts of Scutellaria baicalensis (S), Glycyrrhiza uralensis (G), Paeonia lactiflora (P), and Ziziphus jujuba (Z), a fraction thereof, or any active chemicals present in said herbal extract or fraction thereof; (b) an herbal extract of S, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (c) an herbal extract containing an extract of S, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (d) an herbal extract of G, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (e) an herbal extract, including an extract of G, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (f) an herbal extract of P, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; and (g) Herbal extracts, including extracts of P, fractions thereof, or any active chemicals present in the herbal extracts or fractions thereof. The method comprises administering to the subject a therapeutically effective amount of at least one herbal composition selected from the group consisting of:

15. 1. A method of enhancing efficacy of immune checkpoint blockade therapy in a subject, comprising: (a) herbal extract PHY906, comprising herbal extracts of Scutellaria baicalensis (S), Glycyrrhiza uralensis (G), Paeonia lactiflora (P), and Ziziphus jujuba (Z), a fraction thereof, or any active chemicals present in said herbal extract or fraction thereof; (b) an herbal extract of S, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (c) an herbal extract containing an extract of S, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (d) an herbal extract of G, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (e) an herbal extract, including an extract of G, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (f) an herbal extract of P, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; and (g) Herbal extracts, including extracts of P, fractions thereof, or any active chemicals present in the herbal extracts or fractions thereof. The method comprises administering to the subject a therapeutically effective amount of at least one herbal composition selected from the group consisting of:

16. 1. A method of enhancing vaccine efficacy in a subject, comprising: (a) herbal extract PHY906, comprising herbal extracts of Scutellaria baicalensis (S), Glycyrrhiza uralensis (G), Paeonia lactiflora (P), and Ziziphus jujuba (Z), a fraction thereof, or any active chemicals present in said herbal extract or fraction thereof; (b) an herbal extract of S, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (c) an herbal extract containing an extract of S, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (d) an herbal extract of G, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (e) an herbal extract, including an extract of G, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (f) an herbal extract of P, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; and (g) Herbal extracts, including extracts of P, fractions thereof, or any active chemicals present in the herbal extracts or fractions thereof. The method comprises administering to the subject a therapeutically effective amount of at least one herbal composition selected from the group consisting of:

17. The method of any one of claims 1 and 14 to 16, wherein the subject is a mammal.

18. 20. The method of claim 17, wherein the subject is a human subject.

19. 1. An herbal composition for modulating NFAT activity in T cells of a subject in need thereof, comprising: (a) herbal extract PHY906, comprising herbal extracts of Scutellaria baicalensis (S), Glycyrrhiza uralensis (G), Paeonia lactiflora (P), and Ziziphus jujuba (Z), a fraction thereof, or any active chemicals present in said herbal extract or fraction thereof; (b) an herbal extract of S, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (c) an herbal extract containing an extract of S, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (d) an herbal extract of G, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (e) an herbal extract, including an extract of G, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (f) an herbal extract of P, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (g) an herbal extract, including an extract of P, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; (h) an herbal extract of Z, a fraction thereof, or any active chemicals present in the herbal extract or fraction thereof; and (i) an herbal extract comprising an extract of Z, a fraction thereof, or any active chemicals present in the herbal extract or a fraction thereof; The herbal composition comprising at least one selected from the group consisting of:

20. 20. The composition of claim 19, wherein the herbal composition is administered orally to the subject.

21. 20. The composition of claim 19, wherein the herbal composition is formulated as one selected from the group consisting of pills, tablets, capsules, soups, teas, concentrates, dragees, liquids, drops, and gelatin capsules.

22. 20. The composition of claim 19, further comprising a pharma- ceutically acceptable carrier.

Images