Compositions and methods involving engineered small nuclear RNAs (snRNAs)

Abstract

Disclosed herein is a snRNA system that includes an engineered stem loop. The present disclosure provides a gene therapy composition that includes a new therapeutic RNA targeting platform that is composed of an engineered snRNA (esnRNA) that includes an engineered snRNA stem loop (eSL). Disclosed herein is a composition that includes a nucleic acid molecule, and a vector that includes an engineered snRNA (esnRNA). Disclosed herein is an RNA targeting nucleic acid molecule that includes an engineered snRNA (esnRNA) system, where the esnRNA system includes an engineered stem loop (eSL).

Description

[Technical field]

[0001] Reference to Electronic Sequence Listing The contents of the electronic format of the sequence listing (LOCN_020_001WO_SeqList_ST26.xml; size: 289,776 bytes; and creation date: March 6, 2023) are incorporated herein by reference in their entirety.

[0002] Related Applications This application claims priority to and the benefit of U.S. Provisional Patent Application No. 63 / 316,659, filed March 4, 2022, and U.S. Provisional Patent Application No. 63 / 379,983, filed October 18, 2022. The contents of each of these applications are incorporated herein by reference in their entirety.

[0003] Field of Disclosure The present disclosure is directed to molecular biology, gene therapy, and compositions and methods for altering the expression and activity of RNA molecules. [Background technology]

[0004] background There is a long-felt and unmet need in the art to provide effective treatments for correcting dysfunctional messenger RNA.

[0005] Small nuclear RNAs (snRNAs) are one of the smallest types of RNA with an average size of approximately 150 nucleotides. snRNAs are functional non-coding RNAs. Eukaryotic genomes encode a variety of non-coding RNAs, such as snRNAs, a class of highly abundant RNAs that are localized in the nucleus and perform important functions in intron splicing and RNA processing. snRNAs can form ribonucleoprotein particles (snRNPs) with other proteins in the pre-mRNA splicing process. These snRNPs and additional proteins form large particulate complexes (spliceosomes) bound to unspliced ​​pre-mRNA transcripts. In addition to splicing, snRNAs function in the nuclear maturation of nascent transcripts, in gene expression regulation, as splice donors in non-canonical systems, and in the 3'-end processing of replication-dependent histone mRNAs. Although U7 snRNA can be programmed to bind and modulate mRNAs without exogenous protein expression, there remains a need to develop highly specific mRNA-targeted therapeutics that minimize immunogenicity risks. Furthermore, the small size of these programmed snRNAs creates the opportunity to develop single-vector, highly specific (allele-specific), single-target and multi-targeted gene therapy approaches.

[0006] Based thereon, the present disclosure provides compositions and methods comprising a new therapeutic RNA targeting platform composed of engineered snRNAs. Summary of the Invention [Means for solving the problem]

[0007] overview The present disclosure provides gene therapy compositions comprising a novel therapeutic RNA targeting platform composed of engineered snRNAs (esnRNAs) containing engineered snRNA stem loops (eSLs).

[0008] Disclosed herein are compositions comprising nucleic acid molecules, and vectors comprising engineered snRNAs (esnRNAs).

[0009] Disclosed herein are RNA-targeting nucleic acid molecules that comprise an engineered snRNA (esnRNA) system, where the esnRNA system comprises an engineered stem-loop (eSL).

[0010] In one embodiment, the esnRNA comprises a 5' interacting stabilizer domain (5'ISD).

[0011] In one embodiment, the esnRNA comprises a targeting sequence (TS) (or spacer) that targets an RNA of interest. In another embodiment, the target RNA of interest is a microsatellite repeat RNA or a non-repeat RNA. In another embodiment, the microsatellite repeat RNA of interest is selected from the group consisting of CUG, CAG, GGGGCC, and CCCCGG. In one embodiment, the esnRNA comprises a targeting sequence (TS) that targets two target RNAs of interest that are GGGGCC and CCCCGG. In another embodiment, the two target RNAs of interest are a microsatellite repeat RNA and a non-repeat RNA. In another embodiment, the non-repeat RNA is a flanking sequence of a microsatellite repeat RNA. In another embodiment, the esnRNA comprises a targeting sequence (TS) that targets two or more RNAs of interest. In another embodiment, the esnRNA comprises two or more targeting sequences (TS) that target two or more RNAs of interest. In another embodiment, the esnRNA comprises a fusion of two or more TSs.

[0012] In one embodiment, the esnRNA comprises an Sm binding domain (SmBD). In one embodiment, the SmBD is selected from the group consisting of U1, U2, U4 and U5 SnRNA. In another embodiment, the SmBD is derived from a pseudosnRNA.

[0013] In one embodiment, the esnRNA is operably linked to a snRNA promoter. In another embodiment, the snRNA promoter is a U7 promoter. In another embodiment, the U7 promoter is an endogenous U7 promoter. In another embodiment, the U7 promoter is a human U7 promoter (hU7) or a mouse U7 promoter (mU7). In another embodiment, the U7 promoter is an endogenous human U7 promoter of SEQ ID NO: 43. In one embodiment, the snRNA promoter is a U1 promoter. In another embodiment, the U1 promoter is a human U1 promoter or a mouse U1 promoter. In another embodiment, the snRNA promoter is selected from the group consisting of a human U7 promoter, a human U1 promoter, a human U2 promoter, a human U4 promoter, a human U5 promoter, a human U6 promoter, a human 7sk promoter, a tRNA(Val) promoter, a mouse U1 promoter, and a mouse U7 promoter. In another embodiment, the vector comprises one or more esnRNAs or one or more copies of an esnRNA driven by one or more snRNA promoters. In one embodiment, the vector comprises two copies (2x) of esnRNA. In one embodiment, the vector comprises two snRNA promoters, each promoter driving a copy of 2x esnRNA. In another embodiment, the two snRNA promoters are U7 and U1 promoters. In another embodiment, the two snRNA promoters are selected from the group consisting of human U7, human U1, human U2, human U4, human U5, human U6, human 7sk, tRNA(Val) promoters, mouse U1, mouse U2, mouse U5, mouse U6, mouse U7, and mouse H1 promoters. In another embodiment, the two snRNA promoters are mouse U7 and mouse U1 promoters.

[0014] In one embodiment, the esnRNA is operably linked to a snRNA downstream terminator (DT). In another embodiment, the snRNA DT is U7 DT.

[0015] In one embodiment, the esnRNA comprises an eSL, a U7 promoter, a TS, an SmBD, a 5'ISD, and a DT. In another embodiment, the esnRNA comprises an eSL, a U7 promoter, a U1 promoter, a TS, an SmBD, a 5'ISD, and a DT.

[0016]

[0017] In one embodiment, the esnRNA comprises an eSL, a U7 promoter, a TS, an SmBD, a 5'ISD, and a DT. In another embodiment, the esnRNA comprises an eSL, a U7 promoter, a U1 promoter, a TS, an SmBD, a 5'ISD, and a DT.

[0018] Vectors comprising esnRNA are also disclosed herein. In some embodiments, the vector comprises multiple copies of the esnRNA. In some embodiments, the multiple copies of the esnRNA are two, three or four copies of the esnRNA (2x, 3x or 4x). In some embodiments, the multiple copies of the esnRNA are four or more copies of the esnRNA (4x or more). In some embodiments, each esnRNA of the multiple copies of the esnRNA is separated by a nucleic acid buffer sequence derived from a human non-coding genomic sequence downstream of the snRNA. In one embodiment, the buffer sequence is derived from a human genomic sequence downstream of U7. In one embodiment, the buffer sequence is selected from the group consisting of buffer 1 (30bp, 100bp, or 500bp), buffer 2 (30bp, 100bp, or 500bp), buffer 3 (30bp, 100bp, or 500bp), and combinations thereof. In one embodiment, the vector is a viral vector or a non-viral vector. In another embodiment, the viral vector is an AAV vector. In another embodiment, the AAV vector is a scAAV vector or a ssAAV vector.In another embodiment, the AAV vector is an AAV9 vector.In another embodiment, the AAV9 vector is a ssAAV9 vector or a scAAV9 vector.

[0019] Also disclosed herein is a method of targeting one or more target RNAs of interest and blocking, knocking down, editing, exon skipping, exon inclusion or splicing one or more target RNAs, comprising contacting an esnRNA of the present disclosure with a cell containing one or more target RNAs.

[0020] The present disclosure provides an RNA-targeting nucleic acid molecule comprising an engineered snRNA esnRNA, wherein the esnRNA system comprises an engineered stem-loop (eSL) comprising one or more nucleic acid sequences selected from SEQ ID NO:1-SEQ ID NO:11, SEQ ID NO:146-SEQ ID NO:148, SEQ ID NO:163, or SEQ ID NO:186-205.

[0021] In some embodiments, the esnRNA comprises a targeting sequence (TS) that targets a target RNA of interest.

[0022] In some embodiments, the target RNA is a pre-mRNA or mRNA sequence. In some embodiments, the target RNA of interest is a microsatellite repeat RNA. In some embodiments, the microsatellite repeat RNA is selected from the group consisting of CUG, CAG, and GGGGCC+CCCCGG.

[0023] In some embodiments, the target RNA is a sequence encoding DMD. In some embodiments, the targeting sequence is selected from SEQ ID NO: 206 or SEQ ID NO: 207. In some embodiments, the targeting sequence comprises one or more nucleic acid sequences set forth in SEQ ID NO: 208 to SEQ ID NO: 227.

[0024] In some embodiments, the esnRNA comprises two targeting sequences that target two RNAs of interest. In some embodiments, the two TSs are fusion sequences.

[0025] In some embodiments, the esnRNA comprises a Sm binding domain (SmBD) selected from the group consisting of U1, U2, U4 and U5 SmBD.

[0026] In some embodiments, the SmBD comprises a nucleic acid sequence set forth in any one of SEQ ID NO:31-SEQ ID NO:38, or SEQ ID NO:164.

[0027] In some embodiments, the esnRNA comprises a 5' interacting stabilizer domain (5'ISD) comprising a nucleotide sequence selected from any one of SEQ ID NO:12 to SEQ ID NO:23.

[0028] In some embodiments, the esnRNA comprises a nucleic acid sequence set forth in any one of SEQ ID NO:65 to SEQ ID NO:119 or SEQ ID NO:179 to SEQ ID NO:185.

[0029] The present disclosure provides a vector comprising one or more esnRNAs of the present disclosure.In some embodiments, the viral vector is an AAV vector.In some embodiments, the esnRNA is operably linked to a promoter.

[0030] In some embodiments, the esnRNA is operably linked to a U7 promoter or a U1 promoter.

[0031] In some embodiments, the esnRNA is operably linked to a downstream terminator (DT). In some embodiments, the esnRNA is operably linked to a U7 downstream terminator or a U1 downstream terminator.

[0032] In some embodiments, the vector comprises at least one, at least two, at least three, at least four, or at least five esnRNAs. In some embodiments, each of the at least one, at least two, at least three, at least four, or at least five esnRNAs targets the same target RNA sequence.

[0033] In some embodiments, at least one, at least two, at least three, at least four, or at least five esnRNAs target two or more target RNA sequences. In some embodiments, each esnRNA is separated by a buffer sequence. In some embodiments, the buffer sequence comprises any one of the nucleic acid sequences set forth in SEQ ID NO:24 to SEQ ID NO:30.

[0034] In some embodiments, the vector comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 123 to 143, 168 to 178, or 231 to 233.

[0035] A DMD exon 51 RNA targeting nucleic acid molecule comprising a spacer sequence as set forth in any one of SEQ ID NOs: 206 to 230.

[0036] The present disclosure provides a method of treating a disease or disorder in a subject, the method comprising administering an RNA-targeting nucleic acid molecule of the present disclosure or an AAV vector of the present disclosure.

[0037] In some embodiments, the disease or disorder is associated with a toxic repeat RNA sequence. In some embodiments, the toxic repeat RNA sequence is a CAG, CUG, GGCCCC, CCGGG, or GGCCC+CCGGGG RNA repeat.

[0038] In some embodiments, the disease or disorder is myotonic dystrophy (DM1) or Huntington's disease (HD).

[0039] In some embodiments, the disease or disorder is Duchenne muscular dystrophy. In some embodiments, the RNA targeting nucleic acid molecule or AAV vector targets the RNA sequence encoding dystrophin (DMD).

[0040] In some embodiments, the RNA sequence encoding DMD comprises an intron or exon sequence. In some embodiments, the exon sequence comprises exon 51 of DMD or a flanking region thereof. In some embodiments, the administration is intravenous, intramuscular, subpial, intrathecal, intraparenchymal, intrathecal, intrastriatal, subcutaneous, intradermal, intraperitoneal, intratumoral, intravenous, intraocular and / or parenteral.

[0041] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. [Brief description of the drawings]

[0042] [Figure 1] Figure 1A shows tape station images of PCR products with increasing abundance for engineered SLs indicating increased stability of esnRNAs disclosed herein. Predicted PCR product sizes are shown below the images. Figure 1B illustrates a schematic of an engineered snRNA (esnRNA) containing an engineered stem-loop (eSL) as disclosed herein along with an unengineered stem-loop. Figure 1C shows an alternative mechanism for protecting the 5' end of the snRNA prior to the use of an interaction stabilizer domain (ISD). Figure 1D shows the approximate size of the snRNA cassette.

[0043] [Figure 2A] Figures 2A-2B show FISH quantification and images of CUG RNA foci of esnRNAs targeting CUGs disclosed herein compared to NT (non-targeting) esnRNAs. The y-axis depicts the average foci percentage per cell normalized to NT, and the x-axis depicts treatment. Cell nuclei were stained with DAPI and CUG RNA foci were labeled with specific labeled probes. Figure 2C shows a schematic of the esnRNA MOA that targets and blocks CUG repeat expansions that release MBLN and repairs splicing defects specific to DM1 disease. [Figure 2B]Figures 2A-2B show FISH quantification and images of CUG RNA foci of esnRNAs targeting CUGs disclosed herein compared to NT (non-targeting) esnRNAs. The y-axis depicts the average foci percentage per cell normalized to NT, and the x-axis depicts treatment. Cell nuclei were stained with DAPI and CUG RNA foci were labeled with specific labeled probes. Figure 2C shows a schematic of the esnRNA MOA that targets and blocks CUG repeat expansions that release MBLN and repairs splicing defects specific to DM1 disease. [Figure 2C] Figures 2A-2B show FISH quantification and images of CUG RNA foci of esnRNAs targeting CUGs disclosed herein compared to NT (non-targeting) esnRNAs. The y-axis depicts the average foci percentage per cell normalized to NT, and the x-axis depicts treatment. Cell nuclei were stained with DAPI and CUG RNA foci were labeled with specific labeled probes. Figure 2C shows a schematic of the esnRNA MOA that targets and blocks CUG repeat expansions that release MBLN and repairs splicing defects specific to DM1 disease.

[0044] [Diagram 3] Figure 3A shows qPCR results of dose-dependent knockdown of CAG80 reporter mRNA to baseline levels. The y-axis depicts CAG repeat RNA expression levels relative to the reference gene GAPDH, and the x-axis depicts snRNA treatments (using different doses of 250ng, 500ng or 1000ng) that target (CUG15) or do not target (nt) CAG. Figure 3B shows a Western blot for CAG80 reporter polyQ protein expression. The top lane shows CAG reporter polyQ expression, and the bottom lane shows GAPDH loading control. Figure 3C shows CAG repeat expansion in Huntington's disease mutant HTT, and esnRNA MOA that blocks CAG repeats.

[0045] [Figure 4]Figure 4A shows a tape station image of PCR products to detect USH2A exon 13 inclusion (upper band) or exclusion (lower band) after treatment with esnRNA. Figure 4C shows quantification of the percentage of exon 13 exclusion after esnRNA treatment compared to NT esnRNA control (shown in A). Figure 4B shows a schematic of engineered snRNAs containing eSL compared to non-engineered snRNAs. Figure 4D shows a schematic of splicing modulation in Usher syndrome and DMD (Duchenne muscular dystrophy).

[0046] [Diagram 5] Figures 5A-F show PCR results for the restoration of splicing isoforms of BIN1, DMD and LBD3 (misspliced ​​in DM1 patient cells) after treatment with esnRNA targeting CUG repeats in DM1 patient-derived myotubes. Figures A-C show quantification of the restoration percentage to healthy splice isoforms from the tape station images shown in Figures D-F. The y-axis depicts the correction percentage and the x-axis depicts the treatment (knt refers to non-targeted negative control; CAGx15 refers to CUG-targeted esnRNA; unt refers to untreated).

[0047] [Figure 6] Figures 6A-6B show quantification of the efficacy of esnRNAs with alternative 5' interaction stabilization domains (ISDs) in knocking down CUG RNA foci, transfection of synthetic snRNAs into CTG480 HeLa cells followed by fluorescent in situ hybridization for CUG RNA foci. (Light blue = alternative engineered stem-loops with corresponding 5'ISD. Dark blue = selected engineered stem-loops and corresponding 5'ISD. sR220004 = non-targeting snRNA). Synthetic snRNAs were transfected at 33 nM (A) or 11 nM (B) doses.

[0048] [Figure 7]Figures 7A-7B show that different ISDs confer varying levels of stability over time. Figures 7A and B show the relative abundance of synthetic engineered snRNAs with alternative 5' stabilization domains over time. RNA was collected at 24 h, 48 h, and 72 h after transfection of synthetic snRNAs with various stabilization domains to determine the relative stability of the snRNAs.

[0049] [Figure 8] Figure 8 shows snRNA expression levels by qPCR in CTG480 HeLa cells when snRNAs are expressed under separate PolIII and PolII promoters. The y-axis depicts snRNA expression levels relative to the GAPDH reference gene, and the x-axis depicts the different snRNA promoters used to express the snRNAs (Pol II U1 and U7 promoters or PolIII: U6, tRNA and 7SK). Plasmids with various promoters were transfected at two different doses (250 and 500 ng).

[0050] [Figure 9] Figures 9A-9B show quantification of CUG foci by RNA FISH in CTG480 HeLa cells following transfection of 500 ng (A) or 250 ng (B) of engineered snRNA constructs with various Pol III and Pol II promoters and respective DT sequences. Constructs with Pol II promoters driving expression of engineered snRNAs (P02225 and P03557) are more effective at depleting microsatellite repeat-containing foci than constructs with Pol III promoters driving snRNAs. Grey bars represent NT esnRNAs and blue bars represent CUG-targeting esnRNAs.

[0051] [Figure 10]FIG. 10 shows snRNA expression levels by qPCR in HEK293T cells when snRNAs are expressed under PolIII (U6, tRNA and 7SK) or PolII promoters (U7 and U1) and contain SmOpt or U1 Sm binding sites.

[0052] [Figure 11] Figures 11A-11B show snRNA expression levels relative to the GAPDH reference gene after transfection into HEK293 cells. Primers specific for each snRNA (z) were used in qPCR to determine relative promoter strength. The y-axis depicts snRNA expression levels relative to GAPDH, and the x-axis depicts snRNA spacers znt (non-targeted control, in A) and z38 (targeted spacer, in B) when expressed under the snRNA's distinct promoters (U1, U2, U4, U5 and U7; unt refers to untreated). Primer sets specific for z-nt (Figure A) or z-38 (Figure B) were used.

[0053] [Figure 12A] Figures 12A-12B show results for exon 51 skipping after transduction of human delta exon 52 myotubes with snRNAs disclosed herein (A03980: 2xz38 / 42 fusion snRNA cassette; A03981: two snRNA cassettes, one with z42 TS and the other with z38 TS). Figure 12A shows tape station images of PCR products representative of exon 51 inclusion and exclusion isoforms, as well as a schematic showing predicted fragment sizes. Figure 12B shows quantification of band intensities in Figure 12A by semi-quantitative PCR. The y-axis depicts the percentage of exon 51 skipping and the x-axis depicts treatment (either synthetic snRNA or AAV transduced at different MOIs for A03980 or (of) A03981). [Figure 12B]Figures 12A-12B show results for exon 51 skipping after transduction of human delta exon 52 myotubes with snRNAs disclosed herein (A03980: 2xz38 / 42 fusion snRNA cassette; A03981: two snRNA cassettes, one with z42 TS and the other with z38 TS). Figure 12A shows tape station images of PCR products representative of exon 51 inclusion and exclusion isoforms, as well as a schematic showing predicted fragment sizes. Figure 12B shows quantification of band intensities in Figure 12A by semi-quantitative PCR. The y-axis depicts the percentage of exon 51 skipping and the x-axis depicts treatment (either synthetic snRNA or AAV transduced at different MOIs for A03980 or (of) A03981).

[0054] [Figure 13] Figures 13A-13B show dystrophin staining of human delta exon 52 myotubes and restoration after treatment with snRNA for exon 51 skipping. Figure 13A shows immunofluorescence for desmin or dystrophin in untreated myotubes, myotubes treated with synthetic snRNA, or myotubes treated with MOI of 1e6 or 5e6 of A03980 (2xz38 / z42 fusion snRNA cassette). Figure 13B shows immunofluorescence for desmin or dystrophin in myotubes transduced with MOI of 1e6 or 5e6 of A03981 (two snRNA cassettes with z42 TS and z38 TS).

[0055] [Diagram 14AB]Figure 14A illustrates an A04569 vector genome expressing two fusion snRNAs of the same sequence as depicted in Figure 14B. Figure 14C shows that the exon 51 exonic splicing enhancer (ESE) targeting fusion snRNA can be constructed such that the z38 targeting sequence is in the most 5' position of the antisense sequence, with the z42 targeting sequence downstream of the z38 sequence (z73), or with the z42 targeting sequence in the most 5' position in the opposite orientation and with z38 downstream (z187). In both cases, the antisense sequence of the snRNA is composed of two targeting sequences, each of which targets a separate and unique ESE in exon 51 (Figure 14C, bottom diagram). [Figure 14C] Figure 14A illustrates an A04569 vector genome expressing two fusion snRNAs of the same sequence as depicted in Figure 14B. Figure 14C shows that the exon 51 exonic splicing enhancer (ESE) targeting fusion snRNA can be constructed such that the z38 targeting sequence is in the most 5' position of the antisense sequence, with the z42 targeting sequence downstream of the z38 sequence (z73), or with the z42 targeting sequence in the most 5' position in the opposite orientation and with z38 downstream (z187). In both cases, the antisense sequence of the snRNA is composed of two targeting sequences, each of which targets a separate and unique ESE in exon 51 (Figure 14C, bottom diagram).

[0056] [Diagram 15AB]Figure 15A-D shows the activity of exon 51 ESE-targeted fusion snRNAs in exon 52-deleted human skeletal myotubes and del52hDMD / mdx mice. (A) Tape station images and quantification of exon 51 skipping in DMD exon 52-deleted human skeletal myotubes 24 hours after transfection of low doses of synthetic snRNAs with fusion antisense sequences z73 (z38 / z42) and z187 (z42 / z38). At low doses, transfection of synthetic snRNA z187 induces higher levels of exon 51 skipping than z73. (Figure 15B) shows quantification of exon 51 skipping in human skeletal myotubes with DMD exon 52 deletion after transduction with AAV9-A04526 (with two esnRNA cassettes, each expressing z73) and A04569 (with two cassettes, each expressing z187) at MOIs of 2.5e4, 1e5 and 5e5 for 7 days. (Figure 15C) shows quantification of exon 51 skipping in a humanized exon 52 deleted DMD (del52hDMD / mdx) mouse model. Mice were injected retro-orbitally with 3e12 vector genomes of A04526 and A04569. After 3 weeks of survival, RNA was extracted from tibialis anterior (TA), gastrocnemius (Gc) and heart. Semi-quantitative RT-PCR was performed to detect exon 51 inclusion and exclusion bands. (FIG. 15D) shows quantification of dystrophin-positive fibers 4 weeks after intramuscular delivery of A04526 or ESE-targeted Vivo-Morpholino (ViM) at a dose of 3e11vg / muscle into the gastrocnemius muscle of del52hDMD / mdx mice. hDMD / mdx mice expressing wild-type human dystrophin (gray bars) serve as a positive control for dystrophin expression. U=untreated. [Figure 15C-D] Same as above.

[0057] [Figure 16A]Figure 16A-D shows splicing reversal of DMD and LBD3 splice isoforms and knockdown of DMPK after treatment with snRNA targeting CUG repeats in patient-derived myotubes (containing 1700 CUG repeats). DM1 patient fibroblasts were differentiated into myotubes by transduction with myoD adenoviral vectors (5 days). Cells were then transduced with multiple MOIs of A04233 and A04234 (scAAV9 double snRNA targeting CUG repeats) and cells were harvested 7 days after transduction. Figure 16A shows tape station images of RT-PCR products using specific primers to detect DMD exon 78 inclusion (upper band) and LBD3 exon 11 exclusion (lower band), markers of splicing corrections found in normal WT cells. Quantification of DMD exon 78 inclusion (Figure 16B) and LBD3 exon 11 exclusion (Figure 16C). The x-axis depicts treatment (vector and MOI). The y-axis depicts the percentage of splice correction, either exon inclusion for DMD exon 78 or exclusion for LBD3 exon 11. Figure 16D shows DMPK RNA expression levels by ddPCR after treatment with snRNA (AAV9 A04233 and AAV9 A04234) at different MOIs. The x-axis depicts treatment. The y-axis depicts DMPK copies per 1000 copies of GAPDH reference gene normalized to UNT (untreated cells). [Figure 16BCD] Same as above.

[0058] [Figure 17]Figure 17A-B show images and quantification of nuclear RNA foci from patient-derived myotubes transduced with different MOIs of AAV9 A04233 and AAV9 A04234. DM1 patient fibroblasts were differentiated into myotubes by transduction with myoD adenoviral vectors (5 days). Cells were then transduced with multiple MOIs of A04233 and A04234 (scAAV9 double snRNA targeting CUG repeats) and cells were harvested for RNA FISH (to detect CUG foci) 7 days after transduction. Figure 17A shows images of CUG RNA foci obtained from untreated myotubes and myotubes treated with AAV9 snRNA vectors A04233 and A04234. Cell nuclei were stained with DAPI and CUG FISH was performed using a CUG-labeled probe. Cells were processed 7 days after transduction. Figure 17B shows quantification for the average number of CUG foci per cell. The x-axis depicts the treatment and MOI used. The y-axis depicts the mean CUG foci per cell normalized to UNT (untreated cells).

[0059] [Figure 18] Figure 18A-C depict the treatment, timeline and post-treatment quantification of HTT mutant soluble protein with AAV-snRNA targeting CAG repeats. Figure 18A shows the experimental design for the vector used, AAV-A04390 (2xhU7 / hU1 snRNA targeting CAG repeats), two MOIs, and the end-point assay to detect mutant (mut) HTT soluble protein. Figure 18B depicts the timeline for this experiment. HD patient iPSCs (containing 66 CAG repeats) were differentiated into cortical neurons for 2 weeks and then transduced with AAV-A04390 snRNA vector for another 2 weeks. Cortical neurons were then harvested and mutant soluble HTT protein was quantified by Meso scale discovery immunoassay (MSD; shown in Figure 18C). The y-axis depicts fmol of mutant soluble HTT per mg of protein lysate, and the x-axis depicts treatment and MOI.

[0060] [Figure 19] Figure 19A-B depict the in vivo study design targeting the CAG repeats for the R6 / 2 HD mouse model and the quantification of mutant HTT soluble protein after treatment with AAV-snRNA targeting the CAG repeats (A03081). The diagram in Figure 19A shows the dose (2e10 vector genomes) of AAVrh10-snRNA (4xCAGx15 targeting snRNA vector) administered by intrastriatal injection. Untreated or uninjected contralateral striatum was used as control. (Figure 19B) shows the quantification of mutant soluble HTT protein by Meso scale discovery immunoassay (MSD) for untreated and snRNA treated mice (n=10). The y-axis depicts fmol of mutant soluble HTT per mg of total protein lysate and the x-axis depicts treatment.

[0061] [Figure 20] Figure 20A depicts the difference between snRNA expressed from A04527, which expresses an engineered snRNA with a 5'ISD and an engineered mouse SL, and A04527, which expresses no 5'ISD and has the mouse's native SL. Figure 20B shows a bar graph of z38 / 42 expression (in snRNA copies / nanogram) 2 days after transduction of CHO-Lec2 cells with AAV9-A04527 or A04526 viruses at an MOI of 1e6. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0062] Detailed Description The present disclosure provides gene therapy compositions comprising a novel therapeutic RNA targeting platform composed of engineered snRNAs (esnRNAs) containing engineered snRNA stem loops (eSLs).

[0063] Disclosed herein are compositions comprising nucleic acid molecules, and vectors comprising engineered snRNAs (esnRNAs).

[0064] Small nuclear ribonucleic acids (snRNAs) are essential components of small nuclear ribonucleoprotein complexes (snRNPs) that, when assembled with additional proteins, form a large ribonucleoprotein complex known as the spliceosome, an intracellular machinery designated to mediate the entire mRNA maturation process. The spliceosome is involved in precursor mRNA splicing, the process of removing introns from RNA transcripts prior to protein production. Individual snRNAs are generally about 250 nucleotides or less in size. For example, U1 snRNA is 164 nucleotides in length and is encoded by a gene that is present in several copies in the human genome. U1 snRNAs represent the ribonucleic acid component of the nuclear particle U1 snRNP. U1 snRNAs have a stem and loop three-dimensional structure, and within the 5' region there is a single-stranded sequence, generally about 9 nucleotides in length, that can bind to a splicing donor site on a pre-mRNA molecule by complementary base pairing. (Horowitz et al., 1994, Trends Genet., 10(3):100-6). The various spliceosomal snRNAs are named U1, U2, U4, U5, U6, U4ATAC, U6ATAC, U7, U11 and U12 due to the large amount of uridylic acid they contain. (Mattaj et al., 1993, FASEB J, 15, 7:47-53).

[0065] The snRNA system can be used to treat toxic mutations. For example, antisense oligonucleotides that interfere with splice sites and regulatory elements in exons containing toxic mutations can induce skipping of specific exons at the RNA precursor level. Such antisense sequences can be packaged into snRNA sequences that are delivered using viral vectors with nucleic acid sequences that can transcribe snRNA. U7 snRNA is endogenously involved in histone pre-mRNA 3' end processing, but U7 snRNA can be converted into a versatile tool for splicing modulation by small changes in the binding sites of Sm / Lsm proteins. One such therapeutic strategy for treating Duchenne muscular dystrophy uses modified U7 snRNA to convert out-of-frame mutations into in-frame mutations that result in internally deleted toxic RNA but still functional dystrophin. (Goyenvalle et al., 2009, 17(7): 1234-1240).

[0066] Most U-rich snRNPs are complexes that mediate splicing of pre-mRNAs. U7 snRNP is an exception. U7 is not involved in splicing, but rather is a crucial factor in the unique 3'-end processing of replication-dependent histone mRNAs. By modifying the U7 snRNA histone binding sequence and Sm motif, U7 can no longer participate in the processing of histone pre-mRNAs, and instead blocks or targets the pre-mRNA or smRNA for splicing modulation. In this way, U7 snRNA can be used as an effective gene therapy platform. The U7 snRNA platform also has the added advantage of being small, capable of accumulating in the nucleus without causing cytotoxicity, and has little or no immunoreactivity. (Gadgil et al., 2021, J Gene Med, 23(4): e3321).

[0067] Disclosed herein is a new engineered and redesigned snRNA platform (also known herein as esnRNA platform), which includes 1) an engineered stem-loop (eSL). Compensatory modifications made to the native stem-loop sequence create an engineered stem-loop (eSL) that more effectively communicates (folds and anneals) with the snRNA interaction stabilization domain (ISD), resulting in an snRNA platform with increased stability. See FIG. 1. U7 snRNA has previously been shown to be programmable to modulate mRNA. Disclosed herein is an improved programmed engineered snRNA that can be used as a gene therapy tool. These engineered snRNA systems are shown herein to provide blockade of microsatellite repeat expansion (shown herein to treat Myotonic Dystrophy (DM1) or Huntington's Disease (HD)), exon skipping (shown herein to treat DMD) and splicing modulation (shown herein to treat USH2A (Usher Syndrome Type 2)). In one embodiment, these snRNAs are human snRNAs. In another embodiment, these snRNAs are mouse snRNAs. In another embodiment, the snRNAs are a combination of human and mouse snRNAs. In one embodiment, U7 is human U7 or mouse U7. In another embodiment disclosed herein, the engineered snRNAs include various types of snRNAs (such as U1-U12) by combining domains of endogenous snRNAs to fine-tune platform stabilization and / or reduce off-target effects. For example, in one embodiment, the engineered snRNA system comprises a combination of a human or mouse U7 snRNA component and a human or mouse U1 snRNA component.

[0068] Additional elements that can modulate RNA processing and abundance can be introduced into esnRNAs, including eSL, by further engineering. See FIG. 1C. In one embodiment, additional elements that can modulate esnRNA processing, stability and abundance can be introduced into esnRNAs at the 5' or 3' end by further engineering. In another embodiment, such elements can include, but are not limited to, stem loops, hairpins, GC clamps, kissing loops, triplexes, quadruplexes, and protein binding sites.

[0069] The esnRNA platform and portions thereof disclosed herein can be used in any therapeutic environment and context, as long as a stable spacer(s) (or TS(s)) is included in the design of the esnRNA therapeutic composition. In certain embodiments, the therapeutic esnRNA composition is used to treat a disease selected from the group consisting of Duchenne muscular dystrophy, DM1, and HD. In another embodiment, the esnRNA composition is used to treat DMD caused by exon 51 mutation. Engineered stem loop

[0070] The engineered snRNA (esnRNA) system disclosed herein comprises an engineered stem-loop (eSL) that comprises compensatory modifications of the native snRNA stem-loop. These modifications result in increased stability of the esnRNP compared to snRNPs that comprise unmodified stem-loops. The eSL disclosed herein can be derived from any snRNP, such as U1-U12. In one embodiment, the eSL is a human or mouse U7 eSL. In one embodiment, the eSL is a human or mouse eSL. In some embodiments, the eSL is a human and mouse eSL. In some embodiments, the eSL is a non-human eSL selected from the group consisting of mouse, pig, sheep, goat, cow, dog, cat, horse, or combinations thereof. In some embodiments, the eSL is an eSL selected from the group consisting of human, mouse, pig, sheep, goat, cow, dog, cat, horse, or combinations thereof. In some embodiments, the eSL sequence is not a native stem-loop sequence. In some embodiments, the nucleic acid sequence of eSL is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) not a native stem-loop sequence.

[0071] In some embodiments, the human eSL has the following nucleotide sequence: ggctttctggctccttaccggaaagcc (SEQ ID NO: 1), ggctttctgggaggttaccggaaagcc (SEQ ID NO: 2), ggctttctggcctccttaccggaaagcc (SEQ ID NO: 3), ggctttctggggaggttaccggaaagcc (SEQ ID NO: 4), ggctttctggctggctaccggaaagcc (SEQ ID NO: 5), ggctttctggcttccccggaaagcc (SEQ ID NO: 6), ggctttctggcttcttcccggaaagcc (SEQ ID NO: 7), ggctttctggcaacttaccggaaagcc (SEQ ID NO: 8), ggctttctggttcggtaccggaaagcc (SEQ ID NO: 9), ggctttctggaagccttaccggaaagcc (SEQ ID NO: 10), ggctttctggcttcttaccggaaagcc (SEQ ID NO: 11), or GGCTTTCTGGCCTCCGCCGGAAAGCCCCT (SEQ ID NO: 186) In some embodiments, the nucleic acid sequence comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to one or more of:

[0072] In some embodiments, the mouse eSL has the following nucleotide sequence: ggctttctggctccttaccggaaagcccct (SEQ ID NO: 163) Ggttttctgacctccgtcggaaaacccct (SEQ ID NO: 146), ggttttctgacctccttcggtcggaaaacccct (SEQ ID NO: 147), Ggttttctgacctccgtcggaaaacc (SEQ ID NO: 148), GGTTTTCTGACACTCCGTCGGAAAACCCCT (SEQ ID NO: 228), GGTTTTCTGATCTCCATCGGAAAACCCCT (SEQ ID NO: 229), or GGTTTTCCGACCTCCGTCGGAAAACCCCT (SEQ ID NO: 230) In some embodiments, the nucleic acid sequence comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to one or more of:

[0073] In some embodiments, the human or mouse eSL has the following nucleotide sequence: GGCTTTCTGGCACTCCACCGGAAAGCCCCT (SEQ ID NO: 190), GGCTTTCTGGCACTCCGCCGGAAAGCCCCT (SEQ ID NO: 191), or GGCTTTCTGGCCTCCACCGGAAAGCCCCT (SEQ ID NO: 192) In some embodiments, the nucleic acid sequence comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to one or more of:

[0074] In some embodiments, the canine or feline eSL has the following nucleotide sequence: GGTTTTCCGGTCTCCACCGGAAAGCCCCC (SEQ ID NO: 193) In some embodiments, the nucleic acid sequence comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to one or more of:

[0075] In some embodiments, the bovine, ovine or caprine eSL has the following nucleotide sequence: GGCTTTCCGGTCTCCACCGGAAAGCCCCT (SEQ ID NO: 194), or GGCTTTCCGGCCTCCGCCGGAAAGCCCCT (SEQ ID NO: 195) In some embodiments, the nucleic acid sequence comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to one or more of:

[0076] In some embodiments, the porcine eSL has the following nucleotide sequence: GGTTTTCCGGTCTCCACCGGAAAACCCTT (SEQ ID NO: 196), GGTTTTCCGTGCTCCCACGGAAAACCCTT (SEQ ID NO: 197), GGTTTTCCGGCCTCCGCCGGAAAACCCTT (SEQ ID NO: 198), GGTTTTCCGTGACTCCCACGGAAAACCCTT (SEQ ID NO: 199), or GGTTTTCCGGCACTCCGCCGGAAAACCCTT (SEQ ID NO: 200) In some embodiments, the nucleic acid sequence comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to one or more of:

[0077] In some embodiments, the horse eSL has the following nucleotide sequence: GGTCTTCCGGTCTCCTCCGGAAGGCCCCC (SEQ ID NO: 201), or GGTCTTCCGGCTCCCCGGAAGGCCCCC (SEQ ID NO: 202) In some embodiments, the nucleic acid sequence comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to one or more of:

[0078] In some embodiments, the ovine eSL has the following nucleotide sequence: GGCTTTCCGTGCTCCCACGGAAAGCCCCT (SEQ ID NO: 203), GGCTTTCCGTGACTCCCACGGAAAGCCCCT (SEQ ID NO: 204), or GGCTTTCCGGCACTCCGCCGGAAAGCCCCT (SEQ ID NO: 205) In some embodiments, the nucleic acid sequence comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to one or more of:

[0079] In some embodiments, the engineered stem loop provides enhanced stability of the snRNA compared to a snRNA comprising a native stem loop. In some embodiments, the native snRNA stem loop has the following nucleotide sequence: Ggttttctgacttcggtcggaaaacccct (SEQ ID NO: 145), ggttttctgacttcggtcggaaaacc (SEQ ID NO: 206), Ggctttctggctttttaccggaaagcc (SEQ ID NO: 235), or ggctttctggctttttaccggaaagccCCT (SEQ ID NO: 236). 5' Interacting Stability Domain

[0080] The eSL disclosed herein has more efficient folding and annealing properties due to the 5' interacting stability domain (5'ISD), and also results in increased stability of the esnRNA compared to non-engineered snRNA. The 5'ISD has nucleotides that are complementary to nucleotides in the engineered SL, and while not wishing to be bound by theory, it is predicted that the interaction between the 5'ISD and the eSL forms a secondary structure that protects the 5' end of the snRNA. In some embodiments, the 5'ISD anneals and / or hybridizes to the eSL of the present disclosure. In some embodiments, the 5'ISD is a sequence that has complementarity and / or reverse complementarity to a sequence present in the eSL of the present disclosure. In some embodiments, the 5'ISD disclosed herein can be one of the 5'ISDs selected from the following nucleotide sequences: ggagt (SEQ ID NO: 12), cctct (SEQ ID NO: 13), ggaggt (SEQ ID NO: 14), cctcct (SEQ ID NO: 15), agccag (SEQ ID NO: 16), ggaag (SEQ ID NO: 17), gaagaag (SEQ ID NO: 18), gttg (SEQ ID NO: 19), ccgaa (SEQ ID NO: 20), taaggag (SEQ ID NO: 21), gaag (SEQ ID NO: 22), or ggctt (sequence number 23). Targeting Sequence

[0081] The esnRNA system can be programmed to include a targeting sequence (TS) (also referred to as a spacer). In some aspects, the targeting sequence is a 5' targeting sequence (5'TS) (also referred to as a spacer) that targets one or more RNAs of interest. In this context, 5' refers to the 5' end of the snRNA insert, not necessarily to the entire vector construct that includes the snRNA insert(s). The TS can also be located at or near the 5' end of the snRNA. In an alternative embodiment, the targeting sequence(s) (TS) can be located at or near the 3' position of the snRNA construct, thereby generating a 3' targeting sequence (3'TS), especially when the snRNA construct is not a U7-based snRNA.

[0082] The targeting sequences of the present disclosure, including the 5'TS and 3'TS, can be between about 1 and about 200 nucleotides in length. In some embodiments, the targeting sequences of the present disclosure are between about 10 and about 150 nucleotides in length. In some embodiments, the targeting sequences of the present disclosure are between about 10 and about 100 nucleotides in length. In some embodiments, the targeting sequences of the present disclosure are between about 20 and about 60 nucleotides in length. In some embodiments, the targeting sequences of the present disclosure are at least about 10, 20, 30, 40, 50, 60, or about 70 nucleotides in length.

[0083] In one example, U7 snRNA can be programmed by replacing the histone mRNA binding sequence with a sequence complementary to the target of interest. In some aspects, the esnRNA system of the present disclosure binds to a target mRNA or pre-mRNA sequence of interest. The exemplary esnRNA system shown herein results in blocking or knocking down microsatellite repeat expansion (to treat myotonic dystrophy (DM1) or Huntington's disease (HD)), hexanucleotide repeat expansion (to treat C9 / ALS), splicing modulation (to treat USH2A (Usher syndrome type 2)), or targeting one or more exonic splicing enhancers (ESEs) to induce exon skipping (to treat DMD, e.g., DMD exon 51 skipping). In one embodiment, the target RNA of interest is a microsatellite or hexanucleotide repeat RNA or a non-repeat RNA. In another embodiment, the repeat RNA of interest is selected from the group consisting of CUG, CAG, GGGGCC, and CCCCGG. In one embodiment, the esnRNA comprises a targeting sequence (TS) that targets two target RNAs of interest that are GGGGCC and CCCCGG. In another embodiment, the two target RNAs of interest are a microsatellite repeat RNA and a non-repeat RNA. In another embodiment, the non-repeat RNA is a flanking sequence of the repeat RNA.

[0084] In some embodiments, the esnRNA of the present disclosure targets the pre-mRNA or mRNA sequence that codes for the DMD gene.DMD is the gene that codes for the protein dystrophin.Mutations in DMD are associated with Duchenne muscular dystrophy.In some embodiments, the DMD RNA sequence that is targeted by the esnRNA composition of the present disclosure is the exon 51 DMD RNA sequence.

[0085] A target sequence that binds to a DMD may comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical (or any percentage in between) to one or more of the following nucleotide sequences shown in the table below: [Table 1-1] [Table 1-2]

[0086] In one embodiment, a TS that is a fusion as in the table above can be a single TS sequence contained within the fusion sequence.

[0087] In another embodiment, the targeting sequence (TS) targets two or more RNAs of interest. In another embodiment, the TSs target two or more RNAs of interest are different sequences that target the same pre-mRNA molecule. In one embodiment, the spacer or TS is a fusion sequence. In another embodiment, the fusion sequence is a spacer that targets DMD exon 51, and the fusion sequence is shown in the table above.

[0088] In some embodiments, the CUG repeat targeting sequence comprises the nucleic acid sequence: CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG (SEQ ID NO: 165).

[0089] In some embodiments, the CAG repeat targeting sequence comprises the nucleic acid sequence: CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG (SEQ ID NO: 167). Sm-binding domain

[0090] The esnRNA system disclosed herein utilizes an Sm binding domain (SmBD). The Sm protein ring that assembles around the SmBD to form the snRNP includes SmB / B', SmD1, SmD2, SmD3, SmE, SmF, and SmG. The U7 Sm binding site can recruit endogenous RNA binding factors and be replaced by non-U7 snRNA to make the esnRNA more stable. In one embodiment, the SmBD is selected from the group consisting of U1, U2, U4, and U5 snRNA. In another embodiment, the SmBD is derived from a pseudosnRNA. In another embodiment, the SmBD is a nucleotide sequence comprising SEQ ID NO: 31 (ATTTTT). In another embodiment, the SmBD comprises a nucleotide sequence selected from the group consisting of SEQ ID NO:32 (AATTTTTGG), SEQ ID NO:33 (AATTTGTGG), SEQ ID NO:34 (AATTTGTGG), SEQ ID NO:35 (AATTTCTGG), SEQ ID NO:36 (GATTTTTGG), SEQ ID NO:37 (AATTTTTGA), SEQ ID NO:38 (AATTTTTTG), SEQ ID NO:161 (AATTTTTGGAGCA), and SEQ ID NO:163 (AATTTTTGGAGTA). Promoter sequence

[0091] The esnRNA system disclosed herein comprises a snRNA promoter from any of U1 to U12. In one embodiment, the snRNA promoter is a U7 promoter. In another embodiment, the U7 promoter is a human U7 promoter (hU7) or a mouse U7 promoter (mU7). In another embodiment, the U7 promoter is SEQ ID NO: 39: [ka] The endogenous human U7 promoter comprises the

[0092] In one embodiment, the snRNA promoter is a U1 promoter. In another embodiment, the U1 promoter is a human U1 promoter or a mouse U1 promoter.

[0093] In another embodiment, snRNA promoter drives a copy of snRNA insert.In another embodiment, each copy of snRNA insert is the same.In another embodiment, different snRNA promoter drives each copy of snRNA insert.In one embodiment, 2xsnRNA comprises mouse U7 promoter that drives one copy of snRNA insert, and mouse U1 promoter drives the other copy of snRNA insert.

[0094] In other embodiments, the snRNA promoter is a PolII or PolIII promoter. In other embodiments, the snRNA promoter comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to a promoter and / or promoter sequence listed in the table of exemplary promoters below: [Table 2-1] [Table 2-2] [Table 2-3] Terminator sequence

[0095] The esnRNA system disclosed herein comprises a snRNA downstream terminator (DT). The downstream terminator defines the end of a transcription unit such as an esnRNA or snRNA. In another embodiment, the snRNA DT is U7 DT, comprising CCTCTTATGATGTTTGTTGCCAATGATAGATTGTTTTCACTGTGCAAAAATTATGGGTAGTTTTGGTGGTCTTGATGCAGTTGTAAGCTTGGAG (SEQ ID NO: 49).

[0096] In one embodiment, the esnRNA comprises an eSL, one or more promoters, a TS, an SmBD, a 5'ISD, and a DT. In one aspect, the combination of promoter and DT is a mixed and matched combination.

[0097] In another embodiment, the DT is selected from the exemplary DT and / or DT sequences listed in the exemplary DT table below: [Table 3-1] [Table 3-2]

[0098] In one embodiment, the esnRNA is delivered in an AAV vector.

[0099] In some embodiments, the AAV vector comprises multiple copies of the esnRNA. In some embodiments, the multiple copies of the esnRNA are two, three or four copies of the esnRNA (2x, 3x or 4x). In some embodiments, the multiple copies of the esnRNA are four or more copies of the esnRNA.

[0100] In some embodiments, each esnRNA of the multiple copies of the esnRNA is separated by a nucleic acid buffer sequence derived from a human non-coding genomic sequence downstream of the snRNA. In one embodiment, the buffer sequence is derived from a human genomic sequence downstream of U7.

[0101] In one embodiment, the buffer sequence is selected from the group consisting of the following nucleic acid sequences: Buffer 1 (30 bp) CAAACTACAGAGCCAAGTGCTATCCACAGA (SEQ ID NO: 24), Buffer 2 (30 bp) GAGCTTTCTGGGTTGCCATCTCAAGCAGAC (SEQ ID NO: 25), Buffer 3 (30 bp) TACAAGGCCATCAGCTCATACTCACAATTG (SEQ ID NO: 26), and combinations thereof.

[0102] In another embodiment, the buffer sequence is selected from the group consisting of the following nucleic acid sequences: Buffer 1 (100 bp) CAAACTACAGAGCCAAGTGCTATCCACAGAGAGCTTTCTGGGTTGCCATCTCAAGCAGACTACAAGGCCATCAGCTCATACTCACAATTGACTTTGAGAG (SEQ ID NO: 27), Buffer 2 (100 bp) TTGACCACATACGTGCTCTTTCAAAGTTCTGTGTTTGAAGTTATGTTAGTAACAACTGATGCCCATCCTGCAATGACAAATCCAATTCTCAGTGCAGCTC (SEQ ID NO: 28), and combinations thereof.

[0103] In another embodiment, the buffer sequence is selected from the group consisting of the following nucleic acid sequences: Buffer 1 (500bp) [ka] Buffer 2 (500bp) [ka] , and / or combinations thereof.

[0104] The 100bp and 500bp buffer 1 sequences are derived from a sequence starting 100bp downstream of the Mus musculus U7 pseudogene 8 (location chromosome 14: 4,409,359 to 4,409,421 reverse strand; GRCm39:CM001007.3). The 100bp and 500bp buffer 2 sequences are derived from a sequence starting 130bp downstream of the human U7 pseudogene 5 (chromosome X: 140,451,148 to 140,451,208 forward strand; GRCh38:CM000685.2). Both 100bp buffers are the first 100bp of the corresponding 500bp buffers. The 30bp buffers 1, 2 and 3 are consecutive 30bp sequences within the "100bp buffer 1" downstream of the Mus musculus U7 pseudogene 8. These downstream sequences were selected (using Gencode / Ensembl) due to the lack of repetitive sequences, 40-60% GC content for the entire buffer, 40-60% GC content in 20 bp regions on either side of the buffer, and minimal sequence complexity, as well as the lack of any known regulatory sites or genes within or near the sequences. esnRNA sequence

[0105] Exemplary esnRNA sequences of the present disclosure may include any combination of esnRNA features described herein. In some embodiments, the esnRNA comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to an esnRNA listed in the table of esnRNAs below: [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] vector

[0106] In the context of a recombinant expression vector, the term "operably linked" is intended to mean that the hybrid promoter is linked to the NOI in a manner that allows for expression of the nucleotide sequence, e.g., in a host cell, when the vector is introduced into (or contacted with) the host cell.

[0107] In some embodiments of the compositions and methods of the present disclosure, the vector comprises an engineered snRNA. In some embodiments, the therapeutic snRNA is in a single or unitary vector.

[0108] In some embodiments of the compositions and methods of the present disclosure, the RNA-binding snRNA system can target toxic CAG, CUG, GGCCCC, CCGGG, or GGCCC+CCGGGG RNA repeats (or their flanking sequences) and is in a single vector. In some embodiments of the compositions and methods of the present disclosure, the RNA targeting system can target a non-repeat RNA of interest. In some embodiments of the compositions and methods of the present disclosure, the RNA targeting system can target one or more sequences of DMD. In some aspects, the snRNA system can target multiple (i.e., two or more) RNAs of interest. In some embodiments, the two or more RNAs of interest can be the same pre-mRNA molecule, but different sequences within the pre-mRNA molecule.

[0109] One type of vector is a "plasmid", which refers to a circular double-stranded DNA loop into which additional DNA segments can be inserted, for example, by standard molecular cloning techniques. Another type of vector is a viral vector, in which virus-derived DNA or RNA sequences are present in the vector for packaging into a virus (e.g., retrovirus, replication-defective retrovirus, adenovirus, replication-defective adenovirus, and adeno-associated virus). Viral vectors also include polynucleotides carried by viruses for transfection into host cells. In some embodiments, the vector is a lentivirus (e.g., integration-defective lentivirus vector) or adeno-associated virus (AAV) vector. Vectors, such as bacterial vectors with bacterial origins of replication, can replicate autonomously in the host cell into which they are introduced, while episomal mammalian vectors, and other vectors, such as non-episomal mammalian vectors, are integrated into the genome of the host cell when introduced into the host cell, and are thereby replicated together with the host genome.

[0110] In some embodiments, vectors, such as expression vectors, can direct the expression of genes to which they are operably linked. Common expression vectors are often in the form of plasmids. In some embodiments, recombinant expression vectors include the nucleic acids provided herein, such as esnRNAs, in a form suitable for protein expression in a host cell. The recombinant expression vector includes one or more regulatory elements that can be selected based on the host cell used for expression, and that are operably linked to the nucleic acid sequence to be expressed. Within a recombinant expression vector, "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the regulatory element(s) in a manner that allows for expression of the nucleotide sequence, such as, for example, in an in vitro transcription / translation system or in a host cell when the vector is introduced into the host cell. Certain embodiments of vectors depend on factors such as the choice of the host cell to be transformed and the desired expression level. The vector can be introduced into a host cell to thereby produce transcripts, proteins, or peptides, including fusion proteins or peptides encoded by the nucleic acids described herein, such as, for example, snRNAs, CRISPR transcripts, proteins, enzymes, mutant forms thereof, fusion proteins thereof, and the like. Viral Vectors

[0111] In some embodiments of the compositions and methods of the present disclosure, the vector of the present disclosure is a viral vector. In some embodiments, the viral vector comprises a sequence isolated or derived from a retrovirus. In some embodiments, the viral vector comprises a sequence isolated or derived from a lentivirus. In some embodiments, the viral vector comprises a sequence isolated or derived from an adenovirus. In some embodiments, the viral vector comprises a sequence isolated or derived from an adeno-associated virus (AAV). In some embodiments, the viral vector is replication-incompetent. In some embodiments, the viral vector is isolated or recombinant. In some embodiments, the viral vector is self-complementary. Adeno-associated virus vector

[0112] "AAV vector" as used herein refers to a vector that comprises, consists essentially of, or consists of one or more nucleic acid molecules and one or more AAV terminal inverted repeats (ITRs). In some embodiments, the nucleic acid molecule encodes the esnRNA of the present disclosure. Such an AAV vector can be replicated and packaged into an infectious viral particle when present in a host cell that provides the functionality of the rep and cap gene products, for example, by transfection into the host cell. In some embodiments, the AAV vector contains a promoter, at least one nucleic acid that can code for at least one protein or RNA, and / or enhancer and / or terminator within the flanking ITRs that are packaged into the infectious AAV particle. The nucleic acid portion that is encapsidated can be referred to as the AAV vector genome. The plasmid containing the AAV vector can also contain elements for production, such as antibiotic resistance genes, replication origin sequences, etc., but these are not encapsidated and therefore do not form part of the AAV particle.

[0113] In some embodiments, the AAV vector may comprise at least one nucleic acid encoding the esnRNA composition of the present disclosure. In some embodiments, the AAV vector may comprise at least one regulatory sequence. In some embodiments, the AAV vector may comprise at least one AAV inverted terminal repeat (ITR) sequence. In some embodiments, the AAV vector may comprise a first ITR sequence and a second ITR sequence. In some embodiments, the AAV vector may comprise at least one promoter sequence. In some embodiments, the AAV vector may comprise at least one enhancer sequence. In some embodiments, the AAV vector may comprise at least one terminator sequence. In some embodiments, the AAV vector may comprise at least one polyA sequence. In some embodiments, the AAV vector may comprise at least one linker sequence. In some embodiments, the AAV vector may comprise at least one buffer sequence. In some embodiments, the AAV vector of the present disclosure may comprise at least one nuclear localization signal, or nuclear export signal, and / or both.

[0114] In some embodiments, the AAV vector may include a first AAV ITR sequence, a promoter sequence, an esnRNA sequence, a terminator sequence, and a second AAV ITR sequence. In some embodiments, the AAV vector may include, from 5' to 3', a first AAV ITR sequence, a promoter sequence, an esnRNA sequence, a terminator sequence, and a second AAV ITR sequence.

[0115] In some embodiments, the AAV vector may comprise a first AAV ITR sequence, a first promoter sequence, a first esnRNA sequence, a second promoter sequence, a second esnRNA sequence, and a second AAV ITR sequence. In some embodiments, the AAV vector may comprise a first AAV ITR sequence, a first promoter sequence, a first esnRNA sequence, a second promoter sequence, a second esnRNA sequence, a third promoter sequence, a third esnRNA sequence, and a second AAV ITR sequence. In some embodiments, the AAV vector may comprise a first AAV ITR sequence, a first promoter sequence, a first esnRNA sequence, a second promoter sequence, a second esnRNA sequence, and a second AAV ITR sequence. In some embodiments, the AAV vector may include a first AAV ITR sequence, a first promoter sequence, a first esnRNA sequence, a second promoter sequence, a second esnRNA sequence, a third promoter sequence, a third esnRNA sequence, a fourth promoter sequence, a fourth esnRNA sequence, and a second AAV ITR sequence.

[0116] The term "adeno-associated virus" or "AAV" as used herein refers to a member of the class of viruses related to this name, belonging to the Parvoviridae family, Dependoparvovirus genus. Adeno-associated virus is a single-stranded DNA virus that grows in cells where certain functions are provided by the co-infection of a helper virus. General information and reviews of AAV can be found, for example, in Carter, 1989, Handbook of Parvoviruses, Vol. 1, pp. 169- 228, and Berns, 1990, Virology, pp. 1743-1764, Raven Press, (New York). It is fully expected that the same principles described in these reviews can be applied to additional AAV serotypes characterized after the publication date of these reviews, because it is well known that the various serotypes are very closely related, both structurally and functionally, and even at the genetic level. (See, e.g., Blacklowe, 1988, pp. 165-174 of Parvoviruses and Human Disease, J. R. Pattison, ed.; and Rose, Comprehensive Virology 3: 1-61 (1974).) For example, all AAV serotypes appear to exhibit very similar replication properties mediated by homologous rep genes, and all have three related capsid proteins, such as those expressed in AAV2. This similarity is further suggested by heteroduplex analysis, which reveals extensive cross-hybridization between serotypes along the length of the genome; and the presence of similar self-annealing segments at the ends that correspond to "inverted terminal repeats" (ITRs). Similar infectivity patterns also suggest that the replication functions in each serotype are under similar regulatory control. Multiple serotypes of this virus are known to be suitable for gene delivery, and all known serotypes can infect cells from a variety of tissue types.

[0117] AAV has unique features that make it attractive as a vector to deliver foreign DNA to cells, for example in gene therapy. AAV infection of cells in culture is non-cytopathic, and natural infection of humans and other animals is asymptomatic and asymptomatic. Moreover, AAV infects many mammalian cells, thereby allowing the possibility of targeting many different tissues in vivo. Moreover, AAV can slowly transduce dividing and non-dividing cells and persist as transcriptionally active nuclear episomes (extrachromosomal elements) essentially for the life of these cells. The AAV proviral genome is inserted as cloned DNA into plasmids, thus making the construction of recombinant genomes feasible. Moreover, because signals directing AAV replication and genome encapsidation are contained within the ITRs of the AAV genome, some or all of the internal approximately 4.3 kb genome (encoding the replication and structural capsid proteins, rep-cap,) can be replaced with foreign DNA to generate AAV vectors. The rep and cap proteins can be provided in trans. Another significant feature of AAV is that it is an extremely stable and hardy virus. AAV easily survives the conditions used to inactivate adenovirus (56°C-65°C for several hours), making cryopreservation of AAV less important. AAV can even be freeze-dried. Finally, AAV-infected cells are not resistant to superinfection.

[0118] The recombinant AAV (rAAV) genome of the present invention comprises, consists essentially of, or consists of at least one esnRNA-encoding nucleic acid molecule and one or more AAV ITRs flanking the nucleic acid molecule. The production of pseudotyped rAAV is disclosed, for example, in WO2001083692. Other types of rAAV variants, such as rAAV with capsid mutations, are also contemplated. See, for example, Marsic et al., Molecular Therapy, 22(11): 1900-1909 (2014). Nucleotides of the genomes of various AAV serotypes are also contemplated. Leucide sequences are known in the art.

[0119] In some embodiments of the compositions and methods of the present disclosure, the viral vector comprises a sequence isolated or derived from adeno-associated virus (AAV). In some embodiments, the viral vector comprises a terminal inverted repeat or capsid sequence isolated or derived from AAV of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrhlO, AAV11 or AAV12. In some embodiments, the AAV serotype is AAVrh.74. In one embodiment, the AAV vector comprises a modified capsid. In one embodiment, the AAV vector is an AAV2-Tyr mutant vector. In one embodiment, the AAV vector comprises a capsid in which the non-tyrosine amino acid is located at a position corresponding to the surface-exposed tyrosine residue at position Tyr252, Tyr272, Tyr275, Tyr281, Tyr508, Tyr612, Tyr704, Tyr720, Tyr730 or Tyr673 of wild-type AAV2. See also WO2008 / 124724, which is incorporated herein in its entirety. In some embodiments, the AAV vector comprises an engineered capsid. AAV vectors that comprise engineered capsids include, but are not limited to, AAV2.7m8, AAV9.7m8, AAV2 2tYF, and AAV8 Y733F). In some embodiments, the capsid is a ubiquitination-resistant capsid. In another embodiment, the ubiquitinated capsid is an AAV2 capsid that includes tyrosine (Y) and serine (S) mutations. In another embodiment, the AAV2 capsid includes Y, S, and threonine (T) mutations. In another embodiment, the AAV2 capsid includes, without limitation, AAV2 capsid mutants, such as T455V, T491V, T550V, T659V, Y444+500+730F, and Y444+500+730F+T491V. In some embodiments, the viral vector is replication-incompetent. In some embodiments, the viral vector is isolated or recombinant (rAAV). In some embodiments, the viral vector is self-complementary (scAAV). In some embodiments, the viral vector is single-stranded (ssAAV). AAV ITR sequences

[0120] In some embodiments of the compositions and methods of the present disclosure, the AAV terminal inverted repeat sequence can comprise any AAV ITR sequence known in the art.In some aspects, the AAV ITR sequence can comprise or consist of the AAV1 ITR sequence, the AAV2 ITR sequence, the AAV3 ITR sequence, the AAV4 ITR sequence, the AAV5 ITR sequence, the AAV6 ITR sequence, the AAV7 ITR sequence, the AAV8 ITR sequence, the AAV9 ITR sequence, the AAV10 ITR sequence, the AAVrh10 ITR sequence, the AAV11 ITR sequence, the AAV12 ITR sequence, the AAV13 ITR sequence, or the AAVrh74 ITR sequence.

[0121] In some embodiments, the ITR sequences may comprise modified AAV ITR sequences.

[0122] In some embodiments, the AAV ITR sequences may comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical (or any percentage in between) to SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:162, or SEQ ID NO:166.

[0123] In some embodiments, the first AAV ITR sequence may comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:162, or SEQ ID NO:166, and the second AAV ITR sequence may comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:162, or SEQ ID NO:166. In some embodiments, the first AAV ITR sequence is located 5' of the AAV vector. In some embodiments, a second AAV ITR sequence is located 3' of the AAV vector.

[0124] In some embodiments of the compositions and methods of the present disclosure, the viral vector comprises sequences isolated or derived from an adeno-associated virus (AAV).

[0125] In some embodiments of the compositions and methods of the present disclosure, the vector of the present disclosure is a non-viral vector. In some embodiments, the vector comprises or consists of a nanoparticle, a micelle, a liposome or lipoplex, a polymersome, a polyplex, or a dendrimer. In some embodiments, the vector is an expression vector or a recombinant expression system. As used herein, the term "recombinant expression system" refers to a genetic construct for expressing a certain genetic material formed by recombination. esnRNA vector constructs

[0126] Exemplary esnRNA AAV vectors of the present disclosure may comprise one or more esnRNA sequences of the present disclosure. In some embodiments, the esnRNA AAV vector comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to an esnRNA AAV vector listed in the table of esnRNA AAV vectors below: [Table 5-1] [Table 5-2]

[0127] An exemplary AAV vector of the disclosure comprises, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a DMD exon 51-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a DMD exon 51-targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A04569 encoding the DMD exon 51-targeting snRNA sequence comprises SEQ ID NO:168. A04569: scAAVmU7p-z42 / 38 rev fus-mU7term_mU1p-z42 / 38 rev fus-mU1term; with mouse loop, 5'ISD and eSL [Table 6-1] [Table 6-2]

[0128] An exemplary AAV vector of the disclosure comprises, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a DMD exon 51-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a DMD exon 51-targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A04526 encoding the DMD exon 51-targeting snRNA sequence comprises SEQ ID NO: 169. [Table 7-1] [Table 7-2]

[0129] An exemplary AAV vector of the disclosure comprises, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a DMD exon 51-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a DMD exon 51-targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A04771 encoding the DMD exon 51-targeting snRNA sequence comprises SEQ ID NO: 170. A04771: scAAVmU7p-z42 / 38 reverse fus-mU7term_mU1p-z42 / 38 reverse fus-mU1term; with mouse loop, 5'ISD and eSL, no CCU tail [Table 8-1] [Table 8-2]

[0130] An exemplary AAV vector of the disclosure comprises, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a DMD exon 51-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U7 promoter sequence, a DMD exon 51-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A04525 encoding the DMD exon 51-targeting snRNA sequence comprises SEQ ID NO: 171. A04525: scAAV-mU7p-z38 / 42-mU7term_mU7p-z38 / 42-mU7term; mouse loop, no ISD, no eSL [Table 9]

[0131] An exemplary AAV vector of the disclosure comprises, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a DMD exon 51-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a DMD exon 51-targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A04527 encoding the DMD exon 51-targeting snRNA sequence comprises SEQ ID NO: 172. A04527: scAAV-mU7p-z38 / 42-mU7term_mU1p-z38 / 42-mU1term; mouse loop, no ISD, no eSL [Table 10]

[0132] An exemplary AAV vector of the disclosure comprises, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a DMD exon 51-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a DMD exon 51-targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A04528 encoding the DMD exon 51-targeting snRNA sequence comprises SEQ ID NO: 173. A04528: scAAV-mU7p-z38 / 42-mU7term_mU1p-z38 / 42-mU1term; with human loop, ISD and eSL [Table 11]

[0133] An exemplary AAV vector of the disclosure comprises, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a DMD exon 51-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a DMD exon 51-targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A04529 encoding the DMD exon 51-targeting snRNA sequence comprises SEQ ID NO: 174. A04529: scAAV-mU7p-z38 / 42-mU7term_mU1p-z38 / 42-mU1term; CCU tail addition with human loop, ISD and eSL [Table 12]

[0134] An exemplary AAV vector of the disclosure comprises, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a DMD exon 51-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a DMD exon 51-targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A04537 encoding the DMD exon 51-targeting snRNA sequence comprises SEQ ID NO: 175. A04537: scAAV-mU7p-z38 / 42-mU7term_mU1prom- p-z38 / 42-mU1term; with long mouse loop, 5'ISD and eSL [Table 13]

[0135] An exemplary AAV vector of the present disclosure comprises, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CUG repeat-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a CUG repeat-targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A04233 encoding the CUG repeat-targeting snRNA sequence comprises SEQ ID NO: 176. A04233: scAAV- hU7-CUGx15-hU1-CUGx15 (3'mut ITR) [Table 14-1] [Table 14-2]

[0136] An exemplary AAV vector of the present disclosure comprises, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CUG repeat-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a CUG repeat-targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A04234 encoding the CUG repeat-targeting snRNA sequence comprises SEQ ID NO: 177. A04234: scAAV- hU7-CUGx15-hU1-CUGx15 (5' mut ITR) [Table 15-1] [Table 15-2]

[0137] An exemplary AAV vector of the present disclosure comprises, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CAG repeat-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a CAG repeat-targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A04390 encoding the CAG repeat-targeting snRNA sequence comprises SEQ ID NO: 178. A04390: scAAV 5'mITR hU7-CAG15X-hU1-CAGx15 [Table 16-1] [Table 16-2]

[0138] An exemplary AAV vector of the present disclosure comprises, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CUG repeat-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a CUG repeat-targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A04530 encoding the CUG repeat-targeting snRNA sequence comprises SEQ ID NO:231. A04530: scAAV- mU7p-CUGx15-mU1p-CUGx15; with mouse loop, ISD and eSL [Table 17-1] [Table 17-2]

[0139] An exemplary AAV vector of the present disclosure comprises, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CUG repeat-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a CUG repeat-targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A04940 encoding the CUG repeat-targeting snRNA sequence comprises SEQ ID NO:232. A04940: scAAV- mU7p-CUGx10-mU1p-CUGx10; mouse loop, with ISD and eSL, no CCU [Table 18-1] [Table 18-2]

[0140] An exemplary AAV vector of the present disclosure includes, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CAG repeat-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a CAG repeat-targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A04533 encoding the CAG repeat-targeting snRNA sequence includes SEQ ID NO:233. A04533: scAAV- mU7p-CAGx15-mU1p-CAGx15; with mouse loop, ISD and eSL [Table 19-1] [Table 19-2]

[0141] An exemplary AAV vector of the present disclosure comprises, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A02962 encoding the CUG repeat targeting snRNA sequence comprises SEQ ID NO: 120. A02962 ss pAAV-4X U7(15XCUG) (a derivative of P00369) targets the CUG repeat [Table 20-1] [Table 20-2]

[0142] An exemplary AAV vector of the present disclosure comprises, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A02963 encoding the non-targeting snRNA sequence comprises SEQ ID NO: 121. A02963 ss pAAV-4XU7(NT1) (derivative of P00369) [Table 21-1] [Table 21-2]

[0143] An exemplary AAV vector of the present disclosure comprises, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CAG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CAG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CAG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CAG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A02967 encoding the CAG repeat targeting snRNA sequence comprises SEQ ID NO: 122.

[0144] A02967 ss pAAV-4XU7(15XCAG) CAG repeat targeting [Table 22-1] [Table 22-2] [Table 22-3]

[0145] An exemplary AAV vector of the present disclosure includes, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CUG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A03079 encoding the CUG repeat targeting snRNA sequence includes SEQ ID NO: 123. A03079 sc pAAV-4XU7(15XCUG) (a derivative of P00369) targets the CUG repeat [Table 23-1] [Table 23-2]

[0146] An exemplary AAV vector of the present disclosure comprises, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A03080 encoding the non-repeat targeting snRNA sequence comprises SEQ ID NO: 124. A03080sc pAAV-4XU7(NT1) (derivative of P00369) [Table 24-1] [Table 24-2]

[0147] An exemplary AAV vector of the present disclosure comprises, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CAG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CAG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CAG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CAG repeat targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A03081 encoding the CAG repeat targeting snRNA sequence comprises SEQ ID NO: 125. A03081 sc pAAV-4XU7(15XCAG) CAG repeat targeting [Table 25-1] [Table 25-2] [Table 25-3]

[0148] An exemplary AAV vector of the present disclosure includes, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CUG repeat-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a CMV promoter sequence, a sequence encoding green fluorescent protein (GFP), an sv40 polyA sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A02888 encoding the CUG repeat-targeting snRNA sequence comprises SEQ ID NO: 126. A02888 pAAV_1xU7(15xCUG)_CMV_GFP (no buffer) targeting CUG repeats [Table 26-1] [Table 26-2]

[0149] An exemplary AAV vector of the present disclosure includes, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a CMV promoter sequence, a sequence encoding green fluorescent protein (GFP), an sv40 polyA sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A02889 encoding the non-targeting repeat-targeting snRNA sequence comprises SEQ ID NO: 127. A02889 pAAV_1xU7(NT1)_CMV_GFP(no buffer) [Table 27-1] [Table 27-2]

[0150] An exemplary AAV vector of the present disclosure includes, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CAG repeat-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a CMV promoter sequence, a sequence encoding green fluorescent protein (GFP), an sv40 polyA sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A02925 encoding the CAG repeat-targeting repeat-targeting snRNA sequence comprises SEQ ID NO: 128. A02925 pAAV_1xU7(15xCAG)_CMV_GFP (no buffer) targeting CAG repeats [Table 28-1] [Table 28-2]

[0151] An exemplary AAV vector of the present disclosure includes, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CUG repeat-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CUG repeat-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CUG repeat-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a CMV promoter sequence, a sequence encoding green fluorescent protein (GFP), an sv40 polyA sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A02894 encoding the CUG repeat-targeting repeat-targeting snRNA sequence comprises SEQ ID NO: 129. A02894 pAAV_3xU7(15xCUG)_CMV_GFP(100bp buffer) Targeting CUG repeat [Table 29-1] [Table 29-2] [Table 29-3]

[0152] An exemplary AAV vector of the present disclosure comprises, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a CMV promoter sequence, a sequence encoding green fluorescent protein (GFP), an sv40 polyA sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A02895 encoding the non-targeting snRNA sequence comprises SEQ ID NO: 130. A02895 pAAV_3xU7(NT1)_CMV_GFP(100bp buffer) [Table 30-1] [Table 30-2] [Table 30-3]

[0153] An exemplary AAV vector of the present disclosure includes, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CAG repeat-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CAG repeat-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CAG repeat-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a CMV promoter sequence, a sequence encoding green fluorescent protein (GFP), an sv40 polyA sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A02968 encoding the CAG repeat-targeting snRNA sequence comprises SEQ ID NO: 131. A02968 pAAV_3xU7(15XCAG)_CMV_GFP(100bp buffer) targeting CAG repeat [Table 31-1] [Table 31-2] [Table 31-3]

[0154] An exemplary AAV vector of the present disclosure includes, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CUG repeat-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CUG repeat-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CUG repeat-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a CMV promoter sequence, a sequence encoding green fluorescent protein (GFP), an sv40 polyA sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A02896 encoding the CUG repeat-targeting repeat-targeting snRNA sequence comprises SEQ ID NO: 132. A02896 pAAV_3xU7(15xCUG)_CMV_GFP(500bp buffer) [Table 32-1] [Table 32-2] [Table 32-3]

[0155] An exemplary AAV vector of the present disclosure includes, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a CMV promoter sequence, a sequence encoding green fluorescent protein (GFP), an sv40 polyA sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A02897 encoding the non-targeting repeat targeting snRNA sequence comprises SEQ ID NO: 133. A02897 pAAV_3xU7(NT1)_CMV_GFP(500bp buffer) [Table 33-1] [Table 33-2] [Table 33-3]

[0156] An exemplary AAV vector of the present disclosure includes, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CAG repeat-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CAG repeat-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CAG repeat-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a CMV promoter sequence, a sequence encoding green fluorescent protein (GFP), an sv40 polyA sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A02969 encoding the CAG repeat-targeting snRNA sequence comprises SEQ ID NO: 134. A02969 pAAV_3xU7(15xCAG)_CMV_GFP(500bp buffer) Targeting CAG repeat [Table 34-1] [Table 34-2]

[0157] An exemplary AAV vector of the disclosure comprises, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a DMD exon 51-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a DMD exon 51-targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A03980 encoding the DMD exon 51-targeting snRNA sequence comprises SEQ ID NO: 135. A03980: pAAV(ssAAV)U7 promoter-esnRNA-z38 / 42-U7 termination-U1 promoter-esnRNAz38 / z42-U1 termination [Table 35]

[0158] An exemplary AAV vector of the disclosure comprises, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a DMD exon 51-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a DMD exon 51-targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A03981 encoding the DMD exon 51-targeting snRNA sequence comprises SEQ ID NO: 136. A03981: pAAV(ssAAV)_U7 promoter-esnRNA-z42-U7 termination-U1 promoter-esnRNA-z38-U1 termination [Table 36]

[0159] An exemplary AAV vector of the disclosure comprises, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a DMD exon 51-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a U1 promoter sequence, a DMD exon 51-targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A04229 encoding the DMD exon 51-targeting snRNA sequence comprises SEQ ID NO: 137.

[0160] A04229: pAAV(scAAV)U7 promoter-esnRNA-z38 / 42-U7 termination-U1 promoter-esnRNAz38 / z42-U1 termination-mutITR [Table 37]

[0161] An exemplary AAV vector of the disclosure comprises, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a DMD exon 51-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U1 promoter sequence, a DMD exon 51-targeting U7 esnRNA sequence, a U1 downstream terminator sequence, a buffer sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A04184 encoding the DMD exon 51-targeting snRNA sequence comprises SEQ ID NO: 138. A04184: pAAV(ssAAV)-U7 promoter-z38 / 42-U7 term_U1 promoter-z38 / 42-U1 term_buffer combination sequence [Table 38-1] [Table 38-2]

[0162] An exemplary AAV vector of the present disclosure includes, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CUG repeat-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U1 promoter sequence, a CUG repeat-targeting U7 esnRNA sequence, a U1 downstream terminator sequence, an eCMV promoter sequence, a sequence encoding GFP, a polyA sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A03681 encoding the CUG repeat-targeting snRNA sequence comprises SEQ ID NO: 139. A03681: pAAV(ssAAV)-U7 promoter-zCUGx15-U7 term_U1 promoter-zCUGx15-U1 term-eCMV-eGFP [Table 39-1] [Table 39-2]

[0163] An exemplary AAV vector of the present disclosure includes, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U1 promoter sequence, a CUG repeat-targeting U7 esnRNA sequence, a U1 downstream terminator sequence, a buffer sequence, a U7 promoter sequence, a CUG repeat-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, an eCMV promoter sequence, a sequence encoding GFP, a polyA sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A03682 encoding the CUG repeat-targeting snRNA sequence comprises SEQ ID NO: 140. A03682: pAAV(ssAAV)-U1 promoter-zCUGx15-U1 term_U7 promoter-zCUGx15-U7 term-eCMV-eGFP [Table 40-1] [Table 40-2]

[0164] An exemplary AAV vector of the present disclosure comprises, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a non-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U1 promoter sequence, a non-targeting U7 esnRNA sequence, a U1 downstream terminator sequence, an eCMV promoter sequence, a sequence encoding GFP, a polyA sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A03683 encoding the non-targeting snRNA sequence comprises SEQ ID NO:141. A03683: pAAV(ssAAV)-U7 promoter-znt-U7 term_U1 promoter-znt-U1 term-eCMV-eGFP [Table 41-1] [Table 41-2]

[0165] An exemplary AAV vector of the present disclosure includes, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CUG repeat-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U1 promoter sequence, a CUG repeat-targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A03684 encoding the CUG repeat-targeting snRNA sequence includes SEQ ID NO: 142. A03864: pAAV(ssAAV)-U7 promoter-zCUGx15-U7 term_U1 promoter-zCUGx15-U1 term (derivative of minus GFP-3681) [Table 42-1] [Table 42-2]

[0166] An exemplary AAV vector of the present disclosure includes, from 5' to 3': a first inverted terminal repeat (ITR) sequence, a U7 promoter sequence, a CUG repeat-targeting U7 esnRNA sequence, a U7 downstream terminator sequence, a buffer sequence, a U1 promoter sequence, a CUG repeat-targeting U7 esnRNA sequence, a U1 downstream terminator sequence, and a second ITR sequence. In some embodiments, the nucleic acid sequence encoding the AAV vector A04233 encoding the CUG repeat-targeting snRNA sequence includes SEQ ID NO: 143. A04233: pAAV(scAAV)-U7 promoter-zCUGx15-U7 termination-U1 promoter-zCUGx15-U1 termination (derivative of A03681, no GFP in scAAV) [Table 43-1] [Table 43-2] Promoter sequence

[0167] The gene therapy compositions and RNA-targeted snRNA gene therapy compositions of the present disclosure contain promoter sequences derived from snRNA.

[0168] A "promoter" is a control sequence that is a region of a polynucleotide sequence at which the initiation and rate of transcription are controlled. A promoter can contain genetic elements to which regulatory proteins and molecules, such as RNA polymerase and other transcription factors, can bind.

[0169] In some embodiments of the compositions and methods of the present disclosure, the expression vectors, viral vectors or non-viral vectors provided herein include, but are not limited to, expression control elements. "Expression control elements" as used herein refers to any sequence that regulates the expression of a coding sequence, such as a gene. Exemplary expression control elements include, but are not limited to, promoters, enhancers, microRNAs, post-transcriptional regulatory elements, polyadenylation signal sequences, and introns. Expression control elements can be, for example, constitutive, inducible, repressible, or tissue-specific. A "promoter" is a control sequence that is a region of a polynucleotide sequence where the initiation and rate of transcription are controlled. A promoter can contain genetic elements to which regulatory proteins and molecules, such as RNA polymerase and other transcription factors, can bind. An "enhancer" is a region of DNA to which an activating protein can bind to increase the likelihood or frequency of transcription.

[0170] In some embodiments of the compositions and methods of the present disclosure, the expression vectors, viral vectors or non-viral vectors provided herein include vector elements, such as, but not limited to, buffer sequences derived from human genomic sequences downstream from snRNAs, thus providing the ability to encode multiple snRNAs from a single construct.

[0171] In some embodiments, the incorporation of coding sequences into the compositions disclosed herein allows multicistronic vectors to simultaneously express two or more separate proteins from the same mRNA. The two most widely used strategies for constructing multicistronic configurations are by using IRES or 2A self-cleaving sites. "IRES" refers to an internal ribosome entry site or part thereof of viral, prokaryotic, or eukaryotic origin that is used in polycistronic vector constructs. In some embodiments, an IRES is an RNA element that allows for translation initiation in a cap-dependent manner. The term "self-cleaving peptide" or "sequence encoding a self-cleaving peptide" or "2A self-cleaving site" refers to a linking sequence that is used in vector constructs to incorporate a site for facilitating ribosome skipping and thus generating two polypeptides from a single promoter. Such self-cleaving peptides include, but are not limited to, T2A peptide, and P2A peptide, or other sequences that encode self-cleaving peptides.

[0172] In another embodiment, the vector construct may include linker(s), signal sequence(s), and / or tag(s).

[0173] In some embodiments, the vector is a viral vector. In some embodiments, the vector is an adenoviral vector, an adeno-associated viral (AAV) vector, or a lentiviral vector. In some embodiments, the vector is a retroviral vector, an adenoviral / retroviral chimeric vector, a herpes simplex virus I or II vector, a parvoviral vector, a reticuloendotheliosis virus vector, a poliovirus vector, a papilloma virus vector, a vaccinia virus vector, or any hybrid or chimeric vector that incorporates advantageous aspects of two or more viral vectors. In some embodiments, the vector further comprises one or more expression control elements operably linked to the polynucleotide. In some embodiments, the vector further comprises one or more selection markers. In some embodiments, the AAV vector has low toxicity. In some embodiments, the AAV vector does not integrate into the host genome, thereby reducing the probability of causing insertional mutagenesis. In some embodiments, the AAV vector can encode a total polynucleotide ranging from 4.5kb to 4.75kb.In some embodiments, exemplary AAV vectors that can be used in any of the compositions, systems, methods and kits described herein include AAV1 vectors, modified AAV1 vectors, AAV2 vectors, modified AAV2 vectors, AAV2-Tyr mutant vectors, AAV3 vectors, modified AAV3 vectors, AAV4 vectors, modified AAV4 vectors, AAV5 vectors, modified AAV5 vectors, AAV6 vectors, modified AAV6 vectors, AAV7 vectors, modified AAV7 vectors, AAV8 vectors, AAVrh ... Vectors that can be mentioned include AAV9 vectors, AAV.rh10 vectors, modified AAV.rh10 vectors, AAVrh.74, AAV.rh32 / 33 vectors, modified AAV.rh32 / 33 vectors, AAV.rh43 vectors, modified AAV.rh43 vectors, AAV.rh64R1 vectors, and modified AAV.rh64R1 vectors, AAV-Tyr mutant vectors, AAV-Tyr-Ser mutant vectors, AAV-Tyr-Ser-Thr mutant vectors, and any combinations or equivalents thereof. In some embodiments, lentiviral vectors are integrase-competent lentiviral vectors (ICLV). In some embodiments, lentiviral vectors can refer to transgene plasmid vectors, as well as transgene plasmid vectors with associated plasmids (e.g., packaging plasmids, rev expression plasmids, envelope plasmids), and lentivirus-based particles that can introduce exogenous nucleic acid into cells by viral or viral-like entry mechanisms.

[0174] Lentiviral vectors are well known in the art (see, e.g., Trono D. (2002) Lentiviral vectors, New York: Spring-Verlag Berlin Heidelberg and Durand et al. (2011) Viruses 3(2):132-159 doi: 10.3390 / v3020132). In some embodiments, exemplary lentiviral vectors that can be used in any of the compositions, systems, methods and kits described herein include human immunodeficiency virus (HIV) 1 vectors, modified human immunodeficiency virus (HIV) 1 vectors, human immunodeficiency virus (HIV) 2 vectors, modified human immunodeficiency virus (HIV) 2 vectors, Sooty mangabeyesal immunodeficiency virus (SIV) vectors, and modified human immunodeficiency virus (HIV) vectors. SM ) vector, modified Sooty mangabeyar immunodeficiency virus (SIV SM ) vector, African green monkey immunodeficiency virus (SIV) AGM ) vector, modified African green monkey immunodeficiency virus (SIV AGM ) vector, an equine infectious anemia virus (EIAV) vector, a modified equine infectious anemia virus (EIAV) vector, a feline immunodeficiency virus (FIV) vector, a modified feline immunodeficiency virus (FIV) vector, a visna / maedi virus (VNV / VMV) vector, a modified visna / maedi virus (VNV / VMV) vector, a caprine arthritis encephalitis virus (CAEV) vector, a modified caprine arthritis encephalitis virus (CAEV) vector, a bovine immunodeficiency virus (BIV), or a modified bovine immunodeficiency virus (BIV). nucleic acid

[0175] NOI (nucleotide sequence of interest) includes, without limitation, any nucleotide sequence or transgene that can be delivered by a vector. NOI may be synthetic, may be derived from naturally occurring DNA or RNA, may be codon optimized, may be recombinant RNA / DNA, may be cDNA, may be partial genomic DNA, and / or may be a combination thereof. NOI may be a coding region or partial coding region, but need not be a coding region. NOI may be RNA / DNA in sense or antisense orientation. NOI may be snRNA. NOI may also be referred to herein, without limitation, as transgene, heterologous sequence, gene, therapeutic gene. NOI may code for RNA (ribonucleoprotein complex), POI (protein of interest), partial POI, mutated version or variant of POI. POI may be similar to or correspond to wild type protein. POI may be a fusion protein or ribonucleoprotein complex, e.g. snRNA. In some aspects, the RNA sequences disclosed herein may be represented as DNA sequences, and it is within the ability of one of skill in the art to derive the sequence of the RNA sequence from the DNA sequence. Codon optimization

[0176] In some embodiments, the nucleic acid sequence encoding the NOI or transgene or GOI, for example the RNA targeting snRNA of the present disclosure, is a codon-optimized nucleic acid sequence. In some embodiments, the codon-optimized sequence exhibits at least 5%, at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 100%, at least 200%, at least 300%, at least 500%, or at least 1000% increase in transcription or translation in a human subject compared to a wild-type or non-codon-optimized nucleic acid sequence.

[0177] In some aspects, the codon-optimized nucleic acid sequence exhibits increased stability. In some aspects, the codon-optimized nucleic acid sequence exhibits increased stability by increased resistance to hydrolysis. In some embodiments, the codon-optimized sequence exhibits at least 5%, at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 100%, at least 200%, at least 300%, at least 500%, or at least 1000% increased stability compared to wild-type or non-codon-optimized nucleic acid sequences. In some embodiments, the codon-optimized sequence exhibits at least 5%, at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 100%, at least 200%, at least 300%, at least 500%, or at least 1000% increased resistance to hydrolysis compared to wild-type or non-codon-optimized nucleic acid sequences in human subjects.

[0178] In some embodiments, the codon-optimized nucleic acid sequence may not contain a donor splice site. In some embodiments, the codon-optimized nucleic acid sequence may contain about 1, or about 2, or about 3, or about 4, or about 5, or about 6, or about 7, or about 8, or about 9, or about 10 or less donor splice sites. In some embodiments, the codon-optimized nucleic acid sequence contains at least 1, or at least 2, or at least 3, or at least 4, or at least 5, or at least 6, or at least 7, or at least 8, or at least 9, or at least 10 fewer donor splice sites compared to a non-codon-optimized nucleic acid sequence.

[0179] Without wishing to be bound by theory, the removal of donor splice sites in codon-optimized nucleic acid sequences can unexpectedly and unpredictably increase the expression of proteins of interest in vivo, since cryptic splicing is prevented.Furthermore, cryptic splicing can vary from subject to subject, which means that the expression level of proteins containing donor splice sites can vary unpredictably from subject to subject.For human treatment, such unpredictability is unacceptable.Accordingly, codon-optimized nucleic acid sequences that lack donor splice sites unexpectedly and surprisingly allow increased expression of proteins in human subjects, and regulate protein expression across different human subjects.

[0180] In some embodiments, the codon-optimized nucleic acid sequence may have a GC content that is different from the GC content of the non-codon-optimized nucleic acid sequence that encodes the RNA-targeting snRNA.In some embodiments, the GC content of the codon-optimized nucleic acid sequence is more evenly distributed throughout the nucleic acid sequence compared to the non-codon-optimized nucleic acid sequence.

[0181] Without wishing to be bound by theory, by distributing GC content more evenly throughout the nucleic acid sequence, the codon-optimized nucleic acid sequence exhibits a more uniform melting temperature ("Tm") over the entire length of the transcript. The uniformity of the melting temperature unexpectedly results in increased expression of the codon-optimized nucleic acid in a human subject, since transcription and / or translation of the nucleic acid sequence occurs with less stalling of polymerases and / or ribosomes.

[0182] In some embodiments, a codon-optimized nucleic acid sequence may have fewer inhibitory microRNA target binding sites compared to a non-codon-optimized nucleic acid sequence. In some embodiments, a codon-optimized nucleic acid sequence may have at least one, or at least two, or at least three, or at least four, or at least five, or at least six, or at least seven, or at least eight, or at least nine, or at least ten, or at least ten fewer inhibitory microRNA target binding sites compared to a non-codon-optimized nucleic acid sequence.

[0183] Without wishing to be bound by theory, by having fewer inhibitory microRNA target binding sites, codon-optimized nucleic acid sequences unexpectedly exhibit increased expression in human subjects.

[0184] Provided herein are nucleic acid sequences encoding gene therapy compositions or RNA-targeting snRNA systems for use in the gene transfer and expression techniques described herein. Although not necessarily specified, it should be understood that the sequences provided herein can be used to produce expression products, as well as to produce substantially identical sequences that encode RNA or express and produce proteins with the same biological properties. These "biologically equivalent" or "biologically active" or "equivalent" polypeptides are encoded by equivalent polynucleotides described herein. They can have a primary amino acid sequence that is at least 60%, alternatively at least 65%, alternatively at least 70%, alternatively at least 75%, alternatively at least 80%, alternatively at least 85%, alternatively at least 90%, alternatively at least 95%, alternatively at least 98% identical to the reference polypeptide when compared using sequence identity methods performed under default conditions. Specific polypeptide sequences are provided as examples of certain embodiments. Modifications to the sequences to amino acids with alternative amino acids with similar charges. Furthermore, an equivalent polynucleotide is one that hybridizes under stringent conditions to a reference polynucleotide or its complement, or, for polypeptides, a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a reference coding polynucleotide or its complement. Alternatively, an equivalent polypeptide or protein is one that is expressed from an equivalent polynucleotide.

[0185] The NOI or nucleic acid sequences (e.g., polynucleotide sequences) disclosed herein may be codon-optimized, a technique well known in the art. Codon optimization refers to the fact that different cells use certain codons differently. This codon bias corresponds to a bias in the relative abundance of certain tRNAs in a cell type. Expression can be increased by altering the codons in the sequence to match the relative abundance of the corresponding tRNA. Expression can also be reduced by deliberately selecting codons whose corresponding tRNAs are known to be rare in a particular cell type. Codon usage tables are known in the art for mammalian cells, as well as for a variety of other organisms. The esnRNA can be generated based on the genetic code, e.g., a nucleic acid sequence that encodes the esnRNA. In some embodiments, such sequences are optimized for expression in a host or target cell, e.g., a host cell used to express the esnRNA, or a cell in which the disclosed method is performed (e.g., in a mammalian cell, e.g., a human cell). Codon preferences and codon usage tables for a particular species can be used to engineer isolated nucleic acid molecules encoding esnRNAs that exploit the codon usage preferences of that particular species. For example, esnRNAs disclosed herein can be designed to have codons that are preferentially used by a particular organism of interest. In one example, the esnRNA nucleic acid sequence is optimized for expression in human cells, e.g., has at least 70%, at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity to its corresponding wild-type or source nucleic acid sequence. In some embodiments, an isolated nucleic acid molecule encoding at least one esnRNA (which may be part of a vector) comprises at least one esnRNA coding sequence that is codon-optimized for expression in eukaryotic cells or at least one esnRNA coding sequence that is codon-optimized for expression in human cells.In one embodiment, such codon-optimized esnRNA coding sequences have at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to their corresponding wild-type or origin sequence. In another embodiment, eukaryotic codon-optimized nucleic acid sequences encode esnRNAs that have at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to their corresponding wild-type or origin sequence. In another embodiment, various clones containing functionally equivalent nucleic acids, such as nucleic acids that differ in sequence but code for the same esnRNA sequence, can be routinely generated. Silent mutations in the coding sequence result from the degeneracy (i.e., redundancy) of the genetic code, where more than one codon may code for the same amino acid residue. Thus, for example, leucine can be coded for by CTT, CTC, CTA, CTG, TTA, or TTG; serine can be coded for by TCT, TCC, TCA, TCG, AGT, or AGC; asparagine can be coded for by AAT or AAC; aspartic acid can be coded for by GAT or GAC; cysteine ​​can be coded for by TGT or TGC; alanine can be coded for by GCT, GCC, GCA, or GCG; glutamine can be coded for by CAA or CAG; tyrosine can be coded for by TAT or TAC; and isoleucine can be coded for by ATT, ATC, or ATA. Tables showing the standard genetic code can be found in various sources (see, for example, Stryer, 1988, Biochemistry, 3rd Edition, WH 5 Freeman and Co., NY).

[0186] "Hybridization" refers to a reaction in which one or more polynucleotides react to form a complex stabilized by hydrogen bonds between the bases of nucleotide residues. Hydrogen bonds can exist by Watson-Crick base pairing, by Hoogsteen binding, or in any other sequence-specific manner. The complex can include two strands forming a duplex structure, three or more strands forming a multistranded complex, a single self-hybridizing strand, or any combination of these. A hybridization reaction can constitute a step in a more extensive process, such as the initiation of a PC reaction, or the enzymatic cleavage of a polynucleotide by a ribozyme.

[0187] Examples of stringent hybridization conditions include an incubation temperature of about 25°C to about 37°C; a hybridization buffer concentration of about 6xSSC to about 10xSSC; a formamide concentration of about 0% to about 25%; and a wash solution of about 4xSSC to about 8xSSC. Examples of moderate hybridization conditions include an incubation temperature of about 40°C to about 50°C; a buffer concentration of about 9xSSC to about 2xSSC; a formamide concentration of about 30% to about 50%; and a wash solution of about 5xSSC to about 2xSSC. Examples of high stringency conditions include an incubation temperature of about 55°C to about 68°C; a buffer concentration of about 1xSSC to about 0.1xSSC; a formamide concentration of about 55% to about 75%; and a wash solution of about 1xSSC, 0.1xSSC, or deionized water. Generally, hybridization incubation times are from 5 minutes to 24 hours, with one, two or more washing steps, and washing incubation times are about 1 minute, 2 minutes, or 15 minutes. SSC is a 0.15M NaCl and 15mM citrate buffer. It is understood that equivalents of SSC using other buffer systems can be utilized.

[0188] "Homology" or "identity" or "similarity" refers to sequence similarity between two peptides or two nucleic acid molecules. Homology can be determined by comparing a position in each sequence that can be aligned for comparison. If the same base or amino acid occupies a position in the compared sequences, the molecules are homologous at that position. The degree of homology between sequences depends on the number of matching or homologous positions that the sequences share. An "unrelated" or "non-homologous" sequence shares less than 40% identity or less than 25% identity with one of the sequences of the invention. cell

[0189] In some embodiments of the compositions and methods of the present disclosure, the cells of the present disclosure are prokaryotic cells.

[0190] In some embodiments of the compositions and methods of the present disclosure, the cells of the present disclosure are eukaryotic cells. In some embodiments, the cells are mammalian cells. In some embodiments, the cells are bovine, murine, feline, equine, porcine, canine, simian, or human cells. In some embodiments, the cells are non-human mammalian cells, such as non-human primate cells.

[0191] In some embodiments, the cells of the present disclosure are somatic cells. In some embodiments, the cells of the present disclosure are germline cells. In some embodiments, the germline cells of the present disclosure are not human cells.

[0192] In some embodiments of the compositions and methods of the present disclosure, the cell of the present disclosure is a stem cell. In some embodiments, the cell of the present disclosure is an embryonic stem cell. In some embodiments, the embryonic stem cell of the present disclosure is not a human cell. In some embodiments, the cell of the present disclosure is a multipotent stem cell or a pluripotent stem cell. In some embodiments, the cell of the present disclosure is an adult stem cell. In some embodiments, the cell of the present disclosure is an induced pluripotent stem cell (iPSC). In some embodiments, the cell of the present disclosure is a hematopoietic stem cell (HSC).

[0193] In some embodiments of the compositions and methods of the present disclosure, the somatic cell of the present disclosure is neuronal cell.In one embodiment, the patient's cell or cells that are treated with the compositions disclosed herein include, but are not limited to, central nervous system (neuron), peripheral nervous system (neuron), peripheral motor neuron, and / or sensory neuron.In one embodiment, the neuronal cell is glial cell.

[0194] In some embodiments of the compositions and methods of the present disclosure, the somatic cells of the present disclosure are epithelial cells. In some embodiments, the epithelial cells of the present disclosure form fibroblasts, squamous epithelial cells, cuboidal epithelial cells, columnar epithelial cells, stratified epithelial cells, pseudostratified columnar epithelial cells or transitional epithelial cells. In some embodiments, the epithelial cells of the present disclosure form glands, including but not limited to the pineal gland, thymus, pituitary gland, thyroid gland, adrenal gland, apocrine gland, holocrine gland, part-secretory gland, serous gland, mucous gland and sebaceous gland. In some embodiments, the epithelial cells of the present disclosure are in contact with the outer surface of an organ, including but not limited to the lung, spleen, stomach, pancreas, bladder, intestine, kidney, gallbladder, liver, larynx or pharynx. In some embodiments, the epithelial cells of the present disclosure are in contact with the outer surface of a blood vessel or vein.

[0195] In some embodiments of the present disclosure, the somatic cell is an ocular cell. The ocular cell includes, but is not limited to, a corneal epithelial cell, a keratinocyte, a retinal pigment epithelial (RPE) cell, a lens epithelial cell, an iris pigment epithelial cell, a conjunctival fibroblast, a non-pigmented ciliary epithelial cell, a trabecular meshwork cell, an ocular choroidal fibroblast, and a conjunctival epithelial cell. In some embodiments, the ocular cell is a retinal cell or a corneal cell. In one embodiment, the retinal cell is a photoreceptor cell or a retinal pigment epithelial cell. In another embodiment, the retinal cell is a ganglion cell, an amacrine cell, a bipolar cell, a horizontal cell, a Muller glial cell, a rod cell, or a cone cell. In some embodiments of the compositions and methods of the present disclosure, the somatic cells of the present disclosure are primary cells.

[0196] In some embodiments of the compositions and methods of the present disclosure, the somatic cells of the present disclosure are cultured cells.

[0197] In some embodiments of the compositions and methods of the present disclosure, the somatic cells of the present disclosure are in vivo, in vitro, ex vivo, or in situ.

[0198] In some embodiments of the compositions and methods of the present disclosure, the somatic cells of the present disclosure are autologous or allogeneic cells. How to use

[0199] The present disclosure provides a method of expressing an RNA encoding or NOI in a cell using the snRNA system described herein, comprising administering an AAV viral vector comprising a modified AAV capsid protein of the present disclosure. In one embodiment, the present disclosure provides a method of modifying the activity of an RNA or a protein encoded by an RNA molecule, comprising contacting a composition of the present disclosure with a target RNA molecule under conditions suitable for binding to the RNA molecule.

[0200] The present disclosure provides a method for modifying the level of expression of an RNA molecule of the present disclosure or the expression of a protein encoded by the RNA molecule, comprising contacting a composition of the present disclosure with a cell comprising the RNA molecule under conditions suitable for binding to the RNA molecule. In some embodiments, the cell is in vivo, in vitro, ex vivo or in situ. In some embodiments, the composition of the present disclosure comprises a vector comprising snRNA. In some embodiments, the vector is AAV.

[0201] The present disclosure provides a method of modifying the level of expression of an RNA molecule of the present disclosure or the expression of a protein encoded by the RNA molecule, comprising contacting the composition of the present disclosure with the RNA molecule under conditions suitable for knocking down, blocking, splicing, multitargeting or editing the target RNA. In some embodiments, the vector is AAV.

[0202] The present disclosure provides a method for modifying the activity of a target RNA or a protein encoded by an RNA molecule, comprising contacting a composition with a cell comprising the RNA molecule under conditions suitable for knocking down, blocking, splicing, multitargeting or editing the target RNA. In some embodiments, the cell is in vivo, in vitro, ex vivo or in situ. In some embodiments, the composition comprises a vector comprising the snRNA sequence disclosed herein. In some embodiments, the vector is AAV.

[0203] The present disclosure provides a method of treating a disease or disorder, the method comprising administering to a subject a therapeutically effective amount of a snRNA composition of the present disclosure.

[0204] The present disclosure provides a method of treating a disease in a patient in need of such treatment, comprising administering to the patient a therapeutically effective amount of a snRNA composition of the present disclosure, the composition comprising a vector comprising a snRNA as described herein, and the composition modifies, reduces, disrupts, lowers or eliminates the level of expression of a toxic repeat RNA (compared to the level of expression of a toxic repeat RNA treated with a non-targeting (NT) control or compared to no treatment). In another embodiment, the level of reduction is 1-fold or more. In another embodiment, the level of reduction is 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold or 10-fold. In another embodiment, the level of reduction is 10-fold or more. In another embodiment, the level of reduction is between 10-fold and 20-fold. In another embodiment, the level of reduction is 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold or 20-fold. In another embodiment, the gene therapy composition disclosed herein, when administered to a patient, results in 20%-100% degradation of the toxic repeat RNA. In one embodiment, the % disappearance of the toxic repeat RNA is 20-99%, 25%-99%, 50%-99%, 80%-99%, 90%-99%, 95%-99%. In one embodiment, the % disappearance is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In another embodiment, the % disappearance is complete or 100% disappearance of the toxic repeat RNA.

[0205] The present disclosure provides a method of treating a disease or disorder in a subject, the method comprising administering an RNA-targeting nucleic acid molecule (i.e., an esnRNA of the present disclosure) or an AAV vector comprising an esnRNA of the present disclosure.

[0206] In some embodiments, the disease or disorder is associated with a toxic repeat RNA sequence. In some embodiments, the toxic repeat RNA sequence is a CAG, CUG, GGCCCC, CCGGG, or GGCCC+CCGGGG RNA repeat.

[0207] In some embodiments, the disease or disorder is myotonic dystrophy (DM1) or Huntington's disease (HD).

[0208] In some embodiments, the disease or disorder is Duchenne muscular dystrophy.In some embodiments, the RNA targeting nucleic acid molecule or AAV vector targets the RNA sequence that codes for dystrophin (DMD).In some embodiments, the RNA sequence that codes for DMD comprises an intron sequence or an exon sequence.In some embodiments, the exon sequence comprises exon 51 of DMD or its flanking region.

[0209] In some embodiments of the method of the present disclosure, the subject of the present disclosure is diagnosed with the disease to be treated.In some embodiments, the subject of the present disclosure shows at least one sign or symptom of the disorder or disease to be treated.In some embodiments, the subject of the present disclosure shows at least one sign or symptom of the disease.

[0210] In some embodiments of the method of the present disclosure, the subject of the present disclosure is female.In some embodiments of the method of the present disclosure, the subject of the present disclosure is male.In some embodiments, the subject of the present disclosure has two chromosomes XX or XY.In some embodiments, the subject of the present disclosure has two chromosomes XX or XY and a third chromosome, either X or Y.

[0211] In some embodiments of the method of the present disclosure, the subject of the present disclosure is a newborn, an infant, a child, an adult, an elderly adult, or an older adult.In some embodiments of the method of the present disclosure, the subject of the present disclosure is at least 1 day old, 2 days old, 3 days old, 4 days old, 5 days old, 6 days old, 7 days old, 8 days old, 9 days old, 10 days old, 11 days old, 12 days old, 13 days old, 14 days old, 15 days old, 16 days old, 17 days old, 18 days old, 19 days old, 20 days old, 21 days old, 22 days old, 23 days old, 24 days old, 25 days old, 26 days old, 27 days old, 28 days old, 29 days old, 30 days old, or 31 days old. In some embodiments of the methods of the present disclosure, the subject of the present disclosure is at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, or 12 months old. In some embodiments of the methods of the present disclosure, the subject of the present disclosure is at least 1 year old, 2 years old, 3 years old, 4 years old, 5 years old, 6 years old, 7 years old, 8 years old, 9 years old, 10 years old, 15 years old, 20 years old, 25 years old, 30 years old, 35 years old, 40 years old, 45 years old, 50 years old, 55 years old, 60 years old, 65 years old, 70 years old, 75 years old, 80 years old, 85 years old, 90 years old, 95 years old, 100 years old, or any age or partial age therebetween.

[0212] In some embodiments of the methods of the present disclosure, the subject of the present disclosure is a mammal. In some embodiments, the subject of the present disclosure is a non-human mammal.

[0213] In some embodiments of the methods of the present disclosure, the subject of the present disclosure is a human.

[0214] In some embodiments of the method of the present disclosure, the therapeutically effective amount comprises a single dose of the composition of the present disclosure.In some embodiments, the therapeutically effective amount comprises at least one dose of the composition of the present disclosure.In some embodiments, the therapeutically effective amount comprises one or more doses of the composition of the present disclosure.

[0215] In some embodiments of the methods of the present disclosure, a therapeutically effective amount is one that eliminates a sign or symptom of a disease or disorder, hi some embodiments, a therapeutically effective amount is one that reduces the severity of a sign or symptom of a disease or disorder.

[0216] In some embodiments of the methods of the present disclosure, a therapeutically effective amount is one that eliminates the disease or disorder.

[0217] In some embodiments of the disclosed methods, the therapeutically effective amount prevents the onset of a disease or disorder. In some embodiments, the therapeutically effective amount delays the onset of a disease or disorder. In some embodiments, the therapeutically effective amount reduces the severity of a sign or symptom of a disease or disorder. In some embodiments, the therapeutically effective amount improves the prognosis of a subject.

[0218] In some embodiments of the method of the present disclosure, the composition of the present disclosure is administered to the subject via intracerebral administration. In some embodiments, the composition of the present disclosure is administered to the subject via intrastriatal route. In some embodiments, the composition of the present disclosure is administered to the subject by stereotactic injection or infusion. In some embodiments, the composition is administered to the brain. In some embodiments of the method of the present disclosure, the composition of the present disclosure is administered to the subject locally. In some embodiments, the compositions disclosed herein are formulated as pharmaceutical compositions.Simply put, the pharmaceutical compositions for use disclosed herein can comprise a polynucleotide encoding a protein(s) or a protein(s) optionally contained in AAV, which is optionally also immuno-orthogonal, in combination with one or more pharma- ceutically or physiologically acceptable carriers, diluents or excipients.Such compositions can comprise a buffer, such as neutral buffered saline, phosphate buffered saline, etc.; carbohydrate, such as glucose, mannose, sucrose or dextran, mannitol; protein; polypeptide or amino acid, such as glycine; antioxidant; chelating agent, such as EDTA or glutathione; adjuvant (e.g., aluminum hydroxide); and preservative. The compositions of the present disclosure can be formulated for administration routes, such as, for example, oral, enteral, topical, transdermal, intranasal and / or inhalation administration routes, as well as for administration routes, such as, for example, intravenous, intramuscular, subpial, intrathecal, intraparenchymal, intrathecal, intrastriatal, subcutaneous, intradermal, intraperitoneal, intratumoral, intravenous, intraocular and / or parenteral administration, by injection or infusion. In certain embodiments, the compositions of the present disclosure are formulated for intracerebral or intrastriatal administration. EXAMPLES

[0219] Example 1 esnRNA targeting CUG repeats in DM1 cell models material and method:

[0220] CTG480 HeLa cells were seeded at 100,000 cells / ml in 12-well plates. The next day, snRNA was transfected using lipofectamine (2 μL P3000 and 2.5 μl lipofectamine per sample). After 24 hours, cells were trypsinized and 1 / 2 of the cells were seeded into chamber slides for FISH and the other 1 / 2 into 24-well plates for RNA analysis.

[0221] The next day, RNA was extracted for RNA analysis and cells were fixed for FISH. CUG foci were labeled with a CUG fluorescent probe and cell nuclei were stained with DAPI.

[0222] Objective: To determine whether engineered snRNPs containing engineered stem-loops can knockdown CUG expansions and therefore reduce the number of RNA foci in a DM1 cell model.

[0223] Rationale: U7 snRNA can be programmed to target mRNA by replacing its histone mRNA annealing sequence with a sequence complementary to the target of interest. Others have shown that U7 with 15xCAG repeats reduces the CUG repeat expansion that causes DM1 (Francois et al NSMB 2011). We optimized this snRNA system by engineering the stem loop (SEQ ID NO: 1) to better stabilize the secondary structure of U7 snRNA in cells. We compared our engineered U7 stem loop with the U7 stem loop known in the art (Francois et al NSMB 2011). The construct contains 15xCAG repeats and an optimized Sm binding domain that further helps stabilize the programmed U7. CUG-targeting constructs were tested to determine whether they could deplete CUG foci by binding to and blocking CUG repeats in appropriate cell models and compared to U7, which contains a non-targeting (NT) sequence, see Figures 1A-D and 2A-C.

[0224] To model DM1 and express CUG foci as shown by in situ hybridization, constructs and controls were transiently transfected into HeLa (CTG480), a cell line with 480 CTG repeats inserted into its genome by CRISPR. Cells were plated on chamber slides, fixed, and RNA in situ hybridization was performed on the cells using a probe for CUG and dapi for nuclear staining. Colocalization of the CUG probe and DAPI signals was quantified using Halo.

[0225] Treatment with a 15xCAG esnRNA construct (to target / block the CUG repeats) significantly reduced CUG RNA foci.

[0226] Compared to their respective non-targeting controls, non-engineered snRNA and esnRNA constructs resulted in a 39% and 68% reduction in the average number of foci / cell, respectively.

[0227] Example 2 esnRNA targeting CAG repeats material and method:

[0228] HEK293T cells were seeded at 150,000 cells / ml in 12-well plates. The next day, snRNA was transfected using Lipofectamine (2 μL P3000 and 2.5 μl Lipofectamine per sample). Cells were transfected with the CAG reporter construct (containing 80 CAG repeats) and increasing doses (100-1000 ng) of a CAG repeat-targeting snRNA plasmid (termed CUG-15) or a control non-targeting (nt) plasmid.

[0229] Forty-eight hours after transfection, RNA was extracted for RNA analysis using QiaCube Connect. qRT-PCR was performed to detect the expression levels of the CAG reporter and normalized to the expression levels of the GAPDH reference gene.

[0230] Another set of cells was used for Western blot analysis with myc-tag antibody to detect protein levels of polyQ CAG-containing reporters. GAPDH was used as a loading control.

[0231] Objective: Mutant HTT is caused by the presence of microsatellite repeats in exon 1 of HTT. Here, we investigated whether engineered snRNPs containing engineered stem-loops could knock down CAG microsatellite repeat RNA in a CAG80 reporter assay.

[0232] Rationale:

[0233] U7 snRNA can be programmed to target mRNAs by replacing its histone mRNA annealing sequence with a sequence complementary to the target of interest. The esnRNA system reprogrammed to target CAG repeats contains an eSL of SEQ ID NO:1 to better stabilize the secondary structure of U7 snRNA in cells. The constructs contain 15xCUG repeats to target CAG expansions. These constructs also contained an optimized Sm-binding domain that further helps stabilize programmed U7. The CAG-targeting constructs were tested to determine whether they could knock down CAG repeats and polyQ-containing proteins compared to eSLs containing non-targeting sequences.

[0234] Complete knockdown of detectable polyQ protein was achieved by the highest 3 doses of U7. Near-complete knockdown was achieved by the lowest U7 dose. Thus, we herein show dose-dependent knockdown of CAG80 reporter mRNA to baseline levels. See Figures 3A-3C.

[0235] Example 3 esnRNA modulation of USH2A minigene exon 13 splicing material and method:

[0236] HEK293T cells were seeded at 150,000 / ml in 12-well plates. The next day, 50ng of USH2A minigene was transfected into the cells together with pcDNA expressing non-targeted esnRNA or USH2A exon 13-targeted esnRNA and Lipofectamine in total 250ng, 500ng, or 1ug.

[0237] Cells were harvested 48 hours after transfection. RNA was extracted using a Qiacube connect, reverse transcribed, and semi-quantitative PCR was performed with primers annealing to USH2A exons 12 and 14.

[0238] Quantification of U7 was performed by PCR using primers annealing to non-targeted esnRNA.

[0239] Rationale: Mutations in USH2A exon 13 result in Usher syndrome type 2A. Exon 13 is an in-frame exon, and the treatment strategy involves skipping of exon 13. We designed esnRNAs containing eSLs disclosed herein that target and anneal to the exon splicing enhancer in exon 13 of USH2A, preventing inclusion of exon 13. Our programmed esnRNA system targeting USH2A exon 13 results in efficient exon 13 skipping in minigenes. PCR results suggest higher steady-state levels of the esnRNA system compared to unengineered SLs. See Figures 4A-4D. See also Figure 1A.

[0240] Example 4 Splicing correction by esnRNA-mediated CUG repeat blocking in DM1 patient myotubes material and method:

[0241] DM1 patient myotubes containing 2600 CUG repeats in the 3'UTR of DMPK were differentiated for 13 days and then transfected with esnRNA containing eSL disclosed herein targeting 15x CUG repeats. RNA was extracted from cells 24 hours after treatment, RNA was reverse transcribed and semi-quantitative PCR was performed for DM1 disease splicing biomarkers LDB3 exon 11, BIN1 exon 11 and DMD exon 78. Analysis of splicing isoforms was performed by calculating the percentage of healthy splicing isoforms (LDB3 exon 11 excluded, BIN1 exon 11 included and DMD exon 78 included) relative to the total signal from both disease and healthy isoforms.

[0242] Rationale:

[0243] DM1 is caused by a CUG repeat expansion in the 3'UTR of the DMPK gene, which sequesters the MBNL protein and results in dysregulation of alternative splicing. The esnRNA containing the eSL disclosed herein was programmed to target CUG (15xCUG), which resulted in a dose-dependent increase in healthy splice isoforms for all three tested disease splicing biomarkers compared to non-targeted controls. See Figures 5A-5F. See also Figure 2C.

[0244] Example 5 Examination of alternative 5′ stabilization motifs in U7-based eSLs and ISDs. The efficacy of CUGx15 targeting snRNAs with alternative 5' interaction stabilizing domains (ISDs) in reducing RNA foci was revealed and determined by synthetic snRNA transfection into CTG480 HeLa cells followed by fluorescent in situ hybridization for CUG RNA foci. See Figures 6A-6B. (Light blue = alternative engineered stem-loops with corresponding 5'ISD. Dark blue = selected engineered stem-loops and corresponding 5'ISD. sR220004 = non-targeting snRNA).

[0245] Expression levels of non-targeting snRNAs with alternative 5' stabilization domains were evaluated at 24, 48 and 72 hours after transfection of synthetic snRNAs. See Figures 7A-7B. sR220004 had the highest expression at all time points. sR220088 had no detectable expression. The eSL / 5'ISD found in sR22004 was selected for future constructs. sR220004 and sR220091 retained expression to the highest degree at 48 and 72 hours.

[0246] Example 6 U7 snRNA availability and expression from PolIII and PolII promoters snRNA expression was assessed by qPCR in CTG480 HeLa cells when snRNA expression was driven by different human PolIII and PolII promoters. See Figure 8. The U1 promoter drove the highest levels of snRNA, followed by the U7 promoter. The PolIII promoters U6 and 7SK had low expression, and the PolIII tRNA promoter had the lowest expression.

[0247] CUG foci quantification was assessed by RNA FISH in CTG480 HeLa cells. See Figures 9A-9B. Only the U1 and U7 promoters were clearly effective in reducing the number of CUG foci, with U1 being more effective than U7 (blue = CUG targeting; grey = non-targeting). [Table 44]

[0248] snRNA expression was determined by qPCR in HEK293T cells (see FIG. 10). Expression of U7 snRNA under the PolIII promoter was increased by up to 25× when SmOpt was converted to U1 Sm binding sites. Expression by the PolII U1 and U7 promoters was decreased when the Sm sites were converted to U1 Sm. Expression by the U1 and U7 promoters is superior to the Pol III promoter.

[0249] snRNA transfection into HEK293T cells was performed. See Figures 11A-11B. Here, znt esnRNA and z38 esnRNA expression were driven by separate snRNA promoters. These constructs were transfected into HEK293T cells. 48 hours after transfection, RNA was extracted and cDNA was made. Primers specific for each snRNA (z) were used for qPCR to determine snRNA expression and relative promoter strength.

[0250] Example 7 The esnRNA construct results in DMD exon skipping of exon 51 in patient myotubes. Human delta exon 52 myotubes were transduced with snRNAs disclosed herein, see Figures 12A-12B. Percent exon 51 skipping was determined by quantification of band intensity using amplification primers.

[0251] Human delta exon 52 myotubes were transduced with AAV9 carrying snRNA as disclosed herein. Immunofluorescence was performed for desmin and dystrophin. Dystrophin can be detected after treatment with exon 51 targeting snRNA. See Figures 13A-13B.

[0252] Example 8 Exon 51 skipping skeletal myotubes and DMD mouse model Human skeletal myotubes with exon 52 deletion were transfected with exon 51 RNA-targeting snRNA with fusion antisense sequences (z73=z38 / z42 and z187=z42 / z38) targeting exon splicing enhancers (ESEs). 24 hours after transfection of low doses of snRNA, exon 51 skipping levels were quantified (Tape Station image Figure 15A). Human skeletal myotubes (DMD exon 52 deletion) were transduced with AAV9-A04526 (2xz73) and A04569 (2xz187). Myotubes were transduced with MOIs of 2.5e4, 1e5 and 5e5 for 7 days. AAV9-based exon 51 skipping was quantified (Figure 15B). Mice with hDMD with a deletion of exon 52 (del52hDMD / mdx) were retro-orbitally injected with 3e12 vector genomes of A04526 and A04569. After 3 weeks of survival, RNA was extracted from tibialis anterior (TA), gastrocnemius (Gc) and heart. Semi-quantitative RT-PCR was performed to detect exon 51 inclusion and exclusion bands. (Figure 15C) shows quantification of exon 51 skipping in humanized DMD mouse models. Intramuscular delivery of A04526 or exon 51 ESE-targeted morpholino (ViM) at a 3e11vg / muscle dose into the gastrocnemius of del52hDMD / mdx mice. Figure 15D shows quantification of dystrophin-positive fibers after 4 weeks. hDMD / mdx mice expressing wild-type human dystrophin (gray bars) serve as a positive control for dystrophin expression. U=untreated.

[0253] Example 9 AAV9-based splicing reversal and CUG repeat knockdown in DM1 patient-derived myotubes DM1 patient fibroblasts were differentiated into myotubes by transduction with myoD adenoviral vectors (5 days). Myotubes were transduced with A04233 and A04234 (scAAV9 with double snRNA cassettes targeting CUG repeats) at MOIs of 5e4, 2e5 and 1e6, and myotubes were harvested 7 days after transduction. Splicing reversal of DMD and LBD3 RNA and knockdown of DMPK after treatment with U7 snRNA targeting CUG repeats in patient-derived myotubes (containing 1700 CUG repeats). See Figure 16A-D. Cell nuclei were stained with DAPI and CUG FISH was performed using a CUG-labeled probe. Cells were processed for quantification of the average number of CUG foci per cell 7 days after transduction. See Figure 17A-B.

[0254] Example 10 AAV9-based HTT knockdown in HD patient cells and HD mouse models HD patient iPSCs (containing 66 CAG repeats) were differentiated into cortical neurons for 2 weeks and then transduced with two different MOIs of AAV-A04390 snRNA vector (2x snRNA cassette targeting CAG repeats) for another 2 weeks. Cortical neurons were then harvested and mutant soluble HTT was quantified by Meso scale discovery immunoassay. See Figures 18A-18C. In vivo studies targeting CAG repeats were then planned in the R6 / 2 HD mouse model. AAV-snRNA vector targeting CAG repeats (A03081; AAVrh10-snRNA (4x snRNA with CAGx15 TS)) was administered intrastriatally at 2e10 vector genomes and mutant soluble HTT protein after treatment was quantified by Meso scale discovery immunoassay (MSD) for untreated and snRNA-treated mice (n=10). Please refer to Figures 19A-B.

[0255] Example 11 Higher expression levels with engineered stem-loop snRNA vectors compared to native stem-loop snRNA vectors CHO-Lec2 cells were transduced with AAV9-A04527 vector (native stem-loop expressing z38 / 42 targeting DMD exon 51 ESE) or AAV9-A04526 vector (engineered stem-loop expressing z38 / 42 targeting DMD exon 51 ESE) at an MOI of 1e6. Expression of z38 / 42 was higher in cells transduced with engineered snRNA vectors compared to z38 / 42 expression in cells transduced with native stem-loop snRNA vectors. See Figure 20A-B. Incorporation by Reference

[0256] All documents cited herein, including any cross-referenced or related patents or applications, are incorporated herein by reference in their entirety, unless expressly excluded or otherwise limited. The citation of any document is not an admission that it is prior art to any invention disclosed or embodied herein, or that it alone, or in any combination with any other reference(s), teaches, suggests or discloses any such invention. Furthermore, to the extent that any meaning or definition of a term in this document conflicts with any meaning or definition of the same term in a document incorporated by reference, the meaning or definition assigned to that term in this document shall control. Other embodiments

[0257] While particular embodiments of the present disclosure have been illustrated and described, various other changes and modifications can be made without departing from the spirit and scope of the present disclosure, and the appended claims will cover all such changes and modifications that fall within the scope of the present disclosure.

Claims

1. An RNA-targeting nucleic acid molecule comprising an engineered snRNA esnRNA, wherein the esnRNA system comprises an engineered stem-loop (eSL) comprising one or more nucleic acid sequences selected from SEQ ID NO:1 to SEQ ID NO:11, SEQ ID NO:146 to SEQ ID NO:148, SEQ ID NO:163, or SEQ ID NO:186 to 205.

2. The RNA-targeting nucleic acid molecule of claim 1 , wherein the esnRNA comprises a targeting sequence (TS) that targets a target RNA of interest.

3. The RNA-targeting nucleic acid molecule of claim 2 , wherein the target RNA is a pre-mRNA or mRNA sequence.

4. 3. The RNA-targeting nucleic acid molecule of claim 2, wherein the target RNA of interest is a microsatellite repeat RNA.

5. 5. The RNA targeting nucleic acid molecule of claim 4, wherein the microsatellite repeat RNA is selected from the group consisting of CUG, CAG, and GGGGCC+CCCCGG.

6. The RNA-targeting nucleic acid molecule of claim 2 , wherein the target RNA is a sequence encoding DMD.

7. The RNA-targeting nucleic acid molecule of claim 6, wherein the targeting sequence is selected from SEQ ID NO:206 or SEQ ID NO:

207.

8. The RNA-targeting nucleic acid molecule of claim 6, wherein the targeting sequence comprises one or more of the nucleic acid sequences set forth in SEQ ID NOs:208 to 227.

9. The RNA-targeting nucleic acid molecule of claim 1 , wherein the esnRNA comprises two targeting sequences that target two RNAs of interest.

10. The RNA targeting nucleic acid molecule of claim 9 , wherein the two TSs are a fusion sequence.

11. The RNA-targeting nucleic acid molecule of claim 1, wherein the esnRNA comprises a Sm-binding domain (SmBD) selected from the group consisting of U1, U2, U4 and U5 SmBD.

12. The RNA-targeting nucleic acid molecule of claim 11, wherein the SmBD comprises a nucleic acid sequence set forth in any one of SEQ ID NOs:31 to 38, or SEQ ID NO:

164.

13. The RNA-targeting nucleic acid molecule of claim 1, wherein the esnRNA comprises a 5' interacting stabilizer domain (5'ISD) comprising a nucleotide sequence selected from any one of SEQ ID NOs: 12 to 23.

14. The RNA-targeting nucleic acid of claim 1, wherein the esnRNA comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 65 to 119 or 179 to 185.

15. A vector comprising one or more esnRNAs according to claim 1.

16. The vector of claim 15, wherein the viral vector is an AAV vector.

17. The AAV vector of claim 16, wherein the snRNA is operably linked to a promoter.

18. The AAV vector of claim 16, wherein the snRNA is operably linked to a U7 promoter or a U1 promoter.

19. The AAV vector of claim 6, wherein the snRNA is operably linked to a downstream terminator (DT).

20. The AAV vector of claim 16, wherein the snRNA is operably linked to a U7 downstream terminator or a U1 downstream terminator.

21. The AAV vector of claim 16, wherein the vector comprises at least one, at least two, at least three, at least four, or at least five esnRNAs.

22. The AAV vector of claim 21, wherein each of the at least one, at least two, at least three, at least four, or at least five esnRNAs targets the same target RNA sequence.

23. The AAV vector of claim 21 , wherein the at least one, at least two, at least three, at least four, or at least five esnRNAs target two or more target RNA sequences.

24. 22. The AAV vector of claim 21 , wherein each esnRNA is separated by a buffer sequence.

25. The AAV vector of claim 24, wherein the buffer sequence comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 24 to 30.

26. The AAV vector of claim 20, wherein the vector comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 123 to 143, 168 to 178, or 231 to 233.

27. A method for targeting one or more target RNAs of interest and blocking, knocking down, editing, exon skipping or splicing said one or more target RNAs, comprising the step of contacting an esnRNA described in claim 1 with a cell containing said one or more target RNAs.

28. A DMD exon 51 RNA-targeting nucleic acid molecule comprising a spacer sequence as set forth in any one of SEQ ID NOs: 206 to 230.

29. 17. A method for treating a disease or disorder in a subject, comprising administering an RNA-targeting nucleic acid molecule of claim 1 or an AAV vector of claim 15.

30. 30. The method of claim 29, wherein the disease or disorder is associated with a toxic repeat RNA sequence.

31. 30. The method of claim 29, wherein the toxic repeat RNA sequence is a CAG, CUG, GGCCCC, CCGGG, or GGCCC+CCGGGG RNA repeat.

32. 30. The method of claim 29, wherein the disease or disorder is myotonic dystrophy (DM1) or Huntington's disease (HD).

33. 30. The method of claim 29, wherein the disease or disorder is Duchenne muscular dystrophy.

34. 34. The method of claim 33, wherein the RNA targeting nucleic acid molecule or AAV vector targets an RNA sequence encoding dystrophin (DMD).

35. 35. The method of claim 34, wherein the RNA sequence encoding DMD comprises an intron or exon sequence.

36. 36. The method of claim 35, wherein the exon sequence comprises exon 51 of DMD or a flanking region thereof.

37. 30. The method of claim 29, wherein the administration is intravenous, intramuscular, subpial, intrathecal, intraparenchymal, intrathecal, intrastriatal, subcutaneous, intradermal, intraperitoneal, intratumoral, intravenous, intraocular and / or parenteral administration.

Images