Multigene-edited cells for CD70-directed cancer immunotherapy
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2023-03-06
- Publication Date
- 2026-03-12
AI Technical Summary
While existing cancer immunotherapy improves the ability to identify and destroy cancer cells, it is difficult to effectively reduce potential side effects on healthy cells, and overexpression of cell markers may affect the persistence and amplification ability of cells.
Through gene editing technology, especially the CRISPR-Cas system, gene mutations are introduced into natural killer cells (NK cells) to reduce the expression of proteins such as CD70, CIS and Cbl-b, while introducing memory functions to improve cell durability and amplification capabilities.
The ability of NK cells to identify and destroy target cells more efficiently, while reducing side effects on healthy cells, improving the persistence and amplification ability of cells, thereby enhancing the effect of cancer immunotherapy.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 268,967, filed March 7, 2022, the entire contents of each of which are incorporated herein by reference.
[0002] Some embodiments disclosed herein relate to methods and compositions comprising genetically engineered cells for cancer immunotherapy, particularly cells engineered to reduce expression of certain markers that are also present on target cells. In some embodiments, the disclosure relates to cells that express chimeric antigen receptors and are engineered to reduce expression of one or more markers that increase efficacy, durability, and / or reduce potential side effects when used in cancer immunotherapy. [Background technology]
[0003] As more is learned about different cancers and what properties cancerous cells have that can be used to specifically distinguish them from healthy cells, therapeutic agents are being developed that exploit the distinctive features of cancerous cells. Immunotherapy using engineered immune cells is one approach to treat cancer.
[0004] Incorporation of material by reference to sequence listing files This application incorporates by reference a sequence listing contained in the following XML file submitted concurrently with this application: Filename: NKT.086WO_ST26.xml; created on Mar. 4, 2023 and is 249,856 bytes in size. Summary of the Invention
[0005] Immunotherapy offers a new technological advance in the treatment of disease, where immune cells are engineered to express specific targeting and / or effector molecules that specifically identify and react to diseased or damaged cells. This represents a promising advance, at least in part, due to the possibility of specifically targeting diseased or damaged cells, as opposed to more traditional approaches such as chemotherapy, where all cells are affected, with the desired outcome being that enough healthy cells survive for the patient to survive. One immunotherapy approach is the recombinant expression of chimeric receptors in immune cells to achieve targeted recognition and destruction of the abnormal cells of interest.
[0006] Accordingly, provided herein is a genetically engineered natural killer (NK) cell population for cancer immunotherapy, comprising a plurality of NK cells engineered to express a chimeric antigen receptor (CAR) comprising a tumor-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the tumor-binding domain targets CD70 and comprises an scFv comprising an amino acid sequence having at least about 85%, 90%, 95%, 97% (or more) sequence identity to one or more of SEQ ID NOs: 52, 47, 48, 49, 50, 51, 53 or 54, and the NK cells comprise a scFv comprising an amino acid sequence having at least about 85%, 90%, 95%, 97% (or more) sequence identity to one or more of SEQ ID NOs: 180 or 177-179. and the NK cells also comprise a genomic disruption in a cytokine-inducible SH2-containing protein gene target sequence comprising any one of SEQ ID NOs: 191 or 186-190, and the NK cells comprise at least one additional genomic disruption in the gene target sequence, wherein the engineered NK cells comprising said genomic disruption exhibit one or more of increased expansion capacity, increased cytotoxicity against target cells, and increased persistence compared to NK cells not comprising said genomic disruption. In some embodiments, the NK cells are expanded in culture.
[0007] In some embodiments, the NK cell also comprises a genomic disruption within a gene target sequence encoding a Casitas B lineage lymphoma-b (Cbl-b) protein comprising any one of SEQ ID NOs: 195, 192, 193, or 194. In some embodiments, the genomic disruption within the target sequence of the gene encoding a CD70 protein, the target sequence of the gene encoding a CIS protein, and / or the target sequence of the gene encoding a Cbl-b protein comprises an endonuclease-mediated indel. In some embodiments, the plurality of NK cells comprises a genomic disruption within a plurality of protein-encoding gene target sequences comprising at least three of SEQ ID NOs: 177-195. In some embodiments, the genomic disruption within the protein-encoding gene target sequence comprises an endonuclease-mediated indel.
[0008] Also provided is an engineered NK cell population for cancer immunotherapy, comprising a plurality of NK cells expanded in culture, the plurality of NK cells engineered to express a CAR comprising a tumor-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the tumor-binding domain targets CD70, the NK cells comprise a genomic disruption within a CD70 protein gene target sequence comprising any one of SEQ ID NOs: 177-180, the genomic disruption comprising an endonuclease-mediated indel, the NK cells comprise a genomic disruption within a cytokine-inducible SH2-containing protein gene target sequence comprising any one of SEQ ID NOs: 186-191, the NK cells comprise at least one additional genomic disruption within the gene target sequence, and the engineered NK cells comprising the genomic disruption exhibit one or more of increased expansion capability, increased cytotoxicity against target cells, and increased persistence compared to NK cells not comprising the genomic disruption.
[0009] Further, in some embodiments, a genetically engineered NK cell population for cancer immunotherapy comprises a plurality of NK cells expanded in culture, the plurality of NK cells genetically engineered to express a CAR comprising a tumor-binding domain, a transmembrane domain, and a cytotoxic signaling complex, the tumor-binding domain targets CD70, the NK cells are genetically edited to express a reduced level of CD70 compared to non-edited NK cells expanded in culture, the reduced CD70 expression is engineered via introduction of a genomic disruption in the endogenous CD70 gene, the NK cells express a reduced level of CD70 compared to non-edited NK cells ... In one embodiment, the NK cells are genetically edited to express reduced levels of a cytokine-inducible SH2-containing (CIS) protein, wherein the reduced CIS expression is engineered via the introduction of a genomic disruption in the CIS gene, and the genetically engineered NK cells exhibit one or more of increased expansion capacity, increased cytotoxicity against target cells, and increased persistence compared to NK cells expressing native levels of CIS, and the NK cells have been genetically edited to introduce genomic disruptions in two or more additional genes to reduce expression of proteins encoded by the two or more additional genes compared to NK cells that have not been edited in said genes.
[0010] Also provided is an engineered NK cell population for cancer immunotherapy, comprising a plurality of NK cells engineered to express a CAR comprising a tumor-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the tumor-binding domain targets CD70 and comprises an scFv comprising an amino acid sequence having at least about 85%, 90%, 95%, 97% (or more) sequence identity to one or more of SEQ ID NOs: 47-49 or 51-54, and wherein the plurality of NK cells comprises a genomic disruption within a gene target sequence comprising at least three of SEQ ID NOs: 177-195, and optionally, the genomic disruption comprises an endonuclease-mediated indel.
[0011] In some embodiments, a method of treating cancer in a subject includes administering to the subject a population of engineered immune cells comprising a plurality of NK cells expanded in culture and engineered to express a CAR comprising a tumor-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the tumor-binding domain comprises an scFv that targets CD70 and comprises an amino acid sequence having at least about 85%, 90%, 95%, 97% (or more) sequence identity to one or more of SEQ ID NOs: 47-49 or 51-54, and the NK cells comprise any one of SEQ ID NOs: 177-180. and optionally, said genomic disruption comprises an endonuclease-mediated indel; and the NK cell comprises a genomic disruption within a cytokine-inducible SH2-containing protein gene target sequence comprising any one of SEQ ID NOs: 186-191, and the NK cell comprises at least one additional genomic disruption within the gene target sequence, wherein the engineered NK cell comprising said genomic disruption exhibits one or more of increased expansion capability, increased cytotoxicity against target cells, and increased persistence compared to an NK cell that does not comprise said genomic disruption.
[0012] In some embodiments, the tumor-binding domain comprises a heavy chain variable region and a light chain variable region, the heavy chain variable region comprises CDR-H1, CDR-H2, and CDR-H3, the light chain variable region comprises CDR-L1, CDR-L2, and CDR-L3, and CDR-H1 comprises a sequence having at least about 85%, 90%, 95%, 97% (or more) sequence identity to one or more sequences selected from SEQ ID NOs: 205, 102, 103, and 110, CDR-H2 comprises a sequence having at least about 85%, 90%, 95%, 97% (or more) sequence identity to one or more sequences selected from SEQ ID NOs: 206, 104, 105, 106, and 111, and CDR-H3 comprises a sequence selected from SEQ ID NOs: 207, 107, 108, 109, and 112. CDR-L1 comprises a sequence having at least about 85%, 90%, 95%, 97% (or more) sequence identity with one or more sequences selected from SEQ ID NOs: 209, 131, 132, 133, and 140; CDR-L2 comprises a sequence having at least about 85%, 90%, 95%, 97% (or more) sequence identity with one or more sequences selected from SEQ ID NOs: 210, 134, 135, 136, and 141; and CDR-L3 comprises a sequence having at least about 85%, 90%, 95%, 97% (or more) sequence identity with one or more sequences selected from SEQ ID NOs: 211, 137, 138, 139, and 142.
[0013] In some embodiments, the tumor-binding domain comprises a VH, wherein the VH comprises an amino acid sequence having at least about 85%, 90%, 95%, 97% (or more) sequence identity to one or more of the amino acid sequences of SEQ ID NOs: 153, 151, 152, and 157. In some embodiments, the tumor-binding domain comprises a VH, wherein the VH is encoded by a polynucleotide comprising a sequence having at least about 85%, 90%, 95%, 97% (or more) sequence identity to one or more of the polynucleotides of SEQ ID NOs: 145, 143, 144, 146, and 149. In some embodiments, the tumor-binding domain comprises a VL, wherein the VL comprises an amino acid sequence having at least about 85%, 90%, 95%, 97% (or more) sequence identity to one or more of the amino acid sequences of SEQ ID NOs: 156, 154, 155, and 158. In some embodiments, the tumor-binding domain comprises a VL, and the VL is encoded by a polynucleotide comprising a sequence having at least about 85%, 90%, 95%, 97% (or more) sequence identity to one or more of the polynucleotides of SEQ ID NOs: 148, 146, 147, and 150.
[0014] In some embodiments, the tumor-binding domain comprises a VL and a VH, wherein the VL comprises an amino acid sequence having at least about 85%, 90%, 95%, 97% (or more) sequence identity to the amino acid sequence of SEQ ID NO: 156, and the VH comprises an amino acid sequence having at least about 85%, 90%, 95%, 97% (or more) sequence identity to the amino acid sequence of SEQ ID NO: 153. In some embodiments, the tumor-binding domain comprises a VL and a VH, wherein the VL comprises an amino acid sequence having at least about 85%, 90%, 95%, 97% (or more) sequence identity to the amino acid sequence of SEQ ID NO: 155, and the VH comprises an amino acid sequence having at least about 85%, 90%, 95%, 97% (or more) sequence identity to the amino acid sequence of SEQ ID NO: 152. In some embodiments, the tumor-binding domain comprises a VL and a VH, wherein the VL comprises an amino acid sequence having at least about 85%, 90%, 95%, 97% (or more) sequence identity to the amino acid sequence of SEQ ID NO: 157, and the VH comprises an amino acid sequence having at least about 85%, 90%, 95%, 97% (or more) sequence identity to the amino acid sequence of SEQ ID NO: 158.
[0015] In some embodiments, the tumor-binding domain comprises an scFv, the scFv comprising an amino acid sequence having at least about 85%, 90%, 95%, 97% (or more) sequence identity to one or more of SEQ ID NOs: 52, 47-49, 51, and 53-54. In some embodiments, the tumor-binding domain comprises an scFv, the scFv comprising a VH and a VL linked by a linker comprising the sequence of SEQ ID NO: 50. In some embodiments, the tumor-binding domain comprises an scFv comprising the amino acid sequence of any one of SEQ ID NOs: 52, 51, and 53. In some embodiments, the tumor-binding domain comprises a single chain variable fragment (scFv), the scFv encoded by a polynucleotide comprising a sequence having at least 95% sequence identity to one or more of the polynucleotides of SEQ ID NOs: 35, 30-32, 34, 36, and 37.
[0016] Also provided is a genetically engineered natural killer (NK) cell population comprising a plurality of NK cells engineered to express a chimeric antigen receptor (CAR) comprising a tumor binding domain, a transmembrane domain, and a cytotoxic signaling complex, where the tumor binding domain targets CD70, the NK cell comprises a genomic disruption in a CD70 protein gene target comprising SEQ ID NO: 180, the NK cell also comprises a genomic disruption in a cytokine-inducible SH2-containing protein gene target sequence comprising SEQ ID NO: 191, and the NK cell also comprises a genomic disruption in a CBLB protein gene target sequence comprising SEQ ID NO: 195.
[0017] In some embodiments, the tumor-binding domain comprises an scFv, the scFv comprising a heavy chain variable region (VH) comprising CDR-H1, CDR-H2, and CDR-H3 comprising the sequences of SEQ ID NOs: 205, 206, respectively, a light chain variable region (VL) comprising CDR-L1, CDR-L2, and CDR-L3 comprising the sequences of SEQ ID NOs: 209, 210, and 211, respectively, and a linker between the VH and VL comprising the sequence of SEQ ID NO: 50.
[0018] In some embodiments, the tumor-binding domain comprises an scFv comprising the amino acid sequence of any one of SEQ ID NOs: 52, 51, and 53. In some embodiments, the tumor-binding domain comprises a single chain variable fragment (scFv), wherein the scFv is encoded by a polynucleotide comprising a sequence having at least 95% sequence identity to one or more of the polynucleotides of SEQ ID NOs: 35, 30-32, 34, 36, and 37.
[0019] In some embodiments, the tumor-binding domain comprises a heavy chain variable region (VH), wherein the VH is encoded by a polynucleotide comprising a sequence having at least about 85%, 90%, 95%, 97% (or more) sequence identity to one or more of the polynucleotides of SEQ ID NOs: 143-146 and 149. In some embodiments, the tumor-binding domain comprises a light chain variable region (VL), wherein the VL is encoded by a polynucleotide comprising a sequence having at least about 85%, 90%, 95%, 97% (or more) sequence identity to one or more of the polynucleotides of SEQ ID NOs: 146-148 and 150.
[0020] In some embodiments, the tumor-binding domain comprises a single chain variable fragment (scFv), wherein the scFv is encoded by a polynucleotide comprising a sequence having at least about 85%, 90%, 95%, 97% (or more) sequence identity to one or more of the polynucleotides of SEQ ID NOs: 30-32 and 34-37.
[0021] In some embodiments, the cytotoxic signaling complex comprises an OX40 subdomain and a CD3 zeta subdomain. In some embodiments, the OX40 subdomain comprises the amino acid sequence of SEQ ID NO:6. In some embodiments, the OX40 subdomain is encoded by a sequence having at least about 85%, 90%, 95%, 97% (or more) sequence identity to SEQ ID NO:5. In some embodiments, the CD3 zeta subdomain comprises the amino acid sequence of SEQ ID NO:8. In some embodiments, the CD3 zeta subdomain is encoded by a sequence having at least about 85%, 90%, 95%, 97% (or more) sequence identity to SEQ ID NO:7.
[0022] In some embodiments, the NK cells are engineered to express membrane-bound IL-15 (mbIL15). In some embodiments, mbIL15 is bicistronic encoded on a polynucleotide encoding a CAR. In some embodiments, mbIL15 comprises the amino acid sequence of SEQ ID NO: 213. In some embodiments, mbIL15 is encoded by a sequence having at least about 85%, 90%, 95%, 97% (or more) sequence identity to SEQ ID NO: 27. In some embodiments, the polynucleotides encoding the CAR and mbIL15 comprise a sequence having at least about 85%, 90%, 95%, 97% (or more) sequence identity to one or more of the polynucleotides of SEQ ID NOs: 38-46.
[0023] In some embodiments, the CAR comprises an amino acid sequence having at least about 85%, 90%, 95%, 97% (or more) sequence identity to one or more of the amino acid sequences of SEQ ID NOs: 214-222.
[0024] In some embodiments, the engineered NK cells are edited at CD70, CISH, and CBLB. In some embodiments, the engineered NK cells comprise a genomic disruption in a CD70 protein gene target sequence comprising SEQ ID NO: 180, a genomic disruption in a CIS protein gene target sequence comprising SEQ ID NO: 191, and a genomic disruption in a CBLB protein gene target sequence comprising SEQ ID NO: 195.
[0025] In some embodiments, the engineered NK cells are edited with CD70, CISH, CBLB, and additional target genes. In some embodiments, expression of CD70 is substantially reduced compared to NK cells not edited for CD70, expression of CIS is substantially reduced compared to NK cells not edited for CISH, and expression of CBLB is substantially reduced compared to NK cells not edited for CBLB. In some embodiments, the NK cells do not express detectable levels of CD70, CIS, or CBLB proteins.
[0026] In some embodiments, the gene editing that introduces genome disruption is carried out using CRISPR-Cas system.In some embodiments, the CRISPR-Cas system comprises Cas selected from Cas9, Csn2, Cas4, Cpf1, C2c1, C2c3, Cas13a, Cas13b, Cas13c, CasX, CasY, and combinations thereof.In some embodiments, Cas is Cas9.
[0027] In some embodiments, the CD70 targeted by the tumor-binding domain is expressed by a solid tumor.
[0028] Also provided herein is a genetically engineered natural killer (NK) cell population for cancer immunotherapy, comprising a plurality of NK cells expanded in culture, wherein the NK cells are engineered to express a chimeric antigen receptor (CAR) comprising a tumor-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the tumor-binding domain targets CD70, wherein the NK cells comprise a genomic disruption within a CD70 protein gene target sequence comprising any one of SEQ ID NOs: 180 or 177-180, wherein the genomic disruption comprises an endonuclease-mediated indel, wherein the NK cells also comprise a genomic disruption within a cytokine-inducible SH2-containing protein gene target sequence comprising any one of SEQ ID NOs: 186-191, wherein the NK cells comprise at least one additional genomic disruption within the gene target sequence, wherein the genetically engineered NK cells comprising the genomic disruption exhibit one or more of an increased expansion capability, increased cytotoxicity against target cells, and increased persistence compared to NK cells not comprising the genomic disruption.
[0029] Also provided herein is a genetically engineered natural killer (NK) cell population for cancer immunotherapy, comprising a plurality of NK cells expanded in culture, wherein the NK cells are genetically engineered to express a chimeric antigen receptor (CAR) comprising a tumor-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the tumor-binding domain targets CD70, and the NK cells are genetically edited to express reduced levels of CD70 compared to non-edited NK cells expanded in culture, wherein the reduced CD70 expression is engineered via introduction of a genomic disruption in the endogenous CD70 gene, and the NK cells also express reduced levels of CD70 encoded by the CISH gene compared to non-edited NK cells. Provided is a genetically engineered NK cell population that has been genetically edited to express reduced levels of a cytokine-inducible SH2-containing (CIS) protein, wherein the reduced CIS expression has been engineered via the introduction of a genomic disruption in the CIS gene, and wherein the genetically engineered NK cells comprising said genomic disruption exhibit one or more of increased expansion capacity, increased cytotoxicity against target cells, and increased persistence compared to NK cells expressing native levels of CIS, and wherein the NK cells have been genetically edited to introduce genomic disruptions in two or more additional genes to reduce expression of proteins encoded by said two or more additional genes compared to NK cells that have not been edited in said genes.
[0030] In some embodiments, the cells and methods provided herein are used to treat renal cell carcinoma or metastasis from renal cell carcinoma. Further provided herein is the use of engineered NK cells according to embodiments disclosed herein in the treatment of cancer. In some embodiments, the cancer is a CD70-expressing cancer. In some embodiments, the cancer comprises a solid tumor. Also provided herein is a method of treating cancer in a subject by administering an immune cell described herein. In some embodiments, the administration treats, inhibits, or prevents progression of the cancer. Further provided is the use of engineered NK cells according to embodiments disclosed herein in the manufacture of a medicament for treating cancer.
[0031] Provided herein is an anti-CD70 CAR, the CAR comprising an anti-CD70 binding domain, an OX40 domain, and a CD3 zeta domain, the anti-CD70 CAR comprising an amino acid sequence having at least 95% sequence identity to one or more of the amino acid sequences of SEQ ID NOs: 218, 214-217, or 219-222, or a portion thereof that is capable of generating a cytotoxic signal upon binding to CD70 on a target cell.
[0032] An anti-CD70 chimeric antigen receptor (CAR), the CAR comprising an anti-CD70 binding domain, an OX40 domain, and a CD3 zeta domain, the anti-CD70 CAR comprising an amino acid sequence having at least about 85%, 90%, 95%, 97% (or more) sequence identity to one or more of the amino acid sequences of SEQ ID NOs: 64-72, or a portion thereof capable of generating a cytotoxic signal upon binding to CD70 on a target cell. In some embodiments, the anti-CD70 binding domain comprises an scFv having at least about 85%, 90%, 95%, 97% (or more) sequence identity to any sequence selected from SEQ ID NOs: 52, 47-49, 51, and 53-54.
[0033] Also provided herein is a cell comprising such an anti-CD70 CAR. In some embodiments, the cell is an immune cell. In some embodiments, the cell is a NK cell. In some embodiments, the cell comprises at least three genomic disruptions within at least three gene target sequences selected from SEQ ID NOs: 159-201. In some embodiments, the cell comprises genomic disruptions within gene target sequences encoding the proteins of SEQ ID NOs: 180, 191, and 195. Also provided herein is a method of treating cancer in a subject by administering such a CAR or such a cell. Also provided is the use of such a cell or such a CAR for treating cancer or for manufacturing a medicament for treating cancer.
[0034] Further additional embodiments provide a method of generating a genetically engineered immune cell population, comprising introducing an endonuclease and at least one unique gRNA into an immune cell to induce a genomic disruption in at least one gene target sequence, introducing an endonuclease and at least one additional unique gRNA into an immune cell to induce an additional genomic disruption in an additional gene target sequence, and transducing the immune cell with a viral vector encoding a CAR targeting CD70. In some embodiments, the endonuclease and gRNA are introduced by electroporating the cell. In some embodiments, the cell comprises a NK cell. In some embodiments, no more than three unique gRNAs are introduced at one time. In some embodiments, no more than two unique gRNAs are introduced at one time. In some embodiments, the cells are expanded in culture for a period of time prior to the initial introduction.
[0035] Also provided is a method of generating a genetically engineered immune cell population, comprising expanding the immune cells in culture, introducing an endonuclease and no more than two unique gRNAs into the immune cells to induce genomic disruptions in two different gene target sequences, culturing the cells for an additional period of time, introducing an additional endonuclease and no more than two additional unique gRNAs into the immune cells to induce additional genomic disruptions in no more than two additional gene target sequences, and transducing the immune cells with a viral vector encoding a CAR targeting CD70. In some embodiments, the endonuclease and gRNA are introduced by electroporating the cells. In some embodiments, the cells comprise NK cells. In some embodiments, only one additional gRNA is used in the second introduction. In some embodiments, the gRNA targets CD70, CISH, or CBLB genes.
[0036] In some embodiments, a pharmaceutical composition is provided comprising an engineered NK cell population comprising a genomic disruption within a gene target sequence comprising at least three of SEQ ID NOs: 159-203, wherein said genomic disruption optionally comprises an endonuclease-mediated indel.
[0037] In some embodiments, a pharmaceutical composition is provided comprising an engineered natural killer cell population comprising a genomic disruption within a gene target sequence comprising at least three of SEQ ID NOs: 177-195, wherein the genomic disruption optionally comprises an endonuclease-mediated indel.
[0038] In some embodiments, a pharmaceutical composition is provided that includes an engineered natural killer cell population that includes a genomic disruption within a gene target sequence that includes at least two of SEQ ID NOs: 177-195, the genomic disruption optionally including an endonuclease-mediated indel, and the engineered NK cells express a CAR that targets CD70 that includes an scFv that includes an amino acid sequence having at least about 85%, 90%, 95%, 97% (or more) sequence identity to one or more of SEQ ID NOs: 52, 47-49, 51, and 53-54. In some embodiments, the engineered natural killer cells include a genomic disruption within a target gene sequence of SEQ ID NOs: 180, 191, and 195. In some embodiments of the pharmaceutical compositions provided, the genomic disruption includes an endonuclease-mediated indel.
[0039] Some embodiments relate to methods comprising administering the immune cells described herein to a subject in need thereof. In some embodiments, the subject has cancer. In some embodiments, the administration treats, inhibits, or prevents the progression of the cancer.
[0040] Some embodiments provide for the use of gene-edited cells, anti-CD70 scFvs, anti-CD70 CARs, and / or polynucleotides or amino acid sequences disclosed herein in the treatment or prevention of cancer. [Brief description of the drawings]
[0041] [Figure 1] FIG. 1 is a non-limiting schematic diagram of a tumor-tropic chimeric antigen receptor. [Diagram 2] FIG. 2 shows summary data of various properties of non-limiting embodiments of CD70-targeting CARs according to the present disclosure. [Diagram 3] FIG. 3 shows representative data regarding the persistence of CAR expression by gene-edited NK cells. [Figure 4] FIG. 4 shows representative data regarding the percentage of gene-edited NK cells present in culture over time. [Diagram 5] FIG. 5 shows representative data regarding the expansion capacity of gene-edited NK cells. [Figure 6] FIG. 6 is a schematic diagram of a non-limiting embodiment of a process flow for the generation and analysis of gene edited NK cells. [Figure 7] 7A-7B show representative flow cytometry data for gene editing to knock out CD70 expression in NK cells from two donors. [Figure 8] Figures 8A-8H show representative flow cytometry data regarding the maintenance of reduced CD70 expression by NK cells 10 days after transduction with non-limiting embodiments of the CD70 CAR. [Figure 9] Figures 9A-9H show representative flow cytometry data regarding the maintenance of reduced CD70 expression by NK cells 14 days after transduction with non-limiting embodiments of the CD70 CAR. [Figure 10] Figures 10A-10B show representative Tracking of Indels by Decomposition (TIDE) indel analysis data on the efficacy of gene editing to knock down CD70 expression following transduction with non-limiting embodiments of a CD70 CAR, where 10A shows data from a first donor and 10B shows data from a second donor. Figure 10C shows data from two different donors on the persistence of CD70 / CISH KO NK cells expressing non-limiting embodiments of a CD70 CAR in the absence of interleukin-2 (IL2). [Figure 11] Figures 11A-11D show representative in vitro cytotoxicity data (Bright-Glo™ assay) against low CD70-expressing Panc05 tumor cells using the indicated non-limiting anti-CD70 CARs expressed by NK cells from the first and second donors and tested on days 14 (11A and 11C, respectively) and 17 (11B and 11D, respectively) post-electroporation (EP). [Figure 12]Figures 12A-12B show representative in vitro cytotoxicity data (IncuCyte® assay) against low CD70-expressing Panc05 tumor cells using the indicated non-limiting anti-CD70 CARs expressed by NK cells from a first donor (12A) and a second donor (12B). [Figure 13] Figures 13A-13B show representative in vitro cytotoxicity data (IncuCyte® assay) against moderately CD70-expressing ACHN tumor cells using the indicated non-limiting anti-CD70 CARs expressed by NK cells from a first donor (13A) and a second donor (13B) using two tumor cell re-challenges. [Figure 14] Figures 14A-14C show representative in vitro cytotoxicity data (IncuCyte® assay) against high CD70 expressing 786-O tumor cells using the indicated non-limiting anti-CD70 CARs expressed by NK cells from a first donor (14A) and a second donor (14C) using one tumor cell re-challenge. Figure 14B shows cytotoxicity data collected at the time points indicated by the vertical lines in Figure 14A. [Figure 15] Figures 15A-15D show representative expression data (measured as both the percentage of CAR positive cells and mean fluorescence intensity (e.g., expression density)) at days 0 and 14 post-electroporation (EP) for a first donor (15A-15B) and a second donor (15C-15D). [Figure 16] Figures 16A-16E show representative in vivo data demonstrating that non-limiting embodiments of CD70-directed CARs provided herein exhibit anti-tumor activity in a 786-O renal carcinoma xenograft animal model. [Figure 17] Figures 17A-17B show representative in vivo data demonstrating that non-limiting embodiments of CD70-directed CARs provided herein exhibit anti-tumor activity in a 786-O renal carcinoma xenograft animal model (17A) and that CAR-positive cells persist in the bloodstream for several weeks. [Figure 18] Figures 18A-18B are schematic diagrams of various non-limiting embodiments of gene editing protocols. Figure 18A shows the approach on day 0, where gene editing occurs on quiescent cells. Figure 18B shows the approach on day 6, where gene editing occurs on activated cells. [Figure 19] Figures 19A-19B show the reduction in protein expression after gene editing using the approach of Figure 18A on day 0. Figure 19A shows the reduction in CBLB protein. Figure 19B shows the reduction in CIS protein. [Figure 20] Figures 20A-20C show data regarding enrichment of CD70 CAR-positive gene-edited cells in culture over time. Figure 20A shows the percentage of CD70 CAR-positive gene-edited NK cells at day 11 after editing. Figure 20B shows the percentage of CD70 CAR-positive gene-edited NK cells at day 21 after editing. Figure 20C shows the percentage of CD70 CAR-positive gene-edited NK cells at day 28 after editing. [Figure 21] Figures 21A-21C show data on the expansion of gene-edited cells. Figure 21A shows the fold expansion of edited cells before transduction with CD70 CAR. Figure 21B shows the fold expansion of gene-edited cells after transduction with CD70 CAR. Figure 21C shows the fold expansion of gene-edited NK cells expressing CD70 CAR 14 days after editing. Figures 21D-21E show representative in vitro cytotoxicity data (IncuCyte® assay) against moderate CD70 expressing ACHN cells (21D) and high expressing 786-O cells (21E) using the indicated non-limiting anti-CD70 CARs expressed by donor-derived NK cells. Figures 21F-21G show representative in vitro cytotoxicity data (IncuCyte® assay) against moderate CD70 expressing ACHN cells (21F) and high expressing 786-O cells (21G) using the indicated non-limiting anti-CD70 CARs expressed by donor-derived NK cells with one tumor cell re-challenge. [Figure 22]Figures 22A-22F show cytotoxicity data. Figures 22A-22B show cytotoxicity data 14 days after electroporation (EP) with multiple challenges of ACHN tumor cells. Figure 22A shows data in the absence of TGF beta. Figure 22B shows data in the presence of TGF beta. Figures 22C-22D show cytotoxicity data 21 days after electroporation (EP) with multiple challenges of ACHN tumor cells. Figure 22C shows data in the absence of TGF beta. Figure 22D shows data in the presence of TGF beta. Figures 22E-22F show cytotoxicity data 28 days after electroporation (EP) with multiple challenges of ACHN tumor cells. Figure 22E shows data in the absence of TGF beta. Figure 22F shows data in the presence of TGF beta. [Diagram 23] Figures 23A-23B show the reduction in protein expression after gene editing using the approach of Figure 18B on day 6. Figure 23A shows the reduction in CBLB protein. Figure 23B shows the reduction in CIS protein. [Figure 24] Figures 24A-24B show data regarding enrichment of CD70 CAR-positive gene-edited cells in culture over time. Figure 24A shows the percentage of CD70 CAR-positive gene-edited NK cells at day 10 after expansion. Figure 24B shows the percentage of CD70 CAR-positive gene-edited NK cells at day 15 after expansion. [Diagram 25] 25A-25B show cytotoxicity data on day 14 of expansion with multiple challenges of ACHN tumor cells. Figure 25A shows data in the absence of TGF-beta. Figure 25B shows data in the presence of TGF-beta. [Figure 26] Figures 26A-26B show long-term in vivo cytotoxicity data. Figure 26A shows data indicating that multiply gene-edited NK cells control tumor growth more effectively than controls over 45 days (in the 786-O model). Figure 26B shows similar data using the A-498 xenograft model. [Figure 27]Figure 27 shows a schematic of evaluation of off-target gene editing. [Figure 28] FIG. 28 shows a schematic workflow of a non-limiting embodiment of off-target gene editing. [Figure 29] Figure 29A shows data on the predicted number of off-target sites for the indicated guide RNAs (gRNAs) and the median next generation sequencing (NGS) read coverage across the sites. Figure 29B shows additional data on the predicted number of off-target sites for the indicated guide RNAs and the median NGS read coverage across the sites, including all data shown in Figure 29A. [Diagram 30] Figure 30A shows data on calculated on-target editing (by TIDE and hybrid capture analysis) based on the gRNAs and donors shown in Figure 29A, and data showing no off-target editing. Figure 30B shows data on calculated on-target editing (by TIDE and hybrid capture analysis) based on the gRNAs and donors shown in Figure 29B, and data showing no off-target editing. [Diagram 31] FIG. 31 shows a non-limiting schematic of a workflow for assessing chromosomal translocations after editing. [Diagram 32] Figure 32 shows data on indel frequencies after single and dual editing with CISH-15 gRNA from two donors. [Diagram 33] Figure 33A shows data on indel frequency after single editing with CISH-10 or CISH-15 gRNAs in two donors. Figure 33B shows additional data compared to Figure 33A on indel frequency after single editing with the indicated gRNAs in four donors. [Diagram 34] Figure 34 shows data on CD70 indel frequencies after single, double, or triple editing with CISH-10 or CISH-15 gRNAs from two donors. [Diagram 35]Figures 35A-35G show data on CD70 expression in untransduced NK cells from the first donor at day 13 after the indicated gene editing. Figure 35A shows an isotype control. Figure 35B shows an electroporation (EP) control. Figure 35C shows CD70 gene editing. Figure 35D shows CD70 and CISH editing (using CISH-15 gRNA). Figure 35E shows CD70 and CBLB editing. Figure 35F shows CD70, CBLB, and CISH editing (using CISH-15 gRNA). Figure 35G shows CD70 and CISH editing (using CISH-10 gRNA). [Diagram 36] Figures 36A-36G show data on CD70 expression in non-transduced NK cells from a second donor at day 13 after the indicated gene edits. Figure 36A shows an isotype control. Figure 36B shows an EP control. Figure 36C shows CD70 gene edits. Figure 36D shows CD70 and CISH edits (using CISH-15 gRNA). Figure 36E shows CD70 and CBLB edits. Figure 36F shows CD70, CBLB, and CISH edits (using CISH-15 gRNA). Figure 36G shows CD70 and CISH edits (using CISH-10 gRNA). [Figure 37] Figures 37A-37B show data relating to CBLB and, optionally, CISH (using CISH-15 gRNA) editing. Figure 37A shows data on indel frequency after single or double editing in a first donor. Figure 37B shows data on indel frequency after single or double editing in a second donor. [Figure 38] FIG. 38 provides information regarding non-limiting experimental designs for assessing chromosomal translocations. [Figure 39] Figure 39 shows data regarding indel frequency for certain non-limiting multiple gene edits. [Diagram 40]Figures 40A-40B show non-limiting embodiments of gene editing approaches: Figure 40A shows a single electroporation (EP) approach; Figure 40B shows a dual EP approach. [Diagram 41] Figures 41A-41C show non-limiting embodiments of gene editing approaches using two electroporations (EPs). Figure 41A shows a first configuration of editing. Figure 41B shows a second configuration of editing. Figure 41C shows a third configuration of editing. [Diagram 42] FIG. 42 shows data on chromosomal translocation rates with a single electroporation (EP) approach (three simultaneous edits). [Diagram 43] Figure 43 shows data on chromosomal translocation rates with the first electroporation (EP) performed to achieve dual editing of CD70 and CISH using the indicated CISH gRNAs. [Diagram 44] FIG. 44 shows the first electroporation (EP) performed to achieve dual editing in CD70 and CBLB, and data on chromosomal translocation rates with any configuration of the EP1 / EP2 approach. [Diagram 45] Figure 45A shows data on CBLB, CISH, and CD70 knockout efficiency in CBLB / CISH / CD70 KO NK cells expressing the indicated non-limiting anti-CD70 CARs compared to CBLB / CISH / CD70 KO NK cells not expressing CARs (triple KO) or mock electroporated NK cells not expressing CARs (EP only). Figure 45B shows data on persistence of CBLB / CISH / CD70 KO NK cells expressing the indicated non-limiting anti-CD70 CARs in the absence of interleukin-2 (IL2). Figure 45C shows data on expression of molecules associated with activation in CBLB / CISH / CD70 KO NK cells expressing the indicated non-limiting anti-CD70 CARs cultured with target cells at an E:T ratio of 1:2 or 1:4. [Figure 46]Figure 46A shows the change in tumor volume (TV) from baseline (top panel) and tumor volume (TV) (bottom panel) in 786-O mouse tumor models treated with CISH / CBLB / CD70 NK cells expressing the indicated non-limiting anti-CD70 CARs, CISH / CBLB / CD70 KO NK cells not expressing a CAR (triple KO), or vehicle. Figure 46B shows the persistence of NK cells expressing the indicated non-limiting anti-CD70 CARs in the same mice shown in Figure 46A. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0042] Some embodiments of the methods and compositions provided herein relate to engineered immune cells and combinations thereof for use in immunotherapy. In some embodiments, the engineered cells are engineered in multiple ways, for example, to express a cytotoxicity-inducing receptor complex. As used herein, the term "cytotoxicity receptor complex" shall be given its ordinary meaning and (unless otherwise specified) shall also refer to a chimeric antigen receptor (CAR). In some embodiments, the cells are further engineered to achieve modification of the responsiveness of the cells to non-tumor tissues and / or other therapeutic cells. In some embodiments, natural killer (NK) cells are also engineered to express a cytotoxicity-inducing receptor complex (e.g., a chimeric antigen receptor or a chimeric receptor), for example, to target tumor cells expressing CD70. In some embodiments, the NK cells are genetically edited to reduce and / or eliminate certain markers / proteins that would otherwise inhibit or limit the therapeutic effect of NK cells expressing a CAR. In some embodiments, the certain markers / proteins have expression that is upregulated or otherwise induced by one or more processes performed to engineer and / or expand the NK cells. For example, in some embodiments, the process of expanding NK cells in culture substantially increases CD70 expression by the NK cells. In embodiments where a CD70 CAR is engineered to be expressed by the expanded NK cells, the CAR actually targets not only the tumor expressing CD70, but also the otherwise engineered and expanded NK cells as well. Thus, for example, in some embodiments, therapeutic NK cells are engineered to express a CAR that targets CD70, and are also genetically edited to knock out CD70 expression on the NK cells themselves, which, if present, causes targeting of the tumor, and even the therapeutic NK cells, by the CAR-expressing NK cells. This creates a self-limiting therapeutic effect that would otherwise allow tumor expansion and cancer progression.
[0043] CRISPR-Cas, a genome editing technology based on RNA-guided endonucleases, is widely used for precise gene editing. Using short guide RNAs (gRNAs), endonucleases (one example is Cas9, but there are many others) can be guided to target sites for precise gene editing. The gRNA determines the efficacy and specificity of gene editing by the endonuclease. The gRNA is custom designed to target a specific locus in the genome and recruit the endonuclease to the site. The recruited endonuclease induces a specific double-stranded break within the double-stranded DNA that triggers DNA repair pathways. For example, the non-homologous end joining pathway can be utilized to introduce frameshift mutation(s) and knock out a gene. The homology-directed repair pathway can be utilized for gene replacement or gene knock-in using supplied template DNA. CRISPR / Cas genome editing has been extensively studied in many systems, including bacteria, plants, and mammals, and is widely considered to have therapeutic potential. However, one of the major challenges associated with gRNAs is the possibility of off-target effects. For example, if there is a mismatch between the gRNA and the target sequence of more than three bases, the gRNA may target (and thus recruit endonucleases to) sites in the genome that are not intended as targets. Off-target effects include small insertions or deletions at genomic sites with homology to the gRNA, and more rarely, large-scale events such as chromosomal translocations, inversions, and deletions. Such off-target effects pose potential safety issues, especially in therapies (e.g., cell therapies) intended for human treatment. Thus, the identification of a gRNA suitable for a given desired edit to a genome is important to minimize off-target effects while maintaining high on-target editing efficiency. According to the embodiments provided herein, and to overcome these challenges, the gRNAs provided herein have been demonstrated to exhibit high on-target editing efficiency and low off-target effects.
[0044] The term "anti-cancer effect" refers to a biological effect that may be manifested by various means, including, but not limited to, reduction in tumor volume, reduction in cancer cell number, reduction in the number of metastases, increase in average life span, reduction in cancer cell proliferation, reduction in cancer cell survival, and / or amelioration of various physiological symptoms associated with a cancerous condition.
[0045] cell type Some embodiments of the methods and compositions provided herein refer to cells, such as immune cells. For example, immune cells, such as NK cells or T cells, can be engineered to contain a chimeric receptor, such as a CD70-directed chimeric receptor, or can be engineered to contain a nucleic acid encoding said chimeric receptor, as described herein. Yet additional embodiments relate to further genetic engineering of cells (e.g., donor NK cells) to reduce, disrupt, minimize, and / or eliminate the expression of one or more markers / proteins by the NK cells, resulting in increased potency and / or persistence of the engineered NK cells.
[0046] Traditional anti-cancer therapies have relied on surgical approaches, radiation therapy, chemotherapy, or a combination of these methods. As research has led to a better understanding of some of the mechanisms of certain cancers, this knowledge has been used to develop targeted cancer therapies. Targeted therapy is a cancer treatment that uses specific drugs to target specific genes or proteins found in cancer cells or cells that support cancer growth (such as blood vessel cells) to suppress or block the growth of cancer cells. More recently, genetic engineering has made it possible to develop approaches that harness specific aspects of the immune system to fight cancer. In some cases, a patient's own immune cells are modified to specifically eradicate that patient's type of cancer. As described in more detail below, various types of immune cells can be used, such as T cells, natural killer (NK cells), or a combination thereof.
[0047] To facilitate cancer immunotherapy, polynucleotides, polypeptides, and vectors are provided herein that encode chimeric antigen receptors (CARs) that include a target binding portion (e.g., an extracellular binding portion of a ligand, or a tumor marker-directed chimeric receptor expressed by cancer cells) and a cytotoxic signaling complex. For example, some embodiments include polynucleotides, polypeptides, or vectors that encode chimeric antigen receptors that are directed against, for example, tumor markers, e.g., CD70, to facilitate the targeting of immune cells to cancer and exert a cytotoxic effect in cancer cells. Also provided are engineered immune cells (e.g., NK cells and / or T cells) that express such CARs. Methods of treating cancer and other uses of such cells for cancer immunotherapy are also provided herein.
[0048] Engineered Cells for Immunotherapy In some embodiments, cells of the immune system are engineered to have an increased cytotoxic effect on target cells, such as tumor cells. For example, cells of the immune system can be engineered to include tumor-directed chimeric receptors and / or tumor-directed CARs, as described herein. In some embodiments, white blood cells or leukocytes are used, as their natural function is to defend the body against abnormal cell proliferation and infections. There are various types of white blood cells that play specific roles in the human immune system, and are therefore the preferred starting point for the engineering of the cells disclosed herein. White blood cells include granulocytes and agranulocytes (the presence or absence of granules in the cytoplasm, respectively). Granulocytes include basophils, eosinophils, neutrophils, and mast cells. Agranulocytes include lymphocytes and monocytes. Cells such as the following cells or other cells described herein can be engineered to include chimeric antigen receptors, e.g., CD70-directed CARs, or nucleic acids encoding CARs. In some embodiments, the cells may be engineered to co-express a membrane-bound interleukin 15 (mbIL15) domain. As discussed in more detail below, in some embodiments, the therapeutic cells are further genetically modified to increase cytotoxicity and / or cellular persistence. In some embodiments, the genetic modification increases the ability of the cells to resist signals emanating from the tumor microenvironment that cause a decrease in efficacy or shortened lifespan of the therapeutic cells.
[0049] Monocytes for immunotherapy Monocytes are a subtype of white blood cells. Monocytes can differentiate into macrophages and myeloid dendritic cells. Monocytes are associated with the adaptive immune system and are responsible for the major functions of phagocytosis, antigen presentation, and cytokine production. Phagocytosis is the process of ingesting cellular material, or whole cells, followed by digestion and destruction of the ingested cellular material. In some embodiments, monocytes are used in association with one or more additional engineered cells as disclosed herein. Some embodiments of the methods and compositions described herein relate to monocytes that include a tumor-directed CAR or a nucleic acid encoding a tumor-directed CAR. Some embodiments of the methods and compositions disclosed herein relate to monocytes that have been engineered to express a CAR that targets a tumor marker, e.g., CD70, and optionally includes a membrane-bound interleukin 15 (mbIL15) domain.
[0050] Lymphocytes for immunotherapy Lymphocytes are the other primary subtype of white blood cells and include T cells (cell-mediated, cytotoxic adaptive immunity), natural killer cells (cell-mediated, cytotoxic innate immunity), and B cells (humoral, antibody-driven adaptive immunity). B cells are engineered according to some embodiments disclosed herein, although some embodiments also relate to engineered T cells or engineered NK cells (mixtures of T cells and NK cells are used in some embodiments, either from the same donor or from different donors). Some embodiments of the methods and compositions disclosed herein relate to lymphocytes engineered to express a CAR that targets a tumor marker, e.g., CD70, and optionally includes a membrane-bound interleukin 15 (mbIL15) domain.
[0051] T Cells for Immunotherapy T cells can be distinguished from other lymphocyte subtypes (e.g., B cells or NK cells) based on the presence of T cell receptors on the cell surface. T cells are divided into various subtypes, including effector T cells, helper T cells, cytotoxic T cells, memory T cells, regulatory T cells, natural killer T cells, mucosal-associated invariant T cells, and gamma delta T cells. In some embodiments, T cells of a specific subtype are engineered. In some embodiments, a mixed pool of T cell subtypes is engineered. In some embodiments, there is no specific selection of T cell types that are engineered to express the cytotoxic receptor complexes disclosed herein. In some embodiments, specific techniques, such as the use of cytokine stimulation, are used to increase the expansion / collection of T cells with specific marker profiles. For example, in some embodiments, activation of specific human T cells, e.g., CD4+ T cells, CD8+ T cells, is achieved by the use of CD3 and / or CD28 as stimulatory molecules. In some embodiments, methods of treating or preventing cancer or infectious diseases are provided that include administering a therapeutically effective amount of T cells expressing a cytotoxic receptor complex and / or a homing moiety as described herein. In some embodiments, the engineered T cells are autologous cells, while in some embodiments, the T cells are allogeneic cells. Some embodiments of the methods and compositions disclosed herein relate to T cells that are engineered to express a CAR that targets a tumor marker, e.g., CD70, and optionally includes a membrane-bound interleukin 15 (mbIL15) domain.
[0052] NK Cells for Immunotherapy In some embodiments, methods of treating or preventing cancer or infectious diseases are provided that include administering a therapeutically effective amount of natural killer (NK) cells expressing a cytotoxic receptor complex and / or a homing moiety as described herein. In some embodiments, the engineered NK cells are autologous cells, while in some embodiments, the NK cells are allogeneic cells. In some embodiments, NK cells are preferred because of the relatively high natural cytotoxic potential of NK cells. In some embodiments, it is unexpectedly beneficial that the engineered cells disclosed herein can further upregulate the cytotoxic activity of NK cells, resulting in more effective activity against target cells (e.g., tumor or other disease cells). Some embodiments of the methods and compositions described herein relate to NK cells engineered to express a CAR that targets a tumor marker, e.g., CD70, and optionally includes a membrane-bound interleukin 15 (mbIL15) domain. In some embodiments, the NK cells are engineered to express a CAR that binds to CD70. In some embodiments, the NK cells are engineered to express a membrane-bound interleukin 15 (mbIL15) domain. In some embodiments, NK cells engineered to express a CAR are also engineered to express (e.g., bicistronic) a membrane-bound interleukin 15 (mbIL15) domain. Thus, in some embodiments, NK cells are engineered to bicistronic express a CAR and mbIL15.
[0053] In some embodiments, primary NK cells are used. In some embodiments, primary NK cells are isolated from peripheral blood mononuclear cells (PBMCs).
[0054] In some embodiments, immortalized NK cells are used and subjected to gene editing and / or engineering as disclosed herein. In some embodiments, the NK cells are derived from the cell line NK-92. NK-92 cells are derived from NK cells, but lack the major inhibitory receptors displayed by normal NK cells while retaining most of the activating receptors. Some embodiments of NK-92 cells described herein in connection with NK-92 cells engineered to silence certain additional inhibitory receptors, e.g., SMAD3, allowing for upregulation of interferon-gamma (IFNγ), granzyme B, and / or perforin production. Further information regarding NK-92 cell lines is disclosed in International Publication No. WO 1998 / 49268 and US Patent Application Publication No. 2002 / 0068044, which are incorporated herein by reference in their entireties. NK-92 cells are used in some embodiments in combination with one or more of the other cell types disclosed herein. For example, in one embodiment, NK-92 cells are used in combination with the NK cells disclosed herein. In an additional embodiment, NK-92 cells are used in combination with the T cells disclosed herein.
[0055] Hematopoietic stem cells for cancer immunotherapy In some embodiments, hematopoietic stem cells (HSCs) are used in the immunotherapy methods disclosed herein. In some embodiments, the cells are engineered to express a homing moiety and / or a cytotoxic receptor complex. HSCs are used in some embodiments to take advantage of their ability to engraft for long-term blood cell production, which can provide a sustained source of targeted anti-cancer effector cells, for example, to combat cancer remission. In some embodiments, this continued production helps to counteract anergy or exhaustion of other cell types, for example, by the tumor microenvironment. In some embodiments, allogeneic HSCs are used, while in some embodiments, autologous HSCs are used. In some embodiments, HSCs are used in combination with one or more additional engineered cell types disclosed herein. Some embodiments of the methods and compositions described herein relate to stem cells, such as hematopoietic stem cells, engineered to express a CAR that targets a tumor marker, for example, CD70, and optionally targets the membrane-bound interleukin 15 (mbIL15) domain.
[0056] induced pluripotent stem cells In some embodiments, immune cells are derived (differentiated) from pluripotent stem cells (PSCs). In some embodiments, immune cells (e.g., NK cells) derived from induced pluripotent stem cells (iPSCs) are used in the immunotherapy methods disclosed herein. iPSCs are used to exploit their ability to differentiate and induce non-pluripotent cells, including, but not limited to, CD34 cells, hemogenic endothelial cells, HSCs (hematopoietic stem and progenitor cells), hematopoietic pluripotent progenitors, T cell precursors, NK cell precursors, T cells, NKT cells, NK cells, and B cells, that contain one or several genetic modifications at selected sites, through differentiation of iPSCs or less differentiated cells that contain the same genetic modifications at selected sites. In some embodiments, iPSCs are used to generate iPSC-derived NK or T cells. In some embodiments, the cells are engineered to express homing moieties and / or cytotoxic receptor complexes. In some embodiments, iPSCs are used in combination with one or more additional engineered cell types disclosed herein. Some embodiments of the methods and compositions described herein relate to stem cells, such as induced pluripotent stem cells, engineered to express a CAR that targets a tumor marker, e.g., CD70, and optionally, a membrane-bound interleukin 15 (mbIL15) costimulatory domain.
[0057] Gene editing of immune cells As discussed above, various cell types can be utilized in cellular immunotherapy.Furthermore, as described in more detail below and shown in the examples, genetic modifications can be made to these cells to increase one or more aspects of their efficacy (e.g., cytotoxicity) and / or persistence (e.g., active life span).
[0058] In some embodiments, genetic manipulation of NK cells is used to further increase the potency and / or persistence of NK cells. For example, in some embodiments, the expression of various markers / proteins is reduced, substantially reduced, or knocked out (removed) via gene editing techniques. Depending on the embodiment, this may include gene editing to reduce the expression of one or more of the CD70 protein encoded by the CD70 gene, the cytokine-inducible SH2-containing (CIS) protein encoded by the CISH gene, and / or the Cbl proto-oncogene B (CBLB) protein encoded by the CBLB gene. In some embodiments, the reduction in expression is achieved via targeted introduction of DNA breaks and subsequent DNA repair mechanisms. In some embodiments, double-stranded breaks in DNA are repaired by non-homologous end joining (NHEJ), where enzymes are used to directly join the DNA ends together to repair the break. However, in some embodiments, the double-stranded breaks are repaired by homology-directed repair (HDR), which is advantageously more precise, thereby allowing sequence-specific cleavage and repair. HDR uses the homologous sequence as a template for regeneration of the missing DNA sequence at the break, such as a vector carrying a desired genetic element (e.g., an insertion element that disrupts the coding sequence of a target protein, such as CD70, CBLB, and / or CISH) in a sequence that is homologous to the flanking sequences of the double-stranded break, resulting in the desired change (e.g., an insertion) being inserted at the site of the DSB.
[0059] In some embodiments, gene editing is accomplished by one or more of various engineered nucleases. In some embodiments, restriction enzymes are used, especially when double-stranded breaks are desired in multiple regions. In some embodiments, bioengineered nucleases are used. Depending on the embodiment, one or more of zinc finger nucleases (ZFNs), transcription activator-like effector-like nucleases (TALENs), meganucleases and / or clustered regularly interspaced short palindromic repeats (CRISPR / Cas9) systems are used to specifically edit genes encoding one or more target proteins, such as CD70, CBLB, and / or CISH. In some embodiments, the CRISPR / Cas9 system is used to gene edit a target gene, such as CD70. In some embodiments, the CRISPR / Cas9 system is used to gene edit a target gene, such as CISH. In some embodiments, the CRISPR / Cas9 system is used to gene edit a target gene, such as CBLB.
[0060] Meganucleases are characterized by their ability to recognize and cleave large DNA sequences (14-40 base pairs). In some embodiments, meganucleases from the LAGLIDADG family are used and subjected to mutagenesis and screening to generate meganuclease variants that recognize a unique sequence(s), such as a specific site in a gene encoding a target protein of interest. In some embodiments, two or more meganucleases or functional fragments thereof are fused to create a hybrid enzyme that recognizes a desired target sequence within a gene encoding a target protein of interest, such as CD70, CBLB and / or CISH.
[0061] In contrast to meganucleases, ZFNs and TALENs have a function based on a non-specific DNA cleavage catalytic domain linked to a specific DNA sequence that recognizes peptides such as zinc fingers or transcription activator-like effectors (TALEs). Advantageously, ZFNs and TALENs thus allow sequence-independent DNA cleavage and have a high degree of sequence specificity in target recognition. Zinc finger motifs naturally function in transcription factors to recognize specific DNA sequences for transcription. The C-terminal part of each finger is involved in the specific recognition of DNA sequences. The sequences recognized by ZFNs are relatively short (e.g., about 3 base pairs), but in some embodiments, combinations of 2, 3, 4, 5, 6, 7, 8, 9, 10 or more zinc fingers with characterized recognition sites are used, which allows targeting of specific sequences, such as parts of genes that usually code for target proteins expressed by NK cells, such as CD70, CBLB and / or CISH. The combined ZFNs are then fused to the catalytic domain(s) of an endonuclease such as FokI (optionally a FokI heterodimer) to induce targeted DNA cleavage. Additional information regarding the use of ZFNs to edit target genes of interest such as CD70 or CISH can be found in U.S. Patent No. 9,597,357, which is incorporated herein by reference.
[0062] Transcription activator-like effector nucleases (TALENs) are specific DNA-binding proteins characterized by an array of 33 or 34 amino acid repeats. Similar to ZFNs, TALENs fuse the DNA cleavage domain of a nuclease to a TALE domain, allowing the introduction of sequence-independent double-stranded DNA breaks, allowing highly precise target site recognition. TALENs can create double-stranded breaks at target sites, which are repaired by error-prone non-homologous end joining (NHEJ), resulting in gene disruption by introducing small insertions or deletions. Advantageously, TALENs are used in some embodiments, due at least in part to their higher specificity in DNA binding, reduced off-target effects, and ease of construction of DNA-binding domains.
[0063] CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) is a genetic element that bacteria use to defend against viruses. The repeats are short sequences that are derived from viral genomes and integrated into the bacterial genome. Cas (CRISPR-associated proteins) process these sequences and cleave the matching viral DNA sequences. By introducing a plasmid containing the Cas gene into a eukaryotic cell and specifically constructing CRISPR, the eukaryotic genome can be cleaved at any desired location. Additional information regarding CRISPR can be found in US Patent Publication No. 2014 / 0068797, which is incorporated herein by reference. In some embodiments, the native CD70 expression by NK cells is disrupted or substantially eliminated by targeting the CD70-encoding gene with the CRISPR / Cas system. In some embodiments, one or more additional target proteins normally expressed by NK cells are disrupted or substantially eliminated by targeting the corresponding encoding genes with the CRISPR / Cas system. Depending on the embodiment, one or more of the cytokine-inducible SH2-containing protein encoded by the CISH gene, the Cbl proto-oncogene B protein encoded by the CBLB gene, and / or the CD70 gene are targeted with the CRISPR / Cas system. Depending on the embodiment, class 1 or class 2 Cas is used. In some embodiments, class 1 Cas is used, and the Cas type is selected from the following types: I, IA, IB, IC, ID, IE, IF, IU, III, IIIA, IIIB, IIIC, IIID, IV, IVA, IVB, and combinations thereof. In some embodiments, the Cas is selected from the group consisting of Cas3, Cas8a, Cas5, Cas8b, Cas8c, Cas10d, Cse1, Cse2, Csy1, Csy2, Csy3, GSU0054, Cas10, Csm2, Cmr5, Cas10, Csx11, Csx10, Csf1, and combinations thereof. In some embodiments, class 2 Cas is used, where the Cas type is selected from the following types: II, IIA, IIB, IIC, V, VI, and combinations thereof.In some embodiments, the Cas is selected from the group consisting of Cas9, Csn2, Cas4, Cpf1, C2c1, C2c3, Cas13a (previously known as C2c2), Cas13b, Cas13c, CasX, CasY, and combinations thereof. In some embodiments, the Cas is Cas9. In some embodiments, a class 2 CasX is used, where CasX can form a complex with a guide nucleic acid, and the complex can bind to a target DNA, where the target DNA includes a non-target strand and a target strand. In some embodiments, a class 2 CasY is used, where CasY can bind and modify a target nucleic acid and / or a polypeptide associated with the target nucleic acid.
[0064] As discussed herein, in some embodiments, NK cells are used for immunotherapy. In some embodiments provided herein, gene editing of NK cells confers various beneficial characteristics to the cells, such as, for example, increased proliferation, increased cytotoxicity, and / or increased persistence. In some embodiments provided herein, gene editing of NK cells can advantageously confer the edited NK cells the ability to resist and / or overcome various inhibitory signals generated in the tumor microenvironment. Tumors are known to produce various signaling molecules intended to reduce the anti-tumor effect of immune cells. As discussed in more detail below, in some embodiments, gene editing of NK cells limits this tumor microenvironment suppressive effect in NK cells, T cells, a combination of NK and T cells, or any edited / engineered immune cells provided herein.
[0065] As discussed below, in some embodiments, gene editing is employed to reduce or knock out the expression of a target protein, for example, by disrupting the underlying gene that codes for the protein. In some embodiments, gene editing can reduce the expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, about 99%, or more (including any amount between those listed). In some embodiments, the gene is completely knocked out so that the expression of the target protein is undetectable. In some embodiments, gene editing is used to "knock in" or alternatively increase the expression of the target protein. In some embodiments, expression of the target protein may be increased by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed).
[0066] According to further embodiments, other regulators of one or more aspects of NK cell (or T cell) function are regulated via gene editing. Various cytokines provide immune cells with negative or positive signals (similar to TGF-beta above). As a non-limiting example, IL15, as disclosed herein, is a positive regulator of NK cells and can increase one or more of NK cell homing, NK cell migration, NK cell expansion / proliferation, NK cell cytotoxicity, and / or NK cell persistence. To suppress NK cells under normal physiological circumstances, cytokine-inducible SH2-containing protein (CIS, encoded by CISH gene) acts as a key negative regulator of IL-15 signaling in NK cells. As discussed herein, IL15 biology impacts multiple aspects of NK cell functionality, including but not limited to proliferation / expansion, activation, cytotoxicity, persistence, homing, migration, etc., among others. Thus, according to some embodiments, CISH editing increases NK cell functionality across multiple functions, resulting in more effective and long-lasting NK cell therapy. In some embodiments, an inhibitor of CIS is used in conjunction with the administration of engineered NK cells.In some embodiments, CIS expression is knocked down or knocked out through gene editing of CISH gene, for example, by using CRISPR-Cas editing.In other embodiments, small interfering RNA, antisense RNA, TALEN or zinc finger is used.In some embodiments, CIS expression in T cell is knocked down through gene editing.
[0067] In some embodiments, CISH gene editing confers an increased ability to home to target sites to NK cells. In some embodiments, CISH gene editing confers an increased ability to migrate, e.g., within tissues, e.g., in response to chemoattractants or away from repellents. In some embodiments, CISH gene editing confers an increased ability to activate NK cells and thus exert, e.g., anti-tumor effects. In some embodiments, CISH gene editing confers an increased proliferative capacity to NK cells, in some embodiments allowing for the generation of robust NK cell numbers from donor blood samples. Furthermore, in such embodiments, NK cells edited for CISH and engineered to express a CAR are more easily, robustly, and consistently expanded in culture. In some embodiments, CISH gene editing confers an increased cytotoxicity to NK cells. In some embodiments, CISH editing synergistically increases the cytotoxic effect of engineered NK cells and / or engineered T cells expressing a CAR.
[0068] In some embodiments, CISH gene editing activates or inhibits a wide range of pathways. CIS proteins are negative regulators of IL15 signaling, for example, by inhibiting the JAK-STAT signaling pathway. These pathways typically result in the transcription of IL15-responsive genes (including CISH). In some embodiments, knockdown of CISH disinhibits JAK-STAT (e.g., JAK1-STAT5) signaling and increases the transcription of IL15-responsive genes. In some embodiments, knockout of CISH results in increased signaling through the mammalian target of rapamycin (mTOR), with a corresponding increase in the expression of genes related to cellular metabolism and respiration. In some embodiments, knockout of CISH results in increased expression of IL15-induced IL-2Rα (CD25), but not IL-15Rα or IL-2 / 15Rβ, increased NK cell membrane binding of IL15 and / or IL2, increased phosphorylation of STAT-3 and / or STAT-5, and increased expression of anti-apoptotic proteins such as Bcl-2. In some embodiments, CISH knockout results in IL15-induced upregulation of selected genes related to mitochondrial function (e.g., electron transport chain and cellular respiration) and cell cycle. Thus, in some embodiments, knockout of CISH by gene editing increases NK cell cytotoxicity and / or persistence, at least in part through metabolic reprogramming. In some embodiments, negative regulators of cell metabolism, such as TXNIP, are downregulated in response to CISH knockout. In some embodiments, promoters for cell survival and proliferation, including BIRC5 (survivin), TOP2A, CKS2, and RACGAP1, are upregulated after CISH knockout, while antiproliferative or proapoptotic proteins, such as TGFB1, ATM, and PTCH1, are downregulated.In some embodiments, the CISH knockout alters the state of signaling (e.g., activates or inactivates) via or through one or more of CXCL-10, IL2, TNF, IFNg, IL13, IL4, Jnk, PRF1, STAT5, PRKCQ, IL2 receptor beta, SOCS2, MYD88, STAT3, STAT1, TBX21, LCK, JAK3, IL& receptor, ABL1, IL9, STAT5A, STAT5B, Tcf7, PRDM1, and / or EOMES.
[0069] In some embodiments, editing of the CBLB increases NK cell functionality across multiple functionalities, resulting in more effective and long-lasting NK cell therapy. CBLB is an E3 ubiquitin ligase and a negative regulator of NK cell activation. CBLB reduces NK cell degranulation and cytotoxicity. Editing of the CBLB affects multiple aspects of NK cell functionality, including but not limited to proliferation, cytotoxicity, and increased IFNγ production. In some embodiments, inhibitors of CBLB are used in conjunction with administration of engineered NK cells. In some embodiments, CBLB expression is knocked down or knocked out by gene editing of the CBLB gene, for example, by using CRISPR-Cas editing. In other embodiments, small interfering RNA, antisense RNA, TALEN, or zinc fingers are used. In some embodiments, CBLB expression in T cells is knocked down by gene editing.
[0070] In some embodiments, CBLB gene editing increases the resistance of NK cells to inhibition via TAM receptors (Tyro-3, Axl and Mer). In some embodiments, CBLB gene editing confers an increased ability to be activated to NK cells, thus exerting, for example, anti-tumor effects. In some embodiments, CBLB gene editing confers an increased proliferative capacity to NK cells, and in some embodiments, robust NK cell numbers can be generated from a donor blood sample. Furthermore, in such embodiments, NK cells edited for CBLB and engineered to express a CAR expand more easily, robustly and consistently in culture. In some embodiments, CBLB gene editing confers increased cytotoxicity to NK cells. In some embodiments, editing of the CBLB synergistically increases the cytotoxic effect of engineered NK cells and / or engineered T cells expressing a CAR.
[0071] In some embodiments, the gene that is disrupted, knocked out, or otherwise modified to reduce expression of the encoded protein is CD70. In some embodiments, expression of CD70 is disrupted (e.g., knocked out) in NK cells because NK cells naturally express relatively high levels of CD70, and if expression is maintained at natural levels, NK cells expressing an anti-CD70 CAR will target not only CD70-expressing tumor cells, but also other NK cells (whether natural NK cells or those expressing a CD70 CAR). Thus, in some embodiments, gene editing is used to knock out CD70 expression by NK cells, so that engineered NK cells expressing an anti-CD70 CAR do not target therapeutic NK cells, but also tumors expressing CD70. In some embodiments, an inhibitor of CD70 is used in combination with administration of engineered NK cells. In some embodiments, CD70 expression is knocked down or knocked out by gene editing of the CD70 gene, for example, by using CRISPR-Cas editing. In other embodiments, small RNA, antisense RNA, TALEN, or zinc fingers are used. In some embodiments, CD70 expression in T cells is knocked down by gene editing.
[0072] In some embodiments, gene editing of immune cells can also provide unexpected increases in the expansion, persistence and / or cytotoxicity of edited immune cells. As disclosed herein, engineered cells (e.g., cells expressing CARs) can also be edited, the combination providing robust cells for immunotherapy. In some embodiments, editing allows for unexpectedly improved NK cell expansion, persistence and / or cytotoxicity. In some embodiments, knocking out CISH expression in NK cells removes a potent negative regulator of IL15-mediated signaling in NK cells, disinhibiting NK cells and allowing one or more of increased NK cell homing, NK cell migration, NK cell activation, expansion, cytotoxicity and / or persistence. In some embodiments, knocking out CBLB expression in NK cells increases the resistance of NK cells to TAM-mediated inhibition. In additional embodiments, CD70 is knocked out in NK cells such that engineered NK cells expressing anti-CD70 CARs do not target therapeutic NK cells as well as CD70-expressing tumors. Furthermore, in some embodiments, editing can increase NK cell and / or T cell function in an otherwise suppressive tumor microenvironment. In some embodiments, CISH gene editing results in increased NK cell expansion, persistence and / or cytotoxicity without the need for exogenously provided Notch ligand.
[0073] Extracellular domain (tumor-binding factor) Some embodiments of the compositions and methods described herein relate to a chimeric antigen receptor that includes an extracellular domain that includes a tumor-binding domain (also called an antigen-binding protein or antigen-binding domain), as described herein. The tumor-binding domain targets, for example, CD70, depending on the embodiment.
[0074] In some embodiments, the antigen binding domain is derived from or comprises a wild type or non-wild type sequence of an antibody, antibody fragment, scFv, Fv, Fab, (Fab')2, single domain antibody (SDAB), vH or vL domain, camelid VHH domain, or a non-immunoglobulin scaffold, such as a DARPIN, an affibody, an affilin, an adnectin, an affitin, a repebody, a finomer, an alphabody, an avimer, an atrimer, a sentinin, a pronectin, an anticalin, a Kunitz domain, an armadillo repeat protein, an autoantigen, a receptor, or a ligand. In some embodiments, the tumor binding domain comprises more than one antigen binding domain.
[0075] Antigen-binding proteins In some embodiments, an antigen binding protein is provided. As used herein, the term "antigen binding protein" shall be given its ordinary meaning and shall also refer to an antigen binding fragment that binds to an antigen, and, where appropriate, a protein that includes a scaffold or framework portion that allows the antigen binding fragment to adopt a conformation that promotes binding of the antigen binding protein to the antigen. In some embodiments, the antigen is a cancer antigen (e.g., CD70) or a fragment thereof. In some embodiments, the antigen binding fragment comprises at least one CDR from an antibody that binds to the antigen. In some embodiments, the antigen binding fragment comprises all three CDRs from the heavy chain of the antibody that binds to the antigen or from the light chain of the antibody that binds to the antigen. Further, in some embodiments, the antigen binding fragment comprises all six CDRs from the antibody that binds to the antigen (three from the heavy chain and three from the light chain). In some embodiments, the antigen binding fragment comprises one, two, three, four, five, or six CDRs from the antibody that binds to the antigen, and in some embodiments, the CDRs can be any combination of heavy and / or light chain CDRs. The antigen binding fragment in some embodiments is an antibody fragment.
[0076] Non-limiting examples of antigen-binding proteins include antibodies, antibody fragments (e.g., antigen-binding fragments of antibodies), antibody derivatives, and antibody analogs. Further specific examples include, but are not limited to, single chain variable fragments (scFv), nanobodies (e.g., the VH domain of a camelid heavy chain antibody; VHH fragments), Fab fragments, Fab' fragments, F(ab')2 fragments, Fv fragments, Fd fragments, and complementarity determining region (CDR) fragments. These molecules can be derived from any mammalian source, such as human, mouse, rat, rabbit, or pig, dog, or camel. Antibody fragments can compete with intact (e.g., natural) antibodies for binding to a target antigen, and fragments can be synthesized de novo using modification of intact antibodies (e.g., enzymatic or chemical cleavage) or recombinant DNA technology or peptide synthesis. Antigen-binding proteins can include, for example, alternative protein frameworks or artificial scaffolds with grafted CDRs or CDR derivatives. Such scaffolds include, but are not limited to, antibody-derived scaffolds that contain, for example, mutations introduced to stabilize the three-dimensional structure of the antigen-binding protein, as well as fully synthetic scaffolds that contain, for example, biocompatible polymers. Additionally, peptide antibody mimetics ("PAMs") can be used, as well as scaffolds based on antibody mimetics that utilize fibronectin components as a scaffold.
[0077] In some embodiments, the antigen binding protein comprises one or more antibody fragments incorporated into a single polypeptide chain or multiple polypeptide chains. For example, antigen binding proteins can include, but are not limited to, diabodies; intracellular antibodies; domain antibodies (a single VL or VH domain, or two or more VH domains connected by a peptide linker); maxibodies (two scFvs fused to an Fc region); triabodies; tetrabodies; minibodies (scFvs fused to a CH3 domain); peptibodies (one or more peptides bound to an Fc region); linear antibodies (a pair of tandem Fd segments (VH-CH1-VH-CH1) that form a pair of antigen binding regions with complementary light chain polypeptides); small modular immunopharmaceuticals; and immunoglobulin fusion proteins (e.g., IgG-scFv, IgG-Fab, 2scFv-IgG, 4scFv-IgG, VH-IgG, IgG-VH, and Fab-scFv-Fc).
[0078] In some embodiments, the antigen-binding protein has the structure of an immunoglobulin. As used herein, the term "immunoglobulin" shall be given its ordinary meaning and shall refer to a tetrameric molecule, each tetramer comprising two identical pairs of polypeptide chains, each pair having one "light" chain (about 25 kDa) and one "heavy" chain (about 50-70 kDa). The amino-terminal portion of each chain contains a variable region of about 100-110 or more amino acids primarily responsible for antigen recognition. The carboxy-terminal portion of each chain defines a constant region primarily responsible for effector function.
[0079] Within light and heavy chains, the variable (V) and constant (C) regions are joined by a "J" region of about 12 or more amino acids, with heavy chains also including a "D" region of about 10 more amino acids. The variable regions of each light / heavy chain pair form the antibody binding site such that an intact immunoglobulin has two binding sites.
[0080] Immunoglobulin chains exhibit the same general structure of relatively conserved framework regions (FR) connected by three hypervariable regions, also called complementarity determining regions or CDRs. From the N-terminus to the C-terminus, both light and heavy chains comprise the domains FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4.
[0081] Human light chains are classified as kappa and lambda light chains. An antibody "light chain" refers to the smaller of the two types of polypeptide chains present in antibody molecules in their naturally occurring conformations. Kappa (K) and lambda (λ) light chains refer to the two major antibody light chain isotypes. A light chain can comprise a polypeptide that includes, from the amino terminus to the carboxyl terminus, a single immunoglobulin light chain variable region (VL) and a single immunoglobulin light chain constant domain (CL).
[0082] Heavy chains are classified as mu (μ), delta (Δ), gamma (γ), alpha (α), and epsilon (ε), and define the antibody's isotype as IgM, IgD, IgG, IgA, or IgE, respectively. An antibody "heavy chain" refers to the larger of the two types of polypeptide chains present in an antibody molecule in its naturally occurring conformation and typically determines the class to which the antibody belongs. A heavy chain can comprise, from amino terminus to carboxyl terminus, a polypeptide comprising a single immunoglobulin heavy chain variable region (VH), an immunoglobulin heavy chain constant domain 1 (CH1), an immunoglobulin hinge region, an immunoglobulin heavy chain constant domain 2 (CH2), an immunoglobulin heavy chain constant domain 3 (CH3), and optionally an immunoglobulin heavy chain constant domain 4 (CH4).
[0083] The IgG class is further divided into subclasses, namely IgG1, IgG2, IgG3, and IgG4. The IgA class is further divided into subclasses, namely IgA1 and IgA2. IgM has subclasses including, but not limited to, IgM1 and IgM2. The heavy chains of IgG, IgA, and IgD antibodies have three domains (CH1, CH2, and CH3), while the heavy chains of IgM and IgE antibodies have four domains (CH1, CH2, CH3, and CH4). The immunoglobulin heavy chain constant domains can be from any immunoglobulin isotype, including subtypes. The antibody chains are linked to each other via interpolypeptide disulfide bonds between the CL and CH1 domains (e.g., between the light and heavy chains) and between the hinge regions of the antibody heavy chains.
[0084] In some embodiments, the antigen-binding protein is an antibody. The term "antibody" as used herein refers to a protein or polypeptide sequence derived from an immunoglobulin molecule that specifically binds to an antigen. An antibody may be a monoclonal, or polyclonal, multiple or single chain, or intact immunoglobulin, and may be derived from a natural or recombinant source. An antibody may be a tetramer of an immunoglobulin molecule. An antibody may be "humanized," "chimeric," or non-human. An antibody may include intact immunoglobulins of any isotype, including, for example, chimeric, humanized, human, and bispecific antibodies. An intact antibody generally includes at least two full-length heavy chains and two full-length light chains. An antibody sequence may be derived only from a single species, or may be "chimeric," i.e., different portions of the antibody may be derived from two different species, as further described below. Unless otherwise indicated, the term "antibody" also includes antibodies comprising two substantially full-length heavy chains and two substantially full-length light chains, provided that the antibody retains the same or similar binding and / or function as an antibody composed of two full-length light and heavy chains. For example, antibodies with substitutions, insertions or deletions of 1, 2, 3, 4 or 5 amino acid residues at the N-terminus and / or C-terminus of the heavy and / or light chains are included in the definition, provided that the antibody retains the same or similar binding and / or function as an antibody comprising two full-length heavy chains and two full-length light chains. Examples of antibodies include monoclonal antibodies, polyclonal antibodies, chimeric antibodies, humanized antibodies, human antibodies, bispecific antibodies, and synthetic antibodies. In some embodiments, monoclonal and polyclonal antibodies are provided. As used herein, the term "polyclonal antibody" shall be given its ordinary meaning and shall refer to an antibody population that typically varies widely in composition and binding specificity. As used herein, the term "monoclonal antibody" ("mAb") shall be given its ordinary meaning and shall refer to one or more of a population of antibodies having identical sequence. A monoclonal antibody binds to an antigen at a specific epitope on the antigen.
[0085] In some embodiments, the antigen-binding protein is an antibody fragment or antigen-binding fragment. The term "antibody fragment" refers to at least a portion of an antibody that retains the ability to specifically interact with an epitope of an antigen (e.g., by binding, steric hindrance, stabilization / destabilization, spatial distribution). Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, Fv fragments, scFv antibody fragments, disulfide-linked Fvs (sdFv), Fd fragments consisting of VH and CHI domains, linear antibodies, single domain antibodies such as sdAb (either vL or vH), camelid vHH domains, multispecific antibodies formed from antibody fragments such as bivalent fragments comprising two Fab fragments linked by a disulfide bridge at the hinge region, and isolated CDRs or other epitope-binding fragments of antibodies. Antigen-binding fragments can also be incorporated into single domain antibodies, maxibodies, minibodies, nanobodies, intrabodies, diabodies, triabodies, tetrabodies, v-NARs and bis-scFvs (see, e.g., Hollinger and Hudson, Nature Biotechnology 23: 1126-1136, 2005). Antigen-binding fragments can also be grafted onto polypeptide-based scaffolds such as fibronectin type III (Fn3) (see, e.g., U.S. Pat. No. 6,703,199, which describes fibronectin polypeptide minibodies). Antibody fragments can include Fab, Fab', F(ab')2, and / or Fv fragments that contain at least one CDR of an immunoglobulin sufficient to confer specific antigen binding to a cancer antigen (e.g., CD70). Antibody fragments can be produced by recombinant DNA technology or by enzymatic or chemical cleavage of intact antibodies.
[0086] In some embodiments, Fab fragments are provided. Fab fragments are monovalent fragments with VL, VH, CL and CH1 domains; F(ab')2 fragments are bivalent fragments with two Fab fragments linked by disulfide bridges at the hinge region; Fd fragments have VH and CH1 domains; Fv fragments have VL and VH domains of a single arm of an antibody; and dAb fragments have VH domain, VL domain, or antigen-binding fragments of VH or VL domain. In some embodiments, these antibody fragments can be incorporated into single domain antibodies, single chain antibodies, maxibodies, minibodies, intrabodies, intrabodies, diabodies, triabodies, tetrabodies, v-NARs and bis-scFvs. In some embodiments, the antibody comprises at least one CDR as described herein.
[0087] Also provided herein, in some embodiments, are single-chain variable fragments. As used herein, the term "single-chain variable fragment" ("scFv") shall be given its ordinary meaning and shall refer to a fusion protein in which the VL and VH regions are connected to form a continuous protein chain via a linker (e.g., a synthetic sequence of amino acid residues), which is long enough for the protein chain to fold back on itself and form a monovalent antigen-binding site. For the sake of clarity, unless otherwise indicated, a "single-chain variable fragment" is not an antibody or antibody fragment as defined herein. A diabody is a bivalent antibody comprising two polypeptide chains, each polypeptide chain comprising a VH and a VL domain connected by a linker configured to reduce or not allow pairing between the two domains on the same chain, thus allowing each domain to pair with a complementary domain on another polypeptide chain. According to some embodiments, when the two polypeptide chains of a diabody are identical, the diabody resulting from their pairing has two identical antigen-binding sites. Polypeptide chains with different sequences can be used to generate diabodies with two different antigen-binding sites. Similarly, tribodies and tetrabodies are antibodies that contain three and four polypeptide chains, respectively, forming three and four antigen-binding sites, respectively, which can be the same or different.
[0088] In some embodiments, an antigen binding protein comprises one or more CDRs. As used herein, the term "CDR" shall be given its ordinary meaning and shall also refer to the complementarity determining regions (also called "minimal recognition units" or "hypervariable regions") within an antibody variable sequence. CDRs allow an antigen binding protein to specifically bind to a particular antigen of interest. There are three heavy chain variable region CDRs (CDR-H1, CDR-H2 and CDR-H3) and three light chain variable region CDRs (CDR-L1, CDR-L2 and CDR-L3). The CDRs in each of the two chains are typically aligned by framework regions to form a structure that specifically binds to a particular epitope or domain on the target protein. From N-terminus to C-terminus, both naturally occurring light and heavy chain variable regions typically conform to the following order of these elements: FW1, CDR1, FW2, CDR2, FW3, CDR3, FW4. For the heavy chain variable region, the order is typically from N-terminus to C-terminus: FW-H1, CDR-H1, FW-H2, CDR-H2, FW-H3, CDR-H3, and FW-H4. For the light chain variable region, the order is typically from N-terminus to C-terminus: FW-L1, CDR-L1, FW-L2, CDR-L2, FW-L3, CDR-L3, FW-L4. A numbering system has been devised that numbers the amino acids that occupy positions in each of these domains. This numbering system is defined in Kabat Sequences of Proteins of Immunological Interest (1987 and 1991, NIH, Bethesda, MD) or Chothia & Lesk, 1987, J. Mol. Biol. 196:901-917; Chothia et al., 1989, Nature 342:878-883. The complementarity determining regions (CDRs) and framework regions (FRs) of a given antibody can be identified using this system.Other numbering systems for amino acids in immunoglobulin chains include IMGT® (the international ImMunoGeneTics information system; Lefranc et al, Dev. Comp. Immunol. 29:185-203; 2005), and AHo (Honegger and Pluckthun, J. Mol. Biol. 309(3):657-670; 2001). The binding domains disclosed herein can utilize CDRs defined according to any of these systems. For any given embodiment containing more than one CDR, the CDRs can be defined according to any of the Kabat, Chothia, extended, IMGT, Paratome, AbM, and / or conformational definitions, or any combination of the above. Any CDR can be interpreted under any of these numbering systems, separately or within the context of a variable domain, as appropriate by one of skill in the art. One or more CDRs can be covalently or non-covalently incorporated into a molecule to make it an antigen binding protein.
[0089] In some embodiments, the antigen binding proteins provided herein comprise one or more CDR(s) as part of a larger polypeptide chain. In some embodiments, the antigen binding proteins covalently link one or more CDR(s) to another polypeptide chain. In some embodiments, the antigen binding proteins incorporate one or more CDRs non-covalently. In some embodiments, the antigen binding proteins may comprise at least one of the CDRs described herein incorporated into a biocompatible framework structure. In some embodiments, the biocompatible framework structure comprises a polypeptide or portion thereof sufficient to form a conformationally stable structural support, or framework, or scaffold, capable of presenting one or more sequences of amino acids that bind to antigens (e.g., CDRs, variable regions, etc.) at a localized surface region. Such structures may be naturally occurring polypeptides or polypeptide "folds" (structural motifs) or may have one or more modifications, such as amino acid additions, deletions, and / or substitutions, relative to a naturally occurring polypeptide or fold. Depending on the embodiment, the scaffold can be derived from polypeptides of a variety of different species (or more than one species), such as humans, non-human primates or other mammals, other vertebrates, invertebrates, plants, bacteria or viruses.
[0090] The term "consensus sequence" as used herein with respect to sequences refers to a generalized sequence that represents all different combinations of allowed amino acids at each position of a group of sequences. A consensus sequence can provide insight into the conserved regions of related sequences whose units (e.g., amino acids or nucleotides) are identical in most or all of the sequences, and the regions that show differences between sequences. In the case of antibodies, the consensus sequence of CDRs can indicate amino acids that are important or not essential for antigen binding. It is envisioned that consensus sequences can be prepared with any sequence provided herein, and the resulting various sequences derived from the consensus sequence can be verified to have the same effect as the template sequence.
[0091] In some embodiments, antibody or its binding fragment comprises a combination of CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3, and one or more of these CDRs are defined by consensus sequence.The consensus sequence provided herein is derived from the alignment of the CDRs provided herein.However, it is envisioned that alternative alignments can be performed (e.g., using global or local alignments, or using different algorithms such as Hidden Markov Models, seed guide tree, Needleman-Wunsch algorithm, or Smith-Waterman algorithm), and such alternative consensus sequences can be derived.
[0092] Depending on the embodiment, the biocompatible framework structures are based on protein scaffolds or skeletons other than immunoglobulin domains. In some such embodiments, these framework structures are based on fibronectin, ankyrin, lipocalin, neocarzinostatin, cytochrome b, CP1 zinc finger, PST1, coiled coil, LACI-D1, Z domain and / or tendamistat domain.
[0093] As used herein, the term "chimeric antibody" shall be given its ordinary meaning and shall also refer to an antibody that includes one or more regions from one antibody and one or more regions from one or more other antibodies. For example, the framework regions of the antigen binding proteins disclosed herein, e.g., targeting CD70, may be derived from one or more different antibodies, such as human antibodies, or humanized antibodies. In one example of a chimeric antibody, a portion of the heavy and / or light chain is identical to, homologous to, or derived from an antibody from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical to, homologous to, or derived from an antibody from another species or belonging to another antibody class or subclass. Also provided herein are fragments of such antibodies that exhibit the desired biological activity. In some embodiments, the CAR disclosed herein comprises an anti-CD70 binding domain.
[0094] In some embodiments, the anti-CD70 binding domain comprises a VH and a VL linked by a linker. In some embodiments, the anti-CD70 binding domain is an scFv. In some embodiments, the CAR disclosed herein comprises an scFv as a binding factor for a tumor antigen. In some embodiments, the scFv is encoded by a polynucleotide comprising a sequence having at least about 85%, about 90%, about 95%, or more sequence identity to one or more of SEQ ID NOs: 23-24, 30-32, and / or 34-37. In some embodiments, the scFv is encoded by a polynucleotide comprising a sequence set forth in SEQ ID NO: 23. In some embodiments, the scFv is encoded by a polynucleotide comprising a sequence set forth in SEQ ID NO: 24. In some embodiments, the scFv is encoded by a polynucleotide comprising a sequence set forth in SEQ ID NO: 30. In some embodiments, the scFv is encoded by a polynucleotide comprising a sequence set forth in SEQ ID NO: 31. In some embodiments, the scFv is encoded by a polynucleotide comprising a sequence set forth in SEQ ID NO: 32. In some embodiments, the scFv is encoded by a polynucleotide comprising the sequence set forth in SEQ ID NO: 34. In some embodiments, the scFv is encoded by a polynucleotide comprising the sequence set forth in SEQ ID NO: 35. In some embodiments, the scFv is encoded by a polynucleotide comprising the sequence set forth in SEQ ID NO: 36. In some embodiments, the scFv is encoded by a polynucleotide comprising the sequence set forth in SEQ ID NO: 37. In some embodiments, the scFv comprises an amino acid sequence having at least about 85%, about 90%, about 95%, or more sequence identity to one or more of SEQ ID NOs: 25-26, 47-49, and / or 51-54. In some embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 25. In some embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 26. In some embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 47. In some embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 48.In some embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 49. In some embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 51. In some embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 52. In some embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 53. In some embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 54.
[0095] In some embodiments, the various domains / subdomains are separated by a linker, such as, for example, a GS3 linker (SEQ ID NO: 208) or a GS2 linker (SEQ ID NOs: 15 and 16, nucleotide and protein, respectively) is used (or a GSn linker). Other linkers used according to various embodiments disclosed herein include, but are not limited to, those encoded by SEQ ID NOs: 17, 19, or 21. In some embodiments, other linkers comprise a peptide sequence of one of SEQ ID NOs: 18, 20, or 22. In some embodiments, the linker comprises the sequence of SEQ ID NO: 50. This provides the possibility to separate the various component parts of the receptor complex along with a polynucleotide that can increase the expression, stability, and / or functionality of the receptor complex.
[0096] Cytotoxicity Signaling Complex Some embodiments of the compositions and methods described herein relate to chimeric antigen receptors (e.g., CARs directed against CD70) that comprise a cytotoxic signaling complex. As disclosed herein, according to some embodiments, the cytotoxic receptor complexes provided comprise one or more transmembrane and / or intracellular domains that initiate a cytotoxic signaling cascade upon an extracellular domain(s) that binds to a ligand on the surface of a target cell.
[0097] In some embodiments, the cytotoxic signaling complex comprises at least one transmembrane domain, at least one costimulatory domain, and / or at least one signaling domain. In some embodiments, more than one component moiety comprises a given domain - for example, a costimulatory domain can comprise two subdomains. Furthermore, in some embodiments, a domain can serve multiple functions, for example, a transmembrane domain can serve to provide a signaling function.
[0098] Transmembrane domain Some embodiments of the compositions and methods described herein relate to chimeric receptors (e.g., tumor antigen-directed CARs and / or ligand-directed chimeric receptors) that include a transmembrane domain. In some embodiments in which a transmembrane domain is employed, the portion of the transmembrane protein employed retains at least a portion of its normal transmembrane domain.
[0099] However, in some embodiments, the transmembrane domain comprises at least a portion of CD8, a transmembrane glycoprotein normally expressed on both T cells and NK cells. In some embodiments, the transmembrane domain comprises CD8α. In some embodiments, the transmembrane domain comprises a CD8α transmembrane domain. In some embodiments, the CD8α transmembrane domain has the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the CD8α transmembrane domain is truncated or modified and has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity to a CD8α having the sequence of SEQ ID NO:3. In some embodiments, the CD8α transmembrane domain comprises the amino acid sequence of SEQ ID NO:4. In some embodiments, the CD8α transmembrane domain is truncated or modified and has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity to a CD8α having the sequence of SEQ ID NO:4.
[0100] In some embodiments, the transmembrane domain is linked to a "hinge" domain. In some embodiments, the "hinge" domain of CD8α has the nucleic acid sequence of SEQ ID NO:1. In some embodiments, the CD8α hinge is truncated or modified to have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity to a CD8α having the sequence of SEQ ID NO:1. In some embodiments, the "hinge" of CD8α comprises the amino acid sequence of SEQ ID NO:2. In some embodiments, the hinge of CD8α can be truncated or modified to have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity to the sequence of SEQ ID NO:2.
[0101] In some embodiments, the CD8α hinge and the CD8α transmembrane domain are used together (referred to herein as the CD8 hinge / transmembrane complex). In some embodiments, the CD8 hinge / transmembrane complex is encoded by the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the CD8 hinge / transmembrane complex is truncated or modified to have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity with the CD8 hinge / transmembrane complex having the sequence of SEQ ID NO: 13. In some embodiments, the CD8 hinge / transmembrane complex comprises the amino acid sequence of SEQ ID NO: 14. In some embodiments, the CD8 hinge / transmembrane complex hinge is truncated or modified to have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity with the CD8 hinge / transmembrane complex having the sequence of SEQ ID NO: 14.
[0102] Stimulation domain Some embodiments of the compositions and methods described herein relate to chimeric antigen receptors that include stimulatory domains. In addition to various transmembrane and signaling domains (as well as transmembrane / signaling domain combinations), in some embodiments, additional stimulatory molecules may be provided. These may be, for example, specific molecules that further increase the activity of immune cells. Cytokines may be used in some embodiments. For example, as a non-limiting example, specific interleukins such as IL-2 and / or IL-15 are used. In some embodiments, immune cells for treatment are engineered to express such molecules in a secretory form. In further embodiments, such stimulatory domains are engineered to be membrane-bound, acting as autocrine stimulatory molecules (or even as paracrine stimulators to neighboring cells).
[0103] In some embodiments, the NK cells disclosed herein are engineered to express interleukin 15 (IL15, IL-15). In some embodiments, IL15 is expressed from a separate cassette on a construct comprising any one of the CARs disclosed herein. In some embodiments, IL15 is expressed on the same cassette as any one of the CARs disclosed herein, optionally separated by a cleavage site, e.g., a proteolytic cleavage site or a T2A, P2A, E2A, or F2A autocleaving peptide cleavage site. In some embodiments, IL15 is membrane-bound IL15 (mbIL15). In some embodiments, mbIL15 comprises a native IL15 sequence, such as a human native IL15 sequence, and at least one transmembrane domain. In some embodiments, the native IL15 sequence is encoded by a sequence having at least 85%, at least 90%, at least 95% sequence identity to SEQ ID NO:11. In some embodiments, the native IL15 sequence comprises a peptide sequence having at least 85%, at least 90%, at least 95% sequence identity to SEQ ID NO: 12. In some embodiments, the native IL15 sequence comprises the amino acid sequence of SEQ ID NO: 12. In some embodiments, the at least one transmembrane domain comprises a CD8 transmembrane domain. In some embodiments, mbIL15 may comprise additional components such as a leader sequence and / or a hinge sequence. In some embodiments, the leader sequence is a CD8 leader sequence. In some embodiments, the hinge sequence is a CD8 hinge sequence.
[0104] In some embodiments, the tumor antigen-directed CAR and / or the tumor ligand-directed chimeric receptor are encoded by a polynucleotide that encodes one or more cytoplasmic protease cleavage sites. Such sites can be recognized and cleaved by cytoplasmic proteases, resulting in the separation (and separate expression) of the various component parts of the receptor encoded by the polynucleotide. In some embodiments, the tumor antigen-directed CAR and / or the tumor ligand-directed chimeric receptor are encoded by a polynucleotide that encodes one or more self-cleaving peptides, such as a T2A cleavage site, a P2A cleavage site, an E2A cleavage site, and / or an F2A cleavage site. As a result, depending on the embodiment, various components of the engineered cytotoxic receptor complex can be delivered to NK cells or T cells by a single vector or multiple vectors. Thus, as shown diagrammatically in the figure, the construct can be encoded by a single polynucleotide, but also includes a cleavage site, so that downstream elements of the construct are expressed by the cell as separate proteins (as is the case in some embodiments with IL-15). In some embodiments, a T2A cleavage site is used. In some embodiments, the T2A cleavage site has the nucleic acid sequence of SEQ ID NO: 9. In some embodiments, the T2A cleavage site may be truncated or modified to have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity to the sequence of SEQ ID NO: 9. In some embodiments, the T2A cleavage site comprises the amino acid sequence of SEQ ID NO: 10. In some embodiments, the T2A cleavage site is truncated or modified to have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity to the T2A cleavage site having the sequence of SEQ ID NO: 10.
[0105] In some embodiments, NK cells are engineered to express membrane-bound interleukin 15 (mbIL15). In such embodiments, mbIL15 expression on NK increases the cytotoxic effect of engineered NK cells by increasing the proliferation and / or lifespan of NK cells. In some embodiments, mbIL15 is encoded by the same polynucleotide as the CAR, although separate vectors may also be used. In some embodiments, mbIL15 has the nucleic acid sequence of SEQ ID NO:27. In some embodiments, mbIL15 can be truncated or modified to have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity with the sequence of SEQ ID NO:27. In some embodiments, mbIL15 comprises the amino acid sequence of SEQ ID NO:28. In some embodiments, mbIL15 is truncated or modified to have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity with mbIL15 having the sequence of SEQ ID NO:28. In some embodiments, mbIL15 comprises the amino acid sequence of SEQ ID NO: 213. In some embodiments, mbIL15 is truncated or modified and has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity to mbIL15 having the sequence of SEQ ID NO: 213. Membrane-bound IL15 sequences are found in PCT Publication Nos. 2018 / 183385 and 2020 / 056045, each of which is expressly incorporated herein by reference in its entirety, and relate to membrane-bound IL15 sequences.
[0106] Signaling domains Some embodiments of the compositions and methods described herein relate to chimeric receptors (e.g., tumor antigen-directed CARs and / or tumor ligand-directed chimeric receptors) that include a signaling domain. For example, an immune cell engineered according to some embodiments disclosed herein may include at least one subunit of the CD3 T cell receptor complex (or a fragment thereof). In some embodiments, the signaling domain includes a CD3 zeta subunit. In some embodiments, the CD3 zeta is encoded by the nucleic acid sequence of SEQ ID NO: 7. In some embodiments, the CD3 zeta may be truncated or modified to have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity with a CD3 zeta having the sequence of SEQ ID NO: 7. In some embodiments, the CD3 zeta domain includes the amino acid sequence of SEQ ID NO: 8. In some embodiments, the CD3 zeta domain is truncated or modified and has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity to a CD3 zeta domain having the sequence of SEQ ID NO:8.
[0107] In some embodiments, the unexpected increased signaling is achieved by the use of multiple signaling domains whose activities act synergistically. For example, in some embodiments, the signaling domain further comprises an OX40 domain. In some embodiments, the OX40 domain is an intracellular signaling domain. In some embodiments, the OX40 intracellular signaling domain has a nucleic acid sequence of SEQ ID NO:5. In some embodiments, the OX40 intracellular signaling domain can be truncated or modified to have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity with OX40 having a sequence of SEQ ID NO:5. In some embodiments, the OX40 intracellular signaling domain comprises an amino acid sequence of SEQ ID NO:6. In some embodiments, the OX40 intracellular signaling domain is truncated or modified to have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% sequence identity with OX40 intracellular signaling domain having a sequence of SEQ ID NO:6. In some embodiments, OX40 is used as the only transmembrane / signaling domain in the construct, but in some embodiments, OX40 can be used with one or more other domains.For example, in some embodiments, a combination of OX40 and CD3 zeta is used.As a further example, in some embodiments, a combination of CD28, OX40, 4-1BB, and / or CD3 zeta is used.
[0108] Chimeric antigen receptor constructs In some embodiments, various cytotoxic receptor complexes (also called cytotoxic receptors) are provided herein with the general structure of chimeric antigen receptors. Figure 1 shows a schematic diagram of CD70-directed CAR. CARa is a schematic diagram of a non-limiting embodiment of CAR. CARb is a schematic diagram of the polynucleotide encoding CAR, as well as optional T2A and mbIL15. Figure 1 also describes two non-limiting polynucleotide constructs NK71 and NK72 that target CD70 (including optional T2A and mbIL15).
[0109] As shown in the figure, some embodiments of the polynucleotide encoding the CAR include an anti-tumor binding factor, a CD8a hinge domain, a CD8a transmembrane domain, an OX40 domain, a CD3ζ domain (such as a CD3ζ ITAM domain), a 2A cleavage site, and / or a membrane-bound IL-15 domain (although, as noted above, some embodiments use soluble IL-15). In some embodiments, the binding and activation functions are engineered to be performed by separate domains. In some embodiments, the general structure of the chimeric antigen receptor construct includes a hinge and / or a transmembrane domain. In some embodiments, these can be accomplished by a single domain, or in some embodiments, multiple subdomains can be used. The receptor complex further includes a signaling domain that transmits a signal after binding of the homing moiety to the target cell, ultimately resulting in a cytotoxic effect in the target cell. In some embodiments, the complex further includes a co-stimulatory domain, which in some embodiments acts synergistically to augment the function of the signaling domain. Expression of these complexes in immune cells, such as NK cells and / or T cells, allows for the targeting and destruction of specific target cells, such as cancerous cells expressing a given tumor marker. Some of these receptor complexes contain an extracellular domain that includes an anti-CD70 moiety, or a CD70-binding moiety, that binds to CD70 on the surface of the target cell and activates the engineered cell. The CD3 zeta ITAM subdomains can act in concert as signaling domains. The IL-15 domain, e.g., the mbIL-15 domain, can act as a stimulatory domain. The IL-15 domain, e.g., the mbIL-15 domain, can make immune cells expressing it (e.g., NK or T cells) particularly effective against target tumor cells. It is recognized that the IL-15 domain, such as the mbIL-15 domain, can be encoded in a separate construct according to some embodiments. Furthermore, each component can be encoded in one or more separate components.
[0110] In some embodiments, anti-CD70 binding domains are disclosed herein. In some embodiments, the anti-CD70 binding domains are scFv. These anti-CD70 binding domains are specific to and / or preferentially bind to CD70. The anti-CD70 binding domains disclosed herein can be incorporated into any one of the chimeric antigen receptor constructs disclosed herein. The anti-CD70 binding domains disclosed herein can also be expressed by cells separately or within an anti-CD70 CAR.
[0111] In some embodiments, the anti-CD70 binding domain comprises a polynucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to or derived from either of SEQ ID NO:23 and / or SEQ ID NO:24, or to an extent defined by any two of the foregoing percentages.
[0112] In some embodiments, the anti-CD70 binding domain comprises a heavy chain variable region and a light chain variable region, in some embodiments, the heavy chain variable region comprises CDR-H1, CDR-H2, and CDR-H3, and the light chain variable region comprises CDR-L1, CDR-L2, and CDR-L3. In some embodiments, CDR-H1 comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs: 102-103 or 110; CDR-H2 comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs: 104-106 or 111; and CDR-H3 comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs: 107-109 or 112. CDR-L1 comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs: 131-133 or 140; CDR-L2 comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs: 134-136 or 141; and CDR-L3 comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs: 137-139 or 142.
[0113] In some embodiments of the anti-CD70 binding domain, the heavy chain variable region comprises an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to any sequence selected from SEQ ID NOs: 151-153 and 157. In some embodiments, the light chain variable region comprises an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to any sequence selected from SEQ ID NOs: 154-156 and 158.
[0114] In some embodiments of the anti-CD70 binding domain, 1) the heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO: 151, and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO: 154; 2) the heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO: 152, and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO: 155. , CDR-L3 within SEQ ID NO: 153; 3) the heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO: 153, and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO: 156; 4) the heavy chain variable region comprises CDR-H1, CDR-H2, CDR-H3 within SEQ ID NO: 157, and the light chain variable region comprises CDR-L1, CDR-L2, CDR-L3 within SEQ ID NO: 158. Other light chain variable regions, heavy chain variable regions, scFvs, and CARs targeting CD70 can be found in U.S. Patent Application Publication No. 2022 / 0002424, which is incorporated herein by reference in its entirety.
[0115] In some embodiments of the anti-CD70 binding domain, 1) the heavy chain variable region comprises SEQ ID NO: 151 and the light chain variable region comprises SEQ ID NO: 154; 2) the heavy chain variable region comprises SEQ ID NO: 152 and the light chain variable region comprises SEQ ID NO: 155; 3) the heavy chain variable region comprises SEQ ID NO: 153 and the light chain variable region comprises SEQ ID NO: 156; or 4) the heavy chain variable region comprises SEQ ID NO: 157 and the light chain variable region comprises SEQ ID NO: 158.
[0116] In some embodiments of the anti-CD70 binding domain, the heavy chain variable region and / or the light chain variable region comprise a framework. In some embodiments, the heavy chain variable region comprises FW-H1, FW-H2, FW-H3, and FW-H4. In some embodiments, the heavy chain variable region comprises, from N-terminus to C-terminus, the following order: FW-H1, CDR-H1, FW-H2, CDR-H2, FW-H3, CDR-H3, and FW-H4. In some embodiments, the light chain variable region comprises FW-L1, FW-L2, FW-L3, and FW-L4. In some embodiments, the light chain variable region comprises, from N-terminus to C-terminus, the following order: FW-L1, CDR-L1, FW-L2, CDR-L2, FW-L3, CDR-L3, FW-L4. In some embodiments, FW-H1 comprises a sequence having at least 95%, 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs: 73-76, FW-H2 comprises a sequence having at least 95%, 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs: 77-80, FW-H3 comprises a sequence having at least 95%, 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs: 81-96, and FW-H4 comprises a sequence having at least 95%, 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs: 97-101. FW-L1 comprises a sequence having at least 95%, 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs: 113 to 116, FW-L2 comprises a sequence having at least 95%, 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs: 117 to 120, FW-L3 comprises a sequence having at least 95%, 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs: 121 to 124, and FW-L4 comprises a sequence having at least 95%, 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs: 125 to 130.
[0117] In some embodiments of the anti-CD70 binding domain, the heavy chain variable domain is encoded by a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to any sequence selected from SEQ ID NOs: 143-145 and 149.
[0118] In some embodiments of the anti-CD70 binding domain, the light chain variable domain is encoded by a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to any sequence selected from SEQ ID NOs: 146-148 and 150.
[0119] In some embodiments, the anti-CD70 binding domain is an antibody, a Fab' fragment, a F(ab')2 fragment, or an scFv.
[0120] In some embodiments, the anti-CD70 binding domain is encoded by a polynucleotide sequence that comprises a sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to one or more of SEQ ID NOs: 30-32 or 34-37, or to a range defined by any two of the foregoing percentages. In some embodiments, the anti-CD70 binding domain comprises an amino acid sequence having at least about 85%, about 90%, about 95%, or more sequence identity to one or more of SEQ ID NOs: 47-49 or 51-54.
[0121] In some embodiments, the anti-CD70 binding domain comprises a heavy chain variable region (VH) comprising CDR-H1, CDR-H2, and CDR-H3. In some embodiments, CDR-H1 comprises the amino acid sequence set forth in SEQ ID NO: 102, 103, 110, or 205. In some embodiments, CDR-H2 comprises the amino acid sequence set forth in SEQ ID NO: 104, 105, 106, 111, 206, or 225. In some embodiments, CDR-H3 comprises the amino acid sequence set forth in SEQ ID NO: 107, 108, 109, 112, 207, or 226. In some embodiments, the VH comprises CDR-H1, CDR-H2, and CDR-H3 comprising the amino acid sequences set forth in SEQ ID NO: 205, 206, and 207, respectively. In some embodiments, the VH comprises CDR-H1, CDR-H2, and CDR-H3 comprising the amino acid sequences set forth in SEQ ID NOs: 110, 111, and 112, respectively. In some embodiments, the VH comprises CDR-H1, CDR-H2, and CDR-H3 comprising the amino acid sequences set forth in SEQ ID NOs: 205, 225, and 226, respectively. In some embodiments, the VH comprises the amino acid sequence set forth in SEQ ID NOs: 151, 152, 153, or 157. In some embodiments, the VH comprises the amino acid sequence set forth in SEQ ID NO: 151. In some embodiments, the VH comprises the amino acid sequence set forth in SEQ ID NO: 152. In some embodiments, the VH comprises the amino acid sequence set forth in SEQ ID NO: 153. In some embodiments, the VH comprises the amino acid sequence set forth in SEQ ID NO: 157.
[0122] In some embodiments, the anti-CD70 binding domain comprises a light chain variable region (VL) comprising CDR-L1, CDR-L2, and CDR-L3. In some embodiments, CDR-L1 comprises the amino acid sequence set forth in SEQ ID NO: 131, 132, 133, 140, 204, or 209. In some embodiments, CDR-L2 comprises the amino acid sequence set forth in SEQ ID NO: 134, 135, 136, 141, 210, or 223. In some embodiments, CDR-L3 comprises the amino acid sequence set forth in SEQ ID NO: 137, 138, 139, 142, 211, or 224. In some embodiments, the VL comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences set forth in SEQ ID NO: 209, 210, and 211, respectively. In some embodiments, the VL comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences set forth in SEQ ID NOs: 140, 141, and 142, respectively. In some embodiments, the VL comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences set forth in SEQ ID NOs: 204, 223, and 224, respectively. In some embodiments, the VL comprises the amino acid sequence set forth in SEQ ID NOs: 154, 155, 156, or 158. In some embodiments, the VL comprises the amino acid sequence set forth in SEQ ID NO: 154. In some embodiments, the VL comprises the amino acid sequence set forth in SEQ ID NO: 155. In some embodiments, the VL comprises the amino acid sequence set forth in SEQ ID NO: 156. In some embodiments, the VL comprises the amino acid sequence set forth in SEQ ID NO: 158.
[0123] In some embodiments, the VH comprises CDR-H1, CDR-H2, and CDR-H3 comprising the amino acid sequences set forth in SEQ ID NOs: 205, 206, and 207, respectively; and the VL comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences set forth in SEQ ID NOs: 209, 210, and 211, respectively. In some embodiments, the VH comprises the amino acid sequence set forth in SEQ ID NO: 153, and the VL comprises the amino acid sequence set forth in SEQ ID NO: 156.
[0124] In some embodiments, the VH comprises CDR-H1, CDR-H2, and CDR-H3 comprising the amino acid sequences set forth in SEQ ID NOs: 110, 111, and 112, respectively; and the VL comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences set forth in SEQ ID NOs: 140, 141, and 142, respectively. In some embodiments, the VH comprises the amino acid sequence set forth in SEQ ID NO: 157, and the VL comprises the amino acid sequence set forth in SEQ ID NO: 158.
[0125] In some embodiments, the VH comprises CDR-H1, CDR-H2, and CDR-H3 comprising the amino acid sequences set forth in SEQ ID NOs: 205, 225, and 226, respectively; and the VL comprises CDR-L1, CDR-L2, and CDR-L3 comprising the amino acid sequences set forth in SEQ ID NOs: 204, 223, and 224, respectively. In some embodiments, the VH comprises the amino acid sequence set forth in SEQ ID NO: 152, and the VL comprises the amino acid sequence set forth in SEQ ID NO: 155.
[0126] In some embodiments, the anti-CD70 binding domain comprises a VH and a VL linked by a linker. In some embodiments, the anti-CD70 binding domain is an scFv. In some embodiments, the CAR disclosed herein comprises an scFv as a binding agent for tumor antigen. In some embodiments, the linker comprises the amino acid sequence of SEQ ID NO: 50 or 208.
[0127] In some embodiments, the scFv comprises an amino acid sequence having at least about 85%, about 90%, about 95%, or more sequence identity to one or more of SEQ ID NOs: 25-26, 47-49, and / or 51-54. In some embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 25. In some embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 26. In some embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 47. In some embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 48. In some embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 49. In some embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 51. In some embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 52. In some embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 53. In some embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 54.
[0128] Also disclosed herein are CARs. In some embodiments, the CAR is an anti-CD70 CAR. In some embodiments, the CAR comprises one or more of the anti-CD70 binding domains disclosed herein.
[0129] In some embodiments, the CAR further comprises an OX40 subdomain and a CD3 zeta subdomain. In some embodiments, the OX40 subdomain is encoded by a sequence having at least 95% sequence identity to SEQ ID NO:5. In some embodiments, the OX40 subdomain comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 99%, or at least 100% sequence identity to SEQ ID NO:6. In some embodiments, the OX40 subdomain comprises the amino acid sequence of SEQ ID NO:6. In some embodiments, the CD3 zeta subdomain is encoded by a sequence having at least 95% sequence identity to SEQ ID NO:7. In some embodiments, the CD3 zeta subdomain comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 99%, or at least 100% sequence identity to SEQ ID NO:8. In some embodiments, the CD3 zeta subdomain comprises the amino acid sequence of SEQ ID NO:8. In some embodiments, the mbIL15 is encoded by a sequence having at least 95% sequence identity to SEQ ID NO:27. In some embodiments, mbIL15 comprises the amino acid sequence of SEQ ID NO: 213. In some embodiments, one or more of SEQ ID NOs: 30-32 and / or 34-37, the polynucleotide encoding the OX40 subdomain, the polynucleotide encoding the CD3 zeta subdomain, and the polynucleotide encoding mbIL15 are arranged in a 5' to 3' direction within the polynucleotide.
[0130] In some embodiments, an anti-CD70 CAR is provided and is encoded by a polynucleotide that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to one or more of SEQ ID NOs: 40-46, or a portion thereof (e.g., excluding the mbIL15 sequence and / or the self-cleaving peptide sequence), or to an extent defined by any two of the foregoing percentages. In some embodiments, the CAR comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to one or more of SEQ ID NOs: 55-63, or a portion thereof (e.g., excluding the mbIL15 sequence and / or the self-cleaving peptide sequence), or to an extent defined by any two of the foregoing percentages. In some embodiments, the CAR comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identity to one or more of SEQ ID NOs: 64-72, or a portion thereof, or to a range defined by any two of the foregoing percentages. In some embodiments, the CAR comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identity to any one of SEQ ID NOs: 214-222, or to a range defined by any two of the foregoing percentages. In some embodiments, the CAR comprises an amino acid sequence of any one of SEQ ID NOs: 214-222.
[0131] In some embodiments, a polynucleotide is provided that encodes an anti-CD70 binding domain / CD8a hinge / CD8a transmembrane domain / OX40 / CD3 zeta chimeric antigen receptor complex (see FIG. 1, CD70 CARa). The polynucleotide comprises or consists of an anti-CD70 binding domain, a CD8α hinge, a CD8a transmembrane domain, an OX40 domain, and a CD3 zeta domain, as described herein. In some embodiments, the polynucleotide further encodes mbIL15 (see FIG. 1, CD70CARb). In some embodiments, the anti-CD70 binding domain comprises an scFv. In some embodiments, the anti-CD70 scFv is encoded by a nucleic acid molecule having a sequence according to any one of SEQ ID NOs: 30-32 or 34-37. In some embodiments, the anti-CD70 scFv is encoded by a nucleic acid sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity, homology, and / or functional equivalence to any one of SEQ ID NOs: 30-32 or 34-37. In some embodiments, the scFv comprises amino acids having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity, homology, and / or functional equivalence to any one of SEQ ID NOs: 47-49 or 51-54. In some embodiments, the anti-CD70 CAR is encoded by a nucleic acid sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity, homology, and / or functional equivalence with any one of SEQ ID NOs: 38-46, or a portion thereof (e.g., a portion excluding the mbIL15 sequence and / or the self-cleaving peptide sequence).In some embodiments, the anti-CD70 CAR comprises an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity, homology, and / or functional equivalence to any one of SEQ ID NOs: 55-63, or a portion thereof (e.g., excluding the mbIL15 sequence and / or the self-cleaving peptide sequence). In some embodiments, the anti-CD70 CAR comprises an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity, homology, and / or functional equivalence to any one of SEQ ID NOs: 64-72, or a portion thereof. In some embodiments, the anti-CD70 CAR comprises an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity, homology, and / or functional equivalence to any one of SEQ ID NOs: 214-222, or a portion thereof.
[0132] In some embodiments, a polynucleotide is provided that encodes an anti-CD70 scFv / CD8a hinge / CD8a transmembrane domain / OX40 / CD3 zeta chimeric antigen receptor complex (see FIG. 1, NK71). The polynucleotide comprises or consists of an anti-CD70 scFv encoded by a nucleic acid sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity, homology, and / or functional equivalence with SEQ ID NO:23. In some embodiments, the polynucleotide further encodes mbIL15. In some embodiments, the polynucleotide encodes an scFv that shares at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity, homology, and / or functional equivalence with SEQ ID NO:25.
[0133] In some embodiments, a polynucleotide is provided that encodes an anti-CD70 scFv / CD8a hinge / CD8a transmembrane domain / OX40 / CD3 zeta chimeric antigen receptor complex (see FIG. 1, NK72). The polynucleotide comprises or consists of an anti-CD70 scFv encoded by a nucleic acid sequence that shares at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity, homology, and / or functional equivalence with SEQ ID NO:24. In some embodiments, the polynucleotide further encodes mbIL15. In some embodiments, the polynucleotide encodes an scFv that shares at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity, homology, and / or functional equivalence with SEQ ID NO:26. However, in some embodiments, the anti-CD70 CAR disclosed herein does not comprise an scFv of SEQ ID NO:25 or 26.
[0134] Also provided herein are natural killer (NK) cells expressing any of the anti-CD70 CARs described herein. In some embodiments, the CAR comprises the amino acid sequence of any one of SEQ ID NOs: 214-222. In some embodiments, the CAR comprises the amino acid sequence of SEQ ID NO: 214. In some embodiments, the CAR comprises the amino acid sequence of SEQ ID NO: 215. In some embodiments, the CAR comprises the amino acid sequence of SEQ ID NO: 216. In some embodiments, the CAR comprises the amino acid sequence of SEQ ID NO: 217. In some embodiments, the CAR comprises the amino acid sequence of SEQ ID NO: 218. In some embodiments, the CAR comprises the amino acid sequence of SEQ ID NO: 219. In some embodiments, the CAR comprises the amino acid sequence of SEQ ID NO: 220. In some embodiments, the CAR comprises the amino acid sequence of SEQ ID NO: 221. In some embodiments, the CAR comprises the amino acid sequence of SEQ ID NO: 222.
[0135] In some embodiments, a genetically engineered natural killer cell population for cancer immunotherapy is provided. In some embodiments, the population comprises a plurality of NK cells expanded in culture. In some embodiments, at least a portion of the plurality of NK cells is engineered to express a chimeric antigen receptor comprising a tumor-binding domain, a transmembrane domain, and a cytotoxic signaling complex. In some embodiments, the tumor-binding domain targets CD70 and is encoded by a polynucleotide comprising a sequence having at least 85%, at least 90%, or at least 95% sequence identity to SEQ ID NO: 23 or 24. In some embodiments, the tumor-binding domain targets CD70 and comprises an amino acid sequence having at least 85%, at least 90%, or at least 95% or more sequence identity to SEQ ID NO: 25 or 26.
[0136] In some embodiments, the NK cells are genetically edited to express reduced levels of CD70 compared to unedited NK cells expanded in culture. In some embodiments, the reduced CD70 expression was engineered via editing of the endogenous CD70 gene. In some embodiments, the NK cells are further genetically edited to express reduced levels of CIS protein encoded by the CISH gene compared to unengineered NK cells. In some embodiments, the reduced CIS expression was engineered via editing of the CISH gene. In some embodiments, the genetically engineered NK cells exhibit one or more of increased proliferation capacity, increased cytotoxicity against target cells, and increased persistence compared to NK cells expressing native levels of CIS. In some embodiments, the NK cells are further genetically edited to express reduced levels of CD70 protein. In some embodiments, the reduced CD70 expression was achieved via editing of the gene encoding said CD70. In some embodiments, the genetically engineered NK cells exhibit one or more of increased proliferation capacity, increased cytotoxicity against target cells, and increased persistence compared to NK cells expressing native levels of CD70. In some embodiments, the NK cells are further genetically edited to express a reduced level of CBLB protein. In some embodiments, the reduced CBLB expression is achieved through editing the gene encoding said CBLB protein. In some embodiments, the genetically engineered NK cells exhibit one or more of the following, compared to NK cells expressing natural levels of CBLB protein: increased expansion capacity, increased cytotoxicity against target cells, and increased persistence.
[0137] In some embodiments, the tumor binding domain targets CD70 and is encoded by a polynucleotide comprising a sequence having at least 85%, at least 90%, or at least 95% sequence identity to SEQ ID NO: 30-32 or 34-37. In some embodiments, the tumor binding domain targets CD70 and comprises an amino acid sequence having at least 85%, at least 90%, or at least 95% or more sequence identity to SEQ ID NO: 47-49 or 51-54. In some embodiments, the NK cells are genetically edited to express reduced levels of CD70 compared to unedited NK cells expanded in culture. In some embodiments, the reduced CD70 expression was engineered via editing of the endogenous CD70 gene. In some embodiments, the NK cells are further genetically edited to express reduced levels of CIS protein encoded by the CISH gene compared to unengineered NK cells. In some embodiments, the reduced CIS expression was engineered via editing of the CISH gene. In some embodiments, the engineered NK cells exhibit one or more of an increased expansion capacity, increased cytotoxicity against target cells, and increased persistence compared to NK cells expressing native levels of CIS. In some embodiments, the NK cells are further genetically edited to express a reduced level of CD70 protein. In some embodiments, the reduced CD70 expression was achieved via editing of the gene encoding said CD70. In some embodiments, the engineered NK cells exhibit one or more of an increased expansion capacity, increased cytotoxicity against target cells, and increased persistence compared to NK cells expressing native levels of CD70. In some embodiments, the NK cells are further genetically edited to express a reduced level of CBLB protein. In some embodiments, the reduced CBLB expression was achieved via editing of the gene encoding said CBLB protein. In some embodiments, the engineered NK cells exhibit one or more of an increased expansion capacity, increased cytotoxicity against target cells, and increased persistence compared to NK cells expressing native levels of CBLB protein.
[0138] Also disclosed herein are cells comprising any one of the anti-CD70 binding domains disclosed herein and / or any one of the CARs disclosed herein. In some embodiments, the cell is an immune cell. In some embodiments, the cell is a NK cell or a T cell. In some embodiments, the cell is gene edited to express reduced levels of CISH, CBLB, CD70, or any combination thereof, compared to an unengineered cell. In some embodiments, the cell is gene edited with one or more guide RNAs having at least 95% sequence identity to SEQ ID NOs: 159-201. In some embodiments, the cell comprises a genomic disruption within a target sequence of the CD70 gene, the target sequence being selected from any one of SEQ ID NOs: 177-180. In some embodiments, the cell comprises a genomic disruption within a target sequence of the CISH gene, the target sequence being selected from any one of SEQ ID NOs: 181-191. In some embodiments, the cell comprises a genomic disruption within a target sequence of the CBLB gene, the target sequence being selected from any one of SEQ ID NOs: 192-195. In some embodiments, the cell comprises a genomic disruption within a target sequence of the CD70 gene, the target sequence being selected from any one of SEQ ID NOs: 177-180; a genomic disruption within a target sequence of the CISH gene, the target sequence being selected from any one of SEQ ID NOs: 181-191; and a genomic disruption within a target sequence of the CBLB gene, the target sequence being selected from any one of SEQ ID NOs: 192-195. In some embodiments, the cell comprises a genomic disruption within a target sequence of SEQ ID NO: 180; a genomic disruption within a target sequence of SEQ ID NO: 191; and a genomic disruption within a target sequence of SEQ ID NO: 195.
[0139] Unless otherwise indicated to the contrary, sequences provided for guide RNAs (gRNAs) described using deoxyribonucleotides refer to target DNA sequences (complementary to the corresponding non-target DNA sequence to which the gRNA binds) and should also be considered as referring to the RNA guide actually used (e.g., considered as employing ribonucleotides, where the ribonucleotide uracil is used in place of the deoxyribonucleotide thymine, or conversely, thymine is used in place of uracil, when describing either the RNA or DNA sequence, both are base pairs complementary to adenine). In other words, the sequences provided for a particular gRNA in Table 1 are identical to the gRNA sequence actually used, except that the gRNA sequence contains uracil instead of thymine. For example, a gRNA having the sequence TCACCAAGCCCGCGACCAATGGG (SEQ ID NO: 202) is also referred to as the following sequence UCACCAAGCCCGCGACCAAUGGG (SEQ ID NO: 203), or a gRNA having the sequence UCACCAAGCCCGCGACCAAUGGG (SEQ ID NO: 203) is also referred to as the following sequence TCACCAAGCCCGCGACCAATGGG (SEQ ID NO: 202). Furthermore, the non-target DNA sequence to which a particular gRNA sequence binds is complementary to the sequence of the particular gRNA. For example, a gRNA having the provided sequence of TCACCAAGCCCGCGACCAATGGG (SEQ ID NO: 202) binds to a non-target DNA sequence of AGTGGTTCGGGGCGCTGGTTACCC (SEQ ID NO: 212). In this situation, the corresponding target DNA sequence complementary to the non-target DNA sequence is TCACCAAGCCCGCGACCAATGGG (SEQ ID NO: 202).
[0140] Table 1 provides a non-limiting list of gRNAs used to edit the indicated target genes. gRNAs having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with these listed gRNAs are also within the scope of this disclosure.
[0141] [Table 1] TIFF2025508050000003.tif82160
[0142] Treatment Methods, Administration, and Dosage Some embodiments relate to methods of treating, ameliorating, inhibiting, or preventing cancer using cells or immune cells comprising chimeric antigen receptors and / or activated chimeric receptors as disclosed herein. In some embodiments, the methods include treating or preventing cancer. In some embodiments, the methods include administering a therapeutically effective amount of immune cells expressing tumor-targeting chimeric antigen receptors and / or tumor-targeting chimeric receptors as described herein. Examples of types of cancer that can be treated in this way are described herein.
[0143] Disclosed herein is a method for treating cancer in a subject.In some embodiments, the method comprises administering to a subject any one of the anti-CD70 binding domains disclosed herein, any one of the CARs disclosed herein, or any one of the cells disclosed herein, or any combination thereof.
[0144] Also disclosed herein is the use of any one of the anti-CD70 binding domains disclosed herein, any one of the CARs disclosed herein, any one of the cells disclosed herein, or any combination thereof for the treatment of cancer. Also disclosed herein is the use of any one of the anti-CD70 binding domains disclosed herein, any one of the CARs disclosed herein, any one of the cells disclosed herein, or any combination thereof in the manufacture of a medicament for the treatment of cancer.
[0145] In certain embodiments, treatment of a subject with a genetically engineered cell(s) described herein achieves one, two, three, four, or more of the following effects, including, for example, (i) a reduction or amelioration of the severity of a disease or a symptom associated therewith; (ii) a reduction in the duration of a symptom associated with a disease; (iii) protection against progression of a disease or a symptom associated therewith; (iv) a regression of a disease or a symptom associated therewith; (v) protection against the onset or onset of a symptom associated with a disease; (vi) protection against recurrence of a symptom associated with a disease; (vii) a reduction in the hospitalization of a subject; (viii) a reduction in the length of hospitalization; (ix) an increase in survival of a subject with a disease; (x) a reduction in the number of symptoms associated with a disease; (xi) an enhancement, improvement, complement, supplement, or augmentation of the prophylactic or therapeutic effect of another therapy. Each of these comparisons is to a different therapy for a disease, including, for example, a cell-based immunotherapy for a disease using cells that do not express a construct disclosed herein.
[0146] Administration can be by a variety of routes, including, but not limited to, intravenous, intraarterial, subcutaneous, intramuscular, intrahepatic, intraperitoneal, and / or local delivery to the affected tissue. The dose of immune cells, such as NK cells and / or T cells, can be readily determined for a given subject based on their weight, disease type and condition, and the desired aggressiveness of the treatment, but may range from about 10 to about 20% depending on the embodiment. 5 cells / kg~about 10 12 cells / kg (e.g., 10 5 ~10 7 , 10 7 ~10 10 , 10 10 ~10 12 and overlapping ranges therein). In one embodiment, a dose escalation regimen is used. In some embodiments, various immune cells, such as NK and / or T cells, are administered at a dose of, for example, about 1×10 6 cells / kg ~ approx. 1×10 8 In some embodiments, immune cells such as NK cells and / or T cells are administered in the range of, for example, about 300×10 6 Cells ~ approx. 10×109 In some embodiments, immune cells such as NK cells are administered in the range of about 1×10 6 cells / kg ~ approx. 1×10 8 In some embodiments, immune cells such as NK cells are administered in the range of about 300×10 6 Cells ~ approx. 10×10 9 In some embodiments, the range of cells is about 300×10 6 In some embodiments, about 1×10 NK cells are administered. 9 In some embodiments, about 1.5×10 NK cells are administered. 9 NK cells are administered.
[0147] Depending on the embodiment, various types of cancer can be treated, hi some embodiments, the cancer is a CD70-expressing cancer.
[0148] In some embodiments, hepatocellular carcinoma is treated. Further embodiments provided herein include the treatment or prevention of the following non-limiting examples of cancer, including but not limited to acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), adrenal cortical carcinoma, Kaposi's sarcoma, lymphoma, gastrointestinal cancer, appendix cancer, central nervous system cancer, basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, brain tumors (including but not limited to astrocytoma, spinal cord tumor, brain stem glioma, glioblastoma, craniopharyngioma, ependymoblastoma, ependymoma, medulloblastoma, medulloblastoma), breast cancer, bronchial tumor, Burkitt's lymphoma, and the like. cancer, cervical cancer, colon cancer, chronic lymphocytic leukemia (CLL), chronic myelogenous leukemia (CML), chronic myeloproliferative disorders, ductal carcinoma, endometrial cancer, esophageal cancer, gastric cancer, Hodgkin's lymphoma, non-Hodgkin's lymphoma, hairy cell leukemia, renal cell carcinoma, leukemia, oral cancer, nasopharyngeal cancer, liver cancer, lung cancer (e.g., but not limited to, non-small cell lung cancer (NSCLC) and small cell lung cancer), pancreatic cancer, intestinal cancer, lymphoma, melanoma, eye cancer, ovarian cancer, pancreatic cancer, prostate cancer, pituitary cancer, uterine cancer, and vaginal cancer.
[0149] In some embodiments, the present specification also provides a method for the treatment of cancer, comprising administering to a patient a therapeutic agent that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% (and ranges thereof) sequence identity and / or homology to the respective nucleic acid or amino acid sequence of SEQ ID NOs: 1-203 (or a combination of two or more of SEQ ID NOs: 1-203), and that exhibits, without limitation, (i) increased proliferation, (ii) increased activation, (iii) receptors encoded by the nucleic acid and amino acid sequences, as compared to the respective nucleic acid or amino acid sequences of SEQ ID NOs: 1-203 (or a combination of two or more of SEQ ID NOs: 1-203). Also provided are nucleic acid or amino acid sequences that also exhibit one or more of the following functions, including: (i) increased cytotoxic activity against cells presenting a ligand bound by NK cells; (ii) increased homing to tumors or sites of infection; (iii) decreased off-target cytotoxic effects; (iv) increased secretion of immunostimulatory cytokines and chemokines (including, but not limited to, IFNg, TNFa, IL-22, CCL3, CCL4, and CCL5); (vii) increased ability to stimulate further innate and adaptive immune responses; and (viii) combinations thereof.
[0150] In some embodiments, also provided herein are nucleic acid or amino acid sequences that have at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% (and ranges therebetween) sequence identity and / or homology to the respective nucleic acid or amino acid sequences of SEQ ID NOs: 1-226 (or combinations of two or more of SEQ ID NOs: 1-226), and exhibit, but are not limited to, (i) increased proliferation, (ii) increased activation, (iii) increased expression of the receptor encoded by the nucleic acid and amino acid sequences, as compared to the respective SEQ ID NOs: 1-226 (or combinations of two or more of SEQ ID NOs: 1-226). Also provided are nucleic acid or amino acid sequences that also exhibit one or more of the following functions, including: (i) increased cytotoxic activity against cells presenting a ligand bound by NK cells having the NK polypeptide; (iv) increased homing to tumors or sites of infection; (v) decreased off-target cytotoxic effects; (vi) increased secretion of immunostimulatory cytokines and chemokines (including, but not limited to, IFNg, TNFa, IL-22, CCL3, CCL4, and CCL5); (vii) increased ability to stimulate further innate and adaptive immune responses; and (viii) combinations thereof.
[0151] Additionally, in some embodiments, amino acid sequences corresponding to any of the nucleic acids disclosed herein are provided, taking into account the degeneracy of the nucleic acid code. Additionally, sequences (either nucleic acid or amino acid) that differ from those explicitly disclosed herein but have functional similarity or equivalence are also contemplated within the scope of the present disclosure. The above includes mutations, truncations, substitutions, or other types of modifications.
[0152] In some embodiments, the polynucleotide encoding the disclosed cytotoxic receptor complex is mRNA.In some embodiments, the polynucleotide is DNA.In some embodiments, the polynucleotide is operably linked to at least one regulatory element for the expression of the cytotoxic receptor complex.
[0153] Furthermore, according to some embodiments, a vector is provided that comprises a polynucleotide encoding any of the polynucleotides provided herein, and the polynucleotide may be operably linked to at least one regulatory element for expression of a cytotoxic receptor complex. In some embodiments, the vector is a retrovirus.
[0154] Further provided herein are engineered immune cells (e.g., NK and / or T cells) comprising the polynucleotides, vectors, or cytotoxic receptor complexes disclosed herein. Further provided herein are compositions comprising a mixture of engineered immune cells (e.g., NK cells and / or engineered T cells), each population comprising the polynucleotides, vectors, or cytotoxic receptor complexes disclosed herein. Further provided herein are compositions comprising a mixture of engineered immune cells (e.g., NK cells and / or engineered T cells), each population comprising the polynucleotides, vectors, or cytotoxic receptor complexes disclosed herein, and the T cell population is genetically modified to reduce / eliminate gvHD and / or HvD. In some embodiments, the NK cells and T cells are from the same donor. In some embodiments, the NK cells and T cells are from different donors. In some embodiments, one or more genes are edited (e.g., knocked out or knocked in) to confer one or more enhanced functions or characteristics to the edited cells. For example, in some embodiments, CIS protein is substantially reduced by editing CISH, which results in increased NK cell proliferation, cytotoxicity and / or persistence.
[0155] The dose of immune cells, such as NK cells and / or T cells, can be readily determined for a given subject based on their weight, disease type and condition, and the desired aggressiveness of the treatment, but may range from about 10 to about 20% depending on the embodiment. 5 cells / kg~about 10 12 cells / kg (e.g., 10 5 ~107 , 10 7 ~10 10 , 10 10 ~10 12 and overlapping ranges therein). In one embodiment, a dose escalation regimen is used. In some embodiments, the various NK cells are administered at a dose ranging from, for example, about 1×10 6 cells / kg ~ approx. 1×10 8 Between cells / kg are administered. Depending on the embodiment, various types of cancer or infectious diseases can be treated.
[0156] Type of Cancer Some embodiments of the compositions and methods described herein relate to administering tumor-tropic chimeric antigen receptors and / or immune cells comprising tumor-tropic chimeric receptors to patients with cancer. Various embodiments provided herein include the treatment or prevention of the following non-limiting examples of cancers, including both solid and suspension tumors. Examples of cancers include, but are not limited to, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), adrenal cortical carcinoma, Kaposi's sarcoma, lymphoma, gastrointestinal cancer, appendix cancer, central nervous system cancer, basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, brain tumors (e.g., but not limited to, astrocytoma, spinal cord tumor, brain stem glioma, craniopharyngioma, ependymoblastoma, ependymoma, medulloblastoma, medulloblastoma), breast cancer, bronchial tumor, Burkitt's lymphoma, cervical cancer, colon cancer, chronic lymphocytic leukemia (CLL), and other cancers. LL), chronic myelogenous leukemia (CML), chronic myeloproliferative disorders, ductal carcinoma, endometrial cancer, esophageal cancer, gastric cancer, Hodgkin's lymphoma, non-Hodgkin's lymphoma, hairy cell leukemia, renal cell carcinoma, leukemia, oral cancer, nasopharyngeal cancer, liver cancer, lung cancer (e.g., but not limited to, non-small cell lung cancer (NSCLC) and small cell lung cancer), pancreatic cancer, intestinal cancer, lymphoma, melanoma, eye cancer, ovarian cancer, pancreatic cancer, prostate cancer, pituitary cancer, uterine cancer, and vaginal cancer. In some embodiments, the cancer comprises a solid tumor. In some embodiments, the cancer is esophageal cancer. In some embodiments, the cancer is head and neck cancer. In some embodiments, the cancer is lung cancer. In some embodiments, the cancer is liver cancer. In some embodiments, the cancer is colorectal cancer. In some embodiments, the cancer is bladder cancer. In some embodiments, the cancer is cervical cancer. In some embodiments, the cancer is endometrial cancer. In some embodiments, the cancer is ovarian cancer. In some embodiments, the cancer is uterine cancer. In some embodiments, the cancer is melanoma.
[0157] Cancer Targeting Some embodiments of the compositions and methods described herein relate to immune cells that contain chimeric receptors that target cancer antigens. Non-limiting examples of target antigens include CD70, CD5, CD19; CD123; CD22; CD30; CD171; CS1 (also called CD2 subset 1, CRACC, SLAMF7, CD319, and 19A24); TNF receptor family member B cell maturation (BCMA); CD38; DLL3; G protein-coupled receptor class C group 5, member D (GPRC5D); epidermal growth factor receptor (EGFR) CD138; prostate specific membrane antigen (PSMA); tyrosine kinase 3 (FLT3), etc. Fms; KREMEN2 (kringle-containing transmembrane protein 2), ALPPL2, claudin 4, claudin 6, C-type lectin-like molecule-1 (CLL-1 or CLECL1); CD33; epidermal growth factor receptor variant III (EGFRviii); ganglioside G2 (GD2); ganglioside GD3 (aNeu5Ac(2-8)aNeu5Ac(2-3)bDGalp(l-4)bDGlcp(ll)Cer); Tn antigen ((TnAg) or (GalNAca-Ser / Thr)); prostate-specific membrane antigen (PSMA); receptor tyrosine kinase-like orphan receptor 1 (ROR1); Fms like tyrosine kinase 3 (FLT3); tumor-associated glycoprotein 72 (TAG72); CD38; CD44v6; glycosylated CD43 epitope expressed in acute leukemia or lymphoma but not hematopoietic progenitor cells, glycosylated CD43 epitope expressed in non-hematopoietic cancers, carcinoembryonic antigen (CEA); epithelial cell adhesion molecule (EPCAM); B7H3 (CD276); KIT (CD117); interleukin-13 receptor subunit nit alpha-2 (IL-13Ra2 or CD213A2); mesothelin; interleukin 11 receptor alpha (IL-IIRa); prostate stem cell antigen (PSCA); protease serine 21 (testisin or PRSS21); vascular endothelial growth factor receptor 2 (VEGFR2); Lewis (Y) antigen; CD24; platelet-derived growth factor receptor beta (PDGFR-beta); stage-specific fetal antigen-4 (SSEA-4); CD20; folate receptor alpha (FRa or FR1); folate receptor beta (FRb);receptor tyrosine protein kinase ERBB2 (Her2 / neu); mucin 1, cell surface associated (MUC1); epidermal growth factor receptor (EGFR); neural cell adhesion molecule (NCAM); prostase; prostatic acid phosphatase (PAP); elongation factor 2 mutated (ELF2M); ephrin B2; fibroblast activation protein alpha (FAP); insulin-like growth factor 1 receptor (IGF-I receptor), carbonic anhydrase IX (CAIX); proteasome (prosome, macropain) subunit, beta, type 9 (LMP2); glycoprotein 100 (gp 100); oncogene fusion protein consisting of breakpoint cluster region (BCR) and Abelson murine leukemia viral oncogene homolog 1 (Abl) (bcr-abl); tyrosinase; ephrin type A receptor 2 (EphA2); sialyl Lewis adhesion molecule (sLe); ganglioside GM3 (aNeu5Ac(2-3)bDClalp(l-4)bDGlcp(ll)Cer); transglutaminase 5 (TGS5); high molecular weight melanoma-associated antigen (HMWMAA); o-acetyl-GD2 ganglioside (OAcGD2); tumor endothelial marker 1 (TEM1 / CD248); tumor endothelial marker 7-related (TEM7R); claudin 6 (CLDN6); thyroid-stimulating hormone receptor (TSHR); G protein-coupled receptor class C group 5, member D (GPRC5D); chromosome X open reading frame 61 (CXORF61); CD97; CD179a; anaplastic lymphoma kinase (ALK); polysialic acid; placenta-specific 1 (PLAC1); hexasaccharide moiety of globoH glycoceramide (GloboH); mammary differentiation antigen (NY-BR-1); uroplakin 2 (UPK2); hepatitis A virus cell receptor 1 (HAVCR1); adrenergic receptor beta 3 (ADRB3); pannexin 3 (PANX3); G protein-coupled receptor 20 (GPR20); lymphocyte antigen 6 complex, locus K9 (LY6K); olfactory receptor 51E2 (OR51E2); TCR gamma alternative reading frame protein (TARP); Wilms tumor protein (WT1); cancer / testis antigen 1 (NY-ES0-1); cancer / testis antigen 2 (LAGE-1a); melanoma-associated antigen 1 (MAGE-A1); ETS translocation variant gene 6 located on chromosome 12p (ETV6-AML);sperm protein 17 (SPA17); X antigen family, member 1A (XAGE1); angiopoietin-binding cell surface receptor 2 (Tie2); melanoma cancer testis antigen-1 (MAD-CT-1); melanoma cancer testis antigen-2 (MAD-CT-2); Fos-related antigen 1; tumor protein p53 (p53); p53 mutant; prostein; survivin; telomerase; prostate cancer tumor antigen-1 (PCT Al or galectin 8), melanoma antigen recognized by T cells 1 (MelanA or MARTI); rat sarcoma (Ras) mutant; human telomerase; reverse transcriptase (hTERT); sarcoma translocation breakpoint; melanoma inhibitor of apoptosis (ML-IAP); ERG (transmembrane protease, serine 2 (TMPRSS2) ETS fusion gene); N-acetylglucosaminyl-transferase V (NA17); paired box protein Pax-3 (PAX3); androgen receptor; cyclin B1; v-myc avian myeloid cell tumor viral oncogene neuroblastoma-derived homolog (MYCN); Ras homolog family member C (RhoC); tyrosinase-related protein 2 (TRP-2); cytochrome P450 IB1 (CYPIB1); CCCTC-binding factor (zinc finger protein)-like (BORIS or Brother of the Regulator of Imprinted Proteins) Sites; squamous cell carcinoma antigen recognized by T cells 3 (SART3); paired box protein Pax-5 (PAX5); proacrosin-binding protein sp32 (OY-TES1); lymphocyte-specific protein tyrosine kinase (LCK); kinase anchor protein 4 (AKAP-4); synovial sarcoma, X-breakpoint 2 (SSX2); receptor for advanced glycation end products (RAGE-1); renal ubiquitous 1 (RU1); renal ubiquitous 2 (RU2); legumain; human papillomavirus E6 (HPVE6); human papillomavirus E7 (HPV E7); intestinal carboxylesterase; heat shock protein 70-2 mutant (mut hsp70-2); CD79a; CD79b; CD72; leukocyte-associated immunoglobulin-like receptor 1 (LAIR1); Fc fragment of the IgA receptor (FCAR or CD89);Leukocyte immunoglobulin-like receptor subfamily A member 2 (LILRA2); CD300 molecule-like family member f (CD300LF); C-type lectin domain family 12 member A (CLEC12A); Bone marrow stromal cell antigen 2 (BST2); EGF-like module-containing mucin-like hormone receptor-like 2 (EMR2); Lymphocyte antigen 75 (LY75); Glypican-3 (GPC3); Fc receptor-like 5 (FCRL5); Immunoglobulin lambda-like polypeptide 1 (IGLLl), MPL, biotin, c-MYC epitope Tag, CD34, LAMP1, TROP2, GFR alpha 4, CDH17, CDH6, NYBR1, CDH19, CD200R, Slea (CA19.9; sialyl Lewis antigen);Fucosyl-GM1, PTK7, gpNMB, CDH1-CD324, DLL3, CD276 / B7H3, ILl lRa, IL13Ra2, CD179b-IGLll, TCR gamma-delta, NKG2D, CD32 (FCGR2A), Tn ag, Tim1- / HVCR1, CSF2RA (GM-CSFR-alpha), TGF beta R2, Lewis Ag, TCR-beta chain, TCR-beta 2 chain, TCR-gamma chain, TCR-delta chain, FITC, luteinizing hormone receptor (LHR), follicle-stimulating hormone receptor (FSHR), gonadotropin hormone receptor (CGHR or GR), CCR4, GD3, SLAMF6, SLAMF4, HIV1 envelope glycoprotein, HTLV1-Tax, CMV pp65, EBV-EBNA3c, KSHV These include antigens recognized by K8.1, KSHV-gH, influenza A hemagglutinin (HA), GAD, PDL1, guanylate cyclase C (GCC), autoantibodies to desmoglein 3 (Dsg3), autoantibodies to desmoglein 1 (Dsgl), HLA, HLA-A, HLA-A2, HLA-B, HLA-C, HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, HLA-DR, HLA-G, IgE, CD99, Ras G12V, tissue factor 1 (TF1), AFP, GPRC5D, claudin 8.2 (CLD18A2 or CLDN18A.2), P-glycoprotein, STEAP1, Liv1, nectin-4, Cripto, gpA33, BST1 / CD157, small conductance chloride channel, and TNT antibodies. ;
[0158] Non-limiting embodiments Among the embodiments provided herein are the following: 1. A genetically engineered natural killer (NK) cell population for cancer immunotherapy, comprising a plurality of NK cells engineered to express a chimeric antigen receptor (CAR) comprising a tumor-binding domain, a transmembrane domain, and a cytotoxic signaling complex; The tumor-binding domain targets CD70, The tumor-binding domain comprises an scFv comprising an amino acid sequence having at least about 90% sequence identity to one or more of SEQ ID NOs: 47-49 or 51-54; the NK cell comprises a genomic disruption within a CD70 protein gene target sequence comprising any one of SEQ ID NOs: 177-180, and optionally, the genomic disruption comprises an endonuclease-mediated indel; The NK cell comprises a genomic disruption within a cytokine-inducible SH2-containing protein gene target sequence comprising any one of SEQ ID NOs: 186 to 191; the NK cell comprises at least one additional genomic disruption within the gene target sequence; A genetically engineered NK cell population, wherein the genetically engineered NK cells containing the genomic disruption exhibit one or more of increased expansion capacity, increased cytotoxicity against target cells, and increased persistence compared to NK cells not containing the genomic disruption. 2. The NK cell population of embodiment 1, wherein the NK cells are expanded in culture. 3. A genetically engineered natural killer (NK) cell population for cancer immunotherapy, comprising a plurality of NK cells expanded in culture; A plurality of NK cells are engineered to express a chimeric antigen receptor (CAR) that contains a tumor-binding domain, a transmembrane domain, and a cytotoxicity signaling complex; The tumor-binding domain targets CD70, The NK cell comprises a genomic disruption within a CD70 protein gene target sequence comprising any one of SEQ ID NOs: 177-180, wherein the genomic disruption comprises an endonuclease-mediated indel; The NK cell comprises a genome disruption within a cytokine-inducible SH2-containing protein gene target sequence comprising any one of SEQ ID NOs: 186 to 191; the NK cell comprises at least one additional genomic disruption within the gene target sequence; A genetically engineered NK cell population, wherein the genetically engineered NK cells containing the genomic disruption exhibit one or more of increased expansion capacity, increased cytotoxicity against target cells, and increased persistence compared to NK cells not containing the genomic disruption. 4. A genetically engineered natural killer (NK) cell population for cancer immunotherapy, comprising a plurality of NK cells expanded in culture; A plurality of NK cells are engineered to express a chimeric antigen receptor (CAR) that contains a tumor-binding domain, a transmembrane domain, and a cytotoxicity signaling complex; The tumor-binding domain targets CD70, The NK cells are gene edited to express reduced levels of CD70 compared to non-edited NK cells that have been expanded in culture, the reduced CD70 expression being engineered via introduction of a genomic disruption in the endogenous CD70 gene; The NK cells are gene-edited to express reduced levels of a cytokine-inducible SH2-containing (CIS) protein encoded by the CISH gene compared to non-edited NK cells, the reduced CIS expression being engineered via introduction of a genomic disruption in the CISH gene; the engineered NK cells exhibit one or more of an increased expansion capacity, increased cytotoxicity against target cells, and increased persistence compared to NK cells expressing native levels of CIS; A genetically engineered NK cell population, wherein the NK cells have been genetically edited to introduce genomic disruptions in two or more additional genes to reduce expression of proteins encoded by said two or more additional genes compared to NK cells that have not been edited in said genes. 5. A genetically engineered natural killer (NK) cell population for cancer immunotherapy, comprising a plurality of NK cells engineered to express a chimeric antigen receptor (CAR) comprising a tumor-binding domain, a transmembrane domain, and a cytotoxic signaling complex; The tumor-binding domain targets CD70, The tumor-binding domain comprises an scFv comprising an amino acid sequence having at least about 90% sequence identity to one or more of SEQ ID NOs: 47-49 or 51-54; A genetically engineered NK cell population, wherein a plurality of NK cells comprise a genomic disruption within a gene target sequence comprising at least three of SEQ ID NOs: 177-195, and optionally, said genomic disruption comprises an endonuclease-mediated indel. 6. The tumor-binding domain comprises a heavy chain variable region and a light chain variable region, the heavy chain variable region comprises CDR-H1, CDR-H2, and CDR-H3, and the light chain variable region comprises CDR-L1, CDR-L2, and CDR-L3; CDR-H1 comprises a sequence having at least 95% sequence identity to one or more sequences selected from SEQ ID NOs: 102, 103, and 110; CDR-H2 comprises a sequence having at least 95% sequence identity to one or more sequences selected from SEQ ID NOs: 104, 105, 106, and 111; CDR-H3 comprises a sequence having at least 95% sequence identity to one or more sequences selected from SEQ ID NOs: 107, 108, 109, and 112; CDR-L1 comprises a sequence having at least 95% sequence identity to one or more sequences selected from SEQ ID NOs: 131, 132, 133, and 140; CDR-L2 comprises a sequence having at least 95% sequence identity to one or more sequences selected from SEQ ID NOs: 134, 135, 136, and 141; 6. The genetically engineered NK cell population of any one of embodiments 1 to 5, wherein CDR-L3 comprises a sequence having at least 95% sequence identity to one or more sequences selected from SEQ ID NOs: 137, 138, 139, and 142. 7. The genetically engineered NK cell population of any one of embodiments 1-6, wherein the tumor-binding domain comprises a VH, and the VH comprises an amino acid sequence having at least 95% sequence identity to one or more of the amino acid sequences of SEQ ID NOs: 151-153 and 157. 8. The genetically engineered NK cell population of any one of embodiments 1 to 7, wherein the tumor-binding domain comprises a VL, and the VL comprises an amino acid sequence having at least 95% sequence identity to one or more of the amino acid sequences of SEQ ID NOs: 154-156 and 158. 9. The genetically engineered NK cell population of any one of embodiments 1 to 8, wherein the tumor-binding domain comprises a VL and a VH, wherein the VL comprises an amino acid sequence having at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 156, and the VH comprises an amino acid sequence having at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 153. 10. The genetically engineered NK cell population of any one of embodiments 1 to 8, wherein the tumor-binding domain comprises a VL and a VH, wherein the VL comprises an amino acid sequence having at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 155, and the VH comprises an amino acid sequence having at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 152. 11. The genetically engineered NK cell population of any one of embodiments 1 to 8, wherein the tumor-binding domain comprises a VL and a VH, wherein the VL comprises an amino acid sequence having at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 157, and the VH comprises an amino acid sequence having at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 158. 12. The genetically engineered NK cell population of any one of embodiments 1-11, wherein the tumor-binding domain comprises an scFv, and the scFv comprises an amino acid sequence having at least 95% sequence identity to one or more of SEQ ID NOs: 47-49 and 51-54. 13. The genetically engineered NK cell population of any one of embodiments 1-12, wherein the tumor-binding domain comprises a heavy chain variable region (VH), and the VH is encoded by a polynucleotide comprising a sequence having at least 95% sequence identity to one or more of the polynucleotides of SEQ ID NOs: 143-146 and 149. 14. The genetically engineered NK cell population of any one of embodiments 1-13, wherein the tumor-binding domain comprises a light chain variable region (VL), and the VL is encoded by a polynucleotide comprising a sequence having at least 95% sequence identity to one or more of the polynucleotides of SEQ ID NOs: 146-148 and 150. 15. The genetically engineered NK cell population of any one of embodiments 1-14, wherein the tumor-binding domain comprises a single chain variable fragment (scFv), and the scFv is encoded by a polynucleotide comprising a sequence having at least 95% sequence identity to one or more of the polynucleotides of SEQ ID NOs: 30-32 and 34-37. 16. The genetically engineered NK cell population of any one of embodiments 1-15, wherein the cytotoxic signaling complex comprises the OX40 subdomain and the CD3 zeta subdomain. 17. The genetically engineered NK cell population of embodiment 16, wherein the OX40 subdomain is encoded by a sequence having at least 95% sequence identity to SEQ ID NO:5. 18. The genetically engineered NK cell population of any one of embodiments 16-17, wherein the CD3 zeta subdomain is encoded by a sequence having at least 95% sequence identity to SEQ ID NO:7. 19. The genetically engineered NK cell population of any one of embodiments 1-18, wherein the NK cells are engineered to express membrane-bound IL-15 (mbIL15). 20. The genetically engineered NK cell population of embodiment 19, wherein mbIL15 is bicistronic encoded on the polynucleotide encoding the CAR. 21. The genetically engineered NK cell population of any one of embodiments 19 or 20, wherein mbIL15 is encoded by a sequence having at least 95% sequence identity to SEQ ID NO: 27. 22. The genetically engineered NK cell population of any one of embodiments 20 or 21, wherein the polynucleotides encoding CAR and mbIL15 comprise a sequence having at least 95% sequence identity to one or more of the polynucleotides of SEQ ID NOs: 38-46. 23. The genetically engineered NK cell population of any one of embodiments 1-22, wherein the CAR comprises an amino acid sequence having at least 95% sequence identity to one or more of the amino acid sequences of SEQ ID NOs: 64-72. 24. The genetically engineered NK cell population of any one of embodiments 1-23, wherein the engineered NK cells are edited for CD70, CISH, and CBLB. 25. The genetically engineered NK cell population of any one of embodiments 1 to 24, wherein the engineered NK cells are edited with CD70, CISH, CBLB, and additional target genes. 26. The genetically engineered NK cell population of embodiment 25, wherein expression of CD70 is substantially reduced compared to NK cells not edited for CD70, expression of CIS is substantially reduced compared to NK cells not edited for CISH, and expression of CBLB is substantially reduced compared to NK cells not edited for CBLB. 27. The genetically engineered NK cell population of embodiment 25 or 26, wherein the NK cells do not express detectable levels of CD70, CIS, or CBLB proteins. 28. The genetically engineered NK cell population of any one of embodiments 1 to 27, wherein the gene editing to introduce the genomic disruption is performed using the CRISPR-Cas system. 29. The genetically engineered NK cell population of embodiment 28, wherein the CRISPR-Cas system comprises a Cas selected from Cas9, Csn2, Cas4, Cpf1, C2c1, C2c3, Cas13a, Cas13b, Cas13c, CasX, CasY, and combinations thereof. 30. The genetically engineered NK cell population of embodiment 28 or 29, wherein Cas is Cas9. 31. A method of treating cancer in a subject comprising administering to the subject the genetically engineered NK cell population of any one of the preceding embodiments. 32. The method of embodiment 31, wherein the cancer is renal cell carcinoma or is a metastasis from renal cell carcinoma. 33. Use of a genetically engineered NK cell population according to any one of embodiments 1 to 30 in the treatment of cancer. 34. Use of a genetically engineered NK cell population according to any one of embodiments 1 to 30 in the manufacture of a medicament for treating cancer. 35. A method of treating cancer in a subject, comprising: administering to a subject a genetically engineered population of NK cells comprising a plurality of populations of NK cells expanded in culture; The NK cells are engineered to express a chimeric antigen receptor (CAR) that contains a tumor-binding domain, a transmembrane domain, and a cytotoxic signaling complex. The tumor-binding domain targets CD70, The tumor-binding domain comprises an scFv comprising an amino acid sequence having at least about 90% sequence identity to one or more of SEQ ID NOs: 47-49 or 51-54; the NK cell comprises a genomic disruption within a CD70 protein gene target sequence comprising any one of SEQ ID NOs: 177-180, and optionally, the genomic disruption comprises an endonuclease-mediated indel; The NK cell comprises a genomic disruption within a cytokine-inducible SH2-containing protein gene target sequence comprising any one of SEQ ID NOs: 186 to 191; the NK cell comprises at least one additional genomic disruption within the gene target sequence; The method, wherein the genetically engineered NK cells containing the genomic disruption exhibit one or more of increased expansion capacity, increased cytotoxicity against target cells, and increased persistence compared to NK cells not containing the genomic disruption. 36. The method of embodiment 35, wherein the NK cells are further gene-edited to express reduced levels of the CBLB protein encoded by the CBLB gene compared to non-edited NK cells. 37. The tumor-binding domain comprises a heavy chain variable region and a light chain variable region, the heavy chain variable region comprises CDR-H1, CDR-H2, and CDR-H3, and the light chain variable region comprises CDR-L1, CDR-L2, and CDR-L3; CDR-H1 comprises a sequence having at least 95% sequence identity to one or more sequences selected from SEQ ID NOs: 102, 103, and 110; CDR-H2 comprises a sequence having at least 95% sequence identity to one or more sequences selected from SEQ ID NOs: 104, 105, 106, and 111; CDR-H3 comprises a sequence having at least 95% sequence identity to one or more sequences selected from SEQ ID NOs: 107, 108, 109, and 112; CDR-L1 comprises a sequence having at least 95% sequence identity to one or more sequences selected from SEQ ID NOs: 131, 132, 133, and 140; CDR-L2 comprises a sequence having at least 95% sequence identity to one or more sequences selected from SEQ ID NOs: 134, 135, 136, and 141; The method of embodiment 35 or 36, wherein the CDR-L3 comprises a sequence having at least 95% sequence identity to one or more sequences selected from SEQ ID NOs: 137, 138, 139, and 142. 38. The method of any one of embodiments 35 to 37, wherein the tumor-binding domain comprises a VH, wherein the VH comprises an amino acid sequence having at least 95% sequence identity with one or more of the amino acid sequences of SEQ ID NOs: 151 to 153 and 157, and the tumor-binding domain comprises a VL, wherein the VL comprises an amino acid sequence having at least 95% sequence identity with one or more of the amino acid sequences of SEQ ID NOs: 154 to 156 and 158. 39. The method of any one of embodiments 35 to 38, wherein the tumor-binding domain comprises a VL and a VH, wherein the VL comprises an amino acid sequence having at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 156, and the VH comprises an amino acid sequence having at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 153. 40. The method of any one of embodiments 35 to 38, wherein the tumor-binding domain comprises a VL and a VH, wherein the VL comprises an amino acid sequence having at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 155, and the VH comprises an amino acid sequence having at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 152. 41. The method of any one of embodiments 35 to 38, wherein the tumor-binding domain comprises a VL and a VH, wherein the VL comprises an amino acid sequence having at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 157, and the VH comprises an amino acid sequence having at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 158. 42. The method of any one of embodiments 35 to 41, wherein the tumor-binding domain comprises an scFv, and the scFv comprises an amino acid sequence having at least 95% sequence identity to one or more of SEQ ID NOs: 47 to 49 and 51 to 54. 43. The method of any one of embodiments 35-42, wherein the cytotoxic signaling complex comprises the OX40 subdomain and the CD3 zeta subdomain. 44. The method of embodiment 43, wherein the OX40 subdomain is encoded by a sequence having at least 95% sequence identity to SEQ ID NO:5, and the CD3 zeta subdomain is encoded by a sequence having at least 95% sequence identity to SEQ ID NO:7. 45. The method of any one of embodiments 35-44, wherein the NK cells are engineered to express membrane-bound IL-15 (mbIL15). 46. The method of embodiment 45, wherein mbIL15 is bicistronic encoded on the polynucleotide encoding the CAR. 47. The method of embodiment 46, wherein the polynucleotides encoding CAR and mbIL15 comprise a sequence having at least 95% sequence identity to one or more of the polynucleotides of SEQ ID NOs: 38-46. 48. The method of any one of embodiments 45 to 47, wherein mbIL15 is encoded by a sequence having at least 95% sequence identity with SEQ ID NO: 27. 49. The method of any one of embodiments 35-48, wherein the CAR comprises an amino acid sequence having at least 95% sequence identity to one or more of the amino acid sequences of SEQ ID NOs: 64-72. 50. The method of any one of embodiments 35 to 49, wherein gene editing is performed using a CRISPR-Cas system, and Cas comprises a Cas9 enzyme. 51. An anti-CD70 chimeric antigen receptor (CAR) comprising an anti-CD70 binding domain, an OX40 domain, and a CD3 zeta domain, The anti-CD70 CAR comprises an amino acid sequence having at least 95% sequence identity to one or more of the amino acid sequences of SEQ ID NOs: 64-72, or a portion thereof that is capable of generating a cytotoxic signal upon binding to CD70 on a target cell. 52. An anti-CD70 chimeric antigen receptor (CAR) comprising an anti-CD70 binding domain, an OX40 domain, and a CD3 zeta domain, The anti-CD70 CAR comprises an amino acid sequence having at least 95% sequence identity to one or more of the amino acid sequences of SEQ ID NOs: 64-72, or a portion thereof that is capable of generating a cytotoxic signal upon binding to CD70 on a target cell. 53. An anti-CD70 CAR according to embodiment 51 or 52, wherein the anti-CD70 binding domain comprises an scFv having at least 95%, 99%, or 100% sequence identity to any sequence selected from SEQ ID NOs: 47-49 and 51-54. 54. A cell comprising an anti-CD70 CAR according to any one of embodiments 51 to 53. 55. The cell of embodiment 54, wherein the cell is an immune cell. 56. The cell of embodiment 54 or 55, wherein the cell is a NK cell. 57. The cell of any one of embodiments 54 to 56, wherein the cell comprises at least three genomic disruptions within at least three gene target sequences selected from SEQ ID NOs: 159 to 201. 58. A method for treating cancer in a subject, comprising administering to the subject a CAR described in any one of embodiments 51-53, or a cell described in any one of embodiments 54-56. 59. Use of an anti-CD70 CAR according to any one of embodiments 51 to 53, or a cell according to any one of embodiments 54 to 56, for treating cancer. 60. Use of an anti-CD70 CAR according to any one of embodiments 51 to 53, or a cell according to any one of embodiments 54 to 56, in the manufacture of a medicament for treating cancer. 61. A method for generating a genetically engineered immune cell population, comprising: introducing an endonuclease and at least one unique gRNA into an immune cell to induce a genome disruption within at least one gene target sequence; introducing an endonuclease and at least one additional unique gRNA into the immune cell to induce additional genomic disruptions within additional gene target sequences; and Transducing immune cells with a viral vector encoding a CD70-targeting CAR The method includes: 62. The method of embodiment 61, wherein the endonuclease and gRNA are introduced by electroporating the cell. 63. The method of embodiment 61 or 62, wherein the cells comprise NK cells. 64. The method of any one of embodiments 61 to 63, wherein no more than three unique gRNAs are introduced at a time. 65. The method of any one of embodiments 61 to 64, wherein no more than two unique gRNAs are introduced at a time. 66. The method of any one of embodiments 61-65, wherein the cells are expanded in culture for a period of time prior to initial introduction. 67. A method for generating a genetically engineered immune cell population, comprising: Expanding immune cells in culture; introducing an endonuclease and up to two unique gRNAs into immune cells to induce genome disruptions within two distinct gene target sequences; Culturing the cells for an additional period of time; introducing an additional endonuclease and up to two unique gRNAs into the immune cells to induce additional genomic disruptions within up to two additional gene target sequences; and Transducing immune cells with a viral vector encoding a CD70-targeting CAR The method includes: 68. The method of embodiment 67, wherein the endonuclease and gRNA are induced by electroporating the cell. 69. The method of embodiment 67 or 68, wherein the cells comprise NK cells. 70. The method of any one of embodiments 61 to 69, wherein only one additional type of gRNA is used in the second introduction. 71. The method of any one of embodiments 61 to 70, wherein the gRNA targets the CD70, CISH, or CBLB gene. 72. A pharmaceutical composition comprising an engineered natural killer cell population comprising a genomic disruption within a gene target sequence comprising at least three of SEQ ID NOs: 159-203, wherein the genomic disruption optionally comprises an endonuclease-mediated indel. 73. A pharmaceutical composition comprising an engineered natural killer cell population comprising a genomic disruption within a gene target sequence comprising at least three of SEQ ID NOs: 177-195, wherein the genomic disruption optionally comprises an endonuclease-mediated indel. 74. A pharmaceutical composition comprising an engineered natural killer cell population comprising a genomic disruption within a gene target sequence comprising at least two of SEQ ID NOs: 177-195, wherein the genomic disruption optionally comprises an endonuclease-mediated indel; A pharmaceutical composition, wherein the engineered NK cells express a CAR targeting CD70 comprising an scFv comprising an amino acid sequence having at least about 90% sequence identity to one or more of SEQ ID NOs: 47-49 and 51-54. 75. A pharmaceutical composition described in any one of embodiments 72 to 74, wherein the genomic disruption comprises an endonuclease-mediated indel. EXAMPLES
[0159] The following is a non-limiting description of the experimental methods and materials used in the examples disclosed below. [Example 1]
[0160] Screening for CD70-binding factors A screen of various CD70 binding agents was performed to characterize selected features of the binding agents and to determine whether they met various thresholds for proceeding to further experimental protocols related to multiplex gene editing (Table E1). Figure 2 outlines the characteristics of certain binding agents in terms of their ability to inhibit tumor growth in an in vitro assay and the durability or persistence of expression of the CAR incorporating the binding agent at day 15 of the process of transducing NK cells with a retroviral vector encoding a CAR construct that targets CD70 in this example. The "128 series" constructs employ scFvs in a vH-GS3 linker-vL format. The "127 series" employ a vL-linker-vH format, where the linker is an alternative linker with at least 80% sequence identity to the linker of SEQ ID NO:50 (encoded by a polynucleotide with at least 80% sequence identity to SEQ ID NO:33). The "129 series" have selected mutations in mbIL15 bicistronically encoded on the polynucleotide encoding the CAR, but expressed separately. This mutation includes mutations in the hinge sequence that change one or more cysteine residues, for example, to serine or alanine residues. Various CD70 binding factors are indicated by an additional numerical identifier, either 58 binding factor or 71 binding factor in this experiment. Taken together, the two numbers indicate binding factor identification and structure. In other words, NK128.58 employs scFv number 58, which uses the vH-GS3 linker-vL format. As discussed herein, various transmembrane and signaling domains can be used. These non-limiting embodiments of the CAR constructs provided herein employ CD8 alpha hinge and transmembrane domains, OX40 costimulatory domains, and CD3 zeta signaling domains.
[0161] [Table 2]
[0162] As shown in Figure 2, this is replicate data from engineered NK cells from four donors, where the cells were also edited to reduce CD70 expression on the NK cells (e.g., to avoid fratricidality) and further edited to knock out CISH expression. The main trend in the cytotoxicity data is that the 127 and 128 series CARs showed relatively consistent tumor growth inhibition in cells from a given donor. As expected, the ability to inhibit tumor growth was greater at effector:target (E:T) ratios of 1:2 compared to E:T ratios of 1:4. The 129 series CARs appeared to be less robust in terms of inhibiting tumor growth. Even at day 15 post-electroporation (EP), each CAR was expressed in most of the NK cell population (as measured by CAR(D15)%). Although there was some variability, the intensity (e.g., number of CD70 CARs expressed by cells) was relatively high among the CD70 CAR-positive cells.
[0163] Figure 3 shows representative data on the persistence of CAR expression over several weeks. Although the construct expressing the "71" CAR appears to have high persistence over at least the first three weeks, these data are important in showing that each of the selected CAR constructs is well expressed by NK cells over several weeks. A similar trend was seen in the corresponding data for the other two donors (not shown). Figure 4 shows data on the total number of NK cells present in the culture 5 weeks after EP. These data show that there is little variation in cell number regardless of the CAR construct expressed by the NK cells, implying that none of the CARs has a particularly adverse effect on NK cell survival. Similarly, Figure 5 shows data showing limited variation in the proliferation capacity of the NK cell population over the first 15 days of culture, regardless of the CAR expressed.
[0164] To further characterize the 58 and 71 binders, the binders were formatted as full IgG1 and assessed for binding to human primary epithelial cells by flow cytometry. Primary epithelial cell types included bronchial, renal, pancreatic, gastric, liver, spleen, esophageal, colonic, small intestinal, and alveolar cells. As a positive control, binding to CD70-expressing cell lines was also assessed. None of the binders bound to the human epithelial cells tested, but did bind to CD70-expressing cell lines (data not shown).
[0165] Collectively, these data demonstrated that an anti-CD70 CAR construct could be stably expressed by gene-edited NK cells and was able to control tumor growth with limited inhibitory effects on proliferation and NK cell population numbers. [Example 2]
[0166] Further characterization of gene-edited NK cells expressing selected CD70 CARs Additional in vitro experiments were performed to further evaluate the NK cells engineered to be dual gene edited and express the selected CD70-targeting CAR. In this series of experiments, the constructs tested were NK128.58, NK128.71, NK127.58, NK127.71, NK146 and NK147, the latter two employing the same scFv architecture as the NK127 and NK128 series, respectively. The NK cells were also edited for both CISH and CD70 to reduce CISH and CD70 protein expression, respectively. Figure 6 shows a non-limiting schematic of the production and evaluation of gene edited CAR-expressing NK cells.
[0167] Figures 7A-7B show flow cytometry data related to CD70 expression by NK cells from two donors (donor 512, top row; donor 548, bottom row) at day 6 after gene editing. Figure 7A shows CD56 expression (representing NK cell prevalence) data, confirming that the gene editing process (e.g., electroporation and introduction of CISH / CD70 gRNA) does not cause a decrease in NK cell numbers. Figure 7B shows that introduction of CISH / CD70 gRNA and endonuclease results in a substantial decrease in CD70 expression compared to EP controls (right column). Figures 8A-8H show data on CD70 expression at day 10 after transduction of gene edited cells with viral vectors encoding the indicated anti-CD70 CAR constructs. As shown in Figure 8G, CD70 / CISH editing reduces the extent of CD70 expression by NK cells (compared to EP controls in Figure 8H). Each of Figures 8A-8F shows minimal CD70 expression (also reduced compared to the non-transduced but gene-edited cells in Figure 8G). This reduction indicates that each of the CAR constructs shown is functionally effective, with the near-zero CD70 expression reflecting fratricide against the remaining gene-edited NK cells that still express some CD70. At least with respect to cytotoxicity directed against the remaining CD70-expressing NK cells, each CD70 CAR construct appears to be similar in their efficacy. Figures 9A-9H show the corresponding data collected at day 14, where in each group where the CD70 CAR was expressed, CD70-expressing cells were again essentially eliminated. Similar day 10 and day 14 data were obtained for the second donor (not shown).
[0168] Figures 10A-10B show the TIDE indel analysis for each of the two donors (10A / 10B, respectively). These data show that gene editing efficiency was approximately 70-85% at day 10, trending towards at least approximately 90% efficiency by day 14 analysis.
[0169] In further experiments, NK cells from the same two donors were knocked out for CD70 and CISH by electroporation with CD70- and CISH-targeting gRNAs on day 0 and engineered to express one of the exemplary CD70 CARs. NK cells knocked out for CD70 and CISH but not expressing the CAR (double KO) or mock electroporated cells (EP only) served as controls. The persistence of cells in the absence of IL-2 was assessed over 5 weeks of culture. Cells expressing 127-series and 128-series CARs showed increased persistence in the absence of IL-2 (Figure 10C).
[0170] Turning to the evaluation of the cytotoxicity of gene-edited CAR-expressing NK cells, IC of different CAR constructs against Panc05 cells, which express low levels of CD70, was significantly higher than IC10. 50 Bright-Glo™ analysis was performed to determine the cytotoxicity profile of CD70 CAR-expressing cells. Figures 11A and 11C show data collected from the first and second donors, respectively, at day 14 after gene editing. At this time point, each of the CAR-expressing cell populations exhibited increased cytotoxicity over CISH-edited NK cells not expressing CAR (EP CISH). 127.58, 127.71, and 128.58 CAR-expressing NK cells were somewhat more potent compared to other CAR-expressing NK cells, such as NK128.71. When the cytotoxicity profile of the same donor was evaluated at day 17, the various CD70 CAR-expressing cells showed somewhat consistent performance (Figures 11B and 11D). Importantly, each group tested effectively eliminated tumor cells, despite the target cells expressing low levels of CD70.
[0171] 12A-12B show cytotoxicity data collected in a 1-day IncuCyte® assay from two different donors when NK cells and target cells (Panc05) were present at a ratio of 1:2. As shown, each experimental group reduced tumor cell numbers (Panc05) compared to the control, with the NK127.58 and NK127.71 constructs appearing to be the most effective.
[0172] Additional experiments were performed to evaluate the efficacy of CD70 CAR-expressing gene-edited NK cells against ACHN tumor cells expressing moderate amounts of CD70. As shown in Figures 13A and 13B, where data was collected from two different donors, there were two rechallenges after the initial co-culture. The E:T ratio here was 1:2, and similar to the Bright-Glo™ assay with Panc05 cells, each group expressing CD70 CAR reduced ACHN tumor cell numbers to a greater extent than the control, with the 127.71 construct appearing to be the most potent.
[0173] Another assay was performed with 786-O tumor cells (high levels of CD70) after the first co-culture and one re-challenge. At the end of the experiment, each construct appeared to exhibit similar cytotoxicity (see Figures 14A and 14C, respectively, from two different donors). An evaluation was performed at an intermediate time point (vertical line in 14A, approximately 3 days) and the resulting tumor cell populations are described in the histogram shown in Figure 14B for the first donor. At this intermediate time point, each CD70 CAR exhibited higher cytotoxicity than CISH-edited NK cells not expressing CAR (CISH EP) and mock electroporated NK cells (EP). At this intermediate time point, the NK127 and 128 series constructs were more potent.
[0174] Figures 15A-15D show data from two different donors on the percentage of NK cells expressing the CAR by mean fluorescence intensity (MFI) (15A and 15C, respectively) and the density of expression by these positive cells (15B and 15D, respectively). These data show that each CAR construct was expressed relatively consistently within a given donor cell population. The 127 series (127.71) appeared to be slightly more highly expressed across both donors. Of note, the NK127.71 construct appeared to be more densely expressed than the other constructs, which may explain the apparent increased cytotoxicity of NK cells expressing this construct against tumor lines with high, medium, or low expression of CD70. Taken together, these in vitro data demonstrate that expression of the CD70 CAR, in conjunction with gene editing of at least two targets (e.g., CISH and CD70), confers increased cytotoxicity and persistence to NK cells against therapeutic cells. In some embodiments, this approach is further enhanced by editing at least one additional gene, in addition to CISH and CD70, such as CBLB, TGFBR2, and / or adenosine receptors, to confer further increased potency and / or persistence to the NK cells. [Example 3]
[0175] Example 3 - In vivo characterization of selected CD70 CARs To expand on the in vitro data discussed above and evaluate the efficacy of gene-edited CD70 CAR-expressing cells, several in vivo experiments were performed. Using a renal cell carcinoma xenograft model, mice were injected with 786-O renal cell carcinoma cells 5 days prior to NK cell administration. A single dose of 20 million NK cells (gene-edited with CD70 and CISH and expressing the CD70 CAR) were injected on day 0. Figures 16A-16E show representative in vivo data evaluating the tumor growth control ability of gene-edited NK cells expressing the indicated CD70 CAR. The CD70-targeting CARs used in this experiment share the same VH, VL, and linker sequences as others provided herein based on the indicated construct suffix (e.g., ".71", ".58", or ".17"), although these particular constructs were produced using alternative generation plasmids (indicated by the "102" construct prefix). Figures 16A and 16B show control data, and Figures 16C and 16E show the CD70 CAR constructs evaluated in previous experiments. As noted from these figures, the presence of CD70 CAR increases cytotoxicity, and editing CISH further increases the cytotoxic effect. A similar trend was detected in the corresponding experiment using A498 xenograft model (data not shown).
[0176] Multiple dose in vivo testing was also performed using the 786-O renal cell carcinoma xenograft model. 10 million 786-O cells were injected 3 days prior to administration of NK cells. Two doses of gene-edited CD70 CAR-expressing NK cells were administered: 30 million on day 0 and 30 million NK cells on day 7. Figures 17A-17B show data regarding tumor burden (17A) and percentage of CAR-expressing NK cells (17B). As shown in Figure 17A, each experimental group showed a decrease in tumor volume increase over time, with the 127.58, 127.71, and 128.58 constructs showing the most suppression of tumor burden. Figure 17B shows the persistence of CAR-positive NK cells. However, in the 127.58 group (not measured on day 26), each group approached nearly 75% of the total NK cell population. The percentage of each group increased over time, indicating that editing NK cells extended the lifespan of the edited cells (control of tumor burden indicates functionality of the cells over time). Collectively, these data indicate that expression of CD70 CAR confers increased cytotoxicity to NK cells, and editing the genome of these cells, e.g., CISH editing, increases cytotoxicity and reduces fratricide of intra-therapeutic cell populations, e.g., by knocking down CD70. As provided herein, additional editing of other genes, such as CBLB, TGFBR2, and / or adenosine receptors, in addition to CISH and CD70, further confers increased potency and / or persistence to NK cells. [Example 4]
[0177] Evaluation of multiplex gene editing in CD70 CAR-expressing NK cells As discussed above, in some embodiments, immune cells (e.g., NK cells) are edited, for example, to knock down or knock out expression of multiple target genes ("multiple gene editing"). In some embodiments, immune cells, such as NK cells, are edited to reduce, substantially reduce, and / or eliminate CD70 expression and engineered to express a CAR that targets CD70. In some embodiments, immune cells are also optionally edited to reduce, substantially reduce, and / or eliminate CISH expression. In some embodiments, immune cells are also optionally edited to reduce, substantially reduce, and / or eliminate Casitas B-lineage lymphoma-b (Cbl-b) expression.
[0178] Genetic editing can be performed at different times depending on the embodiment. Figures 18A-18B show non-limiting examples of cell production processes. Figure 18A shows a day 0 EP approach, where gene editing is performed on day 0 in resting NK cells. Viral transduction is then performed approximately 7 days later (after expansion of edited cells), and in vitro and in vivo evaluations are scheduled as shown. In contrast, Figure 18B shows a day 6 EP approach, where NK cells are first expanded (and thus activated) and gene editing is performed one day prior to viral transduction with CD70 CAR.
[0179] Experimental groups for testing multiple gene editing approaches on day 0 and day 6 are shown in Table E2.
[0180] [Table 3]
[0181] A subset of gene-edited cells was phenotypically characterized on day 6. As shown in Table E3 and Figures 19A-19B, the edited genes were successfully disrupted at both the protein and genomic levels.
[0182] [Table 4]
[0183] As shown in Table E3, surface expression of CD70 in the edited groups was reduced by approximately 70-85% depending on the group (measured at day 11 after EP). Six days after EP, TIDE indel analysis showed indel frequencies of approximately 75-82% for CD70, approximately 67-68% for CISH, and approximately 80-88% for CBLB. As shown in lanes 1-4 of the Western blot in Figure 19A, CBLB protein expression was reduced in analyzed groups 4 (CD70 / CBLB KO) and 5 (CD70 / CISH / CBLB KO) compared to CBLB protein expression in groups 1 (CD70 KO) and 2 (CD70 / CISH KO). Similarly, as shown in lanes 1, 2, and 4 of Figure 19B, CIS protein expression was reduced in groups 2 (CD70 / CISH KO) and 4 (CD70 / CISH / CBLB KO) compared to CIS protein expression in group 1 (CD70 KO). Expression of CD70 CAR enriched CAR-expressing NK cells over time in culture. As shown in Figures 20A-20C, the percentage of cultures that were CD70 CAR positive increased from day 11 (20A) to day 21 (20B) to day 28 (20C). The resulting cultures at day 28 were nearly 100% CD70 CAR positive.
[0184] Evaluation of various editing combinations was performed with respect to the expansion potential of edited NK cells in culture. Figure 21A shows data for the indicated editing combinations in terms of fold expansion before transduction. Although there was some variability, each treatment group showed generally similar expansion. Figure 21B shows the extent of expansion for each treatment group after transduction. Note that the reduced expansion may be due to refractoriness to the transduction protocol. However, by day 14, the overall fold expansion (21C) had recovered, approximately 1000-fold for the single edit group to CD70 and approximately 650-fold for the double and triple edit groups. Of note, there does not appear to be a substantial negative impact on expansion potential when editing three genes (rather than two).
[0185] The functionality of triple-edited NK cells expressing different non-limiting CD70 CARs was performed by in vitro IncuCyte® cytotoxicity assays using ACHN and 786-O cells (medium and high CD70 expression, respectively) at an E:T ratio of 1:2. As shown in Figures 21D-E, each experimental group reduced ACHN and 786-O cells, respectively, compared to the control (EP). A similar assay was performed at an E:T ratio of 1:4 with one tumor rechallenge provided on day 5 from the initial coculture. As shown in Figures 21F-G, each group expressing CD70 CAR reduced ACHN and 786-O tumor cell counts, respectively, to a greater extent than the control (EP), with the 127.71 CAR being the most potent.
[0186] To evaluate the functionality of the engineered and edited cells, we further performed an in vitro cytotoxicity assay using ACHN cells (moderate level of CD70 expression) at an E:T ratio of 1:4 with two rechallenges starting from day 14 after editing. As shown in Figure 22B, the CD70 / CISH-edited group showed substantially increased cytotoxicity compared to the CD70-only edited group. Furthermore, despite two rechallenges with fresh tumor cells, triple editing into CD70 / CISH / CBLB conferred significantly greater cytotoxicity compared to the other groups. Although the condition in Figure 22A was in the absence of TGF-beta, even in the presence of TGF-beta, which inhibits cytotoxicity, triple editing into CD70 / CISH / CBLB showed the most substantial cytotoxicity among the experimental groups. A similar pattern is shown in Figures 22C-22D when the evaluation begins from day 21 after editing. Even when evaluated starting 28 days post-editing, triple-edited NK cells (CD70 / CISH / CBLB) still show robust control of tumor growth despite a 3-day re-challenge (22E) and despite the presence of TGF-beta (22F). These data indicate that triple editing results in a substantial increase in efficacy and persistence.
[0187] Using the same experimental groups listed in Table E2, experiments were performed using the EP approach on day 6 (see FIG. 18B). As assessed on day 10 (day 4 post-editing and day 3 post-transduction from expansion), gene editing successfully disrupted expression at the protein and genomic levels.
[0188] [Table 5]
[0189] As shown in Table E4, surface expression of CD70 in the edited groups was reduced by about 95% or more. TIDE indel analysis showed indel frequencies of about 80-87% for CD70, about 90-95% for CISH, and about 70-80% for CBLB. As shown in lanes 1-3 in the Western blot of Figure 23A, CBLB protein expression was reduced in analyzed groups 2 (CD70 / CBLB KO) and 3 (CD70 / CISH / CBLB KO) compared to CBLB protein expression in group 1 (CD70 / CISH KO). Similarly, CIS protein expression was reduced as shown in lanes 1-3 in Figure 23B (see groups 2 (CD70 / CBLB KO) and 4 (CD70 / CISH / CBLB KO)). Expression of CD70 CAR enriched CAR-expressing NK cells over time in culture. As shown in Figures 24A-24B, the percentage of cells in the cultures that were CD70 CAR positive was approximately 80% at day 10 (Figure 24A) and increased to over 90% at day 15 (Figure 24B). Similar to the data shown using the day 0 EP approach, the day 6 EP cell groups, especially the triple-edited (CD70 / CISH / CBLB), showed significant cytotoxicity against ACHN cells (Figure 25A), even in the presence of TGF-beta (Figure 25B). This increased cytotoxicity was not limited to the in vitro setting, and two xenograft models were used to evaluate the efficacy of the various treatment groups. As shown in the 786-O (high CD70 expression) xenograft model, the triple-edited (CD70 / CISH / CBLB) CD70 CAR-expressing NK cells showed the least increase in tumor volume over a period of approximately 45 days (Figure 26A). Similarly, in A-498 xenografts (also with high CD70 expression), triple-edited (CD70 / CISH / CBLB) CD70 CAR-expressing NK cells prevented a significant increase in tumor volume, notably resulting in no tumors but only scar tissue at the end of the experiment (Figure 26B). Collectively, these in vitro and in vivo data indicate that multiple editing does not adversely affect the proliferation capacity of NK cells in culture, and that triple editing such as CD70 / CISH / CBLB is particularly effective in increasing the cytotoxicity and persistence of NK cells engineered to express the CD70 CAR.Thus, in some embodiments, provided herein are CD70 CAR-expressing NK cells that have been edited to reduce or eliminate endogenous CD70, CISH and CBLB to enhance cancer treatment. [Example 5]
[0190] Off-target gene editing analysis While the triple editing described above was shown to be unexpectedly effective in increasing NK cell cytotoxicity and persistence, additional studies were performed to evaluate possible off-target editing using the exemplary gRNAs.
[0191] Figure 27 shows a schematic diagram of the analysis of off-target editing by hybrid capture. A series of probes is generated and tiled across each potential off-target site. Based on the probe signal, the targeted region is enriched and sequenced. The total number of read sequences containing indels is calculated and divided by the total number of reads for each potential off-target site. If the frequency of indels in the edited sample (relative to the total number of reads for the donor-matched control) is greater than 0.2%, additional statistical analysis is performed. For example, a paired one-tailed T-test is performed to compare the control and treated samples, and sites with P<0.05 are confirmed to be off-target edited. Figure 28 shows a non-limiting off-target analysis process flow. Figure 29A shows information on potential off-target sites and estimated NGS read coverage for selected gRNAs provided herein. Figure 29B shows a summary of the previous data provided in Figure 29A with additional data for more donors for selected gRNAs. As shown, the QC criteria for the NGS analysis was a median coverage of more than 5000 reads, with all samples exceeding all but one repeat of the CISH-13 gRNA.
[0192] Figures 30A and 30B show the results of off-target analysis for selected gRNAs shown in Figures 29A and 29B, respectively. The calculated on-target editing rates were consistent for each gRNA, whether calculated by TIDE analysis or hybrid capture. As shown, only one sample (CISH-10 gRNA) exceeded the 0.2% indel upper limit, requiring more detailed statistical comparison. However, even that analysis did not confirm off-target editing. Thus, these data confirm the accuracy and specificity of these non-limiting embodiments of gRNAs for gene editing. [Example 6]
[0193] Analysis of multigene-edited NK cells Figure 31 shows a non-limiting process flow for producing experimental samples to evaluate the effect of multiple gene editing. Edited cells are generated using the EP approach on day 6, and thus edited after 6 days of expansion. The samples are split after EP, a subset is used for off-target analysis, and a subset is transduced with CD70 CAR candidates and subjected to functional testing.
[0194] Figure 32 summarizes the TIDE analysis of CISH-15 gRNA in two sets of donor NK cells. As can be seen from the data, the indel frequency was not adversely affected by the inclusion of a second edit (as was seen with the second and third edits discussed above). Figure 33A shows a comparison of the indel frequency of CISH-10 vs. CISH-15 gRNA. The indel frequency of additional gRNAs from four different donors is shown in Figure 33B. Figure 34 depicts the indel frequency of CD70 in two donors. Figures 35A-35G show the extent of CD70 expression in the indicated editing context (non-transduced cells). As can be seen from these data, the presence of multiple edits, whether single edits (e.g., CD70 only) or a combination of CD70 and CISH (35D), CBLB (35E), or both (35F), does not reduce the efficacy of individual edits as measured by flow cytometry. Corresponding data is shown for another donor in Figures 36A-36G. These trends are confirmed by the indel frequency analysis outlined in Figures 37A and 37B for two donors. These data show that the second edit either does not reduce (37A) or appears to enhance (37B) the first edit. Overall, the reduced expression of each gene is relatively consistent, confirming that multiplex gene editing is feasible and effective. [Example 7]
[0195] Analysis and optimization of chromosomal translocations in multiply edited NK cells If multiple gene edits are made as in the previous examples, there is a risk that multiple double-strand breaks will allow chromosomal translocation. According to the non-limiting process flow of FIG. 31, edited cells are generated using the EP approach on day 6, and thus edited after 6 days of expansion. FIG. 38 outlines a series of experimental groups to evaluate the possibility of chromosomal translocation. FIG. 39 shows the percentage of on-target edits in each intended editing combination, each well above the desired threshold of 80%. The importance of on-target editing lies in its ability to more accurately evaluate the risk of translocation (e.g., if off-target cuts are reduced, the number of "free" chromosomal material should decrease). Furthermore, the possibility of translocation affects how many editing cycles can be used. Using two gRNAs in a single editing cycle can result in four species. For example, if a gRNA targets endonuclease to cut chromosome 9 and a second gRNA guides endonuclease to cut chromosome 11, the result is four chromosomal fragments: 9A, 9B, 11A, and 11B. If translocations occur, they can be 9A-11B combination, 9B-11B combination, 9A-11A combination, and 9A-11B combination. If three gRNAs are used in a single editing cycle, the result is six chromosomal fragments that can be combined (translocated) into 12 different species. For clinical products and safety, the goal is to minimize translocations. To perform triple editing such as the CD70 / CISH / CBLB combination discussed above, two general approaches are considered, shown diagrammatically in Figures 40A-40B (there is another option of three different editing events, not shown in the figures). Figure 40A shows a single electroporation event to achieve triple editing. The total number of translocations in this approach is the number resulting from that single editing event. Figure 40B shows an alternative approach in which two editing events (EP1 and EP2) are used to achieve the entirety of the intended triple editing (here CD70 / CISH / CBLB). The total possible translocations in this context is the sum of the translocations that occur in the first and second editing events.Thus, in some embodiments, editing combinations are selected to reduce the probability of translocation, for example, based on the gRNAs used in combination in a given editing event.
[0196] Figures 41A-41C show non-limiting combinations of possible editing schemes to achieve triple editing, here CD70 / CISH / CBLB. Figure 41A employs a first (dual) edit on CD70 and CISH (e.g., using the CISH-15 gRNA sequence given by SEQ ID NO: 191), and a second edit on CBLB (e.g., using the CBLB gRNA sequence given by SEQ ID NO: 195). Figure 41B shows a first (single) edit on CD70 (e.g., using the CD70 gRNA sequence given by SEQ ID NO: 180), and a second (dual) edit on CISH and CBLB. Figure 41C shows a first (dual) edit on CD70 and CBLB and a second edit on CISH. Also provided are editing constructs in which, for example, the first and second edits listed above are performed in the reverse order.
[0197] Following the schema in Figure 40A, one electroporation was performed to achieve triple editing, here CD70 / CISH / CBLB. The resulting translocation rate detected was 8.5% (see Figure 42), which is above the desired tolerance range of <4-6%. However, in some embodiments where different genes are edited, an acceptable translocation rate is achieved. The results are likely due to the fact that both CISH and CBLB are on the same chromosome, resulting in a higher probability of translocation (e.g., due to the relative localization of double-strand breaks and "free" chromosomal fragments).
[0198] A dual editing scheme was set up (only the first edit was tested) with CD70 and CISH editing performed in combination (using either CISH-10 or CISH-15 gRNA). As shown in Figure 43, the translocation rate using CISH-10 gRNA (having the sequence given by SEQ ID NO: 187) exceeded the desired threshold, while CISH-15 gRNA (combined with gRNA for CD70) resulted in an acceptable low translocation rate of about 4.4%. Furthermore, a combination of CD70 and CBLB was tested with single editing events in the hope of reducing translocation events. These data show a very desirable translocation frequency of less than 2% (1.6% as tested) as shown in Figure 44. With this relatively low percentage of events when CD70 and CBLB are edited, it is expected that the second edit (edit to CISH) alone will result in fewer, if any, translocation events due to a single cut. Thus, as shown in Figure 44, dual editing can be performed first or second depending on the embodiment. Although single editing is expected to generate few, if any, translocation events, in some embodiments, the total number of translocation events can be further reduced, for example, by optimizing (e.g., increasing) the time between editing events. In some embodiments, EP1 and EP2 are spaced apart by about 12 hours, about 24 hours, about 36 hours, about 48 hours, about 3 days, about 4 days, about 5 days, about 6 days, or about 7 days (or any time between these recited times). In some embodiments, more than 7 days pass between editing events. Taken together, these data show that multiple gene editing to achieve triple editing, e.g., CD70 / CISH / CBLB, can be achieved with a sufficiently low translocation rate and an effective amount of gene expression reduction, as well as expression of a cytotoxic CAR, resulting in a highly cytotoxic cell population. According to some embodiments, the population expressing the CD70 CAR is edited with CD70, CISH, and CBLB to generate a highly active and persistent engineered and edited cell population. In some embodiments, the cells include NK cells. [Example 8]
[0199] In vivo analysis of multigene-edited NK cells CD70 CAR-expressing NK cells with CD70, CISH, and CBLB knockout (CD70 / CISH / CBLB KO) were analyzed for knockout efficiency, cytokine secretion and persistence in vitro, and efficacy and persistence in vivo.
[0200] Briefly, using the exemplary CD70, CISH-15, and CBLB gRNA sequences described herein (e.g., SEQ ID NOs: 180, 191, and 195, respectively), NK cells were knocked out for CD70, CISH, and CBLB, and then engineered to express CARs targeting 127.58, 128.58, 127.71, or 147 CD70. The knockout efficiency of each gene was evaluated 10 and 15 days after electroporation in NK cells expressing different CD70 CARs. For each of CD70, CISH, and CBLB, the knockout efficiency was similar between the different CAR constructs (Figure 45A). Furthermore, by 15 days after electroporation, the knockout efficiency of each of CD70, CISH, and CBLB was comparable between triple knockout cells not expressing CAR (triple KO) and triple knockout cells expressing CAR (Figure 45A). Triple KO NK cells engineered to express an exemplary CD70 CAR were evaluated for their persistence in vitro in the absence of IL-2. Triple KO NK cells not expressing CAR (triple KO) or mock electroporated cells (EP only) were used as controls. As shown in Figure 45B, cells expressing 127 and 128 series CARs tended to show the greatest persistence. CD70 / CISH / CBLB KO NK cells expressing an exemplary CD70 CAR were co-cultured with 786-O target cells at an E:T ratio of 1:2 (dark bars) or 1:4 (light bars) and analyzed for secretion of molecules indicative of NK cell activation (Figure 45C). Cells expressing 127 and 128 series CARs, especially the 127.71 CAR, tended to secrete more molecules associated with activation.
[0201] Ten million 786-O tumor cells were injected into NOD scid gamma (NSG) mice on day -5 and allowed to engraft. On day 0, mice were administered a single dose of 30 × 10 6CD70 CAR NK cells (CD70 / CISH / CBLB KO, e.g., SEQ ID NOs: 180, 191, and 195, respectively) were injected into mice. Tumor volume and NK cell persistence were assessed until about day 70. As controls, mice were injected with equal numbers of NK cells that were knocked out of CD70 / CISH / CBLB but did not express CAR (triple KO) or with vehicle alone. As shown in Figures 46A-B, NK cells expressing the 127.71 CAR showed greater tumor volume (TV) control and in vivo persistence, respectively.
[0202] It is contemplated that various combinations or subcombinations of the specific features and aspects of the embodiments disclosed above can be made and still fall within the scope of one or more inventions. Moreover, any particular feature, aspect, method, property, characteristic, quality, attribute, element, etc. disclosed herein in relation to an embodiment can be used in all other embodiments described herein. Thus, it should be understood that various features and aspects of the disclosed embodiments can be combined with or substituted for one another to form various modes of the disclosed invention. Thus, it is intended that the scope of the invention disclosed herein should not be limited by the specific disclosed embodiments described above. Moreover, the invention is susceptible to various modifications and alternative forms, examples of which are shown in the drawings and described in detail herein. However, the invention is not limited to the particular forms or methods disclosed, but on the contrary, it should be understood that the invention covers all modifications, equivalents and alternatives falling within the spirit and scope of the various embodiments described and the appended claims. Any method disclosed herein need not be performed in the order shown. The methods disclosed herein include specific actions taken by a practitioner; however, they may also include, explicitly or implicitly, third-party direction of those actions. Moreover, when features or aspects of the disclosure are described in terms of a Markush group, one of skill in the art will recognize that the disclosure is also thereby described in terms of any individual members or subgroups of members of the Markush group.
[0203] Ranges disclosed herein also encompass any and all overlaps, subranges, and combinations thereof. Terms such as "up to," "at least," "greater than," "less than," "between" and the like include the indicated number. Numbers preceding terms such as "about" or "approximately" include the indicated number. For example, "about 90%" includes "90%." In some embodiments, at least 95% sequence identity or homology includes 96%, 97%, 98%, 99%, and 100% sequence identity or homology to a reference sequence. Furthermore, when a sequence is disclosed as "comprising" a nucleotide or amino acid sequence, such reference is also intended to include that the sequence "comprises," "consists of," or "consists essentially of" the indicated sequence, unless otherwise indicated. Any titles or subheadings used herein are for organizational purposes and should not be used to limit the scope of the embodiments disclosed herein.
[0204] All references cited herein, including, but not limited to, published and unpublished applications, patents, and literature references, are incorporated herein by reference in their entirety and made a part of this specification. To the extent that the publications and patents or patent applications incorporated by reference conflict with the disclosure contained in the specification, the specification is intended to supersede and / or take precedence over such conflicting material.
[0205] array In some embodiments, amino acid sequences corresponding to any of the nucleic acids disclosed herein (and / or contained in the attached sequence listing) are provided, taking into account the degeneracy of the nucleic acid code. Additionally, sequences (either nucleic acid or amino acid) that differ from the sequences explicitly disclosed herein (and / or contained in the attached sequence listing), but have functional similarity or equivalence, are also contemplated within the scope of the present disclosure. This includes mutations, truncations, substitutions, codon optimization, or other types of modifications.
[0206] According to some embodiments described herein, any of the sequences may be used, or any truncated or mutated form of any of the sequences disclosed herein (and / or included in the attached sequence listing) may be used, and may be used in any combination. The sequences provided herein that include an identifier, such as a tag or other detectable sequence (e.g., a Flag tag), are also provided herein without such tags or other detectable sequences (e.g., the listed sequences with the Flag tag removed). An electronic format of the sequence listing is provided herein. Some of the sequences provided in the sequence listing may be designated as artificial sequences because they are non-naturally occurring fragments or portions of other sequences, including naturally occurring sequences. Some of the sequences provided in the sequence listing may be designated as artificial sequences because they are combinations of sequences from different sources, such as humanized antibody sequences.
[0207] [Table 6] TIFF2025508050000009.tif247151 TIFF2025508050000010.tif247149 TIFF2025508050000011.tif247149 TIFF2025508050000012.tif247150 TIFF2025508050000013.tif247150 TIFF2025508050000014.tif247154 TIFF2025508050000015.tif247150 TIFF2025508050000016.tif247150 TIFF2025508050000017.tif247150 TIFF2025508050000018.tif247150 TIFF2025508050000019.tif247150 TIFF2025508050000020.tif247149 TIFF2025508050000021.tif247150 TIFF2025508050000022.tif247150 TIFF2025508050000023.tif247150 TIFF2025508050000024.tif247150 TIFF2025508050000025.tif247154 TIFF2025508050000026.tif247150 TIFF2025508050000027.tif247150 TIFF2025508050000028.tif247151 TIFF2025508050000029.tif247150 TIFF2025508050000030.tif247149 TIFF2025508050000031.tif247150 TIFF2025508050000032.tif247151 TIFF2025508050000033.tif247150 TIFF2025508050000034.tif217160
Claims
1. an anti-CD70 binding domain that is a single chain variable fragment (scFv) comprising a variable heavy region (VH) and a variable light region (VL) joined by a linker comprising the amino acid sequence set forth in SEQ ID NO:50, (i) VH comprises complementarity-determining regions (CDRs) 1, CDR2, and CDR3 comprising the amino acid sequences set forth in SEQ ID NOs: 205, 206, and 207, respectively; VL comprises CDR1, CDR2, and CDR3 comprising the amino acid sequences set forth in SEQ ID NOs: 209, 210, and 211, respectively; (ii) the VH comprises CDR1, CDR2, and CDR3 comprising the sequences of SEQ ID NOs: 205, 225, and 226, respectively; and the VL comprises CDR1, CDR2, and CDR3 comprising the sequences of SEQ ID NOs: 204, 223, and 224, respectively; or (iii) VH comprises CDR1, CDR2, and CDR3 comprising the sequences of SEQ ID NOs: 110, 111, and 112, respectively; and VL comprises CDR1, CDR2, and CDR3 comprising the sequences of SEQ ID NOs: 140, 141, and 142, respectively; Anti-CD70 binding domain.
2. (i) the VH comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 153, and the VL comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 156; (ii) the VH comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 152 and the VL comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 155; or (iii) the VH comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 157, and the VL comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 158; The anti-CD70 binding domain of claim 1.
3. (i) the VH comprises the amino acid sequence set forth in SEQ ID NO: 153 and the VL comprises the amino acid sequence set forth in SEQ ID NO: 156; (ii) the VH comprises the amino acid sequence set forth in SEQ ID NO: 152 and the VL comprises the amino acid sequence set forth in SEQ ID NO: 155; or (iii) VH comprises the amino acid sequence set forth in SEQ ID NO: 157, and VL comprises the amino acid sequence set forth in SEQ ID NO: 158; The anti-CD70 binding domain of claim 1.
4. The anti-CD70 binding domain of claim 1, wherein the scFv comprises the amino acid sequence shown in SEQ ID NO: 52, SEQ ID NO: 51, or SEQ ID NO:
53.
5. The anti-CD70 binding domain of claim 1, wherein the scFv comprises the amino acid sequence set forth in SEQ ID NO:
52.
6. The anti-CD70 binding domain of claim 1, wherein the scFv comprises the amino acid sequence set forth in SEQ ID NO:
51.
7. The anti-CD70 binding domain of claim 1, wherein the scFv comprises the amino acid sequence set forth in SEQ ID NO:
53.
8. 10. An anti-CD70 chimeric antigen receptor (CAR), comprising: (a) the anti-CD70 binding domain of claim 1; (b) a transmembrane domain; and (c) a cytotoxic signaling complex comprising a CD3 zeta subdomain.
9. The anti-CD70 CAR according to claim 8, wherein the cytotoxic signaling complex comprises an OX40 signaling domain, a CD28 signaling domain, or a 4-1BB signaling domain.
10. An immune cell comprising the anti-CD70 CAR of claim 8.
11. 11. The immune cell of claim 10, wherein the immune cell has been gene-edited to reduce expression of CD70, CISH, and CBLB.
12. Immune cells, (i) comprising a genomic disruption within a target sequence of a gene encoding CD70, wherein the target sequence comprises SEQ ID NO: 180; (ii) a genomic disruption within a target sequence of a gene encoding cytokine-inducible SH2-containing (CIS), wherein the target sequence comprises SEQ ID NO: 191; and (iii) a genomic disruption within a target sequence of a gene encoding Casitas B-lineage lymphoma-b (CBLB), wherein the target sequence comprises SEQ ID NO: 195; The immune cell of claim 10.
13. The immune cell of claim 10, wherein the immune cell is a natural killer (NK) cell.
14. 1. A genetically engineered natural killer (NK) cell population comprising a plurality of NK cells engineered to express a chimeric antigen receptor (CAR) comprising: (a) an anti-CD70 binding domain; (b) a transmembrane domain; and (c) a cytotoxic signaling complex; Genetically engineered NK cells (i) comprising a genomic disruption within a target sequence of a gene encoding CD70, wherein the target sequence comprises SEQ ID NO: 180; (ii) a genomic disruption within a target sequence of a gene encoding cytokine-inducible SH2-containing (CIS), wherein the target sequence comprises SEQ ID NO: 191; and (iii) a genomic disruption within a target sequence of a gene encoding Casitas B-lineage lymphoma-b (CBLB), wherein the target sequence comprises SEQ ID NO: 195; Genetically engineered NK cell populations.
15. 15. The genetically engineered NK cell population of claim 14, wherein the genomic disruptions within the target sequence of the gene encoding CD70, the target sequence of the gene encoding CIS, and the target sequence of the gene encoding CBLB comprise endonuclease-mediated indels.
16. the tumor-binding domain comprises a single-chain variable fragment (scFv) comprising a heavy chain variable region (VH) and a light chain variable region (VL); (i) VH comprises complementarity-determining regions (CDR) 1, CDR2, and CDR3 comprising the sequences of SEQ ID NOs: 205, 206, and 207, respectively; VL comprises CDR1, CDR2, and CDR3 comprising the sequences of SEQ ID NOs: 209, 210, and 211, respectively; (ii) the VH comprises CDR1, CDR2, and CDR3 comprising the sequences of SEQ ID NOs: 205, 225, and 226, respectively; and the VL comprises CDR1, CDR2, and CDR3 comprising the sequences of SEQ ID NOs: 204, 223, and 224, respectively; or (iii) VH comprises CDR1, CDR2, and CDR3 comprising the sequences of SEQ ID NOs: 110, 111, and 112, respectively; and VL comprises CDR1, CDR2, and CDR3 comprising the sequences of SEQ ID NOs: 140, 141, and 142, respectively; 15. The genetically engineered NK cell population of claim 14.
17. (i) the VH comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 153, and the VL comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 156; (ii) the VH comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 152 and the VL comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 155; or (iii) the VH comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 157, and the VL comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 158; 15. The genetically engineered NK cell population of claim 14.
18. (i) the VH comprises the amino acid sequence set forth in SEQ ID NO: 153 and the VL comprises the amino acid sequence set forth in SEQ ID NO: 156; (ii) the VH comprises the amino acid sequence set forth in SEQ ID NO: 152 and the VL comprises the amino acid sequence set forth in SEQ ID NO: 155; or (iii) VH comprises the amino acid sequence set forth in SEQ ID NO: 157, and VL comprises the amino acid sequence set forth in SEQ ID NO: 158; 15. The genetically engineered NK cell population of claim 14.
19. 17. The genetically engineered NK cell population of claim 16, wherein the scFv comprises the amino acid sequence set forth in SEQ ID NO: 52, SEQ ID NO: 51, or SEQ ID NO:
53.
20. A composition comprising immune cells according to any one of claims 10 to 13 or a genetically engineered NK cell population according to any one of claims 14 to 19.
21. 21. The composition of claim 20 for use in treating a CD70-expressing cancer in a subject.
22. 22. The composition of claim 21, wherein the cells are allogeneic to the subject.
23. 22. The composition of claim 21, wherein the cells are autologous to the subject.