Artificial nucleases and uses thereof

Abstract

The present disclosure provides artificial nucleases and uses thereof for editing living cells.

Description

[Technical field]

[0001] The present invention relates to artificial nucleases and their applications for editing living cells. [Background technology]

[0002] In the following discussion, certain articles and methods are described for background and introductory purposes. No statement contained herein should be construed as an "admission" of prior art. Applicant expressly reserves the right, where appropriate, to demonstrate that the methods referenced herein do not constitute prior art under applicable statutory provisions.

[0003] The ability to perform precise, targeted changes to the genome of living cells has been a long-standing goal in biomedical research and development. Recently, a variety of nucleases have been identified that allow for the manipulation of gene sequences, and therefore gene function. These nucleases include nucleic acid-guided nucleases. The range of target sequences that nucleic acid-guided nucleases can recognize is, however, constrained by the need for a specific protospacer adjacent motif (PAM) to be located near the desired target sequence. A PAM is a short nucleotide sequence that is recognized by a gRNA / nuclease complex, which directs the editing of the target sequence in living cells. Although the precise PAM sequence and length requirements for different nucleic acid-guided nucleases vary; a PAM is typically a 2-7 base pair sequence adjacent or proximal to the target sequence, and depending on the nuclease, can be 5' or 3' of the target sequence. Engineering a nucleic acid-guided nuclease may allow for altered PAM preferences, may allow for editing optimization in different organisms, and / or may alter enzyme fidelity; all changes may increase the versatility of a particular nucleic acid-guided nuclease for a given editing task.

[0004] Therefore, there is a need for improved nucleases in the field of nucleic acid-guided nuclease gene editing, such as China Patent Application Publication No. 111511906, China Patent Application Publication No. 113227368, etc. The artificial nucleases described herein also meet this need. Summary of the Invention

[0005] This Summary is provided to introduce a selection of concepts in a simplified form that are further described below in the Detailed Description of the Invention. This Summary is not intended to identify key or essential features of the claimed subject matter, nor is it intended to be used to limit the scope of the claimed subject matter. Other features, details, applications, and advantages of the claimed subject matter will become apparent from the Detailed Description of the Invention set forth below, including aspects of the invention that are illustrated in the accompanying drawings and defined in the appended claims.

[0006] The present invention provides an artificial nuclease comprising an amino acid sequence having the following mutation compared to the amino acid sequence set forth in SEQ ID NO:1: the amino acid at position 169 is mutated from lysine to arginine.

[0007] In one particular embodiment, the amino acid sequence also has one or more mutations selected from the following group: the amino acid at position 589 is mutated from asparagine to any other amino acid, preferably histidine; the amino acid at position 535 is mutated from lysine to any other amino acid, preferably arginine; the amino acid at position 563 is mutated from lysine to any other amino acid, preferably arginine; the amino acid at position 601 is mutated from threonine to any other amino acid, preferably arginine; the amino acid at position 624 is mutated from serine to any other amino acid, preferably arginine.

[0008] In another specific embodiment, the amino acid sequence further has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO:1.

[0009] The present invention also provides artificial nucleases comprising an amino acid sequence having at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13 and SEQ ID NO:14.

[0010] In another specific embodiment, the artificial nuclease has improved editing activity in yeast compared to a nuclease having the amino acid sequence set forth in SEQ ID NO:1.

[0011] The present invention also provides enzyme cocktails comprising one or more of the artificial nucleases in combination.

[0012] The present invention also provides a method for modifying a target region in the genome of a cell, comprising the steps of: (a) a cell; Artificial nucleases; An artificial guide nucleic acid capable of complexing with a nuclease; and An editing sequence that is complementary to the target region and encodes a nucleic acid that has a change in sequence compared to the target region. contacting with; (b) enabling the nuclease, guide nucleic acid and editing sequence to create a genome edit in the target region of the genome of the cell; The present invention provides a method comprising:

[0013] In one particular embodiment, the artificial guide nucleic acid and the editing sequence are provided as a single nucleic acid.

[0014] In another specific embodiment, the single nucleic acid further comprises a mutation in a protospacer adjacent motif (PAM) site.

[0015] The present invention also provides (a) Artificial nuclease; (b) an artificial guide nucleic acid capable of complexing with a nuclease; and (c) an edited sequence having a change in sequence compared to the sequence of the target region in the genome of the cell; A nucleic acid-guided nuclease system comprising: The system results in genome editing in a target region in the genome of a cell facilitated by the nuclease, the artificial guide nucleic acid, and the editing sequence. Provide a system.

[0016] In one particular embodiment, the artificial guide nucleic acid and the editing sequence are provided as a single nucleic acid.

[0017] In another specific embodiment, the single nucleic acid further comprises a mutation in a protospacer adjacent motif (PAM) site.

[0018] The present invention also provides (a) an artificial nuclease; and (b) an artificial guide nucleic acid capable of complexing with a nuclease, the artificial guide nucleic acid comprising a loop sequence comprising the sequence UAUU, UUUU, UGUU, UCUU, UCUUU or UAGU; A composition comprising:

[0019] In one particular embodiment, the artificial guide nucleic acid is a heterologous artificial guide nucleic acid.

[0020] In another particular embodiment, the nuclease is encoded by a nucleic acid sequence that is codon-optimized for use in cells from a particular organism.

[0021] The present invention also provides (a) an artificial nuclease; and (b) a heterologous artificial guide nucleic acid capable of complexing with a nuclease; The present invention provides a nucleic acid-guided nuclease system comprising:

[0022] In one particular embodiment, the system further comprises (c) an edited sequence having an alteration in its sequence compared to the sequence of the target region.

[0023] In another specific embodiment, the targeting system results in editing in the target region facilitated by a nuclease, a heterologous artificial guide nucleic acid, and an editing sequence.

[0024] In another particular embodiment, the artificial guide nucleic acid comprises a loop sequence comprising the sequence UAUU, UUUU, UGUU, UCUU, UCUUU or UAGU.

[0025] In another particular embodiment, the nuclease is encoded by a nucleic acid sequence that is codon-optimized for use in cells from a particular organism.

[0026] The present invention also provides a kit for gene editing comprising an artificial nuclease.

[0027] The present invention also provides uses of the artificial nucleases in the preparation of preparations or kits for (i) genome editing; (ii) targeted nucleic acid diagnostics; (iii) disease treatment.

[0028] These aspects as well as other features and advantages of the present invention are described in greater detail below. [Brief description of the drawings]

[0029] [Figure 1] Activation strength of mutant K169R and wild-type dMad7 (WT) against AbA on TDO / -Trp / -Leu / -Ura plates is shown. [Diagram 2]1 shows the resistance of each mutant of dMad7 to 3-AT. [Diagram 3] 1 shows an in vitro enzyme activity assay of Mad7 double mutants. [Figure 4] 1 shows the sequencing results of OsPPO1 gene editing by the Mad7 mutant in rice protoplasts. [Diagram 5] 1 shows the sequencing results of OsYSA gene editing by the Mad7 mutant in rice protoplasts. [Figure 6] The upper panel shows the results of rice OsGDI1 gene editing with the Mad7-K169R / N589H mutant; the lower panel shows the results of rice S-OsGDI1 gene editing with the Mad7-K169R / N589H mutant. [Figure 7] FIG. 13 depicts the editing efficiency test of Mad7-K169R / N589H in soybean hairy root systems. [Figure 8] 1 shows the sequencing results of zebrafish tyrosinase gene (tyr) editing by Mad7-K169R / N589H. [Figure 9] 1 shows the sequencing results of porcine SOCS2 gene editing with Mad7-K169R / N589H. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0030] [Table 1]

[0031] Detailed Description of the Invention The description set forth below in conjunction with the accompanying drawings is intended to be a description of various, illustrative embodiments of the disclosed subject matter. Although certain features and functionality are described in conjunction with each illustrative embodiment; it will be apparent to one of ordinary skill in the art that the disclosed embodiments may be practiced without each of those specific features and functionality. Furthermore, all of the functionality described in conjunction with one embodiment is intended to be applicable to the additional embodiments described herein, unless expressly stated otherwise or the feature or functionality is incompatible with the additional embodiment. For example, if a given feature or functionality is expressly described in conjunction with one embodiment but not explicitly described in conjunction with an alternative embodiment, it should be understood that the feature or functionality may be adopted, utilized, or performed in conjunction with the alternative embodiment, unless it is incompatible with the alternative embodiment.

[0032] The implementation of the techniques described herein can use conventional techniques and descriptions of organic chemistry, polymer technology, molecular biology (including recombinant technology), cell biology, biochemistry, biological emulsion production, and sequencing technology that are within the scope of the skilled artisan, unless otherwise indicated. Such conventional techniques include polymer array synthesis, hybridization and ligation of polynucleotides, and detection of hybridization using labels. Specific examples of suitable techniques may be obtained by referring to the examples herein. However, other equivalent conventional procedures can also be used, of course. Such prior art and descriptions can be found in standard laboratory manuals, e.g., Green, et al., Eds. (1999), Genome Analysis: A Laboratory Manual Series (Vols. I-IV); Weiner, Gabriel, Stephens, Eds. (2007), Genetic Variation: A Laboratory Manual; Dieffenbach, Dveksler, Eds. (2003), PCR Primer: A Laboratory Manual; Bowtell and Sambrook (2003), DNA Microarrays: A Molecular Cloning Manual; Mount (2004), Bioinformatics: Sequence and Genome Analysis; Sambrook and Russell (2006), Condensed Protocols from Molecular Cloning: A Laboratory Manual; and Sambrook and Russell (2002), Molecular Cloning: A Laboratory Manual (all Cold Spring Harbor Laboratory Press); Stryer, L. (1995) Biochemistry (4 thedition) W. H. Freeman, New York N.Y.; Gait, “Oligonucleotide Synthesis: A Practical Approach” 1984, IRL Press, London; Nelson and Cox (2000), Lehninger, Principles of Biochemistry, 3 rd edition., W. H. Freeman Pub., New York, N. Y.; Berg et al. (2002) Biochemistry, 5 thEd., WH Freeman Pub., New York, NY; Cell and Tissue Culture: Laboratory Procedures in Biotechnology (Doyle & Griffiths, Eds., John Wiley & Sons 1998); Mammalian Chromosome Engineering-Methods and Protocols (G. Hadlaczky, Ed., Humana Press 2011); Essential Stem Cell Methods, (Lanza and Klimanskaya, Eds., Academic Press 2011), all of which are incorporated herein by reference in their entirety for all purposes. Nuclease-specific techniques can be found, for example, in Genome Editing and Engineering from TALENs and CRISPRs to Molecular Surgery, Appasani and Church, 2018; and CRISPR: Methods and Protocols, Lindgren and Charpentier, 2015, both of which are incorporated herein by reference in their entirety for all purposes. Basic methods for enzyme engineering can be found in Enzyme Engineering Methods and Protocols, Samuelson, Ed., 2013; Protein Engineering, Kaumaya, Ed., (2012); and Kaur and Sharma, "Directed Evolution: An Approach to Engineer Enzymes", Crit. Rev. Biotechnology, 26: 165-69 (2006).

[0033] It is noted that, as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, a reference to "an oligonucleotide" refers to one or more oligonucleotides, and a reference to "an automated system" includes equivalent steps and methods for use with the system known to those of skill in the art, and so forth. Additionally, terms such as "left," "right," "upper," "lower," "front," "rear," "side," "height," "length," "width," "upper," "lower," "inner," "outer," "internal," "external," "inner," and "external" that may be used herein merely describe a point of reference and do not necessarily limit embodiments of the present disclosure to any particular orientation or configuration. Furthermore, terms such as "first," "second," "third," and so forth, merely identify one of the many parts, components, steps, operations, functions, and / or points of reference disclosed herein, and similarly do not necessarily limit embodiments of the present disclosure to any particular configuration or orientation.

[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All publications mentioned herein are incorporated by reference for the purpose of describing and disclosing devices, methods and cell populations that can be used in connection with the inventions described herein.

[0035] When a range of values ​​is provided, it is understood that each intervening value between the upper and lower limit of that range, and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may be independently included in the smaller ranges and are also encompassed within the invention, subject to any specifically excluded limits in the stated range. When the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[0036] In the following description, numerous specific details are set forth to provide a more thorough understanding of the present invention. However, it will be apparent to one skilled in the art that the present invention may be practiced without one or more of these specific details. In other instances, features and procedures well known to those skilled in the art have not been described in order to avoid obscuring the present invention.

[0037] The term "complementary" as used herein refers to Watson-Crick base pairing between nucleotides, particularly nucleotides that are hydrogen bonded to each other, with thymine or uracil residues linked to adenine residues by two hydrogen bonds, and cytosine and guanine residues linked by three hydrogen bonds.Generally, nucleic acids comprise nucleotide sequences that are described as having a "percentage of complementarity" or a "percentage of homology" to a specified second nucleotide sequence.For example, a nucleotide sequence may have 80%, 90%, or 100% complementarity to a specified second nucleotide sequence, indicating that 8 of 10 nucleotides, 9 of 10 nucleotides, or 10 of 10 nucleotides of the sequence are complementary to the specified second nucleotide sequence. For example, the nucleotide sequence 3'-TCGA-5' is 100% complementary to the nucleotide sequence 5'-AGCT-3'; and the nucleotide sequence 3'-TCGA-5' is 100% complementary to the region of the nucleotide sequence 5'-TTAGCTGG-3'.

[0038] The term DNA "control sequence" collectively refers to promoter sequences, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites, nuclear localization sequences, enhancers, and the like, which collectively provide for the replication, transcription, and translation of a coding sequence in a recipient cell. Not all of these types of control sequences need be present so long as the selected coding sequence is capable of being replicated, transcribed, and, for some components, translated in an appropriate host cell.

[0039] As used herein, the term "donor DNA" or "donor nucleic acid" refers to a nucleic acid designed to introduce DNA sequence modifications (insertion, deletion, substitution) into a locus by homologous recombination using a nucleic acid-guided nuclease. For homologous recombination repair, the donor DNA must have sufficient homology to the "cut site" or adjacent regions of the site to be edited in the genomic target sequence. The length of one or more homologous arms depends, for example, on the type and size of the modification being made. In many cases, the donor DNA preferably has two regions (e.g., two homologous arms) that have sequence homology to the genomic target locus. Preferably, the "insertion" or "DNA sequence modification" region (the nucleic acid modification expected to be introduced into the genomic target locus in the cell) is located between the two homologous regions. The DNA sequence modification may change one or more bases of the target genomic DNA sequence at one specific site or multiple specific sites. The alteration may include changing 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 or more base pairs of the target sequence. The deletion or insertion may be a deletion or insertion of 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 40, 50, 75, 100, 150, 200, 300, 400, or 500 or more base pairs of the target sequence.

[0040] The term "guide nucleic acid" or "guide RNA" or "gRNA" refers to a polynucleotide comprising 1) a guide sequence capable of hybridizing to a genomic target locus, and 2) a scaffold sequence capable of interacting with or complexing with a nucleic acid-guided nuclease.

[0041] "Homology" or "identity" or "similarity" refers to the sequence similarity between two peptides or, more often in the context of this disclosure, between two nucleic acid molecules. The term "homologous region" or "homologous arm" refers to a region on a donor DNA that has a certain degree of homology with a target genomic DNA sequence. Homology can be determined by comparing positions in each sequence, which may be aligned for comparison purposes. If a position in the compared sequences is occupied by the same base or amino acid, the molecules are homologous at that position. The degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences.

[0042] "Operably linked" refers to an arrangement of elements in which the components so described are configured to perform their normal functions. Thus, a control sequence operably linked to a coding sequence has the ability to affect the transcription, and in some cases, the translation, of the coding sequence. A control sequence need not be contiguous with a coding sequence, so long as it functions to direct the expression of the coding sequence. Thus, for example, a non-translated but transcribed intervening sequence can be present between a promoter sequence and a coding sequence, and the promoter sequence can still be considered to be "operably linked" to the coding sequence. In fact, such sequences need not be present on the same contiguous DNA molecule (i.e., chromosome), and can still have an interaction that results in a regulatory change.

[0043] A "promoter" or "promoter sequence" is a DNA regulatory region capable of binding an RNA polymerase and initiating transcription of a polynucleotide or polypeptide-coding sequence, such as messenger RNA, ribosomal RNA, small nuclear RNA or small nucleolar RNA, guide RNA, or any type of RNA transcribed by any class of RNA polymerase I, II, or III. Promoters may be constitutive or inducible, and in some embodiments, particularly in many embodiments where selection is used, transcription of at least one component of the nucleic acid-guided nuclease editing system is under the control of an inducible promoter.

[0044] As used herein, the term "selection marker" refers to a gene that is introduced into a cell and confers a suitable trait for artificial selection. Commonly used selection markers are well known to those skilled in the art. Drug selection markers such as ampicillin / carbenicillin, kanamycin, chloramphenicol, erythromycin, tetracycline, gentamicin, bleomycin, streptomycin, rifampicin, puromycin, hygromycin, blasticidin and G418 may be used. In other embodiments, the selection markers are human nerve growth factor receptor (detected using MAbs; e.g., as described in U.S. Pat. No. 6,365,373); truncated human growth factor receptor (detected using MAbs); mutant human dihydrofolate reductase (DHFR; fluorescent MTX substrates available); secreted alkaline phosphatase (SEAP; fluorescent substrates available); human thymidylate synthase (TS; confers resistance to the anticancer drug fluorodeoxyuridine); human glutathione S-transferase alpha (GSTA1; conjugates glutathione to the stem cell selective alkylating agent busulfan; a chemopreventive selection marker in CD34+ cells; CD24 cell surface antigen in hematopoietic stem cells; the human CAD gene, which confers resistance to N-(phosphonoacetyl)-L-aspartate (PALA); human multi-drug resistance-1 (human resistance-1; MDR-1; P-glycoprotein surface protein selected for increased drug resistance or enriched by FACS); human CD25 (IL-2a; detectable by Mab-FITC); O 6 -methylguanine DNA-methyltransferase (MGMT; selectable by carmustine); and cytidine deaminase (CD; selectable by Ara-C). "Selection medium" as used herein refers to a cell growth medium to which chemical compounds or biological moieties that select for or against a selection marker have been added.

[0045] The term "target genomic DNA sequence," "target sequence," or "genomic target locus" refers to any locus in a nucleic acid (e.g., genome) in vitro or in vivo, or in a cell or cell population, where at least one nucleotide change is expected to be made using a nucleic acid-guided nuclease editing system. The target sequence may be a genomic locus or an extrachromosomal locus.

[0046] A "vector" is any of a variety of nucleic acids that comprise one or more desired sequences to be delivered to and / or expressed in a cell. Vectors are typically composed of DNA, although RNA vectors are also available. Vectors include, but are not limited to, plasmids, fosmids, phagemids, viral genomes, synthetic chromosomes, and the like. As used herein, the phrase "engineered vector" comprises a coding sequence for a nuclease used in the nucleic acid-guided nuclease systems and methods of the present disclosure. In bacterial systems, the engineered vector may also comprise a λ Red recombineering system or equivalent. The engineered vector also typically comprises a selection marker. As used herein, the phrase "editing vector" comprises a coding sequence for a donor nucleic acid and a gRNA, the donor nucleic acid optionally comprising an alteration to the target sequence that prevents the nuclease from binding at the PAM or spacer in the target sequence after editing has occurred. The editing vector may also comprise a selection marker and / or a barcode. In some embodiments, the engineered vector and the editing vector may be combined; i.e., the contents of the engineered vector may be found on the editing vector. Additionally, the engineered and edited vector comprises control sequences, e.g., operably linked to nuclease coding sequences, recombineering system coding sequences (if present), donor nucleic acid, guide nucleic acid, and one or more selectable markers.

[0047] Generic editing of nucleic acid-guided nucleases in genome systems The present disclosure provides engineered gene editing nucleases that comprise various PAM preferences, optimized editing efficiency in different organisms, and / or altered RNA-guided enzyme fidelity.Certain engineered nucleases exhibit enhanced efficiency, for example, in yeast or mammalian cells, but they may be used to edit all cell types, including archaea, prokaryotic, and eukaryotic (e.g., yeast, fungal, plant and animal) cells.

[0048] The artificial nuclease variants described herein improve RNA-guided enzyme editing systems in which a nucleic acid-guided nuclease (e.g., an RNA-guided nuclease) is used to edit a specific target region in the genome of an organism. A nucleic acid-guided nuclease complexed with an appropriate synthetic guide nucleic acid in a cell can cleave the genome of the cell at a desired location. The guide nucleic acid helps the nucleic acid-guided nuclease to recognize and cleave DNA at a specific target sequence. By manipulating the nucleotide sequence of the guide nucleic acid, the nucleic acid-guided nuclease may be programmed to target any DNA sequence for cleavage as long as an appropriate protospacer adjacent motif (PAM) is nearby.

[0049] The artificial nuclease may be delivered to the cell to be edited as a polypeptide; alternatively, the polynucleotide sequence encoding the artificial nuclease is transformed or transfected into the cell to be edited. The polynucleotide sequence encoding the artificial nuclease may be codon-optimized for expression in a specific cell, such as an archaea, prokaryotic or eukaryotic cell. The eukaryotic cell may be a yeast, fungus, algae, plant, animal, or human cell. The eukaryotic cell may be or be derived from a specific organism, such as a mammal, including but not limited to a human, mouse, rat, rabbit, dog, or non-human mammal, including a non-human primate. The choice of the artificial nuclease to be used depends on many factors, such as what type of editing is to be made in the target sequence and whether a suitable PAM is located near the desired target sequence. The artificial nuclease may be encoded by a DNA sequence on a vector (e.g., an engineered vector) and may be under the control of a constitutive or inducible promoter. In some embodiments, the sequence encoding the nuclease is under the control of an inducible promoter, and the inducible promoter may be separate but the same as the inducible promoter that controls the transcription of the guide nucleic acid; that is, separate inducible promoters may drive the transcription of the nuclease and the guide nucleic acid sequence, but the two inducible promoters may be of the same type. Alternatively, the inducible promoter that controls the expression of the nuclease may be different from the inducible promoter that controls the transcription of the guide nucleic acid.

[0050] Generally, a guide nucleic acid (e.g., gRNA) can complex with a compatible nucleic acid-guided nuclease and then hybridize with the target sequence, thereby directing the nuclease to the target sequence. In certain embodiments, the RNA-guided enzyme editing system may use two separate guide nucleic acid molecules, e.g., CRISPR RNA (crRNA) and trans-activating CRISPR RNA (tracrRNA), that combine to function as guide nucleic acids. In other embodiments used with the artificial nucleases described herein, the guide nucleic acid may be a single guide nucleic acid that comprises both the crRNA sequence and the tracrRNA sequence. The guide nucleic acid can be DNA or RNA; alternatively, the guide nucleic acid may comprise both DNA and RNA. In some embodiments, the guide nucleic acid may comprise modified or non-naturally occurring nucleotides. When the guide nucleic acid comprises RNA, the gRNA may be encoded by a DNA sequence on a polynucleotide molecule, e.g., a plasmid, a linear construct, or the coding sequence may be present in an editing cassette, and is under the control of a constitutive promoter, or in some embodiments, under the control of an inducible promoter, as described below.

[0051] The guide nucleic acid comprises a guide sequence, which is a polynucleotide sequence that has sufficient complementarity with the target sequence to hybridize with the target sequence and direct the sequence-specific binding of the complexed nucleic acid guide nuclease to the target sequence. When optimally aligned using a suitable alignment algorithm, the degree of complementarity between the guide sequence and the corresponding target sequence is about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, or 99% or more, or is greater than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, or 99% or more. Optimal alignment may be determined using any suitable algorithm for sequence alignment. In some embodiments, the guide sequence is about or more than about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, or 75 nucleotides in length. In some embodiments, the guide sequence is less than about 75, 50, 45, 40, 35, 30, 25, 20 nucleotides in length. Preferably, the guide sequence is 10-30 or 15-20 nucleotides in length, or 15, 16, 17, 18, 19, or 20 nucleotides in length.

[0052] In the methods and compositions of the present disclosure, the guide nucleic acid is typically provided as a sequence expressed by a plasmid or vector, and comprises both the guide sequence and the scaffold sequence as a single transcript under the control of a promoter, and in some embodiments, under the control of an inducible promoter. The guide nucleic acid can be engineered to target a desired target sequence by modifying the guide sequence so that it is complementary to the desired target sequence, thereby allowing hybridization between the guide sequence and the target sequence. In general, to generate an edit in a target sequence, the gRNA / nuclease complex binds to the target sequence as determined by the guide RNA, and the nuclease recognizes the protospacer adjacent motif (PAM) sequence adjacent to the target sequence. The target sequence can be any polynucleotide that is endogenous or exogenous to a prokaryotic or eukaryotic cell, or any in vitro polynucleotide. For example, the target sequence can be a polynucleotide that is present in the nucleus of a eukaryotic cell. A target sequence can be a sequence that codes for a gene product (eg, a protein) or a non-coding sequence (eg, a regulatory polynucleotide, an intron, a PAM, or "junk DNA").

[0053] Guide nucleic acids may be used as described in U.S. Patent No. 10,240,167, issued March 26, 2019; U.S. Patent No. 10,266,849, issued April 23, 2019; U.S. Patent No. 9,982,278, issued June 22, 2018; U.S. Patent No. 10,351,877, issued July 15, 2019; and U.S. Patent No. 10,362,422, issued July 30, 2019; and U.S. Patent No. 20,322,336, issued July 20, 2019. The donor nucleic acid may be part of an editing cassette that encodes the donor nucleic acid, such as described in US Patent Application Publication No. 16 / 275,439, filed February 14, 2019; US Patent Application Publication No. 16 / 275,465, filed February 14, 2019; US Patent Application Publication No. 16 / 550,092, filed August 23, 2019; and US Patent Application Publication No. 16 / 552,517, filed August 26, 2019. Alternatively, the guide nucleic acid may not be part of the editing cassette, but may instead be engineered or encoded on the editing vector backbone. For example, the sequence encoding the guide nucleic acid may be assembled or inserted into the vector backbone first, followed by the donor nucleic acid, for example, in the editing cassette. In other cases, the donor nucleic acid, for example, in the editing cassette, may be inserted or assembled into the vector backbone first, followed by the sequence encoding the guide nucleic acid. In still other cases, sequences encoding the guide nucleic acid and the donor nucleic acid (e.g., inserted into an editing cassette) are simultaneously but separately inserted or assembled into a vector. In yet other embodiments, sequences encoding the guide nucleic acid and sequences encoding the donor nucleic acid are both included in an editing cassette.

[0054] The target sequence is associated with a PAM, which is a short nucleotide sequence recognized by the gRNA / nuclease complex. Although the exact PAM sequence and length requirements for different nucleic acid-guided nucleases vary; the PAM is typically a 2-7 base pair sequence adjacent or proximal to the target sequence, and depending on the nuclease, can be 5' or 3' of the target sequence. Manipulation of the PAM interaction domain of the nucleic acid-guided nuclease may allow alteration of the PAM specificity, improve fidelity, or decrease fidelity. In certain embodiments, genomic editing of the target sequence both introduces the desired DNA modification in the target sequence, e.g., the genomic DNA of the cell, and removes the protospacer mutation (PAM) region in the target sequence to mutate or inactivate the protospacer mutation (PAM) region in the target sequence. Inactivating PAM in the target sequence makes it impossible to further edit the cell genome at the target sequence, for example, in subsequent exposure to the nucleic acid guided nuclease complexed with synthetic guide nucleic acid in subsequent rounds of editing.Therefore, cells with the desired target sequence editing and modified PAM can be selected using the nucleic acid guided nuclease complexed with the synthetic guide nucleic acid complementary to the target sequence.Cells that did not undergo the first editing event are cut, the double-stranded DNA is broken, and therefore do not continue to survive.Cells that contain the desired target sequence editing and PAM modification are not cut, and continue to grow and reproduce, since these edited cells no longer contain the required PAM site.

[0055] The range of target sequences that a nucleic acid guided nuclease can recognize is constrained by the need for a specific PAM to be located near the desired target sequence. As a result, it can often be difficult to target editing with the precision required for genome editing. It has been found that nucleases can recognize some PAMs (e.g., canonical PAMs) very well and other PAMs (e.g., non-canonical PAMs) less well or poorly. Because certain artificial nucleases disclosed herein recognize different PAMs, the artificial nucleases increase the number of target sequences that can be targeted for editing; i.e., the artificial nucleases reduce the regions of "PAM deserts" in the genome. Thus, the artificial nucleases expand the range of target sequences that can be edited by increasing the number (diversity) of PAM sequences that are recognized. Furthermore, a cocktail of artificial nucleases may be delivered to a cell so that target sequences flanked by several different PAMs can be edited in a single editing run.

[0056] Another component of the nucleic acid-guided nuclease system is the donor nucleic acid. In some embodiments, the donor nucleic acid may (but is not necessarily) be on the same polynucleotide (e.g., editing vector or editing cassette) as the guide nucleic acid, and under the control of the same promoter (e.g., a single promoter drives transcription of both the guide and donor nucleic acids). The donor nucleic acid is designed to serve as a template for homologous recombination with a target sequence that is nicked or cleaved by the nucleic acid-guided nuclease as part of the gRNA / nuclease complex. The polynucleotide of the donor nucleic acid may be of any suitable length, for example, about 20, 25, 50, 75, 100, 150, 200, 500, or 1000 or more than about 20, 25, 50, 75, 100, 150, 200, 500, or 1000 nucleotides in length. In certain preferred embodiments, the donor nucleic acid may be provided as an oligonucleotide of 20-300 nucleotides, more preferably 50-250 nucleotides. The donor nucleic acid comprises a region (e.g., a homology arm) that is complementary to a portion of the target sequence. When optimally aligned, the donor nucleic acid overlaps (is complementary to) the target sequence by, for example, about 20, 25, 30, 35, 40, 50, 60, 70, 80, or 90 or more nucleotides. In many embodiments, the donor nucleic acid comprises two homology arms (regions that are complementary to the target sequence) in adjacent regions that are mutated or different between the donor nucleic acid and the target template. The donor nucleic acid comprises at least one mutation or change compared to the target sequence, such as an insertion, deletion, modification, or any combination thereof compared to the target sequence.

[0057] As mentioned above, in many cases the donor nucleic acid is provided as an editing cassette, and the editing cassette is inserted into a vector backbone, which may comprise a promoter driving transcription of the gRNA and the coding sequence of the gRNA, or the vector backbone may comprise a promoter driving transcription of the gRNA but not the gRNA itself. Furthermore, more than one, e.g., two, three, or four or more, guide nucleic acid / donor nucleic acid cassettes may be inserted into the engineered vector, each guide nucleic acid being under the control of a separate different promoter, separate similar promoters, or all guide nucleic acid / donor nucleic acid pairs being under the control of a single promoter. In some embodiments, e.g., in embodiments where cell selection is used, the promoter driving transcription of the gRNA and donor nucleic acid (or driving more than one gRNA / donor nucleic acid pair) is an inducible promoter. Inducible editing is advantageous in that singled cells may be grown for several to many cell doublings before editing is initiated, which increases the probability that cells with edits will survive, since the double-strand breaks caused by active editing are highly toxic to cells. This toxicity results in both cell death in the edited colony and a delay in proliferation for the edited cells that survive but must repair and recover after editing. However, if the edited cells have the potential to recover, the size of the colony of edited cells will eventually catch up with the size of the colony of unedited cells. See, for example, U.S. Patent Application Publication No. 16 / 399,988, filed April 30, 2019; U.S. Patent Application Publication No. 16 / 454,865, filed June 26, 2019; and U.S. Patent Application Publication No. 16 / 540,606, filed August 14, 2019. Furthermore, the guide nucleic acid can effectively direct the editing of more than one donor nucleic acid in the editing cassette, for example, when the desired edits are close to each other in the target sequence.

[0058] In addition to the donor nucleic acid, the editing cassette may contain one or more primer sites, which may be used to amplify the editing cassette by using oligonucleotide primers, for example, if the primer sites are located in one or more flanking regions of the other components of the editing cassette.

[0059] Also, as described above, the donor nucleic acid may contain at least one mutation relative to the target sequence, as well as one or more PAM sequence modifications that mutate, delete or inactivate a PAM site in the target sequence, rendering the PAM site "immune" to the nucleic acid-guided nuclease and protecting the target sequence from further editing in subsequent rounds of editing when the same nuclease is used.

[0060] Additionally, the editing cassette may include a barcode. A barcode is a unique DNA sequence that corresponds to a donor DNA sequence, so that the barcode can identify the editing made to the corresponding target sequence. The barcode typically comprises four or more nucleotides. In some embodiments, the editing cassette comprises a collection representing donor nucleic acids, for example, a gene-wide or genome-wide library of donor nucleic acids. The library of editing cassettes is cloned into a vector backbone, for example, each different donor nucleic acid is associated with a different barcode.

[0061] Additionally, in some embodiments, the expression vector or cassette encoding the components of the nucleic acid-guided nuclease system further encodes an artificial nuclease comprising one or more nuclear localization sequences (NLS), such as about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more NLSs. In some embodiments, the artificial nuclease comprises an NLS at or near the amino terminus, an NLS at or near the carboxyl terminus, or a combination.

[0062] The engineered and edited vector comprises a control sequence operably linked to the component sequence to be transcribed. As mentioned above, the promoter driving the transcription of one or more components of the artificial nuclease editing system may be inducible, and an inducible system is likely to be used when selection is to be performed. A number of gene regulatory control systems have been developed to control the expression of genes in plants, microorganisms, and animal cells (including mammalian cells), including the pL promoter (induced by heat inactivation of the CI857 repressor), the pBAD promoter (induced by adding arabinose to cell growth medium), and the rhamnose-inducible promoter (induced by adding rhamnose to cell growth medium). Other systems include the tetracycline-controlled transcriptional activation system (Tet-On / Tet-Off, Clontech, Inc., Palo Alto, CA; Bujard and Gossen, PNAS, 89(l2):5547-555l (1992)), the Lac switch inducible system (Wyborski et al., Environ Mol Mutagen, 28(4):447-58 (1996); DuCoeur et al., Strategies 5(3):70-72 (1992); U.S. Pat. No. 4,833,080), the ecdysone-inducible gene expression system (No et al., PNAS, 93(8):3346-335l (1996)), the cumate gene switch system (Mullick et al., BMC Biotechnology, 6:43 (2006)), and the tamoxifen-inducible gene expression system (Zhang et al., Nucleic Acids, 1999, 10:111-112 (2006)). Acids Research, 24: 543-548 (1996)), and others.

[0063] Typically, performing genome editing in living cells entails transforming the cells with the components required to perform nucleic acid-guided nuclease editing.For example, the cells may be transformed with separate engineered and editing vectors at the same time; the cells may already express the engineered nuclease (e.g., the cells may already be transformed with an engineered vector, or the coding sequence for the engineered nuclease may be stably integrated into the cell genome), so that only the editing vector is required to transform the cells; or the cells may be transformed with a single vector that comprises all the components required to perform nucleic acid-guided nuclease genome editing.

[0064] Various delivery systems can be used for the introduction (e.g., transformation or transfection) of the components of the nucleic acid-guided nuclease editing system into the host cell. These delivery systems include the use of yeast systems, lipofection systems, microinjection systems, biolistics systems, virosomes, liposomes, immunoliposomes, polycations, lipid-nucleic acid conjugates, virions, artificial virions, viral vectors, electroporation, cell-penetrating peptides, nanoparticles, nanowires, and exosomes. Alternatively, the molecular Trojan horse horse liposomes can be used to deliver the nucleic acid-guided nuclease components across the blood-brain barrier. Of particular interest is the use of electroporation, particularly flow-through electroporation (either as a stand-alone instrument or as a module in an automated multi-module system), as described, for example, in U.S. Pat. No. 10,435,717, issued October 8, 2019; and U.S. Pat. No. 10,443,074, issued October 15, 2019; U.S. Patent Application Publication No. 16 / 550,790, filed August 26, 2019; U.S. Patent Application Publication No. 10 / 323,258, filed June 18, 2019; and U.S. Patent Application Publication No. 10 / 415,058, filed September 17, 2019.

[0065] After the cells are transformed with the components required for nucleic acid-guided nuclease editing, the cells are cultured under conditions that promote editing. For example, if a constitutive promoter is used to drive the transcription of artificial nuclease and / or gRNA, the transformed cells only need to be cultured in a typical culture medium under typical conditions (e.g., temperature, CO2 atmosphere, etc.). Alternatively, if editing is inducible by activating an inducible promoter that controls the transcription of one or more of the components required for nucleic acid-guided nuclease editing, such as the transcription of gRNA, donor DNA, nuclease, or in the case of bacteria, recombineering system, the cells are subjected to inducible conditions. The artificial nucleases described herein may be used in automated systems, such as those described in U.S. Patent No. 10,253,316, issued April 9, 2019; U.S. Patent No. 10,329,559, issued June 25, 2019; U.S. Patent No. 10,323,242, issued June 18, 2019; and U.S. Patent No. 10,421,959, issued September 24, 2019; and U.S. Patent Application Publication No. 16 / 412,195, filed May 14, 2019; U.S. Patent Application Publication No. 16 / 423,289, filed May 28, 2019; and U.S. Patent Application Publication No. 16 / 571,091, filed September 14, 2019.

[0066] Incorporation by Reference All publications and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication or patent application was individually indicated to be incorporated by reference. EXAMPLES

[0067] Detailed embodiments of the invention The following examples are presented to provide those of skill in the art with a complete disclosure and description of how to make and use the invention, and are not intended to limit the scope of what the inventors regard as their invention, nor are they intended to represent or imply that the experiments described below are all or the only experiments performed. It will be appreciated by those skilled in the art that numerous variations and / or modifications can be made to the invention shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. The present embodiments are therefore to be considered in all respects as illustrative and not restrictive.

[0068] Example 1: Activation test of Mad7 and its mutant K169R in yeast To test the activation activity of Mad7 in yeast, a fusion protein of nuclease protein lacking cleavage activity (dMad7) and GAL4 activation domain (AD) (plasmid can simultaneously restore leucine auxotrophy) was constructed by referring to yeast one-hybrid experiments. Seven tetracycline operons and an aureobasidin A (AbA) resistance gene driven by the restoration of Ura auxotrophy were introduced into Y1H yeast, and a pGBKT7-modified CrRNA expression plasmid (plasmid can simultaneously restore tryptophan auxotrophy) was utilized to express CrRNA to guide the binding of the fusion protein and thereby activate the expression of the aureobasidin A resistance gene (Figure 1). The nuclease protein was amplified by polymerase chain reaction using oligonucleotide primers to introduce an SV40 nuclear localization sequence at the N-terminus consisting of the DNA sequence “ATGGCCCCAAAGAAGAAGCGGAAGGTC” corresponding to the protein sequence of “MAPKKKRKV”. The resulting amplified DNA fragment and the linearized screening plasmid were then transformed into E. coli by homologous recombination, and the plasmid was extracted and transformed into the yeast mutant Y1H-7xTet after confirming the correct plasmid. A 2 mm colony containing the plasmid was selected, dissolved in saline solution, and incubated for 10 min at 4°C for 1 h. -1The fusion protein of CrRNA-guided nuclease was diluted to 0, 200, 400, 800, 1200 (ng / ml) and spread on plates containing TDO / -Trp / -Leu / -Ura and cultured for three consecutive days in a thermostatic incubator at 30°C. The fusion protein of CrRNA-guided nuclease could activate AbA expression in Y1H-7xTet yeast, so that the yeast could grow on TDO / -Trp / -Leu / -Ura plates containing a certain concentration of AbA. The growth density of the culture was proportional to the activation of dMad7-CrRNA and the binding activity at the 7xTet site. The results of the analysis are shown in Figure 1. The mutant K169R (SEQ ID NO: 5) exhibited higher binding activity to the target site compared to wild-type dMad7 (SEQ ID NO: 4).

[0069] Example 2: Testing the activation ability of activated Mad7 mutants using antagonism between histidine and 3-amino-1,2,4-triazole (3-AT) in yeast A fusion protein of nuclease protein lacking cleavage activity (dMad7) and GAL4 activation domain (AD) (plasmid can simultaneously express leucine) was constructed by referring to yeast one-hybrid experiments. Three tetracycline operon promoters, histidine gene expression cassette (His) and restoration of Ura auxotrophy were introduced into Y1H yeast, and CrRNA expression plasmid modified by pGBKT7 (plasmid can simultaneously express tryptophan) was utilized to express CrRNA to guide the binding of fusion protein and thereby activate the expression of histidine. Nuclease protein was amplified by polymerase chain reaction using oligonucleotide primers to introduce SV40 nuclear localization sequence at the N-terminus consisting of the DNA sequence "ATGGCCCCAAAGAAGAAGCGGAAGGTC" corresponding to the protein sequence of "MAPKKKRKV". The resulting amplified DNA fragment and linearized screening plasmid were transformed into E. coli by homologous recombination, and the plasmid was extracted and transformed into yeast mutant Y1H-3xTet after confirming the correct plasmid. Colonies containing the plasmid were selected and repeatedly spotted onto TDO / Trp- / Leu- / His-+3-AT plates and cultured at 30°C in a thermostatic incubator for three consecutive days. The fusion protein of CrRNA-guided nuclease can activate His expression in Y1H-3xTet yeast, so that the yeast can grow on TDO / Trp- / Leu- / His- plates containing a certain concentration of 3-AT. The 3-AT resistance of yeast was positively correlated with the binding activity between dMad7 mutant and CrRNA. The results of the analysis are shown in Figure 2. Mutants K169R (SEQ ID NO: 5), K169R / K535R (SEQ ID NO: 6), K169R / K563R (SEQ ID NO: 7), K169R / N589H (SEQ ID NO: 8), K169R / T601R (SEQ ID NO: 9), and K169R / S624R (SEQ ID NO: 10) exhibited higher binding activity to CrRNA compared to wild-type dMad7 (SEQ ID NO: 4).

[0070] Example 3: In vitro enzyme activity assay of Mad7 mutant proteins Mad7 double mutant proteins K169R / K535R, K169R / K563R, K169R / N589H, K169R / T601R, K169R / S624R were expressed by bacteria, and CrRNA and substrate DNA comprising target sites were obtained via in vitro synthesis. The purified proteins were first incubated with synthesized CrRNA to form RNA-protease complexes (RNPs), and then the cleavage activity of RNPs was activated using double-stranded DNA comprising target sites as substrates, which then cleaved short single-stranded DNA comprising fluorophores and quenching groups. When a single strand was cleaved, the quenched fluorophore was released and the fluorescence intensity increased. The activity of MAD7 and its mutants was reflected by measuring the fluorescence increment (ΔRn). Because purified proteins could not be quantified precisely, the amount of wild-type protein was assumed to be greater than or equal to the amount of the mutant protein being compared, and if the measured fluorescence increment of any mutant was greater than that of the wild type, the in vitro cleavage activity of the mutant was superior to that of the wild type. The activities of the Mad7 double mutant proteins K169R / K535R, K169R / K563R, K169R / N589H, K169R / T601R, and K169R / S624R were all superior to that of the wild type, as shown in Figure 3.

[0071] Example 4: In vivo editing studies of Mad7 mutant proteins in bacteria The galactose metabolic pathway exists in bacteria, and galactose is phosphorylated by galactokinase (galK, gene ID: 66670972) to finally form glucose 6-phosphate, which is a substrate for glycolysis and is metabolized to pyruvate. If there is enough oxygen, it further enters the tricarboxylic acid cycle to produce a large amount of acidic substances. In the presence of neutral red, the acidic substances can become red, so that the knockout can be determined by color. The λ phage protein was introduced to enable the bacteria to obtain homologous recombination ability, and the galK homology knockout fragment was connected to the vector comprising the λ protein. The plasmid was extracted and transformed into E. coli W3110 for propagation, so that the E. coli had multiple recombination fragments, and then the E. coli was prepared as competent cells, and then transformed with the Mad7 / Mad7 mutant-CrRNA plasmid. The Mad7 protein and the λ protein were produced simultaneously through induction, and in the presence of multiple homologous recombination fragments, the knockout occurred easily. Therefore, the clones on the plate were picked and placed into liquid medium containing neutral red for cultivation. After cultivation, those that turned cloudy yellow were knockout strains, those that turned cloudy red were non-knockout strains, and those that appeared transparent yellow were dead strains. Representative data are shown in Table 1. The knockout efficiency of each protein was calculated after cultivation according to the following formula:

number

[0072] As can be seen in Table 1, the Mad7 double mutants Mad7-K169R / N589H and Mad7-K169R / S624R had higher knockout efficiency for galK in bacteria than the wild type.

[0073] [Table 2]

[0074] Example 5: Editing efficiency test of various Mad7 mutants in rice protoplasts Suitable Mad7 target sites were designed on rice OsPPO1 (LOC4327918) and OsYSA (LOC4333379) genes, and single-target editing test vectors for Mad7 and Mad7 mutants (Mad7-K169R and Mad7-K169R / N589H) were constructed, respectively. The sequences of the target sites were OsPPO1-CrRNA3: tttc aactccagctgctgttagactgt and OsYSA-CrRNA1: tttc acctggtgcccctcccgccgca, respectively.

[0075] Plasmid DNA was extracted using a Promega plasmid extraction kit (Midipreps DNA Purification System, Promega, A7640). Rice protoplasts were prepared for PEG-mediated transformation of the test vectors, and the transformation method was based on “Lin et al., 2018 Application of protoplast technology to CRISPR / Cas9 mutagenesis: from single-cell mutation detection to mutant plant regeneration. Plant Biotechnology Journal https: / / doi.org / 10.1111 / pbi.12870”.

[0076] Protoplast DNA was extracted by the CTAB method, and the editing efficiency of the target site was determined by Hi-TOM sequencing. Hi-TOM detection primers were designed for the target site, and the lengths of the target fragments were 127 bp and 129 bp, respectively. PPO1-sgRNA3-Hi-TOM-F:ggagtgagtacggtgtgcccaaggtatcgctgtcaagttg PPO1-sgRNA3-Hi-TOM-R:GAGTTGGATGCTGGATGgcagtcaaatagtgtgcaaacatg YSA-Hi-TOM-F:GGAGTGAGTACGGTGTGCcagaatcaggtcgacggcatc YSA-Hi-TOM-R:GAGTTGGATGCTGGATGGgacctcatgaaggtgctcgtc

[0077] Hi-TOM sequencing analysis was performed on the amplified target fragments, and representative sequencing results are shown in Figures 4 and 5. Statistical analysis of the editing results showed that for the rice OsPPO1 target site, the editing efficiency of Mad7-K169R / N589H was 4.58%, the editing efficiency of Mad7-K169R was 2.62%, and the editing efficiency of wild-type Mad7 was 2.16%; for the rice OsYSA target site, the editing efficiency of Mad7-K169R / N589H was 4.32%, the editing efficiency of Mad7-K169R was 2.80%, and the editing efficiency of wild-type Mad7 was 2.10%. Both Mad7-K169R and Mad7-K169R / N589H had higher editing efficiency than Mad7.

[0078] Example 6: Editing test of Mad7-K169R / N589H on rice genes To obtain rice material resistant to Rice Black-Streaked Dwarf Virus (RBSDV), two genes, OsGDI1 (Os05g0418000) and S-OsGDI1 (Os07g0271000), which down-regulate RBSDV, were selected and knocked out using Mad7-K169R / N589H as the nuclease for knockout. "TTTN" was selected as the PAM, and the knockout target sites, OsGDI1-ats1 and S-OsGDI1-ats1, were designed in the third exon of the two genes. The corresponding knockout vectors were constructed and genetically transformed into rice tissues using Agrobacterium transformation methods commonly used in the art.

[0079] Total DNA of the resulting rice T0 generation plants was extracted using the CTAB method, and the fragments near the target sites of OsGDI1 and S-OsGDI1 were amplified by PCR, respectively. The amplified fragments of each individual plant were sent to Beijing Tsingke Biotechnology Co., Ltd. for testing, and the knockout of the target genes was confirmed according to the sequencing results (as shown in Figure 6).

[0080] The knockout efficiency of the T0 transformed seedlings was statistically analyzed. Among the rice plants whose target locus OsGDI1-ats1 was edited, 27 of 39 tested rice plants were found to have a knockout, with a knockout efficiency of 69.2%. And for S-OsGDI1-ats1, 22 of 40 tested rice plants were found to have a knockout, with a knockout efficiency of 55.0%.

[0081] Example 7: Editing efficiency test of Mad7-K169R / N589H in soybean hairy root systems According to the prior art in the art, suitable target sites were designed on soybean FAD (GLYMA_10G286400) and MRP5a (GLYMA_03G056000) genes, and a single target editing test vector for Mad7-K169R / N589H was constructed. Soybean hairy roots were also obtained by infecting soybean with Agrobacterium rhizogenes. The hairy roots with fluorescent markers were harvested, DNA was extracted, and then analyzed by high-throughput sequencing analysis.

[0082] The experimental results are shown in Figure 7, in which Mad7-K169R / N589H generated clear mutations in the target regions of the FAD and MRP5a genes.

[0083] Example 8: Efficacy determination of mutant Mad7-K169R / N589H in zebrafish embryos We designed the target site gactggaggacttctggggaggt in the tyrosinase gene (tyr, gene ID: 30207), which is an essential gene in the zebrafish melanin synthesis pathway, and its PAM sequence was tttg. The chemically synthesized corresponding CrRNA was incubated with mutant Mad7-K169R / N589H to form an RNA-protease complex (RNP), and the RNP was adjusted to a concentration of 1 μM and injected into zebrafish one-cell embryos. Melanization of zebrafish embryos was observed 48 hours later. Approximately 500 live embryos were observed after injection in different batches, and four embryos were found to have a melanin-deficient phenotype. DNA was extracted from embryos with melanin deficiency. The target sequence was amplified and sequenced using Dr-TYR-F:GCGTCTCACTCTCCTCGACTCTTC and Dr-TYR-R:GTAGTTTCCGGCGCACTGGCAG.

[0084] The sequencing results are shown in Figure 8 and, compared to uninjected wild-type zebrafish embryos, the injected samples generated both definitive base deletion mutations at the designed target sites.

[0085] Example 9: Knockout validation of mutant Mad7-K169R / N589H in porcine primary fibroblasts Target site design for porcine SOCS2 gene (Gene ID: 100037966): To achieve the purpose of SOCS2 gene deletion, through genome sequence alignment design, the target site gggttctcactgacttctaagga was designed in the 5'-UTR of the porcine SOCS2 gene coding sequence, and the target site ctaaacacgcctcctgtagcgtc was designed after the stop codon of the porcine SOCS2 gene. The corresponding chemically synthesized crRNAs were named CR85 and CR86, respectively.

[0086] RNP transfection was performed into porcine fibroblasts (PEFs) using Lipofectamine Stem Transfection Reagent.

[0087] [Table 3]

[0088] Cells were digested and counted 24 hours after transfection. Cells were seeded uniformly in individual 10 cm Petri dishes at a density of 200 cells or less per 10 cm Petri dish, and fresh medium was replaced every 48 hours. On the 10th day after the cells split in the dish, the cells could be expanded into single-cell clones of appropriate size, which were digested using a cloning cylinder and then transferred to a 24-well cell culture plate. After 3–5 days of continuous culture, DNA amplification target sites were extracted from the cell line portion of the single-cell clone for sequencing validation.

[0089] The results are shown in Figure 9. Sequencing results of multiple cell lines of single cell clones indicated that definitive fragment deletion occurred directly at the designed dual target sites.

[0090] Although the present invention is satisfied by embodiments in many different forms, as described in detail in connection with the preferred embodiments of the present invention, it is understood that the present disclosure should be considered as an exemplification of the principles of the present invention and is not intended to limit the present invention to the specific embodiments shown and described herein. Numerous variations can be made by those skilled in the art without departing from the spirit of the present invention. The scope of the present invention is determined by the appended claims and their equivalents. The abstract and title of the invention should not be construed as limiting the scope of the present invention, and their purpose is to enable the general public, as well as the appropriate authorities, to quickly determine the general nature of the present invention.

Claims

1. An artificial nuclease comprising an amino acid sequence having the following mutation compared to the amino acid sequence set forth in SEQ ID NO:1: the amino acid at position 169 is mutated from lysine to arginine.

2. The artificial nuclease according to claim 1, wherein the amino acid sequence also has one or more mutations selected from the following group: the amino acid at position 589 is mutated from asparagine to any other amino acid, preferably histidine; the amino acid at position 535 is mutated from lysine to any other amino acid, preferably arginine; the amino acid at position 563 is mutated from lysine to any other amino acid, preferably arginine; the amino acid at position 601 is mutated from threonine to any other amino acid, preferably arginine; the amino acid at position 624 is mutated from serine to any other amino acid, preferably arginine.

3. The artificial nuclease of claim 1, wherein the amino acid sequence further has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO:

1.

4. The artificial nuclease of claim 1, comprising an amino acid sequence having at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13 and SEQ ID NO:

14.

5. The artificial nuclease of claim 1, having improved editing activity in yeast compared to a nuclease having the amino acid sequence set forth in SEQ ID NO:

1.

6. An enzyme cocktail comprising a combination of one or more of the artificial nucleases described in any one of claims 1 to 5.

7. 1. A method for modifying a target region in the genome of a cell, comprising: (a) a cell; The artificial nuclease according to any one of claims 1 to 5; An artificial guide nucleic acid capable of complexing with said nuclease; and contacting with an editing sequence that is complementary to the target region and that encodes a nucleic acid having an alteration in sequence compared to the target region; and (b) enabling the nuclease, guide nucleic acid and editing sequence to create a genome edit in the target region of the genome of the cell. A method comprising:

8. The method of claim 7, wherein the artificial guide nucleic acid and the editing sequence are provided as a single nucleic acid.

9. 9. The method of claim 8, wherein the single nucleic acid further comprises a mutation in a protospacer adjacent motif (PAM) site.

10. (a) the artificial nuclease according to any one of claims 1 to 5; (b) an artificial guide nucleic acid capable of complexing with said nuclease; and (c) an edited sequence having a change in sequence compared to the sequence of the target region in the genome of the cell. A nucleic acid-guided nuclease system comprising: The system results in genome editing in a target region in the genome of the cell facilitated by the nuclease, the artificial guide nucleic acid, and the editing sequence. system.

11. The system of claim 10, wherein the artificial guide nucleic acid and the editing sequence are provided as a single nucleic acid.

12. The system of claim 11 , wherein the single nucleic acid further comprises a mutation in a protospacer adjacent motif (PAM) site.

13. (a) the artificial nuclease according to any one of claims 1 to 5; and (b) an artificial guide nucleic acid capable of complexing with said nuclease, said artificial guide nucleic acid comprising a loop sequence comprising the sequence UAUU, UUUU, UGUU, UCUU, UCUUU or UAGU; A composition comprising:

14. The composition of claim 13, wherein the artificial guide nucleic acid is a heterologous artificial guide nucleic acid.

15. The composition of claim 13 , wherein the nuclease is encoded by a nucleic acid sequence that is codon-optimized for use in a cell from a particular organism.

16. (a) the artificial nuclease according to any one of claims 1 to 5; and (b) a heterologous artificial guide nucleic acid capable of complexing with said nuclease; A nucleic acid-guided nuclease system comprising:

17. The system of claim 16, further comprising (c) an edited sequence having a change in sequence compared to the sequence of the target region.

18. 18. The system of claim 17, wherein the targeting system results in editing in the target region facilitated by the nuclease, the heterologous artificial guide nucleic acid, and the editing sequence.

19. 17. The system of claim 16, wherein the artificial guide nucleic acid comprises a loop sequence comprising the sequence UAUU, UUUU, UGUU, UCUU, UCUUU or UAGU.

20. The system of claim 16 , wherein the nuclease is encoded by a nucleic acid sequence that is codon-optimized for use in a cell from a particular organism.

21. A gene editing kit comprising the artificial nuclease described in any one of claims 1 to 5.

22. Use of the artificial nuclease described in claims 1 to 5 in the preparation of a formulation or kit, wherein the formulation or kit is used for (i) genome editing; (ii) targeted nucleic acid diagnosis; or (iii) disease treatment.

Images