Recombinant transforming growth factor beta in yeast

Abstract

The present invention relates to the expression and secretion of transforming growth factor beta (TGFβ) in methylotrophic yeast, such as Pichia pastoris (P. pastoris), yeast cells whose genome comprises TGFβ, and uses thereof, including use in growth media.

Description

[Technical field]

[0001] The present invention relates to the expression and secretion of transforming growth factor beta (TGFβ) in methylotrophic yeast, such as Pichia pastoris (P. pastoris), yeast cells whose genome comprises TGFβ, and uses thereof, including use in growth media. [Background technology]

[0002] Growth factors are naturally occurring cell signaling molecules that play many essential roles, including the regulation of cell proliferation and development, wound healing, and cell differentiation.

[0003] Growth media used in cell culture usually contain a combination of growth factors. It is therefore important to be able to produce suitable growth factors for use in growth media in an efficient and cost-effective manner. Currently, no such method exists for producing TGFβ. The methods used to produce TGFβ are labor intensive and therefore are expensive materials. There is a need for an efficient method for the production of purified TGFβ.

[0004] In the growing field of cultivated meat, cell culture is a fundamental aspect of the process. One of the limiting steps in the production of cultivated meat is the high cost of the growth medium. Climate and other environmental concerns continue to drive the demand for cultivated meat, and therefore also the need for improved growth media to replace animal serum-based media.

[0005] Transforming growth factor beta (TGFβ) is a family of cell regulatory proteins whose members are involved in diverse cellular processes. TGFβ1, TGFβ2, and TGFβ3 are members of this family. TGFβ binds to specific TGFβ receptors (TGFβR), such as TGFβR1 and TGFβR2. TGFβ is a key signaling protein that can regulate a variety of functions, including cell proliferation, differentiation, apoptosis, and metabolism. TGFβ is commonly used in growth media, and there is a continuing need for improved methods of producing TGFβ polypeptides in an efficient manner.

[0006] The present invention fulfills this need by providing a yeast cell whose genome contains TGFβ. To our knowledge, this is the first successful and efficient expression of TGFβ in a methylotrophic yeast, such as P. pastoris.

[0007] Due to the post-translational modification mechanisms of cells, it is particularly beneficial to express TGFβ in methylotrophic yeast, including P. pastoris. For example, TGFβ3 contains five disulfide bridges and folds correctly upon the formation of these disulfide bridges. TGFβ3 has three N-linked glycosylation sites, and advantageously P. pastoris provides a glycosylation pattern similar to the human pattern, ensuring similar folding and activity of TGFβ3 while being sufficiently different to minimize the risk of induced immune responses.

[0008] Additionally, methylotrophic yeasts, including P. pastoris, secrete recombinantly produced proteins more readily than other types of yeast, such as Saccharomyces cerevisiae, and are therefore much better suited as a platform for producing recombinant proteins. [Prior art documents] [Non-patent literature]

[0009] [Non-Patent Document 1] Obst et al., “A Modular Toolkit for Generating Pichia pastoris Secretion Libraries,” ACS Synth. Biol., 2017. [Non-Patent Document 2] Lee et al., “A Highly Characterized Yeast Toolkit for Modular, Multipart Assembly,” ACS Synth. Biol., 2015. [Non-Patent Document 3] Taylor et al., “Start-Stop Assembly: a functionally scarless DNA assembly system optimized for metabolic engineering,” Nucleic Acids Res., 2019. [Non-Patent Document 4] Lin-Cereghino, J et al., “Condensed protocol for competent cell preparation and transformation of the methylotrophic yeast Pichia pastoris”, Biotechniques, 2005 [Non-Patent Document 5] http: / / genomes.urv.es / OPTIMIZER / [Non-Patent Document 6] Aw, R and Polizzi, K, “Liquid PTVA: a faster and cheaper alternative for generating multi-copy clones in Pichia pastoris” Summary of the Invention [Means for solving the problem]

[0010] Provided herein is a methylotrophic yeast cell, and optionally a Pichia pastoris cell, whose genome comprises a sequence encoding transforming growth factor beta.

[0011] In some embodiments, the yeast cell genome comprises sequences encoding TGFβ1, TGFβ2, or TGFβ3.

[0012] In some embodiments, the yeast cell genome comprises a sequence encoding TGFβ3.

[0013] In some embodiments, the yeast cell is transformed using a plasmid, wherein the plasmid comprises the nucleic acid sequence of SEQ ID NO:7, SEQ ID NO:14, or SEQ ID NO:15.

[0014] In some embodiments, the yeast cell is transformed using a plasmid, wherein the plasmid comprises the nucleic acid sequence of SEQ ID NO:7.

[0015] In some embodiments, the yeast cell is transformed using a plasmid, wherein the plasmid comprises the nucleic acid sequence of SEQ ID NO:14.

[0016] In some embodiments, the yeast cell is transformed using a plasmid, wherein the plasmid comprises the nucleic acid sequence of SEQ ID NO:15.

[0017] Also provided herein is a polypeptide obtained or obtainable from a yeast cell of the invention, comprising the amino acid sequence of SEQ ID NO:3.

[0018] Also provided herein is a method of producing a TGFβ polypeptide, comprising transforming a yeast cell to express TGFβ.

[0019] Also provided herein is a method of growing animal cells, comprising culturing the animal cells in a growth medium containing a TGFβ polypeptide of the invention.

[0020] Also provided herein is the use of a polypeptide produced according to the invention in an animal cell growth medium. [Brief description of the drawings]

[0021] [Figure 1] 1A and 1B show an example of the plasmid (pGT86) used to transform P. pastoris in both the circularized form (A) and the linearized form (B). [Diagram 2] FIG. 2 shows the expression results in dot blots. [Diagram 3] FIG. 3 shows the results of expression analysis by Western blot. [Figure 4A] Figures 4A-4D show examples of other plasmids (pBM64 and pBM65) that were used to transform P. pastoris in both circularized (A, C) and linearized (B, D) forms. [Figure 4B] Figures 4A-4D show examples of other plasmids (pBM64 and pBM65) that were used to transform P. pastoris in both circularized (A, C) and linearized (B, D) forms. [Figure 4C] Figures 4A-4D show examples of other plasmids (pBM64 and pBM65) that were used to transform P. pastoris in both circularized (A, C) and linearized (B, D) forms. [Figure 4D] Figures 4A-4D show examples of other plasmids (pBM64 and pBM65) that were used to transform P. pastoris in both circularized (A, C) and linearized (B, D) forms. [Diagram 5] FIG. 5 shows the expression results in a dot plot for plasmid pBM64. [Figure 6] FIG. 6 shows the expression results in a dot plot for plasmid pBM65. [Figure 7]FIG. 7 shows expression results in a dot plot for plasmid pBM65 after liquid PVTA. [Figure 8] FIG. 8 shows the results of a Western blot for plasmid pBM65 after liquid PVTA. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0022] The present invention provides novel yeast cells, the genome of which comprises TGFβ and has the ability to express TGFβ. The present invention also provides methods for obtaining said yeast cells by transformation and polypeptides produced by these yeast cells.

[0023] The novel yeast cells of the present invention include methylotrophic yeast cells, e.g., P. pastoris cells. Methylotrophic yeasts can use methanol as the sole source of carbon and energy. All methylotrophic yeasts share a common pathway for methanol utilization. Methanol is first oxidized by AOX in the peroxisomes to form formaldehyde and hydrogen peroxide (H2O2), both of which are toxic to the cell and are degraded by enzymes located in the peroxisomes. Methylotrophic yeast cells achieve surprisingly high levels of protein expression in the present invention compared to non-methylotrophic yeast cells, e.g., Saccharomyces cells.

[0024] In one embodiment, the invention provides TGFβ coding sequences that are particularly effective in the yeast cells of the invention, in particular, such coding sequences produce surprisingly high levels of expression of TGFβ.

[0025] Unless otherwise defined, all scientific and technical terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Generally, the nomenclature and laboratory procedures in cell culture, molecular genetics, organic chemistry, nucleic acid chemistry and hybridization used herein are those well known and commonly used in the art. Standard techniques are used for nucleic acid and peptide synthesis. The techniques and procedures are generally performed according to conventional methods in the art. The nomenclature used herein and the synthetic biology laboratory procedures described below are those well known and commonly used in the art.

[0026] Cells of the invention In some embodiments, the invention provides a methylotrophic yeast cell, whose genome comprises transforming growth factor beta (TGFβ).

[0027] The yeast cells of the invention are recombinant yeast cells and contain at least one nucleic acid sequence that does not naturally occur in the cell.

[0028] In some embodiments, a yeast cell of the invention is a Pichia, Candida, Hansenula, Ogataea, Torulopsis, or Komagataella cell.

[0029] In some embodiments, a yeast cell of the invention is a Pichia pastoris, Candida boidinii, Ogataea methanolica, Ogataea polymorpha, Ogataea thermomethanolica, or Meyerozyma guilliermondii cell.

[0030] In some embodiments, the yeast cell of the invention is a Pichia pastoris cell.

[0031] Pichia pastoris is also known as Komagataella phaffii, K. phaffii, Komagataella phaffii (Pichia pastoris), Pichia pastoris (Komagataella phaffii), Komagataella kurtzmanii (K. kurtzmanii), and other such variations. These terms are intended to refer to the same species and are used interchangeably herein.

[0032] Pichia pastoris is an example of a methylotrophic yeast.

[0033] The terms "TGFβ1", "TGFb1", "TGF beta 1", "TGFβ-1", "TGFb-1", "TGF beta-1", "transforming growth factor beta 1" and "transforming growth factor beta-1" and similar terms all refer to the same growth factor and may be used interchangeably.

[0034] The terms "TGFβ2," "TGFb2," "TGF beta 2," "TGFβ-2," "TGFb-2," "TGF beta-2," "transforming growth factor beta 2," and "transforming growth factor beta-2," and similar terms all refer to the same growth factor and may be used interchangeably.

[0035] The terms "TGFβ3," "TGFb3," "TGF beta 3," "TGFβ-3," "TGFb-3," "TGF beta-3," "transforming growth factor beta 3," and "transforming growth factor beta-3," and similar terms all refer to the same growth factor and may be used interchangeably.

[0036] Human TGFβ1 comprises the amino acid sequence of SEQ ID NO:1, shown below:

[0037] [ka]

[0038] Human TGFβ2 comprises the amino acid sequence of SEQ ID NO:2, shown below:

[0039] [ka]

[0040] Human TGFβ3 comprises the amino acid sequence of SEQ ID NO:3, shown below:

[0041] [ka]

[0042] TGFβ3 has multiple functions including cell proliferation, differentiation, wound healing, apoptosis, and metabolism.

[0043] TGFβ3 binds to and stimulates the transforming growth factor beta receptor (TGFβR), and this biological activity is required for effective function of the TGFβ3 protein.

[0044] In some embodiments, a yeast cell of the invention comprises the nucleic acid sequence of SEQ ID NO:4, SEQ ID NO:12, or SEQ ID NO:13.

[0045] In some embodiments, the yeast cell of the invention comprises a sequence having at least 80% similarity to SEQ ID NO: 4, SEQ ID NO: 12 or SEQ ID NO: 13 encoding TGFβ3. In some embodiments, the yeast cell of the invention comprises a sequence having at least 85% similarity to SEQ ID NO: 4, SEQ ID NO: 12 or SEQ ID NO: 13 encoding TGFβ3. In some embodiments, the yeast cell of the invention comprises a sequence having at least 90% similarity to SEQ ID NO: 4, SEQ ID NO: 12 or SEQ ID NO: 13 encoding TGFβ3. In some embodiments, the yeast cell of the invention comprises a sequence having at least 95% similarity to SEQ ID NO: 4, SEQ ID NO: 12 or SEQ ID NO: 13 encoding TGFβ3. In some embodiments, the yeast cell of the invention comprises a sequence having at least 99% similarity to SEQ ID NO: 4, SEQ ID NO: 12 or SEQ ID NO: 13 encoding TGFβ3.

[0046] In some embodiments, a yeast cell of the invention comprises the nucleic acid sequence of SEQ ID NO:4.

[0047] In some embodiments, the yeast cell of the invention comprises a sequence having at least 80% similarity to SEQ ID NO: 4 encoding TGFβ3. In some embodiments, the yeast cell of the invention comprises a sequence having at least 85% similarity to SEQ ID NO: 4 encoding TGFβ3. In some embodiments, the yeast cell of the invention comprises a sequence having at least 90% similarity to SEQ ID NO: 4 encoding TGFβ3. In some embodiments, the yeast cell of the invention comprises a sequence having at least 95% similarity to SEQ ID NO: 4 encoding TGFβ3. In some embodiments, the yeast cell of the invention comprises a sequence having at least 99% similarity to SEQ ID NO: 4 encoding TGFβ3.

[0048] In some embodiments, a yeast cell of the invention comprises the nucleic acid sequence of SEQ ID NO:12.

[0049] In some embodiments, the yeast cell of the invention comprises a sequence having at least 80% similarity to SEQ ID NO: 12 encoding TGFβ3. In some embodiments, the yeast cell of the invention comprises a sequence having at least 85% similarity to SEQ ID NO: 12 encoding TGFβ3. In some embodiments, the yeast cell of the invention comprises a sequence having at least 90% similarity to SEQ ID NO: 12 encoding TGFβ3. In some embodiments, the yeast cell of the invention comprises a sequence having at least 95% similarity to SEQ ID NO: 12 encoding TGFβ3. In some embodiments, the yeast cell of the invention comprises a sequence having at least 99% similarity to SEQ ID NO: 12 encoding TGFβ3.

[0050] In some embodiments, a yeast cell of the invention comprises the nucleic acid sequence of SEQ ID NO:13.

[0051] In some embodiments, the yeast cell of the invention comprises a sequence having at least 80% similarity to SEQ ID NO: 13 encoding TGFβ3. In some embodiments, the yeast cell of the invention comprises a sequence having at least 85% similarity to SEQ ID NO: 13 encoding TGFβ3. In some embodiments, the yeast cell of the invention comprises a sequence having at least 90% similarity to SEQ ID NO: 13 encoding TGFβ3. In some embodiments, the yeast cell of the invention comprises a sequence having at least 95% similarity to SEQ ID NO: 13 encoding TGFβ3. In some embodiments, the yeast cell of the invention comprises a sequence having at least 99% similarity to SEQ ID NO: 13 encoding TGFβ3.

[0052] The percent similarity (or "percent similarity") between two sequences can be calculated by multiplying the number of matches in the pair by 100 and dividing by the length of the aligned region, including gaps. Identity scoring counts only perfect matches. Gaps at the ends of the sequences are not included, but internal gaps are included in the length. BLAST (NCBI) can be used to generate the alignment.

[0053] In some embodiments, SEQ ID NO:4 encodes TGFβ3 that binds to at least one transforming growth factor beta receptor (TGFβR).

[0054] In some embodiments, SEQ ID NO:4 encodes TGFβ3 that binds to TGFβR1, TGFβR2 and / or TGFβR3.

[0055] In some embodiments, SEQ ID NO:12 encodes a TGFβ3 that binds to at least one transforming growth factor beta receptor (TGFβR).

[0056] In some embodiments, SEQ ID NO:12 encodes TGFβ3 that binds to TGFβR1, TGFβR2 and / or TGFβR3.

[0057] In some embodiments, SEQ ID NO:13 encodes TGFβ3 that binds to at least one transforming growth factor beta receptor (TGFβR).

[0058] In some embodiments, SEQ ID NO: 13 encodes TGFβ3 that binds to TGFβR1, TGFβR2 and / or TGFβR3.

[0059] In some embodiments, a yeast cell of the invention expresses a polypeptide comprising the amino acid sequence of SEQ ID NO:1, or a fragment, analog or derivative thereof, that binds to at least one transforming growth factor beta receptor (TGFβR).

[0060] In some embodiments, a yeast cell of the invention expresses a polypeptide comprising the amino acid sequence of SEQ ID NO:2, or a fragment, analog or derivative thereof, that binds to at least one transforming growth factor beta receptor (TGFβR).

[0061] In some embodiments, a yeast cell of the invention expresses a polypeptide comprising the amino acid sequence of SEQ ID NO:3, or a fragment, analog or derivative thereof, that binds to at least one transforming growth factor beta receptor (TGFβR).

[0062] In some embodiments, a yeast cell of the invention expresses a polypeptide comprising a sequence having at least 80% similarity to SEQ ID NO:1, wherein the polypeptide binds to at least one transforming growth factor beta receptor (TGFβR). In some embodiments, a polypeptide of the invention comprises a sequence having at least 85% similarity to SEQ ID NO:1. In some embodiments, a polypeptide of the invention comprises a sequence having at least 90% similarity to SEQ ID NO:1, wherein the polypeptide binds to at least one transforming growth factor beta receptor (TGFβR). In some embodiments, a polypeptide of the invention comprises a sequence having at least 95% similarity to SEQ ID NO:1, wherein the polypeptide binds to at least one transforming growth factor beta receptor (TGFβR).

[0063] In some embodiments, a yeast cell of the invention expresses a polypeptide comprising a sequence having at least 80% similarity to SEQ ID NO:2, wherein the polypeptide binds to at least one transforming growth factor beta receptor (TGFβR). In some embodiments, a polypeptide of the invention comprises a sequence having at least 85% similarity to SEQ ID NO:2. In some embodiments, a polypeptide of the invention comprises a sequence having at least 90% similarity to SEQ ID NO:2, wherein the polypeptide binds to at least one transforming growth factor beta receptor (TGFβR). In some embodiments, a polypeptide of the invention comprises a sequence having at least 95% similarity to SEQ ID NO:2, wherein the polypeptide binds to at least one transforming growth factor beta receptor (TGFβR).

[0064] In some embodiments, a yeast cell of the invention expresses a polypeptide comprising a sequence having at least 80% similarity to SEQ ID NO:3, wherein the polypeptide binds to at least one transforming growth factor beta receptor (TGFβR). In some embodiments, a polypeptide of the invention comprises a sequence having at least 85% similarity to SEQ ID NO:3. In some embodiments, a polypeptide of the invention comprises a sequence having at least 90% similarity to SEQ ID NO:3, wherein the polypeptide binds to at least one transforming growth factor beta receptor (TGFβR). In some embodiments, a polypeptide of the invention comprises a sequence having at least 95% similarity to SEQ ID NO:3, wherein the polypeptide binds to at least one transforming growth factor beta receptor (TGFβR).

[0065] In some embodiments, the yeast cells of the invention express a polypeptide that binds to TGFβR1, TGFβR2 and / or TGFβR3.

[0066] In some embodiments, the TGFβ3 comprised by the yeast cells of the invention is human TGFβ3.

[0067] In some embodiments, the TGFβ3 is bovine TGFβ3. In some embodiments, the TGFβ3 is porcine TGFβ3. In some embodiments, the TGFβ3 is chicken TGFβ3.

[0068] In some embodiments, the TGFβ3 comprises the nucleic acid sequence of SEQ ID NO:4, SEQ ID NO:12, or SEQ ID NO:13.

[0069] In some embodiments, the TGFβ3 comprises the nucleic acid sequence of SEQ ID NO:4.

[0070] In some embodiments, the TGFβ3 comprises the nucleic acid sequence of SEQ ID NO:12.

[0071] In some embodiments, the TGFβ3 comprises the nucleic acid sequence of SEQ ID NO:13.

[0072] In some embodiments, the sequence encoding TGFβ3 comprises the nucleic acid sequence of SEQ ID NO:4, SEQ ID NO:12, or SEQ ID NO:13.

[0073] In some embodiments, the sequence encoding TGFβ3 comprises the nucleic acid sequence of SEQ ID NO:4.

[0074] In some embodiments, the sequence encoding TGFβ3 comprises the nucleic acid sequence of SEQ ID NO:12.

[0075] In some embodiments, the sequence encoding TGFβ3 comprises the nucleic acid sequence of SEQ ID NO:13.

[0076] In some embodiments, the yeast cells are transformed with a plasmid comprising a sequence encoding TGFβ1, TGFβ2, or TGFβ3.

[0077] In some embodiments, the plasmid comprises a promoter.

[0078] In some embodiments, the plasmid comprises a coding sequence.

[0079] In some embodiments, the plasmid comprises a terminator.

[0080] In some embodiments, the plasmid comprises a promoter, a coding sequence, and a terminator.

[0081] In some embodiments, the plasmid comprises a signal peptide.

[0082] In some embodiments, the plasmid comprises a promoter, a signal peptide, a coding sequence, and a terminator.

[0083] In some embodiments, the promoter is the alcohol oxidase I (AOX1) promoter. In some embodiments, the promoter comprises the nucleic acid sequence of SEQ ID NO:5.

[0084] In some embodiments, the signal peptide is an alpha mating factor signal peptide. In some embodiments, the signal peptide comprises the nucleic acid sequence of SEQ ID NO:6.

[0085] In some embodiments, the coding sequence comprises TGFβ3, optionally human TGFβ3. In some embodiments, the coding sequence comprises the nucleic acid sequence of SEQ ID NO:4, SEQ ID NO:12, or SEQ ID NO:13.

[0086] In some embodiments, the coding sequence comprises TGFβ3, optionally human TGFβ3. In some embodiments, the coding sequence comprises the nucleic acid sequence of SEQ ID NO:4.

[0087] In some embodiments, the coding sequence comprises TGFβ3, optionally human TGFβ3. In some embodiments, the coding sequence comprises the nucleic acid sequence of SEQ ID NO:12.

[0088] In some embodiments, the coding sequence comprises TGFβ3, optionally human TGFβ3. In some embodiments, the coding sequence comprises the nucleic acid sequence of SEQ ID NO:13.

[0089] In some embodiments, the terminator is an alcohol oxidase I (AOX1) terminator. In some embodiments, the terminator comprises the nucleic acid sequence of SEQ ID NO:7.

[0090] In some embodiments, the plasmid comprises the nucleic acid sequence of SEQ ID NO:4-7.

[0091] In some embodiments, the plasmid comprises the nucleic acid sequences of SEQ ID NOs: 12 and 5-7.

[0092] In some embodiments, the plasmid comprises the nucleic acid sequences of SEQ ID NOs: 13 and 5-7.

[0093] In some embodiments, the plasmid comprises at least one tag.

[0094] In some embodiments, the tag comprises a His tag fused to a HiBiT tag. In some embodiments, the tag comprises the nucleic acid sequence of SEQ ID NO:8.

[0095] In some embodiments, the tag comprises a His tag fused to a TEV cleavage site. In some embodiments, the tag comprises the nucleic acid sequence of SEQ ID NO: 18.

[0096] In some embodiments, the plasmid comprises the nucleic acid sequence of SEQ ID NO:4-8.

[0097] In some embodiments, the plasmid comprises the nucleic acid sequence of SEQ ID NOs: 12, 5-7 and 18.

[0098] In some embodiments, the plasmid comprises the nucleic acid sequence of SEQ ID NOs: 13, 5-7 and 18.

[0099] In some embodiments, the plasmid comprises the nucleic acid sequence of SEQ ID NO:9, SEQ ID NO:16, or SEQ ID NO:17.

[0100] In some embodiments, the plasmid comprises the nucleic acid sequence of SEQ ID NO:9.

[0101] In some embodiments, the plasmid comprises the nucleic acid sequence of SEQ ID NO:16.

[0102] In some embodiments, the plasmid comprises the nucleic acid sequence of SEQ ID NO:17.

[0103] In some embodiments, the plasmid is the plasmid shown in FIG. 1A.

[0104] In some embodiments, the plasmid is the plasmid shown in FIG. 1B.

[0105] In some embodiments, the plasmid is the plasmid shown in Figure 4A.

[0106] In some embodiments, the plasmid is the plasmid shown in Figure 4B.

[0107] In some embodiments, the plasmid is the plasmid shown in Figure 4C.

[0108] In some embodiments, the plasmid is the plasmid shown in Figure 4D.

[0109] The plasmids described herein may be circular.

[0110] The plasmids described herein may be linearized.

[0111] Polypeptides obtained or obtainable from the yeast cells of the invention In some embodiments, the invention provides polypeptides obtained or obtainable from the yeast cells disclosed herein.

[0112] In some embodiments, a polypeptide of the invention comprises the amino acid sequence of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3.

[0113] In some embodiments, the polypeptide of the present invention comprises a sequence having at least 80% similarity to SEQ ID NO: 1, and the polypeptide binds to at least one transforming growth factor beta receptor (TGFβR). In some embodiments, the polypeptide of the present invention comprises a sequence having at least 85% similarity to SEQ ID NO: 1, and the polypeptide binds to at least one transforming growth factor beta receptor (TGFβR). In some embodiments, the polypeptide of the present invention comprises a sequence having at least 90% similarity to SEQ ID NO: 1, and the polypeptide binds to at least one transforming growth factor beta receptor (TGFβR). In some embodiments, the polypeptide of the present invention comprises a sequence having at least 95% similarity to SEQ ID NO: 1, and the polypeptide binds to at least one transforming growth factor beta receptor (TGFβR).

[0114] In some embodiments, the polypeptide of the present invention comprises a sequence having at least 80% similarity to SEQ ID NO:2, and the polypeptide binds to at least one transforming growth factor beta receptor (TGFβR). In some embodiments, the polypeptide of the present invention comprises a sequence having at least 85% similarity to SEQ ID NO:2, and the polypeptide binds to at least one transforming growth factor beta receptor (TGFβR). In some embodiments, the polypeptide of the present invention comprises a sequence having at least 90% similarity to SEQ ID NO:2, and the polypeptide binds to at least one transforming growth factor beta receptor (TGFβR). In some embodiments, the polypeptide of the present invention comprises a sequence having at least 95% similarity to SEQ ID NO:2, and the polypeptide binds to at least one transforming growth factor beta receptor (TGFβR).

[0115] In some embodiments, the polypeptide of the present invention comprises a sequence having at least 80% similarity to SEQ ID NO:3, and the polypeptide binds to at least one transforming growth factor beta receptor (TGFβR). In some embodiments, the polypeptide of the present invention comprises a sequence having at least 85% similarity to SEQ ID NO:3, and the polypeptide binds to at least one transforming growth factor beta receptor (TGFβR). In some embodiments, the polypeptide of the present invention comprises a sequence having at least 90% similarity to SEQ ID NO:3, and the polypeptide binds to at least one transforming growth factor beta receptor (TGFβR). In some embodiments, the polypeptide of the present invention comprises a sequence having at least 95% similarity to SEQ ID NO:3, and the polypeptide binds to at least one transforming growth factor beta receptor (TGFβR).

[0116] The percent similarity (or "percentage similarity") between two sequences can be calculated by multiplying the number of matches in the pair by 100 and dividing by the length of the aligned region, including gaps. Identity scoring counts only perfect matches and does not take into account the degree of similarity of amino acids relative to each other. Gaps at the ends of the sequences are not included, but internal gaps are included in the length.

[0117] The present invention further relates to fragments, analogs and derivatives of the polypeptides obtained or obtainable from the yeast cells disclosed herein, where the "fragments," "derivatives" and "analogs" retain essentially the same biological function or activity as the polypeptides set forth in SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3.

[0118] Methods of the Invention In some embodiments, a method for producing a TGFβ polypeptide is provided, the method comprising culturing a yeast cell of the invention under conditions allowing expression of the polypeptide, and optionally recovering the expressed polypeptide.

[0119] In some embodiments, the method for producing a TGFβ polypeptide further comprises: i) optimizing a nucleic acid encoding a TGFβ polypeptide for expression in yeast; ii) screening more than 10 clones for expression of TGFβ; and / or iii) detecting expression using a tag.

[0120] In some embodiments, the method for producing a TGFβ polypeptide further comprises: i) optimizing a nucleic acid encoding a TGFβ polypeptide for expression in yeast; ii) screening more than 10 clones for expression of TGFβ; and / or iii) detecting expression using a HiBiT peptide tag.

[0121] In some embodiments, the method for producing a TGFβ polypeptide further comprises: i) optimizing a nucleic acid encoding a TGFβ polypeptide for expression in yeast; ii) screening more than 10 clones for expression of TGFβ; and / or iii) detecting expression using a His tag.

[0122] In some embodiments, the invention provides a method for producing a TGFβ3 polypeptide, the method comprising transforming methylotrophic yeast with a linearized plasmid comprising a nucleic acid sequence of SEQ ID NO:4-7 by electroporation and screening more than 10 clones for expression.

[0123] In some embodiments, the invention provides a method for producing a TGFβ3 polypeptide, the method comprising transforming methylotrophic yeast with a linearized plasmid comprising the nucleic acid sequences of SEQ ID NOs: 12 and 5-7 by electroporation and screening more than 10 clones for expression.

[0124] In some embodiments, the invention provides a method for producing a TGFβ3 polypeptide, the method comprising transforming methylotrophic yeast with a linearized plasmid comprising the nucleic acid sequences of SEQ ID NOs: 13 and 5-7 by electroporation and screening more than 10 clones for expression.

[0125] In some embodiments, the present invention provides a method for producing a TGFβ3 polypeptide, the method comprising transforming Pichia pastoris with a linearized plasmid comprising a nucleic acid sequence of SEQ ID NO:4-7 by electroporation and screening more than 10 clones for expression.

[0126] In some embodiments, the invention provides a method for producing a TGFβ3 polypeptide, comprising transforming Pichia pastoris with a linearized plasmid comprising the nucleic acid sequences of SEQ ID NOs: 12 and 5-7 by electroporation and screening more than 10 clones for expression.

[0127] In some embodiments, the invention provides a method for producing a TGFβ3 polypeptide, comprising transforming Pichia pastoris with a linearized plasmid comprising the nucleic acid sequences of SEQ ID NOs: 13 and 5-7 by electroporation and screening more than 10 clones for expression.

[0128] In some embodiments, more than 20 clones or more than 30 clones are screened for expression. In preferred embodiments, more than 40 clones are screened.

[0129] In some embodiments, the invention includes screening clones for expression by detection of the tag.

[0130] In some embodiments, the invention comprises screening clones for expression by detection of the HiBiT tag.

[0131] In some embodiments, the invention comprises screening clones for expression by detection of the His tag.

[0132] In some embodiments, methods of the invention include growing yeast cells of the invention in baffled shake flasks.

[0133] In some embodiments, methods of the invention comprise culturing yeast cells of the invention in a stirred bioreactor.

[0134] In some embodiments, yeast cells of the invention are cultured in a fermentation medium in a stirred bioreactor.

[0135] In some embodiments, yeast cells of the invention are cultured in a fermentation medium in a stirred bioreactor for a defined time, at a defined pH, and / or at a defined temperature.

[0136] In some embodiments, the defined time period is between 6 and 144 hours, preferably between 24 and 96 hours.

[0137] In some embodiments, the defined pH is between 2.0 and 10.0, preferably between 4.0 and 8.0.

[0138] In some embodiments, the defined temperature is between 4 and 37°C, preferably between 8 and 30°C.

[0139] In some embodiments, TGFβ is expressed and secreted from the yeast cells into the fermentation medium. In some embodiments, TGFβ is not stored intracellularly in the yeast cells. Thus, the present invention also relates to the secretory expression of TGFβ using yeast cells.

[0140] In some embodiments, after the culture period, the TGFβ-containing supernatant is separated from the yeast cells by centrifugation.

[0141] In some embodiments, after the culture period, the TGFβ-containing supernatant is separated from the yeast cells by centrifugation and subjected to filtration-based purification.

[0142] In some embodiments, filtration-based purification removes undesirable molecules.

[0143] In some embodiments, the filtered TGF-β-containing sample is optionally freeze-dried for long-term stable storage.

[0144] It is understood that the present invention may relate to the expression of functional variants of TGFβ1, TGFβ2 and TGFβ3 that achieve the same or similar downstream effects as wild-type TGFβ, and proteins in the same biological pathways.

[0145] For example, the present invention may also relate to the expression of any activator of the TGFβ family of receptors. The present invention may also relate to the expression of an activator of the TGFβ3 receptor. The present invention also relates to the formation of the TGF-beta-3-TGFR complex (EMBL-EBI ComplexAc: CPX-2544). The present invention also relates to an activator of the TGFβ signaling pathway. The present invention also relates to an activator of the transforming growth factor beta receptor signaling pathway (EMBL-EBI GO: 0007179).

[0146] Uses of the Polypeptides Produced According to the Invention In some embodiments, the present invention provides the use of a polypeptide as described herein in a growth medium. In some embodiments, the growth medium is an animal growth medium. The growth medium may be serum-free.

[0147] A growth medium is a medium used for the survival, proliferation and / or storage of cells. In some embodiments, the growth medium of the present invention is used for the culture of fibroblasts, myoblasts, adipocytes, mesenchymal stem cells or induced pluripotent stem cells (iPSCs).

[0148] The growth medium of the present invention may additionally comprise one or more additional growth factors, serum or serum replacement, one or more hormones, one or more antibiotics, one or more trace elements and / or one or more antioxidants.

[0149] In some embodiments, the present invention provides a method of growing a cell, comprising culturing the cell in a growth medium containing a polypeptide as described herein. In some embodiments, the cell is an animal cell. In some embodiments, the growth medium is an animal growth medium.

[0150] It is understood that the specific embodiments described herein are presented as illustrations and not limitations of the invention. The principal features of the invention can be employed in various embodiments without departing from the scope of the invention. Those skilled in the art will recognize, or be able to ascertain using no more than routine research, numerous equivalents to the specific procedures described herein. Such equivalents are considered to be within the scope of the invention and are covered by the claims. All publications mentioned in this specification are indicative of the level of skill of those skilled in the art to which this invention pertains.

[0151] All publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.

[0152] The use of the word "a" or "an" when used in conjunction with the term "comprising" in the claims and / or this specification can mean "one," but is also consistent with the meanings of "one or more," "at least one," and "one or more than one." The use of the term "or" in the claims is used to mean "and / or" unless expressly indicated to refer to alternatives only or the alternatives are mutually exclusive, however, this disclosure supports a definition that refers to alternatives only and "and / or."

[0153] Throughout this application, the term "about" is used to indicate that a value includes the inherent variation of error for the subsequent characteristic.

[0154] As used in the specification and claims, the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has", "including" (and any form of including, such as "includes" and "include"), or "containing" (and any form of containing, such as "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

[0155] The term "or combinations thereof" as used herein refers to all permutations and combinations of the listed items preceding the term. For example, "A, B, C, or combinations thereof" is intended to include at least one of A, B, C, AB, AC, BC, or ABC, and also BA, CA, CB, CBA, BCA, ACB, BAC, or CAB, if the order is important in the particular context. Continuing with this example, combinations containing repeats of one or more items or terms are expressly included, such as BB, AAA, MB, BBC, AAABCCCC, CBBAAA, and CABABB. Those skilled in the art will understand that the number of items or terms in any combination is typically not limited, unless otherwise clear from the context.

[0156] Any part of this disclosure may be read in combination with any other part of this disclosure, unless otherwise clear from the context.

[0157] All of the cells, polypeptides, nucleic acids and methods disclosed and claimed in this application can be made and executed without undue experimentation in light of the present disclosure. While the present invention has been described in terms of preferred embodiments, it will be apparent to those skilled in the art that variations can be applied to the cells, polypeptides, nucleic acids and / or methods described herein, and in the steps or sequence of steps of the methods, without departing from the concept, spirit and scope of the invention. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.

[0158] The invention may be further described in the following numbered clauses. 1. A yeast cell, the genome of which contains a sequence encoding transforming growth factor beta 3 (TGFβ3). 2. The yeast cell of claim 1, wherein the TGFβ3 is human TGFβ3. 3. A yeast cell according to claim 1 or claim 2, wherein TGFβ3 comprises the nucleic acid sequence of SEQ ID NO:4. 4. The yeast cell of any one of claims 1 to 3, which is a Pichia pastoris cell. 5. A yeast cell according to any one of claims 1 to 4, which is transformed with a plasmid. 6. The yeast cell of claim 5, wherein the plasmid comprises a promoter, a coding sequence, and a terminator. 7. The yeast cell of claim 6, wherein the plasmid additionally comprises a signal peptide. 8. A yeast cell according to claim 6 or claim 7, wherein the promoter is the alcohol oxidase I (AOX1) promoter. 9. A yeast cell according to any one of claims 6 to 8, wherein the promoter comprises the nucleic acid sequence of SEQ ID NO:5. 10. The yeast cell according to any one of claims 7 to 9, wherein the signal peptide is the alpha mating factor signal peptide. 11. A yeast cell according to any one of claims 7 to 10, wherein the signal peptide comprises the nucleic acid sequence of SEQ ID NO:6. 12. The yeast cell according to any one of claims 6 to 11, wherein the terminator is an alcohol oxidase I (AOX1) terminator. 13. The yeast cell according to any one of claims 6 to 12, wherein the terminator comprises the nucleic acid sequence of SEQ ID NO:7. 14. A yeast cell according to any one of claims 6 to 13, wherein the plasmid comprises a nucleic acid sequence according to SEQ ID NO: 4 to 7. 15. A yeast cell according to any one of claims 6 to 14, wherein the plasmid comprises the nucleic acid sequence of SEQ ID NO:9. 16. A yeast cell capable of expressing TGFβ3. 17. The yeast cell of claim 16, which is a Pichia pastoris cell. 18. A polypeptide comprising the amino acid sequence of SEQ ID NO: 3, obtained or obtainable from a yeast cell according to any one of claims 1 to 17. 19. A method for producing a TGFβ3 polypeptide, comprising transforming a yeast cell with a plasmid encoding TGFβ3. 20. A method for producing a TGFβ3 polypeptide, comprising culturing a yeast cell according to any one of claims 1 to 17 under conditions allowing expression of said polypeptide, and optionally recovering the expressed polypeptide. 21. The method of claim 20, further comprising: i) optimizing a nucleic acid encoding a TGFβ3 polypeptide for expression in yeast, optionally Pichia pastoris; ii) screening more than 10 clones, optionally at least 20 clones, for expression of TGFβ3; and / or iii) detecting expression using a HiBiT peptide tag. 22. A method for growing animal cells, comprising culturing the animal cells in a growth medium containing the polypeptide of claim 18. 23. Use of a polypeptide according to claim 18 in an animal cell growth medium.

[0159] The invention is described in more detail in the following non-limiting examples. EXAMPLES

[0160] The following examples are useful in demonstrating the invention.

[0161] Example 1 Plasmid assembly The Escherichia coli strain DH5α was used for all DNA assemblies and all other clonings described. E. coli DH5α cells were routinely grown in LB medium (tryptone 10 g / l, yeast extract 5 g / l and NaCl 5 g / l) at 37° C. with shaking at 225 rpm, or on LB agar plates (containing 15 g / l bacteriological agar) at 37° C. LB was supplemented with kanamycin (50 μg / ml) or chloramphenicol (25 μg / ml) as appropriate. Chemically competent E. coli DH5α cells were routinely used for transformation.

[0162] Previously assembled plasmids used in this study were as described in Obst et al., "A Modular Toolkit for Generating Pichia pastoris Secretion Libraries," ACS Synth. Biol., 2017, and Lee et al., "A Highly Characterized Yeast Toolkit for Modular, Multipart Assembly," ACS Synth. Biol., 2015.

[0163] Plasmid pGT86 was assembled from five individual parts: Paox1 (pPTK001), α-MF (pPTK005), TGFβ3 CDS (pGT2), 6×His-tag-HiBiT (pMMp014) and Taox1 (pMMp010) into the backbone pMMc002. Golden Gate reactions were performed as described in Taylor et al., "Start-Stop Assembly: a functionally scarless DNA assembly system optimized for metabolic engineering", Nucleic Acids Res., 2019. Chemically competent E. coli cells were transformed with 10 μl of the pGT86 Golden Gate assembly reaction. Plasmids from transformant colonies were purified and sequence verified.

[0164] TGFβ3 CDS (pGT2), 6×His-tag-HiBiT (pMMp014) and Taox1 (pMMp010) were stored in the level 0 storage plasmid pYTK001.

[0165] The coding sequence for human transforming growth factor beta isoform 3 (TGFβ3) (SEQ ID NO: 4) was codon-optimized for Pichia pastoris (rather than optimized for its host of origin, as is the usual practice) using TWIST Biosciences software and synthesized by TWIST Biosciences. The synthetic DNA was mixed directly with pYTK001 in a Golden Gate reaction using the conditions described by Lee et al., "A Highly Characterized Yeast Toolkit for Modular, Multipart Assembly," ACS Sythn Biol., 2015. The resulting reaction mixture was used to transform E. coli. Plasmids (pGT2) from transformant colonies were purified and sequence verified.

[0166] Tags were generated by annealing the complementary pair of oligonucleotides, oBM37 and oBM38 (sequences shown below), as described by Taylor et al. The resulting double-stranded DNA was mixed with pYTK001 in a Golden Gate reaction using conditions described by Lee et al. The resulting reaction mixture was used to transform E. coli. The plasmid (pMMp014) of a transformant colony was purified and the sequence verified.

[0167] The DNA sequence of the terminator Taox1 was synthesized using TWIST Biosciences. The synthetic DNA was mixed directly with pYTK001 in a Golden Gate reaction using the conditions described by Lee et al. The resulting reaction mixture was used to transform E. coli. The plasmid (pMMp010) of a transformant colony was purified and the sequence was verified.

[0168] oBM37 (SEQ ID NO: 10)

[0169] [ka]

[0170] oBM38 (SEQ ID NO: 11)

[0171] [ka]

[0172] pYTK002, pYTK047, pYTK072, pYTK080 and pYTK084 were used to assemble pMMc002 via Golden Gate assembly using the reaction conditions described by Lee et al. The resulting reaction mixture was used to transform E. coli. The plasmid (pMMc002) of a transformant colony was purified and sequence verified.

[0173] The resulting plasmids are shown in Figures 1A and 1B.

[0174] Example 2 Transformation of Pichia pastoris Pichia pastoris strain CBS7435 was used for expression of transforming growth factor beta isoform 3 (TGFβ3). P. pastoris cells were routinely grown in YPD medium (1% yeast extract, 2% peptone, 2% dextrose) at 30°C with shaking at 225 rpm or on YPD agar plates (containing 15 g / l bacteriological agar) at 30°C. YPD was appropriately supplemented with Zeocin (100 μg / ml).

[0175] 1000 μg of pGT86 was linearized using PmeI (NEB) as per the manufacturer's instructions. The linearized pGT86 was cleaned up by gel purification using a QIAquick Gel Extraction kit (Qiagen). 100 μg of linearized pGT86 was transformed into P. pastoris cells using the condensed protocol for electroporation as described in Lin-Cereghino, J. et al., "Condensed protocol for competent cell preparation and transformation of the methylotrophic yeast Pichia pastoris," Biotechniques, 2005.

[0176] Example 3 Expression of TGFβ3 P. pastoris protein expression was performed in buffered dextrose / methanol complex medium (BMDY / BMMY; 1% yeast extract, 2% peptone, 100 mM potassium phosphate (pH 6.0), 1.34% yeast nitrogen base, 4 × 10 -5 % biotin, 2% dextrose or 0.5% methanol).

[0177] For high-throughput screening of protein expression in P. pastoris, deep-bottom 96-well plates sealed with sterile breathable sealing film (Breathe Easier, Sigma Aldrich) containing 300 μl of medium were used. For larger scale expression, 500 ml baffled shake flasks containing 100 ml of medium were used. Isolated transformant clones of P. pastoris were used to inoculate YPD supplemented with Zeocin and grown for 24 h at 30°C and 225 rpm. Cultures were diluted 1:100 in BMDY supplemented with Zeocin and grown for 24 h at 30°C and 225 rpm. After incubation, cells were pelleted at 4000 rpm for 5 min, the supernatant was removed, and fresh BMMY medium was added to induce protein expression. Cultures were incubated at 30°C and 225 rpm for 48 h, and at 24 h the cultures were supplemented with methanol (100%) to a final concentration of 0.5% v / v. After incubation, the cultures were pelleted at 4000 rpm for 5 min and the supernatants were collected for protein expression assays.

[0178] Trichloroacetic acid (100%) was added to the supernatant to a final concentration of 10%. After incubating the supernatant at -20°C for 15 min, the protein precipitate was pelleted at 10,000g for 15 min at 4°C. The pellet was washed twice with acetone (100%) and then air-dried. The washed pellet was resuspended in 1 / 10 the supernatant volume in Tris-HCl (50 mM, pH 8).

[0179] 100 μl of supernatant was loaded into each well of a Dot Blotter apparatus (Wolflabs). Vacuum was applied to transfer proteins onto nitrocellulose membranes (Amersham). TGFβ3 was detected using a 1:1000 dilution of mouse anti-HiBiT primary antibody (CS2006A01) followed by a 1:2500 dilution of horseradish peroxidase (HRP)-conjugated anti-mouse secondary antibody (W4021). Dots were visualized using ECL Western Blotting Substrate (Promega W1001).

[0180] 20 μl of samples (supernatant or concentrated supernatant) were denatured by boiling for 10 min in reducing SDS sample buffer (4× Laemmli protein sample buffer supplemented with 50 mM DTT). Molecular weights were estimated using a prestained protein ladder (10–250 kDa, PageRuler, Thermo Scientific). Proteins were resolved by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) using 12% Surepage precast gels (GenScript). Proteins were fixed to nitrocellulose membranes (Amersham) using a wet / tank blotting system (Bio Rad; 100 V, 1 h, 4 °C). TGFβ3 was detected using a 1:1000 dilution of mouse anti-HiBiT primary antibody (Promega CS2006A01) followed by a 1:2500 dilution of horseradish peroxidase (HRP)-conjugated anti-mouse secondary antibody (Promega W4021). Dots were visualized using ECL Western Blotting Substrate (Promega W1001).

[0181] In this experimental protocol, unlike the usual practice (6–10 clones are validated as recommended by the Invitrogen Pichia Expression Kit manual), we screened more than 50 transformant clones, which was significant because only 6.25% of the screened clones expressed TGFβ3.

[0182] The results are shown in Figures 2 and 3.

[0183] As can be seen in Figures 2 and 3, expression of TGFβ3 was observed for both colonies assayed (c3 and c25), indicating successful integration and expression in Pichia pastoris was achieved.

[0184] 3.4% of the clones express TGFβ3.

[0185] As TGFβ3 colony c3 gave the most intense band on the Western blot (Figure 3), the concentration was assessed for TGFβ3 colony c3. A calibration curve was used to establish the TGFβ3 concentration to allow for quantitative dot blots. A calibration curve was generated by plotting dot intensity against known protein concentrations. Dot intensity was measured using ImageJ. The intensity of the TGFβ3 c3 dots was measured (using ImageJ) and compared using y=mx+c against the calibration curve to establish the concentration.

[0186] The concentration of TGFβ3 was 8.49 mg / L.

[0187] Example 4 2. Plasmid Assembly The E. coli strain DH5α was used for all DNA assemblies and all other clonings described. E. coli DH5α cells were routinely grown in LB medium (tryptone 10 g / l, yeast extract 5 g / l and NaCl 5 g / l) at 37°C with shaking at 225 rpm or on LB agar plates (containing 15 g / l bacteriological agar) at 37°C. LB was supplemented with kanamycin (50 μg / ml) or chloramphenicol (25 μg / ml) as appropriate. LB was supplemented with kanamycin (50 μg / ml) or chloramphenicol (25 μg / ml) as appropriate. Chemically competent E. coli DH5α cells were routinely used for transformation.

[0188] Previously assembled plasmids used in this study were as described in Obst et al., "A Modular Toolkit for Generating Pichia pastoris Secretion Libraries," ACS Synth. Biol., 2017, and Lee et al., "A Highly Characterized Yeast Toolkit for Modular, Multipart Assembly," ACS Synth. Biol., 2015.

[0189] Plasmid pBM64 (SEQ ID NO: 16) was assembled from five individual parts: Paox1 (pPTK001), α-MF (pPTK005), TGFβ3 CDS2 (pGT102), TEV_His_Tag_Linker and Taox1 (pMMp010) into the backbone pMMc002. Golden Gate reactions were performed as described in Taylor et al., "Start-Stop Assembly: a functionally scarless DNA assembly system optimized for metabolic engineering", Nucleic Acids Res., 2019. Chemically competent E. coli cells were transformed with 10 μl of the pBM64 Golden Gate assembly reaction. Plasmids from transformant colonies were purified and sequence verified.

[0190] Plasmid pBM65 (SEQ ID NO: 17) was assembled from five individual parts: Paox1 (pPTK001), α-MF (pPTK005), TGFβ3 CDS3 (pGT103), TEV_His_Tag_Linker and Taox1 (pMMp010) into the backbone pMMc002. Golden Gate reactions were performed as described in Taylor et al., "Start-Stop Assembly: a functionally scarless DNA assembly system optimized for metabolic engineering", Nucleic Acids Res., 2019. Chemically competent E. coli cells were transformed with 10 μl of the pPM65 Golden Gate assembly reaction. Plasmids from transformant colonies were purified and sequence verified.

[0191] TGFβ3 CDS2 (pGT102) was stored in the Level 0 storage plasmid pYTK001.

[0192] TGFβ3 CDS3 (pGT103) was stored in the Level 0 storage plasmid pYTK001.

[0193] The coding sequence (CDS2 and CDS3) encoding human transforming growth factor beta isoform 3 (TGFβ3) was codon-optimized for expression in Pichia pastoris (rather than optimized for its host of origin, as is the usual practice). TGFβ3 CDS2 (SEQ ID NO: 12) was codon-optimized using GeneART software (Thermo Fisher Scientific). TGFβ3 CDS3 (SEQ ID NO: 13) was codon-optimized using OPTIMIZER one AA - one codon methodology (http: / / genomes.urv.es / OPTIMIZER / ). DNA synthesis was performed by TWIST Biosciences. The synthetic DNA was mixed directly with pYTK001 in a Golden Gate reaction using the conditions described by Lee et al., "A Highly Characterized Yeast Toolkit for Modular, Multipart Assembly," ACS Sythn Biol., 2015. The resulting reaction mixture was used to transform E. coli. Plasmids from transformant colonies were purified and sequence verified.

[0194] Tags were generated by annealing complementary pairs of oligonucleotides as described in Taylor et al., 2019. TEV_His_Tag_Linker (SEQ ID NO: 18) resulted from annealing oGT44 and oGT45 (sequence shown below). The resulting double-stranded DNA tag was used directly in a Golden Gate reaction.

[0195] oGT44 (SEQ ID NO: 14) ATCCGAAAACCTTTATTTTCAAGGTCATCATCACCACCATCATTAA

[0196] oGT45 (SEQ ID NO: 15) GCCATTAATGATGGTGGTGATGATGACCTTGAAAATAAAGGTTTTC

[0197] Taox1 was synthesized as described above in Example 1, and pMMc002 was assembled as described in Example 1.

[0198] The resulting plasmids (pBM64 and pBM65) are shown in Figures 4A-4D.

[0199] Example 5 Transformation of Pichia pastoris 2 Pichia pastoris strain CBS7435 was used for expression of transforming growth factor beta isoform 3 (TGFβ3). P. pastoris cells were routinely grown in YPD medium (1% yeast extract, 2% peptone, 2% dextrose) at 30°C with shaking at 225 rpm or on YPD agar plates (containing 15 g / l bacteriological agar) at 30°C. YPD was appropriately supplemented with Zeocin (100 μg / ml).

[0200] 1000 μg of each plasmid (pBM64 and pBM65) was linearized using PmeI (NEB) as per the manufacturer's instructions. Linearized plasmids were cleaned up by gel purification using a QIAquick Gel Extraction kit (Qiagen). 100 μg of linearized plasmids were transformed into P. pastoris cells using the condensed protocol for electroporation as described in Lin-Cereghino, J. et al., "Condensed protocol for competent cell preparation and transformation of the methylotrophic yeast Pichia pastoris," Biotechniques, 2005.

[0201] Example 6 Expression of TGFβ32 P. pastoris protein expression using each plasmid was performed in buffered dextrose / methanol complex medium (BMDY / BMMY; 1% yeast extract, 2% peptone, 100 mM potassium phosphate (pH 6.0), 1.34% yeast nitrogen base, 4 × 10 -5 % biotin, 2% dextrose or 0.5% methanol).

[0202] For high-throughput screening of protein expression in P. pastoris, deep-bottom 96-well plates sealed with sterile breathable sealing film (Breathe Easier, Sigma Aldrich) containing 300 μl of medium were used. For larger scale expression, 500 ml baffled shake flasks containing 100 ml of medium were used. Isolated transformant clones of P. pastoris were used to inoculate YPD supplemented with Zeocin and grown for 24 h at 30°C and 225 rpm. Cultures were diluted 1:100 in BMDY supplemented with Zeocin and grown for 24 h at 30°C and 225 rpm. After incubation, cells were pelleted at 4000 rpm for 5 min, the supernatant was removed, and fresh BMMY medium was added to induce protein expression. Cultures were incubated at 30°C and 225 rpm for 48 h, and at 24 h the cultures were supplemented with methanol (100%) to a final concentration of 0.5% v / v. After incubation, the cultures were pelleted at 4000 rpm for 5 min and the supernatants were collected for protein expression assays.

[0203] Trichloroacetic acid (100%) was added to the supernatant to a final concentration of 10%. After incubating the supernatant at -20°C for 15 min, the protein precipitate was pelleted at 10,000g for 15 min at 4°C. The pellet was washed twice with acetone (100%) and then air-dried. The washed pellet was resuspended in 1 / 10 the supernatant volume in Tris-HCl (50 mM, pH 8).

[0204] 100 μl of supernatant was loaded into each well of a Dot Blotter apparatus (Wolflabs). Vacuum was applied to transfer proteins onto nitrocellulose membranes (Amersham). TGFβ3 was detected using a 1:1000 dilution of mouse anti-HiBiT primary antibody (CS2006A01) followed by a 1:2500 dilution of horseradish peroxidase (HRP)-conjugated anti-mouse secondary antibody (W4021). Dots were visualized using ECL Western Blotting Substrate (Promega W1001).

[0205] 20 μl of samples (supernatant or concentrated supernatant) were denatured by boiling for 10 min in reducing SDS sample buffer (4× Laemmli protein sample buffer supplemented with 50 mM DTT). Molecular weights were estimated using a prestained protein ladder (10–250 kDa, PageRuler, Thermo Scientific). Proteins were resolved by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) using 12% Surepage precast gels (GenScript). Proteins were fixed to nitrocellulose membranes (Amersham) using a wet / tank blotting system (Bio Rad; 100 V, 1 h, 4 °C). TGFβ3 was detected using a 1:1000 dilution of mouse anti-HiBiT primary antibody (Promega CS2006A01) followed by a 1:2500 dilution of horseradish peroxidase (HRP)-conjugated anti-mouse secondary antibody (Promega W4021). Dots were visualized using ECL Western Blotting Substrate (Promega W1001).

[0206] In this experimental protocol, unlike the usual practice (6–10 clones are validated as recommended by the Invitrogen Pichia Expression Kit manual), we screened more than 50 transformant clones, which was significant because only 6.25% of the screened clones expressed TGFβ3.

[0207] The results are shown in Figures 5 and 6.

[0208] As can be seen in Figures 5 and 6, expression of TGFβ3 was observed, indicating successful integration and expression in Pichia pastoris was achieved.

[0209] For pBM64 (Figure 5), 25.9% of the clones express TGFβ3. For pBM65 (Figure 6), 37.8% of the clones express TGFβ3.

[0210] Example 7 liquid PTVA To further increase the TGFβ3 protein concentration, liquid post-transformational vector amplification (PTVA) was used. Liquid PTVA applies increasing selection pressure, typically via antibiotic concentration, to Pichia strains to generate more copies of the inserted foreign DNA containing the antibiotic marker in addition to the gene of interest. Clones that survive at higher concentrations typically have multiple copies of the antibiotic marker to adapt to the increased antibiotic concentration, and therefore multiple copies of the gene of interest leading to increased protein concentration.

[0211] Pichia strain BM65c56 (BM102) (Figure 6) was selected as the parent clone for liquid PTVA, which was performed as described in Aw, R and Polizzi, K, "Liquid PTVA: a faster and cheaper alternative for generating multi-copy clones in Pichia pastoris."

[0212] The results are shown in Figure 7.

[0213] Clone c5 gave very strong dot intensities (Figure 7), so expression of clone c5 (Figure 7) was scaled up to 100 ml (as described above in Example 6) and the protein was visualized using Western blot (Figure 8) and quantified using the His Tag ELISA Detection Kit (GenScript) according to the manufacturer's instructions.

[0214] The concentration of TGFβ3 was 17 mg / L.

[0215] array

[0216] [Table 1A]

[0217] [Table 1B]

[0218] [Table 1C]

[0219] [Table 1D]

[0220] [Table 1E]

[0221]

Table 1F

[0222]

Table 1G

[0223]

Table 1H

[0224]

Table 1I

[0225]

Table 1J

[0226]

Table 1K

[0227]

Table 1L

[0228]

Table 1M

Claims

1. A methylotrophic yeast cell, the genome of which contains a sequence encoding transforming growth factor beta (TGFβ).

2. 2. The yeast cell of claim 1, which is a Pichia pastoris cell.

3. 3. The yeast cell according to claim 1 or claim 2, wherein the TGFβ is TGFβ1, TGFβ2 or TGFβ3.

4. A yeast cell according to any one of claims 1 to 3, wherein the TGFβ is TGFβ3, optionally human TGFβ3.

5. 5. The yeast cell according to any one of claims 1 to 4, wherein the sequence comprises the nucleic acid sequence of SEQ ID NO: 13, SEQ ID NO: 12 or SEQ ID NO:

4.

6. A yeast cell according to any one of claims 1 to 5, wherein the sequence comprises the nucleic acid sequence of SEQ ID NO:

13.

7. 7. The yeast cell according to any one of claims 1 to 6, wherein the sequence comprises the nucleic acid sequence of SEQ ID NO:

12.

8. 8. The yeast cell according to any one of claims 1 to 7, wherein the sequence comprises the nucleic acid sequence of SEQ ID NO:

4.

9. A yeast cell according to any one of claims 1 to 8, which has been transformed with a plasmid.

10. The yeast cell of claim 9 , wherein the plasmid comprises a promoter, a coding sequence, and a terminator.

11. 11. The yeast cell of claim 10, wherein the plasmid additionally comprises a signal peptide.

12. 12. The yeast cell of claim 10 or 11, wherein the promoter is the alcohol oxidase I (AOX1) promoter.

13. 13. The yeast cell according to any one of claims 10 to 12, wherein the promoter comprises the nucleic acid sequence of SEQ ID NO:

5.

14. 14. The yeast cell according to any one of claims 11 to 13, wherein the signal peptide is the alpha mating factor signal peptide.

15. 15. The yeast cell according to any one of claims 11 to 14, wherein the signal peptide comprises the nucleic acid sequence of SEQ ID NO:

6.

16. 16. The yeast cell of any one of claims 10 to 15, wherein the terminator is an alcohol oxidase I (AOX1) terminator.

17. 17. The yeast cell of any one of claims 10 to 16, wherein the terminator comprises the nucleic acid sequence of SEQ ID NO:

7.

18. 18. The yeast cell according to any one of claims 10 to 17, wherein the plasmid comprises a nucleic acid sequence of SEQ ID NO: 4 to 7.

19. 19. The yeast cell according to any one of claims 10 to 18, wherein the plasmid comprises the nucleic acid sequence of SEQ ID NO:

9.

20. 18. The yeast cell according to any one of claims 10 to 17, wherein the plasmid comprises the nucleic acid sequences of SEQ ID NOs: 12 and 5 to 7.

21. 21. The yeast cell according to any one of claims 10 to 17 and 20, wherein the plasmid comprises the nucleic acid sequence of SEQ ID NO:

16.

22. 18. The yeast cell according to any one of claims 10 to 17, wherein the plasmid comprises the nucleic acid sequences of SEQ ID NOs: 13 and 5 to 7.

23. 23. The yeast cell according to any one of claims 10 to 17 and 22, wherein the plasmid comprises the nucleic acid sequence of SEQ ID NO:

17.

24. Methylotrophic yeast cells capable of expressing TGFβ.

25. 25. A yeast cell according to claim 24, capable of expressing TGFβ1, TGFβ2 or TGFβ3.

26. 26. The yeast cell of claim 24 or claim 25, which is a Pichia pastoris cell.

27. 27. A polypeptide comprising the amino acid sequence of SEQ ID NO:3, obtained or obtainable from a yeast cell according to any one of claims 1 to 26.

28. 2. A method for producing a TGFβ polypeptide, the method comprising transforming a methylotrophic yeast cell with a plasmid encoding TGFβ.

29. 27. A method for producing a TGFβ polypeptide, the method comprising culturing a yeast cell according to any one of claims 1 to 26 under conditions allowing expression of said polypeptide, and optionally recovering the expressed polypeptide.

30. 30. The method of claim 29, further comprising the steps of: i) optimizing the nucleic acid encoding a TGFβ polypeptide for expression in yeast, optionally in methylotrophic yeast, and optionally in Pichia pastoris; ii) screening more than 10 clones, optionally at least 20 clones, for expression of TGFβ; and / or iii) detecting expression using a HiBiT peptide tag or a his tag.

31. The method according to any one of claims 28 to 30, wherein the TGFβ polypeptide is a TGFβ3 polypeptide.

32. 28. A method for growing animal cells, comprising culturing the animal cells in a growth medium containing the polypeptide of claim 27.

33. 28. Use of a polypeptide according to claim 27 in an animal cell growth medium.

Images