Compositions and methods for inhibiting expression of prekallikrein (PKK) protein - Patents.com

Abstract

Provided are compositions and methods useful for reducing expression of the kallikrein B1 (KLKB1 or PKK) gene and treating PKK-associated diseases and disorders. Provided are PKK dsRNA agents, and compositions containing the PKK dsRNA agents, useful for reducing PKK expression in cells and subjects.

Description

[Technical field]

[0001] The present invention relates, in part, to compositions and methods for inhibiting the expression of prekallikrein (PKK). [Background technology]

[0002] The glycoprotein plasma prekallikrein (PKK) is encoded by the KLKB1 gene, and its expression in cells and tissues is important for physiological events such as blood coagulation, fibrinolysis, kinin production, and inflammation. PKK is converted to PK by factor Xlla in the kinin-kallikrein pathway. The expression level of PKK and its subsequent conversion to PK are important for the development of vascular and inflammatory diseases. Vascular and inflammatory diseases such as hereditary angioedema (HAE), edema, angioedema, swelling, angioedema of the eyelid, ocular edema, macular edema, cerebral edema, thrombosis, embolism, thromboembolism, deep vein thrombosis, pulmonary embolism, myocardial infarction, infarction, stroke, and peripheral vascular disease are important health problems in many countries. Vascular diseases can reduce the quality of life and lead to death, which is why improved methods of prevention and treatment of such diseases and disorders are needed. Summary of the Invention

[0003] In some embodiments of the invention, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of prekallikrein (PKK) in a cell is provided, the dsRNA agent comprising a sense strand and an antisense strand, and optionally comprising a targeting ligand, wherein nucleotides 2-18 of the antisense strand comprise a region complementary to a PKK RNA transcript, the complementary region comprising at least 15 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from any one of the antisense sequences shown in any one of Tables 1-3. In some embodiments, the region complementary to the PKK RNA transcript comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by no more than 3 nucleotides from any one of the antisense sequences shown in any one of Tables 1-3. In some embodiments, the antisense strand of the dsRNA is at least substantially complementary to a target region of SEQ ID NO: 767, as shown in any one of Tables 1-3. In some embodiments, the antisense strand of the dsRNA is fully complementary to the target region of SEQ ID NO:767 and is set forth in any one of Tables 1-3. In some embodiments, the dsRNA agent comprises a sense strand sequence set forth in any one of Tables 1-3, where the sense strand sequence is at least substantially complementary to the antisense strand sequence of the dsRNA agent. In some embodiments, the dsRNA agent comprises a sense strand sequence set forth in any one of Tables 1-3, where the sense strand sequence is fully complementary to the antisense strand sequence of the dsRNA agent. In some embodiments, the dsRNA agent comprises an antisense strand sequence set forth in any one of Tables 1-3. In some embodiments, the dsRNA agent comprises a sequence set forth as a double-stranded sequence in any one of Tables 1-3.

[0004] In some embodiments, the antisense strand of the dsRNA comprises at least 15 contiguous nucleotide sequences differing by 0, 1, 2 or 3 nucleotides from formula (I): 5'-Z1GAAUAAGUGAAAAACUZ2-3'(I), where Z1 is one selected from the group consisting of C, G, A, U, or absent, and Z2 is a nucleotide sequence of 0-15 nucleotides in length. In some embodiments, Z1 is U. In some embodiments, Z1 is A. In some embodiments, Z2 is selected from the group consisting of G, GU, GA, GC, GG, GAU, GAA, GAC, GAG, GACC, GACU, GACG, GACA, GACAG, GACAGC, GACAGCG, GACAGCGA, GACAGCGAA, GACAGCGAU, GACAGCGAAUC, GACAGCGAAUC, GACAGCGAAUC, GACAGCGAAUC, GACAGCGAAUC, GACAGCGAAUC, GACAGCGAAUC, GACAGCGAAUC, GACAGCGAAUC, GACAGCGAAUC, GACAGCGAAUC, GACAGCGAAUC, GACAUU, GACAGA, or absent. In some embodiments, Z2 is a nucleotide sequence 1, 2, 3 or 4 nucleotides in length, the nucleotide sequence being selected from G, GU, GA, GC, GG, GAU, GAA, GAC, GAG, GACC, GACU, GACG, GACA. In some embodiments, Z1 is absent and Z2 is G. In some embodiments, the sense strand of the dsRNA comprises at least 15 contiguous nucleotide sequences differing by 0, 1, 2 or 3 nucleotides from formula (II): 5'-Z3AGUUUUUCACUUAUUCZ4-3'(II), where Z3 is a nucleotide sequence 0-15 nucleotides in length, and Z4 is one selected from the group consisting of C, G, A, U, or absent. In some embodiments, Z4 is U. In some embodiments, Z4 is A.In some embodiments, Z3 is selected from the group consisting of C, AC, UC, GC, CC, AUC, UUC, GUC, CUC, UGUC, GGUC, AGUC, CGUC, CUGUC, GCUGUC, CGCUGUC, UCGCUGUC, UUCGCUGUC, AUUCGCUGUC, GAUUCGCUGUC, UGAUUCGCUGUC, AUGAUUCGCUGUC, GAUGAUUCGCUGUC, AGAUGAUUCGCUGUC, or is absent. In some embodiments, Z3 is a nucleotide sequence 1, 2, 3 or 4 nucleotides in length, the nucleotide sequence being selected from C, AC, UC, GC, CC, AUC, UUC, GUC, CUC, UGUC, GGUC, AGUC, CGUC. In some embodiments, Z4 is absent and Z3 is C. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, the antisense strand of the dsRNA comprises a sequence of at least 15 contiguous nucleotides that differ from formula (I) by 0, 1, 2 or 3 nucleotides, and the sense strand of the dsRNA comprises a sequence of at least 15 contiguous nucleotides that differ from formula (II) by 0, 1, 2 or 3 nucleotides, where nucleotide formulas (I) and (II) are as described above. In some embodiments, each strand has a length of 40 or less nucleotides. In some embodiments, the sense strand is complementary or substantially complementary to the antisense strand, and the region of complementarity has a length of 16-23 nucleotides. In some embodiments, the region of complementarity has a length of 19-21 nucleotides. In some embodiments, the sense strand has a length of 35 or less nucleotides and comprises a region of complementarity to the antisense strand that comprises at least 15, 16, 17, 18 or 19 nucleotides. In some embodiments, Z1 is a nucleotide complementary to Z4. In some embodiments, Z2 is a nucleotide sequence complementary to Z3.

[0005] In some embodiments, the antisense strand of the dsRNA comprises a sequence of at least 15 contiguous nucleotides that differs by 0, 1, 2 or 3 nucleotides from formula (III): 5'-Z5UAUUUGUGAGAAAGGUZ6-3'(III), where Z5 is one selected from the group consisting of C, G, A, U, or absent, and Z6 is a nucleotide sequence 0-15 nucleotides in length. In some embodiments, Z5 is U. In some embodiments, Z6 is selected from the group consisting of G, GU, GA, GC, GG, GUU, GUA, GUC, GUG, GUAA, GUAU, GUAC, GUAG, GUAUC, GUAUCU, GUAUCUU, GUAUCUUU, GUAUCUUUU, GUAUCUUUUG, GUAUCUUUUGU, GUAUCUUUUGUA, GUAUCUUUUGUAAU, GUAUCUUUUGUAAUG, GUAUUU, GUAUGA, or is absent. In some embodiments, Z6 is a nucleotide sequence 1, 2, 3 or 4 nucleotides in length, the nucleotide sequence being selected from G, GU, GA, GC, GG, GUU, GUA, GUC, GUG, GUAA, GUAU, GUAC, GUAG. In some embodiments, Z5 is absent and Z6 is G. In some embodiments, the sense strand of the dsRNA comprises a sequence of at least 15 contiguous nucleotides that differs by 0, 1, 2 or 3 nucleotides from formula (IV): 5'-Z7ACCUUUCUCACAAAUAZ8-3'(IV), where Z7 is a nucleotide sequence 0-15 nucleotides in length and Z8 is one selected from the group consisting of C, G, A, U, or absent. In some embodiments, Z8 is A.In some embodiments, Z7 is selected from the group consisting of C, AC, UC, GC, CC, AAC, UAC, GAC, CAC, GUAC, CUAC, UUAC, AUAC, GAUAC, AGAUAC, AAGAUAC, AAAGAUAC, AAAAGAUAC, CAAAAGAUAC, ACAAAAGAUAC, UACAAAAGAUAC, UUACAAAAGAUAC, AUUACAAAAGAUAC, CAUUACAAAAGAUAC, or is absent. In some embodiments, Z7 is a nucleotide sequence 1, 2, 3 or 4 nucleotides in length, the nucleotide sequence being selected from C, AC, UC, GC, CC, AAC, UAC, GAC, CAC, GUAC, CUAC, UUAC, AUAC. In some embodiments, Z8 is absent and Z7 is C. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, the antisense strand of the dsRNA comprises a sequence of at least 15 contiguous nucleotides that differ from formula (III) by 0, 1, 2 or 3 nucleotides, and the sense strand of the dsRNA comprises a sequence of at least 15 contiguous nucleotides that differ from formula (IV) by 0, 1, 2 or 3 nucleotides, where nucleotide formulas (III) and (IV) are as described above. In some embodiments, each strand has a length of 40 or less nucleotides. In some embodiments, the sense strand is complementary or substantially complementary to the antisense strand, and the region of complementarity has a length of 16-23 nucleotides. In some embodiments, the region of complementarity has a length of 19-21 nucleotides. In some embodiments, the sense strand has a length of 35 or less nucleotides and comprises a region of complementarity to the antisense strand that comprises at least 15, 16, 17, 18 or 19 nucleotides. In some embodiments, Z5 is the nucleotide complementary to Z8. In some embodiments, Z6 is a nucleotide sequence complementary to Z7.

[0006] In some embodiments, the antisense strand of the dsRNA has the formula (V): 5'-Z9AGUGAAAAACUGACAGZ 10-3'(V) comprises a sequence of at least 15 contiguous nucleotides that differs from the first nucleotide by 0, 1, 2 or 3 nucleotides, and Z9 is one selected from the group consisting of C, G, A, U, or absent. 10 is a nucleotide sequence of 0 to 15 nucleotides in length. In some embodiments, Z is U. In some embodiments, Z is A. In some embodiments, Z 10 is selected from the group consisting of C, CC, CU, CA, CG, CGU, CGG, CGC, CGA, CGAC, CGAU, CGAA, CGAG, CGAAU, CGAAUC, CGAAUCA, CGAAUCAU, CGAAUCAUC, CGAAUCAUCU, CGAAUCAUCUU, CGAAUCAUCUUU, CGAAUCAUCUUUG, CGAAUCAUCUUUGU, CGAAUCAUCUUUGUG, CGAAUU, CGAAGA, or is absent. 10 is a nucleotide sequence 1, 2, 3 or 4 nucleotides in length, the nucleotide sequence being selected from C, CC, CU, CA, CG, CGU, CGG, CGC, CGA, CGAC, CGAU, CGAA, CGAG. In some embodiments, Z9 is absent and Z 10 is C. In some embodiments, the sense strand of the dsRNA has the formula (VI): 5′-Z 11 CUGUCAGUUUUUCACUZ 12 -3'(VI) comprises a sequence of at least 15 contiguous nucleotides that differs from Z by 0, 1, 2 or 3 nucleotides, 11 is a nucleotide sequence of 0 to 15 nucleotides in length, Z 12 is one selected from the group consisting of C, G, A, U, or absent. 12 is A. In some embodiments, Z 12 is U. In some embodiments, Z 11is selected from the group consisting of G, AG, UG, GG, CG, ACG, UCG, GCG, CCG, GUCG, AUCG, CUCG, UUCG, AUUCG, GAUUCG, UGAUUCG, AUGAUUCG, GAUGAUUCG, AGAUGAUUCG, AAGAUGAUUCG, AAAGAUGAUUCG, CAAAGAUGAUUCG, ACAAAGAUGAUUCG, CACAAAGAUGAUUCG, or absent. 11 is a nucleotide sequence of 1, 2, 3 or 4 nucleotides in length, the nucleotide sequence being selected from G, AG, UG, GG, CG, ACG, UCG, GCG, CCG, GUCG, AUCG, CUCG, UUCG. 12 is non-existent, and Z 11 is G. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, the antisense strand of the dsRNA comprises a sequence of at least 15 contiguous nucleotides that differ from formula (V) by 0, 1, 2 or 3 nucleotides, and the sense strand of the dsRNA comprises a sequence of at least 15 contiguous nucleotides that differ from formula (VI) by 0, 1, 2 or 3 nucleotides, where nucleotide formulas (V) and (VI) are as described above. In some embodiments, each strand has a length of 40 or less nucleotides. In some embodiments, the sense strand is complementary or substantially complementary to the antisense strand, and the region of complementarity has a length of 16-23 nucleotides. In some embodiments, the region of complementarity has a length of 19-21 nucleotides. In some embodiments, the sense strand has a length of 35 or less nucleotides and comprises a region of complementarity to the antisense strand that comprises at least 15, 16, 17, 18 or 19 nucleotides. In some embodiments, Z9 is Z 12 In some embodiments, Z 10 is Z 11 is a nucleotide sequence complementary to

[0007] In some embodiments, the antisense strand of the dsRNA has the formula (IX): 5′-Z 13 GUAAUUCAAAGGAGCCZ 14 -3'(IX) comprises a sequence of at least 15 contiguous nucleotides that differs from Z by 0, 1, 2 or 3 nucleotides, 13 is one selected from the group consisting of C, G, A, U, or absent. 14 is a nucleotide sequence of 0 to 15 nucleotides in length. 13 is U. In some embodiments, Z 14 is selected from the group consisting of U, UC, UU, UA, UG, UGU, UGG, UGC, UGA, UGGC, UGGU, UGGA, UGGG, UGGAG, UGGAGU, UGGAGUU, UGGAGUUU, UGGAGUUUU, UGGAGUUUUA, UGGAGUUUUAU, UGGAGUUUUAUC, UGGAGUUUUAUCA, UGGAGUUUUAUCAA, UGGAGUUUUAUCAAG, UGGAUU, UGGAUU, or is absent. 14 is a nucleotide sequence 1, 2, 3 or 4 nucleotides in length, the nucleotide sequence being selected from U, UC, UU, UA, UG, UGU, UGG, UGC, UGA, UGGC, UGGU, UGGA, UGGG. 13 is non-existent, and Z 14 is U. In some embodiments, the sense strand of the dsRNA has the formula (X): 5′-Z 15 GGCUCCUUUGAAUUACZ 16 -3'(X) comprises a sequence of at least 15 contiguous nucleotides that differs from Z by 0, 1, 2 or 3 nucleotides, 15 is a nucleotide sequence of 0 to 15 nucleotides in length, Z 16 is one selected from the group consisting of C, G, A, U, or absent. 16 is A. In some embodiments, Z 15is selected from the group consisting of A, AA, UA, GA, CA, ACA, UCA, GCA, CCA, GCCA, ACCA, CCCA, UCCA, CUCCA, ACUCCA, AACUCCA, AAACUCCA, AAAACUCCA, UAAAACUCCA, AUAAAACUCCA, GAUAAAACUCCA, UGAUAAAACUCCA, UUGAUAAAACUCCA, CUUGAUAAAACUCCA, or absent. 15 is a nucleotide sequence of 1, 2, 3 or 4 nucleotides in length, the nucleotide sequence being selected from A, AA, UA, GA, CA, ACA, UCA, GCA, CCA, GCCA, ACCA, CCCA, UCCA. 16 is non-existent, and Z 15 is A. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, the antisense strand of the dsRNA comprises a sequence of at least 15 contiguous nucleotides that differ from formula (IX) by 0, 1, 2 or 3 nucleotides, and the sense strand of the dsRNA comprises a sequence of at least 15 contiguous nucleotides that differ from formula (X) by 0, 1, 2 or 3 nucleotides, where nucleotide formulas (IX) and (X) are as described above. In some embodiments, each strand has a length of 40 or less nucleotides. In some embodiments, the sense strand is complementary or substantially complementary to the antisense strand, and the region of complementarity has a length of 16-23 nucleotides. In some embodiments, the region of complementarity has a length of 19-21 nucleotides. In some embodiments, the sense strand has a length of 35 or less nucleotides and comprises a region of complementarity to the antisense strand that comprises at least 15, 16, 17, 18 or 19 nucleotides. In some embodiments, Z 13 is Z 16 In some embodiments, Z 14 is Z 15 is a nucleotide sequence complementary to

[0008] In some embodiments, the antisense strand of the dsRNA has the formula (XI): 5′-Z 17 UGGCAAACAUUCACUCZ 18 -3'(XI) comprises a sequence of at least 15 contiguous nucleotides that differs from Z by 0, 1, 2 or 3 nucleotides, 17 is one selected from the group consisting of C, G, A, U, or absent; Z 18 is a nucleotide sequence of 0 to 15 nucleotides in length. 17 is U. In some embodiments, Z 18 is selected from the group consisting of C, CC, CU, CA, CG, CUU, CUG, CUC, CUA, CUUC, CUUU, CUUA, CUUG, CUUUA, CUUUAA, CUUUAAC, CUUUAACA, CUUUAACAA, CUUUAACAAA, CUUUAACAAAA, CUUUAACAAAAG, CUUUAACAAAAGU, CUUUAACAAAAGUC, CUUUAACAAAAGUCA, CUUCUU, CUUCGA, or absent. 18 is a nucleotide sequence of 1, 2, 3 or 4 nucleotides in length, the nucleotide sequence being selected from C, CC, CU, CA, CG, CUU, CUG, CUC, CUA, CUUC, CUUU, CUUA, CUUG. 17 is non-existent, and Z 18 is C. In some embodiments, the sense strand of the dsRNA has the formula (XII): 5′-Z 19 GAGUGAAUGUUUGCCAZ 20 -3'(XII) comprises a sequence of at least 15 contiguous nucleotides that differs from Z by 0, 1, 2 or 3 nucleotides, 19 is a nucleotide sequence of 0 to 15 nucleotides in length, Z 20 is one selected from the group consisting of C, G, A, U, or absent. 20 is A. In some embodiments, Z 19is selected from the group consisting of G, AG, UG, GG, CG, AAG, UAG, GAG, CAG, CAAG, AAAG, UAAG, GAAG, UAAAG, UUAAAG, GUUAAAG, UGUUAAAG, UUGUUAAAG, UUUGUUAAAG, UUUGUUAAAG, CUUUUGUUAAAG, ACUUUUGUUAAAG, GACUUUUGUUAAAG, UGACUUUGUUAAAG, or absent. 19 is a nucleotide sequence of 1, 2, 3 or 4 nucleotides in length, the nucleotide sequence being selected from G, AG, UG, GG, CG, AAG, UAG, GAG, CAG, CAAG, AAAG, UAAG, GAAG. In some embodiments, Z 20 is non-existent, and Z 19 is G. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, the antisense strand of the dsRNA comprises a sequence of at least 15 contiguous nucleotides that differ from formula (XI) by 0, 1, 2 or 3 nucleotides, and the sense strand of the dsRNA comprises a sequence of at least 15 contiguous nucleotides that differ from formula (XII) by 0, 1, 2 or 3 nucleotides, where nucleotide formulas (XI) and (XII) are as described above. In some embodiments, each strand has a length of 40 or less nucleotides. In some embodiments, the sense strand is complementary or substantially complementary to the antisense strand, and the region of complementarity has a length of 16-23 nucleotides. In some embodiments, the region of complementarity has a length of 19-21 nucleotides. In some embodiments, the sense strand has a length of 35 or less nucleotides and comprises a region of complementarity to the antisense strand that comprises at least 15, 16, 17, 18 or 19 nucleotides. In some embodiments, Z 17 is Z 20 In some embodiments, Z 18 is Z 19 is a nucleotide sequence complementary to

[0009] In some embodiments, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of prekallikrein (PKK) is provided, the dsRNA agent comprising a sense strand and an antisense strand, and optionally comprising a targeting ligand, wherein the sense strand comprises at least 15 contiguous nucleotides that differ by 0, 1, 2 or 3 nucleotides from the nucleotide sequence of any one of nucleotides 1014-1044, 1054-1084, 1059-1089, 1106-1138, 1456-1486, 1543-1573, and 2029-2059 of SEQ ID NO: 767, and the antisense strand is complementary or substantially complementary to the sense strand sequence of the dsRNA agent. In some embodiments, each strand has a length of 40 or less nucleotides.

[0010] In some embodiments, the dsRNA agent comprises at least one modified nucleotide. In some embodiments, the antisense strand comprises all or substantially all modified nucleotides. In some embodiments, the at least one modified nucleotide comprises 2'-O-methyl nucleotide, 2'-fluoro nucleotide, 2'-deoxy nucleotide, 2',3'-seco nucleotide mimic, locked nucleotide, unlocked nucleic acid nucleotide (UNA), glycol nucleic acid (GNA) nucleotide, 2'-F-arabino nucleotide, 2'-methoxyethyl nucleotide, abasic nucleotide, ribitol, inverted nucleotide, inverted abasic nucleotide, inverted 2'-OMe nucleotide, inverted 2'-deoxy nucleotide, 2'-amino modified nucleotide, 2'-alkyl modified nucleotide, morpholino nucleotide, and 3'-OMe nucleotide, 5'-phosphorothioate group-containing nucleotide, or terminal nucleotide linked with cholesteryl derivative or dodecanoic acid bisdecyl amide group, 2'-amino modified nucleotide, phosphoramidite, or non-natural base-containing nucleotide. In some embodiments, the dsRNA agent comprises an E-vinylphosphonate nucleotide at the 5' end of the antisense strand. In some embodiments, the dsRNA agent comprises at least one phosphorothioate internucleoside linkage. In some embodiments, the sense strand comprises at least one phosphorothioate internucleoside linkage. In some embodiments, the antisense strand comprises at least one phosphorothioate internucleoside linkage. In some embodiments, the sense strand comprises 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages. In some embodiments, the antisense strand comprises 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages. In some embodiments, the sense strand and the antisense strand are all or substantially all modified nucleotides. In some embodiments, the modified sense strand is a modified sense strand sequence shown in any of Tables 2 and 3.In some embodiments, the modified antisense strand is a modified antisense strand sequence shown in any of Tables 2 and 3. In some embodiments, the antisense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methyl nucleotides and 2'-fluoro nucleotides, with the proviso that less than 6 modified nucleotides are 2'-fluoro nucleotides. In some embodiments, the antisense strand comprises 3 or 5 2'-fluoro nucleotides, preferably 5 2'-fluoro nucleotides. In some embodiments, the sense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methyl nucleotides and 2'-fluoro nucleotides, with the proviso that less than 4 modified nucleotides are 2'-fluoro nucleotides. In some embodiments, the sense strand comprises 3 2'-fluoro nucleotides. In some embodiments, the antisense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methyl nucleotides and 2'-fluoro nucleotides, with the proviso that at least 16 modified nucleotides therein are 2'-O-methyl nucleotides and the nucleotides at positions 2, 7, 12, 14, and / or 16 from the 5' end of the antisense strand are 2'-fluoro nucleotides. In some embodiments, the sense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methyl nucleotides and 2'-fluoro nucleotides, with the proviso that at least 18 modified nucleotides therein are 2'-O-methyl nucleotides and the nucleotides at positions 9, 11, and / or 13 from the 3' end of the sense strand are 2'-fluoro nucleotides. In some embodiments, the antisense strand, in the 5' to 3' direction, has nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand from the first pair of nucleotides at the 5' end of the antisense strand that are 2'-fluoro modified nucleotides, and each of the nucleotides at other positions in the antisense strand are independently non-fluoro modified nucleotides.In some embodiments, the antisense strand is 2'-fluoro modified nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand from the first pair of nucleotides at the 5' end of the antisense strand in the 5' to 3' direction, and each of the nucleotides at other positions in the antisense strand is independently a non-fluoro modified nucleotide. In some embodiments, the sense strand is 2'-fluoro modified nucleotides at positions 9, 11, and 13 of the sense strand from the first pair of nucleotides at the 3' end of the sense strand in the 3' to 5' direction, and each of the nucleotides at other positions in the sense strand is independently a non-fluoro modified nucleotide. In some embodiments, the sense strand is complementary or substantially complementary to the antisense strand, and the complementary region has a length of 16-23 nucleotides. In some embodiments, the complementary region has a length of 19-21 nucleotides. In some embodiments, each strand has a length of 40 nucleotides or less. In some embodiments, each strand has a length of 30 nucleotides or less. In some embodiments, each strand has a length of 25 or less nucleotides. In some embodiments, each strand has a length of 23 or less nucleotides. In some embodiments, each strand has a length of 17 or less nucleotides.

[0011] In some embodiments, the dsRNA agent comprises at least one modified nucleotide and further comprises one or more targeting groups or linking groups.In some embodiments, one or more targeting groups or linking groups are conjugated with the sense strand.In some embodiments, the targeting group or linking group comprises N-acetylgalactosamine (Gal NAc).In some embodiments, the targeting group has the following structure: [ka] [ka]

change

change

change

change

change

change

change

change

change

[0012] According to another aspect of the present invention, there is provided a composition comprising one, two or more dsRNA agents according to any of the above-mentioned embodiments of the present invention.In some embodiments, the composition further comprises a pharma- ceutically acceptable carrier.In some embodiments, the composition further comprises one or more additional therapeutic agents.In some embodiments, the composition is packaged in a kit, container, pack, dispenser, pre-filled syringe, or vial.In some embodiments, the composition is prepared for subcutaneous or intravenous (IV) administration.

[0013] According to another aspect of the present invention, there is provided a cell comprising one, two, or more dsRNA agents according to any of the embodiments of the dsRNA agent. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a human cell.

[0014] According to another aspect of the invention, there is provided a method for inhibiting expression of the prekallikrein (PKK) gene in a cell, comprising the step (i) of preparing a cell or a plurality of cells comprising an effective amount of one or more double-stranded ribonucleic acid (dsRNA) agents according to any of the embodiments of the dsRNA agent or any of the embodiments of the composition. In some embodiments, the method further comprises the step (ii) of maintaining the prepared cell or a plurality of cells for a sufficient time to obtain degradation of an mRNA transcript of the PKK gene, thereby inhibiting expression of the PKK gene in the cell or a plurality of cells and reducing the level of PKK polypeptide in the cell or a plurality of cells. In some embodiments, the cell or a plurality of cells is in a subject and the dsRNA agent is administered subcutaneously or intravenously (IV) to the subject, or the cell or a plurality of cells is outside the subject and contacted with the dsRNA agent. In some embodiments, two, three, or more dsRNA agents are administered to the subject or contacted with the cell or a plurality of cells. In some embodiments, the method further comprises assessing inhibition of the PKK gene in the subject following administration of the dsRNA agent to the subject, wherein the means for assessing comprises (i) determining one or more physiological characteristics of a PKK-associated disease or disorder in the subject, and (ii) comparing the determined physiological characteristics to a baseline pre-administration physiological characteristic of the PKK-associated disease or disorder and / or a control physiological characteristic of the PKK-associated disease or disorder, wherein the comparison indicates the presence or absence of inhibition of expression of the PKK gene in the subject.In some embodiments, the method further comprises assessing inhibition of the PKK gene in the cell or cells after contacting the cell or cells with the dsRNA agent, wherein the means for assessing comprises (i) determining one or more physiological characteristics of a PKK-associated disease or disorder in the cell or cells, and (ii) comparing the determined physiological characteristics to a baseline pre-contact physiological characteristic of the PKK-associated disease or disorder and / or a control physiological characteristic of the PKK-associated disease or disorder, wherein the comparison indicates the presence or absence of inhibition of expression of the PKK gene in the cell or cells. In some embodiments, the control physiological characteristic is a physiological characteristic in a subject having a PKK-associated disease or disorder and not administered a dsRNA agent, or a physiological characteristic in a cell having a PKK-associated disease or disorder and not contacted with a dsRNA agent. In some embodiments, (i) the determined physiological characteristic in the subject is the presence or absence and / or level of one or more of the subject's plasma kallikrein, high molecular weight kininogen (HK), and bradykinin, and the subject's plasma PKK level, or the subject's physical symptoms, skin swelling, limb swelling, fatigue, headache, muscle pain, skin tingling, abdominal pain, nausea and vomiting, hoarseness, shortness of breath, mood changes, laryngeal edema, pain, and fever, and (ii) the determined physiological characteristic in the cell or cells is the presence or absence and / or level of one or more of the kallikrein expression, high molecular weight kininogen (HK) expression, and bradykinin expression, and the level of PKK expression in the cell or cells. In some embodiments, the physiological characteristic is determined in a biological sample obtained from the subject. In some embodiments, the biological sample includes one or more of a blood sample, a serum sample, a tissue sample, a cell sample, and a liver sample. In some embodiments, the determined physiological characteristic in the subject is abnormal as compared to a control level of said physiological characteristic.In some embodiments, the control physiological characteristic in the subject is the physiological characteristic in a subject having a PKK-related disease or disorder and not receiving an anti-PKK dsRNA agent, and the control physiological characteristic in the cell or cells is the physiological characteristic in a cell having a PKK-related disease or disorder and not contacted with an anti-PKK dsRNA agent. In some embodiments, the presence or absence and / or level of one or more of plasma kallikrein, high molecular weight kininogen (HK), and bradykinin in the subject, the plasma PKK level in the subject indicates a reduction in PKK gene expression in the subject and a change in PKK expression level in the cell, and the presence or absence and / or level of one or more of kallikrein, high molecular weight kininogen (HK), and bradykinin in the cell or cells indicates a reduction in PKK gene expression in the cell or cells. In some embodiments, the PKK-related disease or disorder is hereditary angioedema, angioedema, bradykinin-mediated angioedema, diabetic retinopathy, diabetic macular edema, hypertension, nephropathy, vascular disease, stroke, peripheral artery disease (PAD), abdominal aortic aneurysm (AAA), carotid artery disease (CAD), arteriovenous malformation (AVM), critical limb-threatening ischemia (CLTI), pulmonary embolism (thrombus), deep vein thrombosis (DVT), chronic venous insufficiency (CVI) or varicose veins. In some embodiments, the method further comprises administering to the subject an additional therapeutic scheme.

[0015] According to another aspect of the present invention, there is provided a method for inhibiting expression of the PKK gene in a subject, comprising administering to the subject an effective amount of one or more of the double-stranded ribonucleic acid (dsRNA) agents according to any of the embodiments of the above-mentioned double-stranded ribonucleic acid (dsRNA) agents or any of the embodiments of the above-mentioned compositions. In some embodiments, two, three, or more than four dsRNA agents are administered to the subject. In some embodiments, the dsRNA agents are administered to the subject by subcutaneous administration or intravenous (IV) administration. In some embodiments, the method further comprises evaluating the inhibition of the PKK gene in the subject after administration of the one or more dsRNA agents, wherein the means for evaluating comprises (i) determining one or more physiological characteristics of the PKK-related disease or disorder in the subject, and (ii) comparing the determined physiological characteristics with a baseline pre-treatment physiological characteristic of the PKK-related disease or disorder and / or a control physiological characteristic of the PKK-related disease or disorder, wherein the comparison indicates the presence or absence of inhibition of the expression of the PKK gene in the subject. In some embodiments, the determined physiological characteristic in the subject is the subject's plasma PKK level; the presence and / or level of one or more of the subject's plasma kallikrein, high molecular weight kininogen (HK) and bradykinin; the subject's physical symptoms, one or more of skin swelling, swelling of the extremities, fatigue, headache, muscle pain, tingling skin, abdominal pain, nausea and vomiting, hoarseness, shortness of breath, mood changes, laryngeal edema, pain, and fever. In some embodiments, the physiological characteristic is determined in a biological sample obtained from the subject. In some embodiments, the biological sample comprises one or more of a blood sample, a serum sample, a cell sample, a tissue sample, and a liver sample. In some embodiments, the determined physiological characteristic in the subject is more normal compared to a baseline pre-treatment physiological characteristic of the PKK-associated disease or disorder in the subject and / or a control physiological characteristic of the PKK-associated disease or disorder.In some embodiments, the subject's plasma PKK, plasma kallikrein, high molecular weight kininogen (HK) and / or bradykinin levels are statistically significantly higher, lower or unchanged compared to baseline pre-treatment physiological characteristics of the PKK-associated disease or disorder and / or control physiological characteristics of the PKK-associated disease or disorder, indicating the status of PKK gene expression in the subject. In some embodiments, a reduction in the subject's physical symptoms, one or more of skin swelling, swelling of the hands and feet, fatigue, headache, muscle pain, tingling skin, abdominal pain, nausea and vomiting, hoarseness, shortness of breath, mood changes, laryngeal edema, pain, and fever indicates a reduction in PKK gene expression in the subject. In some embodiments, the PKK-related disease or disorder is one or more of hereditary angioedema, angioedema, bradykinin-mediated angioedema, diabetic retinopathy, diabetic macular edema, hypertension, nephropathy, vascular disease, stroke, peripheral arterial disease (PAD), abdominal aortic aneurysm (AAA), carotid artery disease (CAD), arteriovenous malformation (AVM), critical limb threatening ischemia (CLTI), pulmonary embolism (thrombus), deep vein thrombosis (DVT), chronic venous insufficiency (CVI), and varicose veins.In some embodiments, the method includes administering to the subject an additional treatment scheme.

[0016] According to another aspect of the present invention, there is provided a method of treating a disease or disorder associated with the presence of prekallikrein (PKK) protein in a subject, comprising administering to the subject an effective amount of one or more of the double-stranded ribonucleic acid (dsRNA) agents according to any of the above embodiments, or compositions according to any of the above embodiments, to inhibit expression of a PKK gene encoding the PKK protein. In some embodiments, the method comprises administering to the subject two, three, or more dsRNA agents. In some embodiments, the disease or disorder is one or more of hereditary angioedema, angioedema, bradykinin-mediated angioedema, diabetic retinopathy, diabetic macular edema, hypertension, nephropathy, vascular disease, stroke, peripheral arterial disease (PAD), abdominal aortic aneurysm (AAA), carotid artery disease (CAD), arteriovenous malformation (AVM), critical limb-threatening ischemia (CLTI), pulmonary embolism (thrombus), deep vein thrombosis (DVT), chronic venous insufficiency (CVI), and varicose veins. In some embodiments, the method further comprises administering to the subject an additional therapeutic scheme. In some embodiments, the additional therapeutic scheme comprises administering to the subject one or more of a PKK antisense polynucleotide, an additional PKK dsRNA therapeutic agent, a non-PKK dsRNA therapeutic agent, and a PKK non-dsRNA therapeutic agent, and modifying behavior in the subject. In some embodiments, the non-PKK dsRNA therapeutic agent is one or more of a blood thinner, an NSAID, aspirin, an anticoagulant, tissue plasminogen activator (tPA), recombinant tissue plasminogen activator (tPA), a statin, a stent, a cholesterol-lowering therapeutic agent, a vasodilator, cilostazol, an antithrombotic agent, and an antiplatelet agent. In some embodiments, the one or more dsRNA agents are administered to the subject by either subcutaneous administration or intravenous (IV) administration. In some embodiments, the administration reduces the level and / or severity of a physiological characteristic.

[0017] In some embodiments, the method further comprises determining efficacy of the administered one or more double-stranded ribonucleic acid (dsRNA) agents in the subject. In some embodiments, the means for determining efficacy of treatment in the subject comprises (i) determining one or more physiological characteristics of a PKK-associated disease or disorder in the subject, and (ii) comparing the determined physiological characteristics to a baseline pre-treatment physiological characteristic of the PKK-associated disease or disorder, the comparison indicating one or more of the presence or absence of efficacy and a level of efficacy of administering the double-stranded ribonucleic acid (dsRNA) agent to the subject. In some embodiments, the determined physiological characteristic in the subject is the subject's plasma PKK level; the presence and / or level of one or more of the subject's plasma kallikrein, high molecular weight kininogen (HK), and bradykinin; the subject's physical symptoms, one or more of skin swelling, swelling of the extremities, fatigue, headache, muscle pain, tingling skin, abdominal pain, nausea and vomiting, hoarseness, shortness of breath, mood changes, laryngeal edema, pain, and fever. In some embodiments, the physiological characteristic is determined in a biological sample obtained from the subject. In some embodiments, the biological sample comprises one or more of a blood sample, a serum sample, a cell sample, a tissue sample, and a liver sample. In some embodiments, the determined physiological characteristic in the subject is different compared to a baseline pre-treatment physiological characteristic of the PKK-related disease or disorder in the subject or a control level of said physiological characteristic. In some embodiments, levels of one or more of plasma PKK, plasma kallikrein, high molecular weight kininogen (HK), and bradykinin are identified as being statistically significantly higher, lower, or unchanged compared to baseline pre-treatment physiological characteristics of a PKK-associated disease or disorder and / or control physiological characteristics of a PKK-associated disease or disorder, indicating the status of PKK gene expression in the subject.In some embodiments, the PKK-associated disease or disorder is one or more of hereditary angioedema, angioedema, bradykinin-mediated angioedema, diabetic retinopathy, diabetic macular edema, hypertension, nephropathy, vascular disease, stroke, peripheral arterial disease (PAD), abdominal aortic aneurysm (AAA), carotid artery disease (CAD), arteriovenous malformation (AVM), critical limb threatening ischemia (CLTI), pulmonary embolism (thrombus), deep vein thrombosis (DVT), chronic venous insufficiency (CVI), and varicose veins.

[0018] According to another aspect of the present invention, there is provided a method of reducing the level of PKK protein in a subject compared to a baseline pre-treatment level of PKK protein in the subject, comprising administering to the subject an effective amount of one or more of a double-stranded ribonucleic acid (dsRNA) agent according to any of the above embodiments, or a composition of the present invention according to any of the above embodiments, to reduce the level of PKK gene expression. In some embodiments, the dsRNA agent is administered to the subject by subcutaneous administration or intravenous (IV) administration.

[0019] According to yet another aspect of the present invention, there is provided a method for altering a physiological characteristic of a prekallikrein (PKK)-related disease or disorder in a subject, compared to a baseline pre-treatment physiological characteristic of the PKK-related disease or disorder in the subject, comprising administering to the subject an effective amount of one or more double-stranded ribonucleic acid (dsRNA) agents according to any of the above embodiments, or compositions of the present invention according to any of the above embodiments, to alter the physiological characteristic of the PKK-related disease or disorder in the subject. In some embodiments, the alteration reduces the level or severity of the physiological characteristic. In some embodiments, the one or more dsRNA agents are administered to the subject by subcutaneous administration or intravenous (IV) administration. In some embodiments, the physiological characteristic is the subject's plasma PKK level; the presence and / or level of one or more of the subject's plasma kallikrein, high molecular weight kininogen (HK), and bradykinin; the subject's physical symptoms, one or more of skin swelling, swelling of the hands and feet, fatigue, headache, muscle pain, tingling skin, abdominal pain, nausea and vomiting, hoarseness, shortness of breath, mood changes, laryngeal edema, pain, and fever. Sequence Description

[0020] SEQ ID NOs: 1 to 224 and 768 to 972 are shown in Table 1 and are sense strand sequences.

[0021] SEQ ID NOs: 225 to 448 and 973 to 1177 are shown in Table 1 and are antisense strand sequences.

[0022] SEQ ID NOs: 449 to 560 and 1178 to 1382 are sense strand sequences, and SEQ ID NOs: 561 to 672 and 1383 to 1587 are antisense strand sequences, which are shown in Table 2. Here, as for chemical modifications, capital letters represent 2'-fluoro, lower case letters represent 2'-OMe, and * represents phosphorothioate.

[0023] SEQ ID NOs: 673-719, 1588-1635 are sense strand sequences, and SEQ ID NOs: 720-766, 1636-1683 are antisense strand sequences, as shown in Table 3. The delivery molecule is represented as "GLX-0" at the 3' end of the sense strand of SEQ ID NOs: 673-697, "GLS-5" at the 5' end of the sense strand of SEQ ID NOs: 698-709, and GLS-15 at the 5' end of the sense strand of SEQ ID NOs: 710-719, 1588-1635. Chemical modifications include uppercase 2'-fluoro, lowercase 2'-OMe, * phosphorothioate, and Invab reverse abasic.

[0024] SEQ ID NO: 767 is the Homo sapiens kallikrein B1 (KLKB1 or PKK) mRNA sequence [NCBI Reference Sequence: NM_000892.5].

number

[0025] [Figure 1] FIG. 1 is a graph showing PKK levels in monkey serum following a single subcutaneous dose of siRNA compounds at 3 mg / kg. [Diagram 2] FIG. 2 is a graph showing PKK levels in monkey serum following a single subcutaneous dose of siRNA compounds at 3 mg / kg. [Diagram 3] FIG. 3 is a graph showing PKK levels in monkey serum following a single subcutaneous dose of siRNA compounds at 1, 3 or 10 mg / kg. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0026] Some of the present invention include RNAi agents, including but not limited to double-stranded (ds) RNAi agents, that can inhibit the expression of the kallikrein B1 (KLKB1 or PKK) gene. The anti-PKK dsRNA agents of the present invention can target PKK transcripts and inhibit PKK protein expression. The compounds, compositions, and methods of the present invention provide anti-PKK RNAi therapeutic agents and treatments for hereditary angioedema, angioedema, bradykinin-mediated angioedema, diabetic retinopathy, diabetic macular edema, hypertension, nephropathy, vascular disease, cardiovascular disease, thrombosis, inflammation, and / or other PKK-related diseases and disorders. The anti-PKK RNAi agents and compounds delivered to cells by the methods of the present invention can inhibit the expression of the PKK gene, thereby reducing the activity of the PKK protein product of this gene in the cell. The anti-PKK dsRNAi agents of the present invention can be administered to the subject to treat PKK-related diseases and / or disorders in the subject.

[0027] In some embodiments of the present invention, the agents, compounds, compositions, and methods of the present invention are used to achieve efficacy in the prevention / treatment of PKK-related diseases or disorders.For example, and not intended to be limiting, a subject with angioedema administered with a therapeutic agent or composition of the present invention can show one or more of the following characteristics: reduced severity and frequency of angioedema cases, reduced pain, reduced swelling, reduced number of hospital visits, reduced length of hospital stay, and improved quality of life, compared to a subject not administered with a therapeutic agent / therapeutic agent or composition of the present invention.In another non-limiting example, a subject with thrombosis administered with a therapeutic agent or composition of the present invention can show one or more of reduced thrombus, eradication of one or more thrombus, and reduced severity and frequency of thrombosis cases.

[0028] The PKK RNAi described herein can inhibit the expression of PKK protein. In some embodiments of the present invention, the expression of PKK in cells or subjects is reduced to treat diseases or disorders associated with the expression of PKK in cells or subjects. Non-limiting examples of diseases and disorders that can be treated by reducing PKK activity include hereditary angioedema, angioedema, hypertension, nephropathy, vascular disease (non-limiting examples are stroke, peripheral arterial disease (PAD), abdominal aortic aneurysm (AAA), carotid artery disease (CAD), arteriovenous malformation (AVM), critical limb threatening ischemia (CLTI), pulmonary embolism (thrombus), deep vein thrombosis (DVT), chronic venous insufficiency (CVI), and varicose veins of the lower extremities), cardiovascular disease, thrombosis, inflammation, and / or other diseases that are medically beneficial to subjects by reducing the level and activity of PKK protein.

[0029] Some of the present invention includes compositions that contain anti-PKK RNAi agents and methods of using them. Some embodiments of the present invention include pharmaceutical compositions that contain one or more PKK dsRNA agents and a pharma-ceutically acceptable carrier. In some embodiments, the anti-PKK RNAi agents of the present invention may be linked to a delivery compound that can deliver the RNAi agent to cells, including but not limited to hepatocytes. In some embodiments, the delivery compound is a Gal NAc-containing delivery compound.

[0030] Some pharmaceutical compositions of the present invention comprise one, two, or three or more independently selected anti-PKK dsRNA agents and may further comprise one or more independently selected delivery compounds. In some embodiments, two, three, or four or more anti-PKK dsRNAs that can each target one, two, three, or four or more different positions / regions of PPK mRNA are administered to cells and / or subjects.

[0031] The following describes methods for preparing and using compositions comprising anti-PKK dsRNA agents (double-stranded) capable of inhibiting the expression of PKK gene, as well as compositions and methods for treating diseases and disorders caused by and / or regulated by PKK gene expression. As used herein, diseases and / or disorders caused by the presence and / or level of PKK gene expression and / or regulated by PKK gene expression may be referred to as "PKK-associated diseases and / or disorders".

[0032] The term "RNAi" as used herein refers to an agent comprising an RNA that mediates targeted cleavage of an RNA transcript via the RNA-induced silencing complex (RISC) pathway. As used herein, the terms "RNAi" and "RNAi agent" may be used interchangeably with the terms "anti-PKK RNAi" and "anti-PKK RNAi agent," "PKK RNAi" and "PKK RNAi agent," "dsRNA" and "dsRNA agent," "PKK dsRNA" and "PKK dsRNA agent," and "anti-PKK dsRNA" and "anti-PKK dsRNA agent." As is known in the art, an RNAi target region refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during gene transcription, including messenger RNA (mRNA), which is an RNA processing product of the primary transcript. The target portion of an mRNA molecule (also referred to herein as the "target sequence") has a length sufficient to function as a substrate for RNAi-directed cleavage at least at or near that portion. The target sequence may be 8-30 nucleotides in length (including the endpoints), 10-30 nucleotides in length (including the endpoints), 12-25 nucleotides in length (including the endpoints), 15-23 nucleotides in length (including the endpoints), 16-23 nucleotides in length (including the endpoints), or 18-23 nucleotides in length (including the endpoints), including all shorter lengths within each specified range. In some embodiments, the target sequence is 9-26 nucleotides in length (including the endpoints), including all subranges and integers therebetween. For example, in some embodiments of the invention, the target sequence has a length of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides, where the sequence is fully or at least substantially complementary to at least a portion of an RNA transcript of PKK, but is not limited thereto.

[0033] As used herein, "dsRNA agent" refers to a composition comprising an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that can sequence-specifically degrade or inhibit the translation of a messenger RNA (mRNA) transcript of a target mRNA. Without intending to be limited to a particular theory, the dsRNA agent of the present invention can act by the RNA interference mechanism [i.e., by interacting with the RNA interference pathway mechanism (RNA-induced silencing conjugate or RISC) of mammalian cells to induce RNA interference], or by any alternative mechanism or pathway. Methods for silencing genes in plant, invertebrate and vertebrate cells are known in the art (see, for example, (Sharp et al., Genes Dev. 2001, 15:485; Bernstein, et al., (2001) Nature 409:363; Nykanen, et al., (2001) Cell 107:309; and Elbashir, et al., (2001) Genes Dev. 15:188), the disclosures of each of which are incorporated herein by reference in their entirety. Gene silencing programs known in the art can be used in conjunction with the disclosure provided herein to inhibit expression of PKK.

[0034] The dsRNA agent disclosed herein includes sense strand and antisense strand, including but not limited to short interfering RNA (siRNA), RNAi agent, microRNA (miRNA), short hairpin RNA (shRNA), and dicer substrate. The antisense strand of the dsRNA agent described herein is complementary to at least a portion of the targeted mRNA. It is recognized in the art that different lengths of dsRNA double-stranded structures can be used to inhibit the expression of target genes. For example, it is known that dsRNA with double-stranded structure having 19, 20, 21, 22 and 23 base pairs can effectively induce RNA interference (Elbashir et al., EMBO 2001, 20:6877-6888), and it is also known in the art that short or long RNA double-stranded structures can effectively induce RNA interference. In some embodiments of the invention, the PKK dsRNA can include at least one strand of a minimum length of 21 nt or can have a shorter duplex. In some embodiments, the dsRNA agent of the invention is a duplex as shown in any one of Tables 1-3. In some embodiments, the dsRNA agent of the invention is a duplex as shown in any one of Tables 1-3, but can still reduce PKK expression by subtracting 1, 2, 3, or 4 nucleotides from one or both ends of the duplex. In some embodiments of the invention, the PKK dsRNA agent can have a subsequence of at least 15, 16, 17, 18, 19, or 20 or more contiguous nucleotides from one or more sequences in Tables 1-3, and the ability to inhibit expression of the PKK gene differs by no more than 5%, 10%, 15%, 20%, 25%, or 30% from the level of inhibition by a dsRNA containing the complete sequence. The sense sequences, antisense sequences, and duplexes disclosed in Tables 1-3 are also referred to herein as "parent" sequences."Parent" sequence means that the sequences disclosed in Tables 1-3 may be modified, shortened, extended, contain substitutions, etc., as described herein, such that the resulting sequence retains all or at least a portion of the efficacy of the parent sequence in the methods and compositions of the invention. The sense and antisense strands included in the dsRNA of the invention are independently selected. As used herein, the term "independently selected" means that each of two or more similar elements may be selected independently of the selection of the other elements. For example, and not intended to be limiting, two stranded "elements" may be selected for inclusion in a duplex when preparing a dsRNA of the invention. One selected element, the sense sequence, may be SEQ ID NO: 675 (shown in Table 3), and the other selected element, the antisense sequence, may be SEQ ID NO: 722, or may be SEQ ID NO: 722 modified, shortened, or extended and / or containing one, two, or three substitutions relative to its parent sequence, SEQ ID NO: 722. It will be understood that a duplex of the invention need not contain both the sense and antisense sequences shown in Tables 1-3 as mating duplexes. Immediately following each sense and antisense strand sequence in the table is its SEQ ID NO:

[0035] Tables 1-3 show the core extension sequences of the antisense and sense strands of certain PKK dsRNA agents. The term "sequence" as used herein refers to a polynucleotide sequence without chemical modifications or delivery compounds. For example, ugguugcuucuugaaagauaa (SEQ ID NO: 2), the sense strand shown in Table 1, is the sequence represented by SEQ ID NO: 450 in Table 2, where SEQ ID NO: 450 is shown with their chemical modifications. The sequences disclosed herein can be labeled with a labeling symbol. For example, a single-stranded sense sequence can be labeled with "sense strand SS#", a single-stranded antisense sequence can be labeled with "antisense strand AS#", and a duplex comprising a sense strand and an antisense strand can be labeled with "duplex AV#" or "duplex AD#".

[0036] Table 1 discloses the sense and antisense strands, and provides the label number of the duplex consisting of the sense and antisense strands in the same row in Table 1. The term "match site" in the sense and antisense strands as used herein refers to the "matching" site in each strand when the two strands are double-stranded strands. For example, in a 21-nucleobase sense strand and a 21-nucleobase antisense strand, the first nucleobase of the sense strand and the 21st nucleobase of the antisense strand are at the "match site". In another non-limiting example, in a 23-nucleobase sense strand and a 23-nucleobase antisense strand, the second nucleobase of the sense strand and the 22nd nucleobase of the antisense strand are at the match site. In another non-limiting example, in an 18-nucleobase sense strand and an 18-nucleobase antisense strand, the first nucleobase of the sense strand and the 18th nucleobase of the antisense strand are matched at the match site, and the fourth nucleobase of the sense strand and the 15th nucleobase of the antisense strand are matched at the match site. One of skill in the art will understand how to identify match sites in the sense and antisense strands that are or will be double-stranded strands and paired strands.

[0037] In the first column of Table 1, a duplex containing the sense and antisense sequences in the same table row is designated as duplex AV#. For example, Table 1 discloses a duplex designated as duplex AV#AV00001 containing the sense strand of SEQ ID NO: 1 and the antisense strand of SEQ ID NO: 225. Thus, in Table 1, each row contains a duplex according to the invention containing the sense and antisense sequences shown in the same row.

[0038] In some embodiments of the method of the present invention, an RNAi agent is administered to a subject, the duplex sequence of which is shown in Table 1. In some embodiments of the present invention, the RNAi agent administered to a subject comprises a duplex containing at least one of the base sequences shown in Table 1, including 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 sequence modifications. In some embodiments of the method of the present invention, an RNAi agent is linked to a delivery molecule (also referred to herein as a delivery compound) that is a dsRNA polynucleotide sequence shown in Table 1. However, non-limiting examples of delivery compounds include delivery compounds that include a GalNAc compound or GLS-15. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7] [Table 1-8] [Table 1-9]

Table 1-10

Table 1-11

Table 1-12

Table 1-13

Table 1-14

[0039] Table 2 shows the antisense and sense strand sequences of chemically modified PKK RNAi agents of the invention. In some embodiments of the methods of the invention, an RNAi agent having a polynucleotide sequence shown in Table 2 is administered to a cell and / or subject. In some embodiments of the invention, the RNAi agent administered to the subject comprises a duplex shown in the first column of a row in Table 2 and includes sequence modifications shown in the sense and antisense strand sequences in the fourth and seventh columns of the same row in Table 2, respectively. In some embodiments of the methods of the invention, the sequences shown in Table 2 can link the RNAi agent to a compound capable of delivery to cells and / or tissues of a subject (also referred to herein as a "conjugate"). Non-limiting examples of delivery compounds for use in some embodiments of the invention include compounds that contain GalNAc and compounds that contain GLS-15. In the first column of Table 2, the duplex AV# of the base sequence shown in Table 1 is shown. Table 2 shows the duplex AV# and the chemical modifications in the sense and antisense strands of the duplex. For example, Table 1 shows single stranded nucleotide sequences represented by SEQ ID NO: 1 (sense) and SEQ ID NO: 225 (antisense), both of which together form a double strand represented as double strand AV#AV00001. Table 2 shows double strand AV#AV00001, in which the double strand consisting of SEQ ID NO: 449 and SEQ ID NO: 561 contains the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 225, respectively, and has the sense and antisense sequences shown in columns 4 and 7 of Table 2, respectively. The "sense strand SS#" in the second column of Table 2 is a labeling symbol representing the sense sequence (including modifications) shown in the fourth column of the same row. The "antisense strand AS#" in the fifth column of Table 2 is a labeling symbol representing the antisense sequence (including modifications) shown in the seventh column. [Table 2-1] [Table 2-2] [Table 2-3]

Table 2-4

Table 2-5

Table 2-6

Table 2-7

Table 2-8

Table 2-9

Table 2-10

Table 2-11

[0040]

Table 3-1

Table 3-2

Table 3-3

[0041] Table 3 discloses antisense and sense strand sequences of several chemically modified PKK RNAi agents and dsRNAs of the invention. In some embodiments of the methods of the invention, an RNAi agent as shown in Table 3 is administered to a cell and / or subject. In some embodiments of the methods of the invention, an RNAi agent comprising a polynucleotide sequence as shown in Table 3 is administered to a subject. In some embodiments of the invention, the RNAi agent administered to the subject comprises a duplex as shown in Table 3, column 1, which comprises a sequence modification and / or delivery compound as shown in the sense strand and antisense strand sequences, respectively, in columns 4 and 7 of the same row of Table 3. These sequences are used in some in vivo testing studies described herein below. In some embodiments, the sequences shown in Table 3 can be linked to a delivery compound (also referred to herein as a "conjugate"). The delivery compound is, by way of non-limiting example, a Gal NAc-containing compound. Certain embodiments of the delivery compound are shown in Table 3 on the sense strand in column 4 as "GLS-5", "GLS-15" or "GLX-0". As used herein and as shown in Table 3, "GLS-5", "GLS-15" and "GLX-0" refer to Gal NAc-containing compounds. As used herein, "GLX" is used to represent a "GLS" or "GLO" delivery compound (where "X" can be "S" or "O"), and GLX-0 can be any of the GLS and GLO delivery compounds that can be linked to the 3' end of an oligonucleotide during synthesis. For example, and not intended to be limiting, GLX-13 and GLX-14 can be linked to the 3' end of an oligonucleotide of the invention during synthesis.In some embodiments of the invention, the delivery compound designated as "GLS-5," "GLS-15," or "GLX-0" in Table 3 is substituted with any of the compounds GLS-1, GLS-2, GLS-3, GLS-4, GLS-5, GLS-6, GLS-7, GLS-8, GLS-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, the structures of each of which are set forth herein below. One skilled in the art can prepare and use the dsRNA compounds of the present invention linked to any one of GLS-1, GLS-2, GLS-3, GLS-4, GLS-5, GLS-6, GLS-7, GLS-8, GLS-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16 as delivery compounds. Each row of Table 3 is provided with a duplex AD# that represents the sense and antisense sequence duplexes in that row of the table. For example, duplex AD#AD00311 is a duplex comprising a sense strand of SEQ ID NO:693 and an antisense strand of SEQ ID NO:740. In each row of Table 3, a sense strand and an antisense strand are provided and a duplex of the sense strand and the antisense strand is disclosed. In the second column of Table 3, "Sense strand SS#" is a label designation that represents the sense sequence (including modifications) shown in the fourth column of the same row. In the fifth column of Table 3, "Antisense strand AS#" is a label designation that represents the antisense sequence (including modifications) shown in the seventh column. The label designation of a particular linked Gal NAc-containing GLO or GLS compound is shown as GLS-5, GLS-15 or GLX-0.However, it will be understood that the compounds designated as GLS-5, GLS-15 or GLX-0 may be substituted with other GLO or GLS compounds, and the resulting compounds are included in one embodiment of the methods and / or compositions of the invention. In Table 3, SEQ ID NOs: 673-719, 1588-1637 are sense strand sequences, and SEQ ID NOs: 720-766, 1638-1687 are antisense strand sequences. In Table 3, the delivery molecules are designated as "GLX-0" at the 3' end of the sense strand of SEQ ID NOs: 673-697, "GLS-5" at the 5' end of the sense strand of SEQ ID NOs: 698-709, and "GLS-15" at the 5' end of the sense strand of SEQ ID NOs: 710-719. Chemical modifications include capital letters for 2'-fluoro, lower case letters for 2'-OMe, * for phosphorothioate, and Invab for inverted abasic. [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] [Table 4-5] [Table 4-6]

[0042] In some embodiments of the invention, the dsRNA (also referred to herein as a "duplex") is one disclosed in any one of Tables 1-3. Each row of Tables 1-3 discloses a duplex that includes the sense strand sequence and the antisense strand sequence in that table. In addition to the duplexes disclosed in Tables 1-3, it will be understood that in some embodiments, the duplexes of the invention can comprise the sense and antisense sequences shown in Tables 1-3 that differ from the sequences shown in Tables 1-3 by 0, 1, 2, or 3 nucleotides. Thus, as a non-limiting example, in some embodiments, the antisense strand in a duplex of the invention can be SEQ ID NO: 225, 251, 258, 295, 325, 417, or 437 that differs from SEQ ID NO: 225, 251, 258, 295, 325, 417, or 437 by 0, 1, 2, or 3 nucleotides.

[0043] It will be understood that the sense and antisense strand sequences in the duplexes of the invention can be selected independently. Thus, the dsRNA of the invention can comprise the sense and antisense strands of the duplexes disclosed in row 1 of Tables 1-3. Alternatively, in the dsRNA of the invention, one or both of the sense and antisense strands in the selected dsRNA can comprise a sequence shown in Tables 1-3, but one or both of the sense and antisense sequences can comprise one, two, or more nucleobase substitutions relative to the parent sequence. In some embodiments, the selected sequences can be longer or shorter than their parent sequences. Thus, the dsRNA agents included in the invention can comprise, but do not have to comprise, the exact sequences of the sense and antisense pairs disclosed as duplexes in Tables 1-3.

[0044] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein nucleotides 2-18 of the antisense strand comprise a region complementary to a PKK RNA transcript, the complementary region comprising at least 15 contiguous nucleotides that differ by 0, 1, 2 or 3 nucleotides from any one of the antisense sequences set forth in any one of Tables 1-3, and optionally comprising a targeting ligand. In some cases, the region complementary to a PKK RNA transcript comprises at least 15, 16, 17, 18 or 19 contiguous nucleotides that differ by 3 or less nucleotides from any one of the antisense sequences set forth in any one of Tables 1-3. In some embodiments of the dsRNA agent of the invention, the antisense strand of the dsRNA is at least substantially complementary to any one of the target regions of SEQ ID NO: 767, provided in any one of Tables 1-3. In some embodiments, the antisense strand of the dsRNA agent of the invention is fully complementary to any one of the target regions of SEQ ID NO: 767, provided in any one of Tables 1-3. In some embodiments, a dsRNA agent comprises a sense strand sequence shown in any one of Tables 1-3, wherein the sense strand sequence is at least substantially complementary to the antisense strand sequence of the dsRNA agent. In some embodiments, a dsRNA agent of the invention comprises a sense strand sequence shown in any one of Tables 1-3, wherein the sense strand sequence is fully complementary to the antisense strand sequence of the dsRNA agent. In some embodiments, a dsRNA agent of the invention comprises an antisense strand sequence shown in any one of Tables 1-3. In some embodiments, a dsRNA agent of the invention comprises a sense and antisense sequence disclosed as a duplex in any one of Tables 1-3. It will be understood that, as described herein, the sense and antisense strands in a duplex of the invention can be selected independently. mismatch

[0045] As known to those skilled in the art, efficacy in dsRNA can tolerate mismatches, especially mismatches in the terminal regions of dsRNA. Some mismatches in dsRNA are better tolerated, for example, efficacy is better tolerated with mismatches having wobble base pairs G:U and A:C (Du et al., Nucleic Acids Res. 2005 Mar 21;33(5):1671-7). In some embodiments of the methods and compounds of the present invention, the PKK dsRNA agent can include one or more mismatches to the PKK target sequence. In some embodiments, the PKK dsRNA agent of the present invention does not include a mismatch. In some embodiments, the PKK dsRNA agent of the present invention includes no more than one, no more than two, or no more than three mismatches. In some embodiments of the present invention, the antisense strand of the PKK dsRNA agent includes a mismatch to the PKK target sequence that is not located in the center of the complementary region. In some embodiments, the antisense strand of a PKK dsRNA agent contains 1, 2, 3, or 4 or more mismatches within the last 5, 4, 3, 2, or 1 nucleotide from either or both of the 5' or 3' ends of the complementary region. Methods described herein and / or known in the art can be used to determine whether a PKK dsRNA agent containing mismatches to a PKK target sequence effectively inhibits expression of a PKK gene. Complementarity

[0046] Unless otherwise stated, the term "complementary" as used herein, when used to describe a first nucleotide sequence (e.g., a sense strand of a PKK dsRNA agent) in relation to a second nucleotide sequence (e.g., an antisense strand of a PKK dsRNA agent), refers to the ability of an oligonucleotide or polynucleotide comprising a first nucleotide sequence to hybridize to an oligonucleotide or polynucleotide comprising a second nucleotide sequence to form a double-stranded or double helix structure under certain conditions [forming hydrogen bonds of base pairs under mammalian physiological conditions (or similar in vitro conditions)]. Other conditions, such as physiologically relevant conditions present in vivo, may also be applicable. The set of optimal conditions for testing the complementarity of two sequences can be determined by one of skill in the art depending on the ultimate application of the hybridized nucleotides. To meet, at least to some extent, the hybridization requirements described above, complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs, and also include natural or modified nucleotides or nucleotide mimetics. The sequence identity or complementarity is irrelevant to the modification.

[0047] Complementary sequences include, for example, those in the PKK dsRNA described herein, and include base pairing between an oligonucleotide or polynucleotide comprising a first nucleotide sequence and an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or two nucleotide sequences. Such sequences may be referred to herein as "fully complementary" to each other. In some embodiments, when two oligonucleotides are designed to form one or more single-stranded overhangs after hybridization, it is understood that such overhangs are not considered as mismatches for determining complementarity herein. For example, a PKK dsRNA agent comprising an oligonucleotide having a length of 19 nucleotides and an oligonucleotide having a length of 20 nucleotides, where the longer oligonucleotide comprises a 19 nucleotide sequence that is fully complementary to the shorter oligonucleotide, can be said to be "fully complementary" for the purposes described above. Thus, "fully complementary" as used herein means that all (100%) of the bases in a contiguous sequence of a first polynucleotide hybridize to the same number of bases in a contiguous sequence of a second polynucleotide. The contiguous sequence can include all or a portion of the first or second nucleotide sequence.

[0048] As used herein, the term "substantially complementary" means that in a hybridized nucleic acid base sequence pair, at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% (but not all) of the bases in a contiguous sequence of a first polynucleotide hybridize to the same number of bases in a contiguous sequence of a second polynucleotide. The term "substantially complementary" is used to refer to a first sequence relative to a second sequence where the two sequences, the first sequence and the second sequence, when hybridized into a duplex of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 base pairs (bp), contain one or more (e.g., at least 1, 2, 3, 4 or 5) mismatched base pairs, while at the same time maintaining the ability to hybridize under conditions most relevant to their end application (e.g., inhibition of PKK gene expression via the RISC pathway).

[0049] As used herein, the term "partially complementary" is used to refer to the hybridization of nucleobase sequences in which at least 75% (but not all) of the bases in a contiguous sequence of a first polynucleotide hybridize to the same number of bases in a contiguous sequence of a second polynucleotide. In some embodiments, "partially complementary" means that at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of the bases in a contiguous sequence of a first polynucleotide hybridize to the same number of bases in a contiguous sequence of a second polynucleotide.

[0050] The terms "complementary," "fully complementary," "substantially complementary," and "partially complementary" are used herein to refer to base matches between a sense strand and an antisense strand of a PKK dsRNA agent, or between an antisense strand of a PKK dsRNA agent and a sequence of a target PKK mRNA. It will be understood that the term "antisense strand of a PKK dsRNA agent" can refer to the same sequence of a "PKK antisense polynucleotide agent."

[0051] The term "substantially the same" or "substantially identical" used when referring to a nucleic acid sequence as used herein means a nucleic acid sequence comprising a sequence having at least about 85% or more, preferably at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity compared to a reference sequence. The percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window. The percentage is calculated by determining the number of positions at which identical nucleic acid bases occur in the two sequences to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. The invention disclosed herein encompasses substantially the same base sequences as those disclosed herein (e.g., Tables 1-3). In some embodiments, the sequences disclosed herein are completely identical to, or at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to, the sequences disclosed herein (e.g., Tables 1-3).

[0052] The term "strand comprising a sequence" as used herein refers to an oligonucleotide comprising a strand of nucleotides described by a sequence referred to in standard nomenclature of nucleotides. The term "double-stranded RNA" or "dsRNA" as used herein refers to an RNAi comprising an RNA molecule or molecular complex having a hybridized double-stranded region comprising two antiparallel, substantially or completely complementary nucleic acid strands, said to have a "sense" and "antisense" orientation to the target PKK RNA. The double-stranded region may be of any length that allows for specific degradation of the desired target PKK RNA by the RISC pathway, but is typically 9-30 base pairs in length, for example 15-30 base pairs in length. When a double strand of 9 to 30 base pairs is used, the double strand may be any length within the range of, for example, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 base pairs, or any length within any subrange therebetween, specifically, 15 to 30 base pairs, 15 to 26 base pairs, 15 to 23 base pairs, 15 to 22 base pairs, 15 to 21 base pairs, 15 to 20 base pairs, 15 to 19 base pairs, 15 to 18 base pairs, 15 to 17 base pairs, 18 to 30 base pairs, 18 to 26 base pairs, 18 to 30 base pairs, 18 to 40 base pairs, 18 to 50 base pairs, 18 to 60 base pairs, 18 to 70 base pairs, 18 to 80 base pairs, 18 to 90 base pairs, 18 to 100 base pairs, 18 to 200 base pairs, 18 to 300 base pairs, 18 to 40 base pairs, 18 to 50 base pairs, 18 to 60 base pairs, 18 to 100 base pairs, 18 to 200 base pairs, 18 to 3 ...300 base pairs, The length of the PKK dsRNA agent may be, but is not limited to, 19-23 base pairs, 18-22 base pairs, 18-21 base pairs, 18-20 base pairs, 19-30 base pairs, 19-26 base pairs, 19-23 base pairs, 19-22 base pairs, 19-21 base pairs, 19-20 base pairs, 20-30 base pairs, 20-26 base pairs, 20-25 base pairs, 20-24 base pairs, 20-23 base pairs, 20-22 base pairs, 20-21 base pairs, 21-30 base pairs, 21-26 base pairs, 21-25 base pairs, 21-24 base pairs, 21-23 base pairs, or 21-22 base pairs. PKK dsRNA agents produced in cells by Dicer and similar enzyme treatments generally have a length of 19-22 base pairs. One strand of the double-stranded region of a PKK dsDNA agent contains a sequence that is essentially complementary to a region of the target PKK RNA.The two strands forming the double-stranded structure may be derived from a single RNA molecule having at least one self-complementary region, or may be composed of two or more independent RNA molecules. When the double-stranded region is formed from the two strands of a single molecule, the molecule may have a double-stranded region separated by a single strand of nucleotides (herein referred to as a "hairpin loop") between the 3' end of one strand and the 5' end of the other strand forming the double-stranded structure. In some embodiments of the invention, the hairpin loop comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more unpaired nucleotides. When the substantially complementary two strands of a PKK dsRNA agent are composed of a single RNA molecule, the molecules may be linked by a covalent bond, but need not be so linked. When the two strands are covalently linked in a manner other than a hairpin loop, the linking structure is referred to as a "linker." The term "siRNA" is also used herein to refer to a dsRNA agent as described herein.

[0053] In some embodiments of the invention, the PKK dsRNA agent can include a sense sequence and an antisense sequence with unpaired nucleotides or nucleotide analogs at one or two ends of the dsRNA agent. An end without unpaired nucleotides is called a "blunt end" and has no nucleotide overhangs. If both ends of the dsRNA agent are blunt, the dsRNA is called "blunt-ended". In some embodiments of the invention, the dsRNA agent is blunt-ended only at the first end. In some embodiments of the invention, the dsRNA agent is blunt-ended only at the second end. In some embodiments of the invention, the PKK dsRNA agent is blunt-ended at both ends.

[0054] In some embodiments of the dsRNA agent of the present invention, the dsRNA does not have one or two blunt ends. In this case, there is at least one unpaired nucleotide at the end of the strand of the dsRNA agent. For example, a nucleotide overhang exists when the 3' end of one strand of the dsRNA extends beyond the 5' end of the other strand, or vice versa. The dsRNA can include an overhang having at least 1, 2, 3, 4, 5, or 6 or more nucleotides. The nucleotide overhang may include or consist of nucleotide / nucleoside analogs, including deoxyribonucleotides / nucleosides. In some embodiments, the nucleotide overhang exists in the sense strand of the dsRNA agent, the antisense strand of the dsRNA agent, or both ends of the dsRNA agent, and it is understood that the nucleotides in the overhang may exist at the 5' end, 3' end, or both ends of the antisense strand or sense strand of the dsRNA. In some embodiments of the present invention, one or more nucleotides in the overhang are replaced by nucleoside phosphorothioates.

[0055] As used herein, the term "antisense strand" or "guide strand" refers to the strand of a PKK dsRNA agent that contains a region that is substantially complementary to a PKK target sequence.As used herein, the term "sense strand" or "lagging strand" refers to the strand of a PKK dsRNA agent that contains a region that is substantially complementary to a region of the antisense strand of a PKK dsRNA agent. qualification

[0056] In some embodiments of the present invention, the RNA of the PKK RNAi agent is chemically modified to enhance stability and / or one or more other beneficial features.In some aspects of the present invention, nucleic acids can be synthesized and / or modified by methods well established in the art, for example, as described in "Current protocols in Nucleic Acid Chemistry", Beaucage, SLet al. (Eds), John Wiley & Sons, Inc., New York, NY, USA, incorporated herein by reference. Modifications that may be present in the PKK dsRNA agents of the invention in certain embodiments include, for example, (a) end modifications such as 5' end modifications (phosphorylation, conjugation, inverted ligation, etc.), 3' end modifications (conjugation, DNA nucleotides, inverted ligation, etc.), (b) base modifications such as stabilized bases, destabilized bases, or base replacements that base pair with an extended repertoire of partners, abasic (abasic nucleotides) or conjugated bases, (c) sugar modifications (e.g., at the 2' or 4' position) or sugar replacements, and (d) backbone modifications including phosphodiester bond modifications or replacements. Some specific examples of RNA compounds that may be used in certain embodiments of the PKK dsRNA agents, PKK antisense polynucleotides, and PKK sense polynucleotides of the invention include, but are not limited to, RNAs that contain modified backbones or are linked by non-natural internucleotide linkages. As a non-limiting example, RNAs with modified backbones may not have a phosphorus atom in the backbone. RNA that does not have a phosphorus atom in its internucleotide backbone is sometimes referred to as an oligonucleotide. In some embodiments of the invention, modified RNA has a phosphorus atom in its internucleotide backbone.

[0057] The terms "RNA molecule," "RNA," or "ribonucleic acid molecule" are understood to encompass not only RNA molecules expressed or found in nature, but also RNA analogs and derivatives, as described herein or as otherwise known in the art, that contain one or more ribonucleotide / ribonucleoside analogs or derivatives. The terms "ribonucleoside" and "ribonucleotide" can be used interchangeably herein. RNA molecules may be modified in the nucleobase structure or sugar-phosphate backbone structure (e.g., as described herein below), provided that molecules containing nucleoside analogs or derivatives retain the ability to form double strands. As some non-limiting examples, the RNA molecule may further comprise at least one modified nucleoside, including, but not limited to, a 2'-O-methyl group modified nucleoside, a nucleoside containing a 5'-phosphorothioate group, a terminal nucleoside linked to a cholesteryl derivative or a lauric acid bisdecylamide group, a locked nucleoside, an abasic nucleoside, a 2'-deoxy-2'-fluorine modified nucleoside, a 2'-amino group modified nucleoside, a 2'-alkyl group modified nucleoside, a morpholino nucleoside, a phosphoramidite, or a nucleoside containing a non-natural base, or any combination thereof. In some embodiments of the present invention, the RNA molecule comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or up to its full length, ribonucleosides of PKK dsRNA agent molecule, said ribonucleosides being modified ribonucleosides.The multiple modified ribonucleosides in such RNA molecule do not need to be identical in each modification.The term "multiple" as used herein means more than one, and thus multiple can be 2, 3, 4, 5, 6, 7, or more items that the term refers to. As a non-limiting example, multiple modified ribonucleosides in an RNA molecule means that 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or up to the entire length of one or both strands of the PKK dsRNA agent molecule are modified ribonucleosides.It will be understood that the modified ribonucleosides in the sense and antisense strands may be selected independently.

[0058] In some embodiments, a dsRNA agent, PKK antisense polynucleotide, and / or PKK sense polynucleotide of the invention can include one or more independently selected modified nucleotides and / or one or more independently selected non-phosphodiester linkages. As used herein, the term "independently selected" when referring to selected elements (e.g., modified nucleotides, non-phosphodiester linkages, targeting agents, dsRNA agents, duplexes of the invention, etc.) means that two or more selected elements can be, but are not necessarily, the same as one another.

[0059] As used herein, "nucleotide base", "nucleotide" or "nucleobase" refers to a heterocyclic pyrimidine or purine compound that is a standard component of all nucleic acids and includes the bases adenine (a), guanine (g), cytosine (c), thymine (t) and uracil (u) that form nucleotides. Nucleobases may be further modified, including, but not limited to, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. The term "ribonucleotide" or "nucleotide" as used herein may refer to unmodified nucleotides, modified nucleotides, or moieties replaced with alternatives. Those skilled in the art will recognize that guanine, cytosine, adenine, and uracil may be replaced with other moieties without substantially altering the complementary base pairing properties of oligonucleotides that contain nucleotides with such replacement moieties.

[0060] In one embodiment, the modified RNA used in the methods and compositions herein is a peptide nucleic acid (PNA) that has the ability to form a desired double-stranded structure and that enables or mediates specific degradation of the target RNA by the RISC pathway. In one embodiment of the invention, the PKK RNA interfering agent includes a single-stranded RNA that interacts with a target PKK RNA sequence to guide cleavage of the target PKK RNA.

[0061] Modified RNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methylphosphonates and other alkylphosphonates such as 3'-alkylenephosphonates, chiral phosphonates, phosphinates, phosphoramidites such as 3'-aminophosphoramidites and aminoalkylphosphoramidites, thiophosphoramidites, thioalkylphosphonates, thioalkylphosphotriesters, and boranophosphates with normal 3'-5' linkages, their 2'→5' linked analogs, and those with reverse polarity where the internucleoside linkage is 3'→5' to 5'→3' or 2'→5' to 5'→2'. Multiple salts, mixed salts, and free acid forms are also included. Methods for the preparation of phosphorus-containing linkages are well known in the art and such methods can be used to prepare certain modified PKK dsRNA agents, certain modified PKK antisense polynucleotides and / or certain modified PKK sense polynucleotides of the invention.

[0062] Modified RNA backbones that do not contain phosphorus atoms include backbones that are composed of short alkyl or cycloalkyl internucleoside linkages, heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short heteroatom or heterocyclic internucleoside linkages, including morpholine linkages (some of which are formed in the sugar portion of the nucleoside), siloxane backbones, sulfide, sulfoxide and sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and backbones that contain mixed N, O, S and CH2 moieties. Methods for preparing modified RNA backbones that do not contain phosphorus atoms are routinely performed in the art, and such methods can be used to prepare certain modified PKK dsRNA agents, certain modified PKK antisense polynucleotides and / or certain modified PKK sense polynucleotides of the invention.

[0063] In some embodiments of the present invention, the RNA mimic is included in PKK dsRNA, PKK antisense polynucleotide and / or PKK sense polynucleotide, for example, but not limited to, the backbone, i.e., the sugar and internucleoside linkage of the nucleotide unit, is replaced with new groups. In such embodiments, the base unit is maintained to hybridize with the appropriate PKK nucleic acid targeting compound. Such oligomeric compounds, which are RNA mimics with good hybridization properties, are called peptide nucleic acids (PNAs). In PNA compounds, the sugar backbone of RNA is replaced by an amide-containing backbone, particularly an aminoethylglycine backbone. The nucleobases are retained and directly or indirectly linked to the aza nitrogen atom of the backbone amide portion. The preparation of RNA mimics is performed by methods routinely performed in the art, and such methods can be used to prepare the modified PKK dsRNA agents of the present invention.

[0064] In some embodiments of the present invention, the oligonucleotides include, among others, RNAs with phosphorothioate backbones and oligonucleotides with heteroatom backbones, such as -CH2-NH-CH2-, -CH2-N(CH3)-O-CH2- [referred to as methylene (methylimino) or MMI backbones], -CH2-ON(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2-, and -N(CH3)-CH2- [wherein the natural phosphodiester backbone is represented as -OPO-CH2-]. The preparation of RNAs with phosphorothioate backbones and oligonucleotides with heteroatom backbones is carried out by methods routine in the art, and such methods can be used to prepare certain modified PKK dsRNA agents, certain PKK antisense polynucleotides and / or certain PKK sense polynucleotides of the present invention.

[0065] The modified RNA may include one or more substituted sugar moieties. The PKK dsRNA, PKK antisense polynucleotide and / or PKK sense polynucleotide of the present invention may include at the 2' position one selected from the group consisting of OH; F; O-, S- or N-alkyl; O-, S- or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, where alkyl, alkenyl and alkynyl are substituted or unsubstituted C1-C 10 Alkyl or C2-C 10 Alkenyl and alkynyl are also possible. Some exemplary suitable modifications include O[(CH2) n O]mCH3, O(CH2) n OCH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2 and O(CH2) n ON [(CH2) n In some other embodiments, the dsRNA includes at the 2' position, C1 to C 10lower alkyl, substituted lower alkyl, alkylaryl, aralkyl, O-alkylaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleaving groups, reporting groups, intercalators, groups for improving the pharmacokinetic properties of a PKK dsRNA agent, or groups for improving the therapeutic properties of a PKK dsRNA agent, PKK antisense polynucleotide and / or PKK sense polynucleotide, and other substituents with similar properties. In some embodiments, the modification includes 2'-methoxyethoxy (also called 2'-O-CH2CHOCH3, 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504), i.e., an alkoxy-alkoxy group. Another exemplary modification is 2'-dimethylaminooxyethoxy (i.e., O(CH2)2ON(CH3)2, also called 2'-DMAOE), and 2'-dimethylaminoethoxyethoxy (also called in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE, i.e., 2'-O-CH2-O-CH2-N(CH2)2), as described in the Examples below. Methods for preparing modified RNAs (such as those described above) are routine in the art, and such methods can be used to prepare certain modified PKK dsRNA agents of the invention.

[0066] Some other modifications include 2'-methoxy (2'-OCH3), 2'-aminopropoxy (2'-OCH2CH2CH2NH2), 2'-fluoro (2'-F). Similar modifications may be made at other positions on the RNA of a PKK dsRNA agent, PKK antisense polynucleotide and / or PKK sense polynucleotide of the invention, particularly the 3' position of the sugar on the 3' terminal nucleotide or in a PKK dsRNA, PKK antisense polynucleotide or PKK sense polynucleotide in a 2'-5' linkage, and the 5' position of the 5' terminal nucleotide. A PKK dsRNA agent, PKK antisense polynucleotide and / or PKK sense polynucleotide may have a sugar mimic, such as, for example, a cyclobutyl moiety replacing the pentofuranosyl sugar. Methods for preparing modified RNA (e.g., as described above) are routinely performed in the art and can be used to prepare certain modified PKK dsRNA agents, PKK antisense polynucleotides and / or PKK sense polynucleotides of the invention.

[0067] In certain embodiments, a PKK dsRNA agent, a PKK antisense polynucleotide, and / or a PKK sense polynucleotide may include modifications or substitutions of nucleobases (commonly abbreviated in the art as "bases"). As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleic acid bases include, for example, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl derivatives and other alkyl derivatives of adenine and guanine, 2-propyl derivatives and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5- These include uracil (pseudouridine), 4-thiouracil, 8-halogenated, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halogenated, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and adenine, 8-azaguanine and adenine, 7-deazaguanine and adenine, and 3-deazaguanine and adenine.Nucleobases that may be included in certain embodiments of the PKK dsRNA agents of the present invention are well known in the art, see, e.g., Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. Ed. Wiley-VCH, 2008; The Concise Encyclopedia Of Polymer Science And Engineering, pp. 858-859, Kroschwitz, JL, Ed. John Wiley & Sons, 1990; English et al., Angewandte, International Edition, 1991, 30, 613; Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pp. 289-302, Crooke, ST and Lebleu, B., Ed., CRC Press, 1993. Methods for producing dsRNA, PKK antisense strand polynucleotides and / or PKK sense strand polynucleotides comprising nucleobase modifications and / or substitutions (e.g., as described herein) are routinely practiced in the art and can be used to produce certain modified PKK dsRNA agents, PKK sense polynucleotides and / or PKK antisense polynucleotides of the invention.

[0068] In some embodiments, the PKK dsRNA agents, PKK antisense polynucleotides and / or PKK sense polynucleotides of the invention comprise RNA modified to contain one or more locked nucleic acids (LNAs). A locked nucleic acid is a nucleotide having a modified ribose moiety that contains an additional bridge connecting the 2' and 4' carbons. Such structures are effective to "lock" the ribose into a 3'-endo structural conformation. Addition of a locked nucleic acid to the PKK dsRNA agent, PKK antisense polynucleotide and / or PKK sense polynucleotide of the present invention can improve stability in serum and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, O. R. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Methods for preparing dsRNA agents, PKK antisense polynucleotides and / or PKK sense polynucleotides containing locked nucleic acids are routinely performed in the art, and such methods can be used to prepare certain modified PKK dsRNA agents of the present invention.

[0069] In some embodiments, the PKK dsRNA compounds, sense polynucleotides and / or antisense polynucleotides of the present invention comprise at least one modified nucleotide, such as 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxyribonucleotides, 2',3'-seconucleotide mimics, locked nucleotides, 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, and 3'-OMe nucleotides, 5'-phosphorothioate group-containing nucleotides, or terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecylamide groups, 2'-amino modified nucleotides, phosphoramidites, or non-natural base-containing nucleotides. In some embodiments, the PKK dsRNA compounds comprise E-vinyl phosphonate nucleotides at the 5' end of the antisense strand, also referred to herein as the guide strand.

[0070] In some embodiments, the PKK dsRNA compounds of the present invention include at least one modified nucleotide, such as, for example, an abasic nucleotide, ribitol, an inverted nucleotide, an inverted abasic nucleotide, an inverted 2'-ome nucleotide, or an inverted 2'-deoxyribonucleotide, at the 3' and 5' ends of the sense polynucleotide and / or the 3' end of the antisense polynucleotide. As known to those skilled in the art, the inclusion of an abasic or inverted abasic nucleotide at the end of an oligonucleotide enhances stability (Czauderna et al. Nucleic Acids Res. 2003;31(11):2705-2716. doi:10.1093 / nar / gkg393).

[0071] In some embodiments, the PKK dsRNA compounds, antisense polynucleotides of the present invention contain at least one modified nucleotide, e.g., an unlocked nucleic acid nucleotide (UNA) and / or a glycol nucleic acid nucleotide (GNA). UNA and GNA are thermally labile chemical modifications known to those skilled in the art that can significantly improve the off-target profile of siRNA compounds (Janas, et al. Nat Commun. 2018;9(1):723.doi:10.1038 / s41467-018-02989-4; Laursen et al., Mol BioSyst. 2010;6:862-70).

[0072] In some embodiments, the RNA of the PKK dsRNA agent, PKK antisense polynucleotide, and / or PKK sense polynucleotide of the present invention may include other modifications. Such other modifications include chemically binding one or more ligands, moieties, or conjugates to the RNA that enhance one or more characteristics of the PKK dsRNA agent, PKK antisense polynucleotide, and / or PKK sense polynucleotide, respectively. Some non-limiting examples of characteristics that can be enhanced are the activity of the PKK dsRNA agent, PKK antisense polynucleotide, and / or PKK sense polynucleotide; cellular distribution; delivery of the PKK dsRNA agent; pharmacokinetic properties of the PKK dsRNA agent; and cellular uptake of the PKK dsRNA agent. In some embodiments of the present invention, the PKK dsRNA agent includes one or more targeting or linking groups that are conjugated to the sense strand in the PKK dsRNA agent of the present invention in some embodiments. A non-limiting example of a targeting group is a compound containing N-acetylgalactosamine (GalNAc). The terms "targeting group", "targeting agent", "linking agent", "targeting compound" and "targeting ligand" can be used interchangeably herein. In some embodiments of the invention, the PKK dsRNA agent comprises a targeting compound conjugated to the 5' end of the sense strand. In some embodiments of the invention, the PKK dsRNA agent comprises a targeting compound conjugated to the 3' end of the sense strand. In some embodiments of the invention, the PKK dsRNA agent comprises a targeting group containing GalNAc. In some embodiments of the invention, the PKK dsRNA agent does not comprise a targeting compound conjugated to one or both of the 3' and 5' ends of the sense strand. In some embodiments of the invention, the PKK dsRNA agent does not comprise a targeting compound conjugated to one or both of the 5' and 3' ends of the sense strand.

[0073] For example, targeting agents and linkers that can be used in certain embodiments of the invention include, for example, lipid moieties, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86:6553-6556), thioethers, such as cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), beryl-S-tritylthiol (Manoharan et al., Ann. N. Acad. Sci., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids, 1997, 1:131-132), and the like, although other targeting agents and linkers are known herein. Res., 1992,20:533-538), aliphatic chains such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991,10:1111-1118; Kabanov et al., FEBS Lett., 1990,259:327-330; Svinarchuk et al., Biochimie, 1993,75:49-54), di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995,36:3651-3654; Shea et al., Nucl. Acids, 1997,10:1111-1118), Res., 1990, 18:3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), palmityl moieties (Mishra et al., Biochim. Biophys.Acta, 1995, 1264:229-237), or octadecylamine or hexylamino-carbonyloxycholesterol moieties (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923-937).

[0074] In some embodiments, compositions comprising a PKK dsRNA agent, a PKK antisense polynucleotide, and / or a PKK sense polynucleotide can include a ligand that alters the distribution, targeting, etc., of the PKK dsRNA agent. In some embodiments, compositions comprising a PKK dsRNA agent of the invention include a ligand that enhances affinity for a selected target (e.g., a molecule, a cell or cell type, a cell or organ compartment, a tissue, an organ, or a region of the body), e.g., compared to not having such a ligand. Ligands that can be used in the compositions and / or methods of the invention can be naturally occurring substances such as proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulins), carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid), or lipids. Ligands can be recombinant molecules or synthetic molecules, such as synthetic polymers, e.g., synthetic polyamino acids or polyamines. Some examples of polyamino acids are polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolic acid) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, or polyphosphazine. Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, polyamine dendrimer, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary ammonium salt of polyamine, α-helical peptide, etc.

[0075] The ligands included in the compositions and / or methods of the present invention may include targeting groups, some non-limiting examples of which are cell or tissue targeting agents, such as lectins, glycoproteins, lipids or proteins, such as antibodies that bind to specific cell types (e.g., kidney cells or liver cells). The targeting group may be thyroid stimulating hormone, melanotropin, lectins, glycoproteins, surfactant protein A, mucin carbohydrates, polyvalent lactose, polyvalent galactose, N-acetylgalactosamine, N-acetyl-glucosamine, polyvalent mannose, polyvalent fucose, glycosylated polyamino acids, polyvalent galactose, transferrin, bisphosphonates, polyglutamic acid, polyaspartic acid, lipids, cholesterol, steroids, bile acids, folic acid, vitamin B12, vitamin A, biotin, or RGD peptides or RGD peptide mimetics.

[0076] Some other examples of ligands include dyes, intercalators (e.g., acridine), crosslinkers (e.g., psoralen, mitomycin C), porphyrins (TPPC 4, texaphyrin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g., EDTA), lipophilic molecules (e.g., cholesterol, cholic acid, adamantane acetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl, hexadecylglycerol, borneol, menthol, 1,3-propylene glycol, heptadecyl groups, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., antennapedia peptides). peptide), Tat peptide), alkylating agents, phosphate / phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g., biotin), transport / absorption enhancers (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bizimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ conjugates of macrocyclic tetraaza compounds), dinitrophenyl, HRP, or AP.

[0077] The ligand included in the compositions and / or methods of the invention may be a protein (e.g., a glycoprotein), a peptide (e.g., a molecule with a specific affinity for a co-ligand), or an antibody (e.g., an antibody that binds to a specific cell type, including but not limited to hepatocytes). In one embodiment, the ligand used in the compositions and / or methods of the invention may be a hormone or a hormone receptor. In one embodiment, the ligand used in the compositions and / or methods of the invention may be a lipid, a lectin, a carbohydrate, a vitamin, a cofactor, multivalent lactose, multivalent galactose, N-acetylgalactosamine, N-acetyl-glucosamine, multivalent mannose, or multivalent fucose. In one embodiment, the ligand used in the compositions and / or methods of the invention may be an agent that can improve uptake of a PKK dsRNA agent into a cell by disrupting the cytoskeleton in the cell, for example, by disrupting microtubules, microfilaments, and / or intermediate filaments in the cell. Some non-limiting examples of such agents include paclitaxel (taxon), vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, and myoservin.

[0078] In some embodiments, the ligand linked to the PKK dsRNA agent of the present invention functions as a pharmacokinetic (PK) modulator. Examples of PK modulators that can be used in the compositions and methods of the present invention include, but are not limited to, lipophiles, bile acids, steroids, phospholipid analogs, peptides, protein linking agents, PEG, vitamins, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkyl glycerides, diacyl glycerides, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin, serum protein binding aptamers, and the like. In addition, as the ligand in the compositions and / or methods of the present invention, oligonucleotides containing many phosphorothioate bonds in the backbone, for example oligonucleotides of about 5 bases, 10 bases, 15 bases, or 20 bases, may be used, since it is known that oligonucleotides containing many phosphorothioate bonds also bind to serum proteins. PKK dsRNA agent compositions

[0079] In some embodiments of the invention, the PKK dsRNA agent is present in a composition. The composition of the invention may include one or more PKK dsRNA agents and one or more selected from the group consisting of any pharma- ceutically acceptable carrier, delivery agent, targeting agent, detectable marker, and the like. According to some embodiments of the method of the invention, a non-limiting example of a targeting agent that can be used is an agent that directs the PKK dsRNA agent of the invention to and / or within a treated cell. The targeting agent is selected based on factors such as the nature of the PKK-related disease or disorder and the type of cell to be targeted. In some non-limiting examples of some embodiments of the invention, it is desirable to target the PKK dsRNA agent to and / or within a liver cell, pancreatic cell, kidney cell, testicular cell, stomach cell, or lung cell. It will be understood that in some embodiments of the method of the invention, the therapeutic agent includes a PKK dsRNA agent that does not have any additional linking elements other than the delivery agent (e.g., a delivery agent that includes N-acetylgalactosamine (Gal NAc)). For example, in some embodiments of the invention, the PKK dsRNA agent is linked to a delivery compound that includes GalNAc, is included in a composition that includes a pharma- ceutically acceptable carrier, and is administered to a cell or subject without the use of any detectable label, targeting agent, or the like, linked to the PKK dsRNA agent.

[0080] When the PKK dsRNA agent of the present invention is administered and / or linked with one or more selected from the group consisting of a delivery agent, a targeting agent, a labeling agent, etc., the skilled artisan will know how to appropriately select and use the agent applicable to the method of the present invention. The labeling agent can be used in some methods of the present invention to determine the location of the PKK dsRNA agent in cells and tissues, and can be used to determine the location of the therapeutic composition containing the PKK dsRNA agent administered in the method of the present invention in cells, tissues or organs. Methods for linking and using labeling agents, such as enzyme labels, dyes, radioactive labels, etc., are known in the art. It will be understood that in some embodiments of the compositions and methods of the present invention, the labeling agent is linked to one or both of the sense and antisense polynucleotides contained in the PKK dsRNA agent. Delivery of PKK dsRNA agents

[0081] Some embodiments of the method of the present invention include delivering a PKK dsRNA agent to a cell. As used herein, the term "delivery" means to promote or affect uptake or absorption into a cell. Absorption or uptake of the PKK dsRNA agent can occur by independent diffusion or active cellular processes, or by using a delivery agent, targeting agent, etc. that can be combined with the PKK dsRNA agent of the present invention. Delivery means suitable for the method of the present invention include, but are not limited to, in vivo delivery, in which the PKK dsRNA agent is injected or systemically administered at a tissue site. In some embodiments of the present invention, the PKK dsRNA agent is linked to a delivery agent.

[0082] Some non-limiting examples of methods for delivering PKK dsRNA agents to cells, tissues and / or subjects include PKK dsRNA-GalNAc conjugates, PKK dsRNA-GalNAc drug conjugates, SAMiRNA technology, LNP-based delivery methods and naked RNA delivery. These and other delivery methods have been used in the art to deliver therapeutic RNAi agents for treating multiple diseases and disorders, such as, but not limited to, liver disease, acute intermittent porphyria (AIP), hemophilia, pulmonary fibrosis, etc. For details of some delivery means, see, e.g., Nikam, RRKR Good (2018) Nucleic Acid Ther, 28(4), 209-224 Aug 2018; Springer ADSFDowdy (2018) Nucleic Acid Ther. Jun 1, 28(3):109-118; Lee, K. et al., (2018) Arch Pharm, 41(9), 867-874; and Nair, JK et al., (2014) J. Am. Chem. Soc. 136:16958-16961, the contents of each of which are incorporated herein by reference.

[0083] In some embodiments of the invention, the PKK dsRNA agent of the invention comprises being delivered to a cell, tissue and / or subject using lipid nanoparticles (LNPs). LNPs are typically used to deliver PKK dsRNA agents, including therapeutic PKK dsRNA agents, in vivo. One advantage of using LNPs or other delivery agents is that the stability of the PKK RNA agent is improved when it is delivered to a subject using LNPs or other delivery agents. In some embodiments of the invention, the LNPs comprise cationic LNPs carrying one or more PKK RNAi molecules of the invention. When the LNPs containing the PKK RNAi molecules are administered to a subject, and the LNPs and the associated PKK RNAi molecules are taken up into the cell by endocytosis and present therein, the RNAi trigger molecule that mediates RNAi is released.

[0084] In an embodiment of the present invention, another non-limiting example of a delivery agent that can be used to deliver the PKK dsRNA agent of the present invention to a cell, tissue, and / or subject is an agent that comprises GalNAc linked to the PKK dsRNA agent of the present invention and delivers the PKK dsRNA agent to a cell, tissue, and / or subject. Some examples of other GalNAc-containing delivery agents that can be used in some embodiments of the methods and compositions of the present invention are disclosed in PCT WO 2020191183A1 (incorporated herein in its entirety). Non-limiting examples of GalNAc targeting ligands for delivering PKK dsRNA agents to cells that can be applied to the compositions and methods of the present invention include targeting ligand clusters. Some examples of targeting ligand clusters described herein are referred to as GalNAc ligands with phosphodiester linkages (GLO) and GalNAc ligands with phosphorothioate linkages (GLS). The term "GLX-0" as used herein refers to a GalNAc ligand that can be any of the disclosed GLS and GLO delivery compounds that can be linked to the 3' end of an oligonucleotide during synthesis. For example, but not limited to, GLX-13 and GLX-14 can be linked to the 3' end of an oligonucleotide during synthesis. Exemplary GalNAc delivery compounds are referred to herein as compounds GLS-1, GLS-2, GLS-3, GLS-4, GLS-5, GLS-6, GLS-7, GLS-8, GLS-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16. The structures of each of the above compounds are shown below with the linkage between the GalNAc targeting ligand and the RNAi agent of the invention at the right-most position ("GLO-16"). TIFF2025508324000048.tif42). In some embodiments, GLX-0 is a GalNAc ligand that can be linked to the 3' end of an oligonucleotide. It will be understood that any of the RNAi and dsRNA molecules of the present invention can be linked to the structures of GLS-1, GLS-2, GLS-3, GLS-4, GLS-5, GLS-6, GLS-7, GLS-8, GLS-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, GLO-1 through GLO-16 and GLS-1 through GLS-16. [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] .

[0085] In some embodiments of the present invention, delivery in the body can be achieved by a β-glucan delivery system, for example, as described in U.S. Patent Nos. 5,032,401 and 5,607,677, and U.S. Publication No. 2005 / 0281781, which are incorporated herein by reference in their entirety. The PKK RNAi agent can also be introduced into cells in vitro using methods known in the art, such as, for example, electroporation or lipid transfection. In some embodiments of the methods of the present invention, the PKK dsRNA is delivered without a targeting agent. These RNAs can be delivered as naked RNA molecules. As a non-limiting example, the PKK dsRNA of the present invention is administered to a subject in a pharmaceutical composition that includes an RNAi agent but does not include a targeting agent (e.g., a GalNAc targeting compound) to treat a PKK-related disease or disorder in the subject, such as hereditary angioedema, angioedema, hypertension, nephropathy, vascular disease, cardiovascular disease, thrombosis, inflammation, etc.

[0086] It will be understood that the examples of RNAi delivery means described herein are not limited to the several delivery means described herein, as well as delivery means used in the art, can be used in combination with the PKK RNAi agents and treatment methods described in the embodiments herein.

[0087] The PKK dsRNA agent of the present invention can be administered to a subject in an amount and form effective to reduce the level and activity of PKK polypeptide in a cell and / or a subject. The term "activity" of PKK as used herein refers to the activity of the product of PKK cleavage occurring in a cell and a subject. It is known in the art that PKK is cleaved by FXIIa to produce a-kallikrein, an active protease involved in subsequent biological activities. Thus, the "activity of PKK polypeptide" as used herein in a cell refers to the activity of the product of a-kallikrein cleavage of PKK polypeptide. In some embodiments of the method of the present invention, one or more PKK dsRNA agents are administered to a cell and / or a subject to treat a disease or disorder associated with PKK expression and activity. In some embodiments, the method of the present invention includes administering one or more independently selected PKK dsRNA agents to a subject in need of such treatment to reduce a disease or disorder associated with PKK expression in the subject. The PKK dsRNA agents or PKK antisense polynucleotide agents of the invention are also administered to reduce PKK expression and / or activity in one or more in vitro, ex vivo, and in vivo cells.

[0088] In some embodiments of the present invention, the delivery (e.g., incorporation) of a PKK dsRNA agent into a cell reduces the level of PKK polypeptide in the cell, and thus reduces its activity. Targeting agents and methods can be used to assist in delivering a PKK dsRNA agent to a specific cell type, cell subtype, organ, spatial region in a subject, and / or subcellular region in a cell. A PKK dsRNA agent can be administered alone or in combination with one or more additional PKK dsRNA agents in some methods of the present invention. In some embodiments, two, three, or four or more independently selected PKK dsRNA agents are administered to a subject. In some embodiments of the compositions and methods of the present invention, two or three or more independently selected therapeutic molecules are included. In some embodiments of the methods of the present invention, two, three, or four or more PKK siRNAs that target one or two or more different locations / regions of KLKB1 mRNA are administered to a cell and / or subject. In such cases, the compositions of the invention can comprise two, three, four or more independently selected PKK siRNAs, each conjugated to an independently selected delivery compound. Certain embodiments of the agents and / or compositions of the invention include bivalent siRNA compounds (also referred to herein as linked siRNA compounds), which comprise two independently selected PKK siRNAs conjugated to the same delivery compound.

[0089] In some embodiments of the present invention, the PKK dsRNA agent is administered to a subject in combination with one or more additional therapeutic schemes for treating a PKK-related disease or disorder. Such a combination may produce a synergistic effect. Some non-limiting examples of additional therapeutic schemes are administration of one or more PKK antisense polynucleotides of the present invention, administration of a non-PKK dsRNA therapeutic agent, and behavior modification. The additional therapeutic schemes can be administered at one or more times before, simultaneously, or after administration of the PKK dsRNA agent of the present invention. As used herein, "simultaneous" administration refers to within 5 minutes of time zero, within 10 minutes of time zero, within 30 minutes of time zero, within 45 minutes of time zero, and within 60 minutes of time zero. It should be understood that "time zero" refers to the time when the PKK dsRNA agent of the present invention is administered to the subject.

[0090] In a non-limiting example, in some embodiments of the present invention, the additional therapeutic scheme administered to the subject includes one or more selected from the group consisting of one or more PKK antisense polynucleotides, one or more additional PKK dsRNA therapeutics, one or more non-PKK dsRNA and / or siRNA therapeutics, and behavioral modification. Non-limiting examples of non-PKK dsRNA therapeutic schemes include plasma kallikrein inhibitors (ecallantide (also known by the trade name Kalbitor®) and berotralstat (by the trade name Orladeyo®). TMOther treatment options include chemotherapy, chemotherapy alone or in combination with chemotherapy alone ... 6(1):23-30(2010)) and / or treatments to the subject. Some non-limiting examples of behavioral modification are meal plans, rest plans, exercise plans, and counseling. These and other therapeutic agents and behavioral modifications are known in the art and can be used to treat PKK diseases or disorders in a subject, and can be administered to a subject in combination with administration of one or more PKK dsRNA agents of the invention to treat PKK diseases or disorders. The PKK dsRNA agents of the invention administered to a cell or subject to treat a PKK-related disease or disorder can act synergistically with one or more other therapeutic agents or activities to improve the effectiveness of one or more therapeutic agents or active agents and / or improve the effectiveness of the PKK dsRNA agent in treating a PKK-related disease or disorder.

[0091] The therapeutic methods of the invention comprising administering a PKK dsRNA can be used in asymptomatic subjects with a PKK-related disease or disorder and / or when one or more PKK-related diseases or disorders are present, at early, middle, late stages of the disease or disorder, and at any time before or after any of these stages. The methods of the invention can also be used to treat subjects who have previously been treated for a PKK-related disease or disorder with one or more other therapeutic agents and / or therapeutic activities, but have not been successful in treating the PKK-related disease or disorder in the subject, and have experienced minimal success and / or failure. Vectors encoding dsRNA

[0092] In some embodiments of the invention, the PKK dsRNA agent can be delivered to cells using a vector. The PKK dsRNA agent transcription unit can be included in a DNA or RNA vector. The creation and use of vectors encoding transgenes to deliver sequences to cells and / or subjects is known in the art. In the methods of the invention, the use of vectors can result in transient expression of PKK dsRNA for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more hours, or 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more weeks. The length of transient expression can be determined using routine methods based on factors such as, but not limited to, the particular vector construct selected and the target cell and / or tissue. Such transgenes can be introduced as linear constructs, circular plasmids, or viral vectors, and can be integrative or non-integrative vectors. Transgenes can also be constructed so that they are inherited as extrachromosomal plasmid genes (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).

[0093] The single or multiple strands of the PKK dsRNA agent can be transcribed from a promoter on an expression vector. If two independent strands are to be expressed, for example to produce dsRNA, two independent expression vectors can be introduced together into a cell, such as by transfection or infection. In some embodiments, each independent strand of a PKK dsRNA agent of the invention can be transcribed by two promoters contained in the same expression vector. In some embodiments of the invention, the PKK dsRNA agent is expressed as an inverted repeat polynucleotide linked by a linker polynucleotide sequence, such that the PKK dsRNA agent has a stem and loop structure.

[0094] Some non-limiting examples of RNA expression vectors are DNA plasmids or viral vectors.The expression vectors used in the embodiments of the present invention are compatible with eukaryotic cells.Eukaryotic cell expression vectors are widely used in the art and can be obtained from many commercial sources.The delivery of PKK dsRNA expression vectors can be systemic, for example, by intravenous or intramuscular administration, by administration to target cells explanted from a subject, by introduction into the subject, or by any other means that allows integration into desired target cells.

[0095] Viral vector systems that may be included in the methods of the present invention include, but are not limited to, (a) adenovirus vectors, (b) retrovirus vectors, including, but not limited to, lentivirus vectors, Moloney murine leukemia virus, (c) adeno-associated virus vectors, (d) herpes simplex virus vectors, (e) SV 40 vectors, (f) polyoma virus vectors, (g) papilloma virus vectors, (h) picornavirus vectors, (i) poxvirus vectors, such as orthopox, e.g., vaccinia virus vectors, or avipox, e.g., canarypox or fowlpox, and (j) auxiliary-dependent or gutless adenoviruses. Constructs for recombinantly expressing PKK dsRNA agents may include regulatory elements, e.g., promoters, enhancers, etc., selected to provide constitutive or regulated / inducible expression. The use of promoters and enhancers, etc., as well as viral vector systems, are well known in the art and may be used in conjunction with the methods and compositions described herein.

[0096] In some embodiments of the present invention, the use of viral vectors is included for delivering PKK dsRNA agents to cells.Many adenovirus-based delivery systems are commonly used in the art, for example, for delivery to lung, liver, central nervous system, endothelial cells and muscle.Some non-limiting examples of viral vectors that can be used in the method of the present invention include AAV vectors, poxviruses such as vaccinia virus, modified vaccinia virus Ankara (MVA), NYVAC, and bird pox such as fowlpox or canarypox.

[0097] Some embodiments of the present invention include the method of using vector to deliver PKK dsRNA agent to cell.Such vector can be in a pharmaceutically acceptable carrier, which may or may not include the slow release matrix in which gene delivery vector is incorporated.In some embodiments, the vector for delivering PKK dsRNA can be produced from recombinant cell, and the pharmaceutical composition of the present invention can include one or more cells producing PKK dsRNA delivery system. Pharmaceutical compositions containing PKK dsRNA

[0098] Some embodiments of the present invention include the use of pharmaceutical compositions comprising PKK dsRNA agents and pharma- ceutical acceptable vectors. Pharmaceutical compositions comprising PKK dsRNA agents can be used in the methods of the present invention to reduce PKK gene expression and serum PKK activity, and are useful for treating PKK-related diseases or disorders. Such pharmaceutical compositions can be prepared based on the delivery mode. Non-limiting examples of formulations for delivery modes include compositions prepared for subcutaneous delivery, compositions prepared for systemic administration by parenteral delivery, compositions prepared for intravenous delivery (IV), compositions prepared for intrathecal delivery, compositions prepared for direct delivery to the brain, and the like. To deliver PKK dsRNA agents into cells, pharmaceutical compositions of the present invention can be administered using one or more of the following means: topical (e.g., transdermal patch); pulmonary (e.g., inhalation or blowing of powder or aerosol agent by nebulizer); intratracheal; intranasal; epidermal and transdermal; oral or parenteral. Parenteral administration includes, for example, intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subcutaneous (by an implanted device), or intracranial (intraparenchymal, intrathecal or intraventricular administration) means. The PKK dsRNA agent can also be delivered directly to a target tissue, for example, the liver or kidney. It will be understood that "delivery of a PKK dsRNA agent" to a cell includes directly delivering a PKK dsRNA agent or a PKK antisense polynucleotide agent, respectively, causing the cell to express a PKK dsRNA agent from a coding vector delivered to the cell, or any suitable means of causing the PKK dsRNA to appear in the cell. The preparation and use of agents and means for delivering inhibitory RNA are known and commonly used in the art.

[0099] As used herein, a "pharmaceutical composition" comprises a pharmacologically effective amount of the PKK dsRNA agent of the present invention and a pharma- ceutically acceptable vector. The term "pharmaceutically acceptable carrier" refers to a carrier for administering a therapeutic agent. Such carriers include, but are not limited to, saline, buffered saline, glucose, water, glycerin, ethanol, and combinations thereof. However, the term specifically does not include cell culture media. In some embodiments, pharma- ceutically acceptable carriers include, but are not limited to, pharma- ceutical acceptable excipients, such as inert diluents, disintegrants, adhesives, lubricants, sweeteners, flavorings, colorings, and preservatives. Suitable inert diluents include sodium carbonate, calcium carbonate, sodium phosphate, calcium phosphate, and lactose, although cornstarch and alginic acid are also suitable disintegrants. Adhesives may include starch and gelatin. Lubricants (when present) can usually be magnesium stearate, stearic acid, or talc. If necessary, the tablets can be coated with a material such as glyceryl monostearate or glyceryl distearate, to delay absorption in the gastrointestinal tract.The drugs contained in the pharmaceutical formulation are further described below.

[0100] As used herein, for example, the terms "pharmacologically effective amount", "therapeutically effective amount" and "effective amount" refer to the amount of desired pharmacological, therapeutic or preventive results of the PKK dsRNA agent of the present invention. For example, a clinical treatment performed is considered to be effective when a measurable parameter related to a disease or disorder is reduced by at least 10%. A therapeutically effective amount of a drug for treating the disease or disorder is the amount required to reduce the parameter by at least 10%. For example, a therapeutically effective amount of a PKK dsRNA agent can reduce the level of a PKK polypeptide by at least 10%. Evaluating the effectiveness of compounds and compositions that inhibit PKK expression

[0101] Many art-known methods can be used to determine the presence, absence, and / or level of PKK expression in cells, tissues, and / or subjects before and / or after contact / administration of the PKK inhibitor of the present invention. In some aspects of the present invention, such determination is performed on total RNA obtained from a cell, a plurality of cells, and / or a biological sample obtained from a subject, or on poly(A)+mRNA obtained from a cell, a plurality of cells, and / or a biological sample obtained from a subject. In some embodiments of the method of the present invention, cells and / or biological samples obtained from a subject can be analyzed to determine the amount or level of nucleic acid molecules encoding PKK using means known in the art, including one or more of polymerase chain reaction (PCR), Northern blotting analysis, and quantitative real-time PCR. RNA analysis can be performed on total cellular RNA or poly(A)+mRNA.

[0102] In some embodiments of the methods of the invention, the effectiveness of the inhibition of PKK expression in a cell and / or subject by a dsRNA agent of the invention is evaluated and determined by means known in the art, the presence or absence and / or level of one or more of a PKK polypeptide or its downstream protein products. For example, but not limited to, the effectiveness of the reduction of PKK expression / activity by a dsRNA agent of the invention can be evaluated by determining the presence or absence and / or level of one or more of plasma PKK levels, plasma kallikrein levels, and plasma bradykinin production levels. The presence or absence and / or level of PKK polypeptide activity can be determined (also referred to herein as "measured") in a cell, a plurality of cells, and / or a biological sample obtained from a subject before and / or after administration of a dsRNA agent of the invention to a cell and / or subject. PKK expression in cells, tissues and / or subjects can be determined using many methods known in the art, including, but not limited to, immunoprecipitation, Western blotting, immunoblotting, enzyme-linked immunosorbent assay (ELISA), protein quantitative measurement, protein activity measurement (e.g., caspase activity measurement), immunohistochemistry, immunocytochemistry or fluorescence activated cell sorting (FACS). Antibodies against the target can be identified and obtained commercially or prepared using general monoclonal or polyclonal antibody generation methods known in the art. Effective dose

[0103] In some aspects, the method of the invention includes contacting a cell with an effective amount of a PKK dsRNA agent to reduce expression of the PKK gene in the contacted cell. Some embodiments of the method of the invention include administering an effective amount of a PKK dsRNA agent or a PKK antisense polynucleotide agent to a subject to reduce expression of the PKK gene and treat a PKK-related disease or disorder in the subject. An "effective amount" used to reduce expression of PKK and / or treat a PKK-related disease or disorder is an amount necessary or sufficient to achieve a desired biological effect. For example, an effective amount of a PKK dsRNA agent to treat a PKK-related disease or disorder may be an amount necessary (i) to reduce or stop the progression of the disease or disorder, or (ii) to reverse, reduce or eliminate one or more symptoms of the disease or disorder. In some aspects of the invention, an effective amount is an amount of a PKK dsRNA agent that, when administered to a subject in need of treatment for a PKK-related disease or disorder, results in a therapeutic response for the prevention and / or treatment of the disease or disorder. According to some aspects of the present invention, an effective amount is an amount of the PKK dsRNA agent of the present invention that, when combined or co-administered with an additional treatment for a PKK-related disease or disorder, results in a therapeutic response that prevents and / or treats the disease or disorder. In some embodiments of the present invention, the biological effect of treating a subject with a PKK dsRNA agent of the present invention may be that symptoms caused by a PKK-related disease or disorder are improved and / or completely eliminated. In some embodiments of the present invention, the biological effect is that the PKK-related disease or disorder is completely eliminated, for example, as evidenced by a diagnostic test that shows that the subject is free of a PKK-related disease or disorder. To determine the effect of the agent and / or method of the present invention on a PKK-related disease or disorder, other means known in the art for evaluating the status of a PKK-related disease or disorder can be used.

[0104] Typically, the effective amount of a PKK dsRNA agent to reduce PKK polypeptide activity to a level that treats a PKK-related disease or disorder is determined in a clinical trial, thereby establishing the effective dose for subjects versus controls in a blinded study. In some embodiments, the effective amount is an amount that produces a desired response, for example, an amount that alleviates a PKK-related disease or disorder in cells, tissues, and / or subjects with the disease or disorder. Thus, an effective amount of a PKK dsRNA agent to treat a PKK-related disease or disorder that can be treated by reducing PKK polypeptide activity can be an amount that, when administered, reduces the amount of PKK polypeptide activity in a subject to the amount of PKK polypeptide activity present in a cell, tissue, blood, plasma, and / or subject in the absence of administration of a PKK dsRNA agent or a PKK antisense polynucleotide agent. In one embodiment of the present invention, the level of PKK polypeptide activity and / or PKK gene expression present in a cell, tissue, and / or subject that has not been contacted with or administered a PKK dsRNA agent according to the present invention is referred to as a "control" amount. In some embodiments of the method of the present invention, the control amount of the subject is the amount before the subject is treated, in other words, the level in the subject before administering the PKK agent may be the control level of the subject, and is compared with the level of PKK polypeptide activity and / or PKK gene expression in the subject after administering the siRNA to the subject.When treating a PKK-related disease or disorder, the expected response may be a reduction or elimination of one or more symptoms of the disease or disorder in a cell, tissue, and / or subject.The reduction or elimination may be temporary or permanent.

[0105] It will be appreciated that the status of a PKK-associated disease or disorder can be monitored using methods to determine the activity of a PKK polypeptide, expression of a PKK gene, symptom assessment, clinical testing, and the like. In some embodiments of the invention, the expected response to treating a PKK-associated disease or disorder is to delay or prevent the onset of the disease or disorder. In some embodiments of the invention, the expected response to treating a PKK-associated disease or disorder is to reduce the frequency and / or severity with which symptoms of the associated disease or disorder occur.

[0106] The effective amount of a compound that reduces PKK polypeptide activity can also be determined by assessing the physiological effect of administration of the PKK dsRNA agent to a cell or subject, that is, the reduction of a PKK-related disease or disorder after administration. The effectiveness of the PKK dsRNA agent of the present invention can be determined by measuring and / or monitoring symptoms of the subject, which can be used with the pharmaceutical compound of the present invention to determine whether or not there is a response to treatment. As a non-limiting example, one or more tests of PKK mRNA transcript levels known in the art can be used to determine the status of a PKK-related disease or disorder in a subject before and after treatment of the subject with a PKK dsRNA agent of the present invention. In this example, the disease includes PKK mRNA transcript levels, and further tests are used to determine the PKK mRNA transcript levels in a subject before and after treatment of the subject with a PKK dsRNA agent of the present invention. As another non-limiting example, one or more tests of plasma PKK and / or plasma kallikrein levels known in the art can be used to determine the status of a PKK-related disease or disorder in a subject before and after treatment of the subject with a PKK dsRNA agent of the present invention. In this example, the disease comprises plasma PKK and / or plasma kallikrein levels, and the tests are used to determine plasma PKK and / or plasma kallikrein levels in the subject before and after treatment of the subject with the PKK dsRNA agent of the present invention. In another non-limiting example, one or more tests of contact activation known in the art are used to determine the PKK-related disease status in the subject. In this example, the disease comprises levels of contact activation, and the tests are used to determine contact activation levels in the subject before and after treatment of the subject with the PKK dsRNA agent of the present invention. In another non-limiting example, one or more coagulation tests known in the art are used to determine the PKK-related disease status in the subject. In this example, the disease comprises levels of coagulation, and the tests are used to determine coagulation levels in the subject before and after treatment of the subject with the PKK dsRNA agent of the present invention. In yet another non-limiting example, one or more tests of plasma bradykinin (BK) generating capacity known in the art are used to determine the PKK-related disease status in the subject.In this example, the disease comprises plasma bradykinin levels, and the test is used to determine plasma bradykinin levels in the subject before and after treatment of the subject with the PKK dsRNA agent of the present invention. In yet another non-limiting example, one or more tests of factor XIIa (FXIIa) activity known in the art are used to determine the PKK-related disease status in the subject. In this example, the disease comprises plasma factor XII (FXII) and FXIIa levels, and the test is used to determine plasma FXII and FXIIa levels in the subject before and after treatment of the subject with the PKK dsRNA agent of the present invention. In yet another non-limiting example, one or more tests of activated partial thromboplastin time (aPTT) known in the art are used to determine the PKK-related disease status in the subject. In this example, the disease comprises the length of time to clot formation in the subject, and the test is used to determine the length of time to clot formation in the subject before and after treatment of the subject with the PKK dsRNA agent of the present invention.

[0107] Other means of determining the effectiveness of the dsRNA agent of the invention in reducing PKK activity in a cell or subject can include one or more art-known means of assessing and / or identifying one or more physiological characteristics of a PKK-related disease or disorder in a cell and / or subject, respectively. Non-limiting examples of specific physiological characteristics and symptoms that can be assessed to determine the effectiveness of the dsRNA agent of the invention in a cell and / or subject include swelling of the skin, swelling of the hands and feet, fatigue, headache, muscle pain, tingling skin, abdominal pain, nausea and vomiting, hoarseness, shortness of breath, mood changes, laryngeal edema, pain, fever, etc. in a subject. Routine methods for determining such physiological characteristics are known in the art and include, but are not limited to, blood tests, serum analysis, tissue biopsy, imaging analysis, physical examination, etc.

[0108] It will be understood that the amount of PKK dsRNA agent administered to a subject may be modified at least in part based on the determined disease and / or disorder status and / or physiological characteristics of the subject. The amount of treatment may be varied, for example, by increasing or decreasing the amount of PKK-dsRNA agent or PKK antisense polynucleotide agent, changing the composition of the separately administered PKK dsRNA agent or PKK antisense polynucleotide agent, changing the route of administration, or changing the time of administration. The effective amount of the PKK dsRNA agent will vary depending on the particular disorder being treated, the age and physical condition of the subject being treated, the severity of the disorder, the duration of treatment, the nature of any concurrent treatments, the specific route of administration, and other factors of the physician's knowledge and professional health care. For example, the effective amount will depend on the expected level of PKK polypeptide activity and / or PKK gene expression that will effectively treat the PKK-related disease or disorder. The effective amount of a particular PKK dsRNA agent of the invention used in the methods of the invention can be empirically determined by one of ordinary skill in the art without undue experimentation. With reference to the teachings provided herein, one can select from a number of PKK dsRNA agents or PKK antisense polynucleotide agents of the present invention, and design an effective prophylactic or therapeutic regimen for treating a particular subject by considering factors such as, for example, efficacy, relative bioavailability, patient weight, severity of adverse side effects, and preferred mode of administration.As used in the embodiments of the present invention, an effective amount of the PKK dsRNA agent of the present invention can be an amount that produces a desired biological effect in a cell when contacted with the cell.

[0109] It will be understood that PKK gene silencing can be determined by any suitable measurement in any cell expressing PKK constitutively or modified by genome engineering. In some embodiments of the present invention, administration of the PKK dsRNA agent of the present invention reduces the expression of the PKK gene by at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100%. In some embodiments of the present invention, administration of the PKK dsRNA agent of the present invention reduces the expression of the PKK gene by 5%-10%, 5%-25%, 10%-50%, 10%-75%, 25%-75%, 25%-100% or 50%-100%. dose

[0110] The PKK dsRNA agent and the PKK antisense polynucleotide agent are delivered in the pharmaceutical composition in a dosage sufficient to inhibit expression of the PKK gene. In some embodiments of the invention, the dosage of the PKK dsRNA agent is 0.01-200.0 mg / kg of subject body weight per day, typically 1-50 mg / kg body weight, 5-40 mg / kg body weight, 10-30 mg / kg body weight, 1-20 mg / kg body weight, 1-10 mg / kg body weight, 4-15 mg / kg body weight per day, inclusive of endpoints. For example, the PKK dsRNA agents are 0.01mg / kg, 0.05mg / kg, 0.1mg / kg, 0.2mg / kg, 0.3mg / kg, 0.4mg / kg, 0.5mg / kg, 1mg / kg, 1.1mg / kg, 1.2mg / kg kg, 1.3mg / kg, 1.4mg / kg, 1.5mg / kg, 1.6mg / kg, 1.7mg / kg, 1.8mg / kg, 1.9mg / kg, 2mg / kg, 2.1mg / kg, 2.2mg / kg, 2.3m g / kg, 2.4mg / kg, 2.5mg / kg, 2.6mg / kg, 2.7mg / kg, 2.8mg / kg, 2.9mg / kg, 3.0mg / kg, 3.1mg / kg, 3.2mg / kg, 3.3mg / kg, 3.4mg / kg, 3.5mg / kg, 3.6mg / kg, 3.7mg / kg, 3.8mg / kg, 3.9mg / kg, 4mg / kg, 4.1mg / kg, 4.2mg / kg, 4.3mg / kg, 4.4mg / kg , 4.5mg / kg, 4.6mg / kg, 4.7mg / kg, 4.8mg / kg, 4.9mg / kg, 5mg / kg, 5.1mg / kg, 5.2mg / kg, 5.3mg / kg, 5.4mg / kg, 5.5mg / kg, 5.6mg / kg, 5.7mg / kg, 5.8mg / kg, 5.9mg / kg, 6mg / kg, 6.1mg / kg, 6.2mg / kg, 6.3mg / kg, 6.4mg / kg, 6.5mg / kg, 6.6mg / kg, 6.7mg / kg, 6.8mg / kg, 6.9mg / kg, 7mg / kg, 7.1mg / kg, 7.2mg / kg, 7.3mg / kg, 7.4mg / kg, 7.5mg / kg, 7.6mg / kg, 7.7mg / kg, 7.8mg / kg, 7.9mg / kg, 8mg / kg, 8.1mg / kg, 8.2mg / kg, 8.3mg / kg, 8.4mg / kg, 8.5mg / kg, 8.6mg / kg, 8.7mg / kg, 8.8mg / kg, 8.9mg / kg, 9mg / kg, 9.1mg / kg, 9.2mg / kg, 9.3mg / kg, 9.4mg / kg, 9.5mg / kg, 9.6mg / kg, 9.7mg / kg, 9.8mg / kg, 9.9mg / kg, 10mg / k g, 11mg / kg, 12mg / kg, 13mg / kg, 14mg / kg, 15mg / kg, 16mg / kg, 17mg / kg, 18mg / kg, 19mg / kg, 20mg / kg, 21mg / kg, 22mg / kg, 23mg / kg, 24mg / kg 25mg / kg, 26mg / kg, 27mg / kg, 28mg / kg, 29mg / kg, 30mg / kg, 31mg / kg, 32mg / kg, 33mg / kg, 34mg / kg, 35mg / kg, 36mg / kg, 37mg / kg, 38mg / kg, 39mg / kg, 40mg / kg, 41mg / kg, 42mg / kg, 43mg / kg, 44mg / kg, 45mg / kg, 46mg / kg, 47mg / kg, 48mg / kg, 49mg / kg to 50mg / kg body weight administered as a single dose.

[0111] When determining the dose and delivery time of the PKK dsRNA agent of the present invention, several factors are considered.The absolute amount of the PKK dsRNA agent delivered depends on several factors, including concurrent treatment, number of doses, and individual parameters, including age, physical condition, body type and weight.These are factors known to those skilled in the art and can be obtained by carrying out routine experimentation.In some embodiments, the maximum dose can be used, which is the maximum safe dose based on sound medical judgment.

[0112] In some embodiments, the method of the invention may include administering 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more doses of a PKK dsRNA agent or a PKK antisense polynucleotide agent to the subject. In some cases, the subject may be administered a pharmaceutical compound (e.g., including a PKK dsRNA agent or a PKK antisense polynucleotide agent) at least daily, every other day, weekly, every other week, monthly, etc. The pharmaceutical compound may be administered once a day or more than once a day, for example, two, three, four, five or more doses within a 24-hour period. The pharmaceutical composition of the invention may be administered once a day, or the PKK dsRNA agent may be administered as two or three or more divided doses at appropriate intervals throughout the day, or delivery by continuous infusion or controlled release formulation may be used. In some embodiments of the method of the invention, the pharmaceutical composition of the invention is administered to the subject at least once a day, at least once a week, at least once a month, or at least once a year.

[0113] In some embodiments, the method of the present invention includes a drug compound that may be administered alone or in combination with one or more other PKK dsRNA agents or PKK antisense polynucleotide agents, or / and in combination with other drug treatments or therapeutic activities or schemes administered to a subject with a PKK-related disease or disorder. The drug compound may be administered as a pharmaceutical composition. The pharmaceutical composition used in the method of the present invention may be sterile and may include an amount of a PKK dsRNA agent that reduces the activity of a PKK polypeptide to a level sufficient to produce a desired response in a weight or volume unit suitable for administration to a subject. The dose of a pharmaceutical composition containing a PKK dsRNA agent that reduces PKK protein activity administered to a subject may be selected according to different parameters, particularly the mode of administration used and the condition of the subject. Other factors include the desired treatment time. If the subject responds inadequately to the initial dose administered, a higher dose (or an effectively higher dose by a different, more localized delivery route) may be employed, to the extent that the patient tolerates it. treatment

[0114] PKK-associated diseases and disorders, in which the reduction of the level and / or activity of a PKK polypeptide effectively treats the disease or disorder, can be treated by using the methods and PKK dsRNA agents of the present invention to inhibit PKK expression. Examples of diseases and disorders that can be treated by the PKK dsRNA agents of the present invention and the treatment methods of the present invention include, but are not limited to, hereditary angioedema, angioedema, hypertension, nephropathy, vascular disease, cardiovascular disease, thrombosis, and inflammation. Such diseases and disorders may be referred to herein as "PKK-associated diseases and disorders" and "diseases and disorders caused and / or regulated by PKK."

[0115] In some embodiments of the present invention, the PKK dsRNA agent of the present invention can be administered to the subject at one or more times before or after the diagnosis of PKK-related disease or disorder.In some embodiments of the present invention, the subject is at risk of suffering from or developing PKK-related disease or disorder.The subject at risk of developing PKK-related disease or disorder is the subject that is more likely to develop PKK-related disease or disorder than the control risk of developing PKK-related disease or disorder.In some embodiments of the present invention, the risk level can be statistically significant compared with the control risk level. Non-limiting examples of at-risk subjects include: (1) subjects who have had a pre-existing disease and / or condition, such as, but not limited to, a B-cell lymphoproliferative disorder or an autoimmune disease and a neoplastic disease, and therefore are more susceptible to developing an acquired angioedema (AAE) disease or disorder than a control subject without a pre-existing disease or condition; (2) subjects who are at risk of suffering from or developing hereditary angioedema (e.g., following treatment with an angiotensin-converting enzyme (ACE) inhibitor); (3) subjects who have a personal history of a PKK-related disease or disorder; and (4) subjects who have been treated for a PKK-related disease or disorder. It will be understood that the pre-existing disease and / or condition that makes a subject more susceptible to a PKK-related disease or disorder may be a disease and / or condition previously identified as being associated with a higher likelihood of developing a PKK-related disease or disorder when present.

[0116] It will be understood that the PKK dsRNA agent can be administered to a subject depending on the medical condition of the individual subject. For example, the health care provided to the subject can assess the PKK transcript level, plasma PKK level, plasma kallikrein level, and / or plasma bradykinin production level in a sample obtained from the subject, and determine that there is a desire to reduce the subject's PKK level by administering a PKK dsRNA agent of the present invention. In this example, the PKK transcript, plasma PKK, plasma kallikrein, and plasma bradykinin production levels may be considered non-limiting physiological characteristics of a PKK-associated disorder, even if the subject is not diagnosed as suffering from a PKK-associated disease as disclosed herein. The health care provider can monitor the change in the subject's PKK level as the dose of efficacy of the administered PKK dsRNA agent of the present invention. In a non-limiting example, a biological sample, such as a blood or serum sample, can be collected from the subject, and the subject's PKK level can be determined in the sample. If the presence of plasma PKK level in subject is found, administer PKK dsRNA agent to subject, collect subsequent blood or serum samples from subject after administration, and measure plasma PKK level, and compare the result with the result determined from the sample of said subject before administration (previously).Compared to the level before administration, the reduction of subject's plasma PKK level in subsequent samples indicates the effectiveness of PKK dsRNA agent in reducing subject's plasma PKK level.

[0117] Some embodiments of the methods of the invention include a regulatory treatment that includes administering a dsRNA agent or PKK antisense polynucleotide agent of the invention to a subject based at least in part on an assessment of a change in one or more physiological characteristics of the subject's PKK-related disease or disorder due to the treatment. For example, in some embodiments of the invention, determining the effect of an administered dsRNA agent of the invention on a subject is used to help regulate the amount of a dsRNA agent of the invention subsequently administered to the subject. In a non-limiting example, after administering a dsRNA agent of the invention to a subject, the presence and / or level of plasma kallikrein is measured in a biological sample obtained from the subject, and based at least in part on the determined level, it is determined that a greater amount of the dsRNA agent is desirable, thereby improving the physiological effect of the administered agent, e.g., reducing or further reducing the presence and / or level of plasma kallikrein. In another non-limiting example, after administering a dsRNA agent of the invention to a subject, the bradykinin activation level of the subject is determined, and based at least in part on the determined bradykinin activation level, it is desirable to administer a lesser amount, a greater amount, or the same amount of the dsRNA agent to the subject.

[0118] Thus, some embodiments of the present invention include evaluating changes in one or more physiological characteristics of a subject due to previous treatment in order to adjust the amount of the dsRNA agent of the present invention to be administered to the subject later.Some embodiments of the method of the present invention include measuring the physiological characteristics of a PKK-related disease or disorder one, two, three, four, five, six or more times to evaluate and / or monitor the effectiveness of the administered PKK dsRNA agent of the present invention, and optionally use the results of said determination to adjust one or more of the dose, administration scheme, and / or administration frequency of the dsRNA agent of the present invention to treat the PKK-related disease or disorder in the subject.In some embodiments of the method of the present invention, the desired result of administering an effective amount of the dsRNA agent of the present invention to the subject is a reduction in one or more of PKK transcript levels, plasma PKK levels, plasma kallikrein levels, plasma kallikrein activation levels, bradykinin production rate, FXII to FXIIa conversion rate, and angioedema attack rate, indicating a reduction in PKK gene expression in the subject.

[0119] In some embodiments of the method of the present invention, the desired result of administering an effective amount of the PKK dsRNA agent or PKK antisense polynucleotide agent of the present invention to a subject suffering from angioedema and / or hereditary angioedema may be one or more of the following: reduced mortality, reduced severity and frequency of angioedema, reduced pain, reduced swelling, reduced number of hospital visits, reduced length of hospital stay, and improved quality of life, compared to these characteristics in subjects who did not use the treatment / therapeutic agent or composition of the present invention.In some embodiments of the method of the present invention, the desired result of administering an effective amount of the PKK dsRNA agent or PKK antisense polynucleotide agent of the present invention to a subject suffering from thrombosis may be one or more of the following: reduced thrombus, eradication of one or more thrombus, and reduced severity and frequency of thrombus formation. In some embodiments of the method of the present invention, the desired results of administering an effective amount of the PKK dsRNA agent or PKK antisense polynucleotide agent of the present invention to a subject suffering from hypertension include, but are not limited to, lowering hypertension compared to the level of hypertension in a control subject (non-limiting examples of which are subjects who are not administered the effective amount).In some embodiments of the method of the present invention, the desired results of administering an effective amount of the PKK dsRNA agent or PKK antisense polynucleotide agent of the present invention to a subject suffering from nephropathy include, but are not limited to, improved blood pressure control, reduced protein in urine, reduced swelling of the feet, ankles, hands or eyes, reduced need to urinate, reduced confusion or difficulty concentrating, reduced shortness of breath, and reduced loss of appetite compared to these characteristics in a control subject (non-limiting examples of which are subjects who are not administered the effective amount).In some embodiments of the methods of the invention, the desired results of administering an effective amount of a PKK dsRNA agent or PKK antisense polynucleotide agent of the invention to a subject suffering from a vascular disease include, but are not limited to, a reduction in the presence and / or number of thrombi, a reduction in the incidence and / or severity of stroke, aneurysm, lymphedema, varicose veins, peripheral arterial disease, intestinal ischemia syndrome, renal artery disease, Raynaud's phenomenon, carotid artery disease, and a reduction in vascular occlusion, compared to these features in control subjects (non-limiting examples of which are subjects to which an effective amount is not administered). In some embodiments of the methods of the invention, the desired results of administering an effective amount of a PKK dsRNA agent or PKK antisense polynucleotide agent of the invention to a subject suffering from inflammation include, but are not limited to, a reduction in the incidence and / or severity of inflammation, compared to inflammation in control subjects (non-limiting examples of which are subjects to which an effective amount is not administered).

[0120] According to the PKK RNAi described herein, the expression of PKK protein can be inhibited. In some embodiments of the present invention, the expression of PKK in cells or subjects is reduced to treat diseases or disorders associated with PKK expression in cells or subjects, respectively. Non-limiting examples of diseases and disorders that can be treated by reducing PKK activity include hereditary angioedema, angioedema, hypertension, nephropathy, vascular disease, cardiovascular disease, thrombosis, inflammation, and / or other diseases in which reducing the level and activity of PKK protein is medically beneficial for the subject. Compared to baseline pre-treatment physiological characteristics of PKK-related disease or disorder and / or control physiological characteristics of PKK-related disease or disorder, the subject shows a reduction in PKK gene expression.

[0121] As used herein, the terms "treatment", "treated" or "treating", when used in reference to a PKK-related disease or disorder, may refer to prophylactic treatment to reduce the likelihood of a PKK-related disease or disorder occurring in a subject, or may refer to treatment to eliminate or reduce the frequency and / or severity of a PKK-related disease or disorder after the PKK-related disease or disorder has progressed in a subject. In some embodiments, the treatment of the invention is used to prevent a PKK-related disease or disorder from progressing to a later stage (e.g., more severe) and / or to alleviate the progression of a PKK-related disease or disorder in a subject, as compared to a control subject (which may, in some cases, be a subject who has not been treated to reduce activity of a PKK polypeptide in the subject).

[0122] In some embodiments, the agents, compositions and methods of the present invention can be used to inhibit the expression of the PKK gene. As used herein, the terms "inhibition," "silencing," "reduction," "downregulation," and "knockdown" with respect to expression of the PKK gene refer to a reduction in expression of the PKK gene, as measured, for example, by one or more of the levels of RNA transcribed from the gene, the activity level of expressed PKK, the levels of PKK polypeptides, proteins, or protein subunits translated from mRNA in a cell, cell group, tissue, organ, or subject that transcribes the PKK gene, when the cell, cell group, tissue, body fluid, organ, or subject is contacted with (e.g., treated with) a PKK dsRNA agent of the present invention, compared to a control level of RNA transcribed from the PKK gene, the activity level of expressed PKK, or the PKK translated from mRNA. In some embodiments, the control level is a level in a cell, tissue, organ, or subject that is not contacted with (e.g., treated with) a PKK dsRNA agent or a PKK antisense polynucleotide agent. Method of administration

[0123] Multiple routes of administration of the PKK dsRNA agent can be used in the methods of the invention. The particular delivery mode selected will depend at least in part on the particular disorder being treated and the dosage required for therapeutic efficacy. In general, the methods of the invention can be practiced using any medically acceptable mode of administration, meaning one that produces effective levels to treat PKK-related diseases or disorders and does not cause clinically unacceptable adverse effects. In some embodiments of the invention, the PKK dsRNA agent can be administered via oral, enteral, mucosal, transdermal and / or parenteral routes. The term "parenteral" includes subcutaneous, intravenous, intrathecal, intramuscular, intraperitoneal and intrasternal injection or infusion means. Other routes include, but are not limited to, intranasal (e.g., gastric nasogastric tube), transdermal, vaginal, rectal, sublingual and inhalation. Delivery routes of the invention may include intrasthecal, intracardiac or intracranial. In some embodiments of the invention, the PKK dsRNA agent can be administered by placing it in a slowly releasing matrix and placing the matrix in a subject. In some aspects of the invention, the PKK dsRNA agent can be delivered to a subject cell using nanoparticles coated with a delivery agent that targets a particular cell or organelle. Multiple delivery means, methods, and agents are known in the art. Some non-limiting examples of delivery methods and delivery agents are provided elsewhere herein. In some aspects of the invention, the term "delivery" with respect to a PKK dsRNA agent refers to administering one or more "naked" PKK dsRNA agent sequences to a cell or subject. In some embodiments of the invention, "delivery" refers to administering to a cell or subject by transfection means, delivering to a subject a cell that contains a PKK dsRNA agent, delivering to a cell and / or subject a vector that encodes a PKK dsRNA agent, and the like. Delivering a PKK dsRNA agent by transfection can include administering to a cell and / or subject a vector.

[0124] In some methods of the invention, one or more PKK dsRNA agents or PKK antisense polynucleotide agents can be used in a pharmaceutical that may be administered as a pharma- ceutically acceptable solution that may contain pharma- ceutically acceptable concentrations of salts, buffers, preservatives, compatible vectors, auxiliary agents, and any other therapeutic ingredients. In some embodiments of the invention, the PKK dsRNA agent can be prepared with other therapeutic agents for simultaneous administration. According to the methods of the invention, the PKK dsRNA agent can be used in a pharmaceutical composition. Typically, the pharmaceutical composition includes the PKK dsRNA agent and any pharma- ceutically acceptable vector. Pharmaceutically acceptable vectors are known to those skilled in the art. As used herein, a pharma- ceutically acceptable vector refers to a non-toxic material that does not affect the biological effectiveness of the active ingredient (e.g., the ability of the PKK dsRNA agent to inhibit PKK gene expression in a cell or subject). Many methods for administering and delivering dsRNA agents or PKK antisense polynucleotide agents used in therapeutic applications are known in the art and can be used in the methods of the invention.

[0125] Pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials known in the art. Exemplary pharma-ceutically acceptable carriers are described in U.S. Pat. No. 5,211,657 and are known to those skilled in the art. Such formulations may typically include salts, buffers, preservatives, compatible carriers, and any other therapeutic agents. The salts are pharma-ceutically acceptable when used in medicine, but pharma-ceutically unacceptable salts are not excluded from the scope of the present invention, since they may be conveniently used in the preparation of pharma-ceutically acceptable salts. Such pharmacologically and pharma-ceutically acceptable salts include, but are not limited to, those prepared from acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, formic acid, malonic acid, succinic acid, and the like. Pharmaceutically acceptable salts may also be prepared as alkali metal or alkaline earth metal salts, for example, sodium salts, potassium salts, or calcium salts.

[0126] Some embodiments of the method of the present invention include administering one or more PKK dsRNA agents or PKK antisense polynucleotide agents directly to a tissue. In some embodiments, the tissue to which the compound is administered is a tissue in which a PKK-related disease or disorder exists or can occur, such as, by way of non-limiting example, the liver or kidney. Direct administration to a tissue can be achieved by direct injection or other methods. Many orally administered compounds naturally reach and pass through the liver and kidney. Additionally, some embodiments of the therapeutic method of the present invention include orally administering one or more PKK dsRNA agents to a subject. The PKK dsRNA agents or PKK antisense polynucleotide agents, alone or in combination with other therapeutic agents, can be administered once or multiple times. When administered multiple times, the PKK dsRNA agents can be administered by different routes. For example, but not limited to, the first (or initial multiple) administration can be administered subcutaneously, and one or more additional administrations can be administered orally and / or systemically.

[0127] In some embodiments of the invention where it is desired to administer the PKK dsRNA agent systemically, the PKK dsRNA agent may be prepared for parenteral administration by injection (e.g., push injection or continuous infusion). The formulation for injection is in a unit dosage form, such as, for example, an ampule or a multi-dose container, with or without the addition of a preservative. The formulation of the PKK dsRNA agent (also called a pharmaceutical composition) can take the form of a suspension, solution or emulsion in an oily or aqueous vehicle, and can include compounding agents such as suspending agents, stabilizing agents and / or dispersing agents.

[0128] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils (e.g., olive oil), and injectable organic esters (e.g., ethyl oleate). Aqueous carriers include water, alcoholic / aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (e.g., glucose replenishers based on Ringer's glucose), and the like. Other additives may also be added, such as preservatives, antibacterial agents, antioxidants, chelating agents, inert gases, and the like. Other forms of administration, such as intravenous administration, have relatively low doses. If the subject responds inadequately to the initial dose administered, higher doses (or more effectively higher doses through a different, more localized delivery route) can be employed, to the extent that the patient tolerates them. If necessary, multiple doses per day can be used to achieve appropriate systemic or local levels of one or more PKK dsRNA agents or PKK antisense polynucleotide agents and to achieve an appropriate reduction in PKK protein activity.

[0129] In some further embodiments, the methods of the invention include using a delivery vehicle suitable for implantation into a subject (e.g., a subject), such as a biocompatible microparticle, nanoparticle, or implant. An exemplary biodegradable implant for use in accordance with the methods is described in PCT Publication No. WO 95 / 24929 (herein incorporated by reference), which describes a biocompatible, biodegradable polymeric matrix for containing biopolymers.

[0130] In the methods of the invention, both non-biodegradable and biodegradable polymer matrices can be used to deliver one or more PKK dsRNA agents or PKK antisense polynucleotide agents to a subject. In some embodiments, the matrix can be biodegradable. The matrix polymer can be a natural or synthetic polymer. The polymer can be selected based on the desired release time, which is usually about a few hours to a year or more. Typically, release occurs within a period of a few hours to 3-12 months. The polymer can be in the form of a hydrogel that absorbs up to about 90% of its weight in water and can be optionally crosslinked with multivalent ions or other polymers.

[0131] Generally, in some embodiments of the present invention, PKK dsRNA agents or PKK antisense polynucleotide agents can be delivered using biodegradable implants by diffusion or degradation of polymer matrix.Exemplary synthetic polymers used for such applications are known in the art.Biodegradable and non-biodegradable polymers can be used to deliver PKK dsRNA agents or PKK antisense polynucleotide agents using methods known in the art.Biodegradable adhesive polymers, such as biodegradable hydrogels (see H.S.Sawhney, C.P.Pathak and J.A.Hubell in Macromolecules, 1993, 26, 581-587, the teachings of which are incorporated herein by reference), can be used to deliver PKK dsRNA agents or PKK antisense polynucleotide agents to treat PKK-related diseases or disorders.Other suitable delivery systems include time-release, delayed release, or sustained release delivery systems. Such a system can avoid duplicate administration of PKK dsRNA agents or PKK antisense polynucleotide agents, improving the convenience of subjects and medical and health care professionals. Several types of release delivery systems are available and known to those skilled in the art. (See, e.g., U.S. Patents 5,075,109; 4,452,775; 4,675,189; 5,736,152; 3,854,480; 5,133,974; and 5,407,686, the teachings of each of which are incorporated herein by reference). In addition, pump-based hardware delivery systems may be used. Among these, some are suitable for implantation.

[0132] The use of long-term sustained release implant can be applied to preventive treatment of subjects and subjects at risk of developing recurrent PKK-related disease or disorder.Long-term sustained release as used herein means that implant is constructed and arranged to deliver therapeutic levels of PKK dsRNA agent within at least 10 days, 20 days, 30 days, 60 days, 90 days, 6 months, or 1 year or more.Long-term sustained release implant is well known to those skilled in the art and includes some of the release systems mentioned above.

[0133] Therapeutic formulations of PKK dsRNA agents or PKK antisense polynucleotide agents can be prepared and stored as lyophilized formulations or aqueous solutions by mixing the molecule or compound having the desired purity with any pharma- ceutically acceptable carrier, excipient, or stabilizer [Remington's Pharmaceutical Sciences, 21st ed. (2006)]. Acceptable carriers, excipients, or stabilizers include those that are non-toxic to subjects at the doses and concentrations used, such as buffers, such as phosphates, citrates, and other organic acids; antioxidants, including ascorbic acid and methionine; preservatives (e.g., octadecyldimethylbenzylammonium chloride; hexamethylamine chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl alcohol, or benzyl alcohol; alkyl parabens, such as methylparaben or propylparaben; catechol; resorcinol; cyclohexanol; 3-pentanol, and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine or lysine; monosaccharides, disaccharides and other carbohydrates such as glucose, mannose, dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt forming counterions such as sodium; metal complexes (e.g. Zn-protein complexes); and / or non-ionic surfactants such as TWEEN, PLURONICS® or polyethylene glycol (PEG). Cells, Subjects and Controls

[0134] The methods of the invention can be used in conjunction with cells, tissues, organs, and / or subjects. In some embodiments of the invention, the subject is a human or a vertebrate mammal, including but not limited to primates such as dogs, cats, horses, cows, sheep, mice, rats, and monkeys. Thus, the invention can be used to treat PKK-related diseases or disorders in human and non-human subjects. In some embodiments of the invention, the subject may be a farm animal, a zoo animal, a domestic animal, or a non-domestic animal, and the methods of the invention can be used for veterinary prophylaxis and treatment. In some embodiments of the invention, the subject is a human, and the methods of the invention can be used for human prophylactic and therapeutic regimens.

[0135] Some non-limiting examples of subjects to which the present invention can be applied are subjects diagnosed as suffering from, suspected of suffering from, or at risk of suffering from a disease or disorder associated with higher than desired PKK expression and / or activity (also referred to as "elevated PKK expression levels"). Non-limiting examples of diseases and disorders associated with higher than desired levels of PKK expression and / or activity are described elsewhere herein. The method of the present invention can be applied to subjects diagnosed as suffering from a disease or disorder associated with higher than desired PKK expression and / or activity upon treatment, or subjects believed to suffer from or at risk of developing a disease or disorder associated with higher than desired PKK expression and / or activity. In some embodiments of the present invention, the disease or disorder associated with higher than desired levels of PKK expression and / or activity is an acute disease or disorder. Also, in some embodiments of the present invention, the disease or disorder associated with higher than desired levels of PKK expression and / or activity is a chronic disease or condition.

[0136] In a non-limiting example, the PKK dsRNA agent of the present invention is administered to a subject diagnosed with, suspected of, or at risk of hereditary angioedema, angioedema, hypertension, nephropathy, vascular disease, cardiovascular disease, thrombosis, and / or inflammation, which are associated diseases or disorders that are desirable to reduce PKK expression.The method of the present invention can be applied to subjects diagnosed with a disease or disorder or subjects considered to be at risk of developing a disease or disorder at the time of treatment.

[0137] In another non-limiting example, the PKK dsRNA agent of the present invention is administered to a subject diagnosed with, suspected of, or at risk of hereditary angioedema, angioedema, hypertension, nephropathy, vascular disease, cardiovascular disease, thrombosis, and / or inflammation, which are associated diseases or disorders that are desirable to reduce PKK expression.The method of the present invention can be applied to subjects diagnosed with disease or disorder or subjects considered to be at risk of developing disease or disorder at the time of treatment.

[0138] Cells applicable to the methods of the invention include in vitro, in vivo, and ex vivo cells. The cells can be in a subject, in culture and / or in suspension, or in any other suitable state or condition. Cells applicable to the methods of the invention may be liver cells, hepatocytes, cardiomyocytes, pancreatic cells, cardiovascular cells, renal cells, or other types of vertebrate cells, including human and non-human mammalian cells. In some embodiments of the invention, cells applicable to the methods of the invention are healthy cells that are known not to be diseased cells. In some embodiments of the invention, cells applied to the methods and compositions of the invention are liver cells, hepatocytes, cardiomyocytes, retinal cells, vascular cells, pancreatic cells, cardiovascular cells, and / or renal cells. In some aspects of the invention, the control cells are normal cells, but it will be understood that in certain cases, diseased or disordered cells may be used as control cells, for example, to compare results in diseased or disordered treated cells and diseased or disordered untreated cells. Cells suitable for treatment with embodiments of the invention may be cells expressing the PKK gene, including cells containing an expression vector that includes the PKK gene or a portion of the PKK gene.

[0139] According to the method of the present invention, the level of PKK polypeptide activity can be determined and compared to a control level of PKK polypeptide activity. The control can be a predetermined value or can be in several forms. It can be a single cut-off value, such as a median or mean value. It can be constructed based on comparison groups, such as a group with a low level of PKK polypeptide and / or PKK polypeptide activity and a group with an elevated level of PKK polypeptide and / or PKK polypeptide activity. Other non-limiting examples of comparison groups can be groups suffering from or diagnosed with one or more symptoms of a disease or disorder associated with PKK; groups without or not diagnosed with one or more symptoms of the disease or disorder; subjects who have been administered the siRNA treatment of the present invention; subjects who have not been administered the siRNA treatment of the present invention. Typically, the control can be based on apparently healthy normal individuals or apparently healthy cells in the appropriate age group. It is to be understood that the control according to the present invention can be a sample of material tested in parallel to the experimental material in addition to a predetermined value. For example, it can be a sample from a control group or a control sample made in parallel to the experimental sample. In some embodiments of the invention, the control may be a cell or subject that is not contacted with or treated with a PKK dsRNA agent of the invention, in which case the control level of PKK polypeptide and / or PKK polypeptide activity can be compared to the level of PKK polypeptide and / or PKK polypeptide activity in a cell or subject that has been contacted with a PKK dsRNA agent of the invention.

[0140] In some embodiments of the present invention, the PKK polypeptide level determined for a subject may be a control level for comparison to PKK polypeptide levels determined for the same subject at different times. In a non-limiting example, the level of PKK is determined from a biological sample obtained from a subject who has not received the PKK treatment of the present invention. In some embodiments, the biological sample is a serum sample or a tissue sample. The level of PKK polypeptide determined from a sample obtained from a subject can be used as a baseline or control value for the subject. In the treatment method of the present invention, after one or more administrations of a PKK dsRNA agent to the subject, one or more additional serum samples can be obtained from the subject, and the level of PKK polypeptide in the subsequent sample or samples can be compared to the subject's control / baseline level. Such a comparison can be used to evaluate the onset, progression, or resolution of a PKK-related disease or disorder in a subject. For example, a level of PKK polypeptide in a baseline sample obtained from a subject that is higher than the level obtained from the same subject after administration of a PKK dsRNA agent of the present invention to the subject indicates regression of a PKK-related disease or disorder, and indicates that the administered PKK dsRNA agent of the present invention is effective in treating a PKK-related disease or disorder. In some embodiments, a statistically significant reduction in the level of PKK polypeptide in a sample obtained from the subject compared to the level measured in a sample previously obtained from the subject indicates regression of a PKK-associated disease or disorder.

[0141] In some embodiments of the invention, one or more values ​​of the level of PKK polypeptide and / or PKK polypeptide activity determined for a subject can be used as a control value to compare later levels of PKK polypeptide and / or PKK activity in the same subject, thus allowing for assessment of changes in "baseline" PKK polypeptide activity in the subject. Thus, an initial PKK polypeptide level and / or an initial PKK polypeptide activity level can be present in and / or determined in a subject, and the methods and compounds of the invention can be used to reduce the level of PKK polypeptide and / or PKK polypeptide activity in a subject, using the initial level as a control level for the subject.

[0142] The method of the present invention can be used to administer the PKK dsRNA agent of the present invention to a subject. The efficacy of administration and treatment of the present invention can be evaluated when the level of PKK polypeptide and / or PKK polypeptide activity in serum sample and / or tissue sample obtained from the subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% compared to the pre-administration level of PKK polypeptide and / or PKK polypeptide activity in serum sample and / or tissue sample obtained from the subject at a previous time point or the non-contact control level (e.g., the level of PKK polypeptide and / or PKK polypeptide activity in control serum sample). It will be understood that the level of PKK polypeptide, the activity level of PKK polypeptide, and other physiological characteristics described herein are all related to the expression level of PKK gene. Some embodiments of the methods of the invention include administering to a subject a PKK dsRNA of the invention in an amount effective to inhibit expression of the PKK gene, thereby reducing PKK polypeptide levels and / or PKK polypeptide activity levels in the subject.

[0143] Some embodiments of the present invention include determining the presence, absence, and / or amount (also referred to herein as level) of PKK polypeptide in one or more biological samples obtained from one or more subjects. This determination can be used to evaluate the effectiveness of the treatment method of the present invention. For example, the methods and compositions of the present invention can be used to determine the level of PKK polypeptide and / or PKK polypeptide activity in a biological sample obtained from a subject previously treated by administration of a PKK dsRNA agent of the present invention. The level of PKK polypeptide and / or PKK polypeptide activity measured in a biological sample obtained from a treated subject is indicative of a level of effectiveness of the treatment administered to the subject if it is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 99.9%, 99.99% or more compared to the pre-treatment level of PKK polypeptide and / or PKK polypeptide activity measured for the subject, or the level of a non-contacted control biological sample, respectively. In some embodiments of the methods of the invention, contacting a cell with an siRNA agent of the invention (also referred to herein as "treating") reduces or attenuates PKK gene expression in the cell by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 109%, 109%, 108%, 109%, 109 , 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or about 100% inhibition, e.g., below the level of detection of the measurement.

[0144] In some embodiments of the present invention, the physiological characteristics of PKK-related disease or disorder determined for a subject can be the control of the physiological characteristics determined for the same subject at different times for comparison.In a non-limiting example, physiological characteristics such as PKK transcript level, plasma PKK level, plasma kallikrein level, plasma kallikrein activity level, bradykinin production rate, and / or FXII to FXIIa conversion rate are measured in a biological sample obtained from a subject who has not been subjected to the PKK treatment of the present invention.The PKK transcript level, plasma PKK level, plasma kallikrein level, plasma kallikrein activity level, bradykinin production rate, and / or FXII to FXIIa conversion rate (and / or other physiological characteristics of PKK-related disease or disorder) measured in the sample obtained from the subject can serve as the baseline value or control value of the subject. After one or more administrations of a PKK dsRNA agent to a subject according to the therapeutic methods of the invention, one or more additional biological samples can be obtained from the subject, and the PKK transcript level, plasma PKK level, plasma kallikrein level, plasma kallikrein activity level, bradykinin production rate, and / or FXII to FXIIa conversion rate in the one or more samples are compared to a control / baseline and / or rate in the subject, respectively. Such comparisons can be used to assess the onset, progression, or resolution of a PKK-related disease or disorder in the subject. For example, a PKK transcript level, plasma PKK level, plasma kallikrein level, plasma kallikrein activity level, bradykinin production rate and / or FXII to FXIIa conversion rate in a baseline sample obtained from a subject that is higher than the PKK transcript level, plasma PKK level, plasma kallikrein level, plasma kallikrein activity level, bradykinin production rate and / or FXII to FXIIa conversion rate measured in a sample obtained from the same subject after administration of a PKK dsRNA agent of the invention to the subject indicates regression of a PKK-associated disease or disorder and indicates that the administered PKK dsRNA agent of the invention is effective in treating a PKK-associated disease or disorder.

[0145] In some embodiments of the present invention, the value of one or more physiological characteristics of a PKK-related disease or disorder determined for a subject may be used to compare a control value of the physiological characteristic later in the same subject, thus allowing for an assessment of changes in the "baseline" physiological characteristic in the subject. Thus, an initial physiological characteristic may be present in and / or determined in a subject, and the method and compound of the present invention may be used to reduce the level of PKK polypeptide and / or activity of PKK polypeptide in a subject, using the initial physiological characteristic determination as a control for the subject.

[0146] Using the method of the present invention, the PKK dsRNA agent of the present invention can be administered to a subject in an effective amount to treat PKK-related disease or disorder. The effectiveness of the administration and treatment of the present invention can be evaluated by measuring changes in one or more physiological characteristics of PKK-related disease or disorder. In a non-limiting example, the PKK transcript level, plasma PKK level, plasma kallikrein level, plasma kallikrein activity level, bradykinin production rate, and / or FXII to FXIIa conversion rate determined in a biological sample obtained from a subject treated by the method of the present invention is at least 0.5%, 1%, 5%, 10%, 20% 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 99.9%, 99.99% or 100% lower than the pre-administration level of the physiological characteristic in the biological sample obtained from the subject at the time point before treatment, or the physiological characteristic determined in a non-contact control, indicating the effectiveness of the treatment administered to the subject. In another non-limiting example, the efficacy of the treatment administered to the subject is indicated if the angioedema attack rate determined in the subject treated by the method of the present invention is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 99.9%, 99.99% or 100% compared to the pre-treatment angioedema attack rate in the subject in the pre-treatment period or the determined physiological characteristics in uncontacted controls. It will be understood that the determination of the physiological characteristics of the PKK-associated disease or disorder described herein correlates with the level of PKK gene expression. Some embodiments of the methods of the invention include administering to a subject a PKK dsRNA agent of the invention in an amount effective to inhibit PKK gene expression thereby reducing PKK transcript levels, plasma PKK levels, plasma kallikrein levels, plasma kallikrein activity levels, bradykinin production rate, FXII to FXIIa conversion rate, and / or angioedema attack rate, or otherwise positively affecting physiological characteristics of a PKK-related disease or disorder in a subject.

[0147] In some embodiments of the present invention, determining the presence or absence and / or changes in physiological characteristics of a PKK-related disease or disorder, for example, by using, but not limited to, (1) evaluating physiological characteristics of one or more biological samples obtained from one or more subjects; (2) taking a cell and / or tissue biopsy from the subject (e.g., but not limited to, a liver biopsy); (3) taking a serum sample from the subject; (4) taking a blood sample from the subject; or (5) physical examination of the subject, can be used. Such determinations can be used to evaluate the effectiveness of the treatment methods of the present invention. kit

[0148] Kits are also included within the scope of the present invention and include one or more PKK dsRNA agents and instructions for use in the methods of the present invention. Kits of the present invention can include one or more selected from the group consisting of PKK dsRNA agents, PKK sense polynucleotides, and PKK antisense polynucleotide agents that can be used to treat PKK-related diseases or disorders. Kits including one or more PKK dsRNA agents, PKK sense polynucleotides, and PKK antisense polynucleotides can be made for use in the therapeutic methods of the present invention. The components of the kits of the present invention can be packaged in aqueous media or in lyophilized form. Kits of the present invention can include a carrier compartmentalized to receive one or more container means or a series of container means, such as test tubes, vials, flasks, bottles, syringes, etc., in a sealed manner therein. The first container device or series of container devices can include one or more compounds, such as a PKK dsRNA agent and / or a PKK sense or antisense polynucleotide agent. The second container device or series of container devices may contain a targeting agent, labeling agent, delivery agent, etc., which may be included as part of the PKK dsRNA agent administered in one embodiment of the therapeutic method of the invention.

[0149] The kits of the invention may also include instructions, typically in written form, that provide guidance for carrying out treatment with the kit and for making decisions based thereon.

[0150] The following examples are provided to illustrate the present invention and are not intended to limit the scope of the present invention. As will be apparent to those skilled in the art, the present invention may be applied in a variety of compositions and methods. EXAMPLES

[0151] Example 1 Synthesis of PKK RNAi Agents The PKK RNAi agent duplexes shown in Tables 2-3 above were synthesized according to the following general procedure. Sense and antisense sequences of siRNA were synthesized on an oligonucleotide synthesizer using a well-established solid-phase synthesis method based on phosphoramidite chemistry. Oligonucleotide chain elongation was achieved through a four-step cycle of deprotection, coupling, capping, and oxidation or sulfurization to add each nucleotide. Synthesis was performed on a solid-phase support made of controlled pore glass (CPG, 500 or 1000A). The phosphoramidites to be used as monolayers were obtained commercially. Phosphoramidites bearing GalNAc ligand clusters (GLPA1 and GLPA2 as non-limiting examples) were synthesized according to the procedures of Examples 2-3 herein. siRNAs used for in vitro screening (Table 2) were synthesized at 20 nmol. siRNAs used for in vivo testing (Table 3) were synthesized at a scale of 1 μmol or more. When a GalNAc ligand (GLO-0 as a non-limiting example) was linked to the 3'-end of the sense strand, a CPG solid support with a GalNAc ligand linked thereto was used. When a GalNAc ligand (GLS-1 or GLS-2 as a non-limiting example) was linked to the 5'-end of the sense strand, a GalNAc phosphoramidite (GLPA1 or GLPA2 as a non-limiting example) was used for the final coupling reaction. 3% trichloroacetic acid (TCA) in dichloromethane was used to deprotect the 4,4'-dimethoxytrityl protecting group (DMT). 5-Ethylthio-1H-tetrazole was used as the activating agent. I2 in THF / Py / H2O and phenylacetodisulfide (PADS) in pyridine / MeCN were used for the oxidation and sulfurization reactions, respectively. After the final solid-phase synthesis step, the cyanoethyl protecting group was removed with 20% diethylamine in acetonitrile. The nucleobase protecting groups were removed and the solid support-bound oligomer was cleaved by treatment with 28% ammonium hydroxide solution for 2 h at 65° C. The aqueous solution containing the single-stranded crude product was further purified by ion pairing reversed phase HPLC (IP-RP-HPLC).The single-stranded oligonucleotide products purified by IP-RP-HPLC were converted to the sodium salt by dissolving in 1.0 M NaOAc and precipitating with ice-cold EtOH. Equimolar complementary sense and antisense oligonucleotides were annealed in water to form the double-stranded siRNA products, which were lyophilized to give a fluffy white solid. Example 2 Preparation of Intermediate A and Intermediate B

[0152] As shown in Scheme 1 below, intermediate A was synthesized by treating commercially available galactosamine pentaacetate with trimethylsilyl trifluoromethanesulfonate (TMSOTf) in dichloromethane (DCM). It was then glycosylated with Cbz-protected 2-(2-aminoethoxy)ethan-1-ol to give compound II. The Cbz protecting group was removed by hydrogenation to give the trifluoroacetic acid (TFA) salt as intermediate A. Intermediate B was synthesized according to the same scheme, except that Cbz-protected 2-(2-(2-aminoethoxy)ethoxy)ethan-1-ol was used as the starting material. [ka]

[0153] To a solution of compound I (20.0 g, 51.4 mmol) in 1,2-dichloroethane (DCE) (100 mL) was added TMSOTf (17.1 g, 77.2 mmol). The resulting reaction solution was stirred at 60° C. for 2 h, followed by stirring at 25° C. for 1 h. Cbz-protected 2-(2-aminoethoxy)ethan-1-ol (13.5 g, 56.5 mmol) in DCE (100 mL) dried over 4A molecular sieve powder (10 g) was added dropwise to the above reaction solution at 0° C. under N2 atmosphere. The resulting reaction mixture was stirred at 25° C. for 16 h under N2 atmosphere. The reaction mixture was filtered and washed with saturated aqueous sodium bicarbonate solution (200 mL), water (200 mL) and saturated saline (200 mL). The organic layer was dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to give the crude product, which was triturated with 2-methyltetrahydrofuran / heptane (5 / 3, v / v, 1.80 L) for 2 h. The resulting mixture was filtered and dried to give compound II (15.0 g, 50.3% yield) as a white solid.

[0154] To a dry, argon-purged hydrogenation bottle, 10% Pd / C (1.50 g) was carefully added, followed by 10 mL of tetrahydrofuran (THF), followed by a solution of compound II (15.0 g, 26.4 mmol) in THF (300 mL) and TFA (trifluoroacetic acid, 3.00 g, 26.4 mmol). The resulting mixture was degassed, purged with H2 three times, and stirred under H2 (45 psi) at 25 °C for 3 h. Thin layer chromatography (TLC, solvent: DCM:MeOH = 10:1) showed that compound II was completely consumed. The reaction mixture was filtered and concentrated under reduced pressure. The residue was dissolved in anhydrous DCM (500 mL) and concentrated. The above process was repeated three times to give intermediate A (14.0 g, 96.5% yield) as a foamy white solid. 1H NMR (400MHz DMSO-d6): δppm7.90(d,J=9.29Hz,1H),7.78(br s,3H),5.23(d,J=3.26Hz,1H),4.98(dd,J=11.29,3.26Hz,1H),4.56(d,J=8. 53Hz,1H),3.98-4.07(m,3H),3.79-3.93(m,2H),3.55-3.66(m,5H),2.98(br d,J=4.77Hz,2H),2.11(s,3H),2.00(s,3H),1.90(s,3H),1.76(s,3H).

[0155] Intermediate B was synthesized in a similar manner to intermediate A. 1 H NMR(400MHz DMSO-d6):δppm7.90(br d,J=9.03Hz,4H),5.21(d,J=3.51Hz,1H),4.97(dd,J=11.1Hz,1H),4.54(d,J=8.53Hz,1H), 3.98-4.06(m,3H),3.88(dt,J=10.9Hz,1H),3.76-3.83(m,1H),3.49-3.61(m,9H),2.97(br s, 2H), 2.10 (s, 3H), 1.99 (s, 3H), 1.88 (s, 3H), 1.78 (s, 3H). C 20 H 34 N2O 11 Calculated mass: 478.22; Measured mass: 479.3 (M+H + ). Example 3 Synthesis of GalNAc ligand cluster phosphoramidites GLPA1, GLPA2 and GLPA15.

[0156] GLPA1 and GLPA2 were prepared according to Scheme 2 below. Starting from benzyl-protected propane-1,3-diamine, alkylation with tert-butyl 2-bromoacetate gave triester compound I. The benzyl protecting group was removed by hydrogenation to give secondary amine compound II. The amide was coupled with 6-hydroxyhexanoic acid to give compound III. The tert-butyl protecting group was then removed after treatment with HCl in dioxane to give triacid compound IV. Amide coupling of triacid compound IV with intermediate A or intermediate B gave compound Va or Vb. Phosphoramidite GLPA1 or GLPA2 was synthesized by phosphorylating compound Va or Vb with 2-cyanoethyl N,N-diisopropylchlorophosphoramidite and a catalytic amount of 1H-tetrazole. [ka]

[0157] To a solution of N-benzyl-1,3-propanediamine (5.00 g, 30.4 mmol) in dimethylformamide (DMF, 100 mL) was added tert-butyl 2-bromoacetate (23.7 g, 121 mmol), followed by dropwise addition of diisopropylethylamine (DIEA, 23.61 g, 182 mmol). The resulting reaction mixture was stirred at 25-30 °C for 16 h. LCMS showed that N-benzyl-1,3-propanediamine was completely consumed. The reaction mixture was diluted with H2O (500 mL) and extracted with EtOAc (500 mL x 2). The combined organics were washed with saturated brine (1 L), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure to give the crude product, which was purified by silica gel column chromatography (gradient: petroleum ether: ethyl acetate = 20:1 to 5:1). Compound I was obtained as a colorless oil (12.1 g, 78.4% yield). 1H NMR (400MHz, CDCl3): δppm7.26-7.40(m,5H),3.79(s,2H),3.43(s,4H),3.21(s,2 H),2.72(dt,J=16.9,7.34Hz,4H),1.70(quin,J=7.2Hz,2H),1.44-1.50(m,27H).

[0158] A dry hydrogenation bath was purged with argon three times. Pd / C (200 mg, 10%) was added, followed by MeOH (5 mL), followed by a solution of compound I (1.00 g, 1.97 mmol) in MeOH (5 mL). The reaction mixture was degassed under vacuum and refilled with H2. The above process was repeated three times. The reaction mixture was stirred at 25 °C under H2 (15 psi) atmosphere for 12 h. LCMS showed that compound I was completely consumed. The reaction mixture was filtered under vacuum under N2 atmosphere. The filtrate was concentrated under reduced pressure to give compound II (655 mg, 79.7% yield) as a yellow oil, which was used in the next step without further purification. 1 H NMR (400MHz, CDCl3): δppm3.44(s,4H),3.31(s,2H),2.78(t,J=7.1Hz,2H),2.68 (t,J=6.9Hz,2H),1.88(brs,1H),1.69(quin,J=7.03Hz,2H),1.44-1.50(s,27H).

[0159] A mixture of compound II (655 mg, 1.57 mmol), 6-hydroxyhexanoic acid (249 mg, 1.89 mmol), DIEA (1.02 g, 7.86 mmol), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI, 904 mg, 4.72 mmol) and 1-hydroxybenzotriazole (HOBt, 637 mg, 4.72 mmol) in DMF (6 mL) was degassed and purged with N 3 times, then stirred at 25° C. under N 2 atmosphere for 3 h. LCMS showed the desired product. The reaction mixture was diluted with H 2 O (10 mL) and extracted with 20 mL of EtOAc (10 mL×2). The combined organics were washed with saturated brine (20 mL), dried over anhydrous Na2SO4, filtered and concentrated to give the crude product, which was purified by silica gel column chromatography (gradient: petroleum ether:ethyl acetate=5:1 to 1:1) to give compound III (650 mg, 77.8% yield) as a yellow oil. 1 H NMR (400MHz, CDCl3): δppm3.90-3.95(s,2H),3.63(t,J=6.40Hz,2H),3.38-3.45(m,6 H),2.72(t,J=6.65Hz,2H),2.40(t,J=7.28Hz,2H),1.55-1.75(m,8H),1.44(s,27H). C 27 H 50 Calculated mass of N2O8: 530.36; Found: 531.3 (M+H + ).

[0160] A mixture of compound III (5.5 g, 10.3 mmol) in HCl / dioxane (2 M, 55 mL) was stirred at 25° C. for 3 h. LCMS showed that compound III was completely consumed. The reaction mixture was filtered, washed with EtOAc (50 mL), and dried under reduced pressure to give a crude product, which was dissolved in CH3CN (50 mL) and the volatiles were removed under vacuum. The above process was repeated three times to give compound IV (2.05 g, 54.5% yield) as a white solid. 1H NMR(400MHz,D2O):δppm4.21(s,1H),4.07(d,J=4.5Hz,4H),3.99(s,1H),3.4 5-3.52(m,3H),3.42(t,J=6.5Hz,1H),3.32-3.38(m,1H),3.24-3.31(m,1H), 2.37(t,J=7.4Hz,1H),2.24(t,J=7.4Hz,1H),1.99(dt,J=15.5,7.53Hz,1H), 1.85-1.94(m,1H),1.85-1.94(m,1H),1.39-1.56(m,4H),1.19-1.31(m,2H).

[0161] A mixture of compound IV (500 mg, 1.05 mmol), intermediate A (2.02 g, 3.67 mmol), DIEA (813 mg, 6.30 mmol), EDCI (704 mg, 3.67 mmol) and HOBt (496 mg, 3.67 mmol) in DMF (10 mL) was degassed and purged with N2 three times, after which the mixture was stirred under N2 atmosphere at 25 °C for 3 h. LCMS showed the desired product. The reaction mixture was quenched by addition of H2O (10 mL) and extracted with DCM (10 mL x 2). The combined organics were extracted with 10% citric acid (20 mL). The aqueous phase was neutralized with saturated NaHCO3 solution and re-extracted with DCM (10 mL x 2). The organics were dried over sodium sulfate, filtered, and concentrated under reduced pressure to give compound Va (570 mg, 0.281 mmol, 26.8% yield) as a white solid. 1 H NMR:(400MHz,CDCl3)ppmδ7.84-8.12(m,3H),6.85-7.15(m,2H),6.66-6.81(m,1H),5.36(br d,J=2.7Hz,3H),5.11-5.27(m,3H),4.63-4.85(m,3H),3.90-4.25(m,18H),3.37-3.75(m,28H),3.15-3.28(m, 4H),2.64(brd,J=6.53Hz,2H),2.30-2.46(m,2H),2.13-2.18(m,9H),2.05(s,9H),1.94-2.03(m,18H),1.68(br s,2H),1.45(br s,2H),1.12(br t,J=7.0Hz,2H).

[0162] To a solution of compound Va (260 mg, 0.161 mmol) in anhydrous DCM (5 mL) was added diisopropylammonium tetrazolide (30.3 mg, 0.177 mmol) at room temperature under an atmosphere of N2, followed by dropwise addition of 3-bis(diisopropylamino)phosphanyloxypropanenitrile (194 mg, 0.645 mmol). The reaction mixture was stirred at 20-25 °C for 2 h. LCMS showed that compound Va was completely consumed. After cooling to -20 °C, it was added to a stirring solution of brine / saturated aqueous NaHCO3 (1:1.5 mL) at 0 °C. After stirring for 1 min, DCM (5 mL) was added. The layers were separated. The organics were washed with brine / saturated aqueous NaHCO3 (1:1.5 mL), dried over Na2SO4, filtered and concentrated to a volume of approximately 1 mL. The residual solution was added dropwise to 20 mL of methyl tert-butyl ether (MTBE) with stirring. This caused a white solid to precipitate. The mixture was centrifuged and the solid collected. The solid was redissolved in 1 mL of DCM and precipitated by adding MTBE (20 mL). The solid was again isolated by centrifugation. The collected solid was dissolved in anhydrous CH3CN. The volatiles were removed. This process was repeated two more times to give the GalNAc ligand phosphoramidite compound GLPA 1 (153 mg, 84.4 μmol) as a white solid. 1 H NMR (400MHz, CDCl3):ppmδ7.71-8.06(m,2H),6.60-7.06(m,3H),5.37(br d,J=3.0Hz,3H),5.18-5.32(m,3H),4.70-4.86(m,3H),3.92-4.25(m,18H),3.42-3.85(m,30H),3.25(m ,4H),2.59-2.75(m,4H),2.27-2.44(m,2H),2.15-2.20(s,9H)2.07(s,9H),1.96-2.03(m,18H),1.65(br s,4H),1.44(br d,J=7.28Hz,2H),1.14-1.24(m,12H). 31 P NMR(CDCl3): ppm δ 147.15.

[0163] GalNAc ligand phosphoramidite compound GLPA2 was synthesized in a similar manner except that intermediate B was used. 1 H NMR(400MHz,CDCl3):ppmδ7.94-8.18(m,1H),7.69(br s,1H),6.66-7.10(m,3H),5.35(d,J=3.5Hz,3H),5.07-5.25(m,3H),4.76-4 .86(m,3H),4.01-4.31(m,10H),3.91-4.01(m,8H),3.74-3.86(m,4H),3.52- 3.71(m,30H),3.42-3.50(m,6H),3.15-3.25(m,4H),2.52-2.70(m,4H),2.2 2-2.45(m,2H),2.15-2.22(s,9H),2.06(s,9H),1.95-2.03(m,18H),1.77(br s, 2H), 1.58-1.66 (m, 4H), 1.40 (m, 2H), 1.08-1.24 (m, 12H). 31 P NMR(CDCl3): ppm δ 147.12.

[0164] GLPA15 was prepared according to Scheme 3 below. [ka]

[0165] Starting from secondary amine compound I-1 (compound II in Scheme 2), the Cbz protecting group was introduced to give compound II-1. The tert-butyl group of compound II-1 was removed by treatment with acid to give triacid compound III-1. Amide coupling of compound III-1 with intermediate A gave compound IV-1. The Cbz protecting group of compound IV-1 was removed by hydrogenation to give secondary amine compound V-1, which was reacted with glutaric anhydride to give carboxyl compound VI-1. Compound VI-1 was reacted with piperidin-4-ol under amide coupling reaction conditions to give compound VII. Compound VII was treated with 2-cyanoethyl N,N-diisopropylchlorophosphoroimide and a catalytic amount of 1H-tetrazole to synthesize phosphoramidite compound GLPA15.

[0166] 1 H NMR(400MHz,inDMSO-d6):δppm8.05(br d,J=6.50Hz,2H),7.81(br d,J=9.01Hz,3H),5.22(d,J=3.25Hz,3H),4.98(dd,J=11.26,3.25Hz,3H),4.55(br d,J=8.50Hz,3H),4.03(s,9H),3.64-3.97(m,12H),3.55-3.63(m,6H),3.50(br s,5H),3.40(br d,J=6.13Hz,6H),3.17-3.30(m,9H),3.07(br d,J=14.26Hz,4H),2.76(t,J=5.82Hz,2H),2.18-2.47(m,6H),2.10(s,9H),1 .99(s,9H),1.89(s,9H),1.78(s,9H),1.52-1.74(m,6H),1.12-1.19(m,12H). 31 P NMR(DMSO-d6): ppm δ 145.25.

[0167] In certain studies, the method used to attach a GalNAc-containing targeting group (also referred to herein as a GalNAc delivery compound) to the 5' end of the sense strand involves the use of a GalNAc phosphoramidite (GLPA1) in the final coupling step of solid phase synthesis, using a synthetic process exemplified by the process used when performing oligonucleotide chain extension to add nucleotides to the 5' end of the sense strand.

[0168] In some studies, the method of attaching a GalNAc-containing targeting group to the 3'-end of the sense strand includes using a solid support (CPG) containing GLO-n. In some studies, the method of attaching a GalNAc-containing targeting group to the 3'-end of the sense strand includes attaching the GalNAc targeting group to a CPG solid support via an ester bond and using a CPG with a GalNAc targeting group attached when synthesizing the sense strand, whereby the GalNAc targeting group is attached to the 3'-end of the sense strand. Example 4 In vitro screening of PKK siRNA duplexes

[0169] Cryopreserved PHHs were thawed, adjusted to the appropriate density, and seeded into 96-well plates. At the same time as seeding, cells were transfected with test siRNA or control siRNA using Lipofectamine RNAiMax. Test siRNAs were measured in triplicate at two concentrations (1 nM and 0.2 nM). In a separate experiment, test siRNAs were measured in triplicate at 10 nM. The results of these two experiments are summarized in Table 4.

[0170] 24 hours after transfection, the medium was removed and the cells were collected for RNA extraction. Total RNA was extracted using RNeasy® 96 Kit (QIAGEN-74182) according to the manufacturer's manual. cDNA was synthesized using FastKing RT Kit (with gDNase) (Tiangen-KR116-02) according to the manufacturer's manual.

[0171] PKK cDNA was detected by qPCR. GAPDH cDNA was detected in parallel as an internal control. Percentage knockdown was calculated by comparing PKK mRNA expression levels in samples treated with PKK siRNA and non-targeting control siRNA. The double-stranded sequences used correspond to those shown in Table 2. [Table 5-1] [Table 5-2] Example 5 In vivo screening of PKK siRNA agents

[0172] To evaluate the in vivo activity of PKK siRNA, mice (4 per group) infected with AAV encoding the human PKK gene were used. Fourteen days before siRNA administration, female C57BL / 6J mice were infected with adeno-associated virus 8 (AAV8, 2 × 10 11 The mice were infected by intravenous administration of a solution of the vector (viral particle). On day 0, the mice were subcutaneously administered a single dose of 3 mg / kg of PKK siRNA agent or PBS. Blood samples were collected on day 0 before siRNA administration and on day 7 at the end. Human PKK protein concentration was measured by ELISA assay according to the manufacturer's recommended protocol (Abcam, Human Prekallikrein 1B ELISA Kit, ab202405). Knockdown percentage was calculated by comparing human PKK levels in mouse plasma samples on day 7 in the siRNA-treated group (normalized to PKK expression before administration of siRNA) and the PBS-treated group. The results are summarized in Tables 5, 6, and 7. In this example, GLO-0 in the compounds listed in Table 3 refers to the compound Gal NAc3 in Jayaprakash, et al., (2014) J. Am. Chem. Soc., 136, 16958-16961. The double-stranded sequence corresponds to that shown in Table 3. [Table 6] [Table 7] [Table 8] Example 6 In vivo testing of PKK siRNA agents

[0173] To evaluate the in vivo activity of PKK siRNA, mice (6 mice per group) infected with AAV encoding the human PKK gene were used. Fourteen days before siRNA administration, female C57BL / 6J mice were infected with adeno-associated virus 8 (AAV8, 2 × 10 11The mice were infected by intravenous administration of a solution of the vector (viral particle). On day 0, the mice were subcutaneously administered a single dose of 3 mg / kg of PKK siRNA agent or PBS. Blood samples were collected on day 0, before siRNA administration, on day 7, and on day 14 at the end. Human PKK protein concentration was measured by ELISA assay according to the manufacturer's recommended protocol (Abcam, human prekallikrein 1B ELISA kit, ab202405). Percentage knockdown was calculated by comparing human PKK levels in mouse plasma samples on days 7 and 14 between the siRNA-treated group (normalized to PKK expression before administration of siRNA) and the PBS-treated group. The results are summarized in Table 8. In this example, GLO-0 in the compounds listed in Table 3 refers to the compound Gal NAc3 in Jayaprakash, et al., (2014) J. Am Chem. Soc., 136, 16958-16961. The double-stranded sequences used correspond to those shown in Table 3. [Table 9] Example 7 In vitro screening of PKK siRNA duplexes

[0174] Huh7 cells were trypsinized and adjusted to the appropriate density and seeded into 96-well plates. Cells were transfected with test or control siRNAs at the same time as seeding using Lipofectamine RNAiMax (Invitrogen-13778-150) according to the manufacturer's recommended protocol. siRNAs were measured in triplicate at two concentrations (0.2 nM and 1.0 nM).

[0175] Day 0, psiCHECK(TM)-2 vector transfection (one plate) (1) 2.5 μg of psiCHECK™-2 vector plasmid was transferred to an RNase-free Eppendorf tube (Solution Mixture #1). (2) Trypsin was added to one flask to detach Huh7 cells, the cells were counted using a Vi cell counter, and the cell density was adjusted to 1x10^5 / ml. (3) 7.5 μL of Fugene-HD was transferred to the solution mixture #1 tube and mixed. (4) The solution from step 3 was added to the cell suspension, mixed, and the suspension was dispensed into a 96-well plate (100 μl / well).

[0176] 3.2 Day 1, siRNA transfection (1) Lipofectamine® RNAiMAX reagent was diluted with Opti-MEM® medium. (2) siRNA was diluted with RNA-free water to prepare a 12-fold stock solution. (3) Equal volumes of diluted RNAiMax and siRNA were mixed. The mixture was incubated at room temperature for 15 minutes to form complexes. (4) 45 μl / well of compound Lipofectamine® RNAiMAX (Opti-MEM) mixture was added to 225 μl / well of fresh DMEM medium, the supernatant was discarded into the assay plate, and 120 μl / well of compound mixture was added to the 96-well plate.

[0177] Compound-free control wells were defined as cells transfected with the psiCHECK™-2 vector and not treated with siRNA, and blank controls were wells with cells only.

[0178] 3.3 Day 2, Dual-Glo® Luciferase Assay (1) Reagent was added to the assay plate and allowed to sit for 10 minutes to allow cell lysis to occur. (2) 100 μl of cell lysate was transferred to the plate and fluorescence was measured. (3) 50 μl of Dual-Glo® Stop&Glo® reagent was added to the assay plate, mixed, and then the plate was left to stand for 10 minutes before measuring Renilla luminescence. (4) Relative expression was calculated.

[0179] 4. Data Analysis

[0180] Ratio of sample wells = (sample Renilla emission - background) / (sample fluorescence emission - background)

[0181] Ratio of compound-free control wells = (control Renilla emission - background) / (control sample fluorescence emission - background)

[0182] % Inhibition = 100 - (ratio of sample wells / average ratio of no compound controls) x 100%. The results are summarized in Tables 9, 10, 11 and 12. [Table 10] [Table 11-1] [Table 11-2] [Table 12-1] [Table 12-2] [Table 12-3]

[0183] [Table 13-1] [Table 13-2] [Table 13-3] Example 8 In vivo testing of PKK siRNA agents

[0184] To evaluate the in vivo activity of PKK siRNA, mice (4 mice per group) infected with AAV encoding the human PKK gene were used. Fourteen days before siRNA administration, female C57BL / 6J mice were infected with adeno-associated virus 8 (AAV8, 2 × 10 11 The mice were infected by intravenous administration of a solution of the vector (viral particle). On day 0, mice were subcutaneously administered a single dose of 3 mg / kg of PKK siRNA or PBS. Blood samples were collected on day 0, before siRNA administration, on day 7, and on day 14 at the end. Human PKK protein concentration was measured by ELISA assay according to the manufacturer's recommended protocol (Abcam, Human Prekallikrein 1B ELISA Kit, ab202405). Percentage knockdown was calculated by comparing human PKK levels in mouse plasma samples on days 7 and 14 between the siRNA-administered group (normalized to PKK expression before siRNA administration) and the PBS-administered group. The results are summarized in Tables 13, 14, 15, and 16. In this example, GLO-0 in the compounds listed in Table 3 refers to compound Gal NAc3 in Jayaprakash, et al., (2014) J. Am Chem. Soc., 136, 16958-16961. The double-stranded sequences used correspond to those shown in Table 3. [Table 14] [Table 15] [Table 16] [Table 17] Example 9 In vivo testing of PKK siRNA agents in cynomolgus monkeys

[0185] Male cynomolgus monkeys (age 13-22 years, weight 7-9 kg, 3 per group) were studied. Each monkey was injected subcutaneously with one of the test substances prepared in PBS at 3 mg / kg on day 1 (before administration of siRNA). After overnight fasting, blood samples were collected on days -7 (before administration), 1 (before administration), 8, 15, 22, 29, 43, 50, 57, 64, 71, 78, 85, 92, 99, 104, 111, 118, 125, 132, 140, 147, 154, 161, 167, 174, 185, and 192. Serum PKK protein concentrations were measured by ELISA (Human prekallikrein 1B (KLKB1) SimpleStep ELISA® kit; Abcam; catalog number: ab202405). The PKK residual rates (normalized to day 1, before administration of siRNA) in the groups administered with compounds AD00278-1, AD00311-1, AD00312-1, and AD00407-1 are shown in FIG. Example 10 In vivo testing of PKK siRNA agents in cynomolgus monkeys

[0186] The study was conducted on male cynomolgus monkeys (3 monkeys per group). Each monkey was subcutaneously injected with one of the test substances prepared in PBS at 3 mg / kg on day 1 (before administration of siRNA). After overnight fasting, blood samples were collected on days -7 (before administration), 1 (before administration), 8, 15, 22, 29, 43, 50, and 57. Serum PKK protein concentrations were measured by ELISA. The PKK residual rates (normalized to day 1 (before administration of siRNA)) of the groups administered compounds AD00588-1, AD00506-1, AD00506-2, AD00592-1, AD00570-1, and AD00561-1 are shown in Figure 2. Example 11 In vivo testing of PKK siRNA agents in cynomolgus monkeys

[0187] The study was conducted on male cynomolgus monkeys (3 per group). Each monkey was subcutaneously injected with one of the test substances prepared in PBS at 3 mg / kg on day 1 (before administration of siRNA). After overnight fasting, blood samples were collected on days -7 (before administration), 1 (before administration), 8, 15, 22, and 29. Serum PKK protein concentration was measured by ELISA. The PKK residual rate (normalized to day 1 (before administration of siRNA)) in the group administered compound AD00506-4 is shown in Figure 3. Equivalent aspects

[0188] Although several embodiments of the present invention have been described and illustrated herein, those skilled in the art will readily envision various other means and / or structures for performing the several functions and / or obtaining the results and / or one or more advantages described herein. Such variations and / or modifications are deemed to be within the scope of the present invention. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are exemplary, and that the actual parameters, dimensions, materials, and / or configurations will depend on the specific application or use to which the teachings of the present invention are put. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalent aspects to the specific embodiments of the present invention described herein. It will thus be understood that the foregoing embodiments are merely illustrative, and that within the scope of the appended claims and their equivalent aspects, the invention may be practiced otherwise than as specifically described and protected. The present invention relates to each of the features, systems, articles, materials, and / or methods described herein. Additionally, any combination of two or more of such features, systems, articles, materials and / or methods, unless such combinations are mutually inconsistent, is also within the scope of the invention.

[0189] All definitions and uses herein will be understood to take precedence over dictionary definitions, definitions in documents incorporated by reference, and / or common meanings of the defined terms.

[0190] As used in the specification and claims, nouns unmodified by a numeral will be understood to mean "at least one or one," unless expressly indicated to the contrary.

[0191] The term "and / or" as used in the specification and claims shall be understood to mean "either or both" of the elements so connected; that is, the elements are present together in some cases and separately in other cases. Unless expressly indicated, elements other than those expressly identified by the "and / or" phrase may optionally be present, whether related or unrelated to those expressly identified elements.

[0192] All references, patents and patent applications and publications cited or referred to in this application are hereby incorporated by reference in their entirety.

Claims

1. 1. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of prekallikrein (PKK) in a cell, comprising: the dsRNA agent comprises a sense strand and an antisense strand, and optionally comprises a targeting ligand, wherein nucleotides 2-18 of the antisense strand comprise a region complementary to a PKK RNA transcript; A double-stranded ribonucleic acid (dsRNA) agent, wherein the complementary region comprises at least 15 contiguous nucleotides that differ by 0, 1, 2, or no more than 3 nucleotides from any one of the antisense sequences shown in any one of Tables 1-3.

2. 2. The dsRNA agent of claim 1, wherein the region complementary to a PKK RNA transcript comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by no more than 3 nucleotides from any one of the antisense sequences shown in any one of Tables 1-3.

3. 3. The dsRNA agent of claim 1 or 2, wherein the antisense strand of the dsRNA is at least substantially complementary to a target region of SEQ ID NO: 767 and set forth in any one of Tables 1-3.

4. 4. The dsRNA agent of claim 3, wherein the antisense strand of the dsRNA is perfectly complementary to a target region of SEQ ID NO: 767 and is set forth in any one of Tables 1-3.

5. 2. The dsRNA agent of claim 1, wherein the dsRNA agent comprises a sense strand sequence that is at least substantially complementary to an antisense strand sequence of the dsRNA agent shown in any one of Tables 1-3.

6. 2. The dsRNA agent of claim 1, wherein the dsRNA agent comprises a sense strand sequence that is perfectly complementary to an antisense strand sequence of the dsRNA agent shown in any one of Tables 1-3.

7. The dsRNA agent of claim 1, wherein the dsRNA agent comprises an antisense strand sequence shown in any one of Tables 1-3.

8. The dsRNA agent of claim 1, wherein the dsRNA agent comprises a sequence shown as a double-stranded sequence shown in any one of Tables 1-3.

9. The dsRNA agent of claim 1, wherein the dsRNA agent comprises at least one modified nucleotide.

10. 2. The dsRNA agent of claim 1, wherein the antisense strand has all or substantially all nucleotides that are modified nucleotides.

11. 11. The dsRNA agent of claim 9 or 10, wherein the at least one modified nucleotide comprises a 2'-O-methyl nucleotide, a 2'-fluoro nucleotide, a 2'-deoxy nucleotide, a 2',3'-seconucleotide mimic, a locked nucleotide, an unlocked nucleic acid (UNA) nucleotide, a glycol nucleic acid (GNA) nucleotide, a 2'-F-arabino nucleotide, a 2'-methoxyethyl nucleotide, an abasic nucleotide, a ribitol, an inverted nucleotide, an inverted abasic nucleotide, an inverted 2'-OMe nucleotide, an inverted 2'-deoxy nucleotide, a 2'-amino modified nucleotide, a 2'-alkyl modified nucleotide, a morpholino nucleotide, and a 3'-OMe nucleotide, a 5'-phosphorothioate group-containing nucleotide, or a terminal nucleotide linked to a cholesteryl derivative or a dodecanoic acid bisdecylamide group, a 2'-amino modified nucleotide, a phosphoramidite, or a non-natural base-containing nucleotide.

12. The dsRNA agent of claim 9 or 10, comprising an E-vinylphosphonate nucleotide at the 5' end of the antisense strand.

13. 2. The dsRNA agent of claim 1, comprising at least one phosphorothioate internucleoside linkage.

14. The dsRNA agent of claim 1, wherein the sense strand comprises at least one phosphorothioate internucleoside linkage.

15. The dsRNA agent of claim 1, wherein the antisense strand comprises at least one phosphorothioate internucleoside linkage.

16. The dsRNA agent of claim 1, wherein the sense strand comprises 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages.

17. The dsRNA agent of claim 1, wherein the antisense strand comprises 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages.

18. 2. The dsRNA agent of claim 1, wherein all or substantially all of the nucleotides in the sense strand and the antisense strand are modified nucleotides.

19. 2. The dsRNA agent of claim 1, wherein the modified sense strand is a modified sense strand sequence shown in any one of Tables 2 and 3.

20. 2. The dsRNA agent of claim 1, wherein the modified antisense strand is a modified antisense strand sequence shown in any one of Tables 2 and 3.

21. The dsRNA agent of claim 1, wherein the sense strand is complementary or substantially complementary to the antisense strand, and the complementary region has a length of 16 to 23 nucleotides.

22. The dsRNA agent of claim 1, wherein the complementary region has a length of 19 to 21 nucleotides.

23. The dsRNA agent of claim 1, wherein each strand has a length of 30 or less nucleotides.

24. The dsRNA agent of claim 1, wherein each strand has a length of 25 nucleotides or less.

25. The dsRNA agent of claim 1, wherein each strand has a length of 23 nucleotides or less.

26. The dsRNA agent of claim 1, comprising at least one modified nucleotide and further comprising one or more targeting groups or one or more linking groups.

27. 27. The dsRNA agent of claim 26, wherein the one or more targeting groups or the one or more linking groups are conjugated to the sense strand.

28. 28. The dsRNA agent of claim 26 or 27, wherein the targeting group or linking group comprises N-acetylgalactosamine (GalNAc).

29. 28. The dsRNA agent of claim 26 or 27, wherein the targeting group has the structure: 【Chemistry 1-1】 【Chemistry 1-2】 【Chemistry 1-3】 【Chemistry 1-4】 【Chemistry 1-5】 【Chemistry 1-6】 【Chemistry 1-7】 【Chemistry 1-8】 【Chemistry 1-9】 【Chemistry 1-10】 【Chemistry 1-11】 。

30. The dsRNA agent of claim 1, comprising a targeting group conjugated to the 5'-end of the sense strand.

31. The dsRNA agent of claim 1, comprising a targeting group conjugated to the 3'-end of the sense strand.

32. The dsRNA agent of claim 1, wherein the antisense strand comprises an inverted abasic residue at the 3' end.

33. 2. The dsRNA agent of claim 1, wherein the sense strand comprises one or two inverted abasic residues at the 3' and / or 5' end.

34. The dsRNA agent of claim 1, which has two blunt ends.

35. The dsRNA agent of claim 1 , wherein at least one strand comprises a 3′ overhanging end having at least one nucleotide.

36. The dsRNA agent of claim 1 , wherein at least one strand comprises a 3′ overhanging end having at least two nucleotides.

37. The dsRNA agent of any one of claims 1 to 36, wherein the PKK RNA transcript is SEQ ID NO:

767.

38. A composition comprising one, two or more dsRNA agents according to any one of claims 1-37.

39. 40. The composition of claim 38, further comprising a pharma- ceutically acceptable carrier.

40. 40. The composition of claim 39, further comprising one or more additional therapeutic agents.

41. 41. The composition of claim 40, packaged in a kit, container, pack, dispenser, pre-filled syringe, or vial.

42. 40. The composition of claim 38, formulated for subcutaneous or intravenous (IV) administration.

43. A cell comprising the dsRNA agent of any one of claims 1-37.

44. 44. The cell of claim 43, which is a mammalian cell, or optionally a human cell.

45. 1. A method for inhibiting expression of a prekallikrein (PKK) gene in a cell, comprising:

43. A method comprising the step (i) of preparing a cell or a plurality of cells comprising an effective amount of one or more of the double-stranded ribonucleic acid (dsRNA) agents of any one of claims 1 to 37, or the compositions of any one of claims 38 to 42.

46. 45. The method of claim 44, further comprising the step (ii) of inhibiting expression of a PKK gene in the cell or cells prepared in step (i) of claim 45 for a time sufficient to obtain degradation of an mRNA transcript of a PKK gene, thereby reducing the level of a PKK polypeptide in the cell or cells.

47. 47. The method of claim 45 or 46, wherein the cell or cells are within a subject and the dsRNA agent is administered subcutaneously or intravenously (IV) to the subject, or the cell or cells are outside a subject and contacted with the dsRNA agent.

48. 48. The method of any one of claims 45-47, wherein two, three, or more dsRNA agents are administered to the subject or contacted with the cell or cells.

49. The method further comprises the step of evaluating inhibition of a PKK gene in the subject after administration of the dsRNA agent to the subject, wherein the means for evaluating comprises: (i) determining one or more physiological characteristics of a PKK-associated disease or disorder in said subject; and (ii) comparing the determined physiological characteristic to a baseline pre-administration physiological characteristic for said PKK-associated disease or disorder, and / or a control physiological characteristic for said PKK-associated disease or disorder; The method of any one of claims 45 to 48, wherein the comparison indicates the presence or absence of inhibition of expression of a PKK gene in the subject.

50. The method further comprises the step of evaluating inhibition of a PKK gene in the cell or cells after contacting the cell or cells with the dsRNA agent, wherein the means for evaluating comprises: (i) determining one or more physiological characteristics of a PKK-associated disease or disorder in said cell or cells; and (ii) comparing the determined physiological characteristic to a baseline pre-exposure physiological characteristic of said PKK-associated disease or disorder, and / or to a control physiological characteristic of said PKK-associated disease or disorder; The method of any one of claims 45 to 48, wherein the comparison indicates the presence or absence of inhibition of expression of a PKK gene in the cell or cells.

51. 51. The method of claim 49 or 50, wherein the control physiological characteristic is a physiological characteristic in a subject having a PKK-associated disease or disorder and not administered the dsRNA agent, or a physiological characteristic in a cell having a PKK-associated disease or disorder and not contacted with the dsRNA agent.

52. (i) the determined physiological characteristic in the subject is the presence or absence and / or level of one or more of the following in the subject: plasma PKK level in the subject; plasma kallikrein, high molecular weight kininogen (HK), and bradykinin in the subject; or one or more of the following physical symptoms in the subject: swelling of the skin, swelling of the extremities, fatigue, headache, muscle pain, tingling of the skin, abdominal pain, nausea and vomiting, hoarseness, shortness of breath, mood changes, laryngeal edema, pain, and fever; 52. The method of any one of claims 49 to 51, wherein (ii) the determined physiological characteristic in the cell or plurality of cells is the presence or absence and / or level of one or more of: level of PKK expression, kallikrein expression, high molecular weight kininogen (HK) expression and bradykinin expression in the cell or plurality of cells.

53. 50. The method of claim 49, wherein the physiological characteristic is determined in a biological sample obtained from the subject.

54. 54. The method of claim 53, wherein the biological sample comprises one or more of a blood sample, a serum sample, a tissue sample, a cell sample, and a liver sample.

55. 50. The method of claim 49, wherein the determined physiological characteristic in the subject is abnormal as compared to a control level of the physiological characteristic.

56. the control physiological characteristic in the subject is a physiological characteristic in a subject having the PKK-associated disease or disorder and who is not administered the anti-PKK dsRNA agent; 51. The method of claim 49 or 50, wherein the control physiological characteristic in the cell or cells is a physiological characteristic in a cell that has the PKK-associated disease or disorder and that is not contacted with the anti-PKK dsRNA agent.

57. the presence or absence and / or level of one or more of plasma kallikrein, high molecular weight kininogen (HK), and bradykinin in the subject, plasma PKK levels in the subject, indicating a reduction in PKK gene expression in the subject, and an alteration in PKK expression levels in the cells; 51. The method of claim 49 or 50, wherein the presence or absence and / or levels of one or more of kallikrein, high molecular weight kininogen (HK), and bradykinin in the cell or cells indicates reduced PKK gene expression in the cell or cells.

58. 51. The method of claim 49 or 50, wherein the PKK-associated disease or disorder is hereditary angioedema, angioedema, bradykinin-mediated angioedema, diabetic retinopathy, diabetic macular edema, hypertension, nephropathy, vascular disease, stroke, peripheral arterial disease (PAD), abdominal aortic aneurysm (AAA), carotid artery disease (CAD), arteriovenous malformation (AVM), critical limb threatening ischemia (CLTI), pulmonary embolism (thrombosis), deep vein thrombosis (DVT), chronic venous insufficiency (CVI) or varicose veins.

59. 1. A method for inhibiting expression of a PKK gene in a subject, comprising:

43. A method comprising administering to the subject an effective amount of one or more of the double-stranded ribonucleic acid (dsRNA) agents of any one of claims 1-37, or the compositions of any one of claims 38-42.

60. 60. The method of claim 59, wherein two, three, four or more dsRNA agents are administered to the subject.

61. 61. The method of claim 59 or 60, wherein the dsRNA agent is administered to the subject subcutaneously or intravenously (IV).

62. The method further comprises the step of assessing inhibition of said PKK gene after administration of one or more of said dsRNA agents, wherein said means for assessing comprises: (i) determining one or more physiological characteristics of a PKK-associated disease or disorder in said subject; and (ii) comparing the determined physiological characteristic to a baseline pre-treatment physiological characteristic for said PKK-associated disease or disorder and / or a control physiological characteristic for said PKK-associated disease or disorder; The method of any one of claims 59 to 61, wherein the comparison indicates the presence or absence of inhibition of expression of a PKK gene in the subject.

63. 63. The method of claim 62, wherein the determined physiological characteristic in the subject is one or more of the following: presence or absence and / or levels of one or more of plasma kallikrein, high molecular weight kininogen (HK), and bradykinin in the subject, plasma PKK levels in the subject, physical symptoms in the subject, swelling of the skin, swelling of the hands and feet, fatigue, headache, muscle pain, tingling of the skin, abdominal pain, nausea / vomiting, hoarseness, shortness of breath, mood changes, laryngeal edema, pain, and fever.

64. 63. The method of claim 62, wherein the physiological characteristic is determined in a biological sample obtained from the subject.

65. 65. The method of claim 64, wherein the biological sample comprises one or more of a blood sample, a serum sample, a cell sample, a tissue sample, and a liver sample.

66. 63. The method of claim 62, wherein the determined physiological characteristic in the subject is more normal compared to a baseline pre-treatment physiological characteristic in the subject for a PKK-associated disease or disorder and / or compared to a control physiological characteristic for the PKK-associated disease or disorder.

67. The method of claim 63, wherein the subject's levels of one or more of plasma PKK, plasma kallikrein, high molecular weight kininogen (HK), and bradykinin are identified as being statistically significantly higher, lower, or unchanged compared to a baseline pre-treatment physiological characteristic of the PKK-associated disease or disorder and / or a control physiological characteristic of the PKK-associated disease or disorder, indicating the status of PKK gene expression in the subject.

68. 64. The method of claim 63, wherein a reduction in one or more of the following physical symptoms in the subject: swelling of the skin, swelling of the hands and feet, fatigue, headache, muscle pain, tingling skin, abdominal pain, nausea and vomiting, hoarseness, shortness of breath, mood changes, laryngeal edema, pain, and fever indicates a reduction in PKK gene expression in the subject.

69. 63. The method of claim 62, wherein the PKK-associated disease or disorder is one or more of hereditary angioedema, angioedema, bradykinin-mediated angioedema, diabetic retinopathy, diabetic macular edema, hypertension, nephropathy, vascular disease, stroke, peripheral arterial disease (PAD), abdominal aortic aneurysm (AAA), carotid artery disease (CAD), arteriovenous malformation (AVM), critical limb threatening ischemia (CLTI), pulmonary embolism (thrombosis), deep vein thrombosis (DVT), chronic venous insufficiency (CVI), and varicose veins.

70. 1. A method of treating a disease or disorder in a subject, comprising: the disease or disorder is associated with the presence of a prekallikrein (PKK) protein; 44. A method comprising administering to said subject an effective amount of one or more of the double-stranded ribonucleic acid (dsRNA) agents of any one of claims 1 to 37, or the compositions of any one of claims 38 to 42, to inhibit expression of a PKK gene encoding said PKK protein.

71. 71. The method of claim 70, comprising administering to the subject two, three, four or more dsRNA agents.

72. 72. The method of claim 70 or 71, wherein the associated disease or disorder is one or more of hereditary angioedema, angioedema, bradykinin-mediated angioedema, diabetic retinopathy, diabetic macular edema, hypertension, nephropathy, vascular disease, stroke, peripheral arterial disease (PAD), abdominal aortic aneurysm (AAA), carotid artery disease (CAD), arteriovenous malformation (AVM), critical limb threatening ischemia (CLTI), pulmonary embolism (thrombosis), deep vein thrombosis (DVT), chronic venous insufficiency (CVI), and varicose veins.

73. 72. The method of claim 70 or 71, further comprising administering to the subject an additional therapeutic scheme.

74. 74. The method of claim 73, wherein the additional treatment scheme comprises administering to the subject one or more of a PKK antisense polynucleotide, an additional PKK dsRNA therapeutic, a non-PKK dsRNA therapeutic, and a PKK non-dsRNA therapeutic, and behavioral modification in the subject.

75. 75. The method of claim 74, wherein the non-PKK dsRNA therapeutic is one or more of a blood thinner, an NSAID, aspirin, an anticoagulant, tissue plasminogen activator (tPA), recombinant tissue plasminogen activator (tPA), a statin, a stent, a cholesterol lowering therapy, a vasodilator, cilostazol, an antithrombotic agent, and an antiplatelet agent.

76. 75. The method of claim 74, wherein the one or more dsRNA agents are administered to the subject by one of subcutaneous and intravenous (IV) administration.

77. 77. The method of any one of claims 70-76, further comprising determining the efficacy of the administered one or more double-stranded ribonucleic acid (dsRNA) agents in the subject.

78. The means for determining efficacy of a treatment in a subject comprises: (i) determining one or more physiological characteristics of a PKK-associated disease or disorder in said subject; and (ii) comparing the determined physiological characteristic to a baseline pre-treatment physiological characteristic for said PKK-associated disease or disorder; 78. The method of claim 77, wherein the comparison indicates one or more of: the presence or absence of efficacy, and a level of efficacy, of administration of a double-stranded ribonucleic acid (dsRNA) agent to the subject.

79. 79. The method of claim 78, wherein the determined physiological characteristic in the subject is one or more of the following: presence or absence and / or levels of one or more of plasma kallikrein, high molecular weight kininogen (HK), and bradykinin in the subject, plasma PKK levels in the subject, physical symptoms in the subject, swelling of the skin, swelling of the extremities, fatigue, headache, muscle pain, tingling of the skin, abdominal pain, nausea / vomiting, hoarseness, shortness of breath, mood changes, laryngeal edema, pain, and fever.

80. 79. The method of claim 78, wherein the physiological characteristic is determined in a biological sample obtained from the subject.

81. 81. The method of claim 80, wherein the biological sample comprises one or more of a blood sample, a serum sample, a cell sample, a tissue sample, and a liver sample.

82. 80. The method of claim 78, wherein the determined physiological characteristic in the subject is different as compared to a baseline pre-treatment physiological characteristic for a PKK-associated disease or disorder in the subject or a control level of the physiological characteristic.

83. 80. The method of claim 79, wherein the levels of one or more of plasma PKK, plasma kallikrein, high molecular weight kininogen (HK), and bradykinin are identified as being statistically significantly higher, lower, or unchanged compared to a baseline pre-treatment physiological characteristic of the PKK-associated disease or disorder and / or a control physiological characteristic of the PKK-associated disease or disorder, indicating the status of PKK gene expression in the subject.

84. 84. The method of any one of claims 78-83, wherein the PKK-associated disease or disorder is one or more of hereditary angioedema, angioedema, bradykinin-mediated angioedema, diabetic retinopathy, diabetic macular edema, hypertension, nephropathy, vascular disease, stroke, peripheral arterial disease (PAD), abdominal aortic aneurysm (AAA), carotid artery disease (CAD), arteriovenous malformation (AVM), critical limb threatening ischemia (CLTI), pulmonary embolism (thrombosis), deep vein thrombosis (DVT), chronic venous insufficiency (CVI), and varicose veins.

85. 1. A method of reducing the level of a PKK protein in a subject as compared to a baseline pre-treatment level of a PKK protein in said subject, comprising:

44. A method comprising administering to said subject an effective amount of one or more of the double-stranded ribonucleic acid (dsRNA) agents of any one of claims 1-37, or the compositions of any one of claims 38-42, to reduce the level of PKK gene expression.

86. 86. The method of claim 85, wherein the dsRNA agent is administered to the subject by subcutaneous or intravenous (IV) administration.

87. 1. A method of altering a physiological characteristic of a prekallikrein (PKK)-associated disease or disorder in a subject, as compared to a baseline pre-treatment physiological characteristic of the PKK-associated disease or disorder in the subject, comprising:

43. A method comprising administering to a subject an effective amount of one or more of the double-stranded ribonucleic acid (dsRNA) agents of any one of claims 1-37, or the compositions of any one of claims 38-42, to alter a physiological characteristic of a PKK-related disease or disorder in said subject.

88. 88. The method of claim 87, wherein the one or more dsRNA agents are administered to the subject by subcutaneous or intravenous (IV) administration.

89. 88. The method of claim 87, wherein the physiological characteristics are one or more of the following: presence or absence and / or levels of one or more of plasma kallikrein, high molecular weight kininogen (HK), and bradykinin in the subject; plasma PKK levels in the subject; physical symptoms in the subject, swelling of the skin, swelling of the hands and feet, fatigue, headache, muscle pain, tingling skin, abdominal pain, nausea / vomiting, hoarseness, shortness of breath, mood changes, laryngeal edema, pain, and fever.

90. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of prekallikrein (PKK), comprising: the dsRNA agent comprises a sense strand and an antisense strand, and optionally comprises a targeting ligand; the sense strand comprises at least 15 contiguous nucleotides that differ by 0, 1, 2 or 3 nucleotides from any one of nucleotides 1014-1044, 1054-1084, 1059-1089, 1106-1138, 1456-1486, 1543-1573, and 2029-2059 of SEQ ID NO:767; A double-stranded ribonucleic acid (dsRNA) agent, wherein the antisense strand is complementary or substantially complementary to a sense strand sequence of the dsRNA agent.

91. 91. The dsRNA agent of claim 90, wherein the region complementary to a PKK RNA transcript comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from the nucleotide sequence of any one of nucleotides 1014-1044, 1054-1084, 1059-1089, 1106-1138, 1456-1486, 1543-1573, or 2029-2059 of SEQ ID NO:

767.

92. 92. The dsRNA agent of claim 90 or 91, wherein the antisense strand of the dsRNA is at least substantially or completely complementary to a target region of SEQ ID NO:

767.

93. 92. The dsRNA agent of claim 90 or 91, wherein said sense strand sequence is at least substantially or completely complementary to the antisense strand sequence of said dsRNA agent.

94. 91. The dsRNA agent of claim 90, wherein said dsRNA agent comprises at least one modified nucleotide.

95. 91. The dsRNA agent of claim 90, wherein the antisense strand and the sense strand have all or substantially all modified nucleotides.

96. 96. The dsRNA agent of claim 94 or 95, wherein the at least one modified nucleotide comprises a 2'-O-methyl nucleotide, a 2'-fluoro nucleotide, a 2'-deoxy nucleotide, a 2',3'-seconucleotide mimic, a locked nucleotide, an unlocked nucleic acid (UNA) nucleotide, a glycol nucleic acid (GNA) nucleotide, a 2'-F-arabino nucleotide, a 2'-methoxyethyl nucleotide, an abasic nucleotide, a ribitol, an inverted nucleotide, an inverted abasic nucleotide, an inverted 2'-OMe nucleotide, an inverted 2'-deoxy nucleotide, a 2'-amino modified nucleotide, a 2'-alkyl modified nucleotide, a morpholino nucleotide, and a 3'-OMe nucleotide, a 5'-phosphorothioate group-containing nucleotide, or a terminal nucleotide linked to a cholesteryl derivative or a dodecanoic acid bisdecylamide group, a 2'-amino modified nucleotide, a phosphoramidite, or a non-natural base-containing nucleotide.

97. The dsRNA agent of claim 90, wherein the sense strand is complementary or substantially complementary to the antisense strand, and the complementary region has a length of 16 to 23 nucleotides.

98. The dsRNA agent of claim 90, wherein the complementary region has a length of 19 to 21 nucleotides.

99. 91. The dsRNA agent of claim 90, wherein each strand has a length of 40 nucleotides or less, or has a length of 30 nucleotides or less, or has a length of 25 nucleotides or less, or has a length of 23 nucleotides or less.

100. A composition comprising one, two or more dsRNA agents according to any one of claims 90-99.

101. 1. A method of treating a disease or disorder in a subject, comprising: the disease or disorder is associated with the presence of a prekallikrein (PKK) protein; 100. A method comprising administering to said subject an effective amount of one or more of the double-stranded ribonucleic acid (dsRNA) agents of any one of claims 90-99, or the composition of claim 100, to inhibit expression of a PKK gene encoding said PKK protein.

102. 102. The method of claim 101, wherein the disease or disorder is one or more of hereditary angioedema, angioedema, bradykinin-mediated angioedema, diabetic retinopathy, diabetic macular edema, hypertension, nephropathy, vascular disease, stroke, peripheral arterial disease (PAD), abdominal aortic aneurysm (AAA), carotid artery disease (CAD), arteriovenous malformation (AVM), critical limb threatening ischemia (CLTI), pulmonary embolism (thrombus), deep vein thrombosis (DVT), chronic venous insufficiency (CVI), and varicose veins.

Images