Method for producing bone and cartilage

Abstract

The present application describes methods for generating cartilage or bone by controlling the expression levels of MAST4 in cells.

Description

[Technical field]

[0001] The present invention relates to therapeutic compositions for generating cartilage or bone by regulating the MAST4 protein. [Background technology]

[0002] General Background and State of the Art

[0003] Mesenchymal stromal cells (MSCs) are multipotent cells that can differentiate into various lineages of mesenchymal cell types, including chondrocytes, osteoblasts, and adipocytes. 1 .

[0004] The commitment and differentiation of MSCs into each individual cell type depends on various signaling pathways, including Wnt, TGF-β, BMP, and FGF. 2 During differentiation, the coordinated up-regulation and repression of transcription factors is triggered through specific signaling pathways and interactions with numerous other transcription factors that act as co-regulators.

[0005] Sox9, a member of the family of high mobility group (HMG) domain transcription factors, is an activator of chondrogenesis and regulates the initiation of prechondrogenic condensation to terminal differentiation of chondrocytes. 3~5 Sox9 activates collagen genes (Col2, Col9, Col11) and cartilage matrix genes (Acan and Comp) through direct binding to their enhancers and promoters. 6、7 Considering that Sox9 is a key regulator of chondrogenesis, it is tightly regulated by diverse mechanisms. 8 Several studies have reported phosphorylation events that regulate Sox9 in chondrocytes. 9-11 .

[0006] TGF-β signaling is involved in the development and maintenance of cartilage, particularly stimulating chondrocyte differentiation during the early stages of chondrogenesis 12、13Animal studies have demonstrated that Smad3, a key mediator of TGF-β1 signaling, is required for maintaining articular cartilage and that mice with either Smad3 deficiency or chondrocyte-specific depletion of Smad3 exhibited degeneration of articular cartilage. 14、15 In addition, previous studies have reported that TGF-β1 signaling promotes chondrogenesis through regulation of Sox9 in both Smad3-dependent and -independent manners. 16~18 These results suggest that the TGF-β1-Sox9 axis is important in regulating chondrogenesis.

[0007] Wnt / β-catenin signaling plays a key role in endochondral ossification by regulating osteoblast differentiation and maturation 19 Wnt-induced stabilization of intracellular β-catenin and its subsequent nuclear translocation leads to activation of Runx2, the master transcription factor for osteoblast differentiation, particularly in mesenchymal cells destined for bone development. 20 Furthermore, GSK-3β, a key negative regulator of canonical Wnt / β-catenin signaling, has been shown to attenuate Runx2 activity during bone formation, suggesting that GSK-3β is a promising molecular target for the treatment of bone diseases. 21 .

[0008] In the present invention, taking into consideration that protein kinases play an important role in signal transduction, we attempted to identify genes that may be involved in regulating the switching of mesenchymal progenitor cells to specific pathways downstream of TGF-β or Wnt signaling. In the present invention, we identified that microtubule-associated serine / threonine kinase 4 (Mast4), which is suppressed by TGF-β1 during chondrogenesis of MSCs and enhanced by Wnt-mediated GSK-3β inhibition during osteogenesis of MSCs, plays an essential role in determining the cell fate of MSCs toward chondrocyte or osteoblast differentiation. We showed that Mast4-induced Sox9 phosphorylation at serine 494 residue leads to proteasomal degradation of Sox9. We further demonstrated that Mast4 deficiency leads to increased Sox9 stability and Smad3-Sox9 association, leading to increased transcriptional activity of Sox9 and subsequent expression of chondrocyte marker genes, ultimately promoting chondrogenic differentiation of MSCs. Meanwhile, we found that GSK-3β-induced Mast4 phosphorylation induced Mast4 recruitment of the E3 ligase Smurf1, leading to Mast4 degradation. We then demonstrated that Mast4 stabilized by Wnt-mediated GSK-3β inhibition promoted β-catenin nuclear localization, ultimately increasing Runx2 transcriptional activity, and subsequently promoting osteogenic differentiation of MSCs. The effect of Mast4 on chondro-osteogenesis of mesenchymal progenitor cells was - / - It has been confirmed in vivo that mice exhibit excessive cartilage synthesis but osteoporosis or reduced bone formation. Interestingly, Mast4 depletion in MSCs promotes cartilage formation and regeneration in vivo. Taken together, our findings reveal an essential role for Mast4 in determining the fate of MSC development towards cartilage or bone. Summary of the Invention

[0009] The present invention relates to a method for manipulating MAST4 expression in cells such that the end product results in the production of cartilage or bone. For example, if cells are engineered such that MAST4 is inhibited, the resulting cells will produce extracellular matrix material, and when the cells are administered to a site of interest in a subject, cartilage will be produced. Conversely, if cells are engineered such that MAST4 is highly expressed, and such cells are administered to a site of interest in a subject, bone will be produced.

[0010] In one aspect, the invention relates to a method for generating bone comprising administering to a subject in whom it is desired to form bone at or near the site of a bone defect, a eukaryotic cell having stabilized or increased expression or activity of microtubule-associated serine / threonine kinase family member 4 (MAST4) protein or a fragment thereof compared to a normal cell, the method comprising recombinantly expressing MAST4 in the cell.

[0011] The cell may be a connective tissue cell. The eukaryotic cell may be a mesenchymal stem cell, a fibroblast, an osteoprogenitor cell, an osteocyte, a preosteoblast, an osteoblast, or an osteoclast. The eukaryotic cell may be allogeneic or autologous to the host. The cell may recombinantly overexpress MAST4 in the cell. The expressed MAST4 may be under the control of a viral promoter. The viral promoter may be derived from a lentivirus or an adeno-associated virus.

[0012] In another aspect of the invention, a cell can be contacted with a composition comprising: (1) a compound that specifically binds to a nucleic acid encoding a MAST4 inhibitory protein, thereby inhibiting expression of the MAST4 inhibitory protein; or (2) a compound that specifically binds to a MAST4 inhibitory protein, thereby inhibiting its binding to MAST4. Without being bound by any limitation, the MAST4 inhibitory protein may be GSK-3. The inhibitory compound may be a chemical compound, a polypeptide, or a polynucleotide, or a combination thereof. The polypeptide may be an antibody or an antigen-binding molecule. The inhibitory compound of GSK-3α or GSK-3β may be a microRNA (miRNA), a small interfering RNA (siRNA), a small hairpin RNA (shRNA), a Piwi-interacting RNA (piRNA), a small nuclear RNA (snRNA), or an antisense oligonucleotide, or a combination thereof. The compound may also be a CRISPR-Cas comprising a guide RNA specific to a nucleic acid encoding a MAST4 inhibitory protein (or a fragment thereof). The guide RNA may be a double RNA comprising a CRISPR RNA (crRNA) and a transactivating crRNA (tracrRNA) specific to a nucleic acid encoding a MAST4 inhibitory protein (or a fragment thereof), or a single-stranded guide RNA comprising a portion of the crRNA and the tracrRNA and hybridizing with a nucleic acid encoding a MAST4 inhibitory protein (or a fragment thereof). The cell may be a connective tissue cell. The cell may be a mesenchymal stem cell, a fibroblast, an osteoprogenitor cell, an osteocyte, a preosteoblast, an osteoblast, or an osteoclast. The cell may be autologous or allogeneic to the host. The cell may further comprise a recombinant construct expressing MAST4. The recombinant construct may overexpress MAST4.

[0013] In another aspect, the present invention provides a method for producing extracellular matrix from a eukaryotic cell, comprising contacting the eukaryotic cell with a composition comprising a compound capable of specifically binding to a nucleic acid encoding a microtubule-associated serine / threonine kinase family member 4 (MAST4) protein or a fragment thereof and inhibiting expression or activity of MAST4 protein, wherein the compound is capable of specifically binding to a nucleic acid encoding a MAST4 protein or a fragment thereof, and wherein the eukaryotic cell is a chondrocyte, a fibroblast, or a mesenchymal stem cell. The inhibitory compound is a microRNA (miRNA), a small interfering RNA (siRNA), a small hairpin RNA (shRNA), a Piwi-interacting RNA (piRNA), a small nuclear RNA (snRNA), or an antisense oligonucleotide, or a combination thereof.

[0014] In another aspect, the present invention relates to a method for preventing, treating, or ameliorating a joint disease, the method comprising: (i) administering a compound that inhibits microtubule-associated serine / threonine kinase family member 4 (MAST4) in a eukaryotic cell, such that expression or activity of MAST4 protein is inhibited; and (ii) administering the eukaryotic cell thereby obtained to a subject in need thereof at or near a joint where cartilage is desired to be formed.

[0015] These and other objects of the present invention will be more fully understood from the following description of the invention, the referenced drawings attached hereto, and the claims appended hereto. [Brief description of the drawings]

[0016] This patent or application contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0017] The present invention will be more fully understood from the detailed description given herein below and the accompanying drawings, which are given by way of example only and therefore are not intended to limit the invention;

[0018] [Figure 1]Figure 1a-1f show targeted deletion of Mast4 gene enhances cartilage matrix gene expression and reduces osteogenic gene expression in vitro. a: Representative RT-PCR results from at least three independent experiments of high-density micromass cultures of C3H10T1 / 2 cells in the presence of BMP-2. b: Representative qRT-PCR results of expression of chondrocyte marker genes in differentiated wild-type and Mast4-depleted C3H10T1 / 2 cells. Mast4 protein expression was confirmed by Western blot during chondrogenic differentiation. c: Heatmap of DEGs classified into cartilage tissue / chondrocyte growth and bone formation in chondrogenically differentiated wild-type and Mast4-depleted C3H10T1 / 2 cells for 6 days. d: Representative qRT-PCR results of Sox9-targeted genes and Mmp9 / 13 identified by RNA-seq measurements in wild-type and Mast4-depleted C3H10T1 / 2 cells differentiated into chondrocytes for 6 days. e: Representative qRT-PCR results of osteoblast marker genes and genes related to bone formation identified in c above in wild-type and Mast4-depleted C3H10T1 / 2 cells differentiated into osteoblasts for 10 days. Transcriptional network of DEGs related to cartilage tissue and chondrocyte growth, TGF-β signaling, and BMP signaling in wild-type and Mast4-depleted C3H10T1 / 2 cells differentiated into chondrocytes for 6 days. Node size was set based on node connectivity. Red circles indicate genes showing differential expression in Mast4-depleted C3H10T1 / 2 cells. Data in b, d, and e are representative means ± SD of three independent experiments, each performed in triplicate (n=3). Unpaired two-tailed Student's t-test (P < 0.05) with Benjamini-Hochberg correction for multiple testing was performed for all statistical analyses. P values ​​vs. WT for corresponding days.

[0019] [Diagram 2]Figures 2a-2l show that Mast4 regulates chondrogenesis through post-translational regulation of Sox9. a: Alcian blue staining of C3H10T1 / 2 cells. b: 2x105 hBMSCs were differentiated into chondrocytes for 21 days, followed by protein extraction from the pellet. c: C3H10T1 / 2 cells were differentiated into chondrocytes for 6 days, followed by Sox9 ChIP with Col2a1 gene (TGF-β1 (5 ng / ml) and Vactosertib (0.5 μM), a TGF-β type I receptor kinase inhibitor) for 48 hours. d: 4xCol2a1-luc, Sox9, and Mast4-PDZ were transiently overexpressed in wild-type and Mast4-depleted C3H10T1 / 2 cells, followed by TGF-β1 treatment (3 ng / ml for 24 hours). e: Mast4-PDZ and Sox9 were transfected into C3H10T1 / 2 cells followed by immunoprecipitation analysis. f: Western blot analysis of Sox9 stability in C3H10T1 / 2 cells. g: Wild-type and Mast4-depleted C3H10T1 / 2 cells were differentiated into chondrocytes for 6 days followed by TGFβ1 (5 ng / ml for 48 h) and MG-132 (10 μM for 6 h) treatment and Sox9 immunoprecipitation. Band intensities representing pSerine and Sox9 were transformed by densitometry using ImageJ. Data are summarized as the mean ± SD of three independent experiments (n = 3). Unpaired two-tailed Student's t test (P < A ± SEM (± SEM) of 0.05 was performed for statistical analysis. h: Sox9 and Mast4-PDZ were transfected into C3H10T1 / 2 cells in the presence of MG-132 (10 μM for 6 h). Two independent MASS SPEC statistical analyses were performed. i: Mast4-PDZ was co-transfected with Sox9 wild type (WT), S494A, or S494D mutants into C3H10T1 / 2 cells. j: 4xCol2a1-luc and Sox9 WT / S494A / S494D were co-transfected into C3H10T1 / 2 cells followed by TGF-β1 treatment (3 ng / ml for 24 h). k: Representative Alcian blue staining of C3H10T1 / 2 cells stably overexpressing Sox9 WT, S494A, and S494D in micromass culture for 6 days.l: Wild-type and C3H10T1 / 2 cells stably overexpressing Sox9 WT, S494A, and S494D were differentiated into chondrocytes for 6 days. mRNA expression was examined by RT-PCR. Data in c, d, and j are representative means ± SD of three independent experiments, each performed in triplicate (n = 3). Unpaired two-tailed Student's t-tests (P < 0.05) with Benjamini-Hochberg correction for multiple testing were performed for all statistical analyses. a, b, e g, i, and l: Representative results obtained from at least three independent experiments. TCL: total cell lysates.

[0020] [Diagram 3]Figure 3a-3g show that TGF-β1-induced suppression of Mast4 enhances chondrogenesis by increasing Sox9-Smad3 association. a: Sox9 and Smad3 were co-transfected into wild-type and Mast4-depleted C3H10T1 / 2 cells, followed by TGF-β1 treatment (5 ng / ml, 30 min). Sox9 was immunoprecipitated using HA antibody. Band intensities representing GFP-Smad3 and HA-Sox9 expression levels in the immunoprecipitates were converted to the ratio of Smad3 to Sox9 by densitometry using ImageJ software. Data are shown as the mean ± SD of three independent experiments (n = 3). Unpaired two-tailed Student's t-test (P < 0.05) was performed for statistical analysis. b: Smad3 ChIP assay on Col2a1 gene was performed in differentiated C3H10T1 / 2 cells for 6 days. c: Mast4 expression was examined by RT-PCR and Western blot in C3H10T1 / 2 cells treated with TGF-β1 for 48 h. d: Luciferase assay was performed in undifferentiated C3H10T1 / 2 cells. Vactosertib (0.5 μM) was pretreated for 2 h before TGF-β1 (5 ng / ml) treatment for 24 h. e: Smad3 ChIP assay on Mast4 gene was performed in C3H10T1 / 2 cells undergoing chondrogenic differentiation for 6 days. TGF-β1 (5 ng / ml) and Vactosertib (0.5 μM) were treated for 48 and 50 h, respectively, before harvesting. f: Endogenous Mast4 and Sox9 protein expression was examined by Western blotting in differentiating C3H10T1 / 2 cells. g: Human primary chondrocytes were treated with TGF-β1 (5 ng / ml) for 24 and 48 h, and Vactosertib (0.5 μM) for 48 h. b, d, and e data are representative means ± SD of three independent experiments, each performed in triplicate (n=3). Unpaired two-tailed Student's t-tests (P < 0.05) with Benjamini-Hochberg correction for multiple testing were performed for all statistical analyses. In a, c, f, and g, representative results are obtained from at least three independent experiments. TCL: total cell lysates.

[0021] [Figure 4]Figures 4a-4l (SEQ ID NOs: 29, 30, 31) show that Wnt induces Mast4 stability via inhibition of GSK-3β. a: Representative ALP staining results of osteogenic differentiated C3H10T1 / 2 cells obtained from at least three independent experiments. b: MC3T3-E1 preosteoblasts were treated with Wnt3a conditioned medium for the indicated times. c: Wild-type and Mast4-PDZ overexpressing C3H10T1 / 2 cells were differentiated into osteoblasts for 10 days. d: Mast4-PDZ and GSK-3β were transfected into C3H10T1 / 2 cells followed by CHIR-99021 treatment (10 μM, 9 h). e: Mast4-PDZ and GSK-3β were transfected into C3H10T1 / 2 cells followed by immunoprecipitation assay. Bands recognized by phosphoserine antibody were later reprobed with HA antibody. f: Smurf1, Mast4-PDZ and GSK-3β were transfected into C3H10T / 12 cells treated with CHIR-99021 (10 μM, 9 h) followed by immunoprecipitation assay. g: Smurf1 and GSK-3β were transfected into wild-type and GSK-3β-depleted Mast4-PDZ overexpressing C3H10T1 / 2 cells. h: Mast4-PDZ WT, P628A / Y634A and Smurf1 were transfected into wild-type and GSK-3β-depleted C3H10T1 / 2 cells. i: Various Mast4 kinase domain deletion mutants and GSK-3β were transfected into C3H10T1 / 2 cells. j: Flag-Mast4-PDZ WT and Δ632-636 were co-transfected with HA-ubiquitin in C3H10T1 / 2 cells in the absence or presence of Smurf1 and GSK-3β. Cell lysates were immunoprecipitated with Flag antibody and immunoblotted with the indicated antibodies. k: MC3T3-E1 cells were transfected with Mast4-PDZ WT and Δ632-636 followed by treatment with Wnt3a-conditioned medium (2.5 h). l: 6xOSE-Luc, Mast4-PDZ WT and Δ632-636 were transfected into C3H10T1 / 2 cells followed by treatment with Wnt3a-conditioned medium (18 h). Data are representative means ± SD of three independent experiments, each performed in triplicate (n=3).Unpaired two-tailed Student's t-test (P < 0.05) with Benjamini-Hochberg correction for multiple testing was performed for all statistical analyses. bk Representative results from at least three independent experiments. TCL: total cell lysates.

[0022] [Diagram 5] Figure 5a-5h show that Mast4 depletion induces altered chondrogenesis and osteogenesis during development. a, b: Immunofluorescence images of Sox9 and Col2a1 in the growth plates of PN day 1 Mast4+ / + and Mast4- / - mice (n=3). c, d: Pentachrome staining of tibial growth plates of (c) 1-day-old and (d) 3-week-old Mast4+ / + and Mast4- / - mice (n=5). Black arrows indicate areas of hypertrophy. e: μCT images of trabecular bone in tibiae of Mast4+ / + and Mast4- / - mice. Trabecular total bone mass and bone mineral density (BMD) were measured from μCT images (n=8 in Mast4+ / + and n=10 in Mast4- / - mice).f: Bone formation was visualized by dual calcein labeling 7 and 2 days before sacrifice, and the distance between labels was measured at three points per tibia (n=10 tibias in Mast4+ / + and n=5 tibias in Mast4- / - mice).MAR: mineral apposition rateg: Representative images of immunofluorescence staining of Osterix and Mmp13 near metaphyseal vessels (CD31) in the proximal tibia of 6-week-old Mast4+ / + and Mast4- / - mice (n=3).GP: growth plate, MP: metaphysis.h: Representative Alcian Blue and Alizarin Red S staining results obtained from in vitro colony formation assays with skeletal stem cells isolated from 5-week-old Mast4+ / + and Mast4- / - mice (n=5). e, f: Data are presented as mean ± SD. For all statistical analyses, unpaired two-tailed Student's t-tests (P < 0.05) were performed.

[0023] [Figure 6]Figure 6a-6e show the identification of genes regulated by Mast4 in mouse cartilage and bone. a, b: RNA sequencing was performed by combining RNA obtained from tibial cartilage and bone of Mast4+ / + and Mast4- / - mice collected at PN day 1 (3 mice per group). a: Enrichment of upregulated genes related to cartilage development in cartilage of Mast4- / - mice. Twenty upregulated genes were predicted as the leading edge subset of the enriched gene set. b: Enrichment of upregulated genes related to skeletal development and Wnt signaling pathway in bone of Mast4+ / + mice. In the plot, 20 and 12 genes were upregulated as the leading edge subset of the enriched gene set in Mast4+ / + mice. Gene set enrichment analysis was applied with the inventive background dataset consisting of all DEGs analyzed from tibial cartilage and bone of Mast4+ / + and Mast4- / - mice. c: Mast4 regulated transcriptional network of Sox9 and Runx2 targets showing differential expression in cartilage and bone. Sox9 and Runx2 targets are related to genes related to functions of skeletal system development, including cartilage and bone development, TGF-β signaling, BMP signaling and Wnt signaling. d: Western blot analysis of Col2a1 and Sox9 proteins in cartilage tissue of Mast4+ / + and Mast4- / - mice at PN day 1. e: Western blot analysis of Runx2, Mmp13 and β-catenin proteins in bone tissue of Mast4+ / + and Mast4- / - mice at PN day 1. d, e: Representative results from at least three independent experiments.

[0024] [Figure 7]Figures 7a-7d show that transplantation of Mast4-depleted MSCs improves chondrogenesis and repair in vivo. a: 100 micromass cultures of wild-type and Mast4-depleted C3H10T1 / 2 cells cultured for 4 days in 150 mm dishes containing chondrogenic differentiation medium were injected subcutaneously into both sides of athymic nude mice (n=4; WT in the left flank and KO in the right flank). Ectopic masses were harvested 2 weeks after transplantation. Values ​​given are the mean ± SD of the volume of the grafts from 4 mice. For statistical analysis in (a), an unpaired two-tailed Student's t-test (P < 0.05) was performed. b: Multiple cartilage structures found in the grafts of wild-type and Mast4-depleted C3H10T1 / 2 cells were confirmed by immunofluorescence staining for Col2a1 and Sox9. The merge of Sox9 and TOPRO-3 is shown in yellow. Representative images were obtained from immunostaining of one cartilage segment formed by wild-type C3H10T1 / 2 cells and seven different cartilage segments formed by Mast4-depleted C3H10T1 / 2 cells. c: Macroscopic and microscopic appearance of full-thickness cartilage defect in the trochlear groove in a rabbit model 12 weeks after transplantation. Vehicle: PBS treatment without hBMSC transplantation. d: Wakitani cartilage repair score of regenerated cartilage. Data are expressed as mean ± SD. c, d: n = 3 (vehicle treatment group), n = 5 (untreated and MAST4-depleted hBMSC transplantation groups). For statistical analysis in (d), one-way ANOVA with Dunnett's correction for multiple comparisons was performed.

[0025] [Figure 8] Figure 8 shows gene expression during chondrogenesis of ATDC5 cells. ATDC5 cells were treated with 100 ng / ml insulin for 6 and 9 days to induce chondrogenesis, and RT-PCR was performed. Representative results are from at least three separate experiments.

[0026] [Figure 9]Figures 9a-9e (SEQ ID NO:32, 33, 34, 35, 36) show the effect of Mast4 depletion on mRNA expression of chondrocyte marker genes. (a) Analysis of CRISPR / Cas9-mediated deletion of Mast4 exon 1 and exon 2 in C3H10T1 / 2 cells. Exons 1 and 2 of the Mast4 locus were amplified to identify genotypes, and PCR products were used for sequencing. Two bases were deleted in both strands of exon 1, inducing a nonsense mutation with translation stop in exon 1. A seven-base deletion and a one-base insertion were found in exon 2, inducing a biallelic mutation with translation stop in exon 2. (b) Depletion of Mast4 protein was confirmed by Western blot using undifferentiated cells. (c and d) Expression of chondrocyte marker genes in undifferentiated (c) wild-type and Mast4-depleted, (d) control and shRNA-mediated Mast4 knockdown C3H10T1 / 2 cells. (d) Data are representative means ± SD of three independent experiments, each performed in triplicate (n = 3). Unpaired two-tailed Student's t-test (P < 0.05) with Benjamini-Hochberg correction for multiple testing was performed for statistical analysis. P values ​​vs. WT. (e) Expression of chondrocyte marker genes was examined in wild-type and Mast4-depleted C3H10T1 / 2 cells induced to chondrogenic differentiation for 6 days. (b, c, and e) Representative results are obtained from at least three separate experiments.

[0027] [Figure 10]Figures 10a-10b show Sox9 expression in wild-type and Mast4-depleted C3H10T1 / 2 cells. (a) Endogenous Sox9 protein expression was examined in undifferentiated wild-type and Mast4-depleted C3H10T1 / 2 cells. Band intensities representing Sox9 expression levels were converted to the ratio of Sox9 to b-actin by densitometry using ImageJ software. Representative results were obtained from at least three separate experiments. (b) mRNA expression of Sox9 in undifferentiated wild-type and Mast4-depleted C3H10T1 / 2 cells was examined by qRT-PCR. Data are representative means ± SD of three independent experiments, each performed in triplicate (n=3). Unpaired two-tailed Student's t-tests (P < 0.05) with Benjamini-Hochberg correction for multiple testing were performed for statistical analysis.

[0028] [Figure 11] Figures 11a-11b show forced expression of truncated Mast4 protein in C3H10T1 / 2 cells. (a) Schematic structure of full-length and truncated Mast4 constructs. (b) RT-PCR was performed using control (LPCX) and Mast4-PDZ-overexpressing C3H10T1 / 2 cells to analyze the mRNA expression of chondrocyte marker genes. Representative results are obtained from at least three separate experiments.

[0029] [Figure 12] Figure 12 shows the DEG and GO enrichment analysis of WT and Mast4-depleted C3H10T1 / 2 cells. Wild-type and Mast4-depleted (KO#1) C3H10T1 / 2 cells were differentiated into chondrocytes under BMP-2 stimulation in high-density micromass culture for 6 days, followed by RNA sequencing analysis. Differentially expressed genes (DEG) analysis and gene ontology (GO) enrichment analysis were performed.

[0030] [Figure 13]Figure 13 shows expression of the collagen gene family in wild-type and Mast4-depleted C3H10T1 / 2 cells. RNA sequencing shows changes in expression of the collagen gene family in wild-type and Mast4-depleted C3H10T1 / 2 cells.

[0031] [Figure 14] Figures 14a-14e show the effect of Mast4 depletion in C3H10T1 / 2 cells on chondrogenesis in vitro. (a) Schematic diagram of chondrogenic differentiation of C3H10T1 / 2 cells in a high-density micromass culture system. (b) 5x103 undifferentiated wild-type and Mast4-depleted C3H10T1 / 2 cells were plated on a 6-well plate. Two micromass cultures (each mass: 1x105 / 10 ml droplet) were plated on a 12-well plate, followed by chondrogenic differentiation under BMP-2 stimulation. The number of cells was counted with a Countess II automated cell counter at the indicated time points. Data are representative means ± SD of three independent experiments, each performed in triplicate (n=3). Unpaired two-tailed Student's t-tests (P < 0.05) with Benjamini-Hochberg correction for multiple testing were performed for all statistical analyses. P values ​​vs. WT. (c) Representative Alcian blue staining results from at least three separate experiments with chondrogenically differentiated C3H10T1 / 2 cells. (d) 1x105 wild-type and Mast4-depleted C3H10T1 / 2 cells in a 50 ml volume were plated onto low-binding 96-well plates and then subjected to chondrogenic differentiation for 8 days. Representative phase contrast images of 3D spheroids were obtained from at least three separate experiments. (e) mRNA was isolated from the spheroids shown in (d) and the expression of chondrogenic marker genes was analyzed by RT-PCR. (c and e) Representative results from at least three separate experiments.

[0032] [Figure 15]Figures 15a-15b show chondrogenic differentiation of human bone marrow-derived stem cells (hBMSCs). (a) Schematic diagram of chondrogenic differentiation of human bone marrow-derived stem cells (hBMSCs) in pellet culture system. (b) 2 × 105 hBMSCs were differentiated into chondrocytes under pellet culture system for 21 days, followed by isolation of mRNA from the aggregates. The mRNA expression of Col2a1 and Acan was examined by qRT-PCR. Undif.: undifferentiated hBMSCs. Data are representative means ± SD of three independent experiments, each performed in triplicate (n = 3). Unpaired two-tailed Student's t-tests (P < 0.05) with Benjamini-Hochberg correction for multiple testing were performed for all statistical analyses.

[0033] [Figure 16]Figures 16a-16e show that Mast4 regulates Sox9 binding to Col2a1 and Sox9 stability. (a) Indicated C3H10T1 / 2 cells were differentiated into chondrocytes for 6 days followed by Sox9 ChIP on the Col2a1 gene. (b) 4xCol2a1-luc was transiently overexpressed in LPCX control and Mast4 PDZ-overexpressing C3H10T1 / 2 cells followed by TGF-β1 treatment (3 ng / ml for 24 h). (a and b) Data are representative means ± standard deviations of three independent experiments, each performed in triplicate (n=3). Unpaired two-tailed Student's t-tests (P < 0.05) with Benjamini-Hochberg correction for multiple testing were performed for all statistical analyses. P values ​​vs. WT. (c) Full-length (HA-Mast4-FULL) and truncated Mast4 (HA-Mast4-PDZ) were co-transfected with Myc-Sox9 into C3H10T1 / 2 cells together with siMAST4 (50 pmol) targeting exogenous Mast4 (human). Due to inefficient detection of full-length Mast4 by HA antibody, a Mast4 antibody recognizing the C-terminus was used. (d) Indicated C3H10T1 / 2 cells were differentiated into chondrocytes for 6 days followed by MG-132 (10 mM, 6 h) treatment. Endogenous Sox9 was immunoprecipitated and complexes were analyzed by Western blot using phosphoserine and Sox9 antibodies. (e) Myc-Sox9 and Mast4-PDZ constructs were transfected into C3H10T1 / 2 cells followed by MG-132 (10 mM, 6 h) treatment. (c-e) Band intensities representing Myc-Sox9 or serine-phosphorylated Sox9 expression levels were converted to the ratio of Myc-Sox9 or pSerine to b-actin or Sox9 in the immunoprecipitates by densitometry using ImageJ software. Representative results are obtained from at least three separate experiments.

[0034] [Figure 17]Figure 17 shows Mast4 regulation of Sox9 through phosphorylation at serine 494 of Sox9. 4xCol2a1-luc, Sox9 WT / S494A / S494D, and Mast4-PDZ were transiently overexpressed in wild-type and Mast4-depleted C3H10T1 / 2 cells as indicated. Data are representative means ± SD of three independent experiments, each performed in triplicate (n=3). Unpaired two-tailed Student's t-test (P < 0.05) with Benjamini-Hochberg correction for multiple testing was performed for statistical analysis.

[0035] [Figure 18] Figures 18a-18c show Mast4 interaction with Smad3 and their effects on TGF-β1 / Smad3-induced transcriptional activation. (a) The indicated plasmids were co-transfected into C3H10T1 / 2 cells, followed by immunoprecipitation assays. Representative results are obtained from at least three separate experiments. (b and c) Smad3 / 4-induced transcriptional activation was examined by (b) CAGA and (c) SBE reporter assays in wild-type and Mast4-depleted C3H10T1 / 2 cells. Data are representative means ± SD of three independent experiments, each performed in triplicate (n=3). Unpaired two-tailed Student's t-tests (P < 0.05) with Benjamini-Hochberg correction for multiple testing were performed for all statistical analyses.

[0036] [Figure 19]Figures 19a-19b show the effect of Mast4 on Smad3 binding to Smad7 and TGF-β1 target gene expression. (a) Smad3 ChIP assays examining Smad3 binding to Smad7 were performed in wild-type and Mast4-depleted differentiated C3H10T1 / 2 cells. Data are representative means ± SD of three independent experiments, each performed in triplicate (n=3). Unpaired two-tailed Student's t-tests (P < 0.05) with Benjamini-Hochberg correction for multiple testing were performed for all statistical analyses. (b) mRNA expression of TGF-β1 target genes was examined in wild-type (WT), Mast4-depleted (KO; KO#1), and Mast4-PDZ-overexpressing (OE) C3H10T1 / 2 cells.

[0037] [Figure 20] Figures 20a-20b show the examination of TGF-β1 regulation of Mast4 promoter activity and Smad3 binding to the Mast4 promoter by Smad3 ChIP assay. (a) The predicted binding sites of Smad3 / 4, p300, c-Jun, Nkx2.1, and E2F-4 transcription factors in the Mast4 promoter were predicted using PROMO v3.0.2 software. (b) Smad3 ChIP assay for Mast4 gene was performed in differentiated (6 days in chondrogenic differentiation medium) C3H10T1 / 2 cells in the presence or absence of TGF-β1 (5 ng / ml, 48 h). Data are representative means ± SD of three independent experiments, each performed in triplicate (n=3). Unpaired two-tailed Student's t-test (P < 0.05) with Benjamini-Hochberg correction for multiple testing was performed for all statistical analyses.

[0038] [Figure 21]Figure 21 shows mRNA expression of Mast4 and chondrocyte marker genes in differentiation of C3H10T1 / 2 cells treated with Vactosertib. Differentiated C3H10T1 / 2 cells were treated with Vactosertib (0.5 mM) for 3 and 6 days. mRNA expression of chondrocyte marker genes was examined by RT-PCR. Representative results are obtained from at least three separate experiments.

[0039] [Figure 22] Figures 22a-22e show Mast4 induction during osteogenesis and GSK-3β regulation of Mast4 expression. (a) Schematic of osteogenic differentiation of C3H10T1 / 2 cells. (b) Indicated C3H10T1 / 2 cells were differentiated into osteoblasts for 10 days followed by Alizarin Red S staining. (c) C3H10T1 / 2 cells were differentiated into osteoblasts for 10 days followed by Western blot analysis for expression of Mast4 and key Wnt signaling molecules. (d) C3H10T1 / 2 cells overexpressing Mast4-PDZ were treated with cycloheximide (CHX; 10 mg / ml) for the indicated times in the absence or presence of CHIR-99021 (10 mM, 9 h). (e) Wild-type and GSK-3b-depleted HA-Mast4-PDZ-overexpressing C3H10T1 / 2 cells were treated with MG-132 (10 mM, 4 h) and CHIR-99021 (10 mM, 9 h). (b-d) Representative results from at least three separate experiments.

[0040] [Figure 23] Figures 23a-23c show GSK-3b and Smurf1 binding to the kinase domain of Mast4. (a) Schematic diagram of Mast4-PDZ deletion mutants. (b) GFP-GSK-3β, (c) GFP-Smurf1 and various deletion mutants of Mast4 were co-transfected into C3H10T1 / 2 cells, followed by immunoprecipitation assays. Representative results are obtained from at least three separate experiments.

[0041] [Figure 24]Figures 24a-24b show the enhancement of Runx2 activity and osteogenic differentiation by Mast4-PDZ overexpression and GSK-3β depletion. (a) 6xOSE-Luc was transfected into wild-type and GSK-3β-depleted wild-type and Mast4-PDZ overexpressing C3H10T / 12 cells followed by treatment with Wnt3a-conditioned medium for 18 h. (b) Wild-type and GSK-3b-depleted wild-type and Mast4-PDZ overexpressing C3H10T / 12 cells were differentiated into osteoblasts for 10 days, followed by examination of the mRNA expression of osteoblast marker genes. (a and b) Data are representative means ± standard deviations of three independent experiments, each performed in triplicate (n=3). Unpaired two-tailed Student's t-tests (P < 0.05) with Benjamini-Hochberg correction for multiple testing were performed for all statistical analyses.

[0042] [Diagram 25] Figures 25a-25e (SEQ ID NOs: 37, 38, 39, 40, 41, 42, 43, 44) show the analysis of CRISPR / Cas9-mediated deletion of Mast4 exon 1 and exon 15. (a) Mouse Mast4 locus is shown with boxes of exons. The structure of Mast4- / - allele is shown. (bc) Mast4 exons 1 and 15 were amplified to identify the genotype, and the PCR products were used for sequencing. As shown by the sequencing results, 71 bases were deleted in exon 1, resulting in a nonsense mutation with a translation stop in exon 1; while 3 bases were deleted in exon 15, removing one arginine. (d) Loss of Mast4 protein in Mast4- / - mice was confirmed by Western blot analysis in brain and muscle of young mice. (e) Representative images showing body size of 6-week-old Mast4+ / +, Mast4+ / -, and Mast4- / - mice. (b and d) Representative results from at least three separate experiments.

[0043] [Figure 26]Figures 26a-26e show the analysis of Mast4 expression patterns, tibial growth plate thickness and hypertrophy area ratio in Mast4+ / + and Mast4- / - mice. (a) Expression patterns of Mast4 in tibiae of PN 1 day Mast4+ / + and Mast4- / - mice (n=3). White dotted lines indicate the borders between proliferation, hypertrophy and ossification areas. P: proliferation area, H: hypertrophy area, O: ossification area. (b) Pentachrome and H&E staining images of tibial growth plate (n=3). (a and b) Representative images were obtained from immunostaining of Mast4+ / + and Mast4- / - mice (n=3). (c-e) Total growth plate thickness and hypertrophic zone thickness were measured in three random fields of each sample (PN 1 day: n=4, PN 3 weeks: n=5, PN 6 weeks: n=3 for both Mast4+ / + and Mast4- / - mice). Hypertrophic zone ratio was calculated as hypertrophic zone thickness / growth plate thickness. Data are presented as mean ± SD. For statistical analysis in (c,d,e), unpaired two-tailed Student's t-test (P < 0.05) was performed. P values ​​vs. WT.

[0044] [Figure 27]Figures 27a-27d show the mCT analysis, elemental mapping by electron probe microanalyzer, and limb length of Mast4+ / + and Mast4- / - mice. (a) Reconstructed 3D mCT images of the tibia. Representative images were obtained from immunostaining of Mast4+ / +, Mast4+ / -, and Mast4- / - mice (n=3). (b) Bone volume, bone mineral density, and cortical bone thickness in the tibia of 6-week-old Mast4+ / + and Mast4- / - mice were examined using mCT images. (c) Elemental mapping of calcium (Ca), phosphorus (P), and magnesium (Mg) in the tibia of 6-week-old Mast4+ / + and Mast4- / - mice. Red areas indicate high elemental concentration, and dark blue indicates low concentration. BEI: backscattered electron image. (d) Limb length of 6-week-old Mast4+ / + and Mast4- / - mice was examined using mCT images. A cross section was set containing the axis passing through the two points furthest from the bone, and the longest length was measured. (b and d) Data are reported as mean ± SD (n = 8 for Mast4+ / + mice, n = 10 for Mast4- / - mice). For statistical analysis in (b, d), an unpaired two-tailed Student's t test (P < 0.05) was performed. P values ​​vs. WT.

[0045] [Figure 28] Figures 28a-28b show the expression of osteoblast marker proteins in the proximal tibia and distal femur of 6-week-old Mast4+ / + and Mast4- / - mice. (a) Expression of Runx2 in the proximal tibia metaphysis of Mast4+ / + and Mast4- / - mice. GP: growth plate, MP: metaplasia. Images showing expression of Osterix and Mmp13 correspond to Figure 5g. (b) Expression of Runx2, Osterix, and Mmp13 is decreased in the periosteum of 6-week-old Mast4- / - mouse distal femur. P: Periosteum, C: Cortex, M: Medulla (a and b). Representative images were obtained from immunostaining of Mast4+ / + and Mast4- / - mice (n=3).

[0046] [Figure 29]Figures 29a-29b show isolation of mouse skeletal stem cells from 5-week-old Mast4+ / + and Mast4- / - mice. (a) Representative FACS plots with percentages of parent gates for each population generated on a BD FACS Aria II and analyzed by FlowJo v10.7.1 and BD FACSDiva v.9.0.1 software. (b) Antibodies and concentrations used to isolate mouse skeletal stem cells.

[0047] [Diagram 30] Figures 30a-30c show functional evaluation of mouse skeletal stem cells isolated from Mast4+ / + and Mast4- / - mice. (a) Schematic of in vitro colony formation assay of mouse skeletal stem cells. (b and c) Stained colonies were extracted for absorbance measurement by using cloning cylinders to distinguish each colony. Alcian blue and Alizarin Red S staining were quantified by absorbance measurement at 630 nm and 405 nm, respectively. Data are reported as mean ± SD of three stained colonies (n=3). For statistical analysis of (b, c), unpaired two-tailed Student's t-test (P < 0.05) was performed.

[0048] [Diagram 31] Figures 31a-31d show chondrogenic and osteogenic differentiation of mouse bone marrow-derived mesenchymal stem cells (mBMMSC). (a) Schematic diagram of mouse bone marrow-derived mesenchymal stem cells (mBMMSC) differentiated into either chondrocytes or osteocytes. (b) Mouse BMMSC were isolated from bone marrow aspirates taken from the tibial bone marrow compartment of Mast4+ / + and Mast4- / - mice, followed by induction of chondrogenic differentiation for 21 days and subsequent Alcian blue staining (n=3). (c) Expression of chondrocyte marker genes in differentiated BMMSC shown in (b). (d) mBMMSC isolated from Mast4+ / + and Mast4- / - mice were cultured in osteoblast culture medium and stained with alkaline phosphatase (ALP). (c and d) Representative results obtained from at least three separate experiments.

[0049] [Diagram 32] Figures 32a-32b show the identification of genes regulated by Mast4 in mouse cartilage and bone. (a) DEGs were classified into five groups based on the changes in gene expression in cartilage and bone. (b) GO enrichment analysis of DEGs in the five groups. A-M indicate enriched GO terms (P<0.001). Box plots in (a) show the enrichment scores of the GO terms (terms:values) listed in (b). Grayscale heatmap in (a) shows the DEGs that hit the GO terms (terms:values).

[0050] [Diagram 33] Figures 33a-33d show Mast4 regulation of Sox9 target genes and osteogenesis-related genes in mouse cartilage and bone, respectively. Heatmap (a and c) and qRT-PCR (b and d) validation of mRNA expression of Sox9 target genes in cartilage tissue and osteogenesis-related genes in tibia bone tissue of Mast4+ / + and Mast4- / - mice on PN1 day. (b and d) Data are representative means ± standard deviations of three independent experiments, each performed in triplicate (n=3). Unpaired two-tailed Student's t-tests (P < 0.05) with Benjamini-Hochberg correction for multiple testing were performed for all statistical analyses.

[0051] [Diagram 34]Figures 34a-34b show the effect of Mast4 depletion in C3H10T1 / 2 cells on chondrogenesis in vivo. (a) Schematic diagram of preparation of differentiated C3H10T1 / 2 cells for subcutaneous injection into the flank of four athymic nude mice (female, 6 weeks old). Mice were sacrificed after 2 weeks and grafts were harvested for further analysis. (b) Multiple cartilage structures found in the masses formed by Mast4-depleted C3H10T1 / 2 cells were confirmed by pentachrome staining. Each rectangular image is displayed at a larger magnification. Bar=100 mm. Representative images were obtained from immunostaining of chondrocytes formed by wild-type C3H10T1 / 2 cells and seven different chondrocytes formed by Mast4-depleted C3H10T1 / 2 cells.

[0052] [Diagram 35] Figures 35a-35c show the transplantation of hBMSCs into full-thickness cartilage defects in rabbit models. (a) Macroscopic appearance of full-thickness cartilage defects in rabbit models and H&E, Safranin O, Masson's trichrome, and microscopic appearance of the defects in the trochlear groove 12 weeks after transplantation, as well as immunohistochemical detection of type II collagen and human HLA class 1 ABC. Vehicle: PBS treatment without hBMSC transplantation. Representative images obtained from n=3 for vehicle treatment group, n=5 for untreated and MAST4-depleted hBMSC transplantation groups. (b) The average percentage of collagen area from the total area of ​​the cartilage defect was assessed using tissue stained with Masson's trichrome. (c) The average percentage of type II collagen stained area in the total area of ​​the cartilage defect. (b and c) n=3 for vehicle, n=5 for naive and CRISPR / Cas9-mediated MAST4 KO (pooled) human bone marrow-derived stem cells. Data are presented as mean ± standard deviation. Statistical analysis for (b, c) was performed using one-way analysis of variance (ANOVA) with Dunnett's correction for multiple comparisons.

[0053] [Diagram 36]Figures 36a-36b show histological grading of regenerated cartilage in full-thickness articular cartilage defects in rabbit knees. (a) Wakitani cartilage repair scoring system. (b) Sections were semi-quantitatively analyzed with the Wakitani score (n=3 for vehicle, n=5 for naive and MAST4 KO (pooled) human bone marrow-derived stem cells). Data are presented as mean ± standard deviation. Statistical analysis in (b) was performed using one-way analysis of variance (ANOVA) with Dunnett's correction for multiple comparisons.

[0054] [Figure 37] Figure 37 shows a schematic diagram of the role of Mast4 in determining the cell fate of MSC development into cartilage or bone. During chondrogenesis, TGF-β1-mediated suppression of Mast4 leads to an increase in Sox9 protein by decreasing Sox9 phosphorylation at S494, which leads to an increase in Sox9 transcriptional activity, ultimately favoring MSCs for chondrogenesis at the expense of osteogenesis. During osteogenesis, Wnt-mediated GSK-3b inhibition blocks GSK-3b-induced Mast4 phosphorylation and subsequent Smurf1-mediated Mast4 degradation. Stabilized Mast4 induces an increase in b-catenin and Runx2 activity, resulting in enhanced osteogenesis of MSCs. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0055] In this specification, "a" and "an" are used to refer to both singular and plural objects.

[0056] As used herein, administration "in combination with" one or more further therapeutic agents includes simultaneous (concurrent) or consecutive administration in any order.

[0057] As used herein, the term "biologically active moiety" in reference to a nucleic acid, protein, protein fragment or derivative thereof is defined as the ability of a nucleic acid or amino acid sequence to mimic a known biological function evoked by the wild-type form of the nucleic acid or protein.

[0058] As used herein, the term "bone growth" relates to bone mass, as indicated by an increase in osteoblast number and size, and increased deposition on the osteoid lining bone surface following systemic administration.

[0059] As used herein, a "carrier" includes a pharma- ceutically acceptable carrier, excipient, or stabilizer that is non-toxic to cells or mammals exposed to the cells or mammals at the dosages and concentrations used. In many cases, the pharma-ceutically acceptable carrier is an aqueous pH buffered solution. Examples of pharma-ceutically acceptable carriers include, but are not limited to, buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid; antioxidants including low molecular weight (less than about 10 residues) polypeptides; proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrin; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and / or non-ionic surfactants such as TWEEN®, polyethylene glycol (PEG), and PLURONICS®.

[0060] As used herein, the term "connective tissue" refers to any tissue that connects and supports other tissues or organs, including, but not limited to, ligaments, cartilage, tendons, bone, or synovium of a mammalian host.

[0061] As used herein, the term "connective tissue cells" or "cells of connective tissue" includes cells found in connective tissues, such as fibroblasts, chondrocytes (chondrocytes), and bone cells (osteoblasts / osteocytes), as well as fat cells (adipocytes) and smooth muscle cells. Preferably, the connective tissue cells are fibroblasts, chondrocytes, and bone cells. More preferably, the connective tissue cells are fibroblasts. Alternatively, the connective tissue cells are osteoblasts or bone cells. It will be appreciated that the invention can be practiced with connective tissue cells, as well as mixed cultures of a single type of cell. It will also be appreciated that the tissue cells may be treated, such as by chemical or radiation, such that the cells stably express a gene of interest. Preferably, the connective tissue cells do not provoke a negative immune response when administered to a host organism. In this regard, it will be appreciated that autologous cells can be used, as well as allogeneic cells, for cell-mediated gene therapy or somatic cell therapy.

[0062] As used herein, a "connective tissue cell line" comprises multiple connective tissue cells derived from a common parent cell.

[0063] As used herein, a "host cell" includes an individual cell or cell culture that can be or has been a recipient of a vector of the invention. A host cell includes the progeny of a single host cell, and the progeny may not necessarily be completely identical (in morphology or total DNA complement) to the original parent cell due to natural, accidental, or deliberate mutations and / or changes.

[0064] As used herein, the term "low bone mass" refers to a level of bone mass as standardly defined by the World Health Organization, "Assessment of Fracture Risk and its Application to Screening for Postmenopausal Osteoporosis (1994). Report of a World Health Organization Study Group. World Health Organization Technical Series 843," which is incorporated herein by reference for its reference to normal and osteoporotic levels of bone mass. Additionally, the term "bone mass" refers to the amount of bone per unit area, which is sometimes referred to as bone mineral density.

[0065] As used herein, the term "mammalian host" includes members of the animal kingdom, including, but not limited to, humans.

[0066] As used herein, the term "mature bone" relates to bone that is mineralized, as opposed to non-mineralized bone, such as osteoid.

[0067] As used herein, the term "osteogenically effective" refers to an amount that affects the formation and development of mature bone.

[0068] As used herein, the term "osteoprogenitor cells" or "bone progenitor cells" refers to cells that have the potential to become bone cells and are present in the periosteum and bone marrow. Osteoprogenitor cells are derived from connective tissue progenitor cells that are also present in the surrounding tissues (muscle).

[0069] As used herein, the term "patient" includes members of the animal kingdom, including, but not limited to, humans.

[0070] As used herein, a composition is described as "pharmacologically or physiologically acceptable" if its administration can be tolerated by or is otherwise suitable for administration to a recipient animal. Such an agent is said to be administered in a "therapeutically effective amount" if the amount administered is physiologically significant. An agent is physiologically significant if its presence results in a detectable change in the physiology of the recipient patient.

[0071] As used herein, "pharmaceutically acceptable carriers and / or diluents" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.

[0072] As used herein, a "promoter" can be any sequence of DNA that is active and controls transcription in eukaryotic cells. The promoter can be active in either or both eukaryotic and prokaryotic cells. Preferably, the promoter is active in mammalian cells. The promoter can be constitutively expressed or inducible. Preferably, the promoter is inducible. Preferably, the promoter is inducible by an external stimulus. More preferably, the promoter is inducible by a hormone or metal. Similarly, "enhancer elements" that also control transcription can be inserted into the DNA vector construct and used with the construct of the present invention to enhance expression of a gene of interest.

[0073] As used herein, a "subject" is a vertebrate, preferably a mammal, more preferably a human.

[0074] As used herein, "dose" refers to a specific amount of a therapeutic agent prescribed to be taken at one time or at a given interval.

[0075] As used herein, "treatment" is an approach to obtain beneficial or desired clinical results. For purposes of the present invention, beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, whether detectable or not, reduction in the magnitude of disease, stabilization of the disease state (not in a negative sense), delay or slowing of disease progression, improvement or alleviation of the disease state, and remission (whether partial or total). "Treatment" also means extending life expectancy beyond that expected in the absence of treatment. "Treatment" refers to both curative treatment and prophylactic or preventative measures. Those in need of treatment include those already suffering from the disease and those wishing to prevent the disease. "Ameliorating" a disease means reducing the severity of the disease state and / or undesirable clinical symptoms and / or slowing or prolonging the time course of progression compared to the situation without treatment.

[0076] As used herein, "vector," "polynucleotide vector," "construct" and "polynucleotide construct" are used interchangeably herein. The polynucleotide vectors of the present invention may be in any of several forms, including, but not limited to, RNA, DNA, RNA encapsulated in a retroviral coat, DNA encapsulated in an adenoviral coat, DNA packaged in another virus or virus-like form (such as herpes simplex and adeno-associated virus (AAV)), DNA encapsulated in a liposome, DNA complexed with polylysine, DNA complexed with synthetic polycationic molecules, DNA complexed with compounds such as polyethylene glycol (PEG) to immunologically "mask" the molecule and / or increase half-life, or DNA complexed with non-viral proteins. Preferably, the polynucleotide is DNA. As used herein, "DNA" includes not only the bases A, T, C, and G, but also any analogs or modified forms of these bases, such as, for example, methylated nucleotides, internucleotide modifications, such as, for example, uncharged bonds and thioates, the use of sugar analogs, and modified and / or alternative backbone structures, such as, for example, polyamides.

[0077] The term "antibody" refers to a specific immunoglobulin against an antigen site. A gene of interest, such as encoding GSK-3α or GSK-3β, can be cloned into an expression vector to obtain a protein encoded by the gene, and an antibody can be prepared from the protein according to methods common in the art. Types of antibodies include polyclonal or monoclonal antibodies, including all immunoglobulin antibodies. Antibodies include not only complete types with two full-length light chains and two full-length heavy chains, but also functional fragments of antibody molecules that do not have an intact complete antibody structure with two light chains and two heavy chains, but have a specific antigen binding site (binding domain) against an antigen site to retain antigen binding function.

[0078] The term "polynucleotide," unless otherwise specified, may be used interchangeably with nucleotide or nucleic acid and refers to deoxyribonucleotides or ribonucleotides. A polynucleotide may include analogs of natural nucleotides and analogs with modified sugar or base moieties, unless otherwise stated. A polynucleotide may be modified by various methods known in the art, if necessary. Examples of modifications may include methylation, capping, replacement of natural nucleotides with one or more homologues, and modifications between nucleotides, such as modifications to uncharged bonds (e.g., methylphosphonates, phosphotriesters, phosphoramidates, carbamates, etc.) or charged bonds (e.g., phosphorothioates, phosphorodithioates, etc.).

[0079] In certain embodiments, as a compound capable of specifically binding to a nucleic acid encoding a protein of interest or a fragment thereof, the polynucleotide capable of specifically binding to a nucleic acid encoding a protein of interest or a fragment thereof may be a microRNA (miRNA), a small interfering RNA (siRNA), a small hairpin RNA (shRNA), a Piwi-interacting RNA (piRNA), a small nuclear RNA (snRNA), or an antisense oligonucleotide, each specific to a nucleic acid encoding a protein of interest or a fragment thereof, or a combination thereof.

[0080] In another particular embodiment, the compound capable of specifically binding to the nucleic acid encoding the protein of interest or a fragment thereof may comprise a polynucleotide capable of specifically binding to the nucleic acid encoding the protein of interest or a fragment thereof, and may be a CRISPR-Cas comprising a guide RNA specific to the nucleic acid encoding the protein of interest or a fragment thereof. In a particular embodiment, the Cas may be Cas9.

[0081] Clustered regularly interspaced short palindromic repeats (CRISPR) refers to a gene locus that contains many short direct repeats found in the genomes of bacteria or archaea whose gene sequences have been elucidated. The CRISPR-Cas system contains Cas9 as an essential protein component that forms a complex with guide RNA (specifically, two RNAs called CRISPR RNA (crRNA) and transactivating crRNA (tracrRNA) contained in the guide RNA) and functions as an active endonuclease.

[0082] In certain embodiments, for the CRISPR-Cas system that specifically acts on a target gene of interest, the guide RNA may be in the form of a double RNA comprising a CRISPR RNA (crRNA) specific to a nucleic acid encoding a protein of interest and a transactivating crRNA (tracrRNA), or a single-stranded guide RNA comprising a portion of the crRNA and the tracrRNA and hybridizing with the nucleic acid encoding the protein of interest. The double-stranded RNA and the single-stranded guide RNA may at least partially hybridize with the polynucleotide encoding the protein of interest.

[0083] Specifically, the guide RNA may be a duplex RNA comprising crRNA and tracrRNA hybridizing with a target sequence selected from a nucleotide sequence encoding a protein of interest, or a single-stranded guide RNA comprising a portion of crRNA and tracrRNA and hybridizing with nucleotides encoding a protein of interest. The target sequence, the gene of interest, comprises a polynucleotide sequence at least partially complementary to the crRNA or sgRNA, and a sequence comprising a protospacer adjacent motif (PAM). The PAM may be a sequence known in the art that may have a suitable sequence for being recognized by a nuclease protein. The gene of interest targeted by the CRISPR-Cas system may be an endogenous DNA or an artificial DNA. The nucleotides encoding the protein of interest may be specifically endogenous DNA of a eukaryotic cell, more specifically endogenous DNA of a chondrocyte.

[0084] In certain embodiments, the crRNA or sgRNA may comprise 20 consecutive polynucleotides complementary to the target DNA. The Cas9 protein or the nucleic acid encoding the Cas9 protein may be derived from a microorganism of the genus Streptococcus. The microorganism of the genus Streptococcus may be Streptococcus pyogenes. The PAM may mean 5'-NGG-3' trinucleotide, and the Cas9 protein may further comprise a nuclear localization signal (NLS) at the C-terminus or N-terminus to increase efficiency.

[0085] In the composition for promoting bone production from eukaryotic cells disclosed herein, the eukaryotic cells may be yeast cells, fungal cells, protozoan cells, plant cells, higher plant cells, insect cells, amphibian cells, or mammalian cells. The mammals may be various, such as humans, monkeys, cows, horses, and pigs. The eukaryotic cells include, but are not limited to, cultured cells (in vitro), transplanted cells, in vivo cells, or recombinant cells isolated from an individual. The eukaryotic cells isolated from an individual may be eukaryotic cells isolated from the same individual into which a product containing bone produced from eukaryotic cells is injected. In this case, it is advantageous in that side effects such as unnecessary hyperimmune reactions and rejection reactions, including graft-versus-host reactions, caused by administering a product produced from a different individual can be prevented.

[0086] In a particular embodiment, the eukaryotic cells may be fibroblasts or chondrocytes or mesenchymal stem cells or osteoprogenitor cells (MC3T3-E1; pre-osteoblasts).

[0087] MAST4

[0088] MAST4 is a protein of human (Human) or mouse (Musmusculus) origin, although the same protein can also be expressed in other mammals, such as monkeys, cows, and horses.

[0089] Human-derived MAST4 may include any of the 12 isoforms present in human cells. The 12 isoforms may include the following amino acid sequences: Isoform sequencing is based on NCBI reference sequencing.

[0090] Isoform 1 - NP_055998.1 [Table 1]

[0091] Isoform 2 - NP_942123.1 [Table 2]

[0092] Isoform 3-NP_001158136.1 [Table 3]

[0093] Isoform 4-NP_001277155.1 [Table 4]

[0094] Isoform 5-NP_001277156.1 [Table 5]

[0095] Isoform 6-NP_001277157.1 [Table 6]

[0096] Isoform 7-NP_001284580.1 [Table 7]

[0097] Isoform 8-NP_001380453.1 [Table 8]

[0098] Isoform 9-NP_001380454.1 [Table 9]

[0099] Isoform 10-NP_001380455.1 [Table 10]

[0100] Isoform 11-NP_001380456.1 [Table 11]

[0101] Isoform 12-NP_001380457.1 [Table 12]

[0102] Amino acid sequences or polynucleotide sequences which are not identical to the amino acid sequences of SEQ ID NOs: 1 to 12 but have biologically equivalent activity can also be considered as MAST4 protein or its mRNA.

[0103] Thus, in certain embodiments, the MAST4 protein may comprise the sequence of any one of SEQ ID NOs: 1-12 and a nucleotide sequence encoding the MAST4 protein.

[0104] The MAST4 protein or polypeptide may comprise an amino acid sequence having 60% or more, for example, 70% or more, 80% or more, 90% or more, 95% or more, 99% or more, or 100% sequence identity to SEQ ID NOs: 1 to 12. Furthermore, the MAST4 protein may have an amino acid sequence having modifications of 1 or more amino acids, 2 or more amino acids, 3 or more amino acids, 4 or more amino acids, 5 or more amino acids, 6 or more amino acids, or 7 or more amino acids in the amino acid sequence of SEQ ID NOs: 1 to 12.

[0105] Each polynucleotide encoding MAST4 may have a sequence that has 60% or more, for example 70% or more, 80% or more, 90% or more, 95% or more, 99% or more, or 100% sequence identity to a sequence encoding any one of the MAST4 proteins. Alternatively, the polynucleotide encoding MAST4 may be a polynucleotide having a sequence that differs from the sequence encoding SEQ ID NOs: 1 to 12 by 1 or more nucleotides, 2 or more nucleotides, 3 or more nucleotides, 4 or more nucleotides, 5 or more nucleotides, 6 or more nucleotides, or 7 or more nucleotides.

[0106] The present inventors first demonstrated that increased or stabilised expression of the MAST4 gene in eukaryotic cells such as mesenchymal stem cells or osteoprogenitor cells increases bone production.

[0107] Furthermore, in certain embodiments, the composition for promoting the production of extracellular matrix from eukaryotic cells may be used for tissue regeneration or anti-aging.

[0108] The term "pharmaceutically acceptable salt" refers to any organic or inorganic addition salt of a compound in the compositions disclosed herein, at a concentration which is relatively non-toxic and innocuous to the patient, and which has an effective effect such that its side effects do not diminish the beneficial efficacy of the compositions disclosed herein. These salts may be selected from any known to those of skill in the art.

[0109] The compositions disclosed herein may further comprise a pharma- ceutically acceptable carrier. The compositions comprising a pharma- ceutically acceptable carrier may have various formulations for parenteral administration. When formulated, the compositions may be prepared using commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, surfactants, etc.

[0110] Preparations for parenteral administration may include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations, suppositories, etc. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, etc. As bases for suppositories, witepsol, macrogol, Tween 61, cacao butter, laurin butter, glycerol, gelatin, etc. may be used.

[0111] As used herein, "stabilizing MAST4" means preventing the degradation or preventing the inhibition of the activity of MAST4. For example, MAST4 can be destabilized or degraded by being ubiquitinated and undergoing proteolysis via the proteasome. Thus, inhibitors of factors that target the degradation of MAST4 are contemplated in the present invention.

[0112] GSK-3 inhibitors

[0113] Glycogen synthase kinase-3 (GSK-3) is a proline-directed serine-threonine kinase. There are two isoforms, GSK-3α and β, which are highly related and largely overlapping. Their many substrates range from regulators of cellular metabolism to molecules that control growth and differentiation. A sampling of GSK-3β inhibitors includes, but is not limited to, Laduviglusib (CHIR-99021) HCl (CAS No. 1797989-42-4), SB216763 (CAS No. 280744-09-4), AT7519 (CAS No. 844442-38-2), CHIR-98014 (CAS No. 252935-94-7), and TWS119 (CAS No. 601514-19-6). See Selleck Chemicals, Houston, TX (2023). Antibodies that specifically inhibit GSK-3β or GSK-3α also exist.

[0114] Bone formation treatment

[0115] The present invention discloses an ex vivo technique that involves culturing eukaryotic cells that inhibit the post-translational expression or inhibition of a protein that inhibits the production or activity of MAST4, and then transplanting the modified eukaryotic cells into a target bone defect area in a mammalian host to result in bone production. Alternatively, or simultaneously, MAST4 expression is increased in the cells.

[0116] The preferred source of cells for treating a human patient are the patient's own connective tissue cells or mesenchymal stem cells, such as autologous fibroblasts or bone precursor cells (osteoprogenitor cells), osteocytes, pre-osteoblasts, osteoblasts or osteoclasts, although it will be understood by those skilled in the art that allogeneic cells may also be used.

[0117] More specifically, the methods may involve the use of inhibitors against GSK-3, including GSK-3α or GSK-3β.

[0118] Another embodiment of the present invention provides the compounds for parenteral administration to a patient of the modified cells and a suitable pharmaceutical carrier in a prophylactically effective amount.

[0119] In the present invention, a method is provided for generating or regenerating bone by injecting suitable mammalian cells that have been transfected or transduced with a gene encoding overexpressed MAST4.

[0120] It is understood that in one embodiment of the invention, the cells can be injected into the area where bone is to be generated or regenerated with or without a scaffold material or any other auxiliary material, such as foreign cells or other biocompatible carriers.

[0121] The method of the present invention may be applied to all types of bones in the body, including, but not limited to, non-union fractures (fractures that cannot heal), craniofacial reconstruction, partial defects due to tumor removal, bone augmentation around hip implant replacements (i.e., 25% of hip implants are replacements for existing implants, since the lifespan of hip implants is only 10 years), and reconstruction of jaw bones for dental purposes. Other target bones include vertebrae on the spine for spinal fusion, large bones, etc. Furthermore, the present invention may be used to treat fractures or defects such as femur, tibia, hip joint, hip fractures, especially in elderly people, by administering the cells of the present invention to a subject in need thereof.

[0122] The cells to be modified include any suitable mammalian cells, including mesenchymal stem cells, and connective tissue cells, including, but not limited to, fibroblasts, osteoprogenitor cells, pre-osteoblasts, osteoblasts, osteocytes, and osteoclasts, and may further include chondrocytes. However, it is understood that the compositions used to contact the bone defect site may also include other non-genetically modified cells, such as pre-osteoblasts, osteoblasts, osteocytes, osteoclasts, chondrocytes, etc.

[0123] When referring to a "bone defect" or "defective bone," it is understood that such defects can include fractures, breaks, and / or degradation of bone, including such conditions caused by injury or disease, and can further include defects in the spine and further degradation of the disc area between vertebrae. In one aspect of the present invention, pain caused by deterioration of the disc space between vertebrae can be treated by fusing the vertebrae surrounding the degenerated disc space.

[0124] One ex vivo method of treating fractured or defective bone disclosed throughout the present specification involves first generating a recombinant virus or plasmid vector containing a DNA sequence encoding a protein or a biologically active fragment thereof. This recombinant vector is then used to infect or transfect a population of in vitro cultured cells to obtain a population of cells containing the vector. These cells are then transplanted into the target bone defect area of ​​a mammalian host, which then results in expression of the protein or protein fragment within the defect area. This expression of the DNA sequence of interest is useful for substantially repairing the fracture or defect.

[0125] More specifically, the methods of the present invention involve using a gene encoding MAST4, or a biologically active derivative or fragment thereof.

[0126] Another embodiment of the present invention provides a method for introducing at least one gene encoding a product into at least one cell for use in treating a mammalian host, the method comprising using viral or non-viral means to introduce the gene encoding the product into the cell. More specifically, the method comprises liposome encapsulation, calcium phosphate co-precipitation, electroporation, or DEAE-dextran mediation, and comprises using as genes a member of the MAST4 family or a biologically active component derivative or fragment thereof, and a selectable marker, or a gene capable of encoding a biologically active component derivative or fragment thereof.

[0127] Another embodiment of the present invention provides additional methods for introducing at least one gene encoding a product into at least one cell for use in treating a mammalian host. The present invention involves the delivery of a DNA vector molecule to a target cell or tissue using biological means. Preferably, the virus is a pseudovirus, the genome of which is modified such that the pseudovirus is only capable of delivery and stable maintenance in the target cell, and preferably does not retain the ability to replicate in the target cell or tissue. The modified viral genome is further engineered by recombinant DNA techniques such that the viral genome acts as a DNA vector molecule containing the heterologous gene of interest to be expressed in the target cell or tissue.

[0128] A preferred embodiment of the present invention is a method for delivering cells expressing MAST4 protein to the target defect area by delivering the MAST4 gene to the tissue of a mammalian host using an adeno-associated virus vector or lentivirus vector using the ex vivo technique disclosed herein. In other words, a DNA sequence of interest encoding a functional MAST4 protein or protein fragment is subcloned into a selected viral vector, the recombinant viral vector is then grown to an appropriate titer and used to infect in vitro cultured cells, and the transduced cells are transplanted into the bone defect area or a nearby area that is therapeutically effective.

[0129] Another preferred method of the present invention involves the direct in vivo delivery of MAST4 gene to the connective tissue of a mammalian host by using either an adenovirus vector, an adeno-associated virus (AAV) vector, or a herpes simplex virus (HSV) vector. In other words, the DNA sequence of interest encoding a functional MAST4 protein or protein fragment is subcloned into the respective viral vector. The MAST4-containing viral vector is then propagated to an appropriate titer and directed to the bone defect area or the nearby area that is effective for bone formation.

[0130] Treatment for osteoporotic fracture healing

[0131] Osteoporosis is the structural deterioration of the skeleton caused by loss of bone mass due to an imbalance in bone formation, bone resorption, or both, such that such resorption dominates the bone formation phase, thereby reducing the weight-bearing capacity of affected bones. In healthy adults, the rates at which bone is formed and resorbed are tightly regulated to maintain the regeneration of skeletal bone. However, in osteoporotic individuals, an imbalance in these bone remodeling cycles occurs, resulting in both loss of bone mass and the formation of microstructural defects in the continuity of the skeleton. These skeletal defects are created by perturbations in the remodeling sequence and accumulate until the structural integrity of the skeleton is severely compromised and fractures are highly likely. This imbalance occurs gradually in most individuals with age (senile osteoporosis), but occurs rapidly and is much more severe in postmenopausal women. In addition, osteoporosis can also result from nutritional and endocrine imbalances, genetic disorders, and many malignant transformations.

[0132] Method for producing cartilage or bone

[0133] Although MSCs have been intensively studied for use in regenerative therapy, the molecular mechanisms governing the differentiation of MSCs have not been fully elucidated. Our results suggest that Mast4 is a key molecule that determines the commitment and differentiation of MSCs to chondrogenic or osteogenic cell fates. We demonstrated that TGF-β1-mediated suppression of Mast4 gene transcription leads to increased Sox9 protein and Smad3-Sox9 association, which in turn increases Sox9 transcriptional activity, ultimately initiating MSCs to promote chondrogenesis at the expense of osteogenesis. With regard to bone formation, the inventors showed that Wnt-mediated inhibition of Mast4 protein degradation by inhibiting GSK-3β activity led to increased β-catenin protein and Runx2 transcriptional activity, ultimately enabling MSCs to promote bone formation (Figure 37).

[0134] The environment-dependent nature of TGF-β has been reported for several decades. In particular, the cytostatic effects of TGF-β have been shown to be regulated by transcriptional activation of CDK inhibitors and repression of c-Myc, highlighting its role in the treatment of cancer. 31 Many studies have also identified the function of TGF-β in determining the fate of pluripotent stem cells during development. With regard to endochondral ossification during skeletal development, TGF-β promotes mesenchymal condensation and chondrogenesis but inhibits chondrocyte maturation and differentiation into osteocytes, indicating its sequential regulation along specific lineages. 32 The bifunctional role of TGF-β signaling during skeletal development is supported by observations in animal models. 15、33 We observed suppression of Mast4 by TGF-β during chondrogenesis in vitro and predominant expression of Mast4 in hypertrophic chondrocytes in vivo. These observations speculate that TGF-β exerts diverse regulatory effects on skeletogenesis through specific regulation of Mast4 at different stages. Furthermore, our finding of Mast4 not affecting the cytostatic effect of TGF-β provides compelling evidence supporting Mast4 as a key mediator of TGF-β-induced chondrogenic differentiation of MSCs.

[0135] Various transcriptional cofactors act as Smad partners to assist in target gene recognition and transcriptional regulation 34 Regarding Smad-mediated gene repression, Smad3 inhibits Runx2 activity through direct interaction, ultimately reducing osteoblast differentiation. 35E2F4 / 5 have been demonstrated as co-repressors in the TGF-β-induced suppression of c-Myc36. TGF-β-induced SpB suppression is associated with Smad3 interaction with Nkx2.137. Interestingly, predicted binding sites for E2F4 and Nkx2.1 near the Smad3 binding site were recognized through the analysis of the Mast4 promoter region. Therefore, it will also be important to examine whether these co-transcription factors are involved in TGF-β / Smad3-mediated Mast4 regulation. Furthermore, the discovery of novel co-transcription factors that regulate Mast4 expression along the successive stages of chondrogenic / osteogenic differentiation will be beneficial for the understanding of cartilage and bone development and their regulation.

[0136] Post-translational modifications (PTMs) regulate protein function and stability, fine-tuning signal transduction. 38 Here, we demonstrate the influence of PTMs on the TGF-β1-Mast4-Sox9 axis during chondrogenesis. Many signaling pathways and PTMs have been shown to regulate Sox9, a master transcription factor during chondrocyte differentiation, by controlling the repertoire of cartilage-associated ECM genes at an early stage. 10、16、39、40 Our findings indicate that Mast4 promotes Sox9 degradation by inducing Sox9 phosphorylation at serine 494. Although it remains to be elucidated whether Mast4-induced Sox9 phosphorylation is recognized by either Sox9 or an E3 ligase for subsequent Mast4 degradation, the present invention indicates that Mast4 is likely to be an important factor controlling Sox9 activity. E6-AP / UBEA is an E3 ligase that induces ubiquitin-mediated proteasomal degradation of Sox9 in hypertrophic chondrocytes during endochondral ossification 41Considering that Mast4 is mainly expressed in hypertrophic chondrocytes, it may be worthwhile to investigate whether Mast4, in cooperation with E6-AP / UBEA, regulates Sox9 stability in hypertrophic chondrocytes. Furthermore, testing of Mast4 regulation of Sox9 stability by phosphorylation at serine 494 in vivo and subsequent chondrogenic differentiation potential may be necessary in future studies. In addition, previous studies have demonstrated the importance of a delicate balance of Sox9 activity in MSCs for proper differentiation. - / - The observation of accumulation of chondrocytes in a terminally differentiated hypertrophic state and their delayed exit from the growth plate shown in mouse endochondral bone may be explained by Mast4 deficiency-mediated overexpression of Sox9 and collagen and reduction of Mmp9 and Mmp13.

[0137] Regarding Wnt / β-catenin, different mechanisms have been reported to explain Wnt-mediated β-catenin stabilization. 42 In particular, Wnt inhibits GSK3 activity towards β-catenin in various ways. Considering that phosphorylation by GSK3 often indicates proteins targeted for ubiquitination and proteolysis, this leads to our finding that inhibition of Mast4 phosphorylation by GSK-3β increases the stability of Mast4 and subsequently β-catenin enhances the action of Wnt / β-catenin signaling in MSCs adopting an osteoblastic fate. 24、43 Furthermore, it would be worthwhile to examine Mast4 protein levels in GSK-3β-deficient mice and mice treated with a GSK-3β inhibitor, which show increased bone formation and bone mass. 21、44、45 .

[0138] Mast4 is Mast1-4 and Mastl 46They belong to the MAST kinase family, which consists of Mast1, Mast2, Mast3, Mast4, Mast5, Mast6, Mast7, Mast8, Mast9, Mast10, Mast11, Mast12, Mast13, Mast14, Mast15, Mast16, Mast17, Mast18, Mast19, Mast20, Mast21, Mast22, Mast23, Mast24, Mast25, Mast26, Mast27, Mast28, Mast29, Mast30, Mast31, Mast32, Mast33, Mast34, Mast35, Mast36, Mast37, Mast38, Mast39 ...9, Mast40, Mast41, Mast42, Mast43, Mast44, Mast45, Mast46, Mast47, Mast48, Mast49, Mast49, Mast41, Mast41, Mast42, Mast43, Mast44, Mast45, Mast46, Mast47, Mast48, Mast49, Mast50, Mast51, Mast52, Mast53, Mast54, Mast55, Mast56, Mast57, Mast58, Mast59, Mast60, Mast61, Mast62, Mast71, Mast82, Mast93, Mast10, Mast11, Mast12, Mast13, Mast14, Mast15, Mast16, Mast17, Mast18, Mast19, Mast21, Mast22, Mast33, Mast4 47、48 Neuroprotective Mediators 49-51 In addition to its role as a phosphodiesterase inhibitor, Mast4 has been reported to undergo O-GlcNAc modification, the overall increase of which is frequently observed during osteoblast differentiation. 52 Furthermore, Mast4-mediated FGF-2 signaling, known to play a role in bone formation, was shown to be upregulated in Sertoli cells through induction of ERM phosphorylation at serine 367 residue. 53 . On the other hand, the microtubule cytoskeleton has been shown to contribute to the osteogenic differentiation of MSCs. 54 Since the MAST kinase family shares a high degree of similarity in protein domains that are considered to be structural and functional components, MAST kinase family members are likely to be important cellular mediators of various signal transduction in normal and disease states. Furthermore, examination of Mast4 regulation in the differentiation of MSCs into various lineages, including osteoblasts or adipocytes, may merit further investigation.

[0139] In conclusion, we have demonstrated that Mast4 is a key mediator in MSC commitment to the chondro-osteogenic differentiation pathway. Our findings suggest a function for Masts4 in restricting Sox9 transcriptional activity to determine the fate of MSC development to cartilage or bone. Thus, in the context of cell therapy, Mast4 represents an ideal target for potential MSC therapy.

[0140] Treatment Composition

[0141] Formulations of compounds for treatment are generally known in the art and can be found in Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Co., Easton, Pa, USA. For example, about 0.05 μg to about 20 mg / kg body weight / day can be administered. Dosage regimens can be adjusted to provide the optimal therapeutic response. For example, several divided doses can be administered daily, or the dose can be proportionally reduced as indicated by the requirements of the treatment situation. The active compound can be administered in any suitable manner, such as intravenously (if water soluble), intramuscularly, subcutaneously, intranasally, or intradermally.

[0142] Pharmaceutical forms suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. All dosage forms must be sterile and fluid to the extent that easy syringability exists. They must be stable under the conditions of manufacture and preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. Prevention against the action of microorganisms can be provided by various antibacterial and antifungal agents, for example, chlorobutanol, phenol, sorbic acid, themerosal, and the like. In many cases, it is preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0143] Sterile injectable solution is prepared by incorporating the required amount of active compound in a suitable solvent with various other ingredients as listed above as necessary, followed by filtration sterilization.Generally, dispersion is prepared by incorporating various sterile active ingredients into a sterile medium (vehicle) that contains a basic dispersion medium and other ingredients as listed above.For the preparation of sterile powder for the preparation of sterile injectable solution, the preferred preparation method is vacuum drying and freeze-drying technology, which prepares the powder of active ingredient with any additional desired ingredients from the solution that has been previously sterile filtered.

[0144] For ease of administration and uniformity of dosage, it is particularly useful to formulate the components into dosage unit forms.The dosage unit forms used in the present invention are physically discrete units suitable as a uniform dose for the mammalian subject to treatment; each unit contains a predetermined amount of active substance calculated to produce a desired therapeutic effect together with the necessary pharmacological carrier.The specifications for the dosage unit forms of the present invention are determined by and directly depend on (a) the unique characteristics of the active substance and the specific therapeutic effect to be achieved, and (b) the limitations inherent to those skilled in the art of compounding such active substances for the treatment of disease in living subjects with disease states that impair physical health.

[0145] The present invention is not limited to the specific embodiments described herein. Indeed, various modifications of the present invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and accompanying drawings. Such modifications are intended to fall within the scope of the appended claims. The following examples are offered by way of illustration of the present invention, but not by way of limitation. EXAMPLES

[0146] All animal studies were approved by the Institutional Animal Care and Use Committee of KNOTUS Co., Ltd. and the Institutional Animal Care and Use Committee of the Phenogenomics animal Research Facility and Woojung BSC and were performed in accordance with the ethical and procedural guidelines. Laboratory mice were maintained on a 12-h light / dark cycle at room temperature (20–22°C) with constant humidity (40 ± 10%).

[0147] Example 1: Generation of Mast4 knockout mice using CRISPR / Cas9 technology

[0148] To generate Mast4 knockout mice by CRISPR / Cas9-mediated gene targeting, we targeted exon 1 and exon 15 of Mast4 (RefSeq accession number: 175171): 5'GGAAACTCTGTCGGAGGAAG-3' (SEQ ID NO: 13) (exon 1) and 5'-GGCACAAAGAGTCCCGCCAG-3' (SEQ ID NO: 14) (exon 15). Then, Dr. Feng Zhang (Addgene, #42230) 55 Each sequence was inserted into the pX330 plasmid carrying both the guide RNA and Cas9 expression units received from Cognitive Science, Inc. These vectors were named pX330-Mast4-E1 and pX330-Mast4-E15.

[0149] Female C57BL / 6J mice (Charles River Laboratories, Kanagawa, Japan) were intraperitoneally injected with pregnant female serum gonadotropin (5 units) and human chorionic gonadotropin (5 units) at 48-h intervals and mated with male C57BL / 6J mice. pX330-Mast4-E1 and pX330-Mast4-E15 (circular, 5 ng / μl each) were co-microinjected into 231 zygotes collected from the oviducts of mated female mice. The 225 surviving injected zygotes were transferred into the oviducts of pseudopregnant ICR females, and 47 newborn pups were obtained. Genomic DNA was collected from the tails of the 31 surviving founder mice.

[0150] To confirm the indel mutations induced by CRISPR / Cas9, the genomic region containing the target site was amplified by PCR using primers for exon 1 target (MAST4-1 genotype F: 5'-GTAGGGACTCCACGCTCCAG-3' (SEQ ID NO: 15); MAST4-1 genotype R: 5'-CCGGACCCTAGTCTCTTCG-3' (SEQ ID NO: 16)) and exon 15 target (MAST4-15 genotype F: 5'-GGGTTCTCTGCGAAAGTCAG-3' (SEQ ID NO: 17); MAST4-15 genotype R: 5'-ATCCCTGTGTTCCGTTTCAG-3' (SEQ ID NO: 18)). PCR products were sequenced using BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific), MAST4-1 genotype F primers, and MAST4-15 genotype F primers. In male founder mouse #38, we found indel mutations in both exon 1 and exon 15 without random pX330 integration. To identify the indel sequences and whether the indel mutations in exon 1 and exon 15 occurred on the same chromosome (in cis), founder mouse #38 was bred with a wild-type female and the indel mutations in the F1 were sequenced. Seventeen F1 neonates were obtained, of which 12 harbored a 71-bp deletion in exon 1 (chr13:103,333,981-103,334,051: GRCm38 / mm10) and a 3-bp deletion in exon 15 (chr13:102,774,360-102,774,362) in cis configuration.

[0151] Example 2 CRISPR / Cas9-mediated deletion of Mast4 in C3H10T1 / 2 and human bone marrow-derived stem cells

[0152] For C3H10T1 / 2 cells, the lentiCRISPRv2 vector (Addgene #52961) was digested with BsmBI and ligated with annealing oligonucleotides targeting Mast4 exon 1; 5'-TACCCTGCCGCTGCCGCACC-3' (SEQ ID NO:19) (LentiCRISPRv2-Mast4 Ex1) and exon 2; 5'-AGCAACCCAGATGTGGCCTG-3' (SEQ ID NO:20) (LentiCRISPRv2-Mast4 Ex2). To generate lentivirus, HEK293T cells were transfected with LentiCRISPRv2-Mast4 Ex1 and packaging vectors (pVSVG and psPAX2, Addgene #8454, #12260) at 70% confluence with polyethylenimine. Viral supernatants were harvested 48 hours post-transfection, filtered through a 0.45 μm filter, and applied to C3H10T1 / 2 cells. After puromycin-mediated selection, single cell clones were expanded in 96-well plates. Exon 1 and exon 2 regions of the Mast4 gene were extracted from genomic DNA using AccuPower TM Amplification was performed using PCR premix (Bioneer). The indel mutation causing frameshift-mediated depletion of Mast4 protein was confirmed by sequencing. For human bone marrow-derived stem cells (hBMSCs), the inventors used the GeneArt TM Guide RNAs (gRNAs) were generated using the Precision gRNA Synthesis Kit (Invitrogen) according to the manufacturer's protocol. Human bone marrow derived stem cells were transformed at passage 5-6 with gRNA targeting exon 5 (forward: 5'-TAATACGACTCACTATAGAGCAACCGGAAAAGCTTAAT-3' (SEQ ID NO: 21); reverse: 5'-TTCTAGCTCTAAAACATTAAGCTTTTCCGGTTGCT-3' (SEQ ID NO: 22)) and Cas9 protein (Toolgen) using the Neon transformation system according to the following manufacture protocol: Because hBMSCs could not form colonies from individual cells, the pool of edited cells was used for further chondrogenic differentiation, protein and mRNA isolation. CRISPR / Cas9-mediated Mast4 gene knockout efficiency in hBMSCs was determined by ICE knockout analysis (www.synthego.com). Mast4-deficient hBMSCs (indicating indel% and the percentage of cells with frameshift or 21+ bp indel) that obtained ICE score and KO score >70, respectively, were used.

[0153] Example 3 Lentiviral shRNA Production / Infection Two different shRNAs targeting exon 15 and exon 22 of Mast4 (shMast4 exon 15 F: CCGGCCCAGTTGATATGGCCAGAATCTCGAGATTCTGGCCATATCAACTGGGTTTTTG (SEQ ID NO: 23), shMast4 exon 22 F: CCGGCCGAAGTTTCTCCTGCTTAAACTCGAGTTTAAGCAGGAGAAACTTCGGTTTTTG (SEQ ID NO: 24)) were designed and the annealed oligos were inserted into pLKO.1 vector. To generate shRNA lentivirus, 293T cells were transfected with pLKO-shMast4 (#1 and #2) or scrambled control pLKO-pGL2 together with lentiviral packaging plasmids psPax2 and VSV-G. 48 hours after transfection, viral supernatants were harvested and filtered. C3H10T1 / 2 cells were infected with shRNA lentivirus and polybrene (8 μg / ml) for 24 h, followed by puromycin selection (4 μg / ml).

[0154] Example 4 Cell Culture and Chondrogenic / Osteogenic Differentiation

[0155] C3H10T1 / 2 cells (clone 8, CCL-2260, ATCC), mouse bone marrow-derived mesenchymal stromal cells (mBMSCs), and human embryonic kidney cell line HEK293T (CRL-3216, ATCC) were grown in Dulbecco's modified Eagle's medium (DMEM; LM001-05, WELGENE) containing 10% fetal bovine serum (FBS; S001-01, WELGENE) and 1% penicillin-streptomycin (P / S; LS202-02, WELGENE). ATDC5 (RCB0565, RIKEN BRC) cells were grown in DMEM / F-12 (11320033, Gibco) containing 5% FBS and 1% P / S. hBMSCs were kindly provided by SCM Lifescience (Incheon, S. Korea), where hBMSC lines were established through a subpopulation culture method 56 . Briefly, human bone marrow aspirates from the iliac crest of three healthy donors after written informed consent approved by the Inha University Hospital Institutional Review Board (IRB number 10-51) were mixed with isolation medium and incubated. The supernatant containing floating bone marrow cells without cells that had settled to the bottom was repeatedly transferred to new 100 mm dishes. After 10-14 days of incubation, well-separated colonies were isolated, expanded, and characterized. These were grown in DMEM (low glucose; LM001-11, WELGENE) containing 10% FBS and 1% P / S. 1-year-old human female donor 57 Human primary chondrocytes, harvested by distorting collagenase-treated cartilage tissue obtained from SCM Lifescience, were also kindly provided by SCM Lifescience and were grown in DMEM (17-205-CVR, Corning) containing 10% FBS (26140-079, Gibco), 20 mM L-glutamine (25030-081, Gibco), and 10 μg / ml gentamicin (15700-060, Thermo Fisher). MC3T3-E1 cells (subclone 4, CRL-2593, ATCC) were grown in alpha-minimal essential medium (α-MEM) without ascorbic acid (LM008-53, WELGENE) containing 10% FBS and 1% P / S. All cells were cultured at 37°C in a humidified 5% CO2 incubator. For micromass culture of C3H10T1 / 2 cells, 1 × 10 cells were cultured in 10 μl drops of normal growth medium. 5 Cells were seeded onto culture dishes, followed by a 2-h attachment period, after which BMP-2 (150 ng / ml; PeproTech)-containing medium was added to the dishes and the medium was changed every 48–72 h. For pellet culture of hBMSCs, 2x10 5 The cells were seeded onto a 15 ml conical tube and incubated in 1% P / S, 10 -7 Cells were grown for 21 days in α-MEM containing 1:100 dexamethasone (Sigma Aldrich), 1 / 100 ITS+premixed universal culture supplement (Corning), 50 ng / ml ascorbic acid (Sigma Aldrich), 10 ng / ml TGF-β1 and TGF-β3 (R&D Systems), and 40 ng / ml L-proline (Sigma Aldrich). Medium was changed every 48–72 h. For mBMSCs, cells were isolated from bone marrow aspirates taken from the tibial bone marrow compartment and cultured for 3 h in DMEM containing 10% FBS. Non-adherent cells were carefully removed and re-fed with fresh medium. Cultured BMMSCs were differentiated into chondrocytes using a StemPro Chondrogenesis Differentiation Kit (Thermo Fisher Scientific) according to the manufacturer's instructions. For osteogenic differentiation of C3H10T1 / 2 cells, confluent cells were cultured for 10 days in maintenance medium supplemented with 50 μg / ml ascorbic acid (Sigma Aldrich), 10 mM β-glycerophosphate (Sigma Aldrich), and 200 ng / ml BMP-2. The medium was changed every 48–72 h.

[0156] Example 5 Alcian Blue and Alkaline Phosphatase (ALP) Staining

[0157] Differentiated cells were washed twice with PBS and fixed in 4% paraformaldehyde for 5–10 min at room temperature. Chondrogenically differentiated cells were stained overnight with Alcian blue solution (1% Alcian blue in 0.1 M HCl, pH 1.0; Sigma Aldrich) followed by one wash with 0.1 M HCl and two washes with PBS. Osteogenically differentiated cells were stained with 5-bromo-4-chloro-3-indolyl phosphate / nitro blue tetrazolium solution (BCIP / NBT; Merck) for 30 min at 37°C.

[0158] Example 6 3D spheroid formation assay

[0159] 3D spheroid formation of C3H10T1 / 2 cells using low-binding plates was performed as previously reported. 23 Briefly, round-bottom ultra-low attachment 96-well microplates (Corning) were coated with gelatin (0.1%; Sigma Aldrich). Then, 1x10 cells were cultured in 50 μl of BMP-2 (150 ng / ml)-containing medium. 5 Cells were added to each well of the coated microplate and cultured for 8 days, with the medium replaced every 48–72 hours.

[0160] Example 7 RNA-Seq and bioinformatics statistical analysis

[0161] For sample preparation for RNA sequencing using differentiated C3H10T1 / 2 cells, a total of 30 high-density micromass cultures from three separate chondrocyte differentiation inductions (10 masses / each induction) of wild-type and Mast4-depleted (KO#1) C3H10T1 / 2 cells were combined together for RNA sequencing. For RNA sequencing using mouse cartilage and bone, cartilage and bone were dissected as follows: Mast4-depleted (KO#1) C3H10T1 / 2 cells were cultured in a CO2 chamber on day 1 of PN. + / + and Mast4 - / -After euthanasia, the femur was cut in the middle. After removing the skin, all muscles were removed with forceps. After cutting the knee joint cartilage and ankle joint of the tibia, the fibula was removed. The epiphysis was separated from the tibial body along the border of the calcified area with a 30G needle. The separated epiphyseal cartilage and tibia were then immersed in Trizol. (登録商標) (Invitrogen). The tibia was partially resected and placed in Trizol R The mice were then minced with a razor blade. Each sample was homogenized with an equal volume of 0.5 mm stainless steel beads. RNA was then obtained by phase separation with chloroform and precipitation with isopropanol. The total amount of RNA obtained from each mouse on PN day 1 was not sufficient for RNA sequencing analysis, so Mast4 + / + and Mast4 - / - RNA obtained from mouse tibial cartilage or bone was combined (n=3 per group). RNA-Seq libraries were prepared using 1 μg of qualified RNA in each sample using the TruSeq RNA sample prep kit according to the manufacturer's manual (Illumina, Inc., San Diego, CA). After qPCR validation, libraries were subjected to paired-end sequencing using an Illumina HiSeq 2500 platform with a read length of 100 bp, yielding an average of 57.7 million reads per library. The quality of the raw reads was assessed with FastQC (version 0.11.9). Clean reads from each sample with an average quality score greater than Q30 were analyzed using TopHat RT-PCR with a set of gene model annotations. 58 The genome was aligned to the mouse reference genome GRCm38.p4mm10 using the Gene expression was calculated as FPKM using Cufflinks. Cuffdiff with cutoff values ​​set at P < 0.05 and ≥ 1.5 fold change, with reference to qPCR validation of Sox9 target genes. 59 Differential expression analysis between wild-type and Mast4-depleted samples was performed by using the Gene Ontology (GO) enrichment analysis of the DEG dataset with a cutoff value of P < 0.001 using the DAVID 60This was done by. Gene interactions related to cartilage and / or bone development, BMP signaling, TGF-β signaling, and Wnt signaling were searched for with a high confidence score (≥ 0.7) using the STRING database (https: / / string-db.org / ) and further analyzed using Cytoscape (www.cytoscape.org) based on the degree of nodal connectivity. Gene Set Enrichment Analysis (GSEA) 61 But Mast4 + / + Or Mast4 - / - Number of false positives and false negatives in any of the mice 62 Balance >0.3 FPKM expressed PN day 1 Mast4 + / + and Mast4 - / - This was applied with the background dataset of the invention consisting of all DEGs analyzed from mouse tibial cartilage and bone.

[0162] Example 8 Reverse transcription PCR (RT-PCR) and real-time RT-PCR

[0163] Total RNA was prepared using EasyBlue (Boca Scientific) and 2 μg of RNA was reverse transcribed using M-MLV reverse transcriptase (Promega) according to the manufacturer's instructions. RT-PCR was performed using AccuPower PCR with specific primer pairs. TM PCR premix (Bioneer) was used. Quantitative real-time PCR was performed using Power SYBR Green PCR Master Mix (Applied Biosystems) on a QuantStudio 5 Real-Time PCR Instrument (Applied Biosystems). mRNA levels of various genes were measured in triplicate and normalized to Gapdh. Information on the oligonucleotides used in this study is provided as follows:

[0164] Example 9 Histological Analysis

[0165] For cartilage immunofluorescence staining, tissues were fixed overnight at 4°C with 4% paraformaldehyde (Wako) in 0.01M PBS (pH 7.4), followed by decalcification using 10% EDTA solution. After embedding in paraffin (Leica Biosystems), samples were sectioned at a thickness of 6 μm. Tissue sections were incubated overnight at 4°C with primary antibodies against Mast4 (Bioworld Technology), Col2a1 (Abcam), and Sox9 (Cell Signaling Technology). After washing in PBS, tissue sections were successively incubated in AlexaFluor488 (Invitrogen) for 2 h at room temperature. Tissue sections were then incubated in TO-PRO (商標) The cells were counterstained with -3 (Invitrogen) for 15 min. Images were taken using a confocal microscope DMi8 (Leica). To detect collagen tissue, sections were stained with freshly prepared Russell-Movat modified pentachrome (American MasterTech) according to the manufacturer's protocol. Images were standard thresholded to binary and positive pixels were counted using a Leica Microsystem CTR 6000 (Leica). For bone immunofluorescence staining, mice were anesthetized, perfusion-fixed with 4% PFA, and femurs and tibias were collected. Samples were fixed overnight in 2% PFA at 4°C. Samples were decalcified in 0.5M EDTA solution for 6 days. Samples were then embedded in 5% low melting point agarose (Invitrogen) and cut into 150 μm sections by vibratome (Leica, CT1200S). After removing the agarose from the sections, the sections were permeabilized with PBST (0.3% Triton X-100 in phosphate-buffered saline) for 20 min and blocked with 5% goat serum in PBST for 30 min. The sections were incubated with primary antibodies diluted in blocking solution for 2 h at room temperature, washed three times with PBS, and treated with secondary antibodies in blocking solution for 75 min at room temperature. After washing the sections three times in PBST and three times with PBS, the sections were mounted on microscope slides using fluorescent mounting medium (DAKO). Primary antibodies and reagents used for immunofluorescence were as follows: CD31 (Millipore, MAB1398Zm, 1:150), MMP13 (Abcam, 1:150), Osterix (Abcam, 1:300), Runx2 monoclonal (Cell Signaling Technology, 1:150). Secondary antibodies and reagents used for IF were as follows: FITC-conjugated anti-hamster IgG (Jackson ImmunoResearch, 1:300), Cy3-conjugated anti-rabbit IgG (Jackson ImmunoResearch, 1:300). Stained bone sections were analyzed at high resolution using a Zeiss LSM 880 confocal microscope (Carl Zeiss). Z-stacks of images were processed using Zen software.

[0166] Example 10: Elemental mapping by EPMA

[0167] An electron probe microanalyzer (EPMA-1610; Shimadzu, Kyoto, Japan) was used for elemental mapping of Ca, P, and Mg. Undecalcified 6-week-old mouse tibiae were embedded in epoxy resin and trimmed with a diamond disk to expose the sagittal plane. After polishing, the specimens were sputter-coated with carbon before elemental analysis. For each experiment, 256 x 256 pixel mapping was performed. The accelerating voltage and beam current were set to 15 kV and 0.03 μA, respectively, and the integrating time was 0.05 s for each pixel.

[0168] Example 11 Micro CT

[0169] Three-dimensional reconstructed computed tomography images were obtained by scanning the mineralized SPC-bearing bone regions with a MicroCT, Skyscan 1076 (Antwerp). The data were then digitized using a frame grabber, and the resulting images were sent to a computer for analysis using the Comprehensive TeX Archive Network (CTAN) topographic reconstruction software.

[0170] Example 12 In vivo calcein labeling

[0171] Three-week-old mice were injected intraperitoneally with 50 mg / kg calcein (Sigma-Aldrich, St. Louis, MO) in 5% sodium bicarbonate solution. Mice were labeled 7 and 2 days before sacrifice. Tibias were fixed in 4% paraformaldehyde at room temperature for 1 day. Samples were incubated in 10% (v / v) KOH for 96 h and analyzed as described in references. 63 The samples were embedded in paraffin as described in. The embedded samples were sectioned at a thickness of 5 μm and visualized under a confocal microscope (DMi8, Leica, Germany). The distance between the labels in the cortical bone was measured at three points per sample.

[0172] Example 13 Morphometry of Growth Plate

[0173] For morphometric analysis, the total thickness of the growth plate cartilage at the proximal end of each tibia was measured on H&E- or pentachrome-stained section images oriented at 90° to the transverse plane of the growth plate and spaced equally along an axis parallel to the longitudinal axis of the bone. Three measurements were obtained from each epiphyseal growth plate, and the final thickness determination in each individual animal represented the average of these values ​​using image analysis software (ImageJ, ver. 1.38e, NIH, USA). The width of the layer occupied by hypertrophic chondrocytes was measured in the same way. In addition, the percentage of the hypertrophic layer relative to the total thickness of the growth plate was calculated. Three left and right tibiae were used for each group.

[0174] Example 14 Isolation of mouse skeletal stem cells using flow cytometry

[0175] Citation Protocol 27 Briefly, 5-week-old male Mast4 cells were cultured in a 30-well plate using FACS separation. + / + and Mast4 - / -Mice (n=5) were sacrificed and the humeri, femurs and tibias were subsequently dissected. Cells were isolated by a combination of mechanical and chemical digestion, and red blood cells were removed by ammonium chloride potassium (ACK) lysis buffer. + CD45 + Hematopoietic cells were filtered by magnetic activated cell sorting (MACS). The remaining cells were then stained for the following antibodies: CD45, TER119, TIE2, ITGAV, CD202B, THY1.1, THY1.2, CD105, and 6C3. 7-AAD was used for live / dead cell discrimination. FACS analysis was performed on a FACS Aria II Instrument (BD Biosciences) and analyzed by FlowJo v10.7.1 and BD FACSDiva v9.0.1 software.

[0176] Example 15 In vivo chondrogenesis assay

[0177] Control and Mast4-depleted C3H10T1 / 2 cells were cultured in chondrogenic differentiation medium containing BMP-2 (150 ng / ml) for 4 days in micromass cultures. Cells were resuspended in PBS (100 micromass cultures at 100 μl / injection) and injected subcutaneously into the flank of athymic nude mice (6-week-old female; n=4). After 2 weeks, mice were euthanized and grafts were harvested for IHC evaluation. The volume of the cartilage-containing grafts was measured and expressed as a function of the formula V=(A*B 2 ) / 2 (where V is the volume (mm 3 ), A is the major axis (mm), and B is the minor axis (mm). All experiments were performed in accordance with the guidelines provided by the Institutional Animal Care and Use Committee of Center for Phenogenomics Animal Research Facility, Woojung BSC (Suwon, Korea, Association for Assessment and Accreditation of Laboratory Animal Care-accredited facility).

[0178] Example 16 In vivo implantation in a rabbit model of full-thickness cartilage defects

[0179] A full-thickness cartilage defect model was prepared as previously reported. 64 Briefly, 13 healthy New Zealand white male rabbits (body weight 3.0–3.5 kg) were obtained 4 weeks before the experiment. The rabbits were anesthetized with zoletil and xylazine. Under aseptic conditions, a parapatellar incision (skin incision) was made on the right knee, and the patella was laterally dislocated. A full-thickness osteochondral defect (3 mm diameter, 3 mm deep) was created in the center of the trochlear groove of the femur by drilling. Cartilage and bone fragments were removed, and the defect site was carefully washed with saline. Vehicle (PBS 50 μl), naïve or MAST4-depleted hBMSCs (2 × 10 in 50 μl) were then added to the graft. 6 Cells; passages 6–7) were transplanted into the defect site (n = 3 for vehicle, n = 5 for naïve and MAST4-depleted hBMSCs), followed by patellar repositioning. The wound was closed with 4-0 nylon sutures. All procedures were performed in accordance with the guidelines provided by the Institutional Animal Care and Use Committee of KNOTUS Co., Ltd. (Incheon, Korea).

[0180] Example 17 Chromatin Immunoprecipitation

[0181] Cells were cross-linked with 1% formaldehyde for 10 min at room temperature. Glycine was added to a final concentration of 125 mM for 5 min to quench formaldehyde cross-linking. Cells were washed with ice-cold phosphate-buffered saline, harvested by scraping, pelleted, and resuspended in SDS lysis buffer (50 mM Tris-HCl [pH 8.1], 1% SDS, 10 mM EDTA) containing complete protease inhibitor cocktail (Roche). Cell extracts were sonicated with a Bioruptor TOS-UCW-310-EX (power, 250 W; 23 cycles of sonication with 30-s intervals; Cosmo Bio). Samples were centrifuged at 18,472 × g for 10 min at 4 °C, and the supernatant was diluted 10-fold with dilution buffer (20 mM Tris-HCl [pH 8.0], 2 mM EDTA, 1% Triton X-100, 150 mM NaCl, and complete protease inhibitor cocktail). Chromatin samples were pretrained with protein A-agarose beads (Santa Cruz) for 2 h before immunoprecipitation against Sox9 and Smad3 (Abcam) antibodies overnight at 4 °C. Immune complexes were collected with protein A-agarose beads. The samples were washed five times: first with low-salt immunoconjugate wash buffer [20 mM Tris-HCl, pH 8.0, 2 mM EDTA, 1% Triton X-100, 0.1% SDS, and 150 mM NaCl], second with high-salt immunoconjugate wash buffer [20 mM Tris-HCl, pH 8.0, 2 mM EDTA, 1% Triton X-100, 0.1% SDS, and 500 mM NaCl], third with LiCl conjugate wash buffer [10 mM Tris-HCl, pH 8.0, 1 mM EDTA, 250 mM LiCl, 1% NP-40, and 1% Na-deoxycholate], and the last two with TE buffer. Immunoprecipitated samples were eluted with a buffer containing 1% SDS and 100 mM NaHCO3 at room temperature. The eluate was heated at 65°C overnight and NaCl was added to a final concentration of 100 mM before cross-linking was reversed. Genomic DNA was extracted with a PCR purification kit (GeneAll). Precipitated chromatin and readouts by real-time PCR were normalized using 5% input chromatin for each sample. Experiments were repeated at least twice. Binding of Sox 9 to the Col2a1 gene was detected using a forward primer of 5'-AACCCTGCCCGTATTTATT-3' (SEQ ID NO: 25) and a reverse primer of 5'-TGTGCATTGTGGGAGAGG-3' (SEQ ID NO: 26). Binding of Smad3 to the Mast4 gene was detected using a forward primer of 5'-TGCTGACACTTTATTTTGCTCT-3' (SEQ ID NO: 27) and a reverse primer of 5'-CATCTCCAAGCCTCTTTCTG-3' (SEQ ID NO: 28).

[0182] Example 18 Ubiquitination Assay

[0183] Flag-MAST4-PDZ, GFP-Smruf1, GFP-GSK-3β, and HA-Ub plasmids were transfected into C3H10T1 / 2 cells, followed by MG-132 treatment (10 μM for 6 h). Cells were boiled for 10 min in SDS lysis buffer [10 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1% SDS, 5 mM NEM, protease inhibitors], followed by 10-fold dilution in dilution buffer [10 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1% Triton X-100]. Lysed samples were immunoprecipitated overnight with Flag antibody (Sigma-Aldrich), and antibody-bound proteins were precipitated with Dynabeads. The precipitated samples were washed with washing buffer A [10 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1% Triton X-100, 0.1% SDS] and B [10 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1% Triton X-100], followed by Western blotting.

[0184] Example 19 Luciferase Assay

[0185] C3H10T1 / 2 cells were transfected with 4xCol2a1-luc, a Smad3 / 4 responsive promoter (CAGA 12Cells were transiently transfected with -luc, SBE-luc, 6xOSE-luc, MAST4-promoter luciferase report plasmid, HA-MAST4 PDZ, and Myc-Sox9 WT / S494A / S494D plasmids using polyethylenimine (Polysciences). Cells were treated with TGF-β1 (3 ng / ml, 24 h) (R&D Systems) and Vactosertib (500 nM, 26 h). Luciferase activity was analyzed using the Luciferase Assay System Kit (Promega) according to the manufacturer's protocol. All assays were performed in triplicate, and all values ​​were normalized for transfection efficiency to β-galactosidase activity.

[0186] Example 20 Immunoprecipitation assay and Western blot analysis

[0187] For immunoprecipitation assays, cell extracts were incubated with the indicated primary antibodies overnight at 4 °C. Antibody-bound proteins were precipitated with Dynabeads Protein G (Invitrogen). Cells were lysed in RIPA buffer containing a protease inhibitor cocktail (Complete; Roche). Samples were separated by SDS-PAGE and subsequently electrotransferred to polyvinylidene difluoride membranes (PVDF; Millipore). Membranes were blocked for 1 h at room temperature and incubated with primary antibodies overnight at 4 °C. Horseradish peroxidase-conjugated antibodies (Millipore) were used as secondary antibodies. Peroxidase reaction products were visualized with WESTZOL (Intron). All signals were detected by an Amersham Imager 600 (GE Healthcare Life Sciences).

[0188] Example 21 In-gel digestion for sample preparation for mass spectrometry

[0189] The gel band corresponding to Myc-Sox9 size was excised and destained sequentially with 50% (v / v) acetonitrile (ACN) prepared in 25 mM ammonium bicarbonate and 100 mM ammonium bicarbonate for 15 min. Proteins were reduced with 20 mM DTT at 60°C for 1 h and then alkylated with 55 mM iodoacetamide at room temperature for 45 min in the dark. After dehydration, proteins were digested with trypsin / Lys-C mix, mass spectrometry grade (Promega, Madison, WI, USA), prepared in 50 mM ammonium bicarbonate at 37°C overnight. Peptides were extracted from the gel pieces with 50% (v / v) ACN prepared in 5% formic acid, dried under a Centrivap concentrator (Labconco, Kansas City, MO, USA), and stored at -20°C until use.

[0190] Example 22 Mass spectrometry for detection of phosphorylation of Sox9

[0191] Peptide samples extracted by in-gel digestion were suspended in 20 μl of solvent A (0.1% formic acid prepared in water, Optima LC / MS grade, ThermoFisher Scientific). Then, 4 μl of the sample was loaded onto an EASYSpray C18 column (75 μm × 50 cm, 2 μm) and separated with a 2–35% gradient of solvent B (0.1% formic acid prepared in ACN) for 65 min at a flow rate of 300 nL / min. Mass spectra were recorded on a Q Exactive hybrid quadrupole-Orbitrap mass spectrometer (Thermo Fisher Scientific) interfaced with a nano-ultra HPLC system (Easy-nLC1000; Thermo Scientific). The spray voltage was set to 1.5 kV and the temperature of the heated capillary was set to 250 °C. The Q-Exactive was operated in data-dependent mode, with each cycle of survey consisting of a full MS scan in the mass range 300-1400 m / z and an MS / MS scan on the 10 most intense ions. The exclusion time for previously fragmented peptides was 20 s. Higher energy collisional dissociation was used to fragment peptides, and the normalized collision energy value was set to 27%. The resolutions for the full MS and MS / MS scans were 70,000 and 17,500. The advanced gain control target was 5 × 10 4 , maximum injection time was set to 120 ms, and isolation window was set to 3 m / z.

[0192] Raw data were processed by using Trans-Proteomic Pipeline (v4.8.0 PHILAE) to convert them into searchable format mzXML files. Database search of sequenced peptides was with Sequest (version 27) algorithm in SORCERER (Sage-N Research, Milpitas) platform with Uniprot human database. Parent ion and fragment ion tolerance were set at 10 ppm (monoisotope) and 1 Da (monoisotope), respectively. Fixed modification was set at 57 Da cysteine ​​(carbamidoethylation). Variable modifications were set at 16 Da methionine (oxidation) and 80 Da serine, threonine, tyrosine (phosphorylation). Trypsin was selected as the enzyme with the highest tolerance of up to two deletion cleavages. MS / MS-based peptide and protein identifications were verified using the Scaffold software package (version 3.4.9, Proteome Software Inc., Portland, OR, USA). The thresholds for peptide and protein identification were 95% min and 95% min, 2 peptides min, respectively. The peptide and protein FDRs were 0.2% (Decoy) and 0.6% (Decoy).

[0193] Example 23 Statistical Analysis

[0194] All quantitative experiments were performed in triplicate and / or repeated at least three times. Data are expressed as mean ± SD. Student's t-tests were performed using GraphPad Prism version 5 (GraphPad Software Inc.). P < 0.05 was considered statistically significant. Significance was achieved at P < 0.05.

[0195] Example 24 Results

[0196] Example 24.1 Mast4 regulates chondro-osteogenic gene expression in MSCs

[0197] We identified microtubule-associated serine / threonine kinase 4 (Mast4) as one of the genes downregulated during chondrogenic differentiation of C3H10T1 / 2 mouse mesenchymal stromal cells and ATDC5 mouse chondrogenic cells (Fig. 1a and Fig. 8). To investigate the role of Mast4 in MSC differentiation, we used the CRISPR / Cas9 system to downregulate Mast4 by either BMP-2 or TGF-β1 (Fig. 9a, 9b). 22 (SEQ ID NOs: 32, 33, 34, 35, 36) in C3H10T1 / 2 cells undergoing chondrogenic differentiation. We observed increased expression of cartilage-specific genes and decreased expression of matrix metallopeptidase (Mmp)-9 / 13 by CRISPR / Cas9-mediated Mast4 depletion and shRNA-mediated Mast4 knockdown in undifferentiated C3H10T1 / 2 cells (Figures 9c, 9d). Furthermore, during differentiation into chondrocytes under BMP-2 stimulation in high-density microculture, the induction of cartilage matrix genes occurred earlier and was enhanced in Mast4-depleted C3H10T1 / 2 cells (Fig. 1b and Fig. 9d). Interestingly, we noticed that the Mast4-depletion-mediated increase in Sox9 protein expression was more obvious than that of Sox9 mRNA expression, implying post-translational regulation of Sox9 by Mast4 (Fig. 10). Because Sox9 is a key transcription factor of chondrocyte-specific genes, the increased amount of Sox9 protein induced by Mast4 depletion may help maintain the chondrocytic character of C3H10T1 / 2 cells. Next, we generated Mast4-overexpressing C3H10T1 / 2 cells to examine whether Mast4 inhibits chondrogenesis. Due to the high molecular weight (>285 kDa) and relatively low expression of full-length Mast4, a truncated Mast4 construct containing the DUF, kinase, and PDZ domains (Mast4-PDZ) was used instead (Fig. S1a). We found that forced expression of Mast4-PDZ protein efficiently suppressed the expression of chondrocyte marker genes (Fig. S1b).

[0198] We further characterized the enhanced chondrogenesis induced by Mast4 depletion by performing RNA sequencing on Mast4-depleted C3H10T1 / 2 micromass cultures and wild type treated with BMP-2 for 6 days. Differentially expressed genes (DEG) analysis identified 151 upregulated and 220 downregulated genes in Mast4-depleted C3H10T1 / 2 cells (Figure 12). Gene ontology enrichment analysis and heatmaps revealed that chondrocyte differentiation (FDR=1.01x10 -3 ) and cartilage development (FDR=5.05x10 -6 We showed that genes related to chondrogenic differentiation and osteogenic differentiation were significantly enriched in Mast4-depleted cells (Fig. S1c and Fig. 1c). The expression of upregulated genes involved in cartilage development (Fig. 1d) and downregulated genes involved in bone formation (Fig. 1e) in chondrogenic and osteogenic differentiated Mast4-depleted cells, respectively, was confirmed by qRT-PCR. Furthermore, among collagen genes, cartilage-specific collagen genes (Col2a1, Col9a1, Col9a2, Col9a3, Col11a1, Col11a2) were specifically upregulated by Mast4 depletion (Fig. 13). Notably, 21 significantly upregulated genes related to cartilage and chondrocyte development in Mast4-depleted cells highly interacted with genes related to BMP and TGF-β signaling pathways, which play important roles in chondrogenesis in addition to cartilage development in the transcriptional network (Fig. 1f). Interestingly, Sox9 directly interacted with BMP2 and TGF-β1 and seemed to function as a hub of the network as a larger node in the two signaling pathways. In summary, our data suggest that Mast4 may play an important role in regulating chondrogenic differentiation of MSCs.

[0199] Example 24.2 Mast4 regulates chondrogenesis by regulating Sox9 stability

[0200] We next examined the effect of Mast4 on chondrogenesis of MSCs (Fig. S13a). The difference in cell proliferation was not significant between wild-type and Mast4-depleted cells, but cell proliferation was significantly increased in Mast4-PDZ-overexpressing C3H10T1 / 2 cells (Fig. S13b). However, Alcian blue staining demonstrated that chondrogenic differentiation in Mast4-depleted cells was enhanced, whereas overexpression of Mast4-PDZ suppressed chondrogenic differentiation (Fig. 2a and Fig. S13c). 3D spheroid formation assay using low-binding platelets 23also showed increased spheroid size and cartilage-specific gene expression by Mast4 depletion (Fig. S13d, 13e). Furthermore, chondrogenic differentiation of MAST4-deficient human bone marrow-derived stem cells (hBMSCs) significantly increased the size of cartilage aggregates and increased the mRNA expression of COL2A1 and ACAN (Fig. 2b and Fig. S15). Chromatin immunoprecipitation (ChIP) assay further revealed that Mast4 deficiency significantly increased the binding of Sox9 protein to the promoter region of Col2a1 gene during chondrogenic differentiation, which was decreased by Mast4 overexpression (Fig. S16a). Notably, depletion of Mast4 was sufficient to significantly increase the binding of Sox9 protein to the promoter region of Col2a1 gene even in the absence of TGF-β1 treatment, which activates Col2a1 gene transcription via Sox918 (Fig. S2c). On the other hand, overexpression of Mast4-PDZ reduced basal and TGF-β1-induced Col2a1 promoter activity and increased Sox9-induced Col2a1 promoter activity, which was more pronounced in Mast4-deficient cells (Figure 16b and Figure 2d).

[0201] Observing an increase in Sox9 protein expression upon Mast4 depletion (Fig. 10), we investigated the post-translational regulation of Sox9 protein stability by Mast4. Considering that Mast4 functions as a serine / threonine kinase, we investigated whether Mast4 induces Sox9 protein phosphorylation, leading to its proteolysis. We found that Mast4 bound to Sox9 and that overexpression of not only full-length but also truncated Mast4 reduced Sox9 protein expression in a dose-dependent manner, which was restored by blocking Mast4 expression with siRNA (Figs. 2e, 2f and Fig. 16c). As expected, Sox9 serine phosphorylation was significantly decreased in Mast4-deficient cells, whereas basal Sox9 protein expression was increased, suggesting that Mast4 may promote Sox9 degradation by inducing Sox9 phosphorylation (Fig. 2g and Fig. S16d). Indeed, Mast4-induced Sox9 degradation was restored by MG-132 treatment (Fig. S16e). To identify the Mast4-mediated phosphorylation site in Sox9 protein, we transiently overexpressed Sox9 and Mast4-PDZ proteins in C3H10T1 / 2 cells in the presence of MG-132 to prevent Mast4-mediated Sox9 degradation. We then immunoprecipitated Sox9, followed by MASS SPEC analysis. MASS SPEC analysis revealed that serine 494, whose phosphorylation status is regulated by Mast4 (Fig. 2h). Notably, Mast4-induced Sox9 degradation was more obvious in C3H10T1 / 2 cells transfected with Sox9 WT and S494D substitution mutant of Sox9 protein, which mimics phosphorylation, whereas S494A substitution mutant of Sox9 protein was hardly degraded by Mast4 (Fig. 2i). Furthermore, we found that luciferase activity of the Sox9-induced Col2a1 promoter reporter by Sox9 S494A was increased in wild-type cells and was comparable to that by Sox9 WT in Mast4-depleted cells (Fig. 2j). Interestingly, the difference in Col2a1 promoter activity by Sox9 WT, S494A, and S494D was not significant in the absence of Mast4. Furthermore, the reduction in Col2a1 activity mediated by Mast4-PDZ was not significant in Sox9 S494A-transfected cells (Fig. S17). We further observed increased chondrogenesis in C3H10T1 / 2 cells stably overexpressing Sox9 S494A and decreased chondrogenesis in cells overexpressing Sox9 S494D by Alcian blue staining and RT-PCR of chondrocyte marker genes (Fig. 2k, 2l). These results indicated that Mast4-mediated Sox9 protein phosphorylation at serine 494 may play an important role in the chondrogenic differentiation of MSCs.

[0202] Example 24.3 TGF-β-induced Mast4 inhibition enhances Sox9-Smad3 association

[0203] We observed an interaction between Mast4 and Smad3 proteins, as well as an increase in TGF-β1 / Smad3-induced transcriptional activity in Mast4-deficient cells ( FIG. 18 ). In addition, previous reports have shown that Smad3 mediates the upregulation of Sox9 18 We demonstrated that Mast4 enhances Sox9-dependent transcriptional activation during chondrogenesis through its interaction with Mast4. Therefore, we hypothesized that Mast4 suppresses TGF-β1 / Smad3-induced Sox9 transcriptional activity by promoting Sox9 protein degradation and reducing Smad3-Sox9 complex formation. Indeed, Sox9 protein stability and Smad3-Sox9 association were increased by Mast4 depletion (Fig. 3a). Furthermore, we found that Mast4 depletion increased Smad3 occupancy at the Sox9 binding site of the Col2a1 gene (Fig. 3b).Importantly, Smad3 binding to the Smad7 promoter and the expression levels of TGF-β1 cytostatic target genes such as Cdkn1a, c-myc, and Smad7 were not affected by the status of Mast4 expression, indicating that TGF-β1-induced chondrogenic differentiation may depend on the levels of Mast4, which controls Sox9 protein stability (Fig. 19).

[0204] The role of TGF-β1 signaling in chondrogenic differentiation 12 Considering this, we investigated whether TGF-β1 induces chondrogenesis through regulating Mast4 expression. Interestingly, TGF-β1 treatment significantly suppressed both Mast4 mRNA and protein expression (Fig. 3c). Mast4 promoter activity was also suppressed by TGF-β1 treatment, whereas Smad3 occupancy at the Mast4 promoter was significantly increased by TGF-β1 treatment, suggesting that TGF-β1 / Smad3 signaling may negatively regulate Mast4 transcription (Fig. 3d, 3e, and Fig. 20). Notably, we observed a gradual decrease in Mast4 protein and mRNA expression levels during chondrogenic differentiation of C3H10T1 / 2 cells and in human primary chondrocytes treated with TGF-β1, respectively (Fig. 3f, 3g), which correlated well with the increase in Sox9 protein expression and mRNA expression of chondrocyte marker genes, reinforcing the findings of enhanced chondrogenesis in Mast4-deficient cells. Furthermore, inhibition of TGF-β signaling by treatment of C3H10T1 / 2 cells with the TGF-β receptor kinase inhibitor Vactosertib prevented downregulation of Mast4 gene and blocked induction of chondrocyte marker genes, indicating that suppression of Mast4 expression by TGF-β1 is essential for chondrogenic differentiation of MSCs (Figure 21). Taken together, our observations suggest that TGF-β1 / Smad3 signaling promotes chondrogenesis through the suppression of Mast4 gene expression, which subsequently leads to the accumulation of Sox9 protein.

[0205] Example 24.4 Wnt-induced Mast4 stabilization increases osteogenesis in MSCs

[0206] It is widely recognized that Wnt / β-catenin signaling plays a key role in skeletal development by governing the lineage commitment and differentiation of mesenchymal stromal cells into osteoblasts. 19Based on the observation of downregulation of genes related to osteogenesis by Mast4 depletion in C3H10T1 / 2 cells, we investigated whether Mast4 mediates Wnt / β-catenin-induced osteogenesis. Indeed, Alizarin Red S staining showed enhanced osteogenic differentiation of C3H10T1 / 2 cells by stable overexpression of Mast4-PDZ (Fig. 4a and Fig. 22a, 22b). Interestingly, Mast4 expression was elevated by Wnt3a stimulation in undifferentiated MC3T3-E1 preosteoblasts (Fig. 4b). Furthermore, osteogenic differentiation of MC3T3-E1 cells resulted in increased Mast4 expression as well as increased Wnt signaling, as indicated by increased levels of active β-catenin and inactive GSK-3β (Fig. 22c). We further observed that stable overexpression of Mast4-PDZ significantly increased β-catenin expression and subsequent Runx2 expression during osteogenic differentiation of C3H10T1 / 2 cells (Fig. 4c). These observations were supported by RNA-seq analysis, which demonstrated significant downregulation of genes related to osteogenesis in Mast4-deficient C3H10T1 / 2 cells (Fig. 1c).

[0207] With evidence for the role of Mast4 as a potent mediator of Wnt / β-catenin-induced osteogenic differentiation of progenitor cells, we found that Mast4 protein expression was dose-dependently decreased by GSK-3β, and GSK-3β inhibitor treatment dramatically increased Mast4 expression (Fig. 4d). Furthermore, inhibition of GSK-3β and depletion of GSK-3β significantly delayed the degradation of Mast4 (Fig. 22d, 22e). GSK-3β-induced phosphorylation has been found to regulate the stability of a number of target proteins 24We next examined whether GSK-3β interacts with Mast4 and induces its degradation by phosphorylating it. We observed that GSK-3β bound to the kinase domain of Mast4 and induced Mast4 serine phosphorylation (Fig. S4a, b, e). Furthermore, in a GSK3 phosphorylation-dependent manner 24 Among the reported E3 ubiquitin ligases recruited to target proteins in Mast4, Smurf1 was shown to interact with the kinase domain of Mast4 and its strength was regulated by GSK-3β status (Fig. S2c and Fig. 4f). Furthermore, we observed that Smurf1-mediated Mast4 degradation was enhanced by overexpression of GSK-3β but inhibited by depletion of GSK-3β (Fig. 4g). WW domain-containing E3 ligases, including Smurf1, recognize the consensus PY motif (PPxY). 25 Taking this into account, we found that mutation of the PY-like motif in the kinase domain of Mast4 (P628A / Y634A) prevented Smurf1-mediated Mast4 degradation, which was no longer affected by GSK-3β depletion (Fig. 4h). To map the region involved in GSK-3β-mediated degradation of Mast4 in conjunction with Smurf1, we generated serial deletion mutants (aa1-aa1229) of Mast4-PDZ. As shown in Figure 4i (SEQ ID NOs: 29, 30, and 31), the expression levels of Mast4 deletion mutants containing the region between aa620 and aa1229 of Mast4-PDZ were significantly higher than those of the predicted GSK3 consensus phosphorylation site (SxxxS). p In the presence of GSK-3β, the expression levels of Mast4 deletion mutants shorter than aa620 were significantly lower than those of the Mast4 deletion mutants shorter than aa620, suggesting that the Mast4 deletion mutants may contain the aa1 gene. Interestingly, amino acid deletion of residues S632-S636 reduced Smurf1-mediated Mast4 polyubiquitination, which was enhanced by GSK-3β, while increasing Mast4 stability (Fig. 4j). Finally, β-catenin nuclear localization and Runx2 transcriptional activity were increased by Mast4 overexpression and further enhanced by blocking GSK3β regulation of Mast4 by S632-S636 deletion (Fig. 4k, 4l). Moreover, either Mast4-PDZ overexpression or depletion of GSK-3β led to a significant increase in Runx2 transcriptional activity and subsequent osteogenic differentiation of C3H10T1 / 2 cells (Fig. 24). Taken together, our data suggest that Mast4, which is stabilized by Wnt-mediated GSK-3β inhibition, may function as a key mediator of Wnt / β-catenin-induced osteogenesis.

[0208] Example 24.5 Mast4 - / - Skeletal abnormalities in mice

[0209] To investigate the role of Mast4 in MSC differentiation, we used a CRISPR / Cas9-mediated knockout system to knock out Mast4 - / - We generated mice (Figures 25a to 25d (SEQ ID NOs: 37, 38, 39, 40, 41, and 42)). - / - Although the mice were viable, they were reduced in size compared to wild-type littermates (Figure 25e). Although we cannot exclude the possibility that effects of Mast4 on other organs also contribute to the small size of the mice, because MSCs are found in many internal organs of adult mice, we focused on studying whether disruption of the Mast4 gene affects the differentiation of MSCs during endochondral ossification in long bones. Mast4 expression is regulated by Mast4 expression on postnatal day (PN). + / +Mast4 expression was observed throughout the mouse tibial growth plate (Fig. 26a). Interestingly, increased expression of Mast4 was observed in hypertrophic chondrocytes, but a smaller portion was localized to proliferating chondrocytes in the tibia. This observation supports our findings of enhanced chondrogenic differentiation of C3H10T1 / 2 cells by Mast4 depletion and suggests a role for Mast4 in mediating the switch to bone growth at the terminal stage of chondrocyte differentiation. Indeed, stronger expression of Sox9 and Col2a1 proteins, two important chondrocyte markers, was observed in Mast4+ / - mice on day 1 of PN. - / - Pentachrome staining also revealed that Mast4 cells were expressed on day 1 of PN. - / - The mice showed an increased thickening layer in the proximal epiphysis (FIG. 5c and FIGS. 26b, 26c). Furthermore, yellowish pentachrome staining was observed in Mast4 cells at 3 weeks of PN. - / - was detected in the mouse growth plate, suggesting that Mast4 depletion may contribute to collagen synthesis in the growth plate (FIG. 5d). Mast4 - / - The thickness of the tibial growth plate in mice was significantly increased by Mast4 at 1 and 3 weeks after PN. + / + The ratio of the hypertrophic layer to the total thickness of the growth plate was significantly decreased at PN 6 weeks (Fig. 26b, 26d). However, the ratio of the hypertrophic layer to the total thickness of the growth plate was significantly decreased in Mast4 mice at PN 3 and 6 weeks. - / - It was significantly increased in mice (Figure 26e). This observation was made by Mast4 - / - These results suggest that excessive cartilage synthesis in the hypertrophic region of the mouse growth plate leads to reduced proliferation of the growth plate, resulting in abnormal ossification. The increased hypertrophy layer is associated with increased expression of Mmp9. - / - and Mmp13 - / - This is observed in both mice and 26 Because this is the predominant phenotype, Mast4 - / -The increase in the hypertrophic zone in mice may be associated with the downregulation of Mmp9 and Mmp13 observed in Mast4-depleted C3H10T1 / 2 cells (FIG. 1d and FIG. 9c).

[0210] On the other hand, Mast4 - / - μCT statistical analysis of the mice showed an osteoporotic phenotype with significant loss of metaphyseal trabecular bone, more porous and thinner cortical bone, and reduced bone mass and mineral density (Figure 5e and Figures 27a, 27b). Furthermore, electron probe microanalyzer (EPMA) showed that 6-week-old Mast4 mice had a significantly decreased metaphyseal trabecular bone, a more porous and thinner cortical bone, and a decreased bone mass and mineral density (Figure 5c). - / - Mouse tibiae showed low levels of mineral ions important for bone development and health, such as magnesium (Mg), phosphate (P), and calcium (Ca) (Figure 27c). - / - Mouse, Mast4 + / + We observed that mice with PN mice showed significantly reduced bone formation as measured by dual calcein labeling, and shorter limb length compared to mice (Fig. 5f and Fig. 27d). Consistently, decreased expression of Osterix, an osteoblast marker important for bone formation, and Mmp13, a marker of mature osteoblasts and a target of Osterix, was observed on day 1 of PN. - / - This was observed in the proximal tibia and distal femur of mice (FIG. 5g and FIG. 28).

[0211] Furthermore, using cell surface marker expression, Mast4 + / + and Mast4 - / - CD45 from mice - TER119 - TIE2 - ITGAV + THY1 - 6C3 - CD105 - We isolated a purified population of skeletal stem cells 27Functional evaluation of these stem cells by in vitro colony formation assays revealed enhanced chondrogenic differentiation, indicated by stronger Alcian Blue staining intensity, but not Mast4, indicated by weaker Alizarin Red S staining intensity. - / - It suppressed osteogenic differentiation, as demonstrated by the ability of mouse skeletal stem cells (Fig. 5h and Fig. 30). Bone marrow-derived stem cells (BMSCs) were also isolated and induced to undergo chondrogenic and osteogenic differentiation. Consistently, Mast4 - / - Chondrogenic but osteogenic differentiation was enhanced in mouse BMSCs (Figure 31). Collectively, our data suggest that Mast4 regulates MSC differentiation fate towards cartilage or bone in vivo.

[0212] Example 24.6 Mast4 - / - Cartilage phenotype in mouse tibiae

[0213] To better understand the role of Mast4 in MSC differentiation, we investigated the role of Mast4 in MSC differentiation on day 1 of PN. - / - RNA from mouse tibia and cartilage was collected and combined with that from wild-type mice (3 mice per group) for RNA sequencing. Differential expression (DE) analysis revealed 175 upregulated (CL1) and 181 downregulated (CL2) genes in bone, as well as Mast4. - / - Tissue-specific expression was demonstrated in mouse cartilage with 108 upregulated (CL4) and 327 downregulated (CL5) genes (Fig. 32a). Gene Ontology (GO) enrichment analysis revealed a high association with skeletal development (D in Fig. 32b; represented by CL2, CL3, and CL4; P=4.5x10 -8 ~9.3x10 -4Notably, 17 of the 120 common differentially expressed genes (DEGs; CL3), which were mostly identified as cartilage-specific Sox9 target genes in skeletal development, showed differential switches of expression between bone and cartilage (Figure 3b), suggesting functional involvement in MSC differentiation. Gene set enrichment analysis of DEGs also revealed that a significant number of DEGs in cartilage were assigned to cartilage development (FDR = 0.001), and DEGs in bone were assigned to skeletal development (FDR = 0.004) and the Wnt signaling pathway (FDR = 0.002) (Figures 6a and 6b). In particular, the majority of Sox9 target genes were associated with Mast4 - / - It was upregulated in mouse cartilage but not in bone. Mast4 - / - We analyzed the networks of Sox9 and Runx2 target genes that showed differential expression in mouse cartilage and / or bone. These Sox9 and Runx2 targets were highly interacted with genes related to skeletal system development, including cartilage and bone development, TGF-β signaling, BMP signaling, and Wnt signaling (Figure 6c). Genes related to cartilage development were highly interacted with Sox9 target genes (i.e., Tgfb1, Bmp7, and Bgn; DE in cartilage). However, genes related to bone development and Wnt signaling mostly interacted with common target genes of Sox9 and Runx2 (i.e., Nog, Bmp2, and Sox9; DE in bone), or with Runx2 targets (i.e., Smad6; DE in bone). Interestingly, the network of Sox9 target genes showed regulation of collagen family and CL3 switch genes in bone and cartilage. Taken together, our results suggest that Mast4 is a key regulator of a transcriptional network involved in the development of the skeletal system.

[0214] Next, wild-type and Mast4 - / - In cartilage tissue isolated from mouse tibiae, the expression of selected cartilage matrix genes and Sox9 target genes in the transcriptional network was further examined by qRT-PCR on PN day 1 (Fig. 33a,b). In particular, collagenase genes (Mmp9 and Mmp13) were downregulated and Mast4 was upregulated. - / - This supported the observation of an increase in the hypertrophic layer in Mast4 mice (Fig. 5c). - / - We found that the mRNA expression of genes involved in osteoblast differentiation was decreased in mouse bone tissue (Fig. 33c, 33d). Consistent with these observations, increased Sox9 and Col2a1 and decreased β-catenin, Runx2, and Mmp13 protein expression were associated with the upregulation of Mast4, Mast5, and Mast6 expression, respectively. - / - This was observed in mouse cartilage and bone tissues (FIGS. 6d and 6e). In summary, Mast4 - / - Our results on the molecular phenotype of mice support that Mast4, through regulation of Sox9, regulates the expression of the aforementioned genes, ultimately promoting chondrogenesis in vivo.

[0215] Example 24.7 Mast4 depletion promotes cartilage formation and repair

[0216] To further examine the effect of Mast4 depletion on chondrogenesis in vivo, differentiated wild-type and Mast4-depleted C3H10T1 / 2 microcultures were subcutaneously implanted into nude mice for the evaluation of cartilage formation (Figure 34a). After 2 weeks, the implants formed by Mast4-depleted cells showed a significant increase in volume (Figure 7a). Previous reports have shown that chondrogenesis from transplants of MSCs was hardly observed by subcutaneous implantation, but was significantly increased by using a diffusion chamber. 28 or implanted into the cartilage defect. 29 showed that this was more commonly observed by Similar to these reports, grafts formed by both wild-type and Mast4-depleted C3H10T1 / 2 cells did not contain a high portion of cartilage lymph nodes. However, we found an increased incidence of cartilage nodule formation in grafts formed by Mast4-depleted cells. To confirm whether lymph nodes consisted of cartilage, tissue sections were stained with pentachrome (Fig. 34b). Increased collagen deposition around lymph nodes was shown in grafts formed by Mast4-depleted cells. Furthermore, Col2a1, a chodrogenic marker protein, and Sox9 protein were highly expressed in grafts formed by Mast4-depleted cells (Fig. 7b). Taken together, these results suggest that depletion of Mast4 can enhance the chondrogenic commitment of MSCs in vivo.

[0217] Next, we evaluated the effect of MAST4 depletion in human bone marrow-derived stem cells (hBMSCs) on cartilage repair in a rabbit full-thickness cartilage defect model. Because hBMSCs could not form colonies from individual cells, we used pools of CRISPR / Cas9-mediated MAST4-depleted cells that exhibited at least 70% indels, frameshifts, or 21+ bp indels. No abnormal findings or severe inflammatory responses were observed. The defects in knee joints treated with vehicle (PBS) or transplanted with naive hBMSCs were vacant and distinguishable from the surrounding tissue, whereas knee joints transplanted with MAST4-depleted hBMSCs showed smooth white repaired tissue that covered the defect without obvious rims of normal surrounding cartilage (Figure 7c and Figure 35). The structure of the repair tissue in MAST4-deficient hBMSC-transplanted knee joints resembled that of normal surrounding cartilage, whereas that in untreated hBMSC-transplanted knee joints showed irregular surfaces and significant gaps in the border regions. Furthermore, increased Safranin O and Massons trichrome staining without significant gaps was observed in the repair tissue of MAST4-depleted hBMSC-transplanted knee joints, indicating enhanced production of cartilage tissue and collagen matrix, respectively. Immunohistochemical staining for type II collagen further revealed that transplantation of MAST4-depleted hBMSCs resulted in significantly stronger expression and similar density to the surrounding normal tissue. Overall, modified Wakitani score analysis 30 demonstrated that transplantation of MAST4-deficient hBMSCs into the defect site significantly improved cartilage repair and regeneration (FIG. 7d and FIG. 36). Taken together, these results suggest that Mast4 depletion may be a useful tool for MSC-based treatment for cartilage regeneration.

[0218] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention specifically described herein. Such equivalents are intended to be encompassed by the scope of the claims. [Prior art documents] [Non-patent literature]

[0219] 1 Pittenger, MF et al. Multilineage potential of adult human mesenchymal stem cells. Science (New York, NY) 284, 143-147 (1999). 2 Chen, Q. et al. Fate decision of mesenchymal stem cells: adipocytes or osteoblasts? Cell Death & Differentiation 23, 1128-1139, doi:10.1038 / cdd.2015.168 (2016). 3 Bell, D. M. et al. SOX9 directly regulates the type-ll collagen gene. Nature Genetics 16, 174-178, doi:10.1038 / ng0697-174 (1997). 4 Lefebvre, V., Huang, W. D., Harley, V., Goodfellow, P. N. & de Crombrugghe, B. SOX9 is a potent activator of the chondrocyte-specific enhancer of the Proa1(II) collagen gene. Molecular and cellular biology 17, 2336-2346, doi:10.1128 / MCB.17.4.2336 (1997). 5 Bi, W., Deng, J. M., Zhang, Z., Behringer, R. R. & de Crombrugghe, B. Sox9 is required for cartilage formation. Nature Genetics 22, 85-89, doi:10.1038 / 8792 (1999). 6 Sekiya, I. et al. SOX9 enhances aggrecan gene promoter / enhancer activity and is up-regulated by retinoic acid in a cartilage-derived cell line, TC6. The Journal of biological chemistry 275, 10738-10744 (2000). 7 Liu, C. J. et al. Transcriptional activation of cartilage oligomeric matrix protein by Sox9, Sox5, and Sox6 transcription factors and CBP / p300 coactivators. Frontiers in bioscience : a journal and virtual library 12, 3899-3910, doi:10.2741 / 2359 (2007). 8 Lefebvre, V. & Dvir-Ginzberg, M. SOX9 and the many facets of its regulation in the chondrocyte lineage. Connect Tissue Res 58, 2-14, doi:10.1080 / 03008207.2016.1183667 (2017). 9 Chikuda, H. et al. Cyclic GMP-dependent protein kinase II is a molecular switch from proliferation to hypertrophic differentiation of chondrocytes. Genes & development 18, 2418-2429, doi:10.1101 / gad.1224204 (2004). 10 Huang, W., Chung, U. I., Kronenberg, H. M. & de Crombrugghe, B. The chondrogenic transcription factor Sox9 is a target of signaling by the parathyroid hormone-related peptide in the growth plate of endochondral bones. Proceedings of the National Academy of Sciences of the United States of America 98, 160-165, doi:10.1073 / pnas.011393998 (2001). 11 Haudenschild, D. R., Chen, J., Pang, N., Lotz, M. K. & D'Lima, D. D. Rho kinase-dependent activation of SOX9 in chondrocytes. Arthritis and rheumatism 62, 191-200, doi:10.1002 / art.25051 (2010). 12 Joyce, M. E., Roberts, A. B., Sporn, M. B. & Bolander, M. E. Transforming growth factor-beta and the initiation of chondrogenesis and osteogenesis in the rat femur. The Journal of cell biology 110, 2195-2207 (1990). 13 Kawakami, Y., Rodriguez-Le?n, J. & Izpis?a Belmonte, J. C. The role of TGFbetas and Sox9 during limb chondrogenesis. Current opinion in cell biology 18, 723-729, doi:10.1016 / j.ceb.2006.10.007 (2006). 14 Chen, C. G., Thuillier, D., Chin, E. N. & Alliston, T. Chondrocyte-intrinsic Smad3 represses Runx2-inducible matrix metalloproteinase 13 expression to maintain articular cartilage and prevent osteoarthritis. Arthritis and rheumatism 64, 3278-3289, doi:10.1002 / art.34566 (2012). 15 Yang, X. et al. TGF-beta / Smad3 signals repress chondrocyte hypertrophic differentiation and are required for maintaining articular cartilage. The Journal of cell biology 153, 35-46 (2001). 16 Coricor, G. & Serra, R. TGF-β regulates phosphorylation and stabilization of Sox9 protein in chondrocytes through p38 and Smad dependent mechanisms. Scientific Reports 6, 38616, doi:10.1038 / srep38616 (2016). 17 Chavez, R. D., Coricor, G., Perez, J., Seo, H. S. & Serra, R. SOX9 protein is stabilized by TGF-β and regulates PAPSS2 mRNA expression in chondrocytes. Osteoarthritis and Cartilage 25, 332-340, (2017). 18 Furumatsu, T., Tsuda, M., Taniguchi, N., Tajima, Y. & Asahara, H. Smad3 induces chondrogenesis through the activation of SOX9 via CREB-binding protein / p300 recruitment. The Journal of biological chemistry 280, 8343-8350, doi:10.1074 / jbc.M413913200 (2005). 19 Baron, R. & Rawadi, G. Targeting the Wnt / beta-catenin pathway to regulate bone formation in the adult skeleton. Endocrinology 148, 2635-2643, doi:10.1210 / en.2007-0270 (2007). 20 Gaur, T. et al. Canonical WNT signaling promotes osteogenesis by directly stimulating Runx2 gene expression. The Journal of biological chemistry 280, 33132-33140, doi:10.1074 / jbc.M500608200 (2005). 21 Kugimiya, F. et al. GSK-3beta controls osteogenesis through regulating Runx2 activity. PLoS One 2, e837, doi:10.1371 / journal.pone.0000837 (2007). 22 Denker, A. E., Haas, A. R., Nicoll, S. B. & Tuan, R. S. Chondrogenic differentiation of murine C3H10T1 / 2 multipotential mesenchymal cells: I. Stimulation by bone morphogenetic protein-2 in high-density micromass cultures. Differentiation; research in biological diversity 64, 67-76, doi:10.1046 / j.1432-0436.1999.6420067.x (1999). 23 Redondo-Castro, E. et al. Generation of Human Mesenchymal Stem Cell 3D Spheroids Using Low-binding Plates. Bio Protoc 8, doi:10.21769 / BioProtoc.2968 (2018). 24 Xu, C., Kim, N. G. & Gumbiner, B. M. Regulation of protein stability by GSK3 mediated phosphorylation. Cell Cycle 8, 4032-4039, doi:10.4161 / cc.8.24.10111 (2009). 25 Huang, S. S., Hsu, L. J. & Chang, N. S. Functional role of WW domain-containing proteins in tumor biology and diseases: Insight into the role in ubiquitin-proteasome system. FASEB Bioadv 2, 234-253, doi:10.1096 / fba.2019-00060 (2020). 26 Stickens, D. et al. Altered endochondral bone development in matrix metalloproteinase 13-deficient マウス. Development 131, 5883, doi:10.1242 / dev.01461 (2004). 27 Gulati, G. S. et al. Isolation and functional assessment of mouse skeletal stem cell lineage. Nature Protocols 13, 1294-1309, doi:10.1038 / nprot.2018.041 (2018). 28 Ashton, B. A. et al. Formation of bone and cartilage by marrow stromal cells in diffusion chambers in vivo. Clin Orthop Relat Res, 294-307 (1980). 29 Noel, D. et al. Short-term BMP-2 expression is sufficient for in vivo osteochondral differentiation of mesenchymal stem cells. Stem Cells 22, 74-85, doi:10.1634 / stemcells.22-1-74 (2004). 30 Lee, J. et al. Fully Dedifferentiated Chondrocytes Expanded in Specific Mesenchymal Stem Cell Growth Medium with FGF2 Obtains Mesenchymal Stem Cell Phenotype In Vitro but Retains Chondrocyte Phenotype In Vivo. Cell Transplant 26, 1673-1687, doi:10.1177 / 0963689717724794 (2017). 31 Siegel, P. M. & Massague, J. Cytostatic and apoptotic actions of TGF-beta in homeostasis and cancer. Nature reviews. Cancer 3, 807-821, doi:10.1038 / nrc1208 (2003). 32 Wu, M., Chen, G. & Li, Y. P. TGF-beta and BMP signaling in osteoblast, skeletal development, and bone formation, homeostasis and disease. Bone research 4, 16009, doi:10.1038 / boneres.2016.9 (2016). 33 Matsunobu, T. et al. Critical roles of the TGF-β type I receptor ALK5 in perichondrial formation and function, cartilage integrity, and osteoblast differentiation during growth plate development. Developmental Biology 332, 325-338, (2009). 34 Massague, J., Seoane, J. & Wotton, D. Smad transcription factors. Genes & development 19, 2783-2810, doi:10.1101 / gad.1350705 (2005). 35 Kang, J. S., Alliston, T., Delston, R. & Derynck, R. Repression of Runx2 function by TGF-beta through recruitment of class II histone deacetylases by Smad3. The EMBO journal 24, 2543-2555, doi:10.1038 / sj.emboj.7600729 (2005). 36 Chen, C. R., Kang, Y., Siegel, P. M. & Massague, J. E2F4 / 5 and p107 as Smad cofactors linking the TGFbeta receptor to c-myc repression. Cell 110, 19-32 (2002). 37 Minoo, P. et al. SMAD3 prevents binding of NKX2.1 and FOXA1 to the SpB promoter through its MH1 and MH2 domains. Nucleic acids research 36, 179-188, doi:10.1093 / nar / gkm871 (2008). 38 Deribe, Y. L., Pawson, T. & Dikic, I. Post-translational modifications in signal integration. Nature structural & molecular biology 17, 666-672, doi:10.1038 / nsmb.1842 (2010). 39 Hong, X. et al. SOX9 is targeted for proteasomal degradation by the E3 ligase FBW7 in response to DNA damage. Nucleic acids research 44, 8855-8869, doi:10.1093 / nar / gkw748 (2016). 40 Akiyama, H., Chaboissier, M. C., Martin, J. F., Schedl, A. & de Crombrugghe, B. The transcription factor Sox9 has essential roles in successive steps of the chondrocyte differentiation pathway and is required for expression of Sox5 and Sox6. Genes & development 16, 2813-2828, doi:10.1101 / gad.1017802 (2002). 41 Hattori, T. et al. E6-AP / UBE3A protein acts as a ubiquitin ligase toward SOX9 protein. The Journal of biological chemistry 288, 35138-35148, doi:10.1074 / jbc.M113.486795 (2013). 42 Clevers, H. & Nusse, R. Wnt / beta-catenin signaling and disease. Cell 149, 1192-1205, doi:10.1016 / j.cell.2012.05.012 (2012). 43 Sutherland, C. What Are the bona fide GSK3 Substrates? Int J Alzheimers Dis 2011, 505607, doi:10.4061 / 2011 / 505607 (2011). 44 Clement-Lacroix, P. et al. Lrp5-independent activation of Wnt signaling by lithium chloride increases bone formation and bone mass in マウス. Proceedings of the National Academy of Sciences of the United States of America 102, 17406-17411, doi:10.1073 / pnas.0505259102 (2005). 45 Marsell, R. et al. GSK-3 inhibition by an orally active small molecule increases bone mass in rats. Bone 50, 619-627, doi:10.1016 / j.bone.2011.11.007 (2012). 46 Pearce, L. R., Komander, D. & Alessi, D. R. The nuts and bolts of AGC protein kinases. Nature reviews. Molecular cell biology 11, 9-22, doi:10.1038 / nrm2822 (2010). 47 Clay, M. R., Varma, S. & West, R. B. MAST2 and NOTCH1 translocations in breast carcinoma and associated pre-invasive lesions. Human pathology 44, 2837-2844, doi:10.1016 / j.humpath.2013.08.001 (2013). 48 Valiente, M. et al. Binding of PTEN to specific PDZ domains contributes to PTEN protein stability and phosphorylation by microtubule-associated serine / threonine kinases. The Journal of biological chemistry 280, 28936-28943, doi:10.1074 / jbc.M504761200 (2005). 49 Hibar, D. P. et al. Novel genetic loci associated with hippocampal volume. Nature communications 8, 13624, doi:10.1038 / ncomms13624 (2017). 50 Steffens, M. et al. Genome-wide association analysis of genetic generalized epilepsies implicates susceptibility loci at 1q43, 2p16.1, 2q22.3 and 17q21.32. Human molecular genetics 21, 5359-5372, doi:10.1093 / hmg / dds373 (2012). 51 De Simone, R., Puig, X. S., Gelisse, P., Crespel, A. & Genton, P. Senile myoclonic epilepsy: delineation of a common condition associated with Alzheimer's disease in Down syndrome. Seizure 19, 383-389, doi:10.1016 / j.seizure.2010.04.008 (2010). 52 Nagel, A. K., Schilling, M., Comte-Walters, S., Berkaw, M. N. & Ball, L. E. Identification of O-linked N-acetylglucosamine (O-GlcNAc)-modified osteoblast proteins by electron transfer dissociation tandem mass spectrometry reveals proteins critical for bone formation. Mol Cell Proteomics 12, 945-955, doi:10.1074 / mcp.M112.026633 (2013). 53 Lee, S.-J. et al. Mast4 knockout shows the regulation of spermatogonial stem cell self-renewal via the FGF2 / ERM pathway. Cell Death & Differentiation 28, 1441-1454, doi:10.1038 / s41418-020-00670-2 (2021). 54 Meka, S. R. K., Chacko, L. A., Ravi, A., Chatterjee, K. & Ananthanarayanan, V. Role of Microtubules in Osteogenic Differentiation of Mesenchymal Stem Cells on 3D Nanofibrous Scaffolds. ACS Biomaterials Science & Engineering 3, 551-559, doi:10.1021 / acsbiomaterials.6b00725 (2017). 55 Cong, L. et al. Multiplex genome engineering using CRISPR / Cas systems. Science (New York, N.Y.) 339, 819-823, doi:10.1126 / science.1231143 (2013). 56 Yi, T. et al. Manufacture of Clinical-Grade Human Clonal Mesenchymal Stem Cell Products from Single Colony Forming Unit-Derived Colonies Based on the Subfractionation Culturing Method. Tissue Eng Part C-Me 21, 1251-1262, doi:10.1089 / ten.tec.2015.0017 (2015). 57 Lee, D. K. et al. Continuous transforming growth factor beta1 secretion by cell-mediated gene therapy maintains chondrocyte redifferentiation. Tissue Eng 11, 310-318, doi:10.1089 / ten.2005.11.310 (2005). 58 Kim, D. et al. TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol 14, R36, doi:10.1186 / gb-2013-14-4-r36 (2013). 59 Trapnell, C. et al. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nature Biotechnology 28, 511-515, doi:10.1038 / nbt.1621 (2010). 60 Huang da, W., Sherman, B. T. & Lempicki, R. A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc 4, 44-57, doi:10.1038 / nprot.2008.211 (2009). 61 Subramanian, A. et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proceedings of the National Academy of Sciences of the United States of America 102, 15545-15550, doi:10.1073 / pnas.0506580102 (2005). ) 62 Ramskold, D., Wang, E. T., Burge, C. B. & Sandberg, R. An abundance of ubiquitously expressed genes revealed by tissue transcriptome sequence data. PLoS Comput Biol 5, e1000598, doi:10.1371 / journal.pcbi.1000598 (2009). 63 Rauch, D. A. et al. The ARF tumor suppressor regulates bone remodeling and osteosarcoma development in マウス. PloS one 5, e15755-e15755, doi:10.1371 / journal.pone.0015755 (2010). 64 Park, Y. B. et al. Single-stage cell-based cartilage repair in a rabbit model: cell tracking and in vivo chondrogenesis of human umbilical cord blood-derived mesenchymal stem cells and hyaluronic acid hydrogel composite. Osteoarthritis Cartilage 25, 570-580, doi:10.1016 / j.joca.2016.10.012 (2017).

Claims

1. A pharmaceutical composition for preventing, treating, or ameliorating joint diseases, comprising mesenchymal stem cells, chondrocytes, or chondrocyte precursor cells in which the expression or activity of microtubule-associated serine / threonine kinase family member 4 (MAST4) protein is suppressed for the regeneration of connective tissue.

2. The composition of claim 1 , wherein the cells are allogeneic to the host.

3. The composition of claim 1, wherein the cells are treated with a composition comprising a compound that inhibits the expression or activity of microtubule-associated serine / threonine kinase family member 4 (MAST4) protein.

4. The composition of claim 3, wherein the compound is a chemical compound, a polypeptide, or a polynucleotide, or a combination thereof.

5. The composition of claim 4, wherein the polypeptide is an antibody or an antigen-binding molecule.

6. 5. The composition of claim 4, wherein the polynucleotide is a microRNA (miRNA), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a Piwi-interacting RNA (piRNA), a small nuclear RNA (snRNA), or an antisense oligonucleotide, or a combination thereof.

7. The composition of claim 4, wherein the compound is a CRISPR-Cas comprising a guide RNA specific for a nucleic acid encoding a MAST4 protein or a fragment thereof.

8. the guide RNA is a duplex RNA comprising a CRISPR RNA (crRNA) specific for a nucleic acid encoding a MAST4 protein or a fragment thereof and a transcription-activating crRNA (tracrRNA); or 8. The composition of claim 7, wherein the guide RNA is a single-stranded guide RNA that comprises a portion of crRNA and tracrRNA and hybridizes to a nucleic acid encoding a MAST4 protein or a fragment thereof.

9. A pharmaceutical comprising the composition of claim 1, wherein the composition is applied to a subject at or near a joint at a site where cartilage formation is desired.

Images