Targeting ART1 for cancer immunotherapy

Abstract

Antibodies that bind to human ART1 and uses thereof are provided.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of the filing date of U.S. Application No. 63 / 307,502, filed February 7, 2022, the disclosure of which is incorporated herein by reference.

[0002] INCORPORATION BY REFERENCE The Sequence Listing is provided herewith as an xml file, "2306900.xml," created on February 2, 2023 and having a size of 99,523 bytes. The contents of the xml file are incorporated herein by reference in their entirety.

[0003] GOVERNMENT RIGHTS STATEMENT This invention was made with Government support under Grant W81XWH1910422 awarded by the Department of Defense. The Government has certain rights in this invention. [Background technology]

[0004] background ADP-ribosyltransferase 1 (ART1), a mono-ADP-ribosyltransferase of the ARTC family, functions extracellularly to ADP-ribosylate cell surface proteins or target soluble proteins in the local tumor microenvironment. Mono-ADP-ribosylation can be blocked by arginine analogs and nicotinamide mimetics that act as competitive inhibitors. Such analogs include novobiocin, an antibiotic that has previously been safely utilized in lung cancer clinical trials based on other non-targeted mechanisms. A second known inhibitor of mono-ADP-ribosylation is metaiodobenzylguanidine (MIBG), a norepinephrine analog with a long safety record useful in medical imaging methods. MIBG can exert an inhibitory effect on the metastatic properties of hepatocellular carcinoma cell lines, possibly through inhibition of mono-ADP-ribosylation. In addition to these well-described inhibitors of mono-ADP-ribosylation, tremendous efforts have been made by pharmaceutical companies to develop small molecule inhibitors of intracellular poly- and mono-ADP-ribosylation. These drugs inhibit NAD at the enzyme active site. + These agents, including ART1, have been shown to inhibit NAD because they are designed to compete with NAD1 and because they are mostly based on benzamide or purine structures. + It is possible that they inhibit other enzymes that utilize ART1 monoribosyltransferase activity, however, these are not specific for ART1 monoribosyltransferase activity. Summary of the Invention

[0005] overview The present disclosure provides selective inhibitors of ART1, such as inhibitors of mono ADP-ribosylation, to suppress tumor growth and promote immune cell cytotoxicity against ART1-expressing cells, such as cancer cells, including lung cancer cells.In particular, the present disclosure provides antibodies, fragments thereof, and single-chain ART1-binding polypeptides, such as antibodies that bind to ART1, that target ART1, i.e., extracellular mono ADP-ribosyltransferase, for the treatment of diseases, including cancer.For example, as disclosed herein, ART1 is highly expressed in multiple human non-small cell lung cancer (NSCLC) lines with different driver mutation status, and strong ART1 protein expression has been observed in the majority of human lung adenocarcinomas.Experiments in genetically engineered mouse adenocarcinoma models suggest that overexpression of ART1 plays an important role in the survival and metastatic growth of disseminated tumor cells, possibly by protecting against immune cells in the tumor microenvironment. Therefore, compounds that specifically inhibit ART1 or its function, such as anti-human ART1 specific antibodies or portions thereof, can be used as targeted therapeutic agents in cancers that overexpress ART1, for example in NSCLC patients, to limit metastatic spread of cancer by promoting immune-mediated destruction of disseminated cells. As an extracellular enzyme target, ART1 has high druggability by various therapeutic modalities, including antibodies and fragments thereof. In addition, inhibitors of ADP-ribosylation can be used in combination therapy with cytotoxic chemotherapy or immune checkpoint inhibitors. ART1 inhibitors are useful for a wide variety of cancers, including, for example, colon or breast cancer. The inhibitors can be useful for inhibiting cancer progression and / or metastasis.

[0006] The present disclosure provides an isolated antibody that binds to human ART1 and optionally mouse ART1. The antibody can be produced from a vertebrate cell, for example, transfected with a nucleic acid sequence encoding an anti-ART1 antibody or an antigen-binding fragment thereof, or a polypeptide that inhibits the activity of human ART1, for example, from an immune cell or hybridoma that expresses a monoclonal antibody. In one embodiment, an isolated monoclonal antibody that binds to human and mouse ART1 is provided. The nucleic acid sequence encoding the anti-ART1 antibody or an antigen-binding fragment thereof, or the polypeptide, can be operably linked to a promoter, for example, a heterologous promoter. The cell can be a mammalian cell, a primate cell, an insect cell, or a plant cell. In one embodiment, an isolated nucleic acid is provided, comprising a promoter operably linked to a nucleotide sequence encoding at least the variable region of a human or mouse heavy or light chain that binds to human and / or mouse ART1.

[0007] In one aspect, an expression cassette is provided comprising a nucleic acid sequence encoding an anti-ART1 antibody or antigen-binding fragment thereof, or a polypeptide that inhibits the activity of human ART1, the sequence being: TIFF2025508690000001.tif46170, or a polypeptide having at least 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto.

[0008] In one aspect, an expression cassette is provided comprising a nucleic acid sequence encoding an anti-ART1 antibody or antigen-binding fragment thereof, or a polypeptide that inhibits the activity of human ART1, the sequence being: S NARMGVS (SEQ ID NO: 21), TIFF2025508690000002.tif28170, encoding multiple CDRs; TIFF2025508690000003.tif126170, or encodes a polypeptide having at least 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto.

[0009] In one aspect, an expression cassette is provided comprising a nucleic acid sequence encoding an anti-ART1 antibody or antigen-binding fragment thereof, or a polypeptide that inhibits the activity of human ART1, the sequence being: TIFF2025508690000004.tif16167, encoding multiple CDRs; Optionally, one or more framework regions having the sequence: TIFF2025508690000005.tif28170; These encode polypeptides having at least 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto.

[0010] In one embodiment, the antibody or antigen-binding fragment thereof or polypeptide comprises CDRs comprising SEQ ID NO:21, SEQ ID NO:22 and SEQ ID NO:23, as well as SEQ ID NO:28, SEQ ID NO:29 and SEQ ID NO:30.

[0011] In one embodiment, the antibody or antigen-binding fragment thereof or polypeptide comprises CDRs comprising SEQ ID NO:35, SEQ ID NO:36 and SEQ ID NO:37, as well as QSVSSSY (SEQ ID NO:42), GAS (SEQ ID NO:43) and SEQ ID NO:44.

[0012] In one embodiment, the antibody or antigen-binding fragment thereof or polypeptide comprises CDRs comprising SEQ ID NO:66, SEQ ID NO:67 and SEQ ID NO:68, as well as SEQ ID NO:81, SEQ ID NO:29 and SEQ ID NO:30.

[0013] In one embodiment, the framework region in the antibody or antigen-binding fragment thereof or polypeptide comprises SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26 and / or WGQGTLVTVSS (SEQ ID NO:27), or a sequence having one, two, three, four, or five conservative amino acid substitutions and, optionally, one, two, or three non-conservative substitutions.

[0014] In one embodiment, the framework region in the antibody or antigen-binding fragment thereof or polypeptide comprises SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, and / or SEQ ID NO:34, or a sequence having one, two, three, four, or five conservative amino acid substitutions and optionally one, two, or three non-conservative substitutions, or a polypeptide having at least 80%, 82%, 84%, 85%, 87%, 88%, 89%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto.

[0015] In one embodiment, the framework region in the antibody or antigen-binding fragment thereof or polypeptide comprises SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, and / or SEQ ID NO:41, or a sequence having one, two, three, four, or five conservative amino acid substitutions and optionally one, two, or three non-conservative substitutions, or a polypeptide having at least 80%, 82%, 84%, 85%, 87%, 88%, 89%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto.

[0016] In one embodiment, the framework region in the antibody or antigen-binding fragment thereof or polypeptide comprises SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, and / or SEQ ID NO:63, or a sequence having one, two, three, four, or five conservative amino acid substitutions and optionally one, two, or three non-conservative substitutions, or a polypeptide having at least 80%, 82%, 84%, 85%, 87%, 88%, 89%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto.

[0017] In one embodiment, the antibody or antigen-binding fragment thereof or polypeptide binds to a portion of human or mouse ART1, such as, for example, residues 70-100, 170-182, 192-206, or 230-245 relative to SEQ ID NO:90.

[0018] In one aspect, the CDRs are Has one, two, or three amino acid substitutions relative to TIFF2025508690000006.tif4170. For example, CDRs with one or two substitutions relative to NARMGVS (SEQ ID NO:21) include NAHMGVS (SEQ ID NO:93), QARMGIS (SEQ ID NO:94), or NGRMGVS (SEQ ID NO:95); CDRs with one, two, or three substitutions relative to HIFSNDEKSYSTSLKS (SEQ ID NO:22) include HIFSNDEKSYSTSIKS (SEQ ID NO:96), HLFSNDEKSYSTSIKS (SEQ ID NO:97), or HIFTNDEKSYSSSLKS (SEQ ID NO:98); CDRs with one or a few substitutions relative to IYGGDSWGYFDN (SEQ ID NO:23) include IYGGADSWGYFEN (SEQ ID NO:99), IYGGDSWAYFDN (SEQ ID NO:100), or LYGIDSWGYFDN (SEQ ID NO:101). NO:101).

[0019] In one aspect, the CDRs are For example, a CDR having one or two substitutions relative to _GFSLSNARMG (SEQ ID NO: 66) has GFSISNARMG (SEQ ID NO: 102), GFSASNTRMG (SEQ ID NO: 103), or GFSISNLRMA (SEQ ID NO: 104). For example, a CDR having one or two substitutions relative to IFSNDEK (SEQ ID NO: 67) has LFSNDEK (SEQ ID NO: 105) or IFSNEDK (SEQ ID NO: 106). For example, CDRs having one, two, or three substitutions relative to ARIYGGDSWGYFDN (SEQ ID NO:68) include GRIYGGDSWGYFDN (SEQ ID NO:107), ARIYAADSWGYFDN (SEQ ID NO:108), or IRAYGGDSWLYFDN (SEQ ID NO:109).

[0020] The composition having, for example, an ART1 expression cassette in a gene expression vector, an ART1-binding antibody or antigen-binding fragment thereof, or a polypeptide that binds to ART1 can be used in in vitro and in vivo methods. For example, the composition can be used to inhibit or treat cancer in a mammal, for example, by administering an effective amount of the composition to the mammal. The mammal can have lung cancer, for example, non-small cell lung cancer, colon cancer, melanoma, glioblastoma, breast cancer, or colorectal cancer. In one embodiment, the mammal is a human. In one embodiment, the amount is effective to inhibit the enzymatic activity of ART1, reduce tumor burden, inhibit metastasis, enhance immune-mediated antitumor activity, or prolong survival. In one embodiment, the mammal has a tumor that overexpresses ART1. The composition can be used to enhance immune response in a mammal in need thereof, for example, a mammal with a tumor that overexpresses ART1, for example, a mammal with NSCLC, colon cancer, or melanoma, to prevent or inhibit ART1-mediated immunosuppression in the mammal.

[0021] In one embodiment, an anti-ART1 antibody is provided that binds to and / or inhibits the activity of human ART1 and / or mouse ART1.

[0022] Further provided is an isolated cell comprising an expression cassette comprising a heterologous promoter operably linked to a nucleic acid sequence encoding an anti-human ART1 antibody or antigen-binding fragment thereof, or a polypeptide that inhibits the activity of human ART1, the antibody, the antigen-binding fragment thereof, or the polypeptide being expressed by: (i) operably linked to the third complementarity determining region (CDR) containing TIFF2025508690000008.tif4128 and / or (ii) a variable region comprising a first CDR comprising GFSLSNARM (SEQ ID NO:66) or NARMGVS (SEQ ID NO:21) operably linked to a second CDR comprising QQWSSNPPT (SEQ ID NO:30); or (iii) a variable region comprising a first CDR comprising GGSISSYY (SEQ ID NO:81) or SSSVSY (SEQ ID NO:28) operably linked to a second CDR comprising DTS (SEQ ID NO:29) operably linked to a third CDR comprising QQWSSNPPT (SEQ ID NO:30); or (iv) a variable region comprising a first CDR comprising GGSISSYY (SEQ ID NO:36) operably linked to a second CDR comprising ISTSGFT (SEQ ID NO:36) operably linked to a third CDR comprising ARDGWGRVFDI (SEQ ID NO:37). and / or (iv) a variable region comprising a first CDR comprising QSVSSSY (SEQ ID NO:42) operably linked to a second CDR comprising GAS (SEQ ID NO:43) operably linked to a third CDR comprising QQYGSST (SEQ ID NO:44). an Ig heavy chain containing a variable region comprising TIFF2025508690000010.tif31170; or In one embodiment, the cell comprises or expresses an Ig light chain (ii) comprising a variable region comprising TIFF2025508690000011.tif22170. (iii), an Ig heavy chain comprising a variable region comprising TIFF2025508690000012.tif10170; or In one embodiment, the cell has or expresses an Ig light chain comprising (iv), the Ig light chain comprising a variable region comprising TIFF2025508690000013.tif10170. TIFF2025508690000014.tif40170. In one embodiment, the cell is a mammalian cell. In one embodiment, the cell is a primate cell. In one embodiment, the cell is a human cell.

[0023] Also provided is a hybridoma comprising a nucleic acid sequence encoding an anti-human ART1 monoclonal antibody that inhibits the activity of human ART1, the antibody comprising: (i) operably linked to the third complementarity determining region (CDR) containing TIFF2025508690000015.tif4128 and / or (ii) a variable region comprising a first CDR comprising GFSLSNARM (SEQ ID NO:66) or NARMGVS (SEQ ID NO:21) operably linked to a second CDR comprising TIFF2025508690000016.tif4128; and / or (ii) a variable region comprising a first CDR comprising SSVSY (SEQ ID NO:81) or SSSVSY (SEQ ID NO:28) operably linked to a second CDR comprising DTS (SEQ ID NO:29) operably linked to a third CDR comprising QQWSSNPPT (SEQ ID NO:30); or (iii) a variable region comprising a first CDR comprising GGSISSYY (SEQ ID NO:36) operably linked to a second CDR comprising ISTSGFT (SEQ ID NO:36) operably linked to a third CDR comprising ARDGWGRVFDI (SEQ ID NO:37). and (iv) a variable region comprising a first CDR comprising QSVSSSY (SEQ ID NO:42) operably linked to a second CDR comprising GAS (SEQ ID NO:43) operably linked to a third CDR comprising QQYGSST (SEQ ID NO:44).

[0024] In one aspect, an isolated nucleic acid is provided that includes a promoter, e.g., a heterologous promoter, operably linked to a nucleotide sequence encoding at least a variable region of an Ig heavy or light chain that binds human and / or mouse ART1, the chain comprising: (i) operably linked to the third complementarity determining region (CDR) containing TIFF2025508690000017.tif4128 a variable region comprising a first CDR comprising GFSLSNARM (SEQ ID NO:66) or NARMGVS (SEQ ID NO:21) operably linked to a second CDR comprising TIFF2025508690000018.tif4128; and / or (ii) a variable region comprising a first CDR comprising SSVSY (SEQ ID NO:81) or SSSVSY (SEQ ID NO:28) operably linked to a second CDR comprising DTS (SEQ ID NO:29) operably linked to a third CDR comprising QQWSSNPPT (SEQ ID NO:30); or (iii) a variable region comprising a first CDR comprising GGSISSYY (SEQ ID NO:35) operably linked to a second CDR comprising ISTSGFT (SEQ ID NO:36) operably linked to a third CDR comprising ARDGWGRVFDI (SEQ ID NO:37); and / or (iv) a variable region comprising a first CDR comprising QSVSSSY (SEQ ID NO:42) operably linked to a second CDR comprising GAS (SEQ ID NO:43) operably linked to a third CDR comprising QQYGSST (SEQ ID NO:44).

[0025] An isolated antibody or antigen-binding fragment thereof that binds to human and mouse ART1 is provided, the antibody or antigen-binding fragment thereof comprising: (i) operably linked to the third complementarity determining region (CDR) containing TIFF2025508690000019.tif4128 and / or (ii) a variable region comprising a first CDR comprising GFSLSNARM (SEQ ID NO:66) or NARMGVS (SEQ ID NO:21) operably linked to a second CDR comprising QQWSSNPPT (SEQ ID NO:30); (iii) a variable region comprising a first CDR comprising SSVSY (SEQ ID NO:81) or SSSVSY (SEQ ID NO:28) operably linked to a second CDR comprising DTS (SEQ ID NO:29) operably linked to a third CDR comprising QQWSSNPPT (SEQ ID NO:30); and / or (iv) a variable region comprising a first CDR comprising QSVSSSY (SEQ ID NO:42) operably linked to a second CDR comprising GAS (SEQ ID NO:43) operably linked to a third CDR comprising QQYGSST (SEQ ID NO:44). In one embodiment, the variable region of (i) in the antibody or fragment thereof comprises: In one embodiment, the variable region of (ii) of the antibody or fragment thereof further comprises one or more framework regions comprising one or more of: In one embodiment, the variable region of (ii) further comprises one or more framework regions comprising one or more of: In one embodiment, the variable region of (ii) further comprises one or more framework regions comprising one or more of: In one embodiment, the variable region of (ii) further comprises one or more framework regions comprising one or more of: In one embodiment, the variable region of (iii) further comprises one or more framework regions comprising one or more of: In one embodiment, the variable region of (iv) further comprises one or more framework regions comprising one or more of: TIFF2025508690000027.tif10165.

[0026] Also provided is a method for inhibiting or treating cancer in a mammal, comprising administering to the mammal a composition comprising an effective amount of an anti-human ART1 antibody or antigen-binding fragment thereof, or a polypeptide that binds to human ART1. In one embodiment, the cancer is lung cancer, colon cancer, melanoma, glioblastoma, breast cancer, or colorectal cancer. In one embodiment, the mammal is a human. In one embodiment, the amount is effective to reduce tumor burden, inhibit metastasis, prolong survival, or any combination thereof. In one embodiment, the composition is administered intravenously or subcutaneously. In one embodiment, the method further comprises administering a chemotherapeutic agent. In one embodiment, the method further comprises administering an immune checkpoint inhibitor. In one embodiment, the antibody, antigen-binding fragment thereof, or polypeptide is (i) operably linked to the third complementarity determining region (CDR) containing TIFF2025508690000028.tif4128 a variable region comprising a first CDR comprising GFSLSNARM (SEQ ID NO:66) or NARMGVS (SEQ ID NO:21) operably linked to a second CDR comprising TIFF2025508690000029.tif4128; and / or (ii) a variable region comprising a first CDR comprising SSVSY (SEQ ID NO:81) or SSSVSY (SEQ ID NO:28) operably linked to a second CDR comprising DTS (SEQ ID NO:29) operably linked to a third CDR comprising QQWSSNPPT (SEQ ID NO:30); or (iii) a variable region comprising a first CDR comprising GGSISSYY (SEQ ID NO:35) operably linked to a second CDR comprising ISTSGFT (SEQ ID NO:36) operably linked to a third CDR comprising ARDGWGRVFDI (SEQ ID NO:37); and / or (iv) a variable region comprising a first CDR comprising QSVSSSY (SEQ ID NO:42) operably linked to a second CDR comprising GAS (SEQ ID NO:43) operably linked to a third CDR comprising QQYGSST (SEQ ID NO:44). In one embodiment, the heavy chain is an IgG heavy chain. In one embodiment, the light chain is an Igκ light chain. In one embodiment, an antibody fragment is administered. In one embodiment, the fragment is a Fab' or scFv.

[0027] Further provided is a method of preventing, inhibiting, or treating ART1-mediated immunosuppression in a mammal, comprising administering to the mammal a composition comprising an effective amount of an anti-human ART1 antibody or antigen-binding fragment thereof, or a polypeptide that binds to human ART1. In one embodiment, the mammal has cancer. In one embodiment, the mammal is a human. In one embodiment, the composition is administered intravenously. In one embodiment, the composition is administered subcutaneously. In one embodiment, the method further comprises administering a chemotherapeutic agent. In one embodiment, the method further comprises administering an immune checkpoint inhibitor. In one embodiment, the antibody, antigen-binding fragment thereof, or polypeptide is (i) operably linked to the third complementarity determining region (CDR) containing TIFF2025508690000030.tif4170 a variable region comprising a first CDR comprising GFSLSNARM (SEQ ID NO:66) or NARMGVS (SEQ ID NO:21) operably linked to a second CDR comprising TIFF2025508690000031.tif4128; and / or (ii) a variable region comprising a first CDR comprising SSVSY (SEQ ID NO:81) or SSSVSY (SEQ ID NO:28) operably linked to a second CDR comprising DTS (SEQ ID NO:29) operably linked to a third CDR comprising QQWSSNPPT (SEQ ID NO:30); or (iii) a variable region comprising a first CDR comprising GGSISSYY (SEQ ID NO:35) operably linked to a second CDR comprising ISTSGFT (SEQ ID NO:36) operably linked to a third CDR comprising ARDGWGRVFDI (SEQ ID NO:37); and / or (iv) a variable region comprising a first CDR comprising QSVSSSY (SEQ ID NO:42) operably linked to a second CDR comprising GAS (SEQ ID NO:43) operably linked to a third CDR comprising QQYGSST (SEQ ID NO:44). In one embodiment, the heavy chain is an IgG heavy chain. In one embodiment, the light chain is an Igκ light chain.

[0028] A method is provided for enhancing an immune response in a mammal having cancer, comprising administering to the mammal a composition comprising an effective amount of an anti-human ART1 antibody or antigen-binding fragment thereof, or a polypeptide that binds to human ART1. In one embodiment, the mammal is a human. In one embodiment, the heavy chain is an IgG heavy chain. In one embodiment, the light chain is an Igκ light chain. In one embodiment, the antibody, antigen-binding fragment thereof, or polypeptide is (i) operably linked to the third complementarity determining region (CDR) comprising TIFF2025508690000032.tif4131 a variable region comprising a first CDR comprising GFSLSNARM (SEQ ID NO:66) or NARMGVS (SEQ ID NO:21) operably linked to a second CDR comprising TIFF2025508690000033.tif4128; and / or (ii) a variable region comprising a first CDR comprising SSVSY (SEQ ID NO:81) or SSSVSY (SEQ ID NO:28) operably linked to a second CDR comprising DTS (SEQ ID NO:29) operably linked to a third CDR comprising QQWSSNPPT (SEQ ID NO:30); or (iii) a variable region comprising a first CDR comprising GGSISSYY (SEQ ID NO:35) operably linked to a second CDR comprising ISTSGFT (SEQ ID NO:36) operably linked to a third CDR comprising ARDGWGRVFDI (SEQ ID NO:37); and / or (iv) a variable region comprising a first CDR comprising QSVSSSY (SEQ ID NO:42) operably linked to a second CDR comprising GAS (SEQ ID NO:43) operably linked to a third CDR comprising QQYGSST (SEQ ID NO:44).

[0029] In one embodiment, an isolated antibody or fragment thereof is provided that, when binding to human ART1, binds to at least one of the following residues of human ART1, e.g., SEQ ID NO:90: ​​S75, S77, T79, R80, R89, H92, or Y99. In one embodiment, the isolated antibody or fragment thereof binds to human ART1, e.g., two, three, four, five, or six of S75, S77, T79, R80, R89, H92, or Y99 of SEQ ID NO:90. In one embodiment, the isolated antibody or fragment thereof binds to human ART1, e.g., S75, S77, T79, R80, R89, H92, and Y99 of SEQ ID NO:90. [Brief description of the drawings]

[0030] [Figure 1] Biochemical and enzymatic assays of huART1 using various MAbs. [Diagram 2] Cell-based enzymatic assay of huART1 with various MAbs. [Diagram 3] Biochemical and enzymatic assays of huART1 / moART1 using various MAbs. [Figure 4] Characterization of huART1 binding of 12F09 and 14G01. [Diagram 5] Characterization of moART1 binding of 12F09 and 14G01. [Figure 6] Characterization of purified 14G01 and 22C12. [Figure 7] KP-1- / +Dox binding 22C12. [Figure 8] KP-1- / +Dox binding 14G01. [Figure 9] KP-1 OE- / +Dox combined 22C12. [Figure 10] KP-1 OE- / +Dox combination 14G01. [Figure 11] Identification of functional ART1 antibodies. (A) Anti-human ART1 positive wells were tested for inhibition of purified human ART1 using a fluorescent readout measuring NAD+. (B) Anti-human ART1 wells were tested for inhibition of human ART1 transiently expressed in HEK293 cells by cell surface ADP-ribosylation assay. (C) Clones 22C12 and 14G01 were tested for inhibition of purified mouse ART1. Anti-ART1 hybridoma supernatants were also tested for inhibition of human ART1 transiently expressed in HEK293 cells. This method has been previously described for ART2 (Krebs et. al.). This method confirms cell surface ADP-ribosylation via an NAD+ analog (etheno-NAD+) that is then detected with an anti-etheno antibody using flow cytometry. Two hybridoma supernatants (fusion wells 22C12 and 14G01) were positive for inhibition of human ART1 in biochemical and cell-based assays. Supernatants from 22C12 and 14G01 were then tested for binding to moART1 by ELISA and inhibition of purified murine ART1. [Figure 12] Affinity measurements of 22C12 and 14G01 for human and mouse ART1 by surface plasmon resonance. Purified antibodies from hybridoma clones 22C12 and 14G01 were captured on an anti-mouse Fc surface and the indicated concentrations of analyte were injected over the surface. (A) Binding of 22C12 to human ART1. (B) Binding of 22C12 to mouse ART1. (C) Binding of 14G01 to human ART1. (D) Binding of 14G01 to mouse ART1. Sensorgrams were double reference subtracted using a control surface and blank injections. Affinity constants were determined by kinetic fit using a 1:1 binding model. [Figure 13] Dose-dependent inhibition of cell surface ADP-ribosylation by 22C12 and 14G01. HEK293 cells transiently transfected with human ART1 were incubated with the indicated concentrations of 22C12 or 14G01, followed by treatment with etheno-NAD+, staining with anti-etheno antibody, and flow cytometry. % inhibition was normalized to HEK293 cells transfected with human ART1 and stained with anti-etheno antibody without etheno-NAD+ treatment. [Figure 14]ART1 is overexpressed in a subset of human lung cancers. (A-B) ART1 immunofluorescence staining of human lung cancer cell lines A549 and H1650 and benign bronchial epithelial cell line BEAS2B. (A) Representative pictures of ART1 surface expression in non-permeabilized cells (left column) and ART1 total cell expression in permeabilized cells (right column). (B) Mean fluorescence intensity (MFI) of surface staining of ART1 in A549, H1650, and BEAS2B cells. Each dot represents ART1 MFI of one cell. (C) Ratio of surface MFI of ART1 to total MFI of ART1 in BEAS2B, A549, and H1650 cells (n=1) (graph in Figure 19A). (D) Violin plot showing qPCR analysis of ART1 in matched lung tumor tissues and normal lung tissues from patients (n=40) with stage I-III lung adenocarcinoma, Wilcoxon paired signed rank test (median is shown as dotted red line, quartiles are shown as solid red lines). (E-F) IHC analysis of ART1 expression in human tissue microarrays (TMA) containing 493 stage I adenocarcinomas. Localization of ART1 expression was scored as (1) membranous (with or without intracytoplasmic staining) or (2) only cytoplasmic of tumor cells. Tumors were scored for immune cell infiltration (listed in Table 4). (E) Representative IHC images and pie chart showing percentage of tumors stained positive for membranous or only cytoplasmic ART1 expression. (F) Percentage of tumors with low or intermediate / high CD8 in tumors with only membranous or only cytoplasmic ART1 staining. Chi-square test. Gene expression data were square root transformed prior to statistical testing. *p<0.05. (G) mRNA expression analysis of ART1 gene expression and genes associated with CD8 T cell cytotoxicity; IFN gamma (IFNG), granzyme A (GZMA), granzyme B (GZMB), perforin 1 (PRF1) 41BB (TNFRSF9) and immune regulatory genes; CTLA-4 (CTLA4), PD-1 (PDCD1), Tim-3 (HAVCR2), Lag-3 (LAG3), and Tigit (TIGIT) in lung adenocarcinoma patients from the TCGA PanCancer Atlas cohort (n=503).Clustered OncoPrint heatmap showing z-scores of mRNA expression across all samples. [Figure 15] ART1 expression promotes tumor growth in mouse lung tumor models. (A) Ectopic subcutaneous (sc) flank tumor models evaluating KP1-ART1OE tumor growth in wild-type and immunodeficient nude mice. (B-D) Orthotopic lung tumor models evaluating lung tumor burden and lung infiltration of CD8 T cells. In both ectopic and orthotopic models, KP1 cells were stably transduced with an ART-overexpressing lentiviral vector (KP1-ART1OE) and subsequently transduced with shRNA targeting ART1 (shART1). Where indicated, mice were appropriately treated with doxycycline water to induce shART1. (A) Growth curves of subcutaneous KP1-ART1OE flank tumors in immunocompetent wild-type C57BL / 6 mice (left panel, n=5 mice / group) and immunodeficient athymic nude mice (right panel, n=5 mice / group). Statistical significance of tumor growth between groups was determined by repeated measures ANOVA. (B) Schematic of the experiment on the orthotopic lung tumor model. (C) Representative images of lung sections stained with H&E (left panel) and lung nodule counts (right panel) from mice sacrificed 14 days after injection of KP1-ART1OE (n=4-5 mice / group). Welch's t-test. Lung nodules in H&E staining are indicated with black arrows. Tumor nodule counts were determined using Image J software. (D) Percentage of CD8 T cells among total lung-infiltrating leukocytes (CD45+ cells) at 16 and 25 days after tumor injection. Welch's t-test. Box plots show median and 10-90th percentiles. Percentage and count data were square-root transformed prior to statistical testing. **p<0.01. [Figure 16]ART1 blockade reduces lung tumor burden and promotes infiltration of P2X7R+CD8 T cells. (A-H) In vivo experiments studying lung tumor burden and lung immune cell analysis in mice orthotopically inoculated with KP1-ART1OE tumors by tail vein injection. Mice were given intraperitoneal (ip) treatment with ART1 blocking antibody (22C12 Ab) or isotype-matched control antibody (iso ctrl Ab) every 3 days starting on day 6 until day 18 (n=7-8 mice / group). The experiment was repeated once with similar results. (A) Schematic of the experiment. (B) Representative H&E stained images of mouse lung sections. (C) Mean lung tumor nodule count and (D) mean lung nodule area at day 19 after tumor inoculation. Welch's t-test. (E-H) Immunophenotyping by flow cytometry of digested lungs of mice at day 19 after treatment with 22C12 Ab or iso ctrl Ab. (E) Representative dot and box plots showing the percentage of CD8 T cells expressing P2X7R and / or the proliferation marker Ki67. (F) Representative dot and box plots showing the percentage of CD8 T cells expressing P2X7R and / or the immunomodulatory receptor PD-1. (G-H) Absolute counts of CD8 T cell subsets normalized to lung weight in the KP1-ART1OE lung tumor model 25 days after tumor cell injection (n=6-7). (G) Counts of P2X7R+CD8 T cells, PD-1+CD8 T cells, and Ki67 high CD8 T cells per gram of tumor-bearing lung tissue. (H) Counts of P2X7R+CD8 TCM, P2X7R+CD8 TEM, and P2X7R+CD8 TRM per gram of tumor-bearing lung tissue. Box plots show median and 10th-90th percentiles. Welch's t-test. Percentage and count data were square root transformed prior to statistical testing. (I-L) In vivo experiments studying the effect of CD8 and CD4 T cell depletion on the antitumor efficacy of ART1 blockade. On day 0, KP1-ART1OE tumors were inoculated orthotopically into mice by tail vein injection.Where indicated, mice received intraperitoneal treatment with ART1 blocking antibody (22C12 Ab) or isotype matched control antibody (isocontrol Ab) (25mg / kg), CD8 depleting antibody (clone: ​​53-6.7) or CD4 depleting antibody (clone: ​​GK1.5) at 500ug on day -1 followed by 250ug every 3 days on days 3-18 (n=7-8 mice / group). (I) Schematic of the experiment, representative H&E stained images of lung sections from (J) mice at day 19 post tumor inoculation, (K) mean lung tumor nodule count, and (L) mean lung nodule area. Tumor nodule count and area were determined using Image J software. a..u.= arbitrary units. Box plots show median and 10th-90th percentiles. One-way ANOVA. Percentage and count data were square root transformed prior to statistical testing *p<005, **p<0.01, ***p<0.001. [Figure 17]ART1-mediated ADP-ribosylation and NICD of lung tumor-infiltrating T cell subsets. (A-C) ADP-ribosylation and NICD assays. T cells isolated from wild-type KP1 tumor-bearing lungs of C57BL / 6 mice were incubated for 2 h with ethano-NAD (eNAD) alone (-rART1), or with eNAD and recombinant mouse ART1 (rART1), CD38 blocking antibody (NIMR-5) (CD38 blocking) or ART1 blocking antibody (ART1 blocking (22C12)). To measure ART1 blockade alone, ART2 blocking nanobody (s+16a) was used to block ART2 activity in all culture conditions. After co-culture, T cells were analyzed by flow cytometry for ADP-ribosylation by eNAD staining and for cell death by DAPI staining (n=7). (A) Example gating showing the identification of CD8 T cells, CD4 Tconv (CD4+CD25-), and CD4 Treg (CD4+CD25+). P2X7R+ and P2X7R- fractions of each T cell subset were analyzed separately for (B) ADP-ribosylation by total eNAD staining and (C) NICD based on eNAD and DAPI co-staining. Repeated measures one-way ANOVA was used to determine statistically significant differences between treatments. Each connected line represents paired analysis of one mouse. Percentage data were square root transformed prior to statistical testing *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 18]Overexpression of ART1 in human lung tumors is associated with low infiltration of P2X7R+CD8 T cells. (A-E) Analysis of immunofluorescence staining of lung tumor tissues and matched normal lung tissues from lung adenocarcinoma patients (n=12). (A) Representative images of ART1 immunofluorescence staining in lung tumors and matched normal tissues. (B) Bar graph showing the mean fluorescence intensity (MFI) of ART1 staining normalized to DAPI MFI in lung tumors and matched normal tissues. Paired t-test. (C) Representative images of immunofluorescence staining of CD8 (red), P2X7R (green), and nuclear staining with DAPI (blue) in lung tumors and matched normal tissues. Yellow in the merged images indicates colocalization of CD8 and P2X7R staining (highlighted by white arrows). (D) Bar graph showing the percentage of P2X7R+CD8 T cells among CD8 T cells in lung tumors and matched normal tissues. Paired t-test. (E) Linear regression analysis correlating the percent change in P2X7R+CD8 T cells in lung tumors from matched tissue with the percent change in ART1 MFI in lung tumors from matched normal tissue. R2 represents the Pearson correlation coefficient. (F-H) Flow cytometry analysis of CD8 T cells infiltrating lung tumor tissue and adjacent matched normal lung tissue from patients with lung adenocarcinoma (n=5). (F) Representative dot plots of P2X7R and CD38 expression in CD8 T cells infiltrating normal lung tissue and lung tumor tissue. (G) Percentage of CD8 T cells expressing P2X7R. Paired t-test. (H) Percentage of P2X7R+CD8 T cells with high surface expression of CD38. Bar graphs show mean values. Paired t-test. Percentage and MFI data were log-transformed prior to statistical testing *p<005, ***p<0.001, ****p<0.0001. [Figure 19]Expression of ART1 and GPLD1 in human lung cancer cell lines and tumor samples, and expression of cytotoxic and immunomodulatory genes in patients with lung adenocarcinoma (TCGA). (A) Immunofluorescent surface staining of total ART1 expression in permeabilized human lung cancer cells A549, H1650, and the benign bronchial epithelial cell line BEAS2B. Each dot represents ART1 MFI of one cell. (B) Violin plot showing GPLD1 qPCR analysis of matched lung tumor tissues and normal lung tissues from patients (n=40) with stage I-III lung adenocarcinoma, Wilcoxon paired signed rank test (median values ​​are shown as dotted red lines, quartile values ​​are shown as solid red lines). (C) IHC analysis of ART1 expression in human tissue microarrays (TMA) containing 493 stage I adenocarcinomas. Representative IHC images and pie chart showing the percentage of tumors that had weak, moderate, or strong ART1 staining. (D) Analysis of mRNA expression of ART1 gene expression and genes associated with CD8 T cell cytotoxicity; IFNγ (IFNG), Granzyme A (GZMA), 41BB (TNFRSF9) and immune regulatory genes; CTLA-4 (CTLA4), PD-1 (PDCD1), and Tigit (TIGIT) in lung adenocarcinoma patients from the TCGA PanCancer Atlas cohort (n=503). Box plots show expression of genes that showed statistically significant differences between lung adenocarcinoma patients with high ART1 tumor expression (ART1 high, z-score >1, n=115) or low ART1 tumor expression (ART1 ow, z-score <1 n=395). Box plots show median and 25th-75th percentiles. **p<0.01. [Figure 20]Overexpression and knockdown of ART1 in KP1 cells. (A) Representative images of ART1 surface immunofluorescence staining and quantification of ART1 mean fluorescence intensity (MFI) in single cells and KP1ART1OE cells with and without doxycycline induction of shART1 and Lewis lung carcinoma (LLC1) cells. Scatter plots show mean with SEM. Each dot represents ART1 MFI of single cells. (B) MAR / PAR immunofluorescence staining measuring ADP-ribosylation of KP1-ART1OE cells with and without doxycycline induction of shART1 in the presence or absence of NAD+ (20 μM). (C) Proliferation assay testing the proliferation of KP1-ART1OE cells in vitro with or without doxycycline induction of shART1. (D) ART1 immunofluorescence staining of KP1-ART1OE tumors harvested 31 days after tumor inoculation from mice with or without doxycycline induction of shART1. Graphs show mean fluorescence intensity (MFI) of ART1 staining normalized to Hoechst MFI. Box plots show median and 10th to 90th percentiles. ART1 MFI values ​​were square root transformed. Welch's t-test. *p<0.05, ****p<0.0001. [Figure 21]CRISPR / Cas9-mediated knockout of ART1 in B16-F10 cells. (A-B) Confirmation of ART1 knockout in CRISPR / Cas9 clones of B16-F10 mouse melanoma cells. B16-F10 scrambled clone B16 control (Scr-6) was transduced with a non-specific CRISPR gRNA and serves as a control. B16-F10 ART1 knockout (ART1KO) clones B16ART1KO(42-1) and B16ART1KO(63-1) were transduced with gRNAs targeting two different regions of exon 1 of the ART1 gene. (A) Flow cytometry cell surface staining of ART1 for B16 CRISPR clones B16 control (Scr-6), B16ART1KO(42-1), and B16ART1KO(63-1). Orange histograms represent cells stained with ART1 primary antibody (rabbit IgG) and Cy5-conjugated secondary anti-rabbit antibody. Blue histograms represent cells stained with secondary antibody alone. (B) Immunofluorescence staining of ART1 in vitro for B16 control clone B16 Control (Scr-6) and B16 ART1 knockout clones B16ART1KO (42-1) and B16ART1KO (63-1). (C) Flank tumor growth of B16 control clone B16 Control (Scr-6) and B16 ART1 knockout clones B16ART1KO (42-1) and B16ART1KO (63-1) in wild-type C57BL / 6 mice (n = 5-6 mice / group). Mice were injected with 1 x 105 cells of each CRISPR clone in the right flank (n = 6 mice / group). Repeated measures ANOVA from the day of tumor inoculation to day 21, P values ​​indicate statistically significant differences in tumor growth compared to B16 control (Scr-6). (D) Proliferation assay testing the proliferation of B16 CRISPR clones B16 control (Scr-6), B16ART1KO(42-1), and B16ART1KO(63-1) in vitro. Red and blue stars represent statistically significant differences in cell numbers at the indicated time points between B16 control (Scr-6) and B16ART1KO(63-1) or B16ART1KO(42-1), respectively. Student's t-test *p<0.05, **p<0.01, ***p<0.001. [Figure 22] Generation and functional testing of ART1 blocking antibody 22C12. (A) Schematic of the workflow for generation of ART1 blocking antibody 22C12. (B) Screening of ART1 binding antibody clones by NAD-Glo assay showing inhibition of ART1 activity by clone 22C12. (C) NAD-Glo assay to determine half-maximal binding (EC50) values ​​of 22C12 antibody clones with mouse light chain (22C12(mLC)) and human light chain (22C12(HuLC)) on ART1 transfected HEK293 cells. (D) Flow cytometry histogram showing binding of 22C12 antibody (mLC) to KP1-ART1OE cells. (E) Etheno-NAD (eNAD) ADP-ribosylation assay to determine half-maximal inhibition (IC50) of ADP-ribosylation of 22C12 antibody clones on ART1 transfected HEK293 cells. Hu IgG1 was used as an isotype control. 2E2 antibody was used as an irrelevant antibody. (F) 20ug / ml of 22c12 Western blot analysis of ADP-ribosylated proteins (using MAR / PAR antibody) in KP1-ART1OE cells incubated for 2 hours with the indicated concentrations of NAD+, treated with or without ART1 antibody. (G-H) Toxicity studies. Tumor-naive mice were treated with intraperitoneal injections of 25 mg / kg 22C12 antibody every 3 days for 3 weeks and monitored for weight loss and blood glucose levels at baseline and weekly until the end of the study. Mice treated with 22c12 antibody remained normal in appearance, activity, gait, and agility compared to mice treated with isotype control antibody. (G) Mouse weights shown as fold change from baseline weight on day 0. (H) Mouse plasma glucose levels shown as fold change from baseline measurements on day 0. [Figure 23]In vivo inhibition of ART1 reduces tumor burden and promotes tumor infiltration of P2X7R+CD8 T cells in KP1-ART1OE and LLC1 tumor models. (A) Schematic of the experiment for in vivo experiments (n=7-8 mice / group) studying tumor progression of KP1-ART1OE flank tumors after intratumoral (it) treatment with anti-ART1 Ab (22C12 Ab) or IgG2A isotype control Ab (isocontrol Ab). Tumors were harvested 25 days after tumor inoculation for weighting and flow cytometry analysis. The experiment was repeated once with similar results. (B) Growth of subcutaneous KP1-ARTOE flank tumors treated with it injection of 22C12 Ab or isocontrol Ab. Repeated measures ANOVA mixed effects model. (C) Tumor weight of resected tumors treated with 22C12 Ab or isocontrol Ab 25 days after tumor inoculation. Welch's t-test. (D-F) LLC1 orthotopic lung tumor model. On day 0, mice were inoculated with 1.5x105 LLC1 cells by intravenous injection. Intraperitoneal treatment with 22C12 Ab or iso-control Ab (25mg / kg, n=9 mice / group) was performed every 3 days starting on day 6 until day 21. On day 22, mice were sacrificed and lungs were fixed and stained with H&E to determine lung tumor burden. Infiltration of P2X7R+CD8 T cells in tumor-bearing lungs was assessed by flow cytometry analysis. (D) Mean lung tumor nodule count and (E) mean lung nodule area on day 22 after tumor inoculation. Tumor nodule count and area were determined using Image J software. au=arbitrary units. Welch's t-test. (F) Flow cytometry analysis of the frequency of P2X7R+CD8 T cells among total CD8 T cells infiltrating the lungs of LLC1-bearing mice 22 days after tumor inoculation. (G) Flow cytometry analysis of KP1-ART1OE-bearing mouse lungs assessing the frequency of P2X7R+CD8 T cells among total CD8 T cells in mice 18 days after tumor injection / shART1 induction (n=6 mice / group). Welch's t-test. Box plots show median and 10-90th percentiles. Percentage data were square root transformed prior to statistical testing. *p<0.05, **p<0.01. [Figure 24]CD8 / CD4 T cell depletion studies in the B16-ARTKO flank tumor model. (A-B) In vivo experiments studying the effect of CD8 and CD4 T cell depletion on the progression of ART1-proficient and ART1-deficient B16-F10 flank tumors. Wild type C57BL / 6 mice were ectopically inoculated by flank injection of 1X105 B16 control (clone Scr-6) or B16ART1KO (clone 63-1) tumor cells on day 0 (n=7-8 mice / group). Mice were treated with CD8 depleting antibody (CD8 depl, clone:53-6.7) or CD4 depleting antibody (CD4 depl, clone:GK1.5) or isotype control antibody (isocontrol). 500ug on day -2 followed by 250ug every 5 days from day 2 until endpoint. (A) Flank tumor growth curves for control B16Scr tumors (top panel) and ART1 knockout B16ART1KO tumors (bottom panel). Asterisks in the graphs indicate the number of tumor-free mice at the endpoint. (B) Kaplan-Meier plot showing the percentage of surviving mice. Log-rank (Mantel-Cox) test. *p<0.05, ***p<0.001. [Diagram 25]RNAseq analysis of P2X7R expression and immune regulatory genes in CD8 T cells from KP1 lung tumor-bearing mice, qPCR analysis of ART1 in CD8 and CD4 T cells and B16-F10 and KP1-ART1OE tumor cells. (A-B) RNA sequencing of CD8 T cells isolated from spleens and lungs of naive mice and mice inoculated intravenously with KP1 tumor cells. Tumors were harvested for CD8 T cell isolation at days 7 and 17 after tumor injection. (A) Heatmap shows gene expression of P2RX7 and genes regulating CD8 T cell cytotoxicity (GZMA, GZMB, IFNG, PRF1) and immune regulatory molecules (CTLA4, HAVCR2, LAG3, PDCD1, TIGIT). (B) Scatter plot shows gene expression of P2RX7. Kruskal-Wallis test was used to determine statistical differences between P2RX7 expression levels at the indicated time points in spleen- and lung-derived CD8 T cells separately. Scatter plots show means with SEM. (C) Representative flow cytometry histograms showing P2X7R expression in CD8 T cells infiltrating the lungs of naive or tumor-bearing mice 21 days after KP1 tumor injection. *p<0.05, **p<0.01. [Figure 26]ADP-ribosylation studies of recombinant ART1 (rART1), inhibition of ADP-ribosylation by ART1 and ART2 blocking antibodies, expression of P2RX7 splice variants in T cells and tumor cells, and tumor cell growth in the presence of NAD+ and ART1 blockade. (A) NAD-Glo assay measuring the availability of free NAD+ to ADP-ribosylate the arginine-rich substrate histone (Hist). Where indicated, ART1 was inactivated by boiling. Each dot represents a technical replicate. (B) Etheno-NAD (eNAD) assay measuring the blocking effect of ART1 and ART2 blockade on ADP-ribosylation in CD4 and CD8 T cells. T cells isolated from KP1 tumor-bearing lungs of wild-type C57BL / 6 mice were incubated with ethano-NAD (eNAD) in the presence or absence of an ART1 blocking antibody (22C12) or an ART2 blocking nanobody (s+16a) for 2 h and then analyzed for ADP-ribosylation by eNAD staining and flow cytometry (n=4). Box plots show median and 10-90 percentiles. One-way ANOVA with Tukey's test for multiple comparisons. *p<0.05, **p<0.01. (C-D) Gene expression analysis by qPCR showing expression levels of (C) p2rx7-k and (D) p2rx7-a isoforms in CD4 Tconv and CD8 T cells isolated from KP1 tumor-bearing lungs at day 15 post-tumor inoculation and in tumor cells KP1, LLC1 and B16. (E-G) Proliferation assays testing in vitro proliferation of (E) KP1ART1OE lung cells, (F) LLC1 cells, and (G) B16 CRISPR clones B16 control (Scr-6), B16ART1KO(42-1), B16ART1KO(63-1) in the presence of NAD+ (20uM) and / or ART1 blocking antibody (22c12, 20ug / ml). [Figure 27](A) Wild-type KP1 lung cancer cells were exposed to thapsigargin for 24 hours and assessed for ART1 mRNA expression by qPCR. (B) Wild-type KP1 mouse lung cancer cells and A549 human lung cancer cells were exposed to a single dose of 8 or 20 Gy or mock-treated (0 Gy) radiation therapy using the Small Animal Radiation Research Platform (SARRP). X-rays were irradiated at a dose rate of 271 cGy / min. Cell surface expression of ART1 was assessed by immunofluorescence staining 48 hours after irradiation. Scatter plots show the mean with SEM. Each dot represents the ART1 MFI of one cell. [Figure 28]CD8 T cells were isolated from wild-type KP1 tumor-bearing lungs by magnetic bead sorting using CD8(TIL)MicroBeads, mouse (Miltenyi, Cat#130-116-478) kit. Cells were added to 48-well plates pre-coated with mouse recombinant ART1 (rART1) (10μg / ml) for 24 hours at 4°C. 1×106 CD8 T cells were resuspended in serum-free RPMI1640 medium (Gibco) containing 100μM etheno-NAD and 5μg / ml anti-ART2.2 antibody (s+16a, Biolegend, Cat#149801) and added to the wells. Cells were incubated for 2 hours at 37°C. CD8 T cells were removed from the plate by gentle pipetting and fixed with 3.7% formaldehyde for 5 minutes. Cells were spun down for 30 seconds in a microcentrifuge. The supernatant was discarded and the cell pellet was resuspended in 1 mL of deionized H2O. The samples were then spun down for 30 seconds and the pellet was resuspended in 200 μL of deionized H2O. 5 μL of cell suspension was added to each gelatin-coated slide (Gelatin-Coated Microscope Slides #1178T40, Thomas Scientific). Three spots were made per slide and each spot was smeared with the side of a pipette tip. The slides were then placed on a hot plate to evaporate the liquid. Each spot was sectioned with a hydrophobic barrier and air-dried. The cells were immunostained by adding primary antibodies against CD8 (mouse (32-M4) #sc-1177), MAR / PAR (poly / mono ADP-ribose (E6F6A) rabbit mAb #83732), P2RX7 (purified rat P2X7R antibody, #148702, Biolegend) and incubated O / N at 4°C. The remaining staining procedure was identical to the approach used to immunostain adherent cells. The samples were then mounted using prolong gold mounting medium (#P36934, Thermofisher). Slides were cold cured overnight at -20°C in the dark.Fluorescence microscopy was performed using a DMIRB inverted microscope (Leica Microsystems, Deerfield, IL) equipped with a cooled charge-coupled device camera (Princeton Instruments, Trenton, NJ). Images were collected with a 20× 1.25 numerical aperture objective. MetaMorph software (Universal Imaging, West Chester, PA) was used for image processing and quantification. [Figure 29] Representative images of ART1 immunofluorescence staining in lung tumors and matched normal tissues from a patient with lung adenocarcinoma. Slides were counterstained with DAPI nuclear stain. [Diagram 30] Characterization of lung tumor-infiltrating dendritic cells (DCs) from the lungs of mice orthotopically inoculated with KP1-ART1OE tumor cells by tail vein injection. Mice were given intraperitoneal (ip) treatment with ART1 blocking antibody (22C12) or isotype-matched control antibody (isocontrol) every 3 days starting on day 6 until day 18. On day 19, mice were euthanized and lungs were weighed and digested for flow cytometric analysis. Counting beads were added prior to acquisition to allow quantification of absolute cell counts per gram of tumor-bearing lung tissue (n=7 mice / group). (A) Frequency of DCs (CD11c+MHCII+) among total live cells. (B) Frequency of conventional type I DCs (cDC1) (CD103+Sirpa-DCs) and (C) conventional type II DCs (cDC2) (CD103-Sirpa+DCs) among total DCs. Frequency of P2X7R+ cells in (D) DC, (E) cDC1 and (F) cDC2. Absolute counts of lung tumor-infiltrating (G) P2X7R+ DC, (H) P2X7R+ cDC1 and (I) P2X7R+ cDC2 normalized to lung tissue weight. Welch's t-test. Box plots show median and 10th-90th percentiles. Percentage data were square root transformed prior to statistical testing. *p<0.05, **p<0.01. [Diagram 31]CRISPR / Cas9-mediated knockout of ART1 in B16-F10 cells and 22C12-mediated blockade of Art1 causes inhibition of tumor growth in mice. Confirmation of ART1 knockout in CRISPR / Cas9 clones of B16-F10 mouse melanoma cells. B16-F10 scrambled clone B16 control (Scr-6) was transduced with a non-specific CRISPR gRNA and serves as a control. B16-F10 ART1 knockout (ART1KO) clone and B16ART1KO(63-1) were transduced with gRNA targeting a region of exon 1 of the ART1 gene. (A) Flow cytometry cell surface staining of ART1 for B16 CRISPR clones B16 control (Scr-6) and B16ART1KO(63-1). Orange histograms represent cells stained with ART1 primary antibody (rabbit IgG) and Cy5-conjugated secondary anti-rabbit antibody. Blue histograms represent cells stained with secondary antibody alone. (B) Immunofluorescence staining of ART1 in vitro for B16 control clones B16 control (Scr-6) and B16ART1KO(63-1). (C) Western blot analysis of ADP-ribosylated proteins (using MAR / PAR antibody) showing reduced MAR / PARylation upon treatment with 22C12 in B16 control (Scr-6) and B16ART1KO(63-1) cells incubated with 20μM NAD+ for 2 hours treated with or without 20ug / ml of anti-ART1 antibody 22C12. (D) Growth of subcutaneous B16 control (Scr-6) flank tumors and B16ART1KO(63-1) flank tumors treated with it injection of 22C12 Ab or isocontrol Ab showing the antitumor effect of 22C12 (***p<0.001). [Diagram 32]22C12-mediated blockade of ART1 in LLC1 leads to inhibition of mouse flank tumor growth. (A) Immunofluorescent surface staining of ART1 in LLC1 cells in vitro. (B) Flow cytometry histograms showing binding of 22C12 Ab to LLC1 cells in vitro. Orange histograms represent cells with 22C12+ antibody. Blue histograms represent secondary antibody, while red histograms represent cells labeled with isotype antibody. (C) Western blot analysis of ADP-ribosylated proteins (using MAR / PAR antibody) in LLC1 cells in vitro treated with or without 20 μg / ml of anti-ART1 antibody 22C12 and incubated with 20 μM NAD+ for 2 hours. Addition of NAD+ increased MAR / PARylation, which was partially blocked by 22C12. (D) The antitumor effect of 22C12 was demonstrated by the growth of subcutaneous LLC1 flank tumors treated with it injection of 22c12 Ab or isocontrol Ab (****P≦0.0001). [Diagram 33] Binding of TDI-Y-009 (22C12 hLC1 IgG4) to ART1 and ART1 paralogs. Bound antibody was detected by a colorimetric reaction mediated by an HRP-conjugated secondary antibody reagent. [Diagram 34] Binding of 22C12 hLC1 IgG4 (TDI-Y-009) antibody to ART1-overexpressing KP1 cells. The binding EC50 was determined to be 4.4 nM. [Diagram 35] Plasma concentrations of TDI-Y-009 in C57BL / 6 mice after a single IV bolus administration. Captured antibodies were measured by a colorimetric reaction mediated by an HRP-conjugated secondary antibody reagent. [Diagram 36] Figures 36A-36C. TDI-Y-009 inhibits tumor growth in an orthotopic lung tumor model. (A) Schematic of the experiment. (B) Mean lung weight. (C) Nodule count and (D) mean lung nodule area 19 days after tumor inoculation. Tumor nodule count and area were determined using Image J software. au = arbitrary units. Welch's t-test. [Figure 37]No adverse safety effects were observed in mice treated with TDI-Y-009. (A) Mouse body weights at weekly intervals from baseline body weight on day 0. (B) Plasma glucose levels in mice from baseline measurements on day 0 to 3 weeks after treatment. [Figure 38] Interaction of huART1 with TDI-Y-009 (SEQ ID NO: 110). [Figure 39] ART1 expression after radiation and chemotherapy. Following treatment with radiation therapy (8 Gy x 3, top row) and cisplatin (bottom row), total and surface ART1 expression was increased in KP1 cells (left panel) and A549 cells (right panel) as measured by RTPCR and by single-cell immunofluorescence. [Diagram 40] Expression of MARylation after radiation. In KP1 cells, in addition to increasing cell surface ART1, radiation therapy (8 Gy × 3) increased cell surface mono-ADP-ribosylation (MARylation) as measured by single-cell immunofluorescence using a MAR-specific antibody. The increase in MARylation was blocked by the addition of 22C12 to the cell culture. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0031] Detailed Description Immune checkpoint inhibitors (ICIs), alone or in combination with chemotherapy, have become standard of care in patients with advanced non-small cell lung cancer (NSCLC) without targetable molecular alterations (Mok et al., 2019). However, the majority of lung cancer patients, including many with high tumor PD-L1 expression, either do not respond to ICIs or do not experience long-term benefit from ICIs (Gandhi et al., 2018; Gandini et al., 2016). Thus, there is an urgent need to identify other robust biomarkers predictive of response to ICIs and to understand the mechanisms of primary and acquired resistance of lung cancer to immunotherapy.

[0032] Cell surface mono-ADP-ribosyltransferases (ARTs or ADPs) post-translationally modify target proteins by transferring an ADP-ribose moiety from NAD+ to amino acid residues. In humans, ADP-ribosyltransferase-1 (ART1) is expressed at low levels in healthy tissues, including the lung. ART1 is a GPI-anchored enzyme with an extracellular catalytic domain. Thus, ART1 can mono-ADP-ribosylate extracellular proteins in the local microenvironment and alter their function (Stevens et al., 2009; Okazaki et al., 1994; Balducci et al., 1999). Although the expression of ART1 in lung cancer has not been studied, previous studies have suggested increased ART1 protein expression in colorectal cancer and glioblastoma, where high expression was associated with poor prognosis (Tang et al., 2013). In mouse models of colorectal cancer, ART1 expression was shown to promote a more aggressive phenotype with increased epithelial-mesenchymal transition and increased angiogenesis (Yang et al., 2016; Song et al., 2016). However, it remains to be determined whether tumor ART1 expression can regulate tumor crosstalk with the immune microenvironment.

[0033] Among the targets of ADP-ribosyltransferase is the P2X7 receptor (P2X7R, gene id: P2rx7). P2X7R is an ATP-gated cation channel of the type 2 purinergic receptor family that has low affinity for extracellular ATP and activates pro-inflammatory pathways (Burnstock & Knight, 2004). It is expressed in multiple immune cell subsets, including T cells, and its expression is essential for inflammatory responses and antitumor immunity (Adinolfi et al., 2015; Haag et al., 2007). In NSCLC, high expression of P2X7R was associated with improved overall and progression-free survival (Boldrini et al., 2015). In pathological conditions such as tissue injury, tumor development, or inflammation, cytosolic NAD +is released into the local extracellular environment where extracellular ADP-ribosyltransferases can use it as a substrate to catalyze the transfer of ADP-ribose to P2X7R (Haag et al., 2007). This covalent modification results in the constitutive activation of P2X7R, leading to the formation of large pores, uncontrolled calcium influx, phosphatidylserine externalization, and ultimately to a process described as NAD-induced cell death (NICD) (Scheuplein et al., 2009). Typically, extracellular NAD + The concentration of NAD+ is generally low and tightly regulated by the ADP-ribosyl cyclase CD38, which is expressed in activated immune cells as well as cancer cells (Sandoval-Montes & Santos-Argumedo, 2005; Chen et al., 2018). However, even in the presence of CD38, the concentration of extracellular NAD+ can be elevated following its rapid release from stressed or dying cells (Haag et al., 2007). In preclinical studies, ART-mediated NICD of T cells has been proposed as a homeostatic mechanism to eliminate naive and bystander T cells in inflamed tissues (Adriouch et al., 2007). Most recently, NICD was shown to regulate the homeostasis of tissue-resident memory T cells (TRM), whose presence in lung tumors was associated with favorable prognosis (Stark et al., 2018; Nizard et al., 2017).

[0034] Escape from immune-mediated rejection allows tumor progression in non-small cell lung cancer (NSCLC) and can be countered in a subset of patients by therapeutic immune checkpoint inhibition (ICI), which restores antitumor immune function. However, the majority of NSCLC patients do not respond to ICI, suggesting the existence of additional mechanisms of tumor immune escape. Extracellular NAD + In inflamed tissues, where concentrations of NAD are high, NAD-induced cell death (NICD) of P2X7 receptor (P2X7R)-expressing T cells mediated by monoADP-ribosyltransferase (ART) regulates immune homeostasis.

[0035] Damaged or inflamed lung epithelial cells may overexpress ART1 as a mechanism of cell survival to protect against cell clearance by inflammatory cells. It was hypothesized that an evolutionarily conserved parallel protective role is provided by ART1 expression in lung cancer cells. Parallels can be drawn between ART1 and immune checkpoint pathways. In both cases, evolutionary mechanisms that exist to protect tissues from secondary damage at sites of inflammation are exploited by cancers to evade immune responses. Given the success of checkpoint inhibition as a strategy to overcome immune escape and effectively treat metastatic lung cancer, a similar strategy was envisioned for ART1 inhibition.

[0036] ART1 is overexpressed in lung cancer, is cytoprotective, and promotes metastatic growth. As described herein, inhibitors of mono ADP-ribosylation have been identified for use in therapeutic inhibition of cancer. For example, using biobanked human material, evidence of ART1 expression in human NSCLC tumors was found using whole-tumor RT-PCR, immunofluorescence, and immunohistochemistry. When compared to matched adjacent normal lung (n=40), median tumor expression of ART1 was increased by more than two-fold (p=0.01) by RT-PCR, suggesting a role in tumor development or progression. Heterogeneous expression was present by RT-PCR, implying that ART1 tumor expression may be more evident in different subpopulations of patients. Subsequently, a tissue microarray containing 184 cases of mostly (74%) stage I NSCLC was stained to determine the prevalence of NSCLC tumors staining positive for ART1. ART1 staining was moderate or strong in 83% (n=145) of adenocarcinomas and 45% (n=39, p<0.001) of squamous cell carcinomas. ART1 expression was found in all stage IV tumors.

[0037] To determine whether ART1 expression contributes to distinct phenotypic characteristics of lung cancer, we used shRNA technology (sh175KP1) to express KRAS G12D / + / p53 - / -ART1 was knocked down in a cell line, KP1 (developed from a genetically engineered mouse model). In a tail vein injection model of immunocompetent mice, a highly significant reduction in metastasis was observed in the ART1 knockdown cell line compared to its parental line. An in vitro model was used to evaluate the ability of freshly procured neutrophils from immunocompetent mice to induce apoptosis in lung cancer cells. Strikingly, at a neutrophil:tumor cell ratio of 20:1, the knockdown cell line, sh175KP1, lacking ART1 expression, was more susceptible to neutrophil-induced apoptosis in co-culture assays (87% vs. 56% Annexin V positive, p=0.05). This is consistent with the protective effect of ART1 expression on alveolar epithelial cells against neutrophil-derived proteins. Chemical inhibition of mono-ADP-ribosylation in the parental KP1 cell line with two well-established inhibitors favored neutrophil-induced apoptosis, implying that the enzymatic activity of ART1 is important for the phenotype. On this basis, it was hypothesized that ART1 expression is cytoprotective for lung cancer cells and favors metastatic growth of circulating cells through its inhibitory effect on tumor-suppressing immune cells or soluble proteins in the blood or metastatic niche. Mono-ADP-ribosylation likely also affects other immune cells in the tumor microenvironment, particularly T cells. As ART1 is an extracellular enzymatic target, it is highly druggable and therefore amenable to therapeutic intervention.

[0038] definition "Vector" refers to a macromolecule or a combination of macromolecules that contains or binds to a polynucleotide and can be used to mediate the delivery of the polynucleotide to cells, either in vitro or in vivo.Exemplary vectors include, for example, plasmids, viral vectors, liposomes, and other gene delivery vehicles.The polynucleotide to be delivered, sometimes referred to as a "target polynucleotide" or a "transgene", can include a coding sequence of interest in gene therapy (e.g., a gene encoding a protein of therapeutic interest), a coding sequence of interest in vaccine development (e.g., a polynucleotide that expresses a protein, polypeptide, or peptide suitable for generating an immune response in a mammal), and / or a selectable or detectable marker.

[0039] As used herein, "transduction", "transfection", "transformation" or "transducing" refers to a process for the introduction of an exogenous polynucleotide into a host cell resulting in expression of the polynucleotide, e.g., a transgene, in the cell, including the use of recombinant viruses to introduce an exogenous polynucleotide into a host cell. Transduction, transfection or transformation of a polynucleotide in a cell can be confirmed by methods well known to those skilled in the art, including, but not limited to, protein expression (including steady-state levels) by ELISA, flow cytometry and Western blot, DNA and RNA measurement by heterologousization assays, e.g., Northern blot, Southern blot and gel shift mobility assay. Methods used for the introduction of an exogenous polynucleotide include well-known techniques such as, for example, viral infection or transfection, lipofection, transformation and electroporation, as well as other non-viral gene delivery techniques. The introduced polynucleotide can be stably or transiently maintained in the host cell.

[0040] "Gene delivery" refers to the introduction of an exogenous polynucleotide into a cell for gene transfer and can include targeting, binding, uptake, transport, localization, replicon integration and expression.

[0041] "Gene transfer" refers to the introduction of an exogenous polynucleotide into a cell, which can include targeting, binding, uptake, transport, localization, and integration of a replicon, but is distinct from and does not imply the subsequent expression of a gene.

[0042] "Gene expression" or "expression" refers to the processes of gene transcription, translation, and post-translational modification.

[0043] The term "polynucleotide" refers to a polymeric form of nucleotides of any length, including deoxyribonucleotides or ribonucleotides or their analogs. Polynucleotides can include modified nucleotides, such as methylated or capped nucleotides and nucleotide analogs, and can be interrupted by non-nucleotide components. If present, modifications to the nucleotide structure can be added before or after assembly of the polymer. As used herein, the term polynucleotide refers interchangeably to double-stranded and single-stranded molecules. Unless otherwise specified or required, any embodiment of the disclosure described herein that is a polynucleotide encompasses both the double-stranded form and each of the two complementary single-stranded forms that are known or predicted to constitute the double-stranded form.

[0044] A "nucleic acid sequence" is intended to encompass a polymer of DNA or RNA, i.e., a polynucleotide, which may be single-stranded or double-stranded and may contain non-natural or altered nucleotides. As used herein, the terms "nucleic acid" and "polynucleotide" refer to a polymeric form of nucleotides of any length, either ribonucleotides (RNA) or deoxyribonucleotides (DNA). These terms refer to the primary structure of the molecule, and thus include double-stranded and single-stranded DNA, as well as double-stranded and single-stranded RNA. The terms include, as equivalents, analogs of either RNA or DNA made of nucleotide analogs, as well as modified polynucleotides, such as, but not limited to, methylated and / or capped polynucleotides.

[0045] An "isolated" polynucleotide, such as a plasmid, virus, polypeptide, or other substance, refers to a preparation of the substance that is devoid of at least some of the other components that may also be present when the substance or similar substance is naturally occurring or initially prepared. Thus, for example, an isolated substance can be prepared by using a purification technique to enrich it from a source mixture. An isolated nucleic acid, peptide, or polypeptide exists in a form or context that is different from that in which it is found in nature. For example, a given DNA sequence (e.g., a gene) is found on the chromosome of a host cell in close proximity to adjacent genes; an RNA sequence, such as a particular mRNA sequence that codes for a particular protein, is found in a cell as a mixture with many other mRNAs that code for many proteins. An isolated nucleic acid molecule can exist in single-stranded or double-stranded form. When an isolated nucleic acid molecule is utilized to express a protein, the molecule will minimally contain the sense or coding strand (i.e., the molecule can be single-stranded), but can contain both the sense and antisense strands (i.e., the molecule can be double-stranded). Enrichment can be measured in absolute terms, such as weight per volume of solution, or can be measured with respect to the second potential interfering substance present in the source mixture.Incremental enrichment of the embodiments of the present disclosure is envisioned.Thus, for example, 2-fold enrichment, 10-fold enrichment, 100-fold enrichment, or 1000-fold enrichment.

[0046] "Transcriptional regulatory sequence" (TRS) refers to a genomic region that controls the transcription of a gene or coding sequence to which it is operably linked. Transcriptional regulatory sequences useful in the present disclosure generally include at least one transcriptional promoter and may also include one or more enhancers and / or terminators of transcription.

[0047] "Operably linked" refers to an arrangement of two or more components in a relationship that allows the components described to function in concert. Illustratively, a transcriptional regulatory sequence or promoter is operably linked to a coding sequence if the TRS or promoter promotes transcription of the coding sequence. An operably linked TRS is generally linked in cis with the coding sequence, but is not necessarily directly adjacent to the coding sequence.

[0048] "Heterologous" means derived from a genotypically different entity than the entity to which it is being compared. For example, a polynucleotide that is introduced into a different cell type by genetic engineering techniques is a heterologous polynucleotide (and, when expressed, can encode a heterologous polypeptide). Similarly, a transcriptional regulatory element, such as a promoter, that is removed from its native coding sequence and operably linked to a different coding sequence is a heterologous transcriptional regulatory element.

[0049] "Terminator" refers to a polynucleotide sequence that tends to reduce or prevent read-through transcription (i.e., reduces or prevents transcription that starts on one side of the terminator from continuing to the other side of the terminator). The extent to which transcription is disrupted is typically a function of the base sequence and / or length of the terminator sequence. In particular, as is well known in many molecular biological systems, certain DNA sequences, commonly referred to as "transcription termination sequences", are specific sequences that tend to disrupt read-through transcription by RNA polymerase, presumably by causing the RNA polymerase molecule to stop and / or move away from the DNA being transcribed. Typical examples of such sequence-specific terminators include polyadenylation ("polyA") sequences, e.g., SV40 polyA. In addition to or instead of such sequence-specific terminators, the insertion of a relatively long DNA sequence between the promoter and the coding region also tends to disrupt transcription of the coding region, generally in proportion to the length of the intervening sequence. This effect probably occurs because there is always some tendency for the RNA polymerase molecule to break away from the DNA being transcribed, and by increasing the length of the sequence that is passed before reaching the coding region, it is generally believed that the breakaway will occur before the transcription of the coding region is completed, or perhaps even begins. Thus, a terminator can prevent transcription from only one direction ("unidirectional" terminator) or from both directions ("bidirectional" terminator), and can be composed of a sequence-specific termination sequence or a sequence-nonspecific terminator, or both. A variety of such terminator sequences are known in the art; exemplary uses of such sequences within the context of the present disclosure are provided below.

[0050] "Host cell," "cell line," "cell culture," "packaging cell line," and other such terms refer to higher eukaryotic cells, e.g., mammalian cells, including human cells, that are useful in the present disclosure for producing, e.g., recombinant viruses or recombinant fusion polypeptides. These cells include the progeny of the original transduced cell. It will be understood that the progeny of a single cell may not necessarily be completely identical (in morphology or genomic complement) to the original parent cell.

[0051] "Recombinant" as applied to a polynucleotide means that the polynucleotide is the product of various combinations of cloning, restriction, and / or ligation steps, and other procedures that result in a construct that differs from the polynucleotide found in nature. A recombinant virus is a viral particle that contains a recombinant polynucleotide. The terms include copies of the original polynucleotide construct and progeny of the original viral construct, respectively.

[0052] "Control element" or "control sequence" is a nucleotide sequence involved in molecular interactions that contribute to the functional regulation of polynucleotides, including the replication, duplication, transcription, splicing, translation, or degradation of polynucleotides. Regulation can affect the frequency, speed, or specificity of a process, and can be enhancing or inhibitory in nature. Control elements known in the art include, for example, transcriptional regulatory sequences such as promoters and enhancers. A promoter is a DNA region that, under certain conditions, can bind RNA polymerase and initiate the transcription of the coding region that is usually located downstream (3' direction) of the promoter. Promoters include AAV promoters, such as P5, P19, P40, and AAV ITR promoters, as well as heterologous promoters.

[0053] An "expression vector" is a vector that contains a region that codes for a gene product of interest and is used to cause the expression of the gene product in the intended target cell. An expression vector also contains a control element that is operably linked to the coding region to facilitate the expression of the protein in the target. The combination of a control element and a gene or genes that are operably linked for expression is sometimes referred to as an "expression cassette", and many expression cassettes are known and available in the art, or can be easily constructed from components available in the art.

[0054] The terms "polypeptide" and "protein" are used interchangeably herein to refer to a polymer of amino acids of any length. The terms also include amino acid polymers that have been modified, such as disulfide bond formation, glycosylation, acetylation, phosphonylation, lipidation, or conjugation with a labeling component.

[0055] When used in reference to a protein, gene, nucleic acid, or polynucleotide in a cell or organism, the term "exogenous" refers to a protein, gene, nucleic acid, or polynucleotide that has been introduced into the cell or organism by artificial or natural means. An exogenous nucleic acid may be from a different organism or cell, or may be one or more additional copies of a nucleic acid that is naturally present in the organism or cell. As a non-limiting example, an exogenous nucleic acid is at a different chromosomal location than that of the native cell, or is otherwise adjacent to a different nucleic acid sequence than that found in nature, such as an expression cassette that links the promoter of one gene to an open reading frame for the gene product of a different gene.

[0056] "Transformed" or "transgenic" are used herein to include any host cell or cell line that has been altered or enhanced by the presence of at least one recombinant DNA sequence. The host cells of the present disclosure are typically generated by transfection with a DNA sequence in a plasmid expression vector, as an isolated linear DNA sequence, or by infection with a recombinant viral vector.

[0057] The term "sequence homology" refers to the percentage of base matches between two nucleic acid sequences, or the percentage of amino acid matches between two amino acid sequences. When sequence homology is expressed as a percentage, for example 50%, the percentage refers to the percentage of matches over the length of the selected sequence compared to some other sequence. Gaps (in either of the two sequences) are allowed to maximize matching; gap lengths of 15 bases or less are usually used, with 6 bases or less being preferred, and 2 bases or less being more preferred. When using oligonucleotides as probes or treatments, the sequence homology between the target nucleic acid and the oligonucleotide sequence is generally 17 or more target base matches (85%) out of 20 possible oligonucleotide base pair matches; 9 or more matches (90%) out of 10 possible base pair matches, or 19 or more matches (95%) out of 20 possible base pair matches.

[0058] Two amino acid sequences are homologous if there is partial or complete identity between them. For example, 85% homology means that 85% of the amino acids are identical when the two sequences are aligned for maximum matching. Gaps (in either of the two sequences being matched) are allowed in maximizing matching; a gap length of 5 or less is preferred, and 2 or less is more preferred. Alternatively, two protein sequences (or polypeptide sequences derived therefrom that are at least 30 amino acids long) are homologous, as this term is used herein, if they have an alignment score of more than 5 (in standard deviation units) using the ALIGN program with a mutation data matrix and a gap penalty of 6 or more. Two sequences or parts thereof are more homologous if their amino acids are 50% or more identical when optimally aligned using the ALIGN program.

[0059] The term "corresponding to" is used herein to mean that a polynucleotide sequence is structurally related to all or a portion of a reference polynucleotide sequence, or a polypeptide sequence is structurally related to all or a portion of a reference polypeptide sequence, e.g., they have at least 80%, 85%, 90%, 95% or more, e.g., 99% or 100% sequence identity. In contrast, the term "complementary to" is used herein to mean that the complementary sequence is homologous to all or a portion of a reference polynucleotide sequence. For illustration, the nucleotide sequence "TATAC" corresponds to the reference sequence "TATAC" and is complementary to the reference sequence "GTATA".

[0060] The term "sequence identity" means that two polynucleotide sequences are identical (i.e., nucleotide-by-nucleotide) over a window of comparison. The term "percentage of sequence identity" means that two polynucleotide sequences are identical (i.e., nucleotide-by-nucleotide) over a window of comparison. The term "percentage of sequence identity" is calculated by comparing two optimally aligned sequences over a window of comparison, determining the number of positions where the same nucleic acid base (e.g., A, T, C, G, U, or I) is present in both sequences to obtain the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to obtain the percentage of sequence identity. As used herein, the term "substantial identity" refers to a characteristic of a polynucleotide sequence, including a sequence having at least 85 percent sequence identity, preferably at least 90-95 percent sequence identity, and more usually at least 99 percent sequence identity, compared to a reference sequence over a comparison window of at least 20 nucleotide positions, and often over a window of at least 20-50 nucleotides, where the percentage of sequence identity is calculated by comparing the reference sequence to a polynucleotide sequence that may contain deletions or additions that total no more than 20 percent of the reference sequence over the window of comparison.

[0061] "Conservative" amino acid substitutions are, for example, aspartic acid-glutamic acid as polar acidic amino acids; lysine / arginine / histidine as polar basic amino acids; leucine / isoleucine / methionine / valine / alanine / glycine / proline as non-polar or hydrophobic amino acids; serine / threonine as polar or uncharged hydrophilic amino acids. Conservative amino acid substitutions also include groupings based on side chains. For example, the group of amino acids with aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; the group of amino acids with aliphatic-hydroxyl side chains is serine and threonine; the group of amino acids with amide-containing side chains is asparagine and glutamine; the group of amino acids with aromatic side chains is phenylalanine, tyrosine, and tryptophan; the group of amino acids with basic side chains is lysine, arginine, and histidine; and the group of amino acids with sulfur-containing side chains is cysteine ​​and methionine. For example, it is reasonable to expect that the substitution of leucine with isoleucine or valine, aspartic acid with glutamic acid, threonine with serine, or similar substitutions of an amino acid with a structurally related amino acid will have no significant effect on the properties of the resulting polypeptide. Whether an amino acid change results in a functional polypeptide can be readily determined by assaying the specific activity of the polypeptide. Naturally occurring residues are divided into groups based on common side chain properties: (1) hydrophobic: norleucine, met, ala, val, leu, ile; (2) neutral hydrophilic: cys, ser, thr; (3) acidic: asp, glu; (4) basic: asn, gln, his, lys, arg; (5) residues that affect chain orientation: gly, pro; and (6) aromatic: trp, tyr, phe.

[0062] The present disclosure also contemplates polypeptides with non-conservative substitutions, which entail exchanging a member of one of the above classes for another.

[0063] "ART1" refers to ADP-ribosyltransferase 1, e.g., mammalian ART1 having the sequence of Accession Nos. NP_004305.2, XP_0115184161, NP_033840.2, or XP_011239959.1, the disclosures of which are incorporated herein by reference, or a protein having at least 80%, 85%, 90%, 92%, 94%, 95%, 97%, 98%, or 99% amino acid sequence identity thereto, an alternative splicing isoform thereof, a fragment peptide thereof, or a post-translationally modified protein or peptide thereof. For example, antibodies within the scope of the present disclosure can be directed to human ART1, e.g., TIFF2025508690000034.tif34152, and / or mouse ART1, e.g. It can be combined into TIFF2025508690000035.tif34170.

[0064] As used herein, the term "antibody" refers to a full-length immunoglobulin molecule or an immunologically active fragment of an immunoglobulin molecule, such as a Fab or F(ab')2 fragment or ScFv, generated, for example, by cleavage of the antibody with an enzyme such as pepsin, or by co-expression of an antibody light chain and an antibody heavy chain in a mammalian cell. The antibody may also be an IgG, IgD, IgA, IgE, or IgM antibody. A full-length immunoglobulin "light chain" (about 25 kD or 214 amino acids) is encoded by a variable region gene at the amino terminus (about 110 amino acids) and a kappa or lambda constant region gene at the carboxy terminus. A full-length immunoglobulin "heavy chain" (about 50 kD or 446 amino acids) is similarly encoded by a variable region gene (about 116 amino acids) and one of the other aforementioned constant region genes, such as gamma (encoding about 330 amino acids). Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD, and IgE, respectively. An exemplary immunoglobulin (antibody) structural unit comprises a tetramer. Each tetramer consists of two identical pairs of polypeptide chains, each pair having one "light" chain (about 25 kD) and one "heavy" chain (about 50-70 kD). The N-terminus of each chain defines a variable region of about 100-110 or more amino acids primarily responsible for antigen recognition. The variable light chain (VLC) is a tetramer that is composed of two identical pairs of polypeptide chains, each pair having one "light" chain (about 25 kD) and one "heavy" chain (about 50-70 kD). The N-terminus of each chain defines a variable region of about 100-110 or more amino acids primarily responsible for antigen recognition. L ) and variable heavy chain (V H The terms constant and constant regions refer to these light and heavy chains, respectively. In each pair of tetramers, the variable regions of the light and heavy chains are both involved in binding to the antigen, and the constant regions are involved in the effector functions of the antibody. In addition to naturally occurring antibodies, immunoglobulins can exist in a variety of other forms, including, for example, Fv, ScFv, Fab, and F(ab')2, as well as bifunctional hybrid antibodies (e.g., Lanzavecchia et al. (1987)), and as single chains (e.g., Huston et al. (1988) and Bird et al. (1988), both of which are incorporated herein by reference) (see generally Hood et al., "Immunology", Benjamin, NY, 2001, incorporated herein by reference).nd ed. (1984) and Hunkapiller and Hood (1986). Thus, the term "antibody" includes antigen-binding antibody fragments, as known in the art, including Fab, Fab2, single chain antibodies (e.g., scFv), chimeric antibodies, etc., either produced by the modification of whole antibodies or synthesized de novo using recombinant DNA technology.

[0065] An immunoglobulin light or heavy chain variable region consists of a "framework" region interrupted by three hypervariable regions, also called CDRs. The extent of the framework region and the CDRs has been precisely defined (see "Sequences of Proteins of Immunological Interest," E. Kabat et al., US Department of Health and Human Services, (1983); incorporated herein by reference). The sequences of the framework regions of different light or heavy chains are relatively conserved within a species. As used herein, a "human framework region" is a framework region that is substantially identical (about 85% or more, usually 90-95% or more) to the framework regions of naturally occurring human immunoglobulins. The framework region of an antibody, which is the combined framework regions of the constituent light and heavy chains, serves to position and align the CDRs. The CDRs are primarily responsible for binding to an epitope of an antigen.

[0066] Chimeric antibodies are antibodies whose light and heavy chain genes are constructed by genetic engineering from immunoglobulin variable and constant region genes, typically from different species. For example, the variable segments of genes from a mouse monoclonal antibody can be joined to human constant segments, such as gamma 1 and gamma 3. An example of a chimeric antibody is one that consists of a variable domain or antigen binding domain from a mouse antibody and a constant domain or effector domain from a human antibody, although other mammalian species may be used.

[0067] As used herein, the term "humanized" immunoglobulin refers to an immunoglobulin that comprises a human framework region and one or more CDRs derived from a non-human (usually mouse or rat) immunoglobulin. A humanized antibody refers to an immunoglobulin having a humanized light chain and a humanized heavy chain. The non-human immunoglobulin providing the CDRs is called the "donor" and the human immunoglobulin providing the framework is called the "acceptor". A constant region need not be present, but if present, it is generally substantially identical to a human immunoglobulin constant region, i.e., at least about 85-90%, or about 95% or more identical. Thus, all parts of a humanized immunoglobulin are substantially identical to the corresponding parts of a natural human immunoglobulin sequence, except possibly for the CDRs. A "humanized antibody" is an antibody that comprises a humanized light chain and a humanized heavy chain immunoglobulin. A donor antibody is said to be "humanized" by the process of "humanization" since it is expected that the resulting humanized antibody will bind to the same antigen as the donor antibody providing the CDRs.

[0068] Thus, humanized forms of non-human (e.g., murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (e.g., Fv, Fab, Fab', F(ab')2 or other antigen-binding subsequences of antibodies) that contain minimal sequence derived from the non-human immunoglobulin. Humanized antibodies comprise human immunoglobulins (recipient antibodies) in which residues from a complementarity determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat, or rabbit that has the desired specificity, affinity, and capacity. In some cases, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies can also comprise residues that are found neither in the recipient antibody nor in the imported CDR or framework sequences. In general, humanized antibodies have substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the framework regions are of human immunoglobulin consensus sequences. The humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin (Jones et al. (1986); Riechmann et al. (1988); and Presta (1992)).

[0069] It will be understood that humanized antibodies can have additional conservative amino acid substitutions that have substantially no effect on antigen binding or other immunoglobulin functions. Conservative substitutions contemplate combinations such as gly, ala; val, ile, leu; asp, glu; asn, gln; ser, thr; lys, arg; and phe, tyr.

[0070] Humanized immunoglobulins, including humanized antibodies, are constructed by genetic engineering. Methods for humanizing non-human antibodies are well known in the art. In general, humanized antibodies have one or more amino acid residues introduced from a source that is non-human. These non-human amino acid residues are often referred to as "import" residues, which typically come from an "import" variable domain. Humanization can be essentially carried out according to the method of Winter and coworkers (Jones et al., Nature, 321:522 (1986); Riechmann et al., Nature, 332:323 (1988); Verhoeyen et al., Science, 239:1534 (1988)) by replacing rodent CDRs or CDR sequences with the corresponding sequences of a human antibody. Thus, such "humanized" antibodies are chimeric antibodies with substantially less than intact human variable domains replaced by the corresponding sequences from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some framework residues are substituted by residues from analogous sites in rodent antibodies.

[0071] Human antibodies can also be produced using a variety of techniques known in the art, including phage display libraries (Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991); Marks et al., J. Mol. Biol., 222:581 (1991)). The techniques of Cole et al. and Boerner et al. are also available for the preparation of human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al., J. Immunol., 147:86 (1991)). Similarly, human antibodies can be made by introducing human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S. Patent Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, and the following scientific publications: Marks et al., Bio / Technology 10:779 (1992); Lonberg et al., Nature, 368:856 (1994); Morrison, Nature, 368:812 (1994); Fishwild et al., Nature Biotechnology, 14:845 (1996); Neuberger, Nature Biotechnology, 14:826 (1996); Lonberg and Huszar, Intern. Rev. Immunol., 13:65 (1995). Most humanized immunoglobulins previously described have a framework identical to that of a particular human immunoglobulin chain and three CDRs derived from a non-human donor immunoglobulin chain.

[0072] The framework may be derived from a particular human immunoglobulin that is significantly homologous to the donor immunoglobulin to be humanized, or it may be a consensus framework derived from many human antibodies. For example, a comparison of the sequences of mouse heavy (or light) chain variable regions with human heavy (or light) variable regions in databanks (e.g., the Protein Identification Resource of the National Biomedical Research Foundation) shows that the degree of homology to different human regions varies widely, typically from about 40% to about 60-70%. By choosing one of the human heavy (respectively light) chain variable regions that is most homologous to the heavy (respectively light) chain variable regions of other immunoglobulins, fewer amino acids will be changed during the transition from one immunoglobulin to a humanized immunoglobulin. The exact overall shape of the humanized antibody with the humanized immunoglobulin chains may more closely resemble the shape of the donor antibody, which also reduces the chances of modifying the CDRs.

[0073] Typically, one of the 3-5 most homologous heavy chain variable region sequences in a representative collection of at least about 10-20 different human heavy chains is selected as an acceptor to provide the heavy chain framework, and similarly for the light chain. One of the 1-3 most homologous variable regions can be used. The selected acceptor immunoglobulin chain can have at least about 65% homology in the framework regions to the donor immunoglobulin.

[0074] In many cases, it may be desirable to use light and heavy chains from the same human antibody as the acceptor sequences to ensure that the humanized light and heavy chains make favorable contacts with each other. Regardless of how the acceptor immunoglobulin is selected, higher affinity can be achieved by selecting a few amino acids in the framework of the humanized immunoglobulin chain to be the same as the amino acid at that position in the donor but not the acceptor.

[0075] Humanized antibodies generally have advantages over murine or, in some cases, chimeric antibodies for use in human therapy: because the effector moieties are human, they can interact better with other parts of the human immune system (e.g., destroy target cells more efficiently, e.g., by complement-dependent cytotoxicity (CDC) or antibody-dependent cellular cytotoxicity (ADCC)); the human immune system should not recognize the framework or constant regions of a humanized antibody as foreign, and therefore the antibody response against such antibodies should be lower than against a completely foreign murine antibody or a partially foreign chimeric antibody.

[0076] The DNA segment having the immunoglobulin sequence typically further comprises an expression control DNA sequence, including a promoter region that is naturally associated or heterologous, operably linked to the humanized immunoglobulin coding sequence. Generally, the expression control sequence is considered to be a eukaryotic promoter system in a vector that can transform or transfect eukaryotic host cells, although control sequences for prokaryotic hosts can also be used. Once the vector is incorporated into a suitable host, the host is maintained under conditions suitable for high-level expression of the nucleotide sequence, and optionally, the collection and purification of the humanized light chain, heavy chain, light / heavy chain dimer, or intact antibody, binding fragment, or other immunoglobulin form may follow (see S. Beychok, Cells of Immunoglobulin Synthesis, Academic Press, New York, (1979), incorporated herein by reference).

[0077] Other modified immunoglobulins that are "substantially homologous" to the native sequence can be readily designed and produced using various recombinant DNA techniques well known to those skilled in the art. For example, the framework regions can be altered at the primary structure level, by several amino acid substitutions, terminal and intermediate additions and deletions, and the like. Furthermore, a variety of different human framework regions can be used alone or in combination as a basis for the humanized immunoglobulins of the present disclosure. In general, genetic modifications can be readily accomplished by a variety of well-known techniques, such as site-directed mutagenesis (see Gillman and Smith, Gene, 8:81 (1979) and Roberts et al., Nature, 328:731 (1987), both of which are incorporated herein by reference). Substantially homologous immunoglobulin sequences are those that exhibit at least about 85% homology, usually at least about 90%, or at least about 95% homology with the reference immunoglobulin protein.

[0078] Alternatively, polypeptide fragments can be generated that contain only a portion of the primary antibody structure, which fragments have one or more immunoglobulin activities (e.g., antigen binding). These polypeptide fragments can be generated by proteolytic cleavage of intact antibodies by methods well known in the art, or by using site-directed mutagenesis to insert a stop codon at a desired position in a vector known to those of skill in the art.

[0079] Exemplary Anti-ART1 Molecules The present disclosure provides an antibody, an antigen-binding fragment thereof, or a polypeptide against ART1. In one embodiment, the antibody, a fragment thereof, or a polypeptide binds to both human ART1 and mouse ART1 and thus likely binds to a conserved sequence in these proteins (see alignment below), while an antibody that binds to human ART1 but not mouse ART1 likely binds to a non-conserved sequence (see alignment below). TIFF2025508690000036.tif114162

[0080] Thus, in one embodiment, an antibody, antigen-binding fragment thereof, or polypeptide against ART1 that binds to both human ART1 and mouse ART1 can bind to residues including those at positions 170-185 (human numbering), 195-210, or 230-250, or a combination thereof. In one embodiment, antibodies that bind to ART1 include those that bind to residues including those at positions 110-160, 185-225, or 245-275, or a combination thereof of ART1. In one embodiment, antibodies that bind to ART1 include those that bind to residues including those at positions 20-50, 80-100, 170-85, 225-245, or 275 to the C-terminus, or a combination thereof. In one embodiment, an antibody, antigen-binding fragment thereof, or polypeptide binds to at least one of the following residues: S75, S77, T79, R80, R89, H92, or Y99 of human ART1 (e.g., SEQ ID NO:90). In one embodiment, the isolated antibody or fragment thereof binds to human ART1, e.g., two, three, four, five, or six of S75, S77, T79, R80, R89, H92, or Y99 of SEQ ID NO:90. In one embodiment, the isolated antibody or fragment thereof binds to human ART1, e.g., S75, S77, T79, R80, R89, H92, and Y99 of SEQ ID NO:90.

[0081] Those skilled in the art will recognize that an antibody is composed of four polypeptides: two identical copies of a heavy (H) chain polypeptide and two copies of a light (L) chain polypeptide. Each of the heavy chains contains one N-terminal variable (V H ) domain and three C-terminal constant (CH1, CH2, and CH3) domains, and each light chain contains one N-terminal variable (V L ) region and one C-terminal constant (C L) regions. The variable regions of each pair of light and heavy chains form the antigen-binding site of the antibody. The nucleic acid sequence encoding an antibody against ART1 can include one or more nucleic acid sequences, each of which encodes one or more of the heavy and / or light chain polypeptides of the anti-ART1 antibody. In this regard, the nucleic acid sequence encoding an antibody against ART1 can include a single nucleic acid sequence encoding the heavy and light chain polypeptides of the anti-ART1 antibody. Alternatively, the nucleic acid sequence encoding an antibody against ART1 can include a first nucleic acid sequence encoding the heavy chain polypeptide of the anti-ART1 antibody and a second nucleic acid sequence encoding the light chain polypeptide of the anti-ART1 antibody. In yet another embodiment, the nucleic acid sequence encoding a fragment of an antibody against ART1 can include a nucleic acid sequence encoding the heavy chain variable region polypeptide of the anti-ART1 antibody, a nucleic acid sequence encoding the light chain variable region polypeptide of the anti-ART1 antibody, or a nucleic acid sequence encoding the heavy chain variable region and light chain variable region polypeptides of the anti-ART1 antibody.

[0082] In another embodiment, the nucleic acid sequence encoding an antibody against ART1 encodes an antigen-binding fragment (also referred to as an "antibody fragment") of an anti-ART1 antibody. The term "antigen-binding fragment" refers to one or more fragments of an antibody that retain the ability to specifically bind to an antigen (e.g., ART1) (see generally Holliger and Hudson 2005). Examples of antigen-binding fragments include, but are not limited to, (i) V L , V H , C L , and C H1 (ii) a F(ab')2 fragment, which is a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; and (iii) a V(ab')2 fragment, which is a monovalent fragment comprising a V domain of a single arm of an antibody. L and V Hand Fv fragments consisting of a Fab fragment of an anti-ART1 antibody. In one embodiment, the nucleic acid sequence encoding the antibody against ART1 or a fragment thereof can comprise a nucleic acid sequence encoding a heavy chain variable region that binds to ART1. In one embodiment, the nucleic acid sequence encoding the antibody against ART1 or a fragment thereof can comprise a nucleic acid sequence encoding a light chain variable region that binds to ART1. In one embodiment, the nucleic acid sequence encoding the antibody against ART1 can comprise a nucleic acid sequence encoding one, two, or three CDRs of the heavy chain variable region that binds to ART1. In one embodiment, the nucleic acid sequence encoding the antibody against ART1 can comprise a nucleic acid sequence encoding one, two, or three CDRs of the light chain variable region that binds to ART1. The antibody fragment can be an scFv antibody or a nanobody (a VHH antibody with a single variable domain in the heavy chain), Fab, or F(ab')2.

[0083] In one embodiment, the nucleic acid sequence can encode the ART1-binding monoclonal antibody 22C12 or a fragment thereof. In one embodiment, the nucleic acid sequence can encode the ART1-binding monoclonal antibody 14G01 or a fragment thereof.

[0084] In one embodiment, a nucleic acid sequence encoding an antibody against ART1 that recognizes (binds to) human and mouse ART1. In one embodiment, the nucleic acid sequence encoding an antibody against ART1 recognizes human ART1 but not mouse ART1.

[0085] Antibodies or antigen-binding fragments thereof can be obtained by any means, including via in vitro sources (e.g., hybridomas or cell lines that recombinantly produce antibodies) and in vivo sources (e.g., rodents).

[0086] Methods for producing antibodies are known in the art and are described, for example, in Kohler and Milstein, Eur. J. Immunol., 5:511 (1976); Harlow and Lane (eds.), Antibodies: A Laboratory Manual, CSH Press (1988); and CA Janeway et al. (eds.), Immunobiology, 5th Ed., Garland Publishing, New York, NY (2001). In certain embodiments, human or chimeric antibodies can be produced using transgenic animals (e.g., mice) in which one or more endogenous immunoglobulin genes have been replaced with one or more human immunoglobulin genes. Examples of transgenic mice in which endogenous antibody genes have been effectively replaced with human antibody genes include, but are not limited to, AlivaMab® mice, VelocImmune mice, Trianni® mice, Kymab™ mice, HUMAB-MOUSE™, Kirin TC MOUSE™, and KM-MOUSE™ (see, e.g., Lonberg, Nat. Biotechnol., 23(9):1117 (2005) and Lonberg, Handb. Exp. Pharmacol., 181:69 (2008)).

[0087] The nucleic acid sequence encoding the antibody against ART1, its antigen-binding fragment, or the polypeptide that binds to ART1 can be produced using methods known in the art. Polypeptides and proteins can be produced recombinantly, for example, using standard recombinant DNA methods (see, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Press, Cold Spring Harbor, NY, 2001; and Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates and John Wiley & Sons, NY, 1994). In addition, the antibody against ART1 or its antigen-binding fragment can be isolated and / or purified from sources such as bacteria, insects, or mammals, such as rats, humans, etc., into which the synthetically produced nucleic acid sequence encoding such antibody or antigen-binding fragment is introduced. Methods of isolation and purification are well known in the art. Alternatively, the nucleic acid sequence described herein can be commercially synthesized. In this regard, the nucleic acid sequence can be synthetic, recombinant, isolated, and / or purified.

[0088] Nucleic acid sequences encoding antibodies against ART1 can be identified by extracting RNA from available antibody-producing hybridoma cells, generating cDNA by reverse transcription, and PCR amplifying the light and heavy chains using the rapid amplification of cDNA ends (RACE) strategy in combination with primers specific for conserved regions in the constant domain.

[0089] The nucleic acid sequence encoding the antibody against ART1 can also be fully or partially humanized by means known in the art. For example, an antibody chimera can be created by replacing the DNA encoding the mouse Fc region of the antibody with a cDNA encoding a human one.

[0090] The Fab portion of the molecule can also be humanized by selectively altering the DNA in the non-CDR portions of the Fab sequence to differ from that of the human by replacing the sequence with appropriate individual amino acids.

[0091] Alternatively, humanization can be achieved by insertion of appropriate CDR-encoding segments into a human antibody "scaffold".

[0092] As is known in the art, the resulting antibody DNA sequences can be modified for high expression levels in mammalian cells through removal of RNA instability elements and / or codon optimization.

[0093] In one embodiment, the nucleic acid sequences encoding the heavy and light chains of the antibody against ART1 can be expressed in a 1:1 ratio under the control of a single promoter using the 2A sequence (cis-acting hydrolase element) self-cleavable sequence. The 2A sequence self-cleaves during protein translation, leaving a short tail of amino acids at the C-terminus of the upstream protein. A furin cleavage recognition site can be added between the 2A sequence and the upstream gene to ensure removal of the remaining amino acids. Plasmids expressing the correct insert can be identified by DNA sequencing and by antibody specific binding using Western analysis and ELISA assays.

[0094] Exemplary Gene Transfer Vectors The present disclosure also provides a gene transfer vector comprising a nucleic acid sequence encoding an antibody, its antigen-binding fragment, or polypeptide against ART1. In one embodiment, the gene transfer vector is a virus. The present disclosure further provides a method of using a gene transfer vector or the encoded gene product against ART1 in a mammal, the method comprising administering the gene transfer vector or the encoded gene product to the mammal. Various aspects of the gene transfer vector, the antibody or its antigen-binding fragment, and the method are discussed below. Although each parameter is discussed separately, the gene transfer vector, the antibody or its antigen-binding fragment, or the polypeptide, and the method can include a combination of the parameters described below. Thus, any combination of parameters can be used according to the gene transfer vector, the antibody or its antigen-binding fragment, the polypeptide, and the method.

[0095] A "gene transfer vector" is any molecule or composition capable of transporting and delivering a heterologous nucleic acid sequence into a suitable host cell where the synthesis of the encoded protein occurs. Typically, a gene transfer vector is a nucleic acid molecule that has been engineered using recombinant DNA techniques known in the art to incorporate a heterologous nucleic acid sequence. Desirably, a gene transfer vector is composed of DNA. Examples of suitable DNA-based gene transfer vectors include plasmids and viral vectors. However, gene transfer vectors that are not based on nucleic acids, such as liposomes, are also known and used in the art. Gene transfer vectors can be based on a single type of nucleic acid (e.g., plasmids) or non-nucleic acid molecules (e.g., lipids or polymers). Gene transfer vectors can be integrated into the genome of the host cell or can exist in the host cell in the form of an episome.

[0096] In one embodiment, gene transfer vector is a viral vector.Suitable viral vectors include, for example, retroviral vectors, herpes simplex virus (HSV)-based vectors, parvovirus-based vectors, such as adeno-associated virus (AAV)-based vectors, AAV-adenovirus chimeric vectors, and adenovirus-based vectors.These viral vectors can be prepared using standard recombinant DNA techniques, for example, as described in Sambrook et al., Molecular Cloning, a Laboratory Manual, 3rd edition, Cold Spring Harbor Press, Cold Spring Harbor, NY (2001), and Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates and John Wiley & Sons, New York, NY (1994).

[0097] Any viral vector can be used to deliver antibody-encoding sequences to a cell, including a mammalian cell, or to a mammal, including, but not limited to, an adeno-associated virus, adenovirus, herpes virus, retrovirus, or lentivirus vector.

[0098] In addition to the nucleic acid sequence encoding an antibody against ART1 or an antigen-binding fragment thereof, the viral vector can include an expression control sequence that effects expression of the nucleic acid sequence in a host cell, such as a promoter, an enhancer, a polyadenylation signal, a transcription terminator, an internal ribosome entry site (IRES), etc. Exemplary expression control sequences are known in the art and are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology, Vol. 185, Academic Press, San Diego, CA. (1990).

[0099] Numerous promoters, including constitutive, inducible and repressible promoters, from various different sources are well known in the art.Representative sources of promoters include, for example, viruses, mammals, insects, plants, yeasts and bacteria, and suitable promoters from these sources are easily available or can be synthetically produced based on publicly available sequences, for example, from depositories such as ATCC and other commercial or personal sources.Promoters can be unidirectional (i.e., initiate transcription in one direction) or bidirectional (i.e., initiate transcription in either 3' or 5' direction).Non-limiting examples of promoters include, for example, T7 bacterial expression system, pBAD (araA) bacterial expression system, cytomegalovirus (CMV) promoter, SV40 promoter, and RSV promoter. Inducible promoters include, for example, the Tet system (U.S. Pat. Nos. 5,464,758 and 5,814,618), the ecdysone inducible system (No et al., Proc. Natl. Acad. Sci., 93:3346 (1996), the T-REXTM system (Invitrogen, Carlsbad, Calif.), the LACSWITCH™ system (Stratagene, San Diego, Calif.), and the Cre-ERT tamoxifen-inducible recombinase system (Indra et al., Nuc. Acid. Res., 27:4324 (1999); Nuc. Acid. Res., 28:e99 (2000); U.S. Pat. No. 7,112,715; and Ramer & Fussenegger, Methods Mol. Biol., 308:123 (2005)).

[0100] The term "enhancer" as used herein refers to a DNA sequence that, for example, increases the transcription of a nucleic acid sequence to which it is operably linked. Enhancers can be located many kilobases away from the coding region of a nucleic acid sequence and can mediate the binding of regulatory factors, the pattern of DNA methylation, or changes in DNA structure. Numerous enhancers from a variety of different sources are well known in the art and are available as or within cloned polynucleotides (e.g., from depositories such as ATCC and other commercial or personal sources). Some polynucleotides that contain a promoter (e.g., the commonly used CMV promoter) also contain an enhancer sequence. Enhancers can be located upstream, internal, or downstream of a coding sequence. In one embodiment, the nucleic acid sequence encoding an antibody or antigen-binding fragment thereof against ART1 is operably linked to a CMV enhancer / chicken beta-actin promoter (also referred to as a "CAG promoter") (see, e.g., Niwa et al., Gene, 108:193 (1991); Daly et al., Proc. Natl. Acad. Sci. USA, 96:2296 (1999); and Sondhi et al., Mol. Ther., 15:481 (2007)).

[0101] Typically, AAV vectors are produced using well-characterized plasmids. For example, human embryonic kidney 293T cells are transfected with one of the transgene-specific plasmids and another plasmid containing an adenovirus helper and AAV rep and cap genes (specific for AAVrh.10, 8, or 9, as appropriate). After 72 hours, cells are harvested and the vector is released from the cells by five freeze / thaw cycles. Subsequent centrifugation and benzonase treatment removes cell debris and unencapsidated DNA. Each AAV vector can be further purified using an iodixanol gradient and an ion exchange column. The purified vector is then concentrated to the required concentration by size-exclusion centrifugation spin columns. Finally, the buffer is exchanged to produce the final vector product, which is formulated in (for example) 1× phosphate-buffered saline. Viral titers can be measured by TaqMan® real-time PCR, and viral purity can be assessed by SDS-PAGE.

[0102] Exemplary Pharmaceutical Compositions and Delivery The present disclosure provides a composition comprising, consisting essentially of, or consisting of the above-mentioned antibody, antibody fragment, such as a single chain polypeptide or gene transfer vector and a pharma- ceutically acceptable (e.g., physiologically acceptable) carrier, or an antibody or antigen-binding fragment thereof, optionally with a pharma- ceutically acceptable (e.g., physiologically acceptable) carrier. When the composition consists essentially of an antibody, antibody fragment, such as a single chain polypeptide or gene transfer vector and a pharma- ceutically acceptable carrier, it can include additional components that do not substantially affect the composition (e.g., adjuvants, buffers, stabilizers, anti-inflammatory agents, solubilizers, preservatives, etc.). When the composition consists of a gene transfer vector and a pharma- ceutically acceptable carrier, or an antibody, antigen-binding fragment thereof or polypeptide, optionally with a pharma- ceutically acceptable carrier, the composition does not include any additional components. Any suitable carrier can be used within the context of the present disclosure, and such carriers are well known in the art. The choice of carrier will be determined in part by the particular site to which the composition may be administered, and the particular method used to administer the composition. The composition may be optionally sterile, except for the gene transfer vector or antibody or its antigen-binding fragment or polypeptide described herein.The composition can be frozen or lyophilized for storage, and can be reconstituted in a suitable sterile carrier before use.The composition can be produced according to conventional techniques, for example, as described in Remington: The Science and Practice of Pharmacy, 21st Edition, Lippincott Williams & Wilkins, Philadelphia, PA (2001).

[0103] Suitable formulations for the composition include aqueous and non-aqueous solutions, isotonic solutions, and aqueous and non-aqueous sterile suspensions that can include antioxidants, buffers, and bacteriostatic agents, as well as suspending agents, solubilizers, thickeners, stabilizers, and preservatives. The formulations can be provided in unit-dose or multi-dose sealed containers, such as ampoules and vials, and can be stored in a freeze-dried (lyophilized) state that requires only the addition of a sterile liquid carrier, such as water, immediately prior to use. Extemporaneous solutions and suspensions can be prepared from sterile powders, granules, and tablets of the type described above. In one embodiment, the carrier is a buffered saline solution. In one embodiment, the gene transfer vector, antibody, or antigen-binding fragment thereof, is administered in a composition formulated to protect the gene transfer vector or antibody or antigen-binding fragment thereof from damage prior to administration. For example, the composition can be formulated to reduce loss of the gene transfer vector in devices, such as glassware, syringes, or needles, used to prepare, store, or administer the gene transfer vector. The composition can be formulated to reduce the light and / or temperature sensitivity of the gene transfer vector or the antibody or its antigen-binding fragment.To this end, the composition can include a pharma-ceutically acceptable liquid carrier, such as those described above, and a stabilizer selected from the group consisting of polysorbate 80, L-arginine, polyvinylpyrrolidone, trehalose, and combinations thereof.The use of such a composition is believed to extend the shelf life of the gene transfer vector, facilitate administration, and increase the efficiency of the method.Formulations for gene transfer vector-containing compositions are further described, for example, in Wright et al., Curr. Opin. Drug Discov. Devel., 6(2): 174-178 (2003) and Wright et al., Molecular Therapy, 12: 171-178 (2005).

[0104] The composition can also be formulated to enhance transduction efficiency. Furthermore, those skilled in the art will recognize that the gene transfer vector or antibody or its antigen-binding fragment can be present in the composition with other therapeutic or biologically active agents. For example, factors that control inflammation, such as ibuprofen or steroids, can be part of the composition to reduce swelling and inflammation associated with in vivo administration of the gene transfer vector or antibody or its antigen-binding fragment. To enhance or modify anti-ART1 immune response, immune system stimulants or adjuvants, such as interleukins, lipopolysaccharides, and double-stranded RNA, can be administered. Antibiotics, i.e., bactericides and fungicides, can be present to treat existing infections and / or reduce the risk of future infections, such as infections associated with gene transfer procedures.

[0105] Injectable depot forms are prepared by forming microencapsulated matrices of the subject compounds in biodegradable polymers such as polylactide-polyglycolide. The rate of drug release can be controlled depending on the ratio of drug to polymer and the nature of the particular polymer used. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable preparations can also be prepared by entrapping the drug in liposomes or microemulsions that are compatible with body tissues.

[0106] In certain aspects, the formulations of the present disclosure comprise a biocompatible polymer selected from the group consisting of polyamides, polycarbonates, polyalkylenes, polymers of acrylic and methacrylic acid esters, polyvinyl polymers, polyglycolides, polysiloxanes, polyurethanes, and copolymers thereof, cellulose, polypropylene, polyethylene, polystyrene, polymers of lactic and glycolic acid, polyanhydrides, poly(ortho)esters, poly(butyric acid), poly(valeric acid), poly(lactide-co-caprolactone), polysaccharides, proteins, polyhyaluronic acid, polycyanoacrylates, and blends, mixtures, or copolymers thereof.

[0107] The composition can be administered in or on a device that allows controlled or sustained release, such as a sponge, a biocompatible meshwork, a mechanical reservoir, or a mechanical implant. Implants (see, e.g., U.S. Pat. No. 5,443,505), devices (see, e.g., U.S. Pat. No. 4,863,457), such as implantable devices, such as mechanical reservoirs or implants, or devices made of polymeric compositions, are particularly useful for administering gene transfer vectors, antibodies, or antigen-binding fragments thereof. The composition can also be administered in the form of sustained release formulations (see, e.g., U.S. Pat. No. 5,378,475), including, for example, gel foam, hyaluronic acid, gelatin, chondroitin sulfate, polyphosphates, such as bis-2-hydroxyethyl-terephthalate (BHET) and / or polylactic-glycolic acid.

[0108] Delivery of the gene transfer vector, antibody or antigen-binding fragment thereof, or composition comprising the polypeptide may be intracerebral (including but not limited to, intraparenchymal, intraventricular, or intracisternal), intrathecal (including but not limited to, lumbar or cisternal), or systemically, including intravenous, oral, or any combination thereof, using devices known in the art. Delivery may also be via surgical implantation of an implanted device.

[0109] The dose of the gene transfer vector in the composition administered to the mammal will depend on several factors, including the size (mass) of the mammal, the extent of any side effects, the particular route of administration, and the like. In one aspect, the method includes administering a "therapeutically effective amount" of a composition comprising the gene transfer vector, antibody or antigen-binding fragment thereof described herein. A "therapeutically effective amount" refers to an amount effective to achieve a desired therapeutic result, at the dosage and duration required. A therapeutically effective amount may vary according to factors such as the extent of the disease state, age, sex, and weight of the individual, and the ability of the gene transfer vector, antibody or antigen-binding fragment thereof to elicit a desired response in the individual. The dose of the gene transfer vector in the composition required to achieve a particular therapeutic effect is typically administered in units of vector genome copies per cell (gc / cell) or vector genome copies / kilogram of body weight (gc / kg). One of skill in the art can readily determine the appropriate gene transfer vector dose range for treating a patient with a particular disease or disorder based on these and other factors well known in the art. A therapeutically effective amount is greater than 1×10 10 Genome copies ~1×10 13 A therapeutically effective amount may be between 1×10 genome copies. 12 Genome copies ~1×10 15 A therapeutically effective dose can be between 1×10 genome copies (total). 12 Genome copies / kg ~ 1 x 10 15 The genome copies / kg can be anywhere between 100 and 200 mg / kg.

[0110] The dose of the antibody or antigen-binding fragment in the composition required to achieve a particular therapeutic effect is typically administered in units of antibody or antigen-binding fragment per kg (mg / kg) or total dose (mg). One of skill in the art can readily determine the appropriate dose range for treating a patient with a particular disease or disorder based on these and other factors well known in the art. A therapeutically effective amount of the antibody or antigen-binding fragment can be between 25-200 mg, e.g., 50-100 mg, 25-50 mg, 50-75 mg, 100-150 mg, 150-200 mg, 200 mg-300 mg, 300 mg-400 mg, 400 mg-500 mg, or 500 mg-600 mg. A therapeutically effective amount of the antibody or antigen-binding fragment can be between 1 mg / kg-20 mg / kg, e.g., 2-5 mg / kg, 5-7 mg / kg, or 10-15 mg / kg.

[0111] In one embodiment, the composition is administered once to the mammal.It is believed that a single administration of the composition will result in sustained expression of anti-ART1 antibodies in the mammal with minimal side effects.However, in certain cases, it may be appropriate to administer the composition multiple times during the treatment period to ensure sufficient exposure of cells to the composition.For example, the composition can be administered to the mammal more than once (e.g., 2, 3, 4, 5, 6, 6, 8, 9, or 10 times or more) during the treatment period.

[0112] The present disclosure provides a therapeutically effective amount of a gene transfer vector comprising a nucleic acid sequence encoding an antibody against ART1, or a pharma- ceutically acceptable composition comprising a therapeutically effective amount of the antibody or antigen-binding fragment thereof, as described above.

[0113] Exemplary Diseases and Conditions Examples of diseases that can be prevented, inhibited, or treated with antibodies or antigen-binding fragments thereof include, but are not limited to, neoplastic cancers (e.g., squamous cell carcinoma, adenocarcinoma, hepatocellular carcinoma, and renal cell carcinoma), particularly those of the bladder, intestine, breast, cervix, colon, esophagus, head, kidney, liver, lung, neck, ovary, pancreas, prostate, and stomach; leukemias; benign and malignant lymphomas, particularly Burkitt's lymphoma and non-Hodgkin's lymphoma; benign and malignant melanomas; myeloproliferative disorders; sarcomas, particularly Ewing's sarcoma, angiosarcoma, Kaposi's sarcoma, liposarcoma, myosarcoma, peripheral neuroepithelioma, and glomerulonephroma. tumors of the central nervous system (e.g., glioma, astrocytoma, oligodendroglioma, ependymoma, glioblastoma, neuroblastoma, ganglioneuroma, ganglioglioma, medulloblastoma, pineal cell tumor, meningioma, meningeal sarcoma, neurofibroma, and schwannoma); tumors of the germ cell system (e.g., intestinal cancer, breast cancer, prostate cancer, cervical cancer, uterine cancer, lung cancer, ovarian cancer, testicular cancer, thyroid cancer, astrocytoma, esophageal cancer, pancreatic cancer, gastric cancer, liver cancer, colon cancer, and melanoma); mixed types of neoplasia, particularly carcinosarcoma and Hodgkin's disease; and tumors of mixed origin, such as Wilms' tumor and teratocarcinoma (Beers and Berkow (eds.), The Merck Manual of Diagnosis and Therapy, 17.sup.th ed.(Whitehouse Station, NJ: Merck Research Laboratories, 1999) 973-74, 976, 986, 988, 991. In one aspect, the disease is pancreatic cancer, lung cancer, liver cancer, skin cancer, colon cancer, breast cancer, prostate cancer, leukemia, Burkitt's lymphoma, acute lymphocytic leukemia, or melanoma.

[0114] The disclosed compositions are useful for treating a subject having a medical condition or disorder associated with overexpression of ART1, or for treating altered ART1 activity, for example, in cancer.

[0115] subject The subject can be any animal, including human and non-human animals.Non-human animals include all vertebrates, for example, mammals and non-mammals, for example, non-human primates, sheep, dogs, cats, cows, horses, chickens, amphibians, and reptiles, but the subject can be a mammal, for example, non-human primates, sheep, dogs, cats, cows, and horses.The subject can also be livestock, for example, cows, pigs, sheep, poultry, and horses, or pets, for example, dogs and cats.

[0116] Exemplary subjects include human subjects suffering from or at risk for the medical diseases and conditions described herein. Subjects will generally be diagnosed with the conditions disclosed herein by one of skill in the art, e.g., a physician.

[0117] The disclosed method described herein can be used for subjects of any species, sex, age, ethnic group, or genotype.Thus, the term subject includes males and females, and includes elderly people, adult subjects in transition age from elderly to adulthood, subjects in transition age from adulthood to minors, and minors, including adolescents, children, and infants.

[0118] Examples of human ethnic groups include Caucasians, Asians, Latin Americans, Africans, African Americans, Native Americans, Semitic peoples, and Pacific Islanders. The methods of the present disclosure may be more suitable for some ethnic groups, such as Caucasians, particularly Northern European populations, and Asian populations.

[0119] The term subject includes subjects of any genotype or phenotype, as described above, as required by the present disclosure. Furthermore, a subject may have any genotype or phenotype with respect to hair color, eye color, skin color, or any combination thereof. The term subject includes subjects of any height, weight, or size or shape of any organ or body part.

[0120] Exemplary Sequences TIFF2025508690000037.tif166170TIFF2025508690000038.tif229170TIFF2025508690000039.tif229170TIFF2025508690000040.tif225170TIFF2025508690000041.tif226170TIFF2025508690000042.tif138162

[0121] Exemplary Aspects The present disclosure provides an isolated cell comprising an expression cassette comprising a heterologous promoter operably linked to a nucleic acid sequence encoding an anti-human ART1 antibody or antigen-binding fragment thereof, or a polypeptide that inhibits the activity of human ART1, wherein the antibody, the antigen-binding fragment thereof, or the polypeptide has a variable heavy chain region comprising a first CDR operably linked to a second CDR operably linked to a third complementarity determining region (CDR); and / or a variable light chain region comprising a first CDR operably linked to a second CDR operably linked to a third CDR. The sequence in the CDR can comprise any of SEQ ID Nos. 21-23, 28-30, 35-36, 42-44, 66-68, or 81, or a sequence having 1, 2, 3, 4, or 5 substitutions. In one embodiment, the majority or all of the substitutions are conservative substitutions. In one embodiment, the heavy or light chain can include one or more framework regions including, but not limited to, one of SEQ ID Nos. 24-27, 31-34, 38-41, 45-47, 51-63, 71-74, or 76-79, or a sequence having 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substitutions. In one embodiment, the majority or all of the substitutions are conservative substitutions. In one embodiment, the heavy or light chain can include one or more framework regions including, but not limited to, one of SEQ ID Nos. 24-27, 31-34, 38-41, 45-47, 51-63, 71-74, or 76-79, or a sequence having at least 80%, 85%, 90%, 92%, 95%, or 99% amino acid sequence identity thereto. In one embodiment, the cell is a mammalian cell, e.g., a primate cell or a rodent cell, e.g., a CHO cell. In one embodiment, the cell is a human cell.

[0122] Also provided is a hybridoma comprising a nucleic acid sequence encoding an anti-human ART1 monoclonal antibody that inhibits the activity of human ART1, the antibody having a variable heavy chain region comprising a first CDR operably linked to a second CDR operably linked to a third CDR; and / or a variable light chain region comprising a first CDR operably linked to a second CDR operably linked to a third CDR. The sequence in the CDR can comprise any of SEQ ID Nos. 21-23, 28-30, 35-37, 42-44, 66-68, or 81, or a sequence having 1, 2, 3, 4, or 5 substitutions. In one embodiment, the majority or all of the substitutions are conservative substitutions. In one embodiment, the heavy or light chain can include one or more framework regions including, but not limited to, one of SEQ ID Nos. 24-27, 31-34, 38-41, 45-47, 51-63, 71-74, or 76-79, or a sequence having 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substitutions. In one embodiment, the heavy or light chain can include one or more framework regions including, but not limited to, one of SEQ ID Nos. 24-27, 31-34, 38-41, 45-47, 51-63, 71-74, or 76-79, or a sequence having at least 80%, 85%, 90%, 92%, 95%, or 99% amino acid sequence identity thereto.

[0123] Further provided is an isolated nucleic acid comprising a promoter operably linked to a nucleotide sequence encoding at least a variable region of an Ig heavy or light chain that binds to human and / or mouse ART1, the chain comprising a variable heavy chain region comprising a first CDR operably linked to a second CDR operably linked to a third CDR; and / or a variable light chain region comprising a first CDR operably linked to a second CDR operably linked to a third CDR. The sequence in the CDR may comprise any of SEQ ID Nos. 21-23, 28-30, 35-36, 42-44, 66-68, or 81, or sequences having 1, 2, 3, 4, or 5 substitutions. In one embodiment, the majority or all of the substitutions are conservative substitutions. In one embodiment, the heavy or light chain can include one or more framework regions including, but not limited to, one of SEQ ID Nos. 24-27, 31-34, 38-41, 45-47, 51-63, 71-74, or 76-79, or a sequence having 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substitutions. In one embodiment, the heavy or light chain can include one or more framework regions including, but not limited to, one of SEQ ID Nos. 24-27, 31-34, 38-41, 45-47, 51-63, 71-74, or 76-79, or a sequence having at least 80%, 85%, 90%, 92%, 95%, or 99% amino acid sequence identity thereto.

[0124] Also provided is an isolated antibody or antigen-binding fragment thereof that binds to human and mouse ART1, wherein the antibody or antigen-binding fragment thereof has a variable heavy chain region comprising a first CDR operably linked to a second CDR operably linked to a third CDR; and / or a variable light chain region comprising a first CDR operably linked to a second CDR operably linked to a third CDR. The sequence in the CDR can comprise any of SEQ ID Nos. 21-23, 28-30, 35-36, 42-44, 66-68, or 81, or sequences having 1, 2, 3, 4, or 5 substitutions. In one embodiment, the majority or all of the substitutions are conservative substitutions. In one embodiment, the heavy or light chain can include one or more framework regions including, but not limited to, one of SEQ ID Nos. 24-27, 31-34, 38-41, 45-47, 51-63, 71-74, or 76-79, or a sequence having 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substitutions. In one embodiment, the heavy or light chain can include one or more framework regions including, but not limited to, one of SEQ ID Nos. 24-27, 31-34, 38-41, 45-47, 51-63, 71-74, or 76-79, or a sequence having at least 80%, 85%, 90%, 92%, 95%, or 99% amino acid sequence identity thereto.

[0125] Inhibitors of ART1, such as anti-human ART1 antibodies or antigen-binding fragments thereof or polypeptides that bind to human ART1, can be used in vivo. In one embodiment, a method for inhibiting or treating cancer in a mammal is provided, in which a composition comprising an effective amount of an anti-human ART1 antibody or antigen-binding fragment thereof or a polypeptide that binds to human ART1 is administered to the mammal. In one embodiment, the cancer is lung cancer, colon cancer, melanoma, glioblastoma, breast cancer, or colorectal cancer. In one embodiment, the mammal is a human. In one embodiment, the amount is effective to reduce tumor burden, inhibit metastasis, prolong survival, or any combination thereof. In one embodiment, the composition is administered systemically. In one embodiment, the mammal is also administered a chemotherapeutic agent. In one embodiment, the mammal is administered an immune checkpoint inhibitor. In one embodiment, the antibody heavy chain or fragment thereof is an IgG heavy chain. In one embodiment, the antibody light chain or fragment thereof is an Igκ light chain. In one embodiment, the fragment is a Fab', F(ab')2, scFv, or single domain. In one embodiment, the antibody or antigen-binding fragment thereof or polypeptide has a variable heavy chain region comprising a first CDR operably linked to a second CDR operably linked to a third CDR; and / or a variable light chain region comprising a first CDR operably linked to a second CDR operably linked to a third CDR. The sequences in the CDRs may comprise any of SEQ ID Nos. 21-23, 28-30, 35-36, 42-44, 66-68, or 81, or sequences having 1, 2, 3, 4, or 5 substitutions. In one embodiment, the majority or all of the substitutions are conservative substitutions. In one embodiment, the heavy or light chain can include one or more framework regions comprising, but not limited to, one of SEQ ID Nos. 24-27, 31-34, 38-41, 45-47, 51-63, 71-74, or 76-79, or a sequence having 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substitutions.In one embodiment, the heavy or light chain can include one or more framework regions comprising, but not limited to, one of SEQ ID Nos. 24-27, 31-34, 38-41, 45-47, 51-63, 71-74, or 76-79, or a sequence having at least 80%, 85%, 90%, 92%, 95%, or 99% amino acid sequence identity thereto.

[0126] In one embodiment, a method of preventing, inhibiting, or treating ART1-mediated immunosuppression in a mammal is provided. The method comprises administering to the mammal a composition comprising an effective amount of an anti-human ART1 antibody or an antigen-binding fragment thereof or a polypeptide that binds to human ART1. In one embodiment, the composition is administered systemically. In one embodiment, the mammal is also administered a chemotherapy drug and / or radiation therapy. In one embodiment, the mammal is administered an immune checkpoint inhibitor. In one embodiment, the antibody heavy chain or fragment thereof is an IgG heavy chain. In one embodiment, the antibody light chain or fragment thereof is an Igκ light chain. In one embodiment, the fragment is a Fab' or scFv. In one embodiment, the antibody or antigen-binding fragment thereof or polypeptide has a variable heavy chain region comprising a first CDR operably linked to a second CDR operably linked to a third CDR; and / or a variable light chain region comprising a first CDR operably linked to a second CDR operably linked to a third CDR. The sequences in the CDRs may comprise any of SEQ ID Nos. 21-23, 28-30, 35-36, 42-44, 66-68, or 81, or sequences with 1, 2, 3, 4, or 5 substitutions. In one embodiment, the majority or all of the substitutions are conservative substitutions. In one embodiment, the heavy or light chain may comprise one or more framework regions comprising, but not limited to, one of SEQ ID Nos. 24-27, 31-34, 38-41, 45-47, 51-63, 71-74, or 76-79, or sequences with 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substitutions. In one embodiment, the heavy or light chain can include one or more framework regions comprising, but not limited to, one of SEQ ID Nos. 24-27, 31-34, 38-41, 45-47, 51-63, 71-74, or 76-79, or a sequence having at least 80%, 85%, 90%, 92%, 95%, or 99% amino acid sequence identity thereto.

[0127] Also provided is a method for enhancing an immune response in a mammal having cancer, comprising administering to the mammal a composition comprising an effective amount of an anti-human ART1 antibody or an antigen-binding fragment thereof or a polypeptide that binds to human ART1. In one embodiment, the composition is administered systemically. In one embodiment, the mammal is also administered a chemotherapy agent and / or radiation therapy. In one embodiment, the mammal is administered an immune checkpoint inhibitor. In one embodiment, the antibody heavy chain or fragment thereof is an IgG heavy chain. In one embodiment, the antibody light chain or fragment thereof is an Igκ light chain. In one embodiment, the fragment is a Fab' or scFv. In one embodiment, the antibody or antigen-binding fragment thereof or polypeptide has a variable heavy chain region comprising a first CDR operably linked to a second CDR operably linked to a third CDR; and / or a variable light chain region comprising a first CDR operably linked to a second CDR operably linked to a third CDR. The sequences in the CDRs may comprise any of SEQ ID Nos. 21-23, 28-30, 35-36, 42-44, 66-68, or 81, or sequences with 1, 2, 3, 4, or 5 substitutions. In one embodiment, the majority or all of the substitutions are conservative substitutions. In one embodiment, the heavy or light chain may comprise one or more framework regions comprising, but not limited to, one of SEQ ID Nos. 24-27, 31-34, 38-41, 45-47, 51-63, 71-74, or 76-79, or sequences with 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substitutions. In one embodiment, the heavy or light chain can include one or more framework regions comprising, but not limited to, one of SEQ ID Nos. 24-27, 31-34, 38-41, 45-47, 51-63, 71-74, or 76-79, or a sequence having at least 80%, 85%, 90%, 92%, 95%, or 99% amino acid sequence identity thereto.

[0128] The invention is illustrated by the following non-limiting examples. EXAMPLES

[0129] Example 1 To determine whether ART1 contributes to distinct phenotypic characteristics, we used shRNA to translocate mouse KRAS G12D / + / p53 - / - We knocked down ART1 expression in a cell line (KP1). In both tail vein injection-induced lung and subcutaneous injection flank tumor models in immune-competent mice, a significant reduction in tumor burden was observed upon knockdown of ART1 and enzyme inhibition. In the KP1 tail vein model, ART1 knockdown was associated with control of tumor progression and long-term survival (approximately 50%) in mice (p<0.001), superior to that seen with immune checkpoint blockade (ICB) using PD-1 antibodies. This effect of ART1 knockdown on tumor growth was significantly abrogated in nude and CD8-depleted mice, suggesting that ART1 may act through an immune-mediated mechanism. ART1 may specifically MAR P2RX7 in CD8+ T cells, particularly tissue-resident memory T cells (Trm). P2RX7 is a cytolytic ATP receptor that mediates apoptotic cell death in T cells, macrophages, and dendritic cells. Cellular stress or cell death and extracellular NAD + Upon release of NAD, the MAR of P2RX7 on the surface of T cells inhibits prolonged receptor activation, Ca, a phenomenon called NAD-induced cell death (NICD). 2+ Thus, it was hypothesized that ART1-induced MAR of P2RX7 in T cells may enable ART1-rich cancer cells to blunt the T cell immune response against them by inducing T cell apoptosis. Indeed, NAD released during cell death and inflammation +It was previously shown that ART1 regulates the homeostasis of cytotoxic CD8 T cells through extracellular ADP-ribosylation. By RNAseq of lung-infiltrating CD8 T cell populations in a mouse model, we showed that the relative expression of P2RX7 increases in CD8+ T cells (p<0.001) with tumor burden after tail vein injection in mice, and that P2X7R+CD8 T cells are preferentially ADP-ribosylated. In vivo, using dox-inducible shRNA, it was shown that higher ART1 expression in cancer cells leads to a lower percentage of activated lung-infiltrating CD8+ T cells. Similar findings were observed in ART1-overexpressing human tumors, where a lower percentage of CD103+ / P2RX7+CD8+Trm cells was found than in adjacent lungs with lower ART1. In a mouse model, it was observed that abrogation of ART1 expression in cancer cells leads to a significant enrichment of tumor-infiltrating P2RX7+ / CD8+ and CD103+ / CD8+(Trm) T cells. Furthermore, it was observed that upon knockdown of ART1, there was a significant enrichment of activated CD103+ / P2RX7+ dendritic cells (DCs) in KP1-implanted tumor mice.

[0130] The complex relationship between ART1-expressing cancer cells and the tumor immune microenvironment was studied. As an extracellular enzyme target, ART1 should be highly druggable. MAR can be blocked by small molecule arginine analogues, such as the antibiotic novobiocin, MIBG (a safe norepinephrine analogue imaging agent), and non-specific PARP inhibitors (e.g., EB-47). These drugs compete with NAD+ at the enzyme active site and have been shown to have anti-cancer effects in mouse models or untargeted patient populations. ART1-overexpressing tumors can be targeted with therapeutic monoclonal antibodies, similar to ICB. A humanized therapeutic monoclonal antibody (22C12) has been developed that binds to ART1 and inhibits ADP-ribosylation in ART1-expressing cancer cells (see Examples 2 and 3). Preliminary data showed a dramatic reduction (about 59%) of mouse KP1 flank tumors when treated intratumorally with 22C12 compared to control antibodies. This reduction was associated with a significant enrichment of P2X7R+CD8+ T cells and P2RX7+CD103+DCs within the tumor.

[0131] We investigated the mechanisms and appropriate circumstances for therapeutic targeting of ART1. ART1 expression may be upregulated by cellular stress and its enzymatic activity may be enhanced by the release of NAD+, both of which occur after commonly used cytotoxic therapies. Thus, increased tumor ART1 expression after treatment may underpin therapeutic inhibition of ART1 in combination with chemotherapy, radiotherapy, or immune checkpoint blockade (ICB).

[0132] Example 2 Development of therapeutic antibodies targeting ART1, an extracellular mono-ADP-ribosyltransferase, for the treatment of cancer Antibodies that specifically inhibit ART1 or its function can be used as targeted therapeutic agents in cancers that express, e.g., overexpress, ART1, for example in NSCLC patients that overexpress ART-1, to limit metastatic spread of cancer by promoting immune-mediated destruction of disseminated cells. As an extracellular enzyme target, ART1 has high druggability. ART1 antibodies can be used as combination therapy with cytotoxic chemotherapy or immune checkpoint inhibitors.

[0133] In one embodiment, the antibody is reactive to both mouse ART1 and human ART1. ART1, substrate protein, and labeled NAD+ are used to enzymatically screen the antibody for inhibitors of mono-ADP-ribosylation. In vitro neutrophil and lymphocyte cytotoxicity assays are used to test potential therapeutic antibodies. In vitro, therapeutic blockade of ART1 promotes immune cell cytotoxicity against ART1-expressing lung cancer cells. Notably, ART1 expression (and similar phenotypes) has been observed in mouse and human breast cancer models and clinical specimens as well as human colorectal cancer specimens. Thus, anti-ART1 antibodies have a broad anti-cancer scope.

[0134] To generate functional humanized antibodies against ART1, recombinant human and mouse ART1 produced and purified in HEK293 mammalian cells was used to immunize transgenic mice with a human immunoglobulin repertoire. After immunization and test bleed analysis, spleens were harvested and fused with a myeloma fusion partner to generate hybridomas.

[0135] First, hybridoma supernatants were screened on ELISA plates coated with purified human ART1. Hybridoma cells from positive wells were frozen for later recovery. Then, fluorescent NAD + Anti-human ART1 positive hybridoma supernatants were tested for inhibition of purified human ART1 by a readout of . This assay measures the NAD consumed in the ADP-ribosylation of histone proteins by ART1. +Measure.

[0136] Anti-ART1 hybridoma supernatants were also tested for inhibition of human ART1 transiently expressed in HEK293 cells. This method has been previously described for ART2 (Krebs et al.) and then detects NAD1, which is detected with an anti-etheno antibody using flow cytometry. + Analogues (etheno-NAD + ) to confirm cell surface ADP-ribosylation. Two hybridoma supernatants (fusion wells 22C12 and 14G01) were positive for inhibition of human ART1 in biochemical and cell-based assays. Supernatants from 22C12 and 14G01 were then also tested for binding to moART1 by ELISA and inhibition of purified mouse ART1 (Figure 11). Twenty-seven hybridoma clones secreted antibodies that bound recombinant human ART1, two clones secreted antibodies that inhibited recombinant human ART1, two clones secreted antibodies that inhibited human ART expressed in HEK293 cells, two clones secreted antibodies that bound mouse ART1, and two clones secreted antibodies that inhibited mouse ART1.

[0137] After subcloning of the hybridomas and expansion of clones 22C12 and 14G01, antibodies were purified from hybridoma supernatants for potency ranking and affinity determination by surface plasmon resonance (SPR). Purified antibodies from clones 22C12 and 14G01 were captured on an SPR anti-Fc chip, and purified human and mouse ART1 were used as analytes at the indicated concentrations (Figure 12).

[0138] To determine potency in cell-based functional assays, purified antibodies from clones 22C12 and 14G01 were incubated with indicated concentrations of huART1-transfected HEK293 cells and then incubated with etheno-NAD + Cell surface ADP-ribosylation was then confirmed by flow cytometry and used to characterize the IC 50Values ​​were calculated (FIG. 13). Binding affinity and in vitro potency data from mAbs 22C12 and 14G01 are summarized in Table 1.

[0139] Table 1. Binding affinity and in vitro potency data for lead candidate mAbs. TIFF2025508690000043.tif13170pM: picomolar concentration nM: nanomolar

[0140] Exemplary ART1 antibody sequences: 22C12 VH(human) TIFF2025508690000044.tif82170 Red: CDRs labeled according to IMGT nomenclature.

[0141] Example 3 ART1 tips the balance between life and death of antitumor T cells The elimination of T cells by NAD-induced cell death following mono-ADP-ribosylation of the P2X7 receptor constitutes a regulatory mechanism for maintaining tissue immune homeostasis. This disclosure shows that in non-small cell lung cancer, tumor cells overexpressing mono-ADP-ribosyltransferase 1, or ART1, exploit this mechanism to escape immune-mediated control by eliminating P2X7 receptor-positive CD8 T cells in the local microenvironment. Therapeutic targeting of ART1 with a novel monoclonal antibody improved tumor control in a mouse model of lung cancer.

[0142] In particular, ART1 was found to be strongly expressed in the majority of lung adenocarcinomas, and its membrane expression was associated with lower CD8 T cell infiltration compared to ART1-negative tumors. In mouse models of NSCLC, genetic and pharmacological targeting of ART1 inhibited tumor growth in immunocompetent but not immunodeficient mice, and upregulated P2X7R in tumors of immunocompetent mice. + It has been shown that P2X7R increases the infiltration of CD8 T cells. - / -We confirmed that CD8 T cells isolated from wild-type mice, but not from wild-type mice, were preferentially susceptible to ART1-mediated ADP-ribosylation and NICD. + CD8 T cell-mediated NAD + Expression of CD38, an ADP-ribosyl cyclase that degrades ART1, reduced ART1-mediated ADP-ribosylation and NICD. ART1-mediated NICD is a mechanism of immune resistance in NSCLC and other cancers.

[0143] Introduction Immune checkpoint inhibitors (ICIs), alone or in combination with chemotherapy, have become standard of care in patients with advanced non-small cell lung cancer (NSCLC) in the absence of targetable molecular alterations (Mok et al., 2019; Reck et al., 2016). However, the majority of lung cancer patients, including many with high tumor PD-L1 expression, either do not respond to ICIs or do not experience long-term benefit from ICIs (Gandhi et al., 2018; Gandini et al., 2016). Thus, there is an urgent need to identify other robust biomarkers predictive of response to ICIs and to understand the mechanisms of primary and acquired resistance of lung cancer to immunotherapy.

[0144] In humans, ADP-ribosyltransferase-1 (ART1) is expressed at low levels in healthy tissues, including the lung. ART1 is a GPI-anchored enzyme with an extracellular catalytic domain. Thus, ART1 can mono-ADP-ribosylate extracellular proteins in the local microenvironment and alter their function (Stevens et al., 2009; Okazaki et al., 1994; Balducci et al., 1999). Although ART1 expression in lung cancer has not been studied, previous studies have suggested increased ART1 protein expression in colorectal cancer and glioblastoma, where high expression was associated with poor prognosis (Yang et al., 2013). In mouse models of colorectal cancer, ART1 expression was shown to promote a more aggressive phenotype with increased epithelial-mesenchymal transition, cell proliferative signaling, and increased angiogenesis (Yang et al., 2013; Song et al., 2016). However, whether tumor ART1 expression can regulate tumor crosstalk with the immune microenvironment remains to be determined.

[0145] Among the well-described targets of ADP-ribosyltransferases is the P2X7 receptor (P2X7R, gene id: P2RX7). P2X7R is an ATP-gated cation channel of the type 2 purinergic receptor family that has low affinity for extracellular ATP and activates pro-inflammatory pathways (Burnstalk & Knight, 2004). It is expressed in multiple immune cell subsets, including T cells, and its expression is essential for inflammatory responses and antitumor immunity (Adinolfi et al., 2015; Haag et al., 2007). P2X7R can also be overexpressed in cancer cells, where it may promote tumor progression. However, in NSCLC, high expression of P2X7R was associated with improved overall and progression-free survival (Boldrini et al., 2015). In pathological conditions, such as tissue injury, tumor development, or inflammation, cytosolic NAD +is released into the local extracellular environment where extracellular ADP-ribosyltransferase can use it as a substrate to catalyze the transfer of ADP-ribose to P2X7R (Haag et al., 2007). This covalent modification results in constitutive activation of P2X7R, inducing the formation of large pores, uncontrolled calcium influx, and externalization of phosphatidylserine, which leads to a process known as NAD-induced cell death (NICD) (Scheuplein et al., 2009). Typically, extracellular NAD + The concentration of NAD+ is low and tightly regulated by the ADP-ribosyl cyclase CD38, which is expressed in activated immune cells as well as cancer cells (Sandoval-Montes & Santos-Argumedo, 2005; Chen et al., 2018). However, even in the presence of CD38, the concentration of extracellular NAD+ can be elevated following its rapid release from stressed or dying cells (Haag et al., 2007). In preclinical studies, ART-mediated NICD of T cells has been proposed as a homeostatic mechanism to eliminate naive and bystander T cells in inflamed tissues (Adriouch et al., 2007). More recently, NICD has been shown to regulate the homeostasis of CD4 regulatory T cells (CD4 Tregs), which have a wide range of immunoregulatory functions, and tissue-resident memory T cells (TRMs), whose presence in lung tumors was associated with favorable prognosis (Stark et al., 2018; Nizard et al., 2017). These preclinical studies identify a role for ADP-ribosyltransferase-2 (ART2) in NICD-mediated immune modulation. ART2 is expressed in mouse lymphocytes, where it can auto-ADP-ribosylate P2X7R-mediated NICD in cis. However, in humans, the ART2 gene contains a premature stop codon, which makes it a pseudogene, while other ARTs, such as ART1, ART3, ART4, and ART5, are transcriptionally active.

[0146] As disclosed herein, ART1 is expressed on the surface of human lung cancer cells, and its expression is associated with P2X7R + ART1 expression is associated with reduced lung tumor infiltration by CD8 T cells. In preclinical models of lung cancer and melanoma, tumor cell ART1 expression promotes escape from CD8 T cell-mediated tumor control. Blockade of ART1 with a therapeutic monoclonal antibody reduced the growth and dissemination of ART1-expressing tumors in immunocompetent mice, and activated P2X7R + and promoted tumor infiltration by CD8 T cells. Overall, our data suggest that tumor expression of ART1 represents a unique mechanism of immune resistance and that ART1 is a viable target for enhancing T cell-mediated tumor rejection.

[0147] result ART1 is expressed in human NSCLC and is associated with reduced CD8 T cell infiltration ART1 expression was assessed by immunofluorescence in human NSCLC lines A549 and H1650 and a benign bronchial epithelial cell line (BEAS2B). Tumor cell lines had heterogeneous expression of cell surface (Figure 14A-B) and whole cell ART1 (Figure 14A, Figure 19A). Both tumor cell lines had a higher ratio of cell surface / whole cell expression than BEAS2B cells (59.5% and 55.4% vs. 29.2%, respectively, Figure 14C). Analysis of ART1 gene expression by RT-qPCR in tumors and matched normal lung tissues from 40 patients with stage I-III lung adenocarcinoma showed significantly higher average expression in cancer samples, driven by a fraction of tumors with significantly higher expression (Figure 14D). Notably, matched tumors also had significantly lower expression of glycosylphosphatidylinositol-specific phospholipase D1 (GPLD1), the only well-characterized mammalian phospholipase that regulates GPI anchor cleavage (Figure 19B). Cell-associated GPLD1 can release GPI-anchored proteins from the cell surface, but expression has been shown to be downregulated upon stress in lung cancer cells, suggesting that tumor cells are more likely to retain ART1 on the cell surface than benign cells.

[0148] To determine ART1 protein expression, a tissue microarray (TMA) consisting of 493 stage I lung adenocarcinomas was analyzed for ART1 expression by immunohistochemistry. Staining for ART1 in cancer cells was strong, moderate, and weak in 55%, 42%, and 3% of the tumors, respectively (Figure 19C and Table 2).

[0149] For the most part, ART1 expression by IHC in cancer cells was diffuse in the cytoplasm, although concentrated staining near the cell periphery and membrane (membranous) was identified in 10% of tumors (Figure 14E and Table 3). Tumors with myxoid histology subtype, a rare tumor that comprised only 3.7% of the cohort, were particularly likely to express membranous ART1 compared with other histology subtypes (44% vs. 8.4%). Tumors were also scored for infiltration of CD3, CD8, CD4, and FoxP3 T cells, CD20 (B cells), CD56 (natural killer (NK) cells), and CD68 or CD163 (macrophages) (Table 4). There was no correlation between overall ART1 staining intensity and immune cell infiltration (Table 2). However, tumors with membranous ART1 staining were significantly more likely to have low CD8 T cell infiltration compared with tumors with only diffuse ART1 in the cytoplasm (72% vs. 44%, Figure 19F, Table 3).

[0150] Next, we used the cBioportal platform to analyze transcriptome data from a lung adenocarcinoma cohort (TCGA, PanCancer Atlas) to assess whether ART1 tumor expression was associated with differential expression of genes associated with CD8 T cell cytotoxicity; IFNγ (IFNG), Granzyme A (GZMA), Granzyme B (GZMB), Perforin 1 (PRF1) 41BB (TNFRSF9), and genes associated with immune regulation; CTLA-4 (CTLA4), PD-1 (PDCD1), Tim-3 (HAVCR2), Lag-3 (LAG3), and Tigit (TIGIT). cBioportals OncoPrint with clustering was used to generate a heatmap, which showed that high ART1 mRNA expression was associated with low expression of CD8 T cell cytotoxicity and immune regulation genes (Figure 14G). Analysis of individual genes revealed that ART1 was associated with differential expression of CD8 T cell cytotoxicity and immune regulation genes (Figure 14G). 高 Patients with tumors were treated with ART1 低 Compared to tumor-bearing patients, the mRNA expression of IFNG, GZMA, TNFRSF9, CTLA4, PDCD1, and TIGIT was shown to be significantly reduced (Figure 19D).

[0151] ART1 Tumor Expression Confers Immune Resistance in a Murine Lung Tumor Model To test the hypothesis that ART1 expression protects tumors from T cell-mediated rejection, we developed a mouse model of ART1-overexpressing NSCLC. G12D / + / p53 - / - Mouse (KP1-ART1 OE The ART1 plasmid was introduced into KP1 cells originally derived from the wild-type KP1 strain. The parent wild-type KP1 strain has low levels of cell surface expression of ART1 at baseline, whereas the engineered KP1-ART1 OE The line showed an approximately 9-fold increase in surface expression of ART1 per cell by IF (FIG. 20A). OECells were transduced with doxycycline-inducible short hairpin RNA (shRNA) targeting ART1 (shART1). Doxycycline-inducible ART1 knockdown significantly reduced both the cell surface expression of ART1 in the cancer cells themselves (Figure 20A) and the ADP-ribosylation of tumor cell surface targets (Figure 20B). KP1-ART1 OE Cell proliferation remained unaffected by ART1 knockdown (FIG. 20C).

[0152] To test the effect of ART1 expression on tumor growth in vivo, immunocompetent wild-type and T cell-deficient nude C57BL / 6 mice were transfected with KP1-ART1. OE Cells were inoculated subcutaneously. Half of the mice in each group were given doxycycline to induce ART1 knockdown in vivo, which was confirmed by immunofluorescence staining of tumor specimens (Figure 20D). In immune-competent mice, KP1-ART1 OE Flank tumors grew rapidly, but doxycycline-induced ART1 knockdown significantly delayed flank tumor growth (Figure 15A, left panel). In T cell-deficient nude mice, KP1-ART1 OE Flank tumors had a similar growth rate to wild-type mice. However, the effect of ART1 knockdown on tumor growth was abrogated only in immunocompetent mice, suggesting that the tumor-promoting effect of ART1 may be T cell-dependent (Figure 15A, right panel). We next investigated the role of ART1 overexpression in an orthotopic lung tumor model.

[0153] KP1-ART1 OE To generate lung tumors, KP1-ART1 OECells were injected into the tail vein and a cohort of mice was given doxycycline to induce ART1 knockdown in vivo (Figure 15B). ART1 knockdown resulted in a significant reduction in lung tumor burden at day 14, as assessed by nodule frequency counts in hematoxylin-eosin (H&E)-stained lung sections (Figure 15C). CD8 T cell infiltration in the lungs was determined by flow cytometry at days 16 and 25. At day 25 after tumor injection, mice with ART1 knockdown induced had a significantly higher frequency of CD8 T cells among total lung tumor-infiltrating leukocytes (CD45+ cells) than mice bearing ART1-expressing tumors (Figure 15D). The percentage of lung tumor-infiltrating CD8 T cells was reduced at day 25 compared to day 16 in control mice, consistent with the loss of immune control associated with tumor progression. To test the role of ART1 in tumor progression in a second immunocompetent mouse tumor model, a melanoma line was chosen because human melanomas are shown to strongly express ART1 in the Human Protein Atlas. B16-F10 mouse melanoma cells have high endogenous ART1 cell surface expression, and we used CRISPR / Cas9 and two different guide RNAs to create an ART1-negative derivative (Figure 21A-B). We observed that subcutaneous injection of ART1-expressing B16-F10 cells in syngeneic immunocompetent mice resulted in the formation of rapidly growing flank tumors, whereas ART1-deficient B16-F10 cells showed significantly impaired tumor growth or failed to form palpable tumors (Figure 21C). The impaired growth of ART1-deficient B16-F10 cells in vivo was not due to reduced fitness of the cancer cells themselves, as ART1-deficient cells grew faster than ART1-expressing B16-F10 cells in vitro (Figure 21D).

[0154] ART1 blockade reduces lung tumor burden and inhibits P2X7R + Promotes infiltration of CD8 T cells The 22C12 monoclonal antibody targeting ART1 was used to investigate therapeutic agents targeting surface ART1. Therapeutic antibody candidates were initially developed through immunization of AlivaMab® Mouse transgenic mice with a human immunoglobulin repertoire utilizing human ART1. Candidate antibodies were further developed that bind to both human and mouse ART1 and inhibit mono ADP-ribosylation (Figures 22A-B). A lead candidate, 22C12, was further developed that potently inhibited the enzymatic activity of ART1 in a primary screening assay. 22C12 antibody clones with mouse light chain (22C12(mLC)) and human light chain (22C12(HuLC)) were generated and tested for activity in vitro and in vivo. ART1-transfected HEK293 cells (HEK-ART1 OE Binding of the 22C12 antibody to IgG was determined by NAD-Glo assay and was measured at half-maximal binding (EC 50 ) values ​​were shown (Figure 22C). Flow cytometry staining revealed that KP1-ART1 OE The binding of 22C12 to cells was evaluated (FIG. 22D). The half-maximal inhibition of ADP-ribosylation by the 22C12 antibody (IC 50 ) is HEK-ART1 OE As determined by cell surface ADP-ribosylation of cells, a 4.5 nM antibody concentration was reached (FIG. 22E). The ability of 22C12 Ab to block cancer cell-induced mono ADP-ribosylation was demonstrated by the inhibition of NAD + KP1-ART1 co-cultured with OE The toxicity of systemic administration of 22C12 antibody was evaluated in tumor-naive mice by ip injection of 25 mg / kg every 3 days for 3 weeks and monitored for weight loss and blood glucose levels at baseline and weekly until the end of the study. Mice remained normal in appearance, activity, gait, and agility throughout the study (Figure 22G-H). To test the in vivo antitumor activity of 22C12, subcutaneously implanted KP1-ART1 OEFlank tumors were given intratumoral injections of 22C12 antibody or isotype subclass-matched control antibody (5 mg / kg), beginning when tumors became palpable (day 11). Injections were repeated every 3 days until day 23. On day 25, mice were sacrificed and tumors were weighed (Figure 23A-C). ART1 blockade significantly delayed tumor growth compared to tumors treated with isotype control antibody (Figure 23B), and mean tumor weights on day 25 were significantly lower in mice treated with 22C12 compared to isotype control antibody (Figure 23C). Next, orthotopic KP1-ART1 OE A study was designed to evaluate the antitumor effects and immune modulation properties of ART1 blockade in a lung tumor model. Mice were treated intraperitoneally with 22C12 antibody (25 mg / kg) or an equivalent dose of isotype control antibody starting on day 6 after tumor injection until day 18 (Figure 16A). On day 19, mouse lungs were fixed and stained with H&E to evaluate lung tumor burden, showing fewer and significantly smaller tumor nodules in mice treated with 22C12 antibody compared to isotype-treated mice (Figure 16B-D). To confirm the observations in a second lung tumor model, endogenous surface ART1 expression in Lewis lung carcinoma (LLC1) cells was evaluated (Figure 20A). In an LLC1 orthotopic lung tumor model (similar treatment strategy to Figure 16A), mice treated with ART1 blockade had reduced lung tumor burden compared to control mice (Figure 23D-E).

[0155] Next, digested KP1-ART1 OE Flow cytometry analysis was performed on tumor-bearing lungs to assess how ART1 blockade affects P2X7R expression in the CD8 T cell compartment. Ki67 expression was assessed to indicate proliferation status, and expression of the immunoregulatory receptor PD-1 was assessed to indicate activation and tumor engagement. P2X7R+T cell expression on NICD RM Given recent studies demonstrating the sensitivity of ART1 blockade to central memory (T CM , CD62L+CD44+CD69-), effector memory (T EM , CD62L-CD44+CD69-), and TRM We assessed whether it increases the infiltration of P2X7R+ memory CD8 T cell subsets, including (CD62L-CD44+CD69+) CD8 T cells.

[0156] The majority of P2X7R+CD8 T cells co-expressed Ki67, indicating that they were in a proliferative state, and ART1 blockade was observed to increase the percentage of P2X7R+Ki67+ but not the percentage of P2X7R-Ki67-CD8 T cell subsets (Figure 16E). PD-1 was co-expressed on a subset of P2X7R+CD8 T cells, and an increase in the percentage of PD-1 expression was observed on both P2X7R- and P2X7R+ CD8 T cell subsets after ART1 blockade (Figure 16F). Furthermore, the absolute number of CD8 T cells expressing P2X7R and Ki67, normalized to the weight of lung tissue, was found to be increased in mice treated with ART1 blockade compared to control mice (Figure 16G). ART1 blockade increased the percentage of P2X7R+T RM increased the infiltration of P2X7R+T EM and T CM The population did not increase significantly (FIG. 16H). OE Following ART1 knockdown in an orthotopic lung tumor model (FIG. 23G), enrichment of P2X7R+CD8 T cells was observed.

[0157] These findings indicate that tumor ART1 expression modulates intratumoral CD8 T cells. Therefore, we next investigated whether tumor resistance exerted by ART1 expression depends on suppression of CD8 T cell-mediated immunity. To this end, we investigated KP1ART1 OEUsing an orthotopic lung tumor model, CD8 and CD4 T cells were depleted in mice by administration of monoclonal antibodies. ART1 was blocked by ip injection of 22C12 starting 6 days after tumor injection (Figure 16I). Lungs were harvested 19 days after tumor inoculation to assess tumor burden by H&E staining. In quantification of lung nodules, a reduction in the number of tumor nodules was observed in mice treated with ART1 blockade compared to control mice, but there was no significant difference between mice treated with ART1 blockade and CD8 or CD4 T cell depleting antibodies (Figure 16J-K). However, analysis of the average area of ​​tumor nodules showed that depletion of CD8 abrogates the reduction in tumor nodule size observed with ART1 blockade alone, whereas depletion of CD4 T cells does not significantly alter the antitumor effect induced by ART1 blockade (Figure 16J,L). To determine whether the dependence of ART1-mediated antitumor effects on CD8 T cells was applicable across different tumor models, CD8 / CD4 depletion studies were performed in the B16-F10 ART1 knockout model (Figure 24). 対照 It was observed that subcutaneous injection of B16 resulted in the formation of rapidly growing flank tumors. 対照 In tumor-bearing mice, CD8 and CD4 depletion led to tumor progression similar to that of mice receiving an isotype control antibody (Figure 24A, top panel, 24B). ART1KO Mice inoculated with B16 cells showed significantly impaired tumor growth or failed to form palpable tumors (3 / 7 mice tumor-free at day 70). ART1KO In tumor-bearing mice, depletion of CD8 T cells was observed in mice treated with isotype control antibody B16 ART1KO This resulted in higher tumor burden and significantly reduced survival compared to tumor-bearing mice. Mice that underwent CD4 T cell depletion developed tumors, albeit with slower tumor growth compared to CD8-depleted mice, and survival was not significantly different compared to animals treated with an isotype control (Figure 24A, bottom panel, 24B).

[0158] P2X7R expression on CD8 T cells predisposes CD8 T cells to ART1-mediated NICD Extracellular NAD + In acute inflammatory tissues characterized by increased expression of ART1, CD8 T cells expressing P2X7R are eliminated by NICD. However, the importance of P2X7R expression on CD8 T cells for antitumor immunity in lung cancer has not been fully described. We assessed whether P2RX7 expression changes in murine CD8 T cells over the course of lung tumor progression. To this end, we performed RNA sequencing analysis on CD8 T cells isolated from the lungs and spleens of mice orthotopically inoculated with wild-type KP1 cells expressing low levels of ART1. Gene expression of P2RX7 and genes implicated in CD8 T cell cytotoxicity and immune regulation was evaluated in CD8 T cells isolated 7 and 17 days after tumor inoculation as well as in CD8 T cells from naive non-tumor-bearing mouse lungs. P2RX7 expression, as well as IFNG, PRF1, PDCD1, CTLA4, HAVCR2, LAG3, and TIGIT, were moderately increased in CD8 T cells isolated from the lungs of mice bearing KP1 tumor burden at day 7 and markedly increased at day 17 after injection of KP1, compared to CD8 T cells isolated from the lungs of naive mice (Figure 25A-B). The observed changes in P2RX7 expression appeared to be restricted to lung-resident CD8 T cells, as no similar expression changes were observed in spleen-derived CD8 T cells (Figure 26). Increased surface expression of P2X7R in populations of CD8 T cells from wild-type KP1 tumor-bearing mice was confirmed by flow cytometry (Figure 25C).

[0159] In light of the finding that P2X7R+CD8 T cells were enriched in lung tumor tissues after genetic or pharmacological inhibition of ART1, we assessed whether P2X7R is a target for ART1-mediated ADP-ribosylation and NICD of lung tumor-infiltrating T cells. To this end, an in vitro co-culture assay was established in which T cells isolated from wild-type KP1 tumor-bearing mouse lungs were incubated with or without recombinant mouse ART1 (rART1). qPCR confirmed that T cells did not express ART1, and the enzymatic activity of rART1 was confirmed by the NAD-Glo assay. Etheno-tagged NAD detectable by flow cytometry was also detected. + (eNAD) was added to the co-culture to identify cells with ADP-ribosylation, while DAPI (4',6-diamidino-2-phenylindole) staining was used to measure cell death. ART2-blocking nanobody (s+16a) was used to block ART2, which is expressed in mouse lymphocytes and can mediate T cell self-ADP-ribosylation in cis. 22C12 monoclonal antibody was used to block surface ART1. The ability of ART2 and ART1 blocking antibodies to inhibit ADP-ribosylation was confirmed in experiments where T cells were cultured in the presence of eNAD alone. Blockade of ART2 resulted in a reduction in ADP-ribosylation in CD8 T cells from 70.1±8.8% to 12.9±2.6% and in CD4 T cells from 54.6±9.6% to 9.3±7.2%. ART1 blockade had no effect on ADP-ribosylation in either CD8 or CD4 T cells. Using a CD38 blocking antibody (NIMR-5), we demonstrated that CD38 expression correlates with free NADPH from the adjacent microenvironment. + We assessed whether mitochondrial DNA could play a cytoprotective role by catabolizing mitochondrial DNA.

[0160] Given previous studies showing the sensitivity of CD4+ regulatory T cells (CD4 Treg) to P2X7R-mediated NICD (22), we analyzed ADP-ribosylation and NICD separately in CD4 Treg, CD4 Tconv cells, and CD8 T cells, as well as in the P2X7R+ and P2X7R- fractions of T cell subsets (Figure 17). Mean P2X7R expression was 9.3±2.4% for CD8 T cells, 21.6±3.9% for CD4 Tconv, and 80.8±2.6% for CD4 Treg.

[0161] Total ADP-ribosylation, represented by positive eNAD staining (FIG. 17B), was assessed. Co-culture with rART1 did not significantly increase ADP-ribosylation of either P2X7R- or P2X7R+CD4 Tconv cell subsets, but both P2X7R- and P2X7R+CD4 Tregs were significantly more ADP-ribosylated in the presence of rART1. CD38 blockade significantly increased ADP-ribosylation of both P2X7R- and P2X7R+CD4 Tconv and CD4 Tregs in the presence of rART1. P2X7R+CD8 T cells, but not P2X7R-CD8 T cells, were susceptible to ART1-mediated ADP-ribosylation, which was increased in the presence of CD8 blocking antibodies. Addition of ART1 blocking antibody (22c12) to co-culture reduced ART1-mediated ADP-ribosylation of CD8 T cells as well as CD4 Tconv and CD4 Treg to baseline levels (Figure 17B). NICD was measured, as determined by the frequency of cells stained positive for both eNAD and DAPI (Figure 17C). P2X7R+CD8 T cells, but not P2X7R-CD8 T cells, were susceptible to ART1-mediated NICD, which was exacerbated by CD38 blockade. ART1 blockade reduced NICD of P2X7R+CD8 T cells to baseline levels. Low NICD levels were detected for CD4 Tconv cells, whereas NICD of CD4 Treg was significantly elevated in the presence of rART1, mainly in the P2X7R+ subset, and reduced to baseline levels upon ART1 blockade. In contrast to its effect on P2X7R+CD8 T cells, CD38 blockade reduced ART1-mediated NICD of P2X7R+CD4 Tregs (Figure 17C).

[0162] Collectively, the present data indicate that CD8 T cells and CD4 Tregs are susceptible to ART1-mediated ADP-ribosylation and NICD via P2X7R. The significant ADP-ribosylation of P2X7R-CD4 Tregs, and to a lesser extent P2X7R- and P2X7R+CD4 Tconv cells, after co-culture with rART1 and CD38 blockers indicates the presence of additional targets in these cells that are susceptible to ADP-ribosylation by ART1 in the absence of CD38 expression. However, the cytoprotective role of CD38 against ART1-mediated NICD observed in P2X7R+CD8 T cells was reversed in P2X7R+ Tregs.

[0163] It was hypothesized that the difference in susceptibility of CD8 T cells and CD4 Tconv cells to ART1-mediated NICD could be explained by differences in the relative expression of the P2RX7 splice variants P2RX7-a and P2RX7-k, which have been shown to have a higher propensity to induce NICD when mono-ADP-ribosylated compared to the P2RX7-a variant. To this end, RNA of CD8 T cells and CD4 Tconv cells isolated from KP1 tumor-bearing mouse lungs was analyzed by qPCR for the expression of P2RX7-a and P2RX7-k. As suggested by previous studies, in addition to immune cells, tumor cells are also known to express P2X7R, which may predispose tumor cells to ART1-mediated NICD. Therefore, RNA isolated from KP1, B16, and LLC1 mouse tumor cells was analyzed for the expression of P2RX7 splice variants. We observed that CD8 T cells isolated from KP1 tumor-bearing lungs, CD4 Tconv cells express comparable levels of P2RX7-k, whereas all tumor cells express low levels of P2RX7-k (Figure 26C). Expression of P2RX7-a was low in both CD8 T cells and CD4 Tconv cells, but expression was detected in KP1 and LLC1 cells and was highly expressed in B16 cells, which may protect ART1-expressing tumor cells from NICD after auto-ADP-ribosylation (Figure 26D). Consistent with these findings, proliferation assays show that ART1-expressing tumor cells grown in the presence of NAD+ and / or ART1 blockade have no significant difference in cell proliferation (Figure 26E-G).

[0164] ART1-expressing human lung tumors express P2X7R + Decreased infiltration of CD8 T cells P2X7R in human lung tumors expressing ART1 +We determined whether CD8 T cell infiltration was modulated. Twelve matched lung adenocarcinoma and adjacent normal lung tissue specimens were stained for ART1 expression by immunofluorescence. Heterogeneous expression of membranous ART1 staining was observed in both normal and cancerous lung tissue. Patient samples were assessed for infiltration of P2X7R+CD8 T cells by immunofluorescence staining, which revealed that the percentage of P2X7R+CD8 T cells among total CD8 T cells was significantly lower in lung tumor tissue compared to normal lung tissue (Figure 18C-D). Linear regression analysis of the percent change in P2X7R positivity in CD8 T cells between normal lung and tumor tissue and the percent change in ART1 MFI between normal lung and tumor tissue revealed a clear inverse correlation between P2X7R+CD8 T cells and ART1 MFI (Pearson correlation, R 2 =0.85, p<0.0001) (FIG. 18E). Furthermore, flow cytometry analysis was performed on isolated tissues from five lung adenocarcinoma patients to evaluate CD8 T cells and their expression of P2X7R and CD38. P2X7R in total CD8 T cells + The percentage of CD8 T cells was lower in the tumor compared to the adjacent lung tissue (7.1±5.6% vs. 19.5±14.8%, p<0.05) (Figure 18F-G). + CD8 T cells expressed high levels of CD38, which was significantly higher than in normal lung tissue (Fig. 18F and H). These data suggest that expression of ART1 in human lung cancer, as well as in mouse models, is related to the P2X7R + This is associated with reduced tumor infiltration by CD8 T cells, indicating that co-expression of CD38 may be necessary to avoid ART1-mediated NICD in the tumor microenvironment.

[0165] Consideration Tumor immune composition is associated with prognosis and response to immunotherapy, and CD8 T cell infiltration generally serves as an indicator of ongoing antitumor immune responses that can be reactivated by ICIs. To improve patient outcomes, it is important to advance our understanding of the factors regulating CD8 T cell infiltration and its function in tumors. In normal tissues, ART-mediated ADP-ribosylation and NICD regulate T cell homeostasis after tissue injury or infection. However, whether this mechanism is involved in regulating CD8 T cell infiltration within tumors and whether expression of ART is dysregulated in human cancers has not been previously investigated. In this study, we show that overexpression of ART1 in human lung cancer cells leads to poor survival and reduced intratumoral CD8 T cells, particularly through the upregulation of P2X7R. + It was shown that ART1 expression is associated with a reduction in CD8 T cell subsets. Furthermore, expression of ART1 in mouse tumors promoted tumor growth in immune-competent mice, but not in T cell-deficient mice or after depletion of CD8 T cells, and tumor-infiltrating P2X7R + In vitro, P2X7R is associated with a reduction in CD8 T cells. - P2X7R but not CD8 T cells + We show that CD8 T cells are susceptible to ART1-mediated ADP-ribosylation and NICD, which is exacerbated upon blockade of CD38, suggesting a potential cytoprotective role. Overall, these data identify ART1 expression in lung cancer, and possibly other cancers, as a novel regulator of CD8 T cell infiltration in the tumor microenvironment. ART1 is a viable target for improving immune-mediated tumor control. As an extracellular, membrane-anchored enzyme, ART1 should have high druggability. Herein, we show that treatment with a monoclonal antibody that binds to and inhibits ART1-induced ADP-ribosylation has therapeutic benefit in preclinical models, and that ART1 + Reduced lung cancer proliferation and activated proliferative P2X7R + It has been shown to result in increased tumor infiltration by CD8 T cells.

[0166] Despite expanding knowledge about the role of mono-ADP-ribosylation in tumor development, ART1 has only recently been described to play a role in cancer progression. In a mouse model of colon adenocarcinoma, Xu et al. showed that overexpression of ART1 promoted tumor growth, whereas knockdown inhibited tumor growth in various immunocompetent models. This effect was attributed to cis-ADP-ribosylation of integrin and Rho effector family members, with subsequent effects on downstream mediators of cell migration. The antitumor effect of knockdown or blockade of ART1 in a mouse lung cancer model is dependent on CD8 T cells. In vitro, knockdown of ART1 inhibited KP1-ART1 OE ART1 had no effect on cell proliferation and in fact enhanced tumor cell proliferation of B16 murine melanoma cells, but impaired tumor growth in vivo in immunocompetent mice. Thus, although ART1 has cancer cell-intrinsic effects that may be model-dependent, the immunosuppressive effects of ART1 expression appear to predominate in this in vivo model.

[0167] These effects are primarily mediated through mono-ADP-ribosylation of P2X7R on CD8 T cells. Tumor expression of P2X7R is associated with improved survival in NSCLC patients, but whether P2X7R expression on CD8 T cells is associated with a survival advantage remains unclear. Preclinical studies have painted a complex picture of the role of P2X7R in tumor progression and antitumor immunity. Di Virgilio and coworkers showed increased tumor progression in P2X7R-deficient mice in the B16-F10 melanoma model, which was associated with low CD8 T cell infiltration. In contrast, administration of a P2X7R antagonist to wild-type tumor-bearing mice resulted in reduced tumor growth and increased immune activation. These seemingly contradictory results can be explained by the fact that P2X7R is required for the activation of inflammasomes in dendritic cells by ATP released by dying cancer cells, which was required for the priming of antitumor CD8 T cells. Thus, P2X7R-deficient mice are unable to mount antitumor immune responses. In contrast, pharmacological inhibition of P2X7R after CD8 T cell priming has already occurred suppresses the P2X7R upregulation induced by ART1, which is highly expressed in B16 melanoma cells. + It is possible to prevent NICD of CD8 T cells. Herein, blocking ART1 in established tumors inhibits P2X7R + It has been shown to promote the infiltration of CD8 T cells.

[0168] Mechanistic studies have shown that P2X7R+CD8 T cells, and to a lesser extent CD4 Tregs, are susceptible to ART1-mediated NICD via P2X7R. The lack of sensitivity of P2X7R+CD4 Tconv cells to ART1-mediated NICD is intriguing. Although it was hypothesized that selective expression of the P2X7R-a splice variant, which is less prone to induce NICD, would explain this discrepancy, we were unable to detect high levels of this variant in either CD4 Tconv or CD8 T cells isolated from tumor-bearing lungs, indicating that other cell-intrinsic mechanisms may be at work that uniquely sensitize P2X7R+CD8 T cells to ART1-mediated NICD. However, the finding that tumor cells express high levels of P2X7R-A may indicate a mechanism by which tumor cells can simultaneously express ART1 and P2X7R without inducing auto-ADP-ribosylation and NICD.

[0169] Recent studies have demonstrated that P2X7R expression in recirculating memory CD8 T cells is essential for extracellular ATP-driven maintenance of mitochondrial function and metabolic fitness, and that CD8 T cells are required for TGFβ sensing-mediated signaling. RMs The generation of T is dependent on P2X7R. RM It was shown that the homeostasis of tumor-bearing lungs is regulated by P2X7R-mediated NICD. Consistent with these findings, ART1 inhibited the proliferation and proliferation of P2X7R+CD8 T cells in tumor-bearing lungs. RMs Together with the observation that lung tumor-infiltrating CD8 T cells have elevated P2X7R expression and co-express cytotoxic and immunomodulatory markers, P2X7R-infiltrating CD8 T cells in lung tumors was found to block increased infiltration of P2X7R. + CD8 T cells represent an important tissue-resident subset of memory T cells with antitumor activity, and these are likely targeted by ART1 tumor expression.

[0170] T cell expression of CD38 is also likely to be an important component in determining whether a cell undergoes NICD. CD38 is upregulated upon activation and differentiation in mouse and human T cells and mediates the upregulation of NAD + These results suggest that P2X7R may represent a cytoprotective mechanism to avoid ADP-ribosylation and NICD in inflamed tissues rich in P2X7R. + We show that CD8 T cells, and to a lesser extent P2X7R+CD4 Tregs, are susceptible to ART1-mediated ADP-ribosylation and NICD, and that CD38 blockade enhances ADP-ribosylation and NICD in P2X7R+CD8 T cells in the presence of ART1. + P2X7R + A subset of CD8 T cells is ART1 + It was found to be enriched in human lung tumors, suggesting that CD38 expression may allow the survival of a subset of antitumor CD8 T cells that would otherwise be eliminated by ART1-mediated NICD via P2X7R.Importantly, in vitro experiments show that ART1-mediated NICD of CD4 Treg is abrogated after CD38 blockade.Thus, in a clinical setting, treatment of ART1-positive adenocarcinoma patients with CD38 blockade may have the dual effect of exacerbating the NICD of CD8 T cells while protecting CD4 Treg, thus distorting the ratio of CD8 T cells to CD4 Treg that is related to immunotherapy response and tumor rejection.

[0171] These findings have implications for the design of clinical studies targeting CD38 to enhance antitumor immunity. In addition to T cells, CD38 is expressed by other immune cells and some cancer cells, and in preclinical studies, it has been shown to mediate the expression of NAD +It has been shown that ART1 contributes to acquired resistance to PD-1 / PD-L1 blockade by converting ART1 to ADPR, a precursor of adenosine, which has a wide range of immunosuppressive functions. The anti-CD38 antibody daratumumab was recently tested in combination with atezolizumab (an anti-PD-L1 antibody) in NSCLC patients in a clinical trial (NCT03023423). The study was terminated early due to increased mortality in the combination treatment arm. The reasons for this outcome are unclear, but it is interesting to consider whether increased NICD of antitumor T cells may have contributed. Since ART1 expression increases after cellular stress, it has been shown that its expression in tumors is highly dynamic and may increase or decrease depending on the degree of inflammation in the TME and in response to treatment. Thus, the immune-modulating effect of ART1 may play an even more important role after treatment with cytotoxic agents, e.g., chemotherapeutic agents and radiation. Such treatment increases the extracellular NAD following cell death, which may lead to increased cellular ... + It is also believed to contribute to increased levels of , potentially priming the local microenvironment for ART1-induced mono-ADP-ribosylation. Thus, more research is needed into the role of ART1 as a viable barrier to responses to combined cytotoxic agents and immunotherapy.

[0172] Thus, in NSCLC, ART1-expressing tumor cells eliminate tumor-infiltrating CD8 T cells via NICD. Our findings suggest that ART1 tumor expression may have prognostic and predictive value in lung cancer patients undergoing immunotherapy. Pharmacological targeting of ART1 may enhance CD8 T cell-mediated immune responses in NSCLC patients.

[0173] material and method Statistical Analysis: Human Patient Data: For NSCLC TMAs, continuous variables are reported as median (interquartile range [IQR]) and categorical variables are reported as counts (percentages). Chi-square or Fisher's exact test was used to compare categorical variables between independent groups. Mann-Whitney U test was used to compare continuous variables between two independent groups. Wilcoxon signed rank test was used to assess statistical significance of gene expression data from paired samples. Paired t-test was used to determine statistical significance of ART1 expression determined by immunofluorescent surface staining in paired samples. ART1 expression data were square root transformed, while percentages of tissue-infiltrating immune cells were log transformed prior to statistical testing with paired t-test to ensure that the assumptions underlying the test were met. Statistical significance of ART1 MFI in human lung tumor cell lines was determined by one-way ANOVA with Tukey's test for multiple comparisons.

[0174] Data from mouse experiments: Data consisting of counts, percentages and expression data were log- or square-root transformed, where indicated, prior to statistical testing by Welch's t-test. OE Tumor growth data comparing the effect of inducible ART1 knockdown in tumors or ART1 knockout in B16-F10 tumors were analyzed by repeated measures ANOVA with Geisser-Greenhouse correction. Mixed model analysis was used to determine statistically significant differences in tumor growth between mice treated with ART1 blocking antibodies or isotype control antibodies. KP1 cells and KP1ART1 with or without shART1 induction OE Statistical significance of differences in ART1 MFI in the 14-well plate was determined by one-way ANOVA with Tukey's test for multiple comparisons. All statistical tests were two-sided and were considered statistically significant at p < 0.05. Data analysis was performed using SPSS software version 25 (IBM Corp.) or GraphPad Prism version 8 (GraphPad).

[0175] Patient sample collection and analysis: Human lung adenocarcinoma samples for immunofluorescence and flow cytometry staining as well as RNA extraction and qPCR analysis were obtained from New York Presbyterian Hospital / Weill Cornell Medical College following an IRB-approved protocol (IRB#1008011221). IHC staining for ART1 was performed on TMAs consisting of 493 stage I lung adenocarcinomas (Suzuki et al., 2013) (primary anti-human ART1 Ab: Santa Cruz, catalog #sc-20255). TMAs were scored in a blinded fashion for the intensity and location of ART1 staining. Intensity of ART staining was scored as (1) negative, (2) weak, (3) moderate, or (4) strong. Location of staining was scored as (1) cytoplasmic, (2) membranous, or (3) both cytoplasmic and membranous. Additionally, TMAs were scored for (1) low, (2) moderate, or (3) high infiltration of immune cell subsets in tumor and stroma; pan T cells, CD4 T cells, CD8 T cells, Tregs, B cells, and macrophages, using markers; CD3, CD4, CD8, FoxP3, CD20, CD56, CD68, and CD163. NK cell infiltration in tumor and stroma was determined as absent or present using CD56 marker. The cutoffs for scoring cell numbers are listed in Table 4.

[0176] Animals: All animal studies were performed in accordance with protocols approved by the Animal Care and Use Committee of New York Presbyterian Hospital / Weill Cornell Medical College (IACUC # 2010-0050, 2015-0028). Wild-type C57BL / 6 mice (strain: C57BL / 6NTac) and athymic nude mice (strain: B6.Cg / NTac-Foxn1nu NE10) were purchased from Taconic Biosciences. All mice were maintained under pathogen-free conditions in the Weill Cornell Medicine animal facility.

[0177] Animal tumor model: For in vivo ART1 knockdown, doxycycline was delivered to mice in drinking water containing sucrose (0.1 mg / mL doxycycline in 50 g / L sucrose) for 48–72 h before incubating the KP1-ART1 OE Control animals received water containing sucrose only. Water was changed every 4 days. Orthotopic lung tumor model: 0.5 × 10 5 KP1-ART1 OE Cells were resuspended in 100 μl of PBS and injected into the tail vein of immunocompetent C57BL / 6 mice (4–6 weeks old). For lung tumor burden assessment at designated endpoints, mice were sacrificed and a portion of the tumor-bearing lung was formalin fixed, paraffin embedded, and sectioned for subsequent H&E staining and blinded counting of lung nodules. The remaining portion of the tumor-bearing lung was weighed, dissociated into a single cell suspension, and stained for analysis by flow cytometry for characterization of CD8 T cells. Ectopic flank tumor model: KP1-ART1 OE , B16 対照(Scr-6) , or B16 ART1KO Cells were cultured in 1×10 in 50 μl PBS from C57BL / 6 mice. 5 100 cells) were subcutaneously injected into the flank of immunodeficient nude mice. After the tumors became palpable, the tumor diameter was measured with a digital caliper and calculated by the formula (length × width 2 Tumor volumes were determined by ELISA using the B16-F10 CRISPR subline. In the flank tumor model, some mice were observed to die before reaching maximum tumor volume, with evidence of metastatic dissemination. Where indicated, tumors were excised, weighed, and processed for immunofluorescence and / or flow cytometry analysis.

[0178] Antibody depletion of CD4 and CD8 T cells. For depletion of CD8 and CD4 T cells, a-CD8 (clone: ​​53-6.7, Bioxcell #BP0004-1) and a-CD4 (clone: ​​GK1.5, Bioxcell #BP0003-1) antibodies were injected ip per mouse according to the following regime: days 1 and 3 (500 ug), then every 72 hours (250 ug) until the end point of the experiment (38). As negative controls for CD8 and CD4 depletion, other groups of mice received InVivoPlus rat IgG2a isotype control, anti-trinitrophenol (clone 2A3, Bioxcell #BP0089) and InVivoPlus rat IgG2b isotype control, anti-keyhole limpet hemocyanin (clone LTF-2, Bioxcell #BP0090), respectively, by ip injection.

[0179] 22C12 treatment of tumor-bearing mice: For flank tumors, intratumoral injections were performed with KP1-ART1 OE Starting on day 11, when tumors were palpable, every 72 hours until day 23 after tumor inoculation. Mice were injected with 5 mg / kg of ART1 antibody clone 22C12 for group "22C12 Ab" or mouse IgG1 isotype control (BioXcell, catalog #BP0297) for group "isocontrol Ab". Tumor size was measured every 72 hours and mice were sacrificed on day 25 after tumor inoculation, at which time tumors were weighed and processed for flow cytometry staining. For the orthotopic lung tumor model, 0.5×10 5 KP1-ART1 OE Cells were injected iv into mice. Mice were intraperitoneally (ip) injected with 25 mg / kg of ART1 antibody clone 22C12 for group "22C12 Ab", or 25 mg / kg of humanized light chain 22C12 Ab 22C12 Ab(HuLC1), or mouse IgG1 isotype control (BioXcell, catalog #BP0297) for group "isocontrol Ab". IP injections were started on day 6 and continued every 72 hours until day 18, as indicated.

[0180] Cell lines: Human cell lines H1650, A549, BEAS2B, and HEK293 were obtained from ATCC and cultured in RPMI medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin in a humidified 5% CO2 incubator at 37°C. The mouse NSCLC cell line KP1 expresses KRAS G12D / + / p53 - / - (KP1) was previously generated from a mouse lung tumor. Mouse LLC1 lung carcinoma cells and B16-F10 melanoma cells were obtained from ATCC and cultured in DMEM medium supplemented with 10% FBS and 1% penicillin-streptomycin in a humidified 5% CO2 incubator at 37°C.

[0181] KP1-ART1 OE and generation of inducible hairpin stable cell lines: (i) KP1-ART1 OE Cell Generation: The pLVX-IRES-tdTomato vector is designed to constitutively co-express a protein of interest and tdTomato from PCMV IE when transduced into mammalian cells. Prior to transduction, the vector was packaged into viral particles in HEK293T cells using the Lenti-XTM HT packaging system (catalog #632160 and 632161, Takara). The presence of tdTomato allows transductants to be visualized by fluorescence microscopy and sorted by flow cytometry. The ART1 gene was overexpressed by using this construct (pLVX-IRES-td-tomato_ART1). 293T cells (6×10 ) were transfected with 7ug of lentiviral short hairpin construct (LT3GENIR) and lentiviral packaging system (Clontech lenti-x single shot) for 10 min. 6Recombinant lentivirus (LV) was generated from 100 cells / 100 mm plate of 100-well ... OE The ART1 gene was knocked down in cells. A custom designed lentiviral construct expressed a short hairpin targeting the Art1 gene and had GFP expression for selection. LVs were generated as described in the previous section. Selection of virus-infected cells expressing shRNA was performed by using 1mg / mL G418 (neomycin analog, Sigma-Aldrich) in the medium. To induce silencing, cells were treated with 1ug / ml doxycycline, which induces GFP and shRNA expression. ART1 shRNA construct #1, Art1_87 LT3GENIR. Antisense guide sequence TIFF2025508690000045.tif412897mer construct TIFF2025508690000046.tif10170.

[0182] CRISPR-mediated gene knockout of ART1 in B16-F10 cells: CRISPR / Cas9-mediated knockout of ART1 was performed in B16-F10 cells using a custom-made ready-to-use DNA plasmid from Sigma-Aldrich in the U6gRNA:CMV-CAS9-2A-tGFP backbone. Two plasmids containing gRNAs targeting a region in exon 3 of the ART1 gene were used to knockout the B16-F10 clone B16 ART1KO(63-1) TIFF2025508690000047.tif4128 and B16 ART1KO(42-1) TIFF2025508690000048.tif4128 was created. A negative control plasmid was used to create the B16-F10 clone B16 対照(Scr-6) TIFF2025508690000049.tif4128 was generated. Briefly, B16-F10 cells were seeded in 12-well plates and incubated for 48 hours to reach 80% confluency. Each CRISPR plasmid (0.5 μg DNA) was mixed with 3□l of TransIT-CRISPR (Sigma-Aldrich) in 100 μl of Opti-MEM medium (Gibco) and incubated at room temperature for 30 minutes. The mixture was added to B16-F10 cells and incubated at 37°C in a humidified 5% CO2 incubator for 24 hours. Transfected GFP-positive single cells were sorted into flat-bottom 96-well plates using flow cytometry-activated cell sorting (FACS). Clones were expanded and tested for surface expression of ART1 by flow cytometry and immunofluorescence staining (Figure 21).

[0183] Proliferation assay: 1.4×10 4Cells were plated in 6-well plates. Cells were trypsinized and counted daily for 4 days using a Cellometer cell counting chamber (Nexcelom Bioscience). For experiments in which cells were treated with NAD (20 μM, Sigma Aldrich, Cat#N8285) + / - 22C12 (20 μg / ml), the FBS medium was replenished with the mentioned reagents every 24 hours until the endpoint.

[0184] Cell immunofluorescence: Adherent cells were plated on poly-D-lysine coated coverslips and treated with serum-free medium for 12 hours before all experiments. Cells were washed with PBS-CM (1 mM MgCl2, 0.1 mM CaCl2), fixed with 3.7% formaldehyde for 5 minutes (to prevent permeabilization), and incubated with blocking solution (5% BSA in 1x PBS) for 1 hour in a 37°C air incubator. Cells were then treated with primary antibodies ART1 (purified ART1 antibody, Pocono, rabbit #2) (1:200) or poly / mono ADP-ribose (CST, clone: ​​E6F6A rabbit mAb catalog #83732) (1:200) dissolved in 1% BSA (in 1x PBS, referred to as "Cell IF antibody buffer") for 1 hour in a 37°C air incubator. Cells were washed with PBS-CM and then incubated with anti-rabbit fluorescent secondary antibody 1:500 (Thermofisher, #A10523) dissolved in "Cell IF Antibody Buffer" for 30 min. Cells were washed with PBS-CM and then stained with 1:1000 Hoechst (Hoechst 3342, Thermofisher) in PBS-CM for 5 min. After washing with PBS-CM, samples were fixed with 3.7% formaldehyde for 5 min. Samples were then washed in PBS and stored in PBS at 4°C in the dark. Cytofluorescence microscopy was performed using a DMIRB inverted microscope (Leica Microsystems, Deerfield, IL) equipped with a cooled charge-coupled device camera (Princeton Instruments, Trenton, NJ). Images were collected with a 40×1.25 numerical aperture objective. MetaMorph software (Universal Imaging, West Chester, PA) was used for image processing and quantification of MFI and background subtraction.

[0185] NAD + Cell treatment with: Prior to all experiments, cells were treated O / N with serum-free medium. Then, cells were treated with NAD using dose-dependent serial dilutions (ranging from 0 to 50 uM) without or with dox (Art1 KD) or with Art1 blocking antibody (22C12). +(Sigma Aldrich, catalog #N8285) were used to treat cells.

[0186] Isolation of mouse tissue samples: Mice were euthanized and tumor-bearing lungs were perfused by injection of 10 ml of chilled PBS through the right ventricle. Lungs and subcutaneous tumors were excised and minced into small pieces using a scalpel. Lung and tumor fragments were transferred to GentleMACS C tubes (Miltenyi, Catalog #130-096-334), after which Lung Dissociation Mix (Miltenyi, Catalog #130-095-927) and Mouse Tumor Dissociation Mix (Miltenyi, Catalog #130-096-730), respectively, were added to the tubes after preparation according to the manufacturer's instructions. Lung and tumor fragments were enzymatically and mechanically digested using a gentleMACS Octo Dissociator with heaters (Miltenyi, Catalog #130-095-937) using programs 37C_m_LDK_1 and 37C_m_TDK_1, respectively. Tissue homogenates were resuspended in RPMI1640 supplemented with 10% FBS (Corning, Cat#15-040-CV) and passed through a 70μM strainer (Corning, Cat#431751) to obtain a single cell suspension. Cells were pelleted and washed once in chilled PBS. Cells were pelleted and resuspended in working solution of RBC Lysis Buffer (eBioscience, Cat#00-4300-54) and incubated for 2 minutes at room temperature. Cells were washed twice in PBS before proceeding to T cell isolation or flow cytometry staining.

[0187] Isolation of human tissue samples for flow cytometry: Fresh NSCLC patient tumor and adjacent normal tissues were obtained from OR / Path on ice in DMEM+10%FBS+1%p / s. Tissues were washed twice with cold DMEM+10%FBS+1%p / s and minced in DMEM supplemented with the following enzyme cocktails for tumor and normal respectively (Collagenase I 50U / mL, Collagenase II 20U / mL, Collagenase IV 50U / mL, Dnase I 50 Kunitz U / mL, Elastase 0.075U / mL). Tissues were digested for 30 minutes at 37°C, filtered, centrifuged at 4°C to collect pellets, which were resuspended in Ack lysis buffer inactivated using RBC lysis with ice-cold DMEM+10%FBS+1%p / s. For flow sorting staining, pellets were resuspended in FACS buffer.

[0188] ADP-ribosylation and NICD assays: Lung single cell suspensions were pelleted and resuspended in MACS buffer (AutoMACS Rinsing solution (Miltenyi, catalog #130-091-222) supplemented with 0.5% BSA stock solution (Miltenyi, catalog #130-091-376). Isolation of T cells was performed by magnetic bead sorting using the Pan T Cell Isolation Kit II, mouse (Miltenyi, catalog #130-095-130) according to the manufacturer's instructions. 48 hours prior to co-culture, cells were added to 48-well plates pre-coated with mouse ART1 (10 μg / ml) for 24 hours at 4°C. 1 × 10 6T cells were resuspended in serum-free RPMI1640 medium (Corning, Cat#15-040-CV) containing 100μM eNAD (Sigma Aldrich, Cat#N2630), 5μg / ml anti-ART2.2 antibody (s+16a, Biolegend, Cat#149801), 30ug / ml anti-CD38 neutralizing antibody (clone: ​​NIMR-5, Novus Biologicals, Cat#NBP2-59506) was added or not to the wells, and 20ug / ml ART1 blocking 22C12 antibody was added or not to the wells. Cells were incubated at 37°C for 2 hours. T cells were removed from the plate by gentle pipetting and transferred to the staining plate. T cells were stained with PE-conjugated anti-etheno-NAD antibody for 30 min at 4°C (clone: ​​IG4, Santa Cruz, catalog #sc-52666), followed by washing in FACS buffer (PBS supplemented with 2 mM EDTA and 0.2% BSA) and staining with surface antibodies CD3 AF594 (Biolegend, catalog #100240), CD8a BV605 (Biolegend, catalog #100743), CD4 APC-Cy7 (Biolegend, catalog #100413), CD25 AF488 (Biolegend, catalog #102018), and P2X7R PE-Cy7 (Biolegend, catalog #148707) for 20 min at 4°C using a FACSymphony analyzer (BD DAPI (Biolegend, catalog #422801) was added to cells 10 min prior to acquisition on a 30-well plate (Becton Biosciences). Flow cytometry data were analyzed using FlowJo software (FlowJo LLC, Becton Dickinson).

[0189] Flow cytometry staining of human and mouse samples: Single cell suspensions derived from enzymatically digested tumor tissues and matched normal lung tissues from patients with lung adenocarcinoma were stained with fixable viability dye (eFluor 780) in PBS for 20 minutes at 4° C. Cells were resuspended in FcR blocking solution (Miltenyi, catalog #130-092-575) for 5 minutes, followed by addition of P2X7R primary antibody (Novus Biologicals, clone: ​​7G1D6 catalog #NBP2-61748) in FACS buffer for 20 minutes at 4° C. Cells were washed in FACS buffer and resuspended in Alexa Fluor® 488-conjugated goat anti-mouse IgG secondary antibody (Biolegend, catalog #405319) for 20 minutes at 4° C. Cells were washed in FACS buffer and incubated for 20 min at 4° C. with a master mix of fluorophore-conjugated surface marker antibodies; CD3-Viogreen (Miltenyi, Cat. #130-113-704), CD8-PerCP-Vio700 (Miltenyi, Cat. #103-113-723), CD38-PE (eBioscience, Cat. #12-0389-42).

[0190] Single cell suspensions from tumor-bearing mouse lungs or subcutaneous flank tumors were stained with a fixable viability dye (eFluor 780) in PBS for 20 minutes at 4° C. For the first study, cells were washed in FACS buffer and resuspended in a master mix of fluorophore-conjugated surface marker antibodies: CD45-BD ​​Horizon V500 (BD Biosciences, Catalog #561487), CD3-eFluor 450 (eBioscience, Catalog #48-0031-82), CD8b-PE-Vio770 (Miltenyi, Catalog #130-106-316), P2X7R-FITC (Miltenyi, Catalog #130-114-221). For further studies to characterize CD8 T cell proliferation and activation, a master mix of the following conjugated antibodies was used: CD45-VioBlue (Miltenyi, catalog #130-110-802), CD3-FITC (Miltenyi, catalog #130-119-798), CD8b-PerCPVio700 (Miltenyi, catalog #130-111-715), P2X7R-APC (Miltenyi, catalog #130-114-330), CD279(PD1)-PE (Miltenyi, catalog #130-111-953). Cells were permeabilized for staining with Ki67 PE-Vio770 (Miltenyi, catalog #130-120-419). To characterize the memory T cell population CD8 T cells, dispersed cells were surface stained in a master mix of the following conjugated antibodies: CD69 PE (Miltenyi, Catalog #130-115-575), CD3-FITC (Miltenyi, Catalog #130-119-798), CD8b-PerCPVio700 (Miltenyi, Catalog #130-111-715), P2X7R-APC (Miltenyi, Catalog #130-114-330), CD62L-VioBlue (Miltenyi, Catalog #130-112-841), and CD44 PE-Vio770 (Miltenyi, Catalog #130-110-085). Memory CD8 T cell subsets are hereafter referred to as T CM :CD62L+CD44+CD69-, TEM :CD62L-CD44+CD69-, T RM : CD62L-CD44+CD69+. After surface staining, human and mouse cells were washed in FACS buffer and fixed using IC fixation buffer (Invitrogen) for 30 min at 4°C. To obtain absolute counts of immune populations, 30ul of counting beads (CountBright™ Absolute Counting Beads, 0.52×105 beads / 50ul, Invitrogen #C36950) were added before data acquisition for each sample. Absolute counts were calculated using the formula; ((cell event counts×counting bead volume) / (counting bead event counts×cell volume))×counting bead concentration. Stained samples were acquired on a MACSQuant analyzer and flow cytometry data was analyzed using FlowJo software (FlowJo LLC, Becton Dickinson).

[0191] Frozen tissue immunofluorescence: Mouse and biomarked patient samples were fixed in formaldehyde and kept in 30% sucrose (in PBS) until the samples sank. Samples were embedded in OCT blocks and sectioned using a cryostat (Leica). Sections were placed on charged slides, sectioned with a barrier pen, and dehydrated in acetone. Sections were then blocked for 1 hour in blocking solution (0.25% Triton -x100 + 5% FBS in 1x PBS). Primary antibodies: Samples were incubated overnight in the dark at 4°C with purified ART1 antibody (Purified ART1 antibody, Pocono, rabbit #2, 1:100), CD8 polyclonal antibody (#PA5-88265, 1:100), P2X7R (P2RX7 antibody, catalog #113544, Biolegend, 1:100)) dissolved in antibody buffer (5% FBS in 1x PBS). Purified ART1 antibody (Purified ART1 antibody, Pocono, rabbit #2, 1:100) was used for Art1 staining of human patient samples. For CD8 / P2X7R staining of human samples, the following antibodies were used: CD8 antibody (YTS105.18) (catalog #NB200-578 Novus Biologicals, 1:100), and P2X7 / P2RX7 antibody (7G1D6) (NBP2-61748 Novus Biologicals, 1:100). Multiple sections of matched tumor and normal lung were stained. Samples were washed multiple times in blocking solution and incubated in the respective secondary antibody (1:200, each secondary antibody) dissolved in antibody buffer for 1 hour in the dark. Samples were washed multiple times in blocking solution and incubated with Hoechst (Hoechst 3342, Thermofisher, 1:1000 in 1x PBS) for 5 minutes. Sections were mounted using prolong gold mounting medium (#P36934, Thermofisher). Sections were cured overnight in the dark at 20°C. Sections stained with secondary antibodies alone were used to determine the specificity of each primary antibody. Fluorescence microscopy was performed using a Zeiss LSM 880 laser scanning confocal microscope. Multiple fields were acquired from multiple sections of each sample.ImageJ (NIH) was used for image processing, background subtraction, quantification MFI calculation, and cell counting.

[0192] Western blot analysis: Prior to all experiments, cells were treated O / N with serum-free medium. Then, NAD was detected using a dose-dependent serial dilution (range 0-50uM) without or with dox (Art1 KD) or with Art1 blocking antibody (22C12). + Cells were treated with 1× Lysis Buffer (Sigma Aldrich, Catalog #N8285). Cells were washed with PBS and lysed in a mixture of 1× Lysis Buffer (Cat. #9803, CST) and Halt Protease & Phosphatase Inhibitor Single-Use Cocktail (Cat. #78442, Thermofisher). Cells were harvested by scraping and centrifuged to collect the supernatant. For immunoblot analysis, cellular proteins were separated by 10% SDS / PAGE, transferred to nitrocellulose membranes, and probed with rabbit MAR / PAR antibody (CST #83732, 1:1000). Blots were acquired using a MyECL imager (Thermofisher). Protein band weights were determined using Pageruler plus prestained protein ladder (10–250 kDa, #26619, Thermofisher).

[0193] Quantitative RT-PCR analysis: Cellular total RNA was extracted with RNA extraction (QIAGEN RNeasy mini kit). For initial studies with tumor cell lines, 500 ng of extracted RNA for each well was reverse transcribed into cDNA using RNA to cDNA EcoDry™ Premix (random hexamers) (catalog #639546, Takara). Quantitative PCR was performed using SYBR green master mix (iQ™ SYBR® Green Supermix, #1708884). Primer sequences for human and mouse genes are listed in Table 5. Real-time qPCR was performed using a C1000 thermal cycler (Bio-Rad) and relative quantification was performed using Bio-Rad CFX Manager software. For studies comparing the levels of P2X7R, P2X7R-a, and P2X7R-k among lung-derived T cells, KP1 lung-derived CD8, KP1 lung-derived CD4, and tumor lines (KP1, LLC1, and B16), a TaqMan one-step qPCR method was utilized. Primers were designed with the help of Thermofisher bioinformatics support. 50 ng RNA was placed into each well and FAM-conjugated mouse primers for the "gene of interest" [P2X7R (Thermofisher Assay ID: Mm01199500_m1, targeted exons 2-3) or P2X7R-A (Thermofisher Assay ID: APXGWX4, targeted exon 1, custom made) or P2X7R-K (Thermofisher Assay ID: APAAF6U, targeted exon 1, custom made), and VIC-conjugated GAPDH primer (Thermofisher Assay ID: Mm05724508_g1, targeted exon 4) were added to the reaction mixture (iTaq Universal Probes One-Step Kit, Biorad #1725141). Relative mRNA expression levels were calculated using the 2-ΔΔct method and normalized to the appropriate housekeeping gene (GAPDH).

[0194] RNA Sequencing and Gene Expression Analysis: CD8 T cells were isolated from untreated mice bearing KP1 lung tumors and RNA sequencing was performed as previously described (Markowitz et al., 2018). To display gene expression of selected genes across various treatment groups and cell types, the FPKM for each treatment / cell type was imported into R (version 3.6.2). The function pheatmap was used to display gene expression as a heatmap, and gene expression values ​​were centered and scaled along the rows by determining a z-score for each value. Clustering was performed using hierarchical clustering.

[0195] TCGA Data Analysis: cBioPortal was used to visualize and analyze transcriptomic data from the TCGA PanCancer Atlas (www.cbioportal.org). Gene expression and OS data of 503 lung adenocarcinoma samples were analyzed. Samples were analyzed using a z-score threshold of ±1.0 to mRNA expression data (batch normalized from Illumina HiSeq_RNASeqV2) with ART1 高 and ART1 低 Tumors were stratified.

[0196] NAD-glo assay: NAD / NADH-Glo™ assay (#G9071, Promega) kit was used. Histones (1.5mg / mL), NAD (200nM) (both from kit) and recombinant ART1 (40nM) or denatured ART1 (40nM) enzyme (enzymes were cloned, expressed, and purified by our collaborators at Tri-Institutional Therapeutic Discovery Institute (TDI)) were added to a 96-well white opaque bottom plate. All components were added to 1x PBS in a final reaction volume of 50μL / well and incubated on a shaker at 37°C for 1 hour and equilibrated to room temperature for 5 minutes. NAD / NADH-Glo detection reagent was prepared by mixing 1mL of reconstituted luciferin detection reagent, 5uL of reductase, 5uL of reductase substrate, 5uL of NAD cycling enzyme, and 5uL of NAD cycling substrate by gently inverting 5 times. 50 uL / well supernatant and 50 uL / well detection reagent were transferred to a new 96-well white luminometer plate and then incubated on a shaker in the dark at room temperature for 30 minutes. The luminescence of the samples was read in the luminometer.

[0197] Development and characterization of 22C12 antibody: Antibody generation: Monoclonal ART1 binding and blocking antibodies were prepared utilizing the AlivaMab® mouse (Ablexis, LLC) transgenic mouse platform containing the human immunoglobulin repertoire. To generate functional human antibodies against ART1, purified recombinant human and mouse ART1 produced in HEK293 mammalian cells was used to immunize AlivaMab® mice, followed by hybridoma generation. A stringent screening funnel developed by TDI was utilized to identify hybridoma supernatants from fused splenocytes expressing antibodies with the desired properties. Hybridoma supernatants were first screened by ELISA using plates coated with purified human ART1. Fluorescent NAD +Anti-human ART1 positive hybridoma supernatants were tested for inhibition of purified human ART1 by a ELISA readout (Abcam, catalogue ab176723). Anti-ART1 hybridoma supernatants were also tested for inhibition of human ART1 transiently expressed in HEK293 cells using an e-NAD based ADP ribosylation assay (Krebs et al., 2003). Hybridoma supernatant clone 22C12 was positive for inhibition of human ART1 in biochemical and cell-based assays. 22C12 supernatants were then tested for binding to mouse ART1 by ELISA and enzymatic inhibition of purified mouse ART1.

[0198] Binding affinity testing of 22C12 to human and mouse ART1: Following hybridoma subcloning and expansion of clone 22C12, the antibody was purified from hybridoma supernatant for potency ranking and affinity determination by bioluminescence (BLI). A range of concentrations of purified mouse and human light chain 22C12 antibody and purified human or mouse ART1 were used to determine the KD.

[0199] Testing dose-dependent inhibition of surface ADP-ribosylation by 22C12: To determine potency in a cell-based functional assay, purified 22C12 antibody was incubated at various concentrations with HEK293 cells transiently transfected with human ART1 prior to treatment with e-NAD. Cell surface ADP-ribosylation was then confirmed by flow cytometry and used to assess IC 50 values ​​were calculated.

[0200] overview The majority of non-small cell lung cancer (NSCLC) patients do not achieve durable clinical responses from immune checkpoint inhibitors, suggesting the existence of additional resistance mechanisms. Mono-ADP-ribosyltransferase (ART)-mediated NAD-induced cell death (NICD) of P2X7 receptor (P2X7R)-expressing T cells regulates immune homeostasis in inflamed tissues. In human lung adenocarcinoma, reduced membranous ART1 tumor cell expression and CD8 T cell infiltration, particularly P2X7R + A link was found between the reduction of CD8 T cell subsets. In a murine NSCLC model, genetic and pharmacological antibody-mediated ART1-blockade delayed tumor growth in a CD8 T cell-dependent manner and downregulated activated P2X7R + Promotes tumor infiltration by CD8 T cells. In vitro, P2X7R + CD8 T cells are susceptible to ART1-mediated ADP-ribosylation and NICD, which is related to NAD + This was exacerbated upon blockade of the degrading ADP-ribosyl cyclase CD38. ART1-mediated NICD provides immune resistance in NSCLC, and antibody-mediated targeting of ART1 can improve tumor control.

[0201] Table 2: ART1 staining intensity in NSCLC tissue microarrays (TMA). Clinical parameters and immune cell scoring of adenocarcinoma tissue microarrays. The table compares tumors with strong ART1 staining versus tumors with weak or moderate ART1 staining. Continuous variables are reported as median (interquartile range) and categorical variables as number (percentage). Chi-square test or Fisher's exact test (**) was used for pairwise comparisons of categorical variables. Mann-Whitney U test was used for pairwise comparisons of continuous variables. TIFF2025508690000050.tif181157

[0202] Table 3: Localization of ART1 staining in NSCLC tissue microarrays (TMAs). Clinical parameters and immune cell scoring of adenocarcinoma tissue microarrays. The table compares tumors in which ART1 staining was located on the cell surface or on the cell surface and in the cytoplasm versus tumors in which ART1 staining was located only in the cytoplasm. Continuous variables are reported as median (interquartile range) and categorical variables as number (percentage). Chi-squared or Fisher's exact test (*) was used for pairwise comparisons of categorical variables. Mann-Whitney U test was used for pairwise comparisons of continuous variables. TIFF2025508690000051.tif185157

[0203] Table 4. Immune cell scoring of NSCLC tissue microarrays TIFF2025508690000052.tif122128

[0204] Table 5. Primers used for qPCR analysis TIFF2025508690000053.tif147128

[0205] Example 4 result ART1 (Art1 KO) was knocked out using CRISPR / Cas9 in B16-F10 melanoma cells using guide RNA (Figure 31A-B). KO of Art1 in "63-1KO" B16 cells resulted in inhibition of cis-ADP ribosylation when extracellular NAD+ was added to the cell culture medium. Similarly, cis-ADP ribosylation was also greatly inhibited in B16-F10 "Scr control 6" cells when co-treated with extracellular NAD+ and 22C12 antibody (Figure 31C). Subcutaneous injection of ART1-expressing "Scr control 6" B16-F10 cells into syngeneic immunocompetent mice resulted in the formation of rapidly growing flank tumors, whereas ART1-deficient B16-F10 "63-1KO" and "Scr control 6" B16-F10 tumors treated intratumorally with 22C12 showed significant delay in tumor growth (Figure 31D).

[0206] Surface ART1 expression was observed in the mouse lung carcinoma line LLC1 (Figure 32A). LLC1 cells bound 22C12 in vitro, consistent with the levels of ART1 on the surface of these cells (Figure 32B). In vitro blockade of the enzymatic activity of surface Art1 by co-treating LLC1 cells with extracellular NAD+ and 22C12 partially blocked the cis-ADP-ribosylation signal (Figure 32C).

[0207] Beginning on day 7, when tumors were palpable, intratumoral injections of 22C12 antibody (5 mg / kg) or an equivalent dose of isotype control antibody were performed into subcutaneously implanted LLC1 flank tumors. Injections were repeated every 3 days until day 25. It was observed that ART1 blockade significantly reduced tumor growth compared to tumors treated with isotype control antibody (FIG. 32D).

[0208] method cell line B16 and LLC1 cell lines were obtained from ATCC and cultured in RPMI medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin in a humidified 5% CO2 incubator at 37 °C. CRISPR-mediated gene knockout of ART1 in B16-F10 cells: CRISPR / Cas9-mediated knockout of ART1 in B16-F10 cells was performed using a custom-made ready-to-use DNA plasmid from Sigma-Aldrich in the U6gRNA:CMV-CAS9-2A-tGFP backbone. Two plasmids containing gRNAs targeting a region in exon 3 of the ART1 gene were used to knockout the B16-F10 clone B16. ART1KO(63-1) TIFF2025508690000054.tif4128 and B16 ART1KO(42-1) TIFF2025508690000055.tif4128 was created. A negative control plasmid was used to create the B16-F10 clone B16 対照(Scr-6)(sequence 5'-3': CGCGATAGCGCGAATATATT; SEQ ID NO:7) was generated. Briefly, B16-F10 cells were seeded in 12-well plates and incubated for 48 hours to reach 80% confluency. Each CRISPR plasmid (0.5 μg DNA) was mixed with 3 μl of TransIT-CRISPR (Sigma-Aldrich) in 100 μl of Opti-MEM medium (Gibco) and incubated at room temperature for 30 minutes. The mixture was added to B16-F10 cells and incubated at 37°C in a humidified 5% CO2 incubator for 24 hours. Transfected GFP-positive single cells were sorted into flat-bottom 96-well plates using flow cytometry-activated cell sorting (FACS). Clones were expanded and tested for surface expression of ART1 by flow cytometry and immunofluorescence staining (Figure 31A-B).

[0209] Cell immunofluorescence Adherent cells were plated on poly-D-lysine coated cover slips and treated with serum-free medium for 12 hours before all experiments. Cells were washed with PBS-CM (1 mM MgCl2, 0.1 mM CaCl2), fixed with 3.7% formaldehyde for 5 minutes (to prevent permeabilization), and incubated with blocking solution (5% BSA in 1x PBS) for 1 hour in a 37°C air incubator. Cells were then treated with primary antibody ART1 (purified ART1 antibody, Pocono, rabbit #2) (1:200) dissolved in 1% BSA (in 1x PBS, referred to as "Cell IF antibody buffer") for 1 hour in a 37°C air incubator. Cells were washed with PBS-CM and then incubated with anti-rabbit fluorescent secondary antibody 1:500 (Thermofisher, #A10523) dissolved in "Cell IF antibody buffer" for 30 minutes. Cells were washed with PBS-CM and then stained with 1:1000 Hoechst (Hoechst 3342, Thermofisher) in PBS-CM for 5 min. After washing with PBS-CM, samples were fixed with 3.7% formaldehyde for 5 min. Samples were then washed in PBS and stored in PBS in the dark at 4°C.

[0210] Cytofluorescence microscopy was performed using a DMIRB inverted microscope (Leica Microsystems, Deerfield, IL) equipped with a cooled charge-coupled device camera (Princeton Instruments, Trenton, NJ). Images were collected with a 40×1.25 numerical aperture objective. MetaMorph software (Universal Imaging, West Chester, PA) was used for image processing and quantification of MFI and background subtraction.

[0211] NAD + Cell treatment with and Western blotting Prior to all experiments, cells were treated O / N with serum-free medium. NAD was then assayed using dose-dependent serial dilutions (0 and 20uM) without or with Art1 blocking antibody (20ug / ml) (22C12). + Cells were treated with 1× Lysis Buffer (Sigma Aldrich, Catalog #N8285). Cells were washed with PBS and lysed in a mixture of 1× Lysis Buffer (Cat. #9803, CST) and Halt Protease & Phosphatase Inhibitor Single-Use Cocktail (Cat. #78442, Thermofisher). Cells were harvested by scraping and centrifuged to collect the supernatant. For immunoblot analysis, cellular proteins were separated by 10% SDS / PAGE, transferred to nitrocellulose membranes, and probed with rabbit MAR / PAR antibody (CST #83732, 1:1000). Blots were acquired using a MyECL imager (Thermofisher). Protein band weights were determined using Pageruler plus prestained protein ladder (10–250 kDa, #26619, Thermofisher).

[0212] Flow cytometry to detect binding of 22c12 Ab to LLC1 cells: Dispersed LLC1 cells were incubated in AF780 viability dye (1:200 in PBS) for 10 minutes. The pellet was then washed and resuspended in FACS buffer. Cells were incubated with 22C12 (final concentration 20ug / ml, 4°C) for 30 minutes, followed by incubation with anti-rabbit 568 (1:200, 4°C) for 30 minutes. Samples were washed 3 times in FACS buffer, filtered, and analyzed by flow cytometer.

[0213] animal All animal studies were performed in accordance with protocols approved by the Animal Care and Use Committee of New York Presbyterian Hospital / Weill Cornell Medical College (IACUC #2010-0050, 2015-0028). Wild-type C57BL / 6 mice (strain: C57BL / 6NTac) were purchased from Taconic Biosciences. All mice were maintained under pathogen-free conditions in the Weill Cornell Medicine animal facility.

[0214] Ectopic flank tumor model B16-F10 cells and LLC1 were injected subcutaneously into the flanks of C57BL / 6 mice (1 × 10 in 0.05 mL PBS for B16). 5 cells in 0.05 mL for LLC1, and 5 x 10 in 0.05 mL for LLC2 5 After the tumor became palpable, the tumor diameter was measured with a digital caliper and calculated using the formula (length × width). 2 Tumor volumes were determined by 1 / 2). 22C12 treatment of tumor-bearing mice: For flank tumors, intratumoral injections were initiated on day 12 (for B16) and day 7 (for LLC1) when tumors were palpable, with intratumoral treatments every 72 hours thereafter. Mice were injected with 5 mg / kg of ART1 antibody clone 22C12 for group "22C12 Ab" or mouse IgG2a isotype control (BioXcell, catalog #BE0085) for group "isocontrol Ab".

[0215] Example 5 Humanization of the murine 22C12 antibody light chain variable region was performed followed by evaluation of the antigen-binding and functional properties of a panel of humanized candidate molecules.

[0216] To humanize the parental murine antibody 22C12 light chain variable region, a potentially suitable human light chain framework was identified using an approach that utilized 3D structures generated by in silico sequence analysis and homology modeling. A panel of humanized antibodies was generated from candidate sequences that were designed to maximize the amount of human sequence in the humanized antibody while retaining the specificity and affinity of the parent antibody. Selection of candidate humanized antibodies from the panel was based on evaluation of binding to the ART1 target antigen and functional inhibition of ART1 enzymatic activity.

[0217] Below is an exemplary humanized framework region of the light chain of antibody 22C12. TIFF2025508690000056.tif103170

[0218] Example 6 Properties of Exemplary Anti-Human ART1 Antibodies

[0219] Table 6. Molecular pharmacological properties TIFF2025508690000057.tif64148

[0220] Table 7. In vivo efficacy TIFF2025508690000058.tif22148

[0221] Table 8. Properties of biological therapeutic agents TIFF2025508690000059.tif34131

[0222] The full length protein sequence of TDI-Y-009 mAb is shown in Table 9. The definition of the IMGT complementarity determining regions (CDRs) is shown in Table 10.

[0223] Table 9: Protein sequence of candidate antibody TDI-Y-009 Chain Name Full Protein Sequence TIFF2025508690000060.tif70148Note: Variable domains are shown in bold font; CDRs are underlined; constant domains are shown in normal font.

[0224] Table 10: CDR sequences of TDI-Y-009 TIFF2025508690000061.tif23170

[0225] Characterization Antibody TDI-Y-009 was characterized for binding, pharmacokinetics, safety, and efficacy to establish a target candidate profile (TCP). For in vivo efficacy and safety testing, the antibody was formatted with mouse IgG1 Fc to reduce the risk of eliciting anti-drug antibodies (ADA) since studies were performed in immunocompetent mice over an extended period of time.

[0226] Binding to ART1: human, cynomolgus monkey, mouse The sequence identity of cynomolgus monkey and mouse ART1 to human ART1 is 95% and 76%, respectively. Studies were performed on a Biacore 4000 using a C1 sensor chip. Briefly, goat anti-human antibodies were amine-coupled to a C1 sensor chip using standard NHS / EDC (0.1 / 0.4M) activation followed by 50 μg / mL of antibody in 10 mM NaAc pH 5.0 and a 1 M ethanolamine blocking step. All studies were performed in PBS (NaCl 137 mM, KCl 2.7 mM. Na2HPO4 10 mM, and KH2PO4 1.8 mM at pH 7.4). Data were collected at 25°C. For each binding cycle, the mAb was diluted to 50 nM, 10 nM, 3.3 nM, and 1.1 nM and captured for 60 seconds. The dissociation phase was monitored for 10 minutes, followed by a regeneration step. During each binding cycle, a new aliquot of antibody was captured. The processed sensorgram data was globally fitted using a simple 1:1 interaction model. Similar high affinity binding of mAbs to human and cynomolgus ART1 was observed with comparable on and off rates. Binding of mouse ART1 was approximately 2-fold lower compared to human ART (Table 11).

[0227] Table 11. Binding kinetics of TDI-Y-009 to ART1 TIFF2025508690000062.tif26148

[0228] Selectivity for human ART1 paralogs To evaluate the selectivity of TDI-Y-009, binding to ART1 paralogs (ART3, ART4, ART5) was performed by ELISA. Briefly, ART1 or paralogs were plated on high-binding ELISA plates at 2.5 μg / mL in 1×PBS and incubated o / n at 4° C. with shaking. After blocking, 1:5 serial dilutions of TDI-Y-009 mAb were added to the plates and incubated at RT for 90 min. After washing, a 1:12,000 dilution of goat anti-human secondary HRP-labeled mAb was then added and incubated at RT for 1 h before washing, adding TMB substrate, developing, and stopping the reaction with acid before reading the absorbance at 450 nM. As shown in FIG. 33, no binding was observed to any of the ART1 paralogs up to 1.3 uM (200 μg / mL).

[0229] Binding to ART1 on cells In short, KP1-ART1 OE Or KP1-ART1 knockdown cells were seeded on plates at 100,000 cells / well. Test antibodies starting at 100 μg / mL were serially diluted 1:5 and then added to the cells and incubated on ice for 30 minutes followed by washing. Cells were then stained with anti-human IgG Fc and incubated on ice for 30 minutes followed by washing. Cells were resuspended in running buffer containing 1000× diluted SYTOX green death stain and plates were read on a Cytoflex flow cytometer. KP1-ART1 with TDI-Y-009 OE Dose-responsive binding to cells was observed (FIG. 34), but not in KP1-ART1 knockdown cells (data not shown).

[0230] Epitope mapping Epitope mapping experiments were performed using chemical cross-linking in conjunction with mass spectrometry (XL-MS). The results showed that TDI-Y-009 cross-links with the following residues of huART1: S75, S77, T79, R80, R89, H92, and Y99. The corresponding paratope amino acids for TDI-Y-009 included light chain S51 (CDR2), T96 (CDR3); heavy chain CDR2 residues S55, K59, T63, and heavy chain CDR3 residues S105 and Y108. Based on modeling of huART1, the epitope is located in the N-terminal helical domain of huART1 and does not overlap with the ART1 active site or the NAD-binding pocket located in the C-terminal β-sheet domain of the enzyme. Binding of the epitope residue Y99 (in helix 3 of the enzyme) could direct the antibody to the NAD-binding pocket, possibly sterically hindering NAD binding. Alternatively, inhibition of ART1 activity may be due to conformational changes induced upon binding of Y-009 that limit substrate binding. Although S75, S77, T79, and R80 are not conserved in mouse ART1, these residues form an insertion in human ART1 that may be mobile and thus capable of forming chemical cross-links with nearby bound antibodies. Other epitope residues suggested by this method (R89, H92, and Y99) are conserved across mouse, cynomolgus, and human ART1 and lie within highly conserved linear regions within the ART1 sequence.

[0231] Pharmacokinetics in mice A study was conducted in C57BL / 6 mice to evaluate the single-dose PK of TDI-Y-009. Plasma PK of the mAb was determined after a single IV bolus of 1, 3, or 10 mg / kg (n=5 / group) using an unvalidated ELISA assay. Briefly, goat anti-human IgG was coated on plates and serum dilutions were then incubated, followed by the addition of a secondary biotin-labeled goat anti-human IgG-Fc and detection using streptavidin-HRP. Analysis was performed using WinNonlin software. As shown in Figure 35, TDI-Y-009 has nonlinear PK with dose-dependent clearance consistent with saturable target-mediated clearance. The 10 mg / kg dose showed a significant increase in T 1 / 2 The PK of the antibody was 0.01 mg / kg, which is typical of a well-behaved antibody in mice that exhibits linear PK. This suggests complete target saturation at this dose, although further doses between 3-10 mg / kg will be required to confirm this.

[0232] In vivo efficacy studies To confirm the in vivo efficacy of TDI-Y-009 mAb (formatted with mIgG1 Fc), orthotopic KP1-ART1 lung tumors were seeded by tail vein injection of tumor cells. OE A lung tumor model was performed. To explore efficacy at lower doses than those used in previous in vivo studies, the antibodies were tested at 10 mg / kg. Mice were administered TDI-Y-009 or an equivalent dose of isotype control antibody IP starting on day 6 and continuing until day 18 after tumor cell injection. Mice treated with TDI-Y-009 antibody had significantly reduced lung tumor burden, reduced number of tumor nodules, and reduced tumor nodule area compared to control mice (Figure 36). The use of mouse IgG1 Fc in the reformatted TDI-Y-009 for this study ruled out a role for ADCC in triggering antitumor activity.

[0233] In vivo safety studies Briefly, tumor-naive C57BL / 6 mice were administered 25 mg / kg IP with parental 22C12 ("mLC22C12"), TDI-Y-009 ("hLC22C12") or isotype control antibody every 3 days for 3 weeks. Mice were closely monitored for weight loss and blood glucose levels were measured at T=0 and then weekly until the end of the study. Mice treated with test antibodies had normal appearance, activity, gait, and agility compared to mice treated with isotype control antibody (Figure 37).

[0234] Epitope mapping Chemical cross-linking, High-Mass MALDI mass spectrometry, and nLC-Orbitrap mass spectrometry were used to characterize the molecular interface between huART1 and 22C12-hLC. Briefly, each protein complex was incubated with a deuterated cross-linker and subjected to multienzymatic cleavage. After enrichment of cross-linked peptides, the samples were analyzed by high-resolution mass spectrometry. This analysis shows that the interaction involves amino acids 75, 77, 79, 80, 89, 92, and 99 of huART1. These results are illustrated in FIG. 38.

[0235] Figure 39 shows the interaction of huART1 / mAb. The PDB structure of huArt1 was generated using Swissmodel software, and the epitope site was colored in blue. The amino acids corresponding to TIFF2025508690000063.tif4128 are provided.

[0236] In one aspect, the framework region in the antibody or antigen-binding fragment thereof or polypeptide comprises: TIFF2025508690000064.tif17154, including sequences with one, two, three, four, or five conservative amino acid substitutions, and optionally one, two or three non-conservative substitutions.

[0237] In one aspect, the framework region in the antibody or antigen-binding fragment thereof or polypeptide comprises: TIFF2025508690000065.tif16163 or a sequence having one, two, three, four, or five conservative amino acid substitutions and, optionally, one, two, or three non-conservative substitutions.

[0238] In one aspect, the antibody or antigen-binding fragment thereof or polypeptide is TIFF2025508690000066.tif46170 or a sequence having one, two, three, four, or five conservative amino acid substitutions and optionally one, two, or three non-conservative substitutions, or a polypeptide having at least 80%, 82%, 84%, 85%, 87%, 88%, 89%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity thereto.

[0239] In one aspect, the antibody or antigen-binding fragment thereof or polypeptide is TIFF2025508690000067.tif22164 or a sequence having one, two, three, four or five conservative amino acid substitutions and optionally one, two or three non-conservative substitutions, or a polypeptide having at least 80%, 82%, 84%, 85%, 87%, 88%, 89%, 90%, 92%, 94%, 95%, 96%, 97%, 98% or 99% amino acid sequence identity thereto.

[0240] References TIFF2025508690000068.tif62128TIFF2025508690000069.tif234138TIFF2025508690000070.tif91128

[0241] All publications, patents and patent applications are incorporated herein by reference. In the foregoing specification, the invention has been described with respect to certain preferred embodiments, and numerous details have been set forth for purposes of illustration, but it will be apparent to those skilled in the art that the invention is susceptible to further embodiments, and that some of the details described herein can be modified considerably without departing from the underlying principles of the invention.

Claims

1. 1. An isolated cell comprising an expression cassette comprising a heterologous promoter operably linked to a nucleic acid sequence encoding an anti-human ART1 antibody or antigen-binding fragment thereof, or a polypeptide that inhibits the activity of human ART1, wherein the antibody, the antigen-binding fragment thereof, or the polypeptide is (i) a variable region comprising a first complementarity determining region (CDR) comprising GFSLSNARM (SEQ ID NO:66) operably linked to a second CDR comprising IFSNDEK (SEQ ID NO:67), which is operably linked to a third CDR comprising ARIYGGDSWGYFDN (SEQ ID NO:68); and / or (ii) a variable region comprising a first CDR comprising SSVSY (SEQ ID NO:81) operably linked to a second CDR comprising DTS (SEQ ID NO:29) operably linked to a third CDR comprising QQWSSNPPT (SEQ ID NO:30); or (iii) a variable region comprising a first CDR comprising GGSISSYY (SEQ ID NO:35) operably linked to a second CDR comprising ISTSGFT (SEQ ID NO:36) operably linked to a third CDR comprising ARDGWGRVFDI (SEQ ID NO:37); and / or (iv) a variable region comprising a first CDR comprising QSVSSSY (SEQ ID NO:42) operably linked to a second CDR comprising GAS (SEQ ID NO:43) operably linked to a third CDR comprising QQYGSST (SEQ ID NO:44). The isolated cell comprising:

2. (i) an Ig heavy chain comprising or an Ig light chain (ii) comprising a variable region comprising:

2. The isolated cell of claim 1, comprising a variable region comprising:

3. (iii) an Ig heavy chain comprising or (iv) an Ig light chain comprising a variable region comprising 2. The isolated cell of claim 1, comprising a variable region comprising:

4. (ii) an Ig light chain comprising 2. The isolated cell of claim 1, comprising a variable region comprising:

5. The cell of any one of claims 1 to 4, which is a mammalian cell.

6. The cell of claim 5, which is a primate cell.

7. The cell of claim 5, which is a human cell.

8. A hybridoma comprising a nucleic acid sequence encoding an anti-human ART1 monoclonal antibody that inhibits the activity of human ART1, wherein the antibody comprises: (i) a variable region comprising a first complementarity determining region (CDR) comprising GFSLSNARM (SEQ ID NO:66) operably linked to a second CDR comprising IFSNDEK (SEQ ID NO:67), which is operably linked to a third CDR comprising ARIYGGDSWGYFDN (SEQ ID NO:68); and / or (ii) a variable region comprising a first CDR comprising SSVSY (SEQ ID NO:81) or SSSVSY (SEQ ID NO:28) operably linked to a second CDR comprising DTS (SEQ ID NO:29) operably linked to a third CDR comprising QQWSSNPPT (SEQ ID NO:30); or (iii) a variable region comprising a first CDR comprising GGSISSYY (SEQ ID NO: 35) operably linked to a second CDR comprising ISTSGFT (SEQ ID NO: 36) operably linked to a third CDR comprising ARDGWGRVFDI (SEQ ID NO: 37); and (iv) a variable region comprising a first CDR comprising QSVSSSY (SEQ ID NO:42) operably linked to a second CDR comprising GAS (SEQ ID NO:43) operably linked to a third CDR comprising QQYGSST (SEQ ID NO:44). The hybridoma, comprising:

9. 1. An isolated nucleic acid comprising a promoter operably linked to a nucleotide sequence encoding at least a variable region of an Ig heavy or light chain that binds to human and / or mouse ART1, wherein the chain comprises: (i) a variable region comprising a first complementarity determining region (CDR) comprising GFSLSNARM (SEQ ID NO:66) operably linked to a second CDR comprising IFSNDEK (SEQ ID NO:67), which is operably linked to a third CDR comprising ARIYGGDSWGYFDN (SEQ ID NO:68); and / or (ii) a variable region comprising a first CDR comprising SSVSY (SEQ ID NO:81) operably linked to a second CDR comprising DTS (SEQ ID NO:29) operably linked to a third CDR comprising QQWSSNPPT (SEQ ID NO:30); or (iii) a variable region comprising a first CDR comprising GGSISSYY (SEQ ID NO:35) operably linked to a second CDR comprising ISTSGFT (SEQ ID NO:36) operably linked to a third CDR comprising ARDGWGRVFDI (SEQ ID NO:37); and / or (iv) a variable region comprising a first CDR comprising QSVSSSY (SEQ ID NO:42) operably linked to a second CDR comprising GAS (SEQ ID NO:43) operably linked to a third CDR comprising QQYGSST (SEQ ID NO:44). The isolated nucleic acid comprising:

10. 1. An isolated antibody or antigen-binding fragment thereof that binds to human and mouse ART1, wherein the antibody or antigen-binding fragment thereof comprises: (i) a variable region comprising a first complementarity determining region (CDR) comprising GFSLSNARM (SEQ ID NO:66) operably linked to a second CDR comprising IFSNDEK (SEQ ID NO:67), which is operably linked to a third CDR comprising ARIYGGDSWGYFDN (SEQ ID NO:68); and / or (ii) a variable region comprising a first CDR comprising SSVSY (SEQ ID NO:81) operably linked to a second CDR comprising DTS (SEQ ID NO:29) operably linked to a third CDR comprising QQWSSNPPT (SEQ ID NO:30); (iii) a variable region comprising a first CDR comprising GGSISSYY (SEQ ID NO:35) operably linked to a second CDR comprising ISTSGFT (SEQ ID NO:36) operably linked to a third CDR comprising ARDGWGRVFDI (SEQ ID NO:37); and / or (iv) a variable region comprising a first CDR comprising QSVSSSY (SEQ ID NO:42) operably linked to a second CDR comprising GAS (SEQ ID NO:43) operably linked to a third CDR comprising QQYGSST (SEQ ID NO:44). The isolated antibody or antigen fragment thereof,

11. (i) the variable region The antibody of claim 10, further comprising one or more framework regions comprising one or more of:

12. (ii) the variable region The antibody of claim 10, further comprising one or more framework regions comprising one or more of:

13. (ii) the variable region The antibody of claim 10, further comprising one or more framework regions comprising one or more of:

14. (ii) the variable region The antibody of claim 10, further comprising one or more framework regions comprising one or more of:

15. (ii) the variable region The antibody of claim 10, further comprising one or more framework regions comprising one or more of:

16. (iii) the variable region The antibody of claim 10, further comprising one or more framework regions comprising one or more of:

17. The variable region (iv) The antibody of claim 10, further comprising one or more framework regions comprising one or more of:

18. A pharmaceutical composition for inhibiting or treating cancer in a mammal, comprising an effective amount of an anti-human ART1 antibody or antigen-binding fragment thereof, or a polypeptide that binds to human ART1.

19. 19. The pharmaceutical composition of claim 18, wherein the cancer is lung cancer, colon cancer, melanoma, glioblastoma, breast cancer, or colorectal cancer.

20. 20. The pharmaceutical composition of claim 18 or 19, wherein the mammal is a human.

21. 20. The pharmaceutical composition of claim 18, wherein said amount is effective to reduce tumor burden, inhibit metastasis, prolong survival, or any combination thereof.

22. 20. The pharmaceutical composition of claim 18, wherein the composition is administered intravenously or subcutaneously.

23. 20. The pharmaceutical composition of claim 18, for use in combination therapy with a chemotherapeutic agent.

24. 20. The pharmaceutical composition of claim 18, for use in combination therapy with an immune checkpoint inhibitor.

25. the antibody, the antigen-binding fragment thereof, or the polypeptide (i) a variable region comprising a first complementarity determining region (CDR) comprising GFSLSNARM (SEQ ID NO:66) operably linked to a second CDR comprising IFSNDEK (SEQ ID NO:67), which is operably linked to a third CDR comprising ARIYGGDSWGYFDN (SEQ ID NO:68); and / or (ii) a variable region comprising a first CDR comprising SSVSY (SEQ ID NO:81) operably linked to a second CDR comprising DTS (SEQ ID NO:29) operably linked to a third CDR comprising QQWSSNPPT (SEQ ID NO:30); or (iii) a variable region comprising a first CDR comprising GGSISSYY (SEQ ID NO:35) operably linked to a second CDR comprising ISTSGFT (SEQ ID NO:36) operably linked to a third CDR comprising ARDGWGRVFDI (SEQ ID NO:37); and / or (iv) a variable region comprising a first CDR comprising QSVSSSY (SEQ ID NO:42) operably linked to a second CDR comprising GAS (SEQ ID NO:43) operably linked to a third CDR comprising QQYGSST (SEQ ID NO:44).

20. The pharmaceutical composition of claim 18, comprising:

26. 19. The pharmaceutical composition of claim 18, wherein the heavy chain is an IgG heavy chain.

27. 19. The pharmaceutical composition of claim 18, wherein the light chain is an Igκ light chain.

28. 19. The pharmaceutical composition of claim 18, comprising the antibody fragment.

29. 29. The pharmaceutical composition of claim 28, wherein the fragment is a Fab' or scFv.

30. A pharmaceutical composition for preventing, inhibiting, or treating ART1-mediated immunosuppression in a mammal, comprising an effective amount of an anti-human ART1 antibody or antigen-binding fragment thereof, or a polypeptide that binds to human ART1.

31. 31. The pharmaceutical composition of claim 30, wherein the mammal has cancer.

32. 32. The pharmaceutical composition of claim 30 or 31, wherein the mammal is a human.

33. 31. The pharmaceutical composition of claim 30, wherein the composition is administered intravenously.

34. 31. The pharmaceutical composition of claim 30, for use in combination therapy with a chemotherapeutic agent.

35. 31. The pharmaceutical composition of claim 30, for use in combination therapy with an immune checkpoint inhibitor.

36. the antibody, the antigen-binding fragment thereof, or the polypeptide (i) a variable region comprising a first complementarity determining region (CDR) comprising GFSLSNARM (SEQ ID NO:66) operably linked to a second CDR comprising IFSNDEK (SEQ ID NO:67), which is operably linked to a third CDR comprising ARIYGGDSWGYFDN (SEQ ID NO:68); and / or (ii) a variable region comprising a first CDR comprising SSVSY (SEQ ID NO:81) or SSSVSY (SEQ ID NO:28) operably linked to a second CDR comprising DTS (SEQ ID NO:29) operably linked to a third CDR comprising QQWSSNPPT (SEQ ID NO:30); or (iii) a variable region comprising a first CDR comprising GGSISSYY (SEQ ID NO:35) operably linked to a second CDR comprising ISTSGFT (SEQ ID NO:36) operably linked to a third CDR comprising ARDGWGRVFDI (SEQ ID NO:37); and / or (iv) a variable region comprising a first CDR comprising QSVSSSY (SEQ ID NO:42) operably linked to a second CDR comprising GAS (SEQ ID NO:43) operably linked to a third CDR comprising QQYGSST (SEQ ID NO:44).

31. The pharmaceutical composition of claim 30, comprising:

37. 31. The pharmaceutical composition of claim 30, wherein the heavy chain is an IgG heavy chain.

38. 31. The pharmaceutical composition of claim 30, wherein the light chain is an Igκ light chain.

39. A pharmaceutical composition for enhancing immune response in a mammal with cancer, comprising an effective amount of an anti-human ART1 antibody or antigen-binding fragment thereof, or a polypeptide that binds to human ART1.

40. 40. The pharmaceutical composition of claim 39, wherein the mammal is a human.

41. 40. The pharmaceutical composition of claim 39, wherein the heavy chain is an IgG heavy chain.

42. 40. The pharmaceutical composition of claim 39, wherein the light chain is an Igκ light chain.

43. the antibody, the antigen-binding fragment thereof, or the polypeptide (i) a variable region comprising a first complementarity determining region (CDR) comprising GFSLSNARM (SEQ ID NO:66) operably linked to a second CDR comprising IFSNDEK (SEQ ID NO:67), which is operably linked to a third CDR comprising ARIYGGDSWGYFDN (SEQ ID NO:68); and / or (ii) a variable region comprising a first CDR comprising SSVSY (SEQ ID NO:81) operably linked to a second CDR comprising DTS (SEQ ID NO:29) operably linked to a third CDR comprising QQWSSNPPT (SEQ ID NO:30); or (iii) a variable region comprising a first CDR comprising GGSISSYY (SEQ ID NO:35) operably linked to a second CDR comprising ISTSGFT (SEQ ID NO:36) operably linked to a third CDR comprising ARDGWGRVFDI (SEQ ID NO:37); and / or (iv) a variable region comprising a first CDR comprising QSVSSSY (SEQ ID NO:42) operably linked to a second CDR comprising GAS (SEQ ID NO:43) operably linked to a third CDR comprising QQYGSST (SEQ ID NO:44).

40. The pharmaceutical composition of claim 39, comprising:

Images