Nitrogen-containing heterocyclic compounds and their uses

Abstract

The present invention relates to a nitrogen-containing heterocyclic compound and its use, which has a significantly superior therapeutic effect on tumors with low or no expression of NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites in the NNMT gene and / or hypermethylation of DNA CpG sites in the NNMT gene region. The present invention provides a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof. TIFF2025509620000598.tif83150

Description

[Technical field]

[0001] The present invention relates to the technical field of medicine, in particular to nitrogen-containing heterocyclic compounds and their uses. [Background technology]

[0002] Tumors, as a common disease that seriously endangers the health of mankind, have also brought about a constant upward trend in the mortality rate of malignant tumors. Due to the heterogeneity of tumors, simply using the same treatment or the same drug according to their origin and pathological characteristics will easily cause problems caused by inappropriate treatment, which will delay the important treatment time and opportunity for patients. Therefore, there seems to be a great need to adopt precision treatment for various tumor situations. With the development of biological technology, tumors have a continuous genotype distribution at the molecular level of genes and proteins, and changes in the expression and activity of tumor-related genes and proteins have been discovered one after another, and the changes in the expression and activity of tumor-related genes and proteins play an important role in the development of malignant tumors. The discovery and application of biomarkers provides precise guidance for the application of related drugs and enables precision treatment of tumors, thereby achieving targeted dosing, greatly improving the therapeutic effect, and reducing the drug dosage and toxic side effects.

[0003] Therefore, there is an urgent need in the art to develop drugs that can precisely treat tumors. Summary of the Invention [Problem to be solved by the invention]

[0004] The present invention aims to provide a compound that has a significantly superior therapeutic effect against tumors with low or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites in the NNMT gene, and / or hypermethylation of DNA CpG sites in the NNMT gene region. [Means for solving the problem]

[0005] A first aspect of the present invention provides a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0006] [ka]

[0007] Here, R 1 and R 2 each independently represents a hydrogen atom, a deuterium atom, a halogen atom, a substituted or unsubstituted C1-C16 alkyl group, a substituted or unsubstituted C3-C16 cycloalkyl group, a substituted or unsubstituted 3-12 membered heterocycloalkyl group, a substituted or unsubstituted C1-C16 halogenated alkyl group, a substituted or unsubstituted C3-C16 halogenated cycloalkyl group, a substituted or unsubstituted C6-C16 aryl group, or a substituted or unsubstituted 5-12 membered heteroaryl group;

[0008] R 3 , R 4 and R 5 are each independently a hydrogen atom, a halogen atom, or R 17 -O-, R 17 -S- or (R 18 R 19 )N-; or R 3 and R 4 , or R 4 and R 5 are linked to form a substituted or unsubstituted 3- to 12-membered heterocycloalkyl ring;

[0009] R 6 , R 8 , R 11 , R 12 , R 13 , R 14 and R 15 each independently represents a hydrogen atom, a substituted or unsubstituted C1-C8 alkyl group, or a halogen atom;

[0010] R 7represents a hydrogen atom, a substituted or unsubstituted C1-C12 alkyl group, a substituted or unsubstituted C1-C12 halogenated alkyl group, a substituted or unsubstituted C6-C16 aryl group-substituted or unsubstituted C1-C12 alkyl group-, or a substituted or unsubstituted 5-16 membered heteroaryl group-substituted or unsubstituted C1-C12 alkyl group-; R 9 and R 10 are linked to form a substituted or unsubstituted 3- to 12-membered heterocycloalkyl ring; R 17 represents a hydrogen atom or a substituted or unsubstituted C1-C16 alkyl group;

[0011] [ka]

[0012] Substituted or unsubstituted C3-C16 cycloalkyl group, substituted or unsubstituted 3-12 membered heterocycloalkyl group, substituted or unsubstituted C3-C16 cycloalkyl group-substituted or unsubstituted C2-C10 acyl group-, substituted or unsubstituted C3-C16 cycloalkyl group-C(O)-, substituted or unsubstituted C1-C16 halogenated alkyl group, substituted or unsubstituted C3-C16 halogenated cycloalkyl group, substituted or unsubstituted 3-12 membered heterocycloalkyl group-substituted or unsubstituted C1-C12 alkyl group-, substituted or unsubstituted C6-C16 aryl group-substituted or unsubstituted C1-C12 alkyl group-, substituted or unsubstituted C6-C16 aryl group-substituted or unsubstituted C6-C16 aryl group-substituted or unsubstituted C1-C12 alkyl group-, substituted or unsubstituted 5- 16-membered heteroaryl group-substituted or unsubstituted C1-C12 alkyl group-, substituted or unsubstituted C6-C16 aryl group-O-substituted or unsubstituted C1-C12 alkyl group-, substituted or unsubstituted C6-C16 aryl group-S-substituted or unsubstituted C1-C12 alkyl group-, substituted or unsubstituted 5-16-membered heteroaryl group-O-substituted or unsubstituted C1-C12 alkyl group-, substituted or unsubstituted 5-16-membered heteroaryl group-S-substituted or unsubstituted C1-C12 alkyl group-, substituted or unsubstituted C2-C8 alkenyl group-substituted or unsubstituted C1-C8 alkyl group-substituted or unsubstituted C2-C8 alkenyl group-substituted or unsubstituted C1-C8 alkyl group-, substituted or unsubstituted C2-C8 alkenyl group-substituted or unsubstituted C1-C8 alkyl group-, or (R 20 R 21 ) N-substituted or unsubstituted C1-C12 alkyl group;

[0013] R 18 and R 19 each independently represents a hydrogen atom, a substituted or unsubstituted C1-C12 alkyl group, a substituted or unsubstituted C3-C12 cycloalkyl group, or a substituted or unsubstituted C6-C16 aryl group-substituted or unsubstituted C1-C12 alkyl group-; or R 18 and R 19 are linked to form a substituted or unsubstituted 3- to 12-membered heterocycloalkyl ring;

[0014] R20 and R 21 each independently represents a hydrogen atom, a substituted or unsubstituted C1-C12 alkyl group, a substituted or unsubstituted C3-C12 cycloalkyl group, or a substituted or unsubstituted C2-C10 ester group; or R 20 and R 21 are joined to form a substituted or unsubstituted 3- to 12-membered heterocycloalkyl group.

[0015] In another preferred example, the heterocycloalkyl group, the heteroaryl group, and the heterocycloalkyl ring each independently have 1 to 4 (preferably 1, 2, 3, or 4) heteroatoms selected from N, O, and S on the heterocycle.

[0016] In another preferred example, the heterocycloalkyl group has 1 to 4 (preferably 1, 2, 3 or 4) heteroatoms independently selected from N, O and S on the heterocycle.

[0017] In another preferred example, there are 1 to 4 (preferably 1, 2, 3 or 4) heteroatoms independently selected from N, O and S on the heterocyclic ring of the heteroaryl group.

[0018] In another preferred example, there are 1 to 4 (preferably 1, 2, 3 or 4) heteroatoms independently selected from N, O and S on the heterocyclic ring of the heterocycloalkyl ring.

[0019] In another preferred embodiment, the heterocycloalkyl group contains 0, 1 or 2 C=C cyclic double bonds.

[0020] In another preferred embodiment, the heterocycloalkyl ring contains 0, 1 or 2 C=C cyclic double bonds.

[0021] In another preferred embodiment, the optional "substitution" is one or more (preferably 1, 2, 3, 4, 5, 6, 7, or 8) hydrogen atoms on the ring or atomic group are each independently replaced by a C1-C10 alkyl group, a C2-C6 alkenyl group, a C3-C12 cycloalkyl group, a C1-C10 halogenated alkyl group, a C3-C8 halogenated cycloalkyl group, a C3-C8 cycloalkoxyl group, a C3-C8 cycloalkylthiol group, a C3-C8 halogenated cycloalkoxyl group, a C3-C8 halogenated cycloalkylthiol group, a halogenated A nitro group, -CN, a carbonyl group (=O), a hydroxyl group, a mercapto group, an amino group, a C1-C4 carboxyl group, a C2-C8 ester group, a C2-C4 acylamino group, a C2-C6 acyl group, a C1-C10 alkoxyl group, a C1-C10 alkylthiol group, a C1-C10 halogenated alkoxyl group, a C1-C10 halogenated alkylthiol group, a C6-C12 aryl group, a C6-C12 aryl group-O-, a 5-10 membered heteroaryl group, a 5-10 membered heteroaryl group-O-, a 5-10 membered heterocycloalkyl group, and (R 20 R 21 )N-.

[0022] In another preferred embodiment, the optional "substitution" is one or more (preferably 1, 2, 3, 4, 5, 6, 7, or 8) hydrogen atoms on the ring or atomic group are each independently replaced by a C1-C8 alkyl group, a C2-C6 alkenyl group, a C3-C12 cycloalkyl group, a C1-C8 halogenated alkyl group, a C3-C8 halogenated cycloalkyl group, a C3-C8 cycloalkoxyl group, a C3-C8 cycloalkylthiol group, a C3-C8 halogenated cycloalkoxyl group, a C3-C8 halogenated cycloalkylthiol group, a halo a aryl atom, a nitro group, -CN, a carbonyl group (=O), a hydroxyl group, a mercapto group, an amino group, a C1-C4 carboxyl group, a C2-C8 ester group, a C2-C4 acylamino group, a C2-C4 acyl group, a C1-C8 alkoxyl group, a C1-C8 alkylthiol group, a C1-C8 halogenated alkoxyl group, a C1-C8 halogenated alkylthiol group, a C6-C12 aryl group, a C6-C12 aryl group-O-, a 5-10 membered heteroaryl group, a 5-10 membered heteroaryl group-O-, a 5-10 membered heterocycloalkyl group, and (R 20 R 21 )N-.

[0023] In another preferred embodiment, the optional "substitution" is one or more (preferably 1, 2, 3, 4, 5, 6, 7, or 8) hydrogen atoms on the ring or atomic group are each independently replaced by a C1-C6 alkyl group, a C2-C4 alkenyl group, a C3-C10 cycloalkyl group, a C1-C6 halogenated alkyl group, a C3-C8 halogenated cycloalkyl group, a C3-C8 cycloalkoxyl group, a C3-C8 cycloalkylthiol group, a C3-C8 halogenated cycloalkoxyl group, a C3-C8 halogenated cycloalkylthiol group, a halo a aryl atom, a nitro group, -CN, a carbonyl group (=O), a hydroxyl group, a mercapto group, an amino group, a C1-C4 carboxyl group, a C2-C6 ester group, a C2-C4 acylamino group, a C2-C4 acyl group, a C1-C6 alkoxyl group, a C1-C6 alkylthiol group, a C1-C6 halogenated alkoxyl group, a C1-C6 halogenated alkylthiol group, a C6-C12 aryl group, a C6-C12 aryl group-O-, a 5-10 membered heteroaryl group, a 5-10 membered heteroaryl group-O-, a 5-10 membered heterocycloalkyl group, and (R 20 R 21 )N-.

[0024] In another preferred example, the optional "substitution" is one or more (preferably 1, 2, 3, 4, 5, 6, 7, or 8) hydrogen atoms on the ring or atomic group are each independently replaced by a C1-C4 alkyl group, a C2-C4 alkenyl group, a C3-C10 cycloalkyl group, a C1-C4 halogenated alkyl group, a C3-C8 halogenated cycloalkyl group, a C3-C8 cycloalkoxyl group, a C3-C8 cycloalkylthiol group, a C3-C8 halogenated cycloalkoxyl group, a C3-C8 halogenated cycloalkylthiol group, a halo a aryl atom, a nitro group, -CN, a carbonyl group (=O), a hydroxyl group, a mercapto group, an amino group, a C1-C4 carboxyl group, a C2-C4 ester group, a C2-C4 acylamino group, a C2-C4 acyl group, a C1-C4 alkoxyl group, a C1-C4 alkylthiol group, a C1-C4 halogenated alkoxyl group, a C1-C4 halogenated alkylthiol group, a C6-C12 aryl group, a C6-C12 aryl group-O-, a 5-10 membered heteroaryl group, a 5-10 membered heteroaryl group-O-, a 5-10 membered heterocycloalkyl group, and (R 20 R 21 )N-.

[0025] In another preferred example, the optional "substitution" refers to one or more (preferably 1, 2, 3, 4, 5, 6, 7, or 8) hydrogen atoms on the ring or on the atomic group being each independently replaced by a substituent.

[0026] Another favorable example is R 1 and R 2 each independently represents a hydrogen atom, a deuterium atom, a halogen atom, a substituted or unsubstituted C1-C12 alkyl group, a substituted or unsubstituted C3-C12 cycloalkyl group, a substituted or unsubstituted 3-12 membered heterocycloalkyl group, a substituted or unsubstituted C1-C12 halogenated alkyl group, a substituted or unsubstituted C3-C12 halogenated cycloalkyl group, a substituted or unsubstituted C6-C12 aryl group, or a substituted or unsubstituted 5-10 membered heteroaryl group.

[0027] Another favorable example is R 1and R 2 each independently represents a hydrogen atom, a deuterium atom, a halogen atom, a substituted or unsubstituted C1-C10 alkyl group, a substituted or unsubstituted C3-C10 cycloalkyl group, a substituted or unsubstituted 3-10 membered heterocycloalkyl group, a substituted or unsubstituted C1-C10 halogenated alkyl group, a substituted or unsubstituted C3-C10 halogenated cycloalkyl group, a substituted or unsubstituted C6-C10 aryl group, or a substituted or unsubstituted 5-10 membered heteroaryl group.

[0028] Another favorable example is R 1 and R 2 each independently represents a hydrogen atom, a deuterium atom, a halogen atom, a substituted or unsubstituted C1-C10 alkyl group, a substituted or unsubstituted C3-C8 cycloalkyl group, a substituted or unsubstituted 3-10 membered heterocycloalkyl group, a substituted or unsubstituted C1-C6 halogenated alkyl group, a substituted or unsubstituted C3-C10 halogenated cycloalkyl group, a substituted or unsubstituted C6-C10 aryl group, or a substituted or unsubstituted 5-8 membered heteroaryl group.

[0029] Another favorable example is R 1 and R 2 each independently represents a hydrogen atom, a deuterium atom, a halogen atom, a substituted or unsubstituted C1-C10 alkyl group, a substituted or unsubstituted C3-C8 cycloalkyl group, a substituted or unsubstituted 3-10 membered heterocycloalkyl group, a substituted or unsubstituted C1-C4 halogenated alkyl group, a substituted or unsubstituted C3-C10 halogenated cycloalkyl group, a substituted or unsubstituted C6-C10 aryl group, or a substituted or unsubstituted 5-8 membered heteroaryl group.

[0030] Another favorable example is R 1 and R 2each independently represents a hydrogen atom, a deuterium atom, a halogen atom, a substituted or unsubstituted C1-C8 alkyl group, a substituted or unsubstituted C3-C8 cycloalkyl group, a substituted or unsubstituted 3-8 membered heterocycloalkyl group, a substituted or unsubstituted C1-C8 halogenated alkyl group, a substituted or unsubstituted C3-C8 halogenated cycloalkyl group, a substituted or unsubstituted C6-C8 aryl group, or a substituted or unsubstituted 5-8 membered heteroaryl group.

[0031] Another favorable example is R 1 and R 2 each independently represents a hydrogen atom, a deuterium atom, a halogen atom, a substituted or unsubstituted C1-C6 alkyl group, a substituted or unsubstituted C3-C8 cycloalkyl group, a substituted or unsubstituted 3-8 membered heterocycloalkyl group, a substituted or unsubstituted C1-C6 halogenated alkyl group, a substituted or unsubstituted C3-C8 halogenated cycloalkyl group, a substituted or unsubstituted C6-C8 aryl group, or a substituted or unsubstituted 5-8 membered heteroaryl group.

[0032] Another favorable example is R 1 and R 2 each independently represents a hydrogen atom, a deuterium atom, a halogen atom, a substituted or unsubstituted C1-C6 alkyl group, a substituted or unsubstituted C3-C8 cycloalkyl group, a substituted or unsubstituted 3-8 membered heterocycloalkyl group, a substituted or unsubstituted C1-C4 halogenated alkyl group, a substituted or unsubstituted C3-C8 halogenated cycloalkyl group, a substituted or unsubstituted C6-C8 aryl group, or a substituted or unsubstituted 5-8 membered heteroaryl group.

[0033] Another favorable example is R 1 and R 2 each independently represents a hydrogen atom, a deuterium atom, a halogen atom, a substituted or unsubstituted C1-C6 alkyl group, a substituted or unsubstituted C3-C8 cycloalkyl group, a substituted or unsubstituted 3-8 membered heterocycloalkyl group, a substituted or unsubstituted C1-C2 halogenated alkyl group, a substituted or unsubstituted C3-C8 halogenated cycloalkyl group, a substituted or unsubstituted C6-C8 aryl group, or a substituted or unsubstituted 5-8 membered heteroaryl group.

[0034] Another favorable example is R 1 and R 2 each independently represents a hydrogen atom, a deuterium atom, a halogen atom, a substituted or unsubstituted methyl group, a substituted or unsubstituted ethyl group, a substituted or unsubstituted propyl group, a substituted or unsubstituted butyl group, a substituted or unsubstituted amyl group, a substituted or unsubstituted hexyl group, a substituted or unsubstituted heptyl group, a substituted or unsubstituted octyl group, a substituted or unsubstituted cyclopropyl group, a substituted or unsubstituted cyclobutyl group, a substituted or unsubstituted cycloamyl group, a substituted or unsubstituted cyclohexyl group, a substituted or unsubstituted cycloheptyl group, In the formula, the halogen atom represents a substituted or unsubstituted ethyl group, a substituted or unsubstituted cyclooctyl group, a substituted or unsubstituted halide methyl group, a substituted or unsubstituted halide ethyl group, a substituted or unsubstituted halide propyl group, a substituted or unsubstituted halide butyl group, a substituted or unsubstituted halide amyl group, a substituted or unsubstituted halide hexyl group, a substituted or unsubstituted phenyl group, a substituted or unsubstituted acetyl group-methyl group-, a substituted or unsubstituted pyridinyl group, a substituted or unsubstituted pyrrolyl group, or a substituted or unsubstituted cyclohexanone group.

[0035] Another favorable example is R 1 and R 2 each independently represents a hydrogen atom, a deuterium atom, a halogen atom, a methyl group, an ethyl group, a propyl group, a butyl group, an amyl group, a hexyl group, a heptyl group, an octyl group, a cyclopropyl group, a cyclobutyl group, a cycloamyl group, a cyclohexyl group, a cycloheptyl group, a cyclooctyl group, a halogenated methyl group, a halogenated ethyl group, a halogenated propyl group, a halogenated butyl group, a halogenated amyl group, a halogenated hexyl group, a phenyl group, an acetyl group-methyl group-, a pyridinyl group, a pyrrolyl group, or a cyclohexanone group.

[0036] In another preferred embodiment, the pyridinyl group is

[0037] [ka]

[0038] In another preferred embodiment, the acetyl group-methyl group-

[0039] [ka]

[0040] In another preferred embodiment, the pyrrolyl group is

[0041] [ka]

[0042] In another preferred embodiment, the cyclohexanone group is

[0043] [ka]

[0044] Another favorable example is R 1 and R 2 represents a hydrogen atom or a deuterium atom.

[0045] Another favorable example is R 1 and R 2 At least one of the groups does not represent a hydrogen atom or a deuterium atom.

[0046] Another favorable example is R 1 represents a hydrogen atom or a deuterium atom, R 2 does not represent a hydrogen atom or a deuterium atom.

[0047] Another favorable example is R 1 does not represent a hydrogen atom or a deuterium atom, and R 2 represents a hydrogen atom or a deuterium atom.

[0048] Another favorable example is R 1 and R 2 does not represent a hydrogen atom or a deuterium atom.

[0049] Another favorable example is R1 does not represent a hydrogen atom or a deuterium atom.

[0050] Another favorable example is R 2 does not represent a hydrogen atom or a deuterium atom.

[0051] Another favorable example is R 1 and R 2 represent the same or different atomic groups.

[0052] In another preferred example, the halogen atom is a fluorine atom, a chlorine atom, a bromine atom, or an iodine atom.

[0053] In another preferred example, the halogenation refers to 1-position halogenation, 2-position halogenation, 3-position halogenation or full halogenation.

[0054] In another preferred embodiment, the halogenation refers to fluorination, chlorination, bromination or iodination.

[0055] In another preferred embodiment, the halogenated methyl group is trichloromethyl.

[0056] In another preferred example, the deuteration refers to 1-position deuteration, 2-position deuteration, 3-position deuteration or full deuteration.

[0057] Another favorable example is R 1 and R 2 each independently represents a hydrogen atom, a deuterium atom, trichloromethyl, a methyl group, a cyclobutyl group, a cycloamyl group, a butyl group, a hexyl group, or a phenyl group.

[0058] In another preferred embodiment, the propyl group is an n-propyl group.

[0059] In another preferred embodiment, the propyl group is

[0060] [ka]

[0061] In another preferred embodiment, the butyl group is an n-butyl group.

[0062] In another preferred embodiment, the butyl group is

[0063] [ka]

[0064] In another preferred embodiment, the amyl group is an n-amyl group.

[0065] In another preferred embodiment, the amyl group is

[0066] [ka]

[0067] In another preferred embodiment, the hexyl group is an n-hexyl group.

[0068] In another preferred embodiment, the hexyl group is

[0069] [ka]

[0070] In another preferred embodiment, the cyclobutyl group is

[0071] [ka]

[0072] In another preferred embodiment, the cyclohexyl group is

[0073] [ka]

[0074] Another favorable example is R 3 , R4 and R 5 are each independently a hydrogen atom, a halogen atom, or R 17 -O-, R 17 -S- or (R 18 R 19 )N-; or R 3 and R 4 , or R 4 and R 5 are joined to form a substituted or unsubstituted 3-10 membered heterocycloalkyl ring.

[0075] Another favorable example is R 3 , R 4 and R 5 are each independently a hydrogen atom, a halogen atom, or R 17 -O-, R 17 -S- or (R 18 R 19 )N-; or R 3 and R 4 , or R 4 and R 5 are joined to form a substituted or unsubstituted 3-8 membered heterocycloalkyl ring.

[0076] Another favorable example is R 3 , R 4 and R 5 are each independently a hydrogen atom, a halogen atom, or R 17 -O-, R 17 -S- or (R 18 R 19 )N-; or R 3 and R 4 , or R 4 and R 5 are joined to form a substituted or unsubstituted 3-membered heterocycloalkyl ring, a substituted or unsubstituted 4-membered heterocycloalkyl ring, a substituted or unsubstituted 5-membered heterocycloalkyl ring, a substituted or unsubstituted 6-membered heterocycloalkyl ring, a substituted or unsubstituted 7-membered heterocycloalkyl ring, a substituted or unsubstituted 8-membered heterocycloalkyl ring, a substituted or unsubstituted 9-membered heterocycloalkyl ring, or a substituted or unsubstituted 10-membered heterocycloalkyl ring.

[0077] Another favorable example is R 3 , R 4 and R 5 are each independently a hydrogen atom, a halogen atom (e.g., Cl, Br), R 17 -O-, R 17 -S- or (R 18 R 19 )N-; or R 3 and R 4 , or R 4 and R 5 are joined to form a substituted or unsubstituted 5-membered heterocycloalkyl ring.

[0078] Another favorable example is R 3 , R 4 and R 5 are each independently a hydrogen atom, a halogen atom (e.g., Cl, Br), R 17 -O-, R 17 -S- or (R 18 R 19 )N-; or R 3 and R 4 , or R 4 and R 5 are linked to form a substituted or unsubstituted dioxopentene ring.

[0079] Another favorable example is R 3 , R 4 and R 5 are each independently a hydrogen atom, a halogen atom (e.g., Cl, Br), R 17 -O-, R 17 -S- or (R 18 R 19 )N-; or R 3 and R 4 , or R 4 and R 5 is combined

[0080] [ka]

[0081] Another favorable example is W 1 represents O or S.

[0082] Another favorable example is W 2 represents O or S.

[0083] Another favorable example is R 3 represents a hydrogen atom.

[0084] Another favorable example is R 5 represents a hydrogen atom.

[0085] Another favorable example is R 3 and R 4 is combined

[0086] [ka]

[0087] Another favorable example is R 4 and R 5 is combined

[0088] [ka]

[0089] Another favorable example is R 6 , R 8 , R 11 , R 12 , R 13 , R 14 and R 15 each independently represents a hydrogen atom, a substituted or unsubstituted C1-C8 alkyl group, or a halogen atom (e.g., Br).

[0090] Another favorable example is R 6 , R 8 , R 11 , R 12 , R 13 , R 14 and R 15 each independently represents a hydrogen atom, a substituted or unsubstituted C1-C6 alkyl group, or a halogen atom (e.g., Br).

[0091] Another favorable example is R 6 , R 8 , R 11 , R 12 , R 13 , R 14 and R 15 each independently represents a hydrogen atom, a substituted or unsubstituted C1-C4 alkyl group, or a halogen atom (e.g., Br).

[0092] Another favorable example is R 6 , R 8 , R 11 , R 12 , R 13 , R 14 and R 15 each independently represents a hydrogen atom or a halogen atom (for example, Br).

[0093] Another favorable example is R 7 represents a hydrogen atom, a substituted or unsubstituted C1-C10 alkyl group, a substituted or unsubstituted C1-C10 halogenated alkyl group, a substituted or unsubstituted C6-C16 aryl group-substituted or unsubstituted C1-C12 alkyl group-, or a substituted or unsubstituted 5-16 membered heteroaryl group-substituted or unsubstituted C1-C12 alkyl group-.

[0094] Another favorable example is R 7 represents a hydrogen atom, a substituted or unsubstituted C1-C8 alkyl group, a substituted or unsubstituted C1-C8 halogenated alkyl group, a substituted or unsubstituted C6-C16 aryl group-substituted or unsubstituted C1-C12 alkyl group-, or a substituted or unsubstituted 5-16 membered heteroaryl group-substituted or unsubstituted C1-C12 alkyl group-.

[0095] Another favorable example is R 7 represents a hydrogen atom, a substituted or unsubstituted C1-C10 alkyl group, a substituted or unsubstituted C1-C10 halogenated alkyl group, a substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C10 alkyl group-, or a substituted or unsubstituted 5-12 membered heteroaryl group-substituted or unsubstituted C1-C10 alkyl group-.

[0096] Another favorable example is R 7 represents a hydrogen atom, a substituted or unsubstituted C1-C10 alkyl group, a substituted or unsubstituted C1-C10 halogenated alkyl group, a substituted or unsubstituted C6-C10 aryl group-substituted or unsubstituted C1-C8 alkyl group-, or a substituted or unsubstituted 5-10 membered heteroaryl group-substituted or unsubstituted C1-C10 alkyl group-.

[0097] Another favorable example is R 7 represents a hydrogen atom, a substituted or unsubstituted C1-C8 alkyl group, a substituted or unsubstituted C1-C8 halogenated alkyl group, a substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C10 alkyl group-, or a substituted or unsubstituted 5-12 membered heteroaryl group-substituted or unsubstituted C1-C12 alkyl group-.

[0098] Another favorable example is R 7 represents a hydrogen atom, a substituted or unsubstituted C1-C8 alkyl group, a substituted or unsubstituted C1-C8 halogenated alkyl group, a substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C10 alkyl group-, or a substituted or unsubstituted 5-12 membered heteroaryl group-substituted or unsubstituted C1-C10 alkyl group-.

[0099] Another favorable example is R 7 represents a hydrogen atom, a substituted or unsubstituted C1-C8 alkyl group, a substituted or unsubstituted C1-C8 halogenated alkyl group, a substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C8 alkyl group-, or a substituted or unsubstituted 5-12 membered heteroaryl group-substituted or unsubstituted C1-C8 alkyl group-.

[0100] Another favorable example is R 7 represents a hydrogen atom, a substituted or unsubstituted C1-C6 alkyl group, a substituted or unsubstituted C1-C8 halogenated alkyl group, a substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C6 alkyl group-, or a substituted or unsubstituted 5-10 membered heteroaryl group-substituted or unsubstituted C1-C6 alkyl group-.

[0101] Another favorable example is R 7 represents a hydrogen atom, a substituted or unsubstituted C1-C6 alkyl group, a substituted or unsubstituted C1-C8 halogenated alkyl group, a substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C5 alkyl group-, or a substituted or unsubstituted 5-8 membered heteroaryl group-substituted or unsubstituted C1-C5 alkyl group-.

[0102] Another favorable example is R 7 is a hydrogen atom, a substituted or unsubstituted C1-C8 alkyl group, a substituted or unsubstituted C1-C8 halogenated alkyl group, a substituted or unsubstituted 5-8 membered heteroaryl group-substituted or unsubstituted C1-C4 alkyl group-

[0103] [ka]

[0104] R 22 , R 23 , R 24 , R 25 , R 26 , R 27 , R 28 , R 29 and R 30 each independently represents a hydrogen atom, a C1-C8 alkyl group, a C3-C12 cycloalkyl group, a C1-C8 halogenated alkyl group, a C3-C8 halogenated cycloalkyl group, a C3-C8 cycloalkoxyl group, a C3-C8 cycloalkylthiol group, a C3-C8 halogenated cycloalkoxyl group, a C3-C8 halogenated cycloalkylthiol group, a halogen atom, a nitro group, -CN, a hydroxyl group, a mercapto group, an amino group, a C1-C4 carboxyl group, a C2-C6 ester group, a C2-C4 acylamino group, a C1-C8 alkoxyl group, a C1-C8 alkylthiol group, a C1-C8 halogenated alkoxyl group, a C1-C8 halogenated alkylthiol group, a C6-C12 aryl group, a C6-C12 aryl group-O-, a 5-10 membered heteroaryl group, a 5-10 membered heteroaryl group-O-, or a 5-10 membered heterocycloalkyl group.

[0105] Another favorable example is R 7 represents a hydrogen atom, a substituted or unsubstituted C1-C6 alkyl group, a substituted or unsubstituted C1-C8 halogenated alkyl group, a pyridinyl group, a methyl group,

[0106] [ka]

[0107] Another favorable example is R 7 represents a hydrogen atom, a substituted or unsubstituted methyl group, a substituted or unsubstituted ethyl group, a substituted or unsubstituted propyl group, a substituted or unsubstituted butyl group, a substituted or unsubstituted amyl group, a substituted or unsubstituted hexyl group, a substituted or unsubstituted heptyl group, a substituted or unsubstituted octyl group, a halogenated hexyl group, a pyridinyl group-methyl group-,

[0108] [ka]

[0109] Another favorable example is R 7 is a hydrogen atom, a methyl group, an ethyl group, a propyl group, a butyl group, an amyl group, a hexyl group, a heptyl group, an octyl group, a halogenated hexyl group, a pyridinyl group, a methyl group,

[0110] [ka]

[0111] In another preferred embodiment, the amyl group is an n-amyl group.

[0112] In another preferred embodiment, the amyl group is

[0113] [ka]

[0114] In another preferred embodiment, the octyl group is

[0115] [ka]

[0116] In another preferred embodiment, the halogenated hexyl group is a 1-position halogenated hexyl group.

[0117] In another preferred embodiment, the halogenated hexyl group is

[0118] [ka]

[0119] Another favorable example is R 9 and R 10 are joined to form a substituted or unsubstituted 3-10 membered heterocycloalkyl ring.

[0120] Another favorable example is R 9 and R 10 are joined to form a substituted or unsubstituted 3-8 membered heterocycloalkyl ring.

[0121] Another favorable example is R 9 and R 10 are joined to form a substituted or unsubstituted 5-8 membered heterocycloalkyl ring.

[0122] Another favorable example is R 9 and R 10 are joined to form a substituted or unsubstituted 5-7 membered heterocycloalkyl ring.

[0123] Another favorable example is R 9 and R 10are joined to form a substituted or unsubstituted 3-membered heterocycloalkyl ring, a substituted or unsubstituted 4-membered heterocycloalkyl ring, a substituted or unsubstituted 5-membered heterocycloalkyl ring, a substituted or unsubstituted 6-membered heterocycloalkyl ring, a substituted or unsubstituted 7-membered heterocycloalkyl ring, a substituted or unsubstituted 8-membered heterocycloalkyl ring, a substituted or unsubstituted 9-membered heterocycloalkyl ring, a substituted or unsubstituted 10-membered heterocycloalkyl ring, a substituted or unsubstituted 11-membered heterocycloalkyl ring, or a substituted or unsubstituted 12-membered heterocycloalkyl ring.

[0124] Another favorable example is R 9 and R 10 is bonded to a substituted or unsubstituted

[0125] [ka]

[0126] R 31 , R 32 , R 33 , R 34 and R 35 each independently represents a hydrogen atom, a C1-C8 alkyl group, a C3-C12 cycloalkyl group, a C1-C8 halogenated alkyl group, a C3-C8 halogenated cycloalkyl group, a C3-C8 cycloalkoxyl group, a C3-C8 cycloalkylthiol group, a C3-C8 halogenated cycloalkoxyl group, a C3-C8 halogenated cycloalkylthiol group, a halogen atom, a nitro group, -CN, a hydroxyl group, a mercapto group, an amino group, a C1-C4 carboxyl group, a C2-C4 ester group, a C2-C4 acylamino group, a C1-C8 alkoxyl group, a C1-C8 alkylthiol group, a C1-C8 halogenated alkoxyl group, a C1-C8 halogenated alkylthiol group, a C6-C12 aryl group, a C6-C12 aryl group-O-, a 5-10 membered heteroaryl group, a 5-10 membered heteroaryl group-O-, or a 5-10 membered heterocycloalkyl group.

[0127] Another favorable example is R 9 and R 10 is combined

[0128] [ka]

[0129] Another favorable example is W 3 represents O or S.

[0130] Another favorable example is W 4 represents O or S.

[0131] Another favorable example is W 5 represents O or S.

[0132] Another favorable example is W 6 represents O or S.

[0133] In another preferred example, the chemical structure of propyl group-phenyl group-methyl group is as follows:

[0134] [ka]

[0135] Another favorable example is R 17 represents a hydrogen atom, a substituted or unsubstituted C1-C12 alkyl group,

[0136] [ka]

[0137] Substituted or unsubstituted C3-C14 cycloalkyl group, substituted or unsubstituted 3-10 membered heterocycloalkyl group, substituted or unsubstituted C3-C14 cycloalkyl group-substituted or unsubstituted C2-C8 acyl group-, substituted or unsubstituted C3-C14 cycloalkyl group-C(O)-, substituted or unsubstituted C1-C12 halogenated alkyl group, substituted or unsubstituted C3-C12 halogenated cycloalkyl group, substituted or unsubstituted 3-10 membered heterocycloalkyl group-substituted or unsubstituted C1-C10 alkyl group-, substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C10 alkyl group-, substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C10 alkyl group-, substituted or unsubstituted 5-1 2-membered heteroaryl group-substituted or unsubstituted C1-C10 alkyl group-, substituted or unsubstituted C6-C12 aryl group-O-substituted or unsubstituted C1-C10 alkyl group-, substituted or unsubstituted C6-C12 aryl group-S-substituted or unsubstituted C1-C10 alkyl group-, substituted or unsubstituted 5-12-membered heteroaryl group-O-substituted or unsubstituted C1-C10 alkyl group-, substituted or unsubstituted 5-12-membered heteroaryl group-S-substituted or unsubstituted C1-C10 alkyl group-, substituted or unsubstituted C2-C6 alkenyl group-substituted or unsubstituted C1-C6 alkyl group-substituted or unsubstituted C2-C6 alkenyl group-substituted or unsubstituted C1-C6 alkyl group-, substituted or unsubstituted C2-C6 alkenyl group-substituted or unsubstituted C1-C6 alkyl group-, or (R 20 R 21 ) N-Represents a substituted or unsubstituted C1-C10 alkyl group.

[0138] Another favorable example is R 17 represents a hydrogen atom or a substituted or unsubstituted C1-C10 alkyl group;

[0139] [ka]

[0140] Substituted or unsubstituted C3-C12 cycloalkyl group, substituted or unsubstituted 3-10 membered heterocycloalkyl group, substituted or unsubstituted C3-C12 cycloalkyl group-substituted or unsubstituted C2-C6 acyl group-, substituted or unsubstituted C3-C12 cycloalkyl group-C(O)-, substituted or unsubstituted C1-C10 halogenated alkyl group, substituted or unsubstituted C3-C10 halogenated cycloalkyl group, substituted or unsubstituted 3-10 membered heterocycloalkyl group-substituted or unsubstituted C1-C8 alkyl group-, substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C8 alkyl group-, substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C8 alkyl group-, substituted or unsubstituted 5- 12-membered heteroaryl group-substituted or unsubstituted C1-C8 alkyl group-, substituted or unsubstituted C6-C12 aryl group-O-substituted or unsubstituted C1-C8 alkyl group-, substituted or unsubstituted C6-C12 aryl group-S-substituted or unsubstituted C1-C8 alkyl group-, substituted or unsubstituted 5-12-membered heteroaryl group-O-substituted or unsubstituted C1-C8 alkyl group-, substituted or unsubstituted 5-12-membered heteroaryl group-S-substituted or unsubstituted C1-C8 alkyl group-, substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C4 alkyl group-substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C4 alkyl group-, substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C4 alkyl group-, or (R 20 R 21 ) N-Represents a substituted or unsubstituted C1-C10 alkyl group.

[0141] Another favorable example is R 17 represents a hydrogen atom or a substituted or unsubstituted C1-C8 alkyl group;

[0142] [ka]

[0143] Substituted or unsubstituted C3-C10 cycloalkyl group, substituted or unsubstituted 3-10 membered heterocycloalkyl group, substituted or unsubstituted C3-C12 cycloalkyl group-substituted or unsubstituted C2-C4 acyl group-, substituted or unsubstituted C3-C12 cycloalkyl group-C(O)-, substituted or unsubstituted C1-C8 halogenated alkyl group, substituted or unsubstituted C3-C8 halogenated cycloalkyl group, substituted or unsubstituted 3-10 membered heterocycloalkyl group-substituted or unsubstituted C1-C6 alkyl group-, substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C6 alkyl group-, substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C6 alkyl group-, substituted or unsubstituted 5-1 2-membered heteroaryl group-substituted or unsubstituted C1-C6 alkyl group-, substituted or unsubstituted C6-C12 aryl group-O-substituted or unsubstituted C1-C6 alkyl group-, substituted or unsubstituted C6-C12 aryl group-S-substituted or unsubstituted C1-C6 alkyl group-, substituted or unsubstituted 5-12-membered heteroaryl group-O-substituted or unsubstituted C1-C6 alkyl group-, substituted or unsubstituted 5-12-membered heteroaryl group-S-substituted or unsubstituted C1-C6 alkyl group-, substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C4 alkyl group-substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C4 alkyl group-, substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C4 alkyl group-, or (R 20 R 21 ) N-Represents a substituted or unsubstituted C1-C8 alkyl group -.

[0144] Another favorable example is R 17 represents a hydrogen atom or a substituted or unsubstituted C1-C8 alkyl group;

[0145] [ka]

[0146] Substituted or unsubstituted C3-C10 cycloalkyl group, substituted or unsubstituted 3-10 membered heterocycloalkyl group, substituted or unsubstituted C3-C12 cycloalkyl group-substituted or unsubstituted C2-C4 acyl group-, substituted or unsubstituted C3-C12 cycloalkyl group-C(O)-, substituted or unsubstituted C1-C8 halogenated alkyl group, substituted or unsubstituted C3-C8 halogenated cycloalkyl group, substituted or unsubstituted 3-10 membered heterocycloalkyl group-substituted or unsubstituted C1-C6 alkyl group-, substituted or unsubstituted C6-C10 aryl group-substituted or unsubstituted C1-C4 alkyl group-, substituted or unsubstituted C6-C10 aryl group-substituted or unsubstituted C6-C10 aryl group-substituted or unsubstituted C1-C4 alkyl group-, substituted or unsubstituted 5-1 0-membered heteroaryl group-substituted or unsubstituted C1-C4 alkyl group-, substituted or unsubstituted C6-C10 aryl group-O-substituted or unsubstituted C1-C4 alkyl group-, substituted or unsubstituted C6-C10 aryl group-S-substituted or unsubstituted C1-C4 alkyl group-, substituted or unsubstituted 5-10-membered heteroaryl group-O-substituted or unsubstituted C1-C4 alkyl group-, substituted or unsubstituted 5-12-membered heteroaryl group-S-substituted or unsubstituted C1-C4 alkyl group-, substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C4 alkyl group-substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C4 alkyl group-, substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C4 alkyl group-, or (R 20 R 21 ) N-Represents a substituted or unsubstituted C1-C8 alkyl group -.

[0147] Another favorable example is R 17 represents a hydrogen atom or a substituted or unsubstituted C1-C6 alkyl group;

[0148] [ka]

[0149] Substituted or unsubstituted C3-C10 cycloalkyl group, substituted or unsubstituted 3-10 membered heterocycloalkyl group, substituted or unsubstituted C5-C12 cycloalkyl group-substituted or unsubstituted C2-C4 acyl group-, substituted or unsubstituted C5-C12 cycloalkyl group-C(O)-, substituted or unsubstituted C1-C8 halogenated alkyl group, substituted or unsubstituted C3-C8 halogenated cycloalkyl group, substituted or unsubstituted 3-10 membered heterocycloalkyl group-substituted or unsubstituted C1-C6 alkyl group-, substituted or unsubstituted C6-C10 aryl group-substituted or unsubstituted C1-C4 alkyl group-, substituted or unsubstituted C6-C10 aryl group-substituted or unsubstituted C6-C10 aryl group-substituted or unsubstituted C1-C4 alkyl group-, substituted or unsubstituted 5-1 0-membered heteroaryl group-substituted or unsubstituted C1-C4 alkyl group-, substituted or unsubstituted C6-C10 aryl group-O-substituted or unsubstituted C1-C4 alkyl group-, substituted or unsubstituted C6-C10 aryl group-S-substituted or unsubstituted C1-C4 alkyl group-, substituted or unsubstituted 5-10-membered heteroaryl group-O-substituted or unsubstituted C1-C4 alkyl group-, substituted or unsubstituted 5-10-membered heteroaryl group-S-substituted or unsubstituted C1-C4 alkyl group-, substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C4 alkyl group-substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C4 alkyl group-, substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C4 alkyl group-, or (R 20 R 21 ) N-Represents a substituted or unsubstituted C1-C8 alkyl group -.

[0150] Another favorable example is R 17 represents a hydrogen atom or a substituted or unsubstituted C1-C6 alkyl group;

[0151] [ka]

[0152] Substituted or unsubstituted C3-C10 cycloalkyl group, substituted or unsubstituted 3-10 membered heterocycloalkyl group, substituted or unsubstituted C6-C12 cycloalkyl group-substituted or unsubstituted C2 acyl group-, substituted or unsubstituted C6-C12 cycloalkyl group-C(O)-, substituted or unsubstituted C1-C6 halogenated alkyl group, substituted or unsubstituted C3-C8 halogenated cycloalkyl group, substituted or unsubstituted 3-10 membered heterocycloalkyl group-substituted or unsubstituted C1-C4 alkyl group-, substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C4 alkyl group-, substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C2 alkyl group-, substituted or unsubstituted 5-8 substituted or unsubstituted C1-C2 alkyl group-, substituted or unsubstituted C6-C8 aryl group-O-substituted or unsubstituted C1-C2 alkyl group-, substituted or unsubstituted C6-C8 aryl group-S-substituted or unsubstituted C1-C2 alkyl group-, substituted or unsubstituted 5-8 membered heteroaryl group-O-substituted or unsubstituted C1-C2 alkyl group-, substituted or unsubstituted 5-8 membered heteroaryl group-S-substituted or unsubstituted C1-C2 alkyl group-, substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C4 alkyl group-substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C2 alkyl group-, substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C2 alkyl group-, or (R 20 R 21 ) N-Represents a substituted or unsubstituted C1-C8 alkyl group -.

[0153] Another favorable example is R 17 represents a hydrogen atom or a substituted or unsubstituted C1-C6 alkyl group;

[0154] [ka]

[0155] Substituted or unsubstituted C6-C12 cycloalkyl group-substituted or unsubstituted C2-C4 acyl group-, substituted or unsubstituted C6-C12 cycloalkyl group-C(O)-, substituted or unsubstituted 3-10 membered heterocycloalkyl group, substituted or unsubstituted C1-C6 halogenated alkyl group, substituted or unsubstituted 5-7 membered heterocycloalkyl group-substituted or unsubstituted C1-C4 alkyl group-, substituted or unsubstituted C6-C10 aryl group-substituted or unsubstituted C1-C4 alkyl group-, substituted or unsubstituted C6-C10 aryl group-substituted or unsubstituted C6-C10 aryl group-substituted or unsubstituted C1-C4 alkyl group-, substituted or unsubstituted 5-10 membered heteroaryl group-substituted or unsubstituted C1-C4 acyl group- alkyl group-, a substituted or unsubstituted C6-C10 aryl group-O-substituted or unsubstituted C1-C4 alkyl group-, a substituted or unsubstituted C6-C10 aryl group-S-substituted or unsubstituted C1-C4 alkyl group-, a substituted or unsubstituted 5-10 membered heteroaryl group-O-substituted or unsubstituted C1-C4 alkyl group-, a substituted or unsubstituted 5-10 membered heteroaryl group-S-substituted or unsubstituted C1-C4 alkyl group-, a substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C2 alkyl group-substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C2 alkyl group-, a substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C2 alkyl group-, or (R 20 R 21 ) N-Represents a substituted or unsubstituted C1-C8 alkyl group -.

[0156] Another favorable example is R 17 represents a hydrogen atom or a substituted or unsubstituted C1-C6 alkyl group;

[0157] [ka]

[0158] Substituted or unsubstituted C8-C10 cycloalkyl group-substituted or unsubstituted C2 acyl group-, substituted or unsubstituted C8-C10 cycloalkyl group-C(O)-, substituted or unsubstituted 5-7 membered heterocycloalkyl group, substituted or unsubstituted C1-C6 halogenated alkyl group, substituted or unsubstituted 5-7 membered heterocycloalkyl group-substituted or unsubstituted C1-C2 alkyl group-, substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C4 alkyl group-, substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C2 alkyl group-, substituted or unsubstituted 5-8 membered heteroaryl group-substituted or unsubstituted C1-C4 alkyl group aryl group-, substituted or unsubstituted C6-C8 aryl group-O-substituted or unsubstituted C1-C2 alkyl group-, substituted or unsubstituted C6-C8 aryl group-S-substituted or unsubstituted C1-C2 alkyl group-, substituted or unsubstituted 5-8 membered heteroaryl group-O-substituted or unsubstituted C1-C2 alkyl group-, substituted or unsubstituted 5-8 membered heteroaryl group-S-substituted or unsubstituted C1-C2 alkyl group-, substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C2 alkyl group-substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C2 alkyl group-, substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C2 alkyl group-, or (R 20 R 21 ) N-Represents a substituted or unsubstituted C1-C8 alkyl group -.

[0159] Another favorable example is R 17 represents a hydrogen atom or a substituted or unsubstituted C1-C4 alkyl group;

[0160] [ka]

[0161] Substituted or unsubstituted C3-C10 cycloalkyl group, substituted or unsubstituted 3-10 membered heterocycloalkyl group, substituted or unsubstituted C6-C12 cycloalkyl group-substituted or unsubstituted C2 acyl group-, substituted or unsubstituted C6-C12 cycloalkyl group-C(O)-, substituted or unsubstituted C1-C6 halogenated alkyl group, substituted or unsubstituted C3-C8 halogenated cycloalkyl group, substituted or unsubstituted 3-10 membered heterocycloalkyl group-substituted or unsubstituted C1-C4 alkyl group-, substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C2 alkyl group-, substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C2 alkyl group-, substituted or unsubstituted 5-8 substituted or unsubstituted C1-C2 alkyl group-, substituted or unsubstituted C6-C8 aryl group-O-substituted or unsubstituted C1-C2 alkyl group-, substituted or unsubstituted C6-C8 aryl group-S-substituted or unsubstituted C1-C2 alkyl group-, substituted or unsubstituted 5-8 membered heteroaryl group-O-substituted or unsubstituted C1-C2 alkyl group-, substituted or unsubstituted 5-8 membered heteroaryl group-S-substituted or unsubstituted C1-C2 alkyl group-, substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C4 alkyl group-substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C2 alkyl group-, substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C2 alkyl group-, or (R 20 R 21 ) N-Represents a substituted or unsubstituted C1-C8 alkyl group -.

[0162] Another favorable example is R 17 represents a hydrogen atom or a substituted or unsubstituted C1-C4 alkyl group;

[0163] [ka]

[0164] Substituted or unsubstituted C6-C12 cycloalkyl group-substituted or unsubstituted C2-C4 acyl group-, substituted or unsubstituted C6-C12 cycloalkyl group-C(O)-, substituted or unsubstituted 3-10 membered heterocycloalkyl group, substituted or unsubstituted C1-C6 halogenated alkyl group, substituted or unsubstituted 5-7 membered heterocycloalkyl group-substituted or unsubstituted C1-C4 alkyl group-, substituted or unsubstituted C6-C10 aryl group-substituted or unsubstituted C1-C4 alkyl group-, substituted or unsubstituted C6-C10 aryl group-substituted or unsubstituted C6-C10 aryl group-substituted or unsubstituted C1-C4 alkyl group-, substituted or unsubstituted 5-10 membered heteroaryl group-substituted or unsubstituted C1-C4 acyl group- alkyl group-, a substituted or unsubstituted C6-C10 aryl group-O-substituted or unsubstituted C1-C4 alkyl group-, a substituted or unsubstituted C6-C10 aryl group-S-substituted or unsubstituted C1-C4 alkyl group-, a substituted or unsubstituted 5-10 membered heteroaryl group-O-substituted or unsubstituted C1-C4 alkyl group-, a substituted or unsubstituted 5-10 membered heteroaryl group-S-substituted or unsubstituted C1-C4 alkyl group-, a substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C2 alkyl group-substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C2 alkyl group-, a substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C2 alkyl group-, or (R 20 R 21 ) N-Represents a substituted or unsubstituted C1-C8 alkyl group -.

[0165] Another favorable example is R 17 represents a hydrogen atom or a substituted or unsubstituted C1-C2 alkyl group;

[0166] [ka]

[0167] Substituted or unsubstituted C8-C10 cycloalkyl group-substituted or unsubstituted C2 acyl group-, substituted or unsubstituted C8-C10 cycloalkyl group-C(O)-, substituted or unsubstituted 5-7 membered heterocycloalkyl group, substituted or unsubstituted C3-C6 halogenated alkyl group, substituted or unsubstituted 5-7 membered heterocycloalkyl group-substituted or unsubstituted C1-C2 alkyl group-, substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C2 alkyl group-, substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C2 alkyl group-, substituted or unsubstituted 5-8 membered heteroaryl group-substituted or unsubstituted C1-C4 alkyl group aryl group-, substituted or unsubstituted C6-C8 aryl group-O-substituted or unsubstituted C1-C2 alkyl group-, substituted or unsubstituted C6-C8 aryl group-S-substituted or unsubstituted C1-C2 alkyl group-, substituted or unsubstituted 5-8 membered heteroaryl group-O-substituted or unsubstituted C1-C2 alkyl group-, substituted or unsubstituted 5-8 membered heteroaryl group-S-substituted or unsubstituted C1-C2 alkyl group-, substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C2 alkyl group-substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C2 alkyl group-, substituted or unsubstituted C2-C4 alkenyl group-substituted or unsubstituted C1-C2 alkyl group-, or (R 20 R 21 ) N-Represents a substituted or unsubstituted C1-C8 alkyl group -.

[0168] Another favorable example is R 17 represents a hydrogen atom, a substituted or unsubstituted methyl group,

[0169] [ka]

[0170] substituted or unsubstituted ethyl group, substituted or unsubstituted propyl group, substituted or unsubstituted amyl group, substituted or unsubstituted hexyl group, substituted or unsubstituted phenyl group-O-substituted or unsubstituted butyl group-, halogenated ethyl group, halogenated propyl group, halogenated butyl group, halogenated hexyl group, substituted or unsubstituted phenyl group-substituted or unsubstituted ethyl group-, substituted or unsubstituted phenyl group-substituted or unsubstituted propyl group-, substituted or unsubstituted phenyl group-substituted or unsubstituted butyl group-, substituted or unsubstituted cyclodecyl group-substituted or unsubstituted acetyl group-, substituted or unsubstituted butenyl group-substituted or unsubstituted ethyl group-substituted or unsubstituted propenyl group-substituted or unsubstituted methyl group-, (R 20 R 21 ) N-substituted or unsubstituted hexyl group-, (R 20 R 21 ) N-substituted or unsubstituted butyl group -, (R 20 R 21 )N-substituted or unsubstituted ethyl group-, substituted or unsubstituted piperidinyl group-substituted or unsubstituted ethyl group-, substituted or unsubstituted butyl group-substituted or unsubstituted piperazine ring-, substituted or unsubstituted methyl group-substituted or unsubstituted piperidinyl group, substituted or unsubstituted phenyl group-substituted or unsubstituted phenyl group-substituted or unsubstituted methyl group-, substituted or unsubstituted vinyl group-substituted or unsubstituted methyl group-, substituted or unsubstituted piperidinyl group-substituted or unsubstituted propyl group-, substituted or unsubstituted piperidinyl group-substituted or unsubstituted ethyl group-, or dimethylamino group-ethyl group-.

[0171] Another favorable example is R 17 is a hydrogen atom, a methyl group,

[0172] [ka]

[0173] Ethyl, propyl, amyl, hexyl, phenyl-O-butyl, halogenated ethyl, halogenated propyl, halogenated butyl, halogenated hexyl, phenyl-ethyl, phenyl-propyl, phenyl-butyl, cyclodecyl-acetyl, butenyl-ethyl-propenyl-methyl, (R 20 R 21 ) N-hexyl group -, (R 20 R 21 ) N-butyl group -, (R 20 R 21 ) N-ethyl, piperidinyl-ethyl, butyl-piperazinyl, methyl-piperidinyl, phenyl-phenyl-methyl, vinyl-methyl, piperidinyl-propyl, piperidinyl-ethyl, or dimethylamino-ethyl.

[0174] In another preferred embodiment, the butyl group is an n-butyl group.

[0175] In another preferred embodiment, the butyl group is

[0176] [ka]

[0177] In another preferred embodiment, the hexyl group is

[0178] [ka]

[0179] In another preferred embodiment, the amyl group is an n-amyl group.

[0180] In another preferred embodiment, the amyl group is

[0181] [ka]

[0182] In another preferred embodiment, the cycloamyl group is

[0183] [ka]

[0184] In another preferred embodiment, the chemical structure of the phenyl group-propyl group- is as follows:

[0185] [ka]

[0186] In another preferred embodiment, the chemical structure of the phenyl group-butyl group is as follows:

[0187] [ka]

[0188] In another preferred embodiment, the chemical structure of the phenyl group-O-butyl group- is as follows:

[0189] [ka]

[0190] In another preferred example, the halogenated ethyl group is a 1-position fluorinated ethyl group, a 1-position chlorinated ethyl group, or a 1-position brominated ethyl group.

[0191] In another preferred embodiment, the halogenated ethyl group has the following chemical structure:

[0192] [ka]

[0193] In another preferred embodiment, the propyl group is an n-propyl group.

[0194] In another preferred embodiment, the propyl group is

[0195] [ka]

[0196] In another preferred embodiment, the halogenated propyl group is a halogenated n-propyl group.

[0197] In another preferred example, the halogenated propyl group is a 1-position fluorinated propyl group, a 1-position chlorinated propyl group, or a 1-position brominated propyl group.

[0198] In another preferred embodiment, the halogenated propyl group has the following chemical structure:

[0199] [ka]

[0200] In another preferred embodiment, the butyl group is an n-butyl group.

[0201] In another preferred embodiment, the halogenated butyl group is a halogenated n-butyl group.

[0202] In another preferred example, the halogenated butyl group is a 1-position fluorinated butyl group, a 1-position chlorinated butyl group, or a 1-position brominated butyl group.

[0203] In another preferred embodiment, the halogenated butyl group has the following chemical structure:

[0204] [ka]

[0205] In another preferred embodiment, the hexyl group is an n-hexyl group.

[0206] In another preferred embodiment, the halogenated hexyl group is a halogenated n-hexyl group.

[0207] In another preferred example, the halogenated hexyl group is a 1-position chlorinated hexyl group or a 1-position brominated hexyl group.

[0208] In another preferred embodiment, the halogenated hexyl group has the following chemical structure:

[0209] [ka]

[0210] In another preferred embodiment, the chemical structure of the cyclodecyl group-acetyl group- is as follows:

[0211] [ka]

[0212] In another preferred embodiment, the chemical structure of the butenyl group-ethyl group-propenyl group-methyl group is as follows:

[0213] [ka]

[0214] In another preferred embodiment, the chemical structure of the piperidinyl group-ethyl group- is as follows:

[0215] [ka]

[0216] In another preferred embodiment, the chemical structure of the phenyl group-phenyl group-methyl group is as follows:

[0217] [ka]

[0218] In another preferred embodiment, the chemical structure of the vinyl group-methyl group is

[0219] [ka]

[0220] In another preferred embodiment, the chemical structure of the piperidinyl group-propyl group- is as follows:

[0221] [ka]

[0222] In another preferred embodiment, the chemical structure of the piperidinyl group-ethyl group- is as follows:

[0223] [ka]

[0224] In another preferred embodiment, the chemical structure of the dimethylamino group-ethyl group- is as follows:

[0225] [ka]

[0226] Another favorable example is R 18 and R 19 each independently represents a hydrogen atom, a substituted or unsubstituted C1-C8 alkyl group, a substituted or unsubstituted C3-C10 cycloalkyl group, or a substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C10 alkyl group-; or R 18 and R 19 are joined to form a substituted or unsubstituted 3- to 12-membered heterocycloalkyl ring.

[0227] Another favorable example is R 18 and R19 each independently represents a hydrogen atom, a substituted or unsubstituted C1-C8 alkyl group, a substituted or unsubstituted C3-C10 cycloalkyl group, or a substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C8 alkyl group-; or R 18 and R 19 are joined to form a substituted or unsubstituted 3- to 12-membered heterocycloalkyl ring.

[0228] Another favorable example is R 18 and R 19 each independently represents a hydrogen atom, a substituted or unsubstituted C1-C6 alkyl group, a substituted or unsubstituted C3-C10 cycloalkyl group, or a substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C6 alkyl group-; or R 18 and R 19 are joined to form a substituted or unsubstituted 3-10 membered heterocycloalkyl ring.

[0229] Another favorable example is R 18 and R 19 each independently represents a hydrogen atom, a substituted or unsubstituted C1-C4 alkyl group, a substituted or unsubstituted C3-C10 cycloalkyl group, or a substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C4 alkyl group-; or R 18 and R 19 are joined to form a substituted or unsubstituted 3-8 membered heterocycloalkyl ring.

[0230] Another favorable example is R 18 and R 19 each independently represents a hydrogen atom, a substituted or unsubstituted C1-C4 alkyl group, a substituted or unsubstituted C3-C10 cycloalkyl group, or a substituted or unsubstituted C6-C10 aryl group-substituted or unsubstituted C1-C4 alkyl group-; or R 18 and R 19 are joined to form a substituted or unsubstituted 3-8 membered heterocycloalkyl ring.

[0231] Another favorable example is R 18 and R19 each independently represents a hydrogen atom, a substituted or unsubstituted C1-C4 alkyl group, a substituted or unsubstituted C3-C10 cycloalkyl group, or a substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C4 alkyl group-; or R 18 and R 19 are joined to form a substituted or unsubstituted 5-8 membered heterocycloalkyl ring.

[0232] Another favorable example is R 18 and R 19 each independently represents a hydrogen atom, a substituted or unsubstituted C1-C4 alkyl group, a substituted or unsubstituted C3-C10 cycloalkyl group, or a substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C4 alkyl group-; or R 18 and R 19 are joined to form a substituted or unsubstituted 5-membered heterocycloalkyl ring, a substituted or unsubstituted 6-membered heterocycloalkyl ring, a substituted or unsubstituted 7-membered heterocycloalkyl ring, or a substituted or unsubstituted 8-membered heterocycloalkyl ring.

[0233] Another favorable example is R 18 and R 19 each independently represents a hydrogen atom or a substituted or unsubstituted phenyl group-substituted or unsubstituted ethyl group-; or R 18 and R 19 are linked to form a substituted or unsubstituted piperazine ring, a substituted or unsubstituted piperidine ring, or a substituted or unsubstituted nitrogen-containing heterocyclic heptane ring.

[0234] Another favorable example is R 18 and R 19 each independently represents a hydrogen atom, a substituted or unsubstituted C1-C4 alkyl group, a substituted or unsubstituted C3-C10 cycloalkyl group, or a substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C4 alkyl group-; or R 18 and R 19 are linked to form a substituted or unsubstituted piperazine ring, a substituted or unsubstituted piperidine ring, or a substituted or unsubstituted nitrogen-containing heterocyclic heptane ring.

[0235] Another favorable example is R 18 and R 19 each independently represents a hydrogen atom or a substituted or unsubstituted phenyl group-substituted or unsubstituted ethyl group-; or R 18 and R 19 are bonded to form a substituted or unsubstituted methyl group-substituted or unsubstituted piperazine ring, a substituted or unsubstituted butyl group-substituted or unsubstituted piperazine ring, a substituted or unsubstituted methyl group-substituted or unsubstituted piperidine ring, a trifluoromethyl group-piperidine ring, a halogenated piperidine ring, or a substituted or unsubstituted nitrogen-containing heterocyclic heptane ring.

[0236] Another favorable example is R 18 and R 19 each independently represents a hydrogen atom or a phenyl group-ethyl group-; or R 18 and R 19 are bonded to form a methyl group-piperazine ring, a butyl group-piperazine ring, a trifluoromethyl group-piperazine ring, a trifluoromethoxy group-piperazine ring, a halogenated piperazine ring, a methyl group-piperidine ring, a trifluoromethyl group-piperidine ring, a trifluoromethoxy group-piperidine ring, a halogenated piperidine ring, a nitrogen-containing heterocyclic heptane ring, or (R 20 R 21 ) Forms an N-piperidine ring.

[0237] Another favorable example is R 3 is a hydrogen atom, a hydroxyl group, a mercapto group, an amino group, a methyl group -O-,

[0238] [ka]

[0239] Ethyl-O-, propyl-O-, amyl-O-, hexyl-O-, phenyl-O-butyl-O-, halogenated ethyl-O-, halogenated propyl-O-, halogenated butyl-O-, halogenated hexyl-O-, phenyl-ethyl-O-, phenyl-propyl-O-, phenyl-butyl-O-, cyclodecyl-acetyl-O-, butenyl-ethyl-propenyl-methyl-O-, (R 20 R 21 ) N-hexyl group -O-, (R 20 R 21 ) N-butyl group -O-, (R 20 R 21 )N-ethyl group-O-, piperidinyl group-ethyl group-O-, butyl group-piperazinyl group-O-, methyl group-piperidinyl group-O-, phenyl group-phenyl group-methyl group-O-, vinyl group-methyl group-O-, piperidinyl group-propyl group-O-, piperidinyl group-ethyl group-O-, dimethylamino group-ethyl group-O-, phenyl group-ethyl group-NH-, butyl group-piperazinyl group-, methyl group-piperazinyl group-, trifluoromethyl group-piperazinyl group-, trifluoromethoxy group-piperazinyl group-, halogenated piperazinyl group-, methyl group-piperidinyl group-, trifluoromethyl group-piperidinyl group-, trifluoromethoxy group-piperidinyl group-, halogenated piperidinyl group-, nitrogen-containing heterocyclic heptane group or (R 20 R 21 ) N-piperidine group -.

[0240] In another preferred embodiment, the chemical structure of the phenyl group-ethyl group is as follows:

[0241] [ka]

[0242] In another preferred embodiment, the chemical structure of the methyl group-piperazine ring is as follows:

[0243] [ka]

[0244] In another preferred embodiment, the chemical structure of the methyl group-piperazinyl group- is as follows:

[0245] [ka]

[0246] In another preferred embodiment, the chemical structure of the butyl group-piperazine ring is as follows:

[0247] [ka]

[0248] In another preferred embodiment, the butyl group-piperazinyl group-has the following chemical structure:

[0249] [ka]

[0250] In another preferred example, the chemical structural formula of the trifluoromethyl group-piperazine ring is as follows:

[0251] [ka]

[0252] In another preferred embodiment, the trifluoromethyl group-piperazinyl group-has the following chemical structure:

[0253] [ka]

[0254] In another preferred embodiment, the chemical structure of the trifluoromethoxy group-piperazine ring is as follows:

[0255] [ka]

[0256] In another preferred embodiment, the trifluoromethoxy group-piperazinyl group-has the following chemical structure:

[0257] [ka]

[0258] In another preferred embodiment, the halogenated piperazine ring is a chlorinated piperazine ring.

[0259] In another preferred embodiment, the halogenated piperazine ring has the following chemical structure:

[0260] [ka]

[0261] In another preferred embodiment, the halogenated piperazinyl group is a chlorinated piperazinyl group.

[0262] In another preferred embodiment, the halogenated piperazinyl group has the following chemical structure:

[0263] [ka]

[0264] In another preferred embodiment, the chemical structure of the methyl group-piperidinyl group- is as follows:

[0265] [ka]

[0266] In another preferred embodiment, the chemical structure of the methyl group-piperidine ring is as follows:

[0267] [ka]

[0268] In another preferred embodiment, the trifluoromethyl group-piperidinyl group-has the following chemical structure:

[0269] [ka]

[0270] In another preferred example, the chemical structural formula of the trifluoromethyl group-piperidine ring is as follows:

[0271] [ka]

[0272] In another preferred embodiment, the trifluoromethoxy group-piperidinyl group-has the following chemical structure:

[0273] [ka]

[0274] In another preferred embodiment, the chemical structure of the trifluoromethoxy group-piperidine ring is as follows:

[0275] [ka]

[0276] In another preferred embodiment, the halogenated piperidine ring is a chlorinated piperidine ring.

[0277] In another preferred embodiment, the halogenated piperidine ring has the following chemical structure:

[0278] [ka]

[0279] In another preferred embodiment, the halogenated piperidinyl group is a chlorinated halogenated piperidinyl group.

[0280] In another preferred embodiment, the halogenated piperidinyl group has the following chemical structure:

[0281] [ka]

[0282] In another preferred embodiment, the nitrogen-containing heterocyclic heptane ring has the following chemical structural formula:

[0283] [ka]

[0284] In another preferred embodiment, the nitrogen-containing heterocyclic heptane group has the following chemical structure:

[0285] [ka]

[0286] In another preferred embodiment, the above (R 20 R 21 The chemical structural formula of the N-piperidine group is as follows:

[0287] [ka]

[0288] In another preferred embodiment, the above (R 20 R 21 ) The chemical structural formula of the N-piperidine ring is as follows:

[0289] [ka]

[0290] Another favorable example is R 18 and R 19 each independently represents a hydrogen atom, a substituted or unsubstituted C1-C4 alkyl group, a substituted or unsubstituted C3-C10 cycloalkyl group, or a substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C4 alkyl group-; Or R 18 and R 19 is combined

[0291] [ka]

[0292] Here, R 42 , R 43 , R 44 , R 45 , R 46 , R 47 , R 48 , R 49 , R 50 and R 51 each independently represents a hydrogen atom, a C1-C10 alkyl group, a C1-C10 halogenated alkyl group, a C1-C10 halogenated alkoxyl group, a C1-C10 halogenated alkylthiol group, or a halogen atom;

[0293] R 52 , R 53 , R 54 , R 55 , R 56 , R 57 , R 58 , R 59 and R 60 each independently represents a hydrogen atom, a C1-C10 alkyl group, a C1-C10 halogenated alkyl group, a C1-C10 halogenated alkoxyl group, a C1-C10 halogenated alkylthiol group, or a halogen atom.

[0294] Another preferred example is (R 20 R 21 )N- is

[0295] [ka]

[0296] R 42 , R 43 , R 44 , R 45 , R 46 , R 47 , R 48 , R 49 , R 50 and R 51 each independently represents a hydrogen atom, a C1-C10 alkyl group, a C1-C10 halogenated alkyl group, a C1-C10 halogenated alkoxyl group, a C1-C10 halogenated alkylthiol group, or a halogen atom;

[0297] R 52 , R 53 , R 54 , R 55 , R 56 , R 57 , R 58 , R 59 and R 60 each independently represents a hydrogen atom, a C1-C10 alkyl group, a C1-C10 halogenated alkyl group, a C1-C10 halogenated alkoxyl group, a C1-C10 halogenated alkylthiol group, or a halogen atom.

[0298] Another favorable example is R 20 and R 21 each independently represents a hydrogen atom, a substituted or unsubstituted C1-C10 alkyl group, a substituted or unsubstituted C3-C10 cycloalkyl group, or a substituted or unsubstituted C2-C8 ester group; or R 20 and R 21 are joined to form a substituted or unsubstituted 3-10 membered heterocycloalkyl group.

[0299] Another favorable example is R 20 and R 21each independently represents a hydrogen atom, a substituted or unsubstituted C1-C8 alkyl group, a substituted or unsubstituted C3-C8 cycloalkyl group, or a substituted or unsubstituted C2-C8 ester group; or R 20 and R 21 are joined to form a substituted or unsubstituted 3-8 membered heterocycloalkyl group.

[0300] Another favorable example is R 20 and R 21 each independently represents a hydrogen atom, a substituted or unsubstituted C1-C6 alkyl group, a substituted or unsubstituted C3-C8 cycloalkyl group, or a substituted or unsubstituted C3-C7 ester group; or R 20 and R 21 are joined to form a substituted or unsubstituted 5-8 membered heterocycloalkyl group.

[0301] Another favorable example is R 20 and R 21 each independently represents a hydrogen atom or a substituted or unsubstituted amyl ester; or R 20 and R 21 are linked to form a substituted or unsubstituted piperidine ring.

[0302] Another favorable example is R 20 and R 21 each independently represents a hydrogen atom or an amyl ester; or R 20 and R 21 are linked to form a piperidine ring.

[0303] In another preferred embodiment, the amyl ester has the following chemical structure:

[0304] [ka]

[0305] In another preferred embodiment, the above (R 20 R 21 )N-Hexyl group - the chemical structure is

[0306] [ka]

[0307] In another preferred embodiment, the above (R 20 R 21 The chemical structure of the N-butyl group is

[0308] [ka]

[0309] In another preferred embodiment, the above (R 20 R 21 The chemical structure of the N-ethyl group is

[0310] [ka]

[0311] Another favorable example is R 22 , R 23 , R 24 , R 25 , R 26 , R 27 , R 28 , R 29 and R 30 each independently represents a hydrogen atom, a C1-C6 alkyl group, a C3-C8 cycloalkyl group, a C1-C6 halogenated alkyl group, a C3-C8 halogenated cycloalkyl group, a C3-C8 cycloalkoxyl group, a C3-C8 cycloalkylthiol group, a C3-C8 halogenated cycloalkoxyl group, a C3-C8 halogenated cycloalkylthiol group, a halogen atom, a nitro group, -CN, a hydroxyl group, a mercapto group, an amino group, a C1-C4 carboxyl group, a C2-C6 ester group, a C2-C4 acylamino group, a C1-C6 alkoxyl group, a C1-C6 alkylthiol group, a C1-C6 halogenated alkoxyl group, a C1-C6 halogenated alkylthiol group, a C6-C12 aryl group, a C6-C12 aryl group-O-, a 5-10 membered heteroaryl group, a 5-10 membered heteroaryl group-O-, or a 5-10 membered heterocycloalkyl group.

[0312] Another favorable example is R 22 , R 23 , R 24 , R 25 , R 26 , R 27 , R 28 , R 29 and R 30 each independently represents a hydrogen atom, a C1-C6 alkyl group, a C1-C6 alkoxyl group, or a C1-C6 alkylthiol group.

[0313] Another favorable example is R 22 , R 23 , R 24 , R 25 , R 26 , R 27 , R 28 , R 29 and R 30 each independently represents a hydrogen atom, a C1-C4 alkyl group, a C1-C4 alkoxyl group, or a C1-C4 alkylthiol group.

[0314] Another favorable example is R 22 , R 23 , R 24 , R 25 , R 26 , R 27 , R 28 , R 29 and R 30 each independently represents a hydrogen atom, a C1-C3 alkyl group, a C1-C2 alkoxyl group, or a C1-C2 alkylthiol group.

[0315] Another favorable example is R 22 , R 23 , R 24 , R 25 , R 26 , R 27 , R 28 , R 29 and R 30 each independently represents a hydrogen atom, a trifluoromethoxy group, or a propyl group.

[0316] In another preferred embodiment, the propyl group is an isopropyl group.

[0317] Another good example is Z 1 and Z 2 each independently represents a substituted or unsubstituted C1-C6 alkylidene group.

[0318] Another good example is Z 1 and Z 2 each independently represents a substituted or unsubstituted C1-C4 alkylidene group.

[0319] Another good example is Z 1 and Z 2 each independently represents a substituted or unsubstituted methylidene group, a substituted or unsubstituted ethylidene group, a substituted or unsubstituted propylidene group, a substituted or unsubstituted butylidene group, a substituted or unsubstituted amytylidene group, or a substituted or unsubstituted hexamethylidene group.

[0320] Another good example is Z 1 and Z 2 each independently represents a methylidene group, an ethylidene group, a propylidene group, a butylidene group, an amylidene group, or a hexamethylidene group.

[0321] In another preferred embodiment, the ethylidene group is

[0322] [ka]

[0323] In another preferred embodiment, the propyl group is

[0324] [ka]

[0325] In another preferred embodiment, the propylidene group is an n-propylene group.

[0326] In another preferred embodiment, the chemical structure of the propylidene group is

[0327] [ka]

[0328] In another preferred embodiment, the chemical structure of the butylidene group is

[0329] [ka]

[0330] Another favorable example is R 31 , R 32 , R 33 , R 34 and R 35 each independently represents a hydrogen atom or a C1-C6 alkyl group.

[0331] Another favorable example is R 31 , R 32 , R 33 , R 34 and R 35 each independently represents a hydrogen atom or a C1-C4 alkyl group.

[0332] Another favorable example is R 41 represents a hydrogen atom or a substituted or unsubstituted C1-C6 alkyl group.

[0333] Another favorable example is R 41 represents a hydrogen atom, or a substituted or unsubstituted C1-C4 alkyl group.

[0334] Another favorable example is R 42 , R 43 , R 44 , R 45 , R 46 , R 47 , R 48 , R 49 , R 50 and R 51each independently represents a hydrogen atom, a C1-C8 alkyl group, a C1-C8 halogenated alkyl group, a C1-C8 halogenated alkoxyl group, a C1-C8 halogenated alkylthiol group, or a halogen atom.

[0335] Another favorable example is R 42 , R 43 , R 44 , R 45 , R 46 , R 47 , R 48 , R 49 , R 50 and R 51 each independently represents a hydrogen atom, a C1-C6 alkyl group, a C1-C6 halogenated alkyl group, a C1-C6 halogenated alkoxyl group, a C1-C6 halogenated alkylthiol group, or a halogen atom.

[0336] Another favorable example is R 42 , R 43 , R 44 , R 45 , R 46 , R 47 , R 48 , R 49 , R 50 and R 51 each independently represents a hydrogen atom, a C1-C4 alkyl group, a C1-C4 halogenated alkyl group, a C1-C4 halogenated alkoxyl group, a C1-C4 halogenated alkylthiol group, or a halogen atom.

[0337] Another favorable example is R 42 , R 43 , R 44 , R 45 , R 46 , R 47 , R 48 , R 49 , R 50 and R 51 each independently represents a hydrogen atom, a methyl group, a butyl group, a trifluoromethoxy group, a trifluoromethoxy group, or a halogen atom (for example, Cl).

[0338] Another favorable example is R 52, R 53 , R 54 , R 55 , R 56 , R 57 , R 58 , R 59 and R 60 each independently represents a hydrogen atom, a C1-C8 alkyl group, a C1-C8 halogenated alkyl group, a C1-C8 halogenated alkoxyl group, a C1-C8 halogenated alkylthiol group, or a halogen atom.

[0339] Another favorable example is R 52 , R 53 , R 54 , R 55 , R 56 , R 57 , R 58 , R 59 and R 60 each independently represents a hydrogen atom, a C1-6 alkyl group, a C1-C6 halogenated alkyl group, a C1-C6 halogenated alkoxyl group, a C1-C6 halogenated alkylthiol group, or a halogen atom.

[0340] Another favorable example is R 52 , R 53 , R 54 , R 55 , R 56 , R 57 , R 58 , R 59 and R 60 each independently represents a hydrogen atom, a C1-4 alkyl group, a C1-C4 halogenated alkyl group, a C1-C4 halogenated alkoxyl group, a C1-C4 halogenated alkylthiol group, or a halogen atom.

[0341] Another favorable example is R 52 , R 53 , R 54 , R 55 , R 56 , R 57 , R 58 , R 59 and R 60each independently represents a hydrogen atom, a methyl group, a butyl group, a trifluoromethoxy group, a trifluoromethoxy group, or a halogen atom (for example, Cl).

[0342] In another preferred example, the halogen atom is a fluorine atom, a chlorine atom, a bromine atom, or an iodine atom.

[0343] In another preferred embodiment, the halogenation refers to fluorination, chlorination, bromination and / or iodination.

[0344] In another preferred example, the halogenation refers to 1-position halogenation, 2-position halogenation, or 3-position halogenation.

[0345] In another preferred embodiment, the aryl group refers to a phenyl group.

[0346] In another preferred embodiment, the compound of formula I is optically inactive or optically active.

[0347] In another preferred embodiment, the compound of formula I does not have a chiral carbon atom or has a chiral carbon atom.

[0348] In another preferred embodiment, the compound of formula I has one chiral carbon atom.

[0349] In another preferred embodiment, the compound of formula I has the structure of a racemate, an R configuration, or an S configuration.

[0350] In another preferred embodiment, the chemical structure of the compound of formula I is as follows:

[0351] [ka]

[0352] Here, R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R7 , R 8 , R 9 , R 10 , R 11 , R 12 , R 13 , R 14 sum R 15 are each independently as defined above.

[0353] In another preferred embodiment, "*" represents the structure of a compound.

[0354] In another preferred embodiment, "*" indicates that the compound is in the racemic, R or S configuration.

[0355] In another preferred embodiment, "*" represents a chiral carbon atom.

[0356] In another preferred embodiment, the structure of the chiral carbon atom is a racemate, an R-structure or an S-structure.

[0357] In another preferred embodiment, the structure of the chiral carbon atom is an R-structure and / or an S-structure.

[0358] In another preferred embodiment, the R-structure and S-structure of the chiral carbon atom refer to a racemic structure.

[0359] In another preferred embodiment, the chemical structure of the compound of formula I is as follows:

[0360] [ka]

[0361] Here, R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 11 , R 12 , R 13 , R 14 , R15 , R 31 , W 3 and W 4 are each independently as defined above.

[0362] In another preferred embodiment, the chemical structure of the compound of formula I is as follows:

[0363] [ka]

[0364] Here, R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 11 , R 12 , R 13 , R 14 , R 15 , R 31 , W 3 , W 4 and * are each independently as defined above.

[0365] In another preferred embodiment, the chemical structure of the compound of formula I is as follows:

[0366] [ka]

[0367] Here, R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 11 , R 12 , R 13 , R 14 , R 15 , R 32 , R 33 , R34 , R 35 , W 5 and W 6 are each independently as defined above.

[0368] In another preferred embodiment, the chemical structure of the compound of formula I is as follows:

[0369] [ka]

[0370] Here, R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 11 , R 12 , R 13 , R 14 , R 15 , R 32 , R 33 , R 34 , R 35 , W 5 , W 6 and * are each independently as defined above.

[0371] In another preferred embodiment, the chemical structure of the compound of formula I is as follows:

[0372] [ka]

[0373] Here, R 1 , R 2 , R 5 , R 6 , R 7 , R 8 , R 11 , R 12 , R 13 , R 14 , R 15 , R 31 , R41 , W 1 , W 2 , W 3 and W 4 are each independently as defined above.

[0374] In another preferred embodiment, the chemical structure of the compound of formula I is as follows:

[0375] [ka]

[0376] Here, R 1 , R 2 , R 5 , R 6 , R 7 , R 8 , R 11 , R 12 , R 13 , R 14 , R 15 , R 31 , R 41 , W 1 , W 2 , W 3 , W 4 The sums * are each independently as defined above.

[0377] In another preferred embodiment, the chemical structure of the compound of formula I is as follows:

[0378] [ka]

[0379] Here, R 1 , R 2 , R 3 , R 6 , R 7 , R 8 , R 11 , R 12 , R 13 , R 14 , R 15 , R 31 , R 41 , W1 , W 2 , W 3 and W 4 are each independently as defined above.

[0380] In another preferred embodiment, the chemical structure of the compound of formula I is as follows:

[0381] [ka]

[0382] Here, R 1 , R 2 , R 3 , R 6 , R 7 , R 8 , R 11 , R 12 , R 13 , R 14 , R 15 , R 31 , R 41 , W 1 , W 2 , W 3 , W 4 and * are each independently as defined above.

[0383] In another preferred embodiment, the chemical structure of the compound of formula I is as follows:

[0384] [ka]

[0385] Here, R 1 , R 2 , R 4 , R 5 , R 6 , R 7 , R 8 , R 11 , R 12 , R 13 , R 14 , R 15 , R 31 , R 42 , R43 , R 44 , R 45 , R 46 , R 47 , R 48 , R 49 , R 50 , R 51 , W 3 and W 4 are each independently as defined above.

[0386] In another preferred embodiment, the chemical structure of the compound of formula I is as follows:

[0387] [ka]

[0388] Here, R 1 , R 2 , R 4 , R 5 , R 6 , R 7 , R 8 , R 11 , R 12 , R 13 , R 14 , R 15 , R 31 , R 42 , R 43 , R 44 , R 45 , R 46 , R 47 , R 48 , R 49 , R 50 , R 51 , W 3 , W 4 and * are each independently as defined above.

[0389] In another preferred embodiment, the chemical structure of the compound of formula I is as follows:

[0390] [ka]

[0391] Here, R 1 , R 2 , R 4 , R 5 , R 6 , R 7 , R 8 , R 11 , R 12 , R 13 , R 14 , R 15 , R 31 , R 52 , R 53 , R 54 , R 55 , R 56 , R 57 , R 58 , R 59 , R 60 , W 3 and W 4 are each independently as defined above.

[0392] In another preferred embodiment, the chemical structure of the compound of formula I is as follows:

[0393] [ka]

[0394] Here, R 1 , R 2 , R 4 , R 5 , R 6 , R 7 , R 8 , R 11 , R 12 , R 13 , R 14 , R 15 , R 31 , R 52 , R 53 , R 54 , R 55 , R 56 , R 57 , R 58 , R 59 , R 60 , W 3 , W 4 and * are each independently as defined above.

[0395] In another preferred embodiment, the chemical structure of the compound of formula I is as follows:

[0396] [ka]

[0397] Here, R 1 , R 2 , R 4 , R 5 , R 6 , R 7 , R 8 , R 11 , R 12 , R 13 , R 14 , R 15 , R 32 , R 33 , R 34 , R 35 , R 42 , R 43 , R 44 , R 45 , R 46 , R 47 , R 48 , R 49 , R 50 , R 51 , W 5 and W 6 are each independently as defined above.

[0398] In another preferred embodiment, the chemical structure of the compound of formula I is as follows:

[0399] [ka]

[0400] Here, R 1 , R 2 , R 4 , R 5 , R 6 , R 7 , R 8 , R 11 , R 12, R 13 , R 14 , R 15 , R 32 , R 33 , R 34 , R 35 , R 42 , R 43 , R 44 , R 45 , R 46 , R 47 , R 48 , R 49 , R 50 , R 51 , W 5 , W 6 and * are each independently as defined above.

[0401] In another preferred embodiment, the chemical structure of the compound of formula I is as follows:

[0402] [ka]

[0403] Here, R 1 , R 2 , R 4 , R 5 , R 6 , R 7 , R 8 , R 11 , R 12 , R 13 , R 14 , R 15 , R 32 , R 33 , R 34 , R 35 , R 52 , R 53 , R 54 , R 55 , R 56 , R 57 , R 58 , R 59 , R 60 , W 5 and W 6 are each independently as defined above.

[0404] In another preferred embodiment, the chemical structure of the compound of formula I is as follows:

[0405] [ka]

[0406] Here, R 1 , R 2 , R 4 , R 5 , R 6 , R 7 , R 8 , R 11 , R 12 , R 13 , R 14 , R 15 , R 32 , R 33 , R 34 , R 35 , R 52 , R 53 , R 54 , R 55 , R 56 , R 57 , R 58 , R 59 , R 60 , W 5 , W 6 and * are each independently as defined above.

[0407] In another preferred embodiment, the chemical structure of the compound of formula I is as follows:

[0408] [ka]

[0409] Here, R 1 , R 2 , R 5 , R 6 , R 7 , R 8 , R 11 , R 12 , R 13 , R 14 , R 15 , R 32 , R33 , R 34 , R 35 , R 41 , W 1 , W 2 , W 5 and W 6 are each independently as defined above.

[0410] In another preferred embodiment, the chemical structure of the compound of formula I is as follows:

[0411] [ka]

[0412] Here, R 1 , R 2 , R 5 , R 6 , R 7 , R 8 , R 11 , R 12 , R 13 , R 14 , R 15 , R 32 , R 33 , R 34 , R 35 , R 41 , W 1 , W 2 , W 5 , W 6 and * are each independently as defined above.

[0413] In another preferred embodiment, the chemical structure of the compound of formula I is as follows:

[0414] [ka]

[0415] Here, R 1 , R 2 , R 3 , R 6 , R 7 , R 8 , R 11 , R12 , R 13 , R 14 , R 15 , R 32 , R 33 , R 34 , R 35 , R 41 , W 1 , W 2 , W 5 and W 6 are each independently as defined above.

[0416] In another preferred embodiment, the compound of formula I has the chemical structure shown in formula I-22.

[0417] [ka]

[0418] Here, R 1 , R 2 , R 3 , R 6 , R 7 , R 8 , R 11 , R 12 , R 13 , R 14 , R 15 , R 32 , R 33 , R 34 , R 35 , R 41 , W 1 , W 2 , W 5 , W 6 and * are each independently as defined above.

[0419] In another preferred embodiment, the pharma- ceutically acceptable salts of the compounds of formula I include salts formed from compounds of formula I and acids.

[0420] In another preferred example, the acid comprises one or more of hydrochloric acid, galactaric acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, benzenesulfonic acid, aspartic acid, and glutamic acid.

[0421] In another preferred example, the pharma- ceutically acceptable salts of the compounds of formula I include salts formed by the compounds of formula I with one or more of hydrochloric acid, galactaric acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, benzenesulfonic acid, aspartic acid, and glutamic acid.

[0422] In another preferred embodiment, the pharma- ceutically acceptable salts of the compounds of formula I include salts formed by the compounds of formula I with hydrochloric acid, galactaric acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, benzenesulfonic acid, aspartic acid, or glutamic acid.

[0423] In another preferred embodiment, the base of the pharma- ceutically acceptable salt of the compound of formula I is a phenyl group in which the acid is one H + This includes bases formed by loss of

[0424] In another preferred example, the base of the pharma- ceutically acceptable salt of the compound of formula I comprises a base formed by hydrochloric acid, galactaric acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, benzenesulfonic acid, aspartic acid, or glutamic acid losing one H+.

[0425] In another preferred embodiment, the base of the pharma- ceutically acceptable salt of the compound of formula I is - , Cl - , Br - , I - , H.C.O.O. - , C.H. 3 COO - , S.O. 4 2- Or NO 3 - Includes.

[0426] In another preferred embodiment, the chemical structure of the compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, is as follows:

[0427] [ka] TIFF2025509620000116.tif186161JPEG2025509620000117.jpg32161TIFF2025509620000118.tif195161JPEG2025509620000119.jpg188161TIFF2025509620000120.tif191155TIFF2025509620000121.tif185160TIFF2025509620000122.tif179160TIFF2025509620000123.tif182160TIFF2025509620000124.tif187160TIFF2025509620000125.tif187160TIFF2025509620000126.tif185160TIFF2025509620000127.tif182160TIFF2025509620000128.tif185160TIFF2025509620000129.tif181160TIFF2025509620000130.tif188160TIFF2025509620000131.tif181160TIFF2025509620000132.tif180160TIFF2025509620000133.tif180160TIFF2025509620000134.tif183160TIFF2025509620000135.tif180160TIFF2025509620000136.tif184160TIFF2025509620000137.tif181160TIFF2025509620000138.tif183160TIFF2025509620000139.tif204160TIFF2025509620000140.tif204160TIFF2025509620000141.tif204160TIFF2025509620000142.tif204160TIFF2025509620000143.tif204160TIFF2025509620000144.tif204160TIFF2025509620000145.tif204160TIFF2025509620000146.tif204160TIFF2025509620000147.tif204160TIFF2025509620000148.tif155160

[0428] A second aspect of the present invention provides a composition comprising (a) said compound of formula I according to the first aspect of the invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, and (b) a pharma- ceutically acceptable carrier.

[0429] In another preferred embodiment, the content of (a) said compound of formula I according to the first aspect of the present invention, or its optical isomer or racemate, or its solvate, or its pharma- ceutically acceptable salt, or its deuterated compound, relative to the total weight of the composition is 0.001-99.9 wt%.

[0430] In another preferred embodiment, the composition is a pharmaceutical composition.

[0431] In another preferred embodiment, the composition further comprises a pharma- ceutically acceptable carrier.

[0432] In another preferred embodiment, the composition is in the form of a solid, liquid or semi-solid.

[0433] In another preferred embodiment, the composition is in the form of an oral preparation, an external preparation, or an injectable preparation.

[0434] In another preferred embodiment, the injectable formulation comprises an intravenous formulation.

[0435] In another preferred embodiment, the composition is in the form of a tablet, an injection, an infusion, an ointment, a gel, a solution, a pill or a coating.

[0436] A third aspect of the present invention provides the use of said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, for the manufacture of a composition or formulation for use in the prevention and / or treatment of tumors.

[0437] In another preferred embodiment, the tumor is of human origin.

[0438] In another preferred embodiment, the tumor is a human tumor.

[0439] In another preferred embodiment, the tumor comprises a tumor in which the NNMT gene is underexpressed or not expressed.

[0440] In another preferred embodiment, the tumor comprises a tumor in which DNA methyltransferase is highly expressed.

[0441] In another preferred embodiment, the DNA methyltransferase is selected from DNMT1, DNMT3a, DNMT3b, or a combination thereof.

[0442] In another preferred embodiment, the tumor comprises a tumor in which DNMT1 is highly expressed.

[0443] In another preferred embodiment, the tumor comprises a tumor in which DNMT3a is highly expressed.

[0444] In another preferred embodiment, the tumor comprises a tumor in which DNMT3b is highly expressed.

[0445] In another preferred embodiment, the tumor comprises a tumor in which UHRF1 is highly expressed.

[0446] In another preferred embodiment, the tumor comprises a tumor with hypermethylation of nucleotide sites in the NNMT gene and / or hypermethylation of DNA CpG sites in the NNMT gene region.

[0447] In another preferred embodiment, the tumor comprises a tumor in which the nucleotide site in the NNMT gene is hypermethylated.

[0448] In another preferred embodiment, said methylation at a nucleotide site in the NNMT gene refers to methylation at a cytosine nucleotide site in the NNMT gene.

[0449] In another preferred embodiment, said methylation at a nucleotide site in the NNMT gene refers to methylation of a cytosine at the nucleotide site in the NNMT gene.

[0450] In another preferred embodiment, said methylation of the nucleotide site of the NNMT gene refers to methylation of the 5th carbon atom on the cytosine of the nucleotide of the NNMT gene.

[0451] In another preferred embodiment, the tumor comprises a tumor in which NNMT gene region DNA CpG sites are hypermethylated.

[0452] In another preferred embodiment, said methylation of the NNMT gene region DNA CpG site refers to methylation of the cytosine nucleotide site of the NNMT gene region DNA CpG site.

[0453] In another preferred embodiment, said methylation of the NNMT gene region DNA CpG site refers to the methylation of the cytosine of the nucleotide of the NNMT gene region DNA CpG site.

[0454] In another preferred embodiment, said methylation of the NNMT gene region DNA CpG site refers to methylation of the 5th carbon atom on the cytosine of the nucleotide of the NNMT gene region DNA CpG site.

[0455] In another preferred embodiment, the NNMT gene is a human-derived NNMT gene.

[0456] In another preferred embodiment, the NNMT gene is a human NNMT gene.

[0457] In another preferred embodiment, the tumor in which the NNMT gene is under-expressed or not expressed refers to a tumor in which the NNMT protein cannot be detected with an NNMT antibody in 1 μg of protein extracted from the tumor, more preferably a tumor in which the NNMT protein cannot be detected with an NNMT antibody in 5 μg of protein extracted from the tumor, more preferably a tumor in which the NNMT protein cannot be detected with an NNMT antibody in 10 μg of protein extracted from the tumor, more preferably a tumor in which the NNMT protein cannot be detected with an NNMT antibody in 100 μg of protein extracted from the tumor, and more preferably a tumor in which the NNMT protein cannot be detected with an NNMT antibody in 1000 μg of protein extracted from the tumor.

[0458] In another preferred embodiment, the tumor in which the NNMT gene is under-expressed or not expressed refers to a tumor in which the expression level of the NNMT gene in tumor cells is lower than the expression level of the NNMT gene in the same type of cells or normal cells.

[0459] In another preferred example, the tumor in which the NNMT gene is under-expressed or not expressed refers to a tumor in which the ratio (E1 / E0) between the expression level E1 of the NNMT gene in tumor cells and the expression level E0 of the NNMT gene in similar cells or normal cells is <1.0.

[0460] In another preferred embodiment, the tumor in which the NNMT gene is under-expressed or not expressed refers to a tumor in which the ratio (E1 / E0) between the expression level E1 of the NNMT gene in a certain cell (e.g., a tumor cell) and the expression level E0 of the NNMT gene in a similar cell or a normal cell is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0461] In another preferred embodiment, the certain cell comprises a tumor cell.

[0462] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0463] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0464] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0465] In another preferred embodiment, said allogeneic cells refer to cells in which the NNMT gene is normally expressed or highly expressed (allogeneic tumor cells).

[0466] In another preferred embodiment, said allogeneic cells refer to cells of the same type, but in which the NNMT gene is normally or highly expressed (allogeneic tumor cells).

[0467] In another preferred embodiment, the normal cells refer to normal tissue cells (eg, cells derived from a tumor cell, cells adjacent to a tumor, or cancerous bladder tissue cells).

[0468] In another preferred embodiment, the normal cells refer to normal tissue cells in which the NNMT gene is normally expressed (eg, cells derived from tumor cells, tumor-adjacent cells, or cancerous bladder tissue cells).

[0469] In another preferred embodiment, E0 is the expression level of the NNMT gene in cells where the NNMT gene is normally expressed or highly expressed.

[0470] In another preferred embodiment, the cells in which the NNMT gene is normally expressed or highly expressed include cells that are insensitive to a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0471] In another preferred embodiment, the tumor in which DNA methyltransferase is highly expressed refers to a tumor in which DNA methyltransferase can be detected with a DNA methyltransferase antibody in 20 μg of protein extracted from the tumor, more preferably a tumor in which DNA methyltransferase can be detected with a DNA methyltransferase antibody in 5 μg of protein extracted from the tumor, more preferably a tumor in which DNA methyltransferase can be detected with a DNA methyltransferase antibody in 1 μg of protein extracted from the tumor, more preferably a tumor in which DNA methyltransferase can be detected with a DNA methyltransferase antibody in 0.2 μg of protein extracted from the tumor, more preferably a tumor in which DNA methyltransferase can be detected with a DNA methyltransferase antibody in 0.05 μg of protein extracted from the tumor, and more preferably a tumor in which DNA methyltransferase can be detected with a DNA methyltransferase antibody in 0.01 μg of protein extracted from the tumor.

[0472] In another preferred embodiment, the tumor in which DNA methyltransferase is highly expressed refers to a tumor in which the expression level of DNA methyltransferase in tumor cells is greater than the expression level of DNA methyltransferase in the same type of cells or normal cells.

[0473] In another preferred embodiment, the tumor with high expression of DNA methyltransferase refers to a tumor in which the ratio (A1 / A0) between the expression level A1 of DNA methyltransferase in tumor cells and the expression level A0 of DNA methyltransferase in similar cells or normal cells is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0474] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0475] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0476] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0477] In another preferred embodiment, the allogeneic cells refer to cells in which DNA methyltransferase is normally expressed or under-expressed (eg, allogeneic tumor cells).

[0478] In another preferred embodiment, said allogeneic cells refer to cells of the same type, but in which DNA methyltransferase is normally or under-expressed (eg allogeneic tumor cells).

[0479] In another preferred embodiment, the allogeneic cells refer to normal tissue cells (eg, cells derived from tumor cells, tumor-adjacent cells, or cancerous bladder tissue cells).

[0480] In another preferred embodiment, the allogeneic cells refer to normal tissue cells in which DNA methyltransferase is normally expressed (eg, cells derived from a tumor cell, cells adjacent to a tumor, or cancerous bladder tissue cells).

[0481] In another preferred embodiment, A0 is the expression level of DNA methyltransferase in cells in which DNA methyltransferase is normally expressed or under-expressed.

[0482] In another preferred embodiment, said cells in which DNA methyltransferase is normally expressed or under-expressed comprise cells which are insensitive to a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0483] In another preferred embodiment, the tumor in which DNMT1 is highly expressed refers to a tumor in which DNMT1 protein can be detected with DNMT1 antibody in 20 μg of protein extracted from the tumor, more preferably a tumor in which DNMT1 protein can be detected with DNMT1 antibody in 5 μg of protein extracted from the tumor, more preferably a tumor in which DNMT1 protein can be detected with DNMT1 antibody in 1 μg of protein extracted from the tumor, more preferably a tumor in which DNMT1 protein can be detected with DNMT1 antibody in 0.2 μg of protein extracted from the tumor, more preferably a tumor in which DNMT1 protein can be detected with DNMT1 antibody in 0.05 μg of protein extracted from the tumor, and more preferably a tumor in which DNMT1 protein can be detected with DNMT1 antibody in 0.01 μg of protein extracted from the tumor.

[0484] In another preferred embodiment, the tumor with high DNMT1 expression refers to a tumor in which the expression level of DNMT1 in tumor cells is greater than the expression level of DNMT1 in the same type of cells or normal cells.

[0485] In another preferred embodiment, the tumor with high expression of DNMT1 refers to a tumor in which the ratio (B1 / B0) between the expression level B1 of DNMT1 in tumor cells and the expression level B0 of DNMT1 in similar cells or normal cells is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0486] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0487] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0488] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0489] In another preferred embodiment, the allogeneic cells refer to cells in which DNMT1 is normally expressed or under-expressed (eg, allogeneic tumor cells).

[0490] In another preferred embodiment, said allogeneic cells refer to cells of the same type, but in which DNMT1 is normally or under-expressed (eg, allogeneic tumor cells).

[0491] In another preferred embodiment, the normal cells refer to normal tissue cells (eg, cells derived from a tumor cell, cells adjacent to a tumor, or cancerous bladder tissue cells).

[0492] In another preferred embodiment, the normal cells refer to normal tissue cells in which DNMT1 is normally expressed (eg, cells derived from a tumor cell, cells adjacent to a tumor, or cancerous bladder tissue cells).

[0493] In another preferred embodiment, B0 is the expression level of DNMT1 in cells where DNMT1 is normally expressed or under-expressed.

[0494] In another preferred embodiment, the cells in which DNMT1 is normally expressed or under-expressed include cells that are insensitive to a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0495] In another preferred embodiment, the tumor in which DNMT3a is highly expressed refers to a tumor in which DNMT3a protein can be detected with DNMT3a antibody in 20 μg of protein extracted from the tumor, more preferably a tumor in which DNMT3a protein can be detected with DNMT3a antibody in 5 μg of protein extracted from the tumor, more preferably a tumor in which DNMT3a protein can be detected with DNMT3a antibody in 1 μg of protein extracted from the tumor, more preferably a tumor in which DNMT3a protein can be detected with DNMT3a antibody in 0.2 μg of protein extracted from the tumor, more preferably a tumor in which DNMT3a protein can be detected with DNMT3a antibody in 0.05 μg of protein extracted from the tumor, and more preferably a tumor in which DNMT3a protein can be detected with DNMT3a antibody in 0.01 μg of protein extracted from the tumor.

[0496] In another preferred embodiment, the tumor with high DNMT3a expression refers to a tumor in which the expression level of DNMT3a in tumor cells is higher than the expression level of DNMT3a in the same type of cells or normal cells.

[0497] In another preferred embodiment, the tumor with high expression of DNMT3a refers to a tumor in which the ratio (C1 / C0) between the expression level C1 of DNMT3a in tumor cells and the expression level C0 of DNMT3a in similar cells or normal cells is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0498] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0499] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0500] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0501] In another preferred embodiment, the allogeneic cells refer to cells in which DNMT3a is normally expressed or under-expressed (eg, allogeneic tumor cells).

[0502] In another preferred embodiment, said allogeneic cells refer to cells of the same type, but in which DNMT3a is normally or under-expressed (eg, allogeneic tumor cells).

[0503] In another preferred embodiment, the normal cells refer to normal tissue cells (eg, cells derived from a tumor cell, cells adjacent to a tumor, or cancerous bladder tissue cells).

[0504] In another preferred embodiment, the normal cells refer to normal tissue cells in which DNMT3a is normally expressed (e.g., cells derived from a tumor cell, cells adjacent to a tumor, or cancerous bladder tissue cells).

[0505] In another preferred embodiment, C0 is the expression level of DNMT3a in cells where DNMT3a is normally expressed or under-expressed.

[0506] In another preferred embodiment, the cells in which DNMT3a is normally expressed or under-expressed include cells that are insensitive to a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0507] In another preferred embodiment, the tumor in which DNMT3b is highly expressed refers to a tumor in which DNMT3b protein can be detected with DNMT3b antibody in 20 μg of protein extracted from the tumor, more preferably a tumor in which DNMT3b protein can be detected with DNMT3b antibody in 5 μg of protein extracted from the tumor, more preferably a tumor in which DNMT3b protein can be detected with DNMT3b antibody in 1 μg of protein extracted from the tumor, more preferably a tumor in which DNMT3b protein can be detected with DNMT3b antibody in 0.2 μg of protein extracted from the tumor, more preferably a tumor in which DNMT3b protein can be detected with DNMT3b antibody in 0.05 μg of protein extracted from the tumor, and more preferably a tumor in which DNMT3b protein can be detected with DNMT3b antibody in 0.01 μg of protein extracted from the tumor.

[0508] In another preferred embodiment, the tumor in which DNMT3b is highly expressed refers to a tumor in which the expression level of DNMT3b in tumor cells is greater than the expression level of DNMT3b in the same type of cells or normal cells.

[0509] In another preferred embodiment, the tumor with high expression of DNMT3b refers to a tumor in which the ratio (D1 / D0) between the expression level D1 of DNMT3b in tumor cells and the expression level D0 of DNMT3b in similar cells or normal cells is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0510] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0511] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0512] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0513] In another preferred embodiment, said allogeneic cells refer to cells in which DNMT3b is normally expressed or under-expressed (allogeneic tumor cells).

[0514] In another preferred embodiment, said allogeneic cells refer to cells of the same type, but in which DNMT3b is normally or under-expressed (allogeneic tumor cells).

[0515] In another preferred embodiment, the normal cells refer to normal tissue cells (eg, cells derived from a tumor cell, cells adjacent to a tumor, or cancerous bladder tissue cells).

[0516] In another preferred embodiment, the normal cells refer to normal tissue cells in which DNMT3b is normally expressed (eg, cells derived from a tumor cell, cells adjacent to a tumor, or cancerous bladder tissue cells).

[0517] In another preferred embodiment, D0 is the expression level of DNMT3b in cells where DNMT3b is normally expressed or under-expressed.

[0518] In another preferred embodiment, the cells in which DNMT3b is normally expressed or under-expressed include cells that are insensitive to a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0519] In another preferred embodiment, the tumor in which UHRF1 is highly expressed refers to a tumor in which UHRF1 protein can be detected with UHRF1 antibody in 20 μg of protein extracted from the tumor, more preferably a tumor in which UHRF1 protein can be detected with UHRF1 antibody in 5 μg of protein extracted from the tumor, more preferably a tumor in which UHRF1 protein can be detected with UHRF1 antibody in 1 μg of protein extracted from the tumor, more preferably a tumor in which UHRF1 protein can be detected with UHRF1 antibody in 0.2 μg of protein extracted from the tumor, more preferably a tumor in which UHRF1 protein can be detected with UHRF1 antibody in 0.05 μg of protein extracted from the tumor, and more preferably a tumor in which UHRF1 protein can be detected with UHRF1 antibody in 0.01 μg of protein extracted from the tumor.

[0520] In another preferred embodiment, the tumor in which UHRF1 is highly expressed refers to a tumor in which the expression level of UHRF1 in tumor cells is greater than the expression level of UHRF1 in the same type of cells or normal cells.

[0521] In another preferred embodiment, the tumor in which UHRF1 is highly expressed refers to a tumor in which the ratio (F1 / F0) between the expression level F1 of UHRF1 in tumor cells and the expression level F0 of UHRF1 in similar cells or normal cells is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0522] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0523] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0524] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0525] In another preferred embodiment, said allogeneic cells refer to cells in which UHRF1 is normally expressed or under-expressed (allogeneic tumor cells).

[0526] In another preferred embodiment, said allogeneic cells refer to cells of the same type, but in which UHRF1 is normally or under-expressed (allogeneic tumor cells).

[0527] In another preferred embodiment, the normal cells refer to normal tissue cells (eg, cells derived from a tumor cell, cells adjacent to a tumor, or cancerous bladder tissue cells).

[0528] In another preferred embodiment, the normal cells refer to normal tissue cells in which UHRF1 is normally expressed (eg, cells derived from a tumor cell, cells adjacent to a tumor, or cancerous bladder tissue cells).

[0529] In another preferred embodiment, F0 is the expression level of UHRF1 in cells where UHRF1 is normally expressed or under-expressed.

[0530] In another preferred embodiment, the cells in which UHRF1 is normally expressed or under-expressed include cells that are insensitive to a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0531] In another preferred embodiment, the tumor in which the nucleotide site of the NNMT gene is hypermethylated refers to a tumor in which the methylation level of the nucleotide site of the NNMT gene in a certain cell (e.g., a tumor cell) is greater than the methylation level of the nucleotide site of the NNMT gene in a similar cell or a normal cell.

[0532] In another preferred embodiment, the tumor in which the nucleotide site of the NNMT gene is hypermethylated refers to a tumor in which the ratio (L1 / L0) between the methylation level L1 of the nucleotide site of the NNMT gene in a certain cell (e.g., a tumor cell) and the methylation level L0 of the nucleotide site of the NNMT gene in a similar cell or a normal cell (e.g., a cancerous bladder tissue cell) is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0533] In another preferred embodiment, the tumor in which the nucleotide site of the NNMT gene is hypermethylated refers to a tumor in which the methylation level of the nucleotide site of the NNMT gene in a certain cell (e.g., a tumor cell) is ≧1%, preferably ≧3%, ≧5%, ≧10%, ≧15% or ≧20%, and more preferably ≧25%, ≧30%, ≧40% or ≧50%.

[0534] In another preferred embodiment, the certain cell comprises a tumor cell.

[0535] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0536] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0537] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0538] In another preferred embodiment, said allogeneic cells refer to cells in which the nucleotide site of the NNMT gene is normally methylated or hypomethylated (allogeneic tumor cells).

[0539] In another preferred embodiment, said allogeneic cells refer to cells of the same type, yet in which the nucleotide site of the NNMT gene is normally methylated or hypomethylated (allogeneic tumor cells).

[0540] In another preferred embodiment, the normal cells refer to normal tissue cells (eg, cells derived from a tumor cell, cells adjacent to a tumor, or cancerous bladder tissue cells).

[0541] In another preferred embodiment, the normal cells refer to normal tissue cells (eg, cells derived from tumor cells, tumor-adjacent cells, or cancerous bladder tissue cells) in which the nucleotide site of the NNMT gene is normally methylated.

[0542] In another preferred embodiment, the cells in which the nucleotide site of the NNMT gene is normally methylated or hypomethylated include cells that are insensitive to a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0543] In another preferred example, the tumor in which the nucleotide site of the NNMT gene is hypermethylated refers to a tumor in which the methylation level (M%) of the nucleotide site of the NNMT gene in a certain cell (e.g., a tumor cell) is ≧3% and less than M1%, where M1 is any positive integer between 3 and 100.

[0544] In another preferred embodiment, M1 is 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90, 95 or 100.

[0545] In another preferred embodiment, said methylation level of a nucleotide site of the NNMT gene refers to the ratio between the number of methylated nucleotides in the NNMT gene region and the number of all nucleotides in the NNMT gene region.

[0546] In another preferred embodiment, said methylation level of a nucleotide site in the NNMT gene comprises a methylation level of a nucleotide site in the NNMT gene promoter region.

[0547] In another preferred embodiment, the nucleotide sequence of the NNMT gene promoter region is shown in SEQ ID NO:1.

[0548] In another preferred embodiment, said methylation level of a nucleotide site of the NNMT gene comprises the methylation level of a nucleotide site within a region from 1050 bp before the transcription start site to 499 bp after the transcription start site of the NNMT gene.

[0549] In another preferred embodiment, the region from 1050 bp before the transcription start site to 499 bp after the transcription start site of the NNMT gene is positions 951 to 2500 of the nucleotide sequence shown in SEQ ID NO:1.

[0550] In another preferred embodiment, said methylation level of a nucleotide site of the NNMT gene comprises the methylation level of a nucleotide site within a region from 1050 bp prior to the transcription start site of the NNMT gene to 193 bp prior to the transcription start site.

[0551] In another preferred embodiment, the region from 1050 bp prior to the transcription initiation site of the NNMT gene to 193 bp prior to the transcription initiation site is positions 951 to 1808 of the nucleotide sequence shown in SEQ ID NO:1.

[0552] In another preferred embodiment, said methylation level of a nucleotide site of the NNMT gene comprises the methylation level of a nucleotide site within a region from 840 bp prior to the transcription start site of the NNMT gene to 469 bp prior to the transcription start site.

[0553] In another preferred embodiment, the region from 840 bp prior to the transcription initiation site of the NNMT gene to 469 bp prior to the transcription initiation site is positions 1161 to 1532 of the nucleotide sequence shown in SEQ ID NO:1.

[0554] In another preferred embodiment, the methylation level of the nucleotide site of the NNMT gene includes the methylation level of a nucleotide site within a region between any two of positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050, and 114166066 on human chromosome 11 (including these two positions themselves).

[0555] In another preferred embodiment, the methylation level of the nucleotide site of the NNMT gene comprises the methylation level of the nucleotide at one or more (e.g., 2, 3, 4, 5, 6 or 7) sites among positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050 and 114166066 of human chromosome 11.

[0556] In another preferred embodiment, the methylation level of the nucleotide site of the NNMT gene comprises the methylation level of the nucleotide of a site selected from position 114165695 of human chromosome 11, position 114165730 of human chromosome 11, position 114165769 of human chromosome 11, position 114165804 of human chromosome 11, position 114165938 of human chromosome 11, position 114166050 of human chromosome 11, position 114166066 of human chromosome 11, or a combination thereof.

[0557] In another preferred embodiment, the methylation level of the nucleotide site of the NNMT gene comprises the methylation level of the nucleotide site within a region between any two of the following positions of the nucleotide sequence of SEQ ID NO:1: 1161, 1196, 1235, 1270, 1404, 1516, and 1532 (including these two positions themselves).

[0558] In another preferred embodiment, the methylation level of the nucleotide site of the NNMT gene comprises the methylation level of one or more (e.g., 2, 3, 4, 5, 6 or 7) of the nucleotide sites 1161, 1196, 1235, 1270, 1404, 1516 and 1532 of the nucleotide sequence of SEQ ID NO:1.

[0559] In another preferred embodiment, said methylation level of the DNA CpG site of the NNMT gene region comprises the methylation level of the nucleotide at the site selected from the sites 1161, 1196, 1235, 1270, 1404, 1516, 1532 or any combination thereof of the nucleotides of the nucleotide sequence of SEQ ID NO:1.

[0560] In another preferred embodiment, the tumor in which the NNMT gene region DNA CpG site is hypermethylated refers to a tumor in which the methylation level of the NNMT gene region DNA CpG site in a certain cell (e.g., a tumor cell) is greater than the methylation level of the NNMT gene region DNA CpG site in a similar cell or a normal cell.

[0561] In another preferred embodiment, the tumor in which the DNA CpG site of the NNMT gene region is hypermethylated refers to a tumor in which the ratio (W1 / W0) between the methylation level W1 of the DNA CpG site of the NNMT gene region of a certain cell (e.g., a tumor cell) and the methylation level W0 of the DNA CpG site of the NNMT gene region of a similar cell or a normal cell (e.g., a cancerous bladder tissue cell) is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0562] In another preferred embodiment, the tumor in which the DNA CpG site in the NNMT gene region is hypermethylated refers to a tumor in which the methylation level of the DNA CpG site in the NNMT gene region in a certain cell (e.g., a tumor cell) is ≧1%, preferably ≧3%, ≧5%, ≧10%, ≧15% or ≧20%, and more preferably ≧25%, ≧30%, ≧40% or ≧50%.

[0563] In another preferred embodiment, the certain cell comprises a tumor cell.

[0564] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0565] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0566] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0567] In another preferred embodiment, the allogeneic cells refer to cells in which the NNMT gene region DNA CpG sites are normally methylated or hypomethylated (eg, allogeneic tumor cells).

[0568] In another preferred embodiment, said allogeneic cells refer to cells of the same type, but in which the NNMT gene region DNA CpG sites are normally methylated or hypomethylated (eg allogeneic tumor cells).

[0569] In another preferred embodiment, the normal cells refer to normal tissue cells (eg, cells derived from a tumor cell, cells adjacent to a tumor, or cancerous bladder tissue cells).

[0570] In another preferred embodiment, the normal cells refer to normal tissue cells (eg, cells derived from tumor cells, tumor-adjacent cells, or cancerous bladder tissue cells) in which the DNA CpG sites in the NNMT gene region are normally methylated.

[0571] In another preferred embodiment, the cells in which the NNMT gene region DNA CpG sites are normally methylated or hypomethylated include cells that are insensitive to a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0572] In another preferred example, the tumor in which the DNA CpG site in the NNMT gene region is hypermethylated refers to a tumor in which the methylation level (M%) of the DNA CpG site in the NNMT gene region of a certain cell (e.g., a tumor cell) is ≧3% and less than M2%, where M2 is any positive integer between 3 and 100.

[0573] In another preferred embodiment, M2 is 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90, 95 or 100.

[0574] In another preferred embodiment, the methylation level of a CpG site refers to the ratio between the number of methylated CpG nucleotides in a certain gene region and the number of all nucleotides in the gene region.

[0575] In another preferred embodiment, said methylation level of the NNMT gene region DNA CpG site refers to the ratio between the number of methylated CpG nucleotides in the NNMT gene region and the number of all nucleotides in the NNMT gene region.

[0576] In another preferred embodiment, the methylation level of a CpG site refers to the ratio between the number of methylated CpG nucleotides in a gene region and the number of all CpG nucleotides in the gene region.

[0577] In another preferred embodiment, said methylation level of the NNMT gene region DNA CpG site refers to the ratio between the number of methylated CpG nucleotides in the NNMT gene region and the number of all CpG nucleotides in the NNMT gene region.

[0578] In another preferred embodiment, said methylation level of DNA CpG sites refers to the ratio between the number of methylated CpG sites in a region of DNA and the number of all CpG sites in said region of DNA.

[0579] In another preferred embodiment, said methylation level of DNA CpG sites refers to the ratio between the number of methylated CpG nucleotides in a region of DNA and the number of all nucleotides in said region of DNA.

[0580] In another preferred embodiment, said methylation level of DNA CpG sites refers to the ratio between the number of methylated CpG nucleotides in a region of DNA and the number of all CpG nucleotides in said region of DNA.

[0581] In another preferred embodiment, said methylation level of NNMT gene region DNA CpG sites refers to the ratio between the number of methylated CpG sites in the DNA of the NNMT gene region and the number of all CpG sites in the NNMT gene region DNA.

[0582] In another preferred embodiment, said methylation level of NNMT gene region DNA CpG sites refers to the ratio between the number of methylated CpG nucleotides of the DNA of the NNMT gene region and the number of all CpG nucleotides of the NNMT gene region DNA.

[0583] In another preferred embodiment, said methylation level of DNA CpG sites in the NNMT gene region comprises the methylation level of DNA CpG sites in the NNMT gene promoter region.

[0584] In another preferred embodiment, the nucleotide sequence of the NNMT gene promoter region is shown in SEQ ID NO:1.

[0585] In another preferred embodiment, said methylation level of DNA CpG sites in the NNMT gene region comprises the methylation level of DNA CpG sites within the region from 1050 bp before the transcription start site to 499 bp after the transcription start site of the NNMT gene.

[0586] In another preferred embodiment, the region from 1050 bp before the transcription start site to 499 bp after the transcription start site of the NNMT gene is positions 951 to 2500 of the nucleotide sequence shown in SEQ ID NO:1.

[0587] In another preferred embodiment, said methylation level of DNA CpG sites in the NNMT gene region comprises the methylation level of DNA CpG sites within the region from 1050 bp before the transcription start site to 193 bp before the transcription start site of the NNMT gene.

[0588] In another preferred embodiment, the region from 1050 bp prior to the transcription initiation site of the NNMT gene to 193 bp prior to the transcription initiation site is positions 951 to 1808 of the nucleotide sequence shown in SEQ ID NO:1.

[0589] In another preferred embodiment, said methylation level of DNA CpG sites in the NNMT gene region comprises the methylation level of DNA CpG sites within the region from 840 bp before the transcription start site to 469 bp before the transcription start site of the NNMT gene.

[0590] In another preferred embodiment, the region from 840 bp prior to the transcription initiation site of the NNMT gene to 469 bp prior to the transcription initiation site is positions 1161 to 1532 of the nucleotide sequence shown in SEQ ID NO:1.

[0591] In another preferred embodiment, the methylation level of DNA CpG sites in the NNMT gene region includes the methylation level of DNA CpG sites within the region between any two of positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050, and 114166066 on human chromosome 11 (including these two positions themselves).

[0592] In another preferred embodiment, the methylation level of the NNMT gene region DNA CpG sites includes the methylation level of one or more (e.g., 2, 3, 4, 5, 6 or 7) sites among positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050 and 114166066 of human chromosome 11.

[0593] In another preferred embodiment, the methylation level of the DNA CpG site of the NNMT gene region comprises the methylation level of a site selected from position 114165695 of human chromosome 11, position 114165730 of human chromosome 11, position 114165769 of human chromosome 11, position 114165804 of human chromosome 11, position 114165938 of human chromosome 11, position 114166050 of human chromosome 11, position 114166066 of human chromosome 11, or a combination thereof.

[0594] In another preferred embodiment, said methylation level of DNA CpG sites in the NNMT gene region comprises the methylation level of DNA CpG sites within the region between any two of the following positions of the nucleotide sequence of SEQ ID NO:1: 1161, 1196, 1235, 1270, 1404, 1516 and 1532 (including these two positions themselves).

[0595] In another preferred embodiment, the methylation level of the NNMT gene region DNA CpG sites comprises the methylation level of one or more (e.g., 2, 3, 4, 5, 6 or 7) of the sites at positions 1161, 1196, 1235, 1270, 1404, 1516 and 1532 of the nucleotide sequence of SEQ ID NO:1.

[0596] In another preferred embodiment, the methylation level of the NNMT gene region DNA CpG site comprises the methylation level of the site selected from the sites at positions 1161, 1196, 1235, 1270, 1404, 1516, 1532 or any combination thereof of the sites of SEQ ID NO:1.

[0597] In another preferred embodiment, the tumor in which the NNMT gene is under-expressed or not expressed can be treated by administering an inhibitor of the NNMT gene.

[0598] In another preferred embodiment, the tumor in which DNA methyltransferase is highly expressed can be treated by administering a promoter of DNA methyltransferase.

[0599] In another preferred embodiment, the tumor in which DNMT1 is highly expressed can be produced by administering a promoter of DNMT1.

[0600] In another preferred embodiment, the tumor in which DNMT3a is highly expressed can be produced by administering a promoter of DNMT3a.

[0601] In another preferred embodiment, the tumor in which DNMT3b is highly expressed can be produced by administering a promoter of DNMT3b.

[0602] In another preferred embodiment, the tumor in which UHRF1 is highly expressed can be produced by administering a promoter of UHRF1.

[0603] In another preferred embodiment, said tumor in which the nucleotide site of the NNMT gene is hypermethylated can be treated by administering an agent that enhances methylation of the nucleotide site of the NNMT gene.

[0604] In another preferred embodiment, the tumor in which the DNA CpG site in the NNMT gene region is hypermethylated can be treated by administering an agent for promoting methylation of the DNA CpG site in the NNMT gene region.

[0605] In another preferred embodiment, the inhibitor comprises an inhibitor having specificity.

[0606] In another preferred embodiment, the enhancer comprises an enhancer having specificity.

[0607] In another preferred embodiment, said inhibitor of the NNMT gene comprises an inhibitor capable of under-expressing or not expressing the NNMT gene in tumors.

[0608] In another preferred embodiment, said promoter of DNA methyltransferase comprises a promoter capable of up-expressing DNA methyltransferase in tumors.

[0609] In another preferred embodiment, said promoter of DNMT1 comprises a promoter capable of up-expressing DNMT1 in tumors.

[0610] In another preferred embodiment, said promoter of DNMT3a comprises a promoter capable of high expression of DNMT3a in tumors.

[0611] In another preferred embodiment, said promoter of DNMT3b comprises a promoter capable of up-expressing DNMT3b in tumors.

[0612] In another preferred embodiment, said promoter of UHRF1 comprises a promoter capable of high expression of UHRF1 in tumors.

[0613] In another preferred embodiment, said promoter of methylation of a nucleotide site in the NNMT gene comprises a promoter capable of hypermethylating a nucleotide site in the NNMT gene in a tumor.

[0614] In another preferred embodiment, said promoter of methylation of DNA CpG sites in the NNMT gene region comprises a promoter capable of hypermethylating DNA CpG sites in the NNMT gene region in tumors.

[0615] In another preferred embodiment, the tumor is selected from lung cancer, kidney cancer, breast cancer, colon cancer, lymphoma, leukemia, pancreatic cancer, brain cancer, liver cancer, prostate cancer, or a combination thereof.

[0616] In another preferred embodiment, the lung cancer is selected from non-small cell lung cancer, small cell lung cancer, or a combination thereof.

[0617] In another preferred embodiment, the lung cancer cells comprise NCI-H82 cells.

[0618] In another preferred embodiment, the colon cancer comprises colon adenocarcinoma.

[0619] In another preferred embodiment, the colon cancer cells comprise SW48 cells.

[0620] In another preferred embodiment, the colon cancer cells comprise MDA-MB-453 cells.

[0621] In another preferred embodiment, the breast cancer comprises triple-negative breast cancer.

[0622] In another preferred embodiment, the lymphoma is selected from B cell lymphoma, T cell lymphoma, or a combination thereof.

[0623] In another preferred embodiment, the lymphoma comprises diffuse large B-cell lymphoma.

[0624] In another preferred embodiment, the brain tumor is selected from glioblastoma, glioma, medulloblastoma, neuroblastoma, or a combination thereof.

[0625] In another preferred embodiment, the brain medulloblastoma comprises a cerebellar medulloblastoma.

[0626] In another preferred embodiment, the glioblastoma comprises glioblastoma multiforme.

[0627] In another preferred embodiment, the brain tumor comprises a medulloblastoma.

[0628] In another preferred embodiment, the brain tumor cells comprise one or more of GB-1 cells, SF126 cells, D341 Med cells, Kelly cells, and NB-1 cells.

[0629] In another preferred embodiment, the renal cancer is selected from renal clear cell adenocarcinoma, renal cancer Wilms, or a combination thereof.

[0630] In another preferred embodiment, the renal cancer comprises renal clear cell adenocarcinoma.

[0631] In another preferred embodiment, the renal cancer comprises Wilms renal cancer.

[0632] In another preferred embodiment, the renal cancer cancer cells comprise renal cancer Wilms cells.

[0633] In another preferred embodiment, the renal cancer cancer cells include one or more of G-401 cells and 786-O cells.

[0634] In another preferred embodiment, the pancreatic cancer comprises pancreatic ductal adenocarcinoma.

[0635] In another preferred embodiment, the pancreatic cancer cells comprise CFPAC-1 cells.

[0636] In another preferred embodiment, the leukemia is selected from T lymphocytic leukemia, myeloid leukemia, or a combination thereof.

[0637] In another preferred embodiment, the T lymphocytic leukemia comprises acute T lymphocytic leukemia.

[0638] In another preferred embodiment, the myeloid leukemia comprises M4 AML acute myeloid leukemia.

[0639] In another preferred embodiment, the myeloid leukemia comprises FAB M4 AML acute myeloid leukemia.

[0640] In another preferred embodiment, said expression comprises protein expression and / or mRNA expression.

[0641] In another preferred embodiment, the composition or formulation is a pharmaceutical composition or formulation.

[0642] In another preferred embodiment, the composition or formulation further comprises a pharma- ceutically acceptable carrier.

[0643] In another preferred embodiment, said expression is mRNA expression or protein expression.

[0644] In another preferred embodiment, the composition or formulation is in the form of a solid, liquid or semi-solid.

[0645] In another preferred embodiment, the composition or preparation is an oral preparation, an external preparation, or an injectable preparation.

[0646] In another preferred embodiment, the injectable formulation is an intravenous injection formulation.

[0647] In another preferred embodiment, the composition or preparation is in the form of a tablet, an injection, an infusion, an ointment, a gel, a solution, a pill, or a coating.

[0648] A fourth aspect of the present invention provides a marker for determining whether the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof is suitable for the prevention and / or treatment of tumor in a tumor patient, the marker comprising an expression level of NNMT gene, an expression level of DNA methyltransferase, an expression level of UHRF1, a methylation level of a nucleotide site of the NNMT gene, and / or a methylation level of a DNA CpG site in the NNMT gene region.

[0649] In another preferred embodiment, when the tumor cells of a tumor patient have low or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites of the NNMT gene, and / or hypermethylation of DNA CpG sites in the NNMT gene region, said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, becomes suitable for the prevention and / or treatment of tumors in said tumor patient.

[0650] In another preferred embodiment, high expression of NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, low methylation of nucleotide sites of NNMT gene, and / or low methylation of DNA CpG sites in NNMT gene region in tumor cells of a tumor patient renders said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, unsuitable for the prevention and / or treatment of tumors in said tumor patient.

[0651] In another preferred embodiment, the content that said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof is suitable for preventing and / or treating a tumor in said tumor patient means that tumor cells of the tumor patient are sensitive to said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0652] In another preferred embodiment, the content that said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof is not suitable for the prevention and / or treatment of tumors in said tumor patient means that tumor cells of the tumor patient are insensitive to said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0653] In another preferred embodiment, the tumor in which the NNMT gene is underexpressed or not expressed is a tumor according to the third aspect of the present invention.

[0654] In another preferred embodiment, the DNA methyltransferase is selected from DNMT1, DNMT3a, DNMT3b, or a combination thereof.

[0655] In another preferred embodiment, the tumor in which DNA methyltransferase (eg DNMT1) is highly expressed is a tumor according to the third aspect of the invention.

[0656] In another preferred embodiment, the tumor in which UHRF1 is highly expressed is a tumor according to the third aspect of the present invention.

[0657] In another preferred embodiment, said tumor in which the nucleotide site of the NNMT gene is hypermethylated is a tumor according to the third aspect of the invention.

[0658] In another preferred embodiment, the tumor in which the NNMT gene region DNA CpG site is hypermethylated is a tumor according to the third aspect of the present invention.

[0659] In another preferred embodiment, the tumor in which the NNMT gene is highly expressed refers to a tumor in which the ratio (E1 / E0) between the expression level E1 of the NNMT gene in a certain cell (e.g., a tumor cell) and the expression level E0 of the NNMT gene in a similar cell or a normal cell is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0660] In another preferred embodiment, the tumor with low expression of DNA methyltransferase refers to a tumor in which the ratio (A1 / A0) between the expression level A1 of DNA methyltransferase in tumor cells and the expression level A0 of DNA methyltransferase in related cells or normal cells is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0661] In another preferred embodiment, the tumor in which DNMT1 is underexpressed refers to a tumor in which the ratio (B1 / B0) between the expression level B1 of DNMT1 in tumor cells and the expression level B0 of DNMT1 in similar cells or normal cells is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0662] In another preferred embodiment, the tumor in which DNMT3a is underexpressed refers to a tumor in which the ratio (C1 / C0) between the expression level C1 of DNMT3a in tumor cells and the expression level C0 of DNA methyltransferase in related cells or normal cells is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0663] In another preferred embodiment, the tumor in which DNMT3b is underexpressed refers to a tumor in which the ratio (D1 / D0) between the expression level D1 of DNMT3b in tumor cells and the expression level D0 of DNA methyltransferase in similar cells or normal cells is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0664] In another preferred example, the tumor in which UHRF1 is underexpressed refers to a tumor in which the ratio (F1 / F0) between the expression level F1 of UHRF1 in tumor cells and the expression level F0 of UHRF1 in similar cells or normal cells is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0665] In another preferred embodiment, the tumor in which the nucleotide site of the NNMT gene is hypomethylated refers to a tumor in which the ratio (L1 / L0) between the methylation level L1 of the nucleotide site of the NNMT gene in a certain cell (e.g., a tumor cell) and the methylation level L0 of the nucleotide site of the NNMT gene in a similar cell or a normal cell (e.g., a cancerous bladder tissue cell) is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0666] In another preferred embodiment, the tumor in which the NNMT gene region DNA CpG site is hypomethylated refers to a tumor in which the ratio (W1 / W0) between the methylation level W1 of the NMT gene region DNA CpG site of a certain cell (e.g., a tumor cell) and the methylation level W0 of the NMT gene region DNA CpG site of the same cell or a normal cell (e.g., a cancerous bladder tissue cell) is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0667] A fifth aspect of the present invention provides a detection reagent kit, comprising: (i) A detection reagent is provided for detecting the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of a nucleotide site in the NNMT gene, and / or the methylation level of a DNA CpG site in the NNMT gene region.

[0668] In another preferred embodiment, the detection sample of the detection reagent kit includes tumor cells.

[0669] In another preferred embodiment, the level comprises a protein level and / or an mRNA level.

[0670] In another preferred embodiment, said expression comprises mRNA and / or protein expression.

[0671] A sixth aspect of the present invention provides the use of a detection reagent kit according to the fifth aspect of the present invention for the manufacture of a concomitant diagnostic kit for determining whether the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, is suitable for the prevention and / or treatment of tumors in tumor patients.

[0672] In another preferred embodiment, the companion detection reagent kit further comprises instructions or a label.

[0673] In another preferred embodiment, the instructions or label include: The present invention describes that when the tumor cells of a tumor patient have low or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation of nucleotide sites of the NNMT gene, and / or high methylation of DNA CpG sites in the NNMT gene region, the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, becomes suitable for the prevention and / or treatment of tumors in the tumor patient.

[0674] In another preferred embodiment, the instructions or label include: It is disclosed that when there is high expression of NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, low methylation of nucleotide sites of NNMT gene, and / or low methylation of DNA CpG sites in NNMT gene region in tumor cells of a tumor patient, said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof becomes unsuitable for the prevention and / or treatment of tumors in said tumor patient.

[0675] In another preferred embodiment, the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, being suitable for the prophylaxis and / or treatment of tumors in tumor patients, has the meaning according to the fourth aspect of the present invention.

[0676] In another preferred embodiment, the content that said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof is not suitable for the prophylaxis and / or treatment of tumors in said tumor patients has the meaning according to the fourth aspect of the present invention.

[0677] A seventh aspect of the invention provides a medical kit.

[0678] The medical kit comprises: (i) a detection reagent used to detect the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene, and / or the methylation level of the DNA CpG site in the NNMT gene region; (ii) the compound of formula I according to the first aspect of the invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0679] In another preferred embodiment, the above content of the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene and / or the methylation level of the DNA CpG site in the NNMT gene region means the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene and / or the methylation level of the DNA CpG site in the NNMT gene region in tumor cells.

[0680] In another preferred embodiment, the sample for detection comprises a tumor.

[0681] In another preferred embodiment, the medical kit further comprises instructions or a label.

[0682] In another preferred embodiment, the instructions or label include: The present invention describes that when the tumor cells of a tumor patient have low or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation of nucleotide sites of the NNMT gene, and / or high methylation of DNA CpG sites in the NNMT gene region, the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, becomes suitable for the prevention and / or treatment of tumors in the tumor patient.

[0683] In another preferred embodiment, the instructions or label include: It is disclosed that when there is high expression of NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, low methylation of nucleotide sites of NNMT gene, and / or low methylation of DNA CpG sites in NNMT gene region in tumor cells of a tumor patient, said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof becomes unsuitable for the prevention and / or treatment of tumors in said tumor patient.

[0684] An eighth aspect of the present invention provides a method for the prevention and / or treatment of tumors by administering to a subject to be treated said compound of formula I as defined in the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, to effect prevention and / or treatment of tumors.

[0685] In another preferred embodiment, the tumor is a tumor according to the third aspect of the invention.

[0686] In another preferred embodiment, the subject to be treated is a human or non-human mammal (eg, rodents, rabbits, monkeys, livestock, dogs, cats).

[0687] In another preferred embodiment, the method further comprises: First, the tumor to be treated is caused to have low or no expression of NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites of NNMT gene, and / or hypermethylation of DNA CpG sites in the NNMT gene region, and then the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof is administered to perform prophylaxis and / or treatment.

[0688] In another preferred embodiment, the method further comprises: First, an inhibitor of the NNMT gene, an enhancer of DNA methyltransferase, an enhancer of UHRF1, an enhancer of methylation of the nucleotide site of the NNMT gene and / or an enhancer of methylation of the DNA CpG site of the NNMT gene region is administered to the subject so that the tumor of the subject has low or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation of the nucleotide site of the NNMT gene and / or high methylation of the DNA CpG site of the NNMT gene region, and then the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof is administered to the subject for prevention and / or treatment.

[0689] In another preferred embodiment, the above-mentioned contents of an inhibitor of the NNMT gene, an enhancer of DNA methyltransferase, an enhancer of UHRF1, an enhancer of methylation of a nucleotide site of the NNMT gene and / or an enhancer of methylation of a DNA CpG site in the NNMT gene region have the meaning described in the fourth aspect of the present invention.

[0690] A ninth aspect of the present invention provides an apparatus or system.

[0691] The device or system includes: (i) a detection module used to detect the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene, and / or the methylation level of the DNA CpG site in the NNMT gene region; (ii) an output module.

[0692] The output module includes: information that, in tumor cells of a tumor patient, low or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites of the NNMT gene, and / or hypermethylation of DNA CpG sites in the NNMT gene region, said compound of formula I according to the first aspect of the invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, becomes suitable for the prevention and / or treatment of tumors in said tumor patient, and / or When there is high expression of NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, hypomethylation of nucleotide sites of NNMT gene, and / or hypomethylation of DNA CpG sites in NNMT gene region in tumor cells of a tumor patient, the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof becomes unsuitable for tumor prevention and / or treatment in the tumor patient.

[0693] In another preferred embodiment, the sample for detection comprises a tumor.

[0694] In another preferred embodiment, the device comprises a gene detector or a protein detector.

[0695] In another preferred embodiment, the device or system further comprises a sample delivery module.

[0696] In another preferred embodiment, the sample supply module is used to supply a tumor cell extract.

[0697] In another preferred embodiment, the device or system further comprises a data processing module.

[0698] In another preferred embodiment, the data processing module processes the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of a nucleotide site of the NNMT gene and / or the methylation level of a DNA CpG site in the NNMT gene region to obtain their numerical ranges.

[0699] In another preferred embodiment, the data processing module processes the expression level of the NNMT gene and / or the methylation level of DNA CpG sites in the NNMT gene promoter region to obtain their numerical ranges.

[0700] A tenth aspect of the present invention provides the use of an inhibitor of the NNMT gene, a promoter of DNA methyltransferase, a promoter of UHRF1, a promoter of methylation of a nucleotide site in the NNMT gene and / or a promoter of methylation of a DNA CpG site in the NNMT gene region to manufacture a composition or formulation for use in enhancing the antitumor effect of an antitumor drug.

[0701] In another preferred embodiment, said inhibitor of the NNMT gene comprises an inhibitor capable of under-expressing or not expressing the NNMT gene in tumors.

[0702] In another preferred embodiment, said promoter of DNA methyltransferase comprises a promoter capable of up-expressing DNA methyltransferase in tumors.

[0703] In another preferred embodiment, the DNA methyltransferase is selected from DNMT1, DNMT3a, DNMT3b, or a combination thereof.

[0704] In another preferred embodiment, said promoter of a DNA methyltransferase comprises a promoter of DNMT1.

[0705] In another preferred embodiment, said promoter of DNMT1 comprises a promoter capable of up-expressing DNMT1 in tumors.

[0706] In another preferred embodiment, said promoter of a DNA methyltransferase comprises a promoter of DNMT3a.

[0707] In another preferred embodiment, said promoter of DNMT3a comprises a promoter capable of high expression of DNMT3a in tumors.

[0708] In another preferred embodiment, said promoter of a DNA methyltransferase comprises a promoter of DNMT3b.

[0709] In another preferred embodiment, said promoter of DNMT3b comprises a promoter capable of up-expressing DNMT3b in tumors.

[0710] In another preferred embodiment, said promoter of UHRF1 comprises a promoter capable of high expression of UHRF1 in tumors.

[0711] In another preferred embodiment, said promoter of methylation of a nucleotide site in the NNMT gene comprises a promoter capable of hypermethylating a nucleotide site in the NNMT gene in a tumor.

[0712] In another preferred embodiment, said promoter of methylation of DNA CpG sites in the NNMT gene region comprises a promoter capable of hypermethylating DNA CpG sites in the NNMT gene region in tumors.

[0713] In another preferred embodiment, the inhibitor comprises an inhibitor having specificity.

[0714] In another preferred embodiment, the enhancer comprises an enhancer having specificity.

[0715] In another preferred embodiment, the antitumor medicament comprises the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0716] In another preferred embodiment, the tumor is a tumor according to the third aspect of the invention.

[0717] In another preferred embodiment, the composition or formulation is a pharmaceutical composition or formulation.

[0718] In another preferred embodiment, the composition or formulation further comprises a pharma- ceutically acceptable carrier.

[0719] In another preferred embodiment, the composition or formulation is in the form of a solid, liquid or semi-solid.

[0720] In another preferred embodiment, the composition or preparation is an oral preparation, an external preparation, or an injectable preparation.

[0721] In another preferred embodiment, the injectable formulation is an intravenous injection formulation.

[0722] In another preferred embodiment, the composition or preparation is in the form of a tablet, an injection, an infusion, an ointment, a gel, a solution, a pill, or a coating.

[0723] An eleventh aspect of the invention provides an active ingredient combination comprising: (1) a first active ingredient comprising an antitumor drug; and (2) a second active ingredient comprising an inhibitor of the NNMT gene, an enhancer of DNA methyltransferase, an enhancer of UHRF1, an enhancer of methylation of nucleotide sites in the NNMT gene and / or an enhancer of methylation of DNA CpG sites in the NNMT gene region.

[0724] In another preferred embodiment, the antitumor medicament comprises the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0725] In another preferred embodiment, the above-mentioned contents of an inhibitor of the NNMT gene, an enhancer of DNA methyltransferase, an enhancer of UHRF1, an enhancer of methylation of a nucleotide site of the NNMT gene and / or an enhancer of methylation of a DNA CpG site in the NNMT gene region have the meaning described in the tenth aspect of the present invention.

[0726] In another preferred embodiment, the molar ratio between the first active ingredient and the second active ingredient is 0.01-600:1, preferably 0.05-500:1, and more preferably 0.1-400:1, 0.2-200:1, 0.5-100:1, 0.5-80:1 or 1-50:1.

[0727] In another preferred embodiment, the combination of active ingredients comprises at least one independent active ingredient.

[0728] In another preferred embodiment, the combination of active ingredients includes a first active ingredient and a second active ingredient that are independent of each other.

[0729] A twelfth aspect of the present invention provides a composition comprising the following components: (1) a first active ingredient comprising an antitumor drug; and (2) a second active ingredient comprising an inhibitor of the NNMT gene, an enhancer of DNA methyltransferase, an enhancer of UHRF1, an enhancer of methylation of nucleotide sites in the NNMT gene and / or an enhancer of methylation of DNA CpG sites in the NNMT gene region.

[0730] In another preferred embodiment, the antitumor medicament comprises the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0731] In another preferred embodiment, the above-mentioned contents of an inhibitor of the NNMT gene, an enhancer of DNA methyltransferase, an enhancer of UHRF1, an enhancer of methylation of a nucleotide site of the NNMT gene and / or an enhancer of methylation of a DNA CpG site in the NNMT gene region have the meaning described in the tenth aspect of the present invention.

[0732] In another preferred embodiment, the composition is a pharmaceutical composition.

[0733] In another preferred embodiment, the pharmaceutical composition further comprises a pharma- ceutically acceptable carrier.

[0734] In another preferred embodiment, the content of said first active ingredient relative to the total weight of active ingredients of the composition is 0.01-99.99 wt%, preferably 0.1-99.9 wt%, and more preferably 1-99 wt%, 10-99 wt% or 20-99 wt%.

[0735] In another preferred embodiment, the content of said second active ingredient relative to the total weight of active ingredients of the composition is 0.01-99.99 wt%, preferably 0.1-99.9 wt%, and more preferably 1-99 wt%, 10-99 wt% or 20-99 wt%.

[0736] A thirteenth aspect of the invention provides a medical kit comprising the following formulation: (A) a first formulation having a first active ingredient comprising an antitumor drug; and (B) A second formulation having a second active ingredient comprising an inhibitor of the NNMT gene, an enhancer of DNA methyltransferase, an enhancer of UHRF1, an enhancer of methylation of nucleotide sites in the NNMT gene and / or an enhancer of methylation of DNA CpG sites in the NNMT gene region.

[0737] In another preferred embodiment, the antitumor medicament comprises the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0738] In another preferred embodiment, the above-mentioned contents of an inhibitor of the NNMT gene, an enhancer of DNA methyltransferase, an enhancer of UHRF1, an enhancer of methylation of a nucleotide site of the NNMT gene and / or an enhancer of methylation of a DNA CpG site in the NNMT gene region have the meaning described in the tenth aspect of the present invention.

[0739] In another preferred embodiment, the medical kit further comprises an instruction manual.

[0740] In another preferred embodiment, the first formulation and the second formulation are independent of each other.

[0741] In another preferred embodiment, the first and second formulations are combined.

[0742] In another preferred embodiment, the instructions include instructions to use the first formulation in combination with the second formulation to enhance the antitumor activity of the antitumor drug.

[0743] In another preferred embodiment, the combination method comprises first administering a second active ingredient comprising an inhibitor of the NNMT gene, an promoter of DNA methyltransferase, an promoter of UHRF1, an promoter of methylation of a nucleotide site in the NNMT gene and / or an promoter of methylation of a DNA CpG site in the NNMT gene region, and then administering an anti-tumor drug.

[0744] A fourteenth aspect of the invention provides a method for inhibiting tumour cells, said method comprising contacting tumour cells with said compound of formula I according to the first aspect of the invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, to inhibit said tumour cells.

[0745] In another preferred embodiment, the method is performed in vitro or is an in vitro method.

[0746] In another preferred embodiment, the method is an in vitro, non-therapeutic, non-diagnostic method.

[0747] In another preferred embodiment, the contacting is performed in an in vitro culture.

[0748] In another preferred embodiment, the tumor is a tumor according to the third aspect of the invention.

[0749] In another preferred embodiment, the method further comprises: The method comprises first causing tumor cells to have low or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites in the NNMT gene, and / or hypermethylation of DNA CpG sites in the NNMT gene region, and then contacting the tumor cells with the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, thereby inhibiting the tumor cells.

[0750] In another preferred embodiment, the method further comprises: First, an inhibitor of the NNMT gene, an promoter of DNA methyltransferase, an promoter of UHRF1, an promoter of methylation at a nucleotide site of the NNMT gene, and / or an promoter of methylation at a DNA CpG site of the NNMT gene region is administered to the tumor cells so that the tumor cells have low or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation of the nucleotide site of the NNMT gene, and / or high methylation of the DNA CpG site of the NNMT gene region, and then the tumor cells are contacted with the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, thereby inhibiting the tumor cells.

[0751] In another preferred embodiment, the above-mentioned contents of an inhibitor of the NNMT gene, an enhancer of DNA methyltransferase, an enhancer of UHRF1, an enhancer of methylation of a nucleotide site of the NNMT gene and / or an enhancer of methylation of a DNA CpG site in the NNMT gene region have the meaning described in the tenth aspect of the present invention.

[0752] A fifteenth aspect of the present invention provides the use of the medical kit according to the seventh aspect of the present invention for the manufacture of a pharmaceutical kit for use in the prevention and / or treatment of tumors.

[0753] In another preferred embodiment, the pharmaceutical kit further comprises instructions or a label.

[0754] In another preferred embodiment, the instructions or label include: The present invention describes that when the tumor cells of a tumor patient have low or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation of nucleotide sites of the NNMT gene, and / or high methylation of DNA CpG sites in the NNMT gene region, the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, becomes suitable for the prevention and / or treatment of tumors in the tumor patient.

[0755] In another preferred embodiment, the instructions or label include: It is disclosed that when there is high expression of NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, low methylation of nucleotide sites of NNMT gene, and / or low methylation of DNA CpG sites in NNMT gene region in tumor cells of a tumor patient, said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof becomes unsuitable for the prevention and / or treatment of tumors in said tumor patient.

[0756] Within the scope of the present invention, each of the above technical features of the present invention may be combined with the following specific technical features to form new or preferred technical solutions, which will not be repeated here due to the limited size of the full text. [Brief description of the drawings]

[0757]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

[0758] As a result of long-term and in-depth research, the present inventors have unexpectedly found for the first time a compound with a significantly excellent therapeutic effect on tumor cells with low or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation of the nucleotide site of the NNMT gene, and / or high methylation of the DNA CpG site in the NNMT gene region. The expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene, and / or the methylation level of the DNA CpG site in the NNMT gene promoter region serve as markers for determining whether the compound of the present invention is suitable for tumor prevention and / or treatment in tumor patients. The present inventors have achieved the present invention based on this.

[0759] term Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0760] As used herein, the terms "including," "comprising," and "having" may be used interchangeably and have closed definitions as well as semi-closed and open definitions. In other words, the terms have the meaning "consisting of" or "consisting essentially of."

[0761] As used herein, the terms "anti-cancer drug" and "anti-tumor drug" may be used interchangeably.

[0762] As used herein, the terms "cancer" and "tumor" may be used interchangeably.

[0763] As used herein, "there is hypermethylation of a DNA CpG site", "hypermethylating a DNA CpG site", and "a DNA CpG site is hypermethylated" may be used interchangeably.

[0764] As used herein, "there is hypomethylation of a DNA CpG site", "to hypomethylate a DNA CpG site", and "a DNA CpG site is hypomethylated" may be used interchangeably.

[0765] As used herein, "there is hypermethylation at a nucleotide site", "hypermethylating a nucleotide site", and "a nucleotide site is hypermethylated" may be used interchangeably.

[0766] As used herein, "there is hypomethylation at a nucleotide site," "hypomethylate a nucleotide site," and "the nucleotide site is hypomethylated" may be used interchangeably.

[0767] As used herein, "IC50" and "IC 50 The term "50% inhibiting concentration" may be used interchangeably and refers to the concentration of an inhibitor at which 50% of the inhibitory effect is achieved.

[0768] As used herein, "methylation of DNA CpG sites," "methylation of CpG nucleotides," and "CpG methylation" may be used interchangeably.

[0769] As used herein, the term "P / S" refers to the addition of Penicillin and Streptomycin to the relevant media.

[0770] As used herein, the term "a cell" refers to a cell (e.g., a single tumor cell) or a group of cells including multiple similar cells (e.g., a tumor tissue).

[0771] As used herein, "the compound of the present invention is suitable for a tumor patient" means that the tumor of the tumor patient is sensitive to the compound of the present invention, and so on.

[0772] As used herein, "the compounds of the present invention are not suitable for tumor patients" means that the tumors of the tumor patients are insensitive to the compounds of the present invention, and the like.

[0773] As used herein, "the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene, and / or the methylation level of the DNA CpG site in the NNMT gene region" refers to one or more of the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene, and the methylation level of the DNA CpG site in the NNMT gene region.

[0774] As used herein, "low or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites in the NNMT gene, and / or hypermethylation of DNA CpG sites in the NNMT gene region" refers to one or more of low or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites in the NNMT gene, and hypermethylation of DNA CpG sites in the NNMT gene region.

[0775] As used herein, "high expression of the NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, hypomethylation of nucleotide sites in the NNMT gene, and / or hypomethylation of DNA CpG sites in the NNMT gene region" refers to one or more of high expression of the NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, hypomethylation of nucleotide sites in the NNMT gene, and hypomethylation of DNA CpG sites in the NNMT gene region.

[0776] As used herein, the English name of the term "NNMT" is Nicotinamide N-Methyltransferase.

[0777] As used herein, the term "bp" refers to base pair.

[0778] As used herein, the term "SST" refers to the transcription start site.

[0779] As used herein, the term "Chr11" refers to human chromosome 11 defined according to the human genome version GCF_000001405.25 (GRCh37.p13).

[0780] As used herein, the term "human chromosome 11" refers to human chromosome 11 defined according to the human genome version GCF_000001405.25 (GRCh37.p13).

[0781] As used herein, the terms "before the transcription start site" and "after the transcription start site" do not include the transcription start site itself.

[0782] As used herein, "position 114165695 of human chromosome 11" refers to the nucleotide at position 114165695 of human chromosome 11; "position 114165730 of human chromosome 11" refers to the nucleotide at position 114165730 of human chromosome 11; "position 114165769 of human chromosome 11" refers to the nucleotide at position 114165769 of human chromosome 11; "position 114165804 of human chromosome 11" refers to the nucleotide at position 114165804 on human chromosome 11; "position 114165938 on human chromosome 11" refers to the nucleotide at position 114165938 on human chromosome 11; "position 114166050 on human chromosome 11" refers to the nucleotide at position 114166050 on human chromosome 11; and "position 114166066 on human chromosome 11" refers to the nucleotide at position 114166066 on human chromosome 11.

[0783] As used herein, gene expression includes protein expression of the gene and / or mRNA expression of the gene, and the like.

[0784] As used herein, the term "DNMT3a" refers to DNA methyltransferase 3a, which may be used interchangeably with "DNMT3A."

[0785] As used herein, the term "DNMT3b" refers to DNA methyltransferase 3b, which may be used interchangeably with "DNMT3B."

[0786] As used herein, the term "DNMT1" refers to DNA methyltransferase 1.

[0787] As used herein, the term "UHRF1" refers to ubiquitin-related tau protein 1 that contains a PHD and a RING finger domain.

[0788] As used herein, the term "MS-ESI" refers to Electro Spray Ionization-Mass Spectroscopy.

[0789] As used herein, "1H NMR" and " 1 The term “H NMR” may be used interchangeably and refers to nuclear magnetic resonance hydrogen spectroscopy.

[0790] It should be understood that one skilled in the art can prepare chemically stable compounds by selecting the substituents and substitution patterns on the compounds of the present invention, and can synthesize said compounds using techniques known in the art and the methods described below. When substituted with one or more (multiple) substituents, it should be understood that these substituents can be located on the same carbon or on different carbons, as long as a stable structure is produced.

[0791] As used herein, the terms "substitution" or "substituted" refer to the replacement of hydrogen atoms on a group with non-hydrogen atom groups as necessary to satisfy their valences and which produce chemically stable compounds, i.e., compounds that do not spontaneously undergo transformations such as cyclization or elimination.

[0792] As used herein, "deuteration" refers to the replacement of one or more hydrogen atoms in a compound or group of atoms with a deuterium atom. Deuteration can be 1-deuteration, 2-deuteration, 3-deuteration or full deuteration.

[0793] As used herein, the term "solvate" refers to a complex formed when a compound coordinates with solvent molecules in a specific ratio.

[0794] As used herein, "R1 ", "R1" and "R 1 " have the same meaning, may be used interchangeably, and have the same meaning as other similar definitions.

[0795] As used herein, [ka]

[0796] As used herein, the term "alkyl group" refers to a straight-chain (i.e., unbranched) or branched saturated hydrocarbon group containing only carbon and hydrogen atoms, or a group of atoms that combines straight and branched chains. A carbon number specified before the alkyl group (e.g., C1-C6 alkyl group) refers to the alkyl group having the specified number of carbon atoms (e.g., 1 to 6), for example, C1-C4 alkyl group refers to an alkyl group containing 1 to 4 carbon atoms. Representative examples of these alkyl groups include, but are not limited to, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, s-butyl, t-butyl, or similar groups.

[0797] As used herein, the term "alkylidene group" refers to an atomic group formed by removing one hydrogen atom from an alkyl group. The alkyl group is as defined above. An alkylidene group specified by the number of carbon atoms (e.g., a C1-C6 alkylidene group) refers to an alkylidene group having the specified number of carbon atoms (e.g., 1 to 6), for example, a C1-C4 alkylidene group refers to an alkylidene group containing 1 to 4 carbon atoms. Representative examples of these alkylidene groups include, but are not limited to, a methylidene group, an ethylidene group, a propylidene group, an isopropylidene group, a butylidene group, an isobutylidene group, an s-butylidene group, a t-butylidene group, or similar atomic groups.

[0798] As used herein, the term "alkenyl group" refers to a hydrocarbyl group formed by removing one hydrogen atom connected to a double bond from a straight or branched chain molecule having one or more double bonds. The alkenyl group specified by the number of carbon atoms before the alkenyl group (e.g., C2-C6 alkenyl group) refers to the alkenyl group having the specified number of carbon atoms (e.g., 1 to 6), for example, C2-C4 alkenyl group refers to an alkenyl group containing 2 to 4 carbon atoms. Representative examples of these alkenyl groups include vinyl groups (CH 2 =CH-), butenyl group (C(CH 3 ) 2 ═CH—) or similar atomic groups, but are not limited to these.

[0799] As used herein, the term "halogen atom" refers to a fluorine atom, chlorine atom, bromine atom, or iodine atom.

[0800] As used herein, the term "halogenated" refers to substitution with a halogen atom.

[0801] As used herein, the term "halogenated alkyl group" refers to an atomic group formed by replacing one or more (preferably one, two, three or four) hydrogen atoms of an alkyl group with halogen atoms. The alkyl group and halogen atom are as defined above. A halogenated alkyl group specified by the number of carbon atoms (e.g., C1-C8 halogenated alkyl group) refers to a halogenated alkyl group having the specified number of carbon atoms (e.g., 1 to 8), for example, a C1-C6 halogenated alkyl group refers to a halogenated alkyl group containing 1 to 6 carbon atoms. Representative examples of these halogenated alkyl groups include -CF 3 , -CHF 2 , monofluorinated isopropyl group, difluorinated butyl group or similar atomic groups.

[0802] As used herein, the term "cycloalkyl group" refers to a saturated or partially saturated monocyclic, bicyclic or polycyclic (fused, bridged or spiro) ring group. A carbon number specified before the cycloalkyl group (e.g., C3-C12) refers to the cycloalkyl group having the specified number of ring carbon atoms (e.g., 3 to 12). For example, the term "C3-C8 cycloalkyl group" refers to a saturated or partially saturated monocycloalkyl or dicycloalkyl group having 3 to 8 ring carbon atoms, including cyclopropyl, cyclobutyl, cycloamyl, cycloheptyl or similar groups. A "spirocycloalkyl group" refers to a bicyclic or polycyclic group sharing a carbon atom (called a spiro atom) between the monocyclic rings, which may contain one or more double bonds, but in which none of the rings have a completely conjugated pi-electron system. "Fused cycloalkyl group" refers to a bicyclic or polycyclic group of all carbon atoms in which each ring in the system shares an adjacent pair of carbon atoms with another ring in the system, where one or more of the rings may contain one or more double bonds, but neither ring has a complete conjugated pi-electron system. "Bridged cycloalkyl group" refers to a polycyclic group of all carbon atoms in which any two rings share two carbon atoms that are not directly connected, where such group may contain one or more double bonds, but neither ring has a complete conjugated pi-electron system. Representative examples of these cycloalkyl groups are: [ka]

[0803] As used herein, the term "halogenated cycloalkyl group" refers to an atomic group formed by replacing one or more (preferably one, two, three or four) hydrogen atoms of a cycloalkyl group with a halogen atom. The cycloalkyl group and the halogen atom are as defined above. A cycloalkyl group limited by the number of carbon atoms (e.g., C3-C8 halogenated cycloalkyl group) refers to a cycloalkyl group having the corresponding number of ring carbon atoms (e.g., 3 to 8), for example, a C3-C8 halogenated cycloalkyl group refers to a halogenated cycloalkyl group containing 3 to 8 ring carbon atoms. Representative examples of these halogenated cycloalkyl groups include, but are not limited to, a monofluorinated cyclopropyl group, a monochlorinated cyclobutyl group, a monofluorinated cycloamyl group, a difluorinated cycloheptyl group or similar atomic groups.

[0804] As used herein, the term "alkoxyl group" refers to an R-O-atom group, where R is an alkyl group. Alkyl groups are as defined above. An alkoxyl group that is specified by the number of carbon atoms before the alkoxyl group (e.g., a C1-C8 alkoxyl group) refers to an alkoxyl group in which the alkyl group has the specified number of carbon atoms (e.g., 1 to 8). Representative examples of these alkoxyl groups include, but are not limited to, methoxy, ethoxy, N-propoxy, isopropoxy, t-butoxy, or similar groups.

[0805] As used herein, the term "alkylthiol group" refers to an R-S group, where R is an alkyl group. The alkyl group is as defined above. An alkylthiol group that is specified by the number of carbon atoms before the alkylthiol group (e.g., a C1-C8 alkoxyl group) refers to an alkyl group in the alkylthiol group that has the specified number of carbon atoms (e.g., 1 to 8). Representative examples of these alkylthiol groups include, but are not limited to, a methylthio group, an ethylthio group, an N-propylthio group, an isopropylthio group, a t-butylthio group, or a similar group.

[0806] As used herein, the term "halogenated alkoxyl group" refers to a halogenated alkyl group -O-, the halogenated alkyl group being as defined above. For example, a C1-C6 halogenated alkoxyl group refers to a halogenated alkoxyl group having 1 to 6 carbon atoms. Representative examples of these halogenated alkoxyl groups include, but are not limited to, a monofluorinated methoxy group, a monofluorinated ethoxy group, a difluorinated butoxy group, or similar atomic groups.

[0807] As used herein, the term "halogenated alkylthiol group" refers to a halogenated alkyl group -S-. The halogenated alkyl group is as defined above. For example, a C1-C6 halogenated alkylthiol group refers to a halogenated alkylthiol group having 1 to 6 carbon atoms. Representative examples of these halogenated alkylthiol groups include, but are not limited to, a monofluorinated methylthio group, a monofluorinated ethylthio group, a difluorinated butylthio group, or a similar atomic group.

[0808] As used herein, the term "cycloalkoxyl group" refers to an R-O-atom group, where R is a cycloalkyl group. Cycloalkyl groups are as defined above. A cycloalkoxyl group that is specified by the number of carbon atoms before the cycloalkoxyl group (e.g., a C3-C8 cycloalkoxyl group) refers to a cycloalkyl group in the cycloalkoxyl group that has the specified number of carbon atoms (e.g., 3 to 8). Representative examples of these cycloalkoxyl groups include, but are not limited to, a cyclopropoxy group, a cyclobutoxy group, or similar groups.

[0809] As used herein, the term "cycloalkylthiol group" refers to an R-S-atom group, where R is a cycloalkyl group. Cycloalkyl groups are as defined above. A cycloalkylthiol group that is specified by the number of carbon atoms before the cycloalkylthiol group (e.g., a C3-C8 cycloalkoxyl group) refers to a cycloalkyl group in the cycloalkylthiol group that has the specified number of carbon atoms (e.g., 3 to 8). Representative examples of these cycloalkylthiol groups include, but are not limited to, a cyclopropylthio group, a cyclobutylthiol group, or similar atomic groups.

[0810] As used herein, the term "halogenated cycloalkoxyl group" refers to an atomic group formed by replacing one or more (preferably one, two, three or four) hydrogen atoms of a cycloalkoxyl group with a halogen atom. The cycloalkoxyl group and the halogen atom are as defined above. A halogenated cycloalkoxyl group limited by the number of carbon atoms (e.g., a C3-C8 halogenated cycloalkoxyl group) refers to a halogenated cycloalkoxyl group having the specified number of ring carbon atoms (e.g., 3 to 8), for example, a C3-C8 halogenated cycloalkoxyl group refers to a halogenated cycloalkoxyl group containing 3 to 8 ring carbon atoms. Representative examples of these halogenated cycloalkoxyl groups include, but are not limited to, a monofluorinated cyclopropyl group -O-, a monochlorinated cyclobutyl group -O-, a monofluorinated cycloamyl group -O-, a difluorinated cycloheptyl group -O-, or similar atomic groups.

[0811] As used herein, the term "halogenated cycloalkylthiol group" refers to an atomic group formed by replacing one or more (preferably one, two, three or four) hydrogen atoms of a cycloalkylthiol group with a halogen atom. The cycloalkylthiol group and the halogen atom are as defined above. A halogenated cycloalkylthiol group limited by the number of carbon atoms (e.g., a C3-C8 halogenated cycloalkoxyl group) refers to a halogenated cycloalkylthiol group having the corresponding number of ring carbon atoms (e.g., 3 to 8), for example, a C3-C8 halogenated cycloalkylthiol group refers to a halogenated cycloalkylthiol group containing 3 to 8 ring carbon atoms. Representative examples of these halogenated cycloalkylthiol groups include, but are not limited to, a monofluorinated cyclopropyl group -S-, a monochlorinated cyclobutyl group -S-, a monofluorinated cycloamyl group -S-, a difluorinated cycloheptyl group -S- or similar atomic groups.

[0812] As used herein, the term "heterocycloalkyl ring" refers to a fully saturated or partially unsaturated ring (including, but not limited to, a 3- to 7-membered monocyclic ring, a 7- to 11-membered bicyclic ring, or an 8- to 16-membered tricyclic ring) in which at least one heteroatom is present in a ring having at least one carbon atom. The number of members preceding the heterocycle refers to the number of ring atoms in the heterocycloalkyl ring. For example, a 3- to 16-membered heterocycle refers to a heterocycle having 3 to 16 ring atoms. Each heterocycle having a heteroatom may have one or more (e.g., 1, 2, 3, or 4) heteroatoms, each of which is independently selected from a nitrogen atom, an oxygen atom, or a sulfur atom, where the nitrogen atom or sulfur atom may be oxidized, and the nitrogen atom may also be quaternized. Representative examples of these monocyclic heterocycloalkyl rings include, but are not limited to, an azetidinyl ring, an oxetane ring, a tetrahydrofuranyl ring, a piperidine ring, and a piperazine ring. Multicyclic heterocycloalkyl rings include piperazine rings having spiro, fused and bridged rings, where the associated spiro, fused and bridged heterocycles are optionally connected to other rings by single bonds or are further fused to other cycloalkyl and heterocycles through any two or more atoms on the ring.

[0813] As used herein, the term "heterocycloalkyl group" refers to a fully saturated or partially unsaturated cyclic group (including, but not limited to, a series of 3- to 7-membered monocyclic, 7- to 11-membered bicyclic, 8- to 16-membered tricyclic, etc.) in which at least one heteroatom is present in a ring having at least one carbon atom. The number of members in front of the heterocycloalkyl group refers to the number of ring atoms in the heterocycloalkyl group. For example, a 3- to 16-membered heterocycloalkyl group refers to a heterocycloalkyl group having 3 to 16 ring atoms. Each heterocycle having a heteroatom may have one or more (e.g., 1, 2, 3, or 4) heteroatoms, each of which is independently selected from a nitrogen atom, an oxygen atom, or a sulfur atom, where the nitrogen atom or sulfur atom may be oxidized and the nitrogen atom may be quaternized. Representative examples of these monocyclic heterocycloalkyl groups include, but are not limited to, an azetidinyl group, an oxetane group, a tetrahydrofuranyl group, a piperidine group, a piperazine group, etc. Polycyclic heterocycloalkyl groups include spirocyclic, fused-ring, and bridged-ring heterocyclic groups. Related spirocyclic, fused-ring, and bridged-ring heterocycloalkyl groups are optionally connected to other atomic groups through a single bond or are further fused to other cycloalkyl rings and heterocycles through any two or more atoms on the ring.

[0814] As used herein, the term "aryl group" refers to an all-carbon atom monocyclic or fused polycyclic (rings sharing adjacent pairs of carbon atoms) atomic group having a conjugated π-electron system, which is an atomic group of an aromatic cyclic hydrocarbon compound. The aryl group specified by the number of carbon atoms before the aryl group (e.g., C6-C12 aryl group) refers to the aryl group having the specified number of ring carbon atoms (e.g., 6 to 12). Representative examples of these aryl groups include phenyl and naphthoyl groups.

[0815] As used herein, the term "heteroaryl group" refers to an aromatic heterocyclic group having one or more (preferably one, two, three or four) heteroatoms. The group may be a single ring (monocyclic) or multiple rings (bicyclic, tricyclic or polycyclic) that are fused or covalently bonded, and each heterocyclic ring that includes a heteroatom may have one or more (e.g., one, two, three or four) heteroatoms independently selected from oxygen, sulfur and nitrogen atoms. The number of members in the heteroaryl group refers to the number of ring atoms in the heteroaryl group. For example, a 5-12 membered heteroaryl group refers to a heteroaryl group having 5 to 12 ring atoms. Representative examples of these heteroaryl groups include, but are not limited to, pyrrolyl, pyrazole, imidazole, thiazole, furan, pyridine, pyrimidine, and the like.

[0816] As used herein, the term "carboxyl group" refers to a group of atoms of the formula -COOH or -alkyl-COOH, where alkyl is as defined above. For example, "C 2 -C 4 Carboxyl group is -C 1 -C 3 The alkyl group refers to a group of atoms of -COOH. Representative examples of these carboxyl groups are -COOH, -CH 2 This includes, but is not limited to, COOH or similar groups.

[0817] As used herein, the term "ester group" refers to a group of atoms of the formula RC(O)-O- or -C(O)-OR, where the alkyl group (R) is as defined above. For example, 2 -C 4 The ester group is -C 1 -C 3 Alkyl group -C(O)-O- or -C(O)-OC 1 -C 3 It refers to the group of alkyl groups. Representative examples of these ester groups are CH 3 C(O)O-, C 2 H 5 C(O)O-, (CH3 ) 2 CHC(O)O-, -C(O)OCH 3 , -C(O)OC 2 H 5 or similar atomic groups, but are not limited to these.

[0818] As used herein, the term "acylamino group" refers to the radical RC(O)-N- or -C(O)-NR, where the alkyl group (R) is as defined above. For example, 2 -C 4 Acylamino group is -C 1 -C 3 Alkyl group -C(O)-N- or -C(O)-NC 1 -C 3 Refers to the group of alkyl groups. A representative example of these acylamino groups is CH 3 C(O)-N-, C 2 H 5 C(O)-N-, (CH 3 ) 2 CHC(O)-N-, -C(O)-N-CH 3 , -C(O)-NC 2 H 5 or similar atomic groups, but are not limited to these.

[0819] As used herein, the term "acyl group" means [ka] Here, R represents an alkyl group, and the alkyl group is as defined above. The acyl group is limited by the number of carbon atoms (e.g., a C2-C6 acyl group) means that the acyl group has the specified number (e.g., 2 to 6) of ring carbon atoms. For example, a C2-C4 acyl group is a C 1 -C 3 The alkyl group refers to an atomic group having the structure -C(O)-. Representative examples of these acyl groups are CH 3 C(O)-, C 2 H 5 This includes, but is not limited to, C(O)- or similar groups.

[0820] As used herein, "-C(O)-" [ka]

[0821] As used herein, an "amino group" alone or as part of another substituent means -NH 2 Represents.

[0822] As used herein, a "nitro group" alone or as part of another substituent means --NO 2 Represents.

[0823] As used herein, a "cyan group" alone or as part of another substituent refers to -CN.

[0824] As used herein, a "hydroxyl group" alone or as part of another substituent refers to --OH.

[0825] As used herein, a "mercapto group" alone or as part of another substituent refers to -SH.

[0826] As used herein, "(R 20 R 21 )N-" [ka] May be used interchangeably.

[0827] As used herein, "R 3 and R 4 , or R 4 and R 5 are linked to form a substituted or unsubstituted 3- to 12-membered heterocycloalkyl ring" is R 3 and R 4 are joined to form a substituted or unsubstituted 3- to 12-membered heterocycloalkyl ring, or R 4 and R 5are bonded to form a substituted or unsubstituted 3- to 12-membered heterocycloalkyl ring.

[0828] In this specification, all substituents are meant to be unsubstituted unless expressly stated as "substituted". The term "substituted" refers to a substituent replacing one or more hydrogen atoms on an atomic group. The substituents are the substituents described above or appearing in each Example. Preferably, the "substitution" refers to one or more (preferably 1, 2, 3, 4, 5, 6, 7 or 8) hydrogen atoms on a ring or atomic group being replaced by a C1-C10 halogenated alkyl group, a C3-C8 halogenated cycloalkyl group, a C3-C8 cycloalkoxyl group, a C3-C8 cycloalkylthiol group, a C3-C8 halogenated cycloalkoxyl group, a C3-C8 halogenated cycloalkylthiol group, a halogen atom, a nitro group, -CN, a carbonyl group (=O), a hydroxyl group, ... A silyl group, a mercapto group, an amino group, a C1-C4 carboxyl group, a C2-C8 ester group, a C2-C4 acylamino group, a C2-C6 acyl group, a C1-C10 alkoxyl group, a C1-C10 alkylthiol group, a C1-C10 halogenated alkoxyl group, a C1-C10 halogenated alkylthiol group, a C6-C12 aryl group, a C6-C12 aryl group-O-, a 5-10 membered heteroaryl group, a 5-10 membered heteroaryl group-O-, a 5-10 membered heterocycloalkyl group, and (R 20 R 21 )N-.

[0829] In the present invention, "prevention" refers to a method of preventing the onset of a disease and / or its associated symptoms or protecting a subject from contracting the disease. As used herein, "prevention" also refers to delaying the onset of a disease and / or its associated symptoms, as well as reducing the subject's risk of contracting the disease.

[0830] "Treatment" according to the present invention means slowing and terminating the progression of a disease or eliminating the disease, but does not require 100% inhibition, elimination or reversal. In some embodiments, the associated disease (e.g., tumor) and its complications are reduced, inhibited and / or reversed by at least about 10%, 30%, 50%, 80%, 90%, or 100%, etc., under the action of the compounds of the present invention, compared to levels observed in the absence of the compounds of the present invention.

[0831] compound As used herein, "a compound of the present invention", "said compound of the present invention", "a compound of formula I of the present invention" or "a compound of formula I" may be used interchangeably and refer to a compound having the chemical structure of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof. This term should be understood to include mixtures of the above components. [ka]

[0832] In particular, the compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, is described in the first aspect of the invention.

[0833] In the present invention, the compound of formula I can be racemic, R or S. The racemic, R or S structure of the compound of the present invention and the knowledge of how to determine it are well known to those skilled in the art, for example, the racemic, R or S structure are as follows: [ka]

[0834] Other compounds may be in racemic, R or S configuration, among many others.

[0835] Typically, the compounds of formula I of the present invention are the specific compounds prepared in the examples of the present invention (including their salt forms or in the free form after removal of the salt radical).

[0836] The compounds of formula I of the present invention may be prepared by organic synthesis methods known in the art.

[0837] In the present invention, the term "pharmaceutical acceptable salt" refers to a salt formed by the compound of the present invention and an acid or base, which is suitable for use as a drug. Pharmaceutically acceptable salts include inorganic salts and organic salts. A preferred type of salt is a salt formed by the compound of the present invention and an acid, and the acid suitable for forming the salt includes, but is not limited to, inorganic acids such as hydrochloric acid, hydrobromic acid, hydrofluoric acid, sulfuric acid, nitric acid, phosphoric acid, etc., organic acids such as formic acid, acetic acid, trifluoroacetic acid, trifluoroformic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, benzenesulfonic acid, etc., and acidic amino acids such as aspartic acid and glutamic acid. One type of preferred salt is a metal salt formed by a compound of the present invention and a base, and bases suitable for forming such salts include, but are not limited to, inorganic bases such as sodium hydroxide, potassium hydroxide, sodium carbonate, sodium bicarbonate, sodium phosphate, and organic bases such as ammonia, triethylamine, diethylamine, and the like.

[0838] The present invention may convert the above compounds of formula I into their pharma- ceutically acceptable salts in a conventional manner, for example, by adding a solution of a suitable acid to a solution of the above compounds, and removing the solvent after complete salification, the corresponding salts of the compounds of the present invention can be obtained.

[0839] Preferably, said compounds of formula I of the present invention are those prepared in the examples of the present invention.

[0840] NNMT gene In the present invention, the English name of NNMT is Nicotinamide N-Methyltransferase. Different databases have different identification numbers for NNMT gene, such as HGNC:7861; Entrez Gene:4837; Ensembl:ENSG00000166741; OMIM:600008; UniProtKB:P40261.

[0841] According to the human genome version GCF_000001405.25 (GRCh37.p13), the NNMT gene region is located from bp 114,128,528 to bp 114,184,258 on human chromosome 11, and is a DNA sequence with a total length of 55,731 bp. This region includes the NNMT gene promoter region, the NNMT gene exon region and the NNMT gene intron region, and the NNMT gene transcription start site is at bp 114,166,535.

[0842] The NNMT gene promoter region is the nucleotide sequence from bp 114,164,535 to bp 114,167,034 on human chromosome 11, i.e., the sequence from 2000 bp (bold) before the transcription start site of the NNMT gene to the transcription start site itself and 499 bp (underlined) after it. The NNMT gene promoter region has a total length of 2500 bp, and its nucleotide sequence is shown in the following SEQ ID NO:1.

[0843] SEQ ID NO: 1: GAGGAGGTGCTTGCCAGACACTGGGTCATGGCAGTGGTCGGTGAAGCTGCAGTTGCCTAGGGCAGGGATGGAGAGAGAGTCTGGGCATGAGGAGAGGGTCTCGGGATGTTTGGCTGGACTAGATTTTACAGAAAGCCTTATCCAGGCTTTTAAAATTACTCTTTCCAGACTTCATCTGAGACTCCTTCTTCAGCCAACATTCCTTAGCCCTGAATACATTTCCTATCCTCATCTTTCCCTTCTTTTTTTTCCTTTCTTTTACATGTTTAAATTTAAACCATTCTTCGTGACCCCTTTTCTTGGGAGATTCATGGCAAGAACGAGAAGAATGATGGTGCTTGTTAGGGGATGTCCTGTCTCTCTGAACTTTGGGGTCCTATGCATTAAATAATTTTCCTGACGAGCTCAAGTGCTCCCTCTGGTCTACAATCCCTGGCGGCTGGCCTTCATCCCTTGGGCAAGCATTGCATACAGCTCATGGCCCTCCCTCTACCATACCC .

[0844] In the present invention, the region from 1050 bp before the transcription start site of the NNMT gene to 499 bp after the transcription start site is positions 951-2500 of the nucleotide sequence shown in SEQ ID NO:1.

[0845] In the present invention, the region from 1050 bp before the transcription start site of the NNMT gene to 193 bp before the transcription start site is positions 951-1808 of the nucleotide sequence shown in SEQ ID NO:1.

[0846] In the present invention, the region from 840 bp before the transcription start site of the NNMT gene to 469 bp before the transcription start site is positions 1161-1532 of the nucleotide sequence shown in SEQ ID NO:1.

[0847] In the present invention, the sites of the nucleotide sequence of SEQ ID NO:1 corresponding to positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050 and 114166066 of human chromosome 11 are shown in Table 1, respectively. [Table 1]

[0848] DNA methylation DNA methylation is a form of chemical modification of DNA that alters gene expression without changing the DNA sequence. Many studies have shown that DNA methylation may alter chromatin structure, DNA morphology, DNA stability, and DNA-protein interaction patterns, thereby regulating gene expression.

[0849] DNA methylation is one of the first and most thoroughly studied epigenetic regulators. In the broad sense, DNA methylation refers to the chemical modification process in which specific bases in DNA sequences acquire one methyl group via covalent bond with S-adenosyl methionine as the methyl donor under the catalysis of DNA methyltransferase1. This DNA methylation modification can occur at the C-5 position of cytosine, the N-6 position of adenine, and the N-7 position of guanine. In general research, DNA methylation refers to the process in which the fifth carbon atom of cytosine in CpG dinucleotides is methylated. The product is called 5-methylcytosine (5-mC), which is the main form of DNA methylation in eukaryotes such as plants and animals. DNA methylation, as a relatively stable modification, can be inherited to new generations of DNA during the DNA replication process under the action of DNA methyltransferases, making it an important regulator of epigenetic inheritance.

[0850] DNA methylation reactions can be divided into two types: in the first type, DNA with two unmethylated strands is methylated, called de novo methylation, and in the second type, double-stranded DNA with one methylated strand is methylated on the other unmethylated strand, called maintenance methylation.

[0851] Typically, DNA methylation is the methylation of DNA CpG sites. CpG dinucleotides are distributed very unevenly in the human genome, and some segments of the genome have CpGs at higher than normal rates. Enriched regions of CpG sites (also called CpG islands) are mainly located in promoter and exon regions of genes, and some regions are enriched in CpG dinucleotides, among which more than 60% of gene promoters contain CpG islands. Here, CpG is an abbreviation of cytosine (C)-phosphate (p)-guanine (G).

[0852] Intracellular gene expression is subject to various types of regulation by signal transduction pathways, transcription factors, and epigenetic modifications. DNA methylation modification is an important method by which epigenetic modifications regulate gene expression. The DNA methylation level in a specific gene region always affects the expression level of that gene. Compared with the regulation of gene expression by signal transduction pathways and transcription factors, DNA methylation modification, an epigenetic modification, has a more stable effect on gene expression and is less susceptible to the extracellular environment. DNA methylation modification is an ideal biomarker because it can be easily detected by existing technologies.

[0853] tumor According to the present study, the compounds of the present invention are useful for the prevention and / or treatment of tumors.

[0854] In the present invention, the terms "tumor," "carcinosis," "cancer," and "mass" may be used interchangeably.

[0855] In a preferred embodiment of the present invention, the "tumor" described in the present invention includes tumors in which the NNMT gene is underexpressed or not expressed. As a representative example, the tumors in which the NNMT gene is underexpressed or not expressed described in the present invention are as described in the third aspect of the present invention.

[0856] In a preferred embodiment of the present invention, the "tumor" according to the present invention includes a tumor in which DNA methyltransferase is highly expressed. As a representative example, the tumor in which DNA methyltransferase is highly expressed according to the present invention is as described in the third aspect of the present invention.

[0857] The DNA methyltransferase according to the present invention includes, but is not limited to, DNMT1, DNMT3a, DNMT3b, or a combination thereof. Preferably, the DNA methyltransferase according to the present invention includes DNMT1.

[0858] In a preferred embodiment of the present invention, the "tumor" according to the present invention includes a tumor in which DNMT1 is highly expressed. As a representative example, the tumor in which DNMT1 is highly expressed according to the present invention is as described in the third aspect of the present invention.

[0859] In a preferred embodiment of the present invention, the "tumor" according to the present invention includes a tumor in which DNMT3a is highly expressed. As a representative example, the tumor in which DNMT3a is highly expressed according to the present invention is as described in the third aspect of the present invention.

[0860] In a preferred embodiment of the present invention, the "tumor" according to the present invention includes a tumor in which DNMT3b is highly expressed. As a representative example, the tumor in which DNMT3b is highly expressed according to the present invention is as described in the third aspect of the present invention.

[0861] In a preferred embodiment of the present invention, the "tumor" according to the present invention includes a tumor in which UHRF1 (ubiquitin-related tau protein 1 containing PHD and ring finger domain) is highly expressed. As a representative example, the tumor in which UHRF1 according to the present invention is highly expressed is as described in the third aspect of the present invention.

[0862] In a preferred embodiment of the present invention, the "tumor" according to the present invention includes a tumor in which the nucleotide site of the NNMT gene is hypermethylated. As a representative example, the tumor in which the nucleotide site of the NNMT gene according to the present invention is hypermethylated is as described in the third aspect of the present invention.

[0863] In a preferred embodiment of the present invention, the "tumor" according to the present invention includes a tumor in which the NNMT gene region DNA CpG site is hypermethylated. As a representative example, the tumor in which the NNMT gene region DNA CpG site is hypermethylated according to the present invention is as described in the third aspect of the present invention.

[0864] Typically, the tumor according to the invention is as described in the third aspect of the invention.

[0865] In the present invention, representative tumor types corresponding to various tumor cell lines are shown in Table 2 below. [Table 2]

[0866] Antitumor drugs In the present invention, the antitumor drug can be the compound of formula I of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

[0867] use The present invention provides the use of the compounds of the invention in the prevention and / or treatment of tumors.

[0868] In particular, the compound of the present invention has a significantly excellent therapeutic effect on tumors with low or no expression of NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation of nucleotide sites of NNMT gene and / or high methylation of DNA CpG sites in NNMT gene region, i.e., tumors with low or no expression of NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation of nucleotide sites of NNMT gene and / or high methylation of DNA CpG sites in NNMT gene region are sensitive to the compound of the present invention. The expression level of NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of nucleotide sites of NNMT gene and / or the methylation level of DNA CpG sites in NNMT gene region serve as markers for determining whether the compound of the present invention is suitable for the refinement treatment of tumor cells. The markers can effectively identify tumor patients who are sensitive to the compound of the present invention and improve the therapeutic effect thereof, and can avoid administering the compound of the present invention to tumor patients who are not sensitive to it, thereby realizing the refinement treatment of tumors.

[0869] The present invention provides a method for preventing and / or treating a tumor, which comprises administering the compound of the present invention to a subject.

[0870] The compound of the present invention has a remarkably excellent therapeutic effect on tumors with low or no expression of NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites of NNMT gene, and / or hypermethylation of DNA CpG sites in NNMT gene region. In the process of preventing and / or treating tumors, first, an inhibitor of NNMT gene, an accelerator of DNA methyltransferase, an accelerator of UHRF1, an accelerator of methylation of nucleotide sites of NNMT gene, and / or an accelerator of methylation of DNA CpG sites in NNMT gene region are given to the subject of treatment so that the tumor of the subject of treatment has low or no expression of NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites of NNMT gene, and / or hypermethylation of DNA CpG sites in NNMT gene region, and then the compound of the present invention is given to prevent and / or treat tumors. Therefore, a compound capable of significantly enhancing the antitumor effect by combining an NNMT gene inhibitor, a DNA methyltransferase promoter, a UHRF1 promoter, a promoter of methylation at the nucleotide site of the NNMT gene, and / or a promoter of methylation at the DNA CpG site in the NNMT gene region has been developed. The compound of the present invention can be combined with an NNMT gene inhibitor, a DNA methyltransferase promoter, a UHRF1 promoter, a promoter of methylation at the nucleotide site of the NNMT gene, and / or a promoter of methylation at the DNA CpG site in the NNMT gene region, thereby significantly enhancing the therapeutic effect of the compound of the present invention against tumors.

[0871] In another preferred embodiment, the subject to be treated is a human or non-human mammal (eg, rodents, rabbits, monkeys, livestock, dogs, cats).

[0872] In the present invention, the method for achieving low or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites of the NNMT gene, and / or hypermethylation of DNA CpG sites in the NNMT gene region in a tumor is not particularly limited, and for example, low or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites of the NNMT gene, and / or hypermethylation of DNA CpG sites in the NNMT gene region in a tumor can be achieved specifically through means such as gene insertion, gene knockout, and gene suppression (e.g., introducing shRNA).

[0873] marker The present invention provides a marker for determining whether the compound of the present invention is suitable for tumor prevention and / or treatment in tumor patients, the marker comprising an expression level of the NNMT gene, an expression level of DNA methyltransferase, an expression level of UHRF1, a methylation level of a nucleotide site of the NNMT gene, and / or a methylation level of a DNA CpG site in the NNMT gene region.

[0874] In one embodiment, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene and / or the methylation level of the DNA CpG site of the NNMT gene promoter region serve as markers for determining whether the compound of the present invention is suitable for tumor prevention and / or treatment in tumor patients. The method includes: In tumor cells of a tumor patient, when the NNMT gene is low or not expressed, the DNA methyltransferase is highly expressed, the UHRF1 is highly expressed, the nucleotide site of the NNMT gene is highly methylated, and / or the DNA CpG site of the NNMT gene region is highly methylated, the compound of the present invention is suitable for preventing and / or treating tumors in tumor patients; and / or This includes, but is not limited to, high expression of the NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, hypomethylation of nucleotide sites in the NNMT gene, and / or hypomethylation of DNA CpG sites in the NNMT gene region in tumor cells of a tumor patient, making the compounds of the present invention unsuitable for tumor prevention and / or treatment in tumor patients.

[0875] Specifically, tumors in which the NNMT gene is under-expressed or not expressed, tumors in which DNA methyltransferase (e.g., DNMT1) is highly expressed, tumors in which UHRF1 is highly expressed, tumors in which nucleotide sites in the NNMT gene are hypermethylated, and / or tumors in which DNA CpG sites in the NNMT gene region are hypermethylated are as described in the third aspect of the present invention.

[0876] In one preferred embodiment of the present invention, the tumors in which the NNMT gene is under-expressed or not expressed, the tumors in which DNA methyltransferase (e.g., DNMT1) is highly expressed, the tumors in which UHRF1 is highly expressed, the tumors in which nucleotide sites in the NNMT gene are hypermethylated and / or the tumors in which DNA CpG sites in the NNMT gene region are hypermethylated are as described in the fourth aspect of the present invention.

[0877] The present invention further provides the use of the marker (or the expression level thereof) or detection agent, which is used to manufacture a detection agent kit, which is used to determine whether the compound of the present invention is suitable for tumor prevention and / or treatment in tumor patients.

[0878] Compositions or formulations, combinations of active ingredients and medical kits, and methods of administration Preferably, the composition according to the present invention is a pharmaceutical composition, and the composition according to the present invention may comprise a pharma- ceutically acceptable carrier.

[0879] As used herein, "pharmaceutical acceptable carrier" refers to one or more compatible solid, semi-solid, liquid and gel fillers that are suitable for human or animal use and must be of sufficient purity and sufficiently low toxicity. "Compatibility" refers to the fact that each component in the drug composition and the active ingredient of the drug can be mixed and mixed together without significantly decreasing the efficacy of the drug.

[0880] In the present invention, it should be understood that the pharma- ceutically acceptable carrier is not particularly limited and may be selected from materials commonly used in the art, prepared by a conventional method, or purchased from the market. Some representative examples of pharma-ceutically acceptable carriers include cellulose and its derivatives (e.g., methylcellulose, ethylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, etc.), gelatin, talc, solid lubricants (e.g., stearic acid and magnesium stearate), calcium sulfate, vegetable oils (e.g., soybean oil, sesame oil, peanut oil, olive oil, etc.), polyhydric alcohols (e.g., propylene glycol, glycerin, mannitol, sorbitol, etc.), emulsifiers (e.g., Tween), wetting agents (e.g., sodium lauryl sulfate), buffers, chelating agents, thickeners, pH adjusters, penetration enhancers, colorants, flavorings, stabilizers, antioxidants, preservatives, bacteriostatic agents, heat-free raw water, etc.

[0881] In a preferred embodiment of the present invention, the composition or formulation is in the form of a solid, liquid or semi-solid.

[0882] In a preferred embodiment of the present invention, the type of the composition or preparation is an oral preparation, an external preparation, or an injectable preparation.

[0883] Representative examples of the composition or preparation include tablets, injections, infusions, ointments, gels, solutions, pills, and coatings.

[0884] The drug formulation should be consistent with the dosage regimen. The drug of the present invention may also be used with other synergistic therapeutic agents (before, during, or after use). When using a drug composition or formulation, a safe and effective amount of drug is administered to the subject (e.g., a human or non-human mammal). The safe and effective amount is usually at least about 10 μg / kg of body weight, and in most cases, less than about 8 mg / kg of body weight, preferably about 10 μg / kg to about 1 mg / kg of body weight. Of course, the specific dosage should be determined in consideration of conditions such as the route of administration and the health condition of the patient, but these conditions are taken into account by a skilled physician.

[0885] The present invention mainly has the following excellent technical effects.

[0886] The present invention has developed a compound with a significantly better and more precise therapeutic effect on tumors with low or no expression of NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites of NNMT gene and / or hypermethylation of DNA CpG sites in NNMT gene region. Tumors with low or no expression of NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites of NNMT gene and / or hypermethylation of DNA CpG sites in NNMT gene region are highly sensitive to the compound of the present invention, i.e., the compound of the present invention has a significantly better therapeutic effect on tumors with low or no expression of NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites of NNMT gene and / or hypermethylation of DNA CpG sites in NNMT gene region. Therefore, the compound of the present invention may improve the therapeutic effect of the treatment for tumors with low or no expression of NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide site of NNMT gene and / or hypermethylation of DNA CpG site of NNMT gene region, and avoid administering the compound of the present invention to tumor patients who are not sensitive to it. Therefore, the compound of the present invention, which has a significantly better therapeutic effect for tumors with low or no expression of NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide site of NNMT gene and / or hypermethylation of DNA CpG site of NNMT gene region, has the advantages of better preventive and therapeutic effect on tumors, low drug dosage, small side effects, etc., and improves the preventive and therapeutic effect of the compound of the present invention on tumors, reduces side effects, and improves patient compliance.

[0887] We will further describe the present invention in conjunction with the following specific examples. The following specific examples provide detailed embodiments and specific operation procedures on the basis of the present technical solutions, but it should be understood that the protection scope of the present invention is not limited to these examples. EXAMPLES

[0888] DNMT3a refers to DNA methyltransferase 3a, and its English name is DNA methyltransferase 3a, NCBI entrez gene:1788; Uniprotkb / Swiss-port: Q9Y6K1.

[0889] DNMT3b refers to DNA methyltransferase 3b, and its English name is NDNA methyltransferase 3b, CBI entrez gene:1789; Uniprotkb / Swiss-port: Q9UBC3.

[0890] DNMT1 refers to DNA methyltransferase 1, and its English name is DNA methyltransferase 1, NCBI entrez gene:1786; Uniprotkb / Swiss-port: P26358.

[0891] UHRF1 refers to ubiquitin-related tau protein 1 containing PHD and RING finger domains, and its English name is NCBI entrez gene:29128; Uniprotkb / Swiss-port:Q96T88.

[0892] The English name of the NNMT gene is Nicotinamide N-Methyltransferase.

[0893] The nucleotide sequence of the promoter region of the NNMT gene is shown in SEQ ID NO:1.

[0894] The region extending from 1050 bp before the transcription start site to 499 bp after the transcription start site of the NNMT gene corresponds to positions 951 to 2500 of the nucleotide sequence shown in SEQ ID NO:1.

[0895] The region from 1050 bp before the transcription start site of the NNMT gene to 193 bp before the transcription start site is positions 951 to 1808 of the nucleotide sequence shown in SEQ ID NO:1.

[0896] The region from 840 bp before the transcription start site of the NNMT gene to 469 bp before the transcription start site is positions 1161 to 1532 of the nucleotide sequence shown in SEQ ID NO:1.

[0897] Example 1 Synthesis of compound AB31866 The chemical structure of the compound AB31866 is as follows: [ka]

[0898] The method for synthesizing compound AB31866 is as follows. [ka]

[0899] Compound 1 (100 mg, 0.29 mmol, 1 eq) and compound 2 (122 mg, 0.58 mmol, 2.0 eq) were dissolved in acetonitrile (4 mL), and sodium iodide (87 mg, 0.58 mmol, 2.0 eq) was added. The reaction was carried out in a microwave at 80°C for 30 minutes, and the reaction was confirmed to be complete by LCMS. The reaction product was diluted with water, and the organic phase was extracted twice with ethyl acetate, dried over anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB31866 from the crude product via reverse phase column chromatography (acetonitrile / water + 0.01% formic acid).

[0900] Compound AB31866: ESI-MS (m / z): Theoretical value [M+H] + :512.16, actual value:512.10. 1H NMR (400 MHz, CDCl3) δ 7.24 (s, 1H), 7.09 (d, J = 8.0 Hz, 2H), 7.01-6.93 (m, 4H), 6.77 (s, 1H), 6.08 (d, J = 12.0 Hz, 2H), 5.66 (d, J = 20.0 Hz, 1H), 5.06 (d, J = 20.0 Hz, 1H), 4.90-4.86 (m, 1H), 4.48-4.44 (m, 1H), 4.07-3.98 (m, 1H), 3.94 (s, 3H), 3.89 (m, 3H), 3.49-3.43 (m, 1H), 3.28-3.23 (m, 1H), 309-3.02 (m, 1H).

[0901] Example 2 Synthesis of compound AB31870 The chemical structure of the compound AB31870 is as follows: [ka]

[0902] The method for synthesizing compound AB31870 is as follows. [ka]

[0903] Compound 1 (100 mg, 0.29 mmol, 1 eq) and compound 2 (97 mg, 0.58 mmol, 2.0 eq) were dissolved in acetonitrile (4 mL), and sodium iodide (87 mg, 0.58 mmol, 2.0 eq) was added. The reaction was carried out in a microwave at 80°C for 30 minutes, and the complete reaction was confirmed by LCMS. The reaction product was diluted with water, and the organic phase was extracted twice with ethyl acetate, dried over anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB31870 from the crude product via reverse phase column chromatography (acetonitrile / water + 0.01% formic acid).

[0904] Compound AB31870: ESI-MS (m / z): Theoretical value [M+H] + : 470.23, actual value: 470.20. 1 H NMR (400 MHz, CDCl3) δ 7.52 (s, 1H), 7.08 (d, J = 8.0 Hz, 1H), 6.98 (d, J = 8.0 Hz, 3H), 6.86 (s, 1H), 6.55 (d, J = 8.0 Hz, 2H), 6.13 (s, 2H), 5.04-4.92 (m, 2H), 4.17-4.13 (m, 2H), 3.89 (s, 3H), 3.85 (m, 3H), 3.36-3.17 (m, 4H), 2.86-2.79 (m, 1H), 1.17 (d, J = 8.0 Hz, 6H).

[0905] Example 3 Synthesis of compound AB31873 The chemical structure of the compound AB31873 is as follows: [ka]

[0906] The method for synthesizing compound AB31873 is as follows. [ka]

[0907] Compound 1 (1.0 g, 2.69 mmol, 1 eq) was dissolved in acetic acid (10 mL), bromine (2.1 g, 13.45 mmol, 5 eq) was added dropwise, and the reaction was carried out at 120 °C for 4 h. After the reaction was exhaustive as determined by LCMS, the reaction product was diluted with water, the organic phase was extracted twice with dichloromethane, backwashed once with brine, dried over anhydrous sodium sulfate, filtered, and centrifuged to obtain compound 2 from the crude product via flash chromatography (100-200 mesh silica gel, DCM / MeOH=30 / 1). ESI-MS (m / z): Theoretical value [M+H] +: 415.04, actual value: 413.95. [ka]

[0908] Compound 2 (200 mg, 0.40 mmol, 1 eq) is dissolved in anhydrous tetrahydrofuran (10 mL), and butylmagnesium bromide (0.4 mL, 1.2 mmol, 5 eq, 3M) is added dropwise under nitrogen gas protection at 0°C, and the reaction is carried out for 0.5 hours, and the complete reaction is confirmed by LCMS inspection, and quenched with saturated aqueous ammonium chloride solution, and the organic phase is extracted with ethyl acetate, dried with anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB31873 from the crude product via thin layer chromatography (DCM / MeOH= 30 / 1).

[0909] Compound AB31873: ESI-MS (m / z): Theoretical value [M+H] + : 472.11, actual value: 472.10. 1 H NMR (400 MHz, CDCl3) δ 7.23 (s, 1H), 6.97 (s, 1H), 6.60 (s, 1H), 6.02 (s, 1H), 5.95 (d, J= 4.0 Hz, 2H), 4.70-4.67 (m, 1H), 3.86(s, 0.82-078 (m, 3H).

[0910] Example 4 Synthesis of compound AB31880 The chemical structure of the compound AB31880 is as follows: [ka]

[0911] The method for synthesizing compound AB31880 is as follows. [ka]

[0912] Compound 1 (300 mg, 0.70 mmol, 1 eq) is dissolved in anhydrous tetrahydrofuran (10 mL), and under the protection of nitrogen gas, hexylmagnesium bromide (3.5 mL, 3.50 mmol, 5 eq, 1M / L) is added at 0 ° C., and the reaction is allowed to proceed for 0.5 hours after warming to room temperature. TLC check is performed, and the complete reaction is achieved by LCMS check. Quenching is performed using saturated aqueous ammonium chloride solution, and the organic phase is extracted twice with ethyl acetate, dried over anhydrous sodium sulfate, filtered, and then centrifuged to remove the liquid. Compound AB31880 is obtained from the crude product through thin layer chromatography (DCM / MeOH=50 / 1).

[0913] Compound AB31880: ESI-MS (m / z): Theoretical value [M+H] + : 436.24, actual value: 436.20. 1 H NMR (400 MHz, CDCl3) δ 7.19 (s, 1H), 6.75-6.68 (m, 2H), 6.62 (s, 1H), 5.81 (s, 1H), 4.70-4.67 (m, 1H), 4.26 (s, 4H), 3.87 (s, 3H), 3.84 (s, 3H), 3.46-3.45 (m, 1H), 3.31-3.29 (m, 1H), 2.87-2.78 (m, 2H), 1.75-1.50 (m, 4H), 1.38-1.26 (m, 6H), 0.82-0.79 (m, 3H).

[0914] Example 5 Synthesis of compound AB31881 The chemical structure of the compound AB31881 is as follows: [ka]

[0915] The method for synthesizing compound AB31881 is as follows. [ka]

[0916] Compound 0 (10.0 g, 26.89 mmol, 1 eq) was placed in a 500 ml eggplant bottle and heated to 190° C. under vacuum for 8 hours, and the reaction was complete as determined by LCMS to give compound 1. MS-ESI: Theoretical value [M] + : 322.11, actual value: 322.30. [ka]

[0917] Compound 1 (500 mg, 1.40 mmol, 1 eq) and compound 2 (642 mg, 2.80 mmol, 2.0 eq) were dissolved in acetonitrile (10 mL) and reacted at 80 °C overnight under nitrogen gas protection. After thorough reaction was confirmed by LCMS inspection, the reaction product was diluted with water, the organic phase was extracted with ethyl acetate, dried over anhydrous sodium sulfate, filtered, and centrifuged to obtain compound 3 from the crude product via flash chromatography (100-200 mesh silica gel, DCM / MeOH=50 / 1). MS-ESI: Theoretical value [M] + :470.20, actual value:470.10. [ka]

[0918] Compound 3 (200 mg, 0.36 mmol, 1 eq) is dissolved in anhydrous tetrahydrofuran (10 mL), and methyl magnesium bromide (0.6 mL, 1.8 mmol, 5 eq, 3M) is added dropwise under nitrogen gas protection at 0°C, and the reaction is carried out for 0.5 hours, and the complete reaction is confirmed by LCMS inspection, and quenched with saturated aqueous ammonium chloride solution, and the organic phase is extracted with ethyl acetate, dried with anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB31881 from the crude product via thin layer chromatography (DCM / MeOH= 30 / 1). Compound AB31881: MS-ESI: Theoretical value [M+H] + : 486.22, actual value: 486.20. 1 H NMR (400 MHz, CDCl3) δ 7.31-7.27 (m, 2H), 7.16 (s, 1H), 6.96-6.92 (m, 3H), 6.73 (s, 2H), 6.59 (s, 1H), 5.94 (s, 2H), 5.86 (s, 1H), 4.87-4.82 (m, 1H), 4.20-4.14 (m, 1H), 4.10-4.07 (m, 3H), 3.82 (s, 3H), 3.42-3.36 (m, 1H), 3.21-3.18 (m, 1H), 2.95-2.88 (m, 1H), 2.78-2.74 (m, 1H), 2.06-1.98 (m, 4H), 1.18 (d, J= 8.0 Hz, 3H).

[0919] Example 6 Synthesis of compound AB31887 The chemical structure of the compound AB31887 is as follows: [ka]

[0920] The method for synthesizing compound AB31887 is as follows. [ka]

[0921] Compound 0 (10.0 g, 26.89 mmol, 1 eq) was placed in a 500 ml eggplant bottle and heated to 190° C. under vacuum for 8 hours, and the reaction was complete as determined by LCMS to give compound 1. MS-ESI: Theoretical value [M] + : 322.11, actual value: 322.30. [ka]

[0922] Compound 1 (500 mg, 1.40 mmol, 1 eq) and compound 2 (565 mg, 2.80 mmol, 2.0 eq) were dissolved in acetonitrile (10 mL) and reacted at 80 °C overnight under nitrogen gas protection. After thorough reaction was confirmed by LCMS inspection, the reaction product was diluted with water, the organic phase was extracted with ethyl acetate, dried over anhydrous sodium sulfate, filtered, and centrifuged to obtain compound 3 from the crude product via flash chromatography (100-200 mesh silica gel, DCM / MeOH=50 / 1). MS-ESI: Theoretical value [M] + : 444.06, actual value: 444.00. [ka]

[0923] Compound 3 (160 mg, 0.30 mmol, 1 eq) is dissolved in anhydrous tetrahydrofuran (10 mL), and methyl magnesium bromide (0.5 mL, 1.5 mmol, 5 eq, 3M) is added dropwise under nitrogen gas protection at 0°C, and the reaction is carried out for 0.5 hours, and the complete reaction is confirmed by LCMS inspection, and the reaction is quenched with saturated aqueous ammonium chloride solution, and the organic phase is extracted with ethyl acetate, dried with anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB31881 from the crude product via thin layer chromatography (DCM / MeOH= 30 / 1).

[0924] Compound AB31881: MS-ESI: Theoretical value [M+H] + : 458.09, actual value: 458.05. 1 H NMR (400 MHz, CDCl3) δ 7.15 (s, 1H), 6.74 (s, 2H), 6.59 (s, 1H), 5.94 (s, 2H), 5.85 (s, 1H), 4.90-4.85 (m, 1H), 4.20-4.11 (m, 2H), 3.83 (s, 3H), 3.71-3.69 (m, 2H), 3.42-3.25 (m, 2H), 2.98-2.77 (m, 2H), 2.43-2.23 (m, 2H), 1.18 (d, J= 4.0 Hz, 3H).

[0925] Example 7 Synthesis of compound AB31888 The chemical structure of the compound AB31888 is as follows: [ka]

[0926] The method for synthesizing compound AB31888 is as follows. [ka]

[0927] Compound 1 (300 mg, 0.84 mmol, 1 eq) and compound 2 (592 mg, 4.20 mmol, 5.0 eq) were dissolved in N,N-dimethylformamide (10 mL) and reacted overnight at 80 °C under nitrogen gas protection. After thorough reaction was confirmed by LCMS inspection, the reaction product was diluted with water, the organic phase was extracted with ethyl acetate, dried over anhydrous sodium sulfate, filtered, and centrifuged to obtain compound 3 from the crude product via flash chromatography (100-200 mesh silica gel, DCM / MeOH=50 / 1). MS-ESI: Theoretical value [M] + : 443.18, actual value: 443.05. [ka]

[0928] Compound 3 (100 mg, 0.21 mmol, 1 eq) is dissolved in anhydrous tetrahydrofuran (10 mL), and methyl magnesium bromide (0.4 mL, 1.05 mmol, 5 eq, 3M) is added dropwise under nitrogen gas protection at 0°C, and the reaction is carried out for 0.5 hours, and the complete reaction is confirmed by LCMS inspection, and the reaction is quenched with saturated aqueous ammonium chloride solution, and the organic phase is extracted with ethyl acetate, dried with anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB31888 from the crude product via thin layer chromatography (DCM / MeOH= 30 / 1).

[0929] Compound AB31888: MS-ESI: Theoretical value [M+H] + : 456.19, actual value: 456.15. 1 H NMR (400 MHz, DMSO-d6) δ 7.25 (s, 1H), 6.81(d, J= 4.0 Hz, 2H), 6.77 (s, 1H), 6.66 (d, J= 4.0 Hz, 1H), 6.00 (d, J= 4.0 Hz, 2H), 5.93 (s, 1H), 4.77-4.73 (m, 1H), 3.97-3.94 (m, 2H), 3.75 (s, 3H), 3.68-3.64 (m, 2H), 3.27-3.21 (m, 2H), 2.84-2.74 (m, 2H), 1.78-1.70 (m, 4H), 1.49-1.45 (m, 4H), 1.05 (d, J= 8.0 Hz, 3H).

[0930] Example 8 Synthesis of compound AB31895 The chemical structure of the compound AB31895 is as follows: [ka]

[0931] The method for synthesizing compound AB31895 is as follows. [ka]

[0932] In a 50ml sealed tube, compound 1 (1.0 g, 2.69 mmol, 1 eq) was dissolved in alcohol (20 mL) and phenethylamine (326 mg, 26.9 mmol, 10 eq) was added. The reaction was heated to 100°C for 48 hours, and the reaction was determined to be exhaustive by LCMS. The reaction product was diluted with water, and the organic phase was extracted twice with ethyl acetate, dried over anhydrous sodium sulfate, filtered, and centrifuged to obtain the crude product 3 via flash chromatography (DCM / MeOH=30 / 1). MS-ESI: Theoretical value [M] + : 425.19, actual value: 425.15. [ka]

[0933] Compound 3 (190 mg, 0.41 mmol, 1 eq) is dissolved in anhydrous tetrahydrofuran (10 mL), and methyl magnesium bromide (0.7 mL, 2.05 mmol, 5 eq, 3M) is added dropwise under nitrogen gas protection at 0°C, and the reaction is carried out for 0.5 hours, and the complete reaction is confirmed by LCMS inspection. The reaction is quenched with saturated aqueous ammonium chloride solution, and the organic phase is extracted twice with ethyl acetate, dried over anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB31895 from the crude product via thin layer chromatography (DCM / MeOH= 50 / 1).

[0934] Compound AB31895: MS-ESI: Theoretical value [M+H] + : 441.21, actual value: 441.20. 1H NMR (400 MHz, DMSO-d6) δ 7.28-7.18 (m, 6H), 6.72 (s, 1H), 6.68 (d, J= 8.0 Hz, 1H), 6.48 (d, J= 8.0 Hz, 1H), 5.96 (d, J= 4.0 Hz, 2H), 5.87 (s, 1H), 4.54-4.50 (m, 1H), 3.68 (s, 3H), 3.18-3.04 (m, 5H), 2.76-2.73 (m, 4H), 0.91 (d, J= 4.0 Hz, 3H).

[0935] Example 9 Synthesis of compound AB31896 The chemical structure of the compound AB31896 is as follows: [ka]

[0936] The method for synthesizing compound AB31896 is as follows. [ka]

[0937] Compound 1 (500 mg, 2.57 mmol, 1 eq) was dissolved in dichloromethane (10 mL), cooled to 0° C., oxalyl chloride (1.6 g, 12.85 mmol, 5 eq) and two drops of N,N-dimethylformamide were added, and the reaction was carried out at room temperature for 2 hours. The reaction was complete as determined by LCMS, and the solvent was removed under reduced pressure to give compound 2. MS-ESI: Theoretical value [M+H] + : 213.10, Actual value: Not measured. [ka]

[0938] Compound 3 (100 mg, 0.29 mmol, 1 eq) was dissolved in dichloromethane (10 mL), triethylamine (88 mg, 0.87 mmol, 3 eq) was added, and the temperature was lowered to 0°C. Compound 2 (420 mg, 1.97 mmol, 6.8 eq) was added, and the reaction was carried out at 0°C for 0.5 hours. The complete reaction was confirmed by LCMS inspection, and the reaction product was diluted with water, and the organic phase was extracted twice with ethyl acetate, dried with anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB31896 from the crude product via reverse phase column chromatography (acetonitrile / water + 0.01% formic acid).

[0939] Compound AB31896: MS-ESI: Theoretical value [M+H] + :514.25, actual value:514.25. 1 H NMR (400 MHz, DMSO-d6) δ 7.27 (s, 1H), 6.91-6.83 (m, 2H), 6.77 (s, 1H), 6.01 (s, 1H), 5.99 (s, 2H), 4.61-4.55 (m, 1H), 3.71 (s, 3H), 3.28-3.14 (m, 2H), 2.79-2.74 (m, 2H), 2.34 (s, 2H), 1.72-1.63 (m, 15H), 1.02 (d, J= 8.0 Hz, 3H).

[0940] Example 10 Synthesis of compound AB31897 The chemical structure of the compound AB31897 is as follows: [ka]

[0941] The method for synthesizing compound AB31897 is as follows. [ka]

[0942] Compound 0 (10.0 g, 26.89 mmol, 1 eq) was placed in a 500 ml eggplant bottle and heated to 190° C. under vacuum for 8 hours, and the reaction was complete as determined by LCMS to give compound 1. [ka]

[0943] Compound 1 (2g, 5.59mmol, 1eq) is dissolved in anhydrous tetrahydrofuran (10mL), and methyl magnesium bromide (11.2mL, 33.54mmol, 6eq,3M) is added at 0℃ under the protection of nitrogen gas, and the reaction is carried out for 0.5 hours by warming to room temperature. The complete reaction is confirmed by LCMS inspection, and the reaction is quenched with saturated aqueous ammonium chloride solution. The organic phase is extracted twice with ethyl acetate, dried with anhydrous sodium sulfate, filtered, and then centrifuged to remove the liquid. Compound 2 is obtained from the crude product by thin layer chromatography (DCM / MeOH=100 / 1~50 / 1). [ka]

[0944] Compound 2 (300 mg, 0.89 mmol, 1 eq) was dissolved in acetonitrile (10 mL), compound 3 (868 mg, 3.56 mmol, 4 eq) and potassium carbonate (491 mg, 3.56 mmol, 4 eq) were added, and the reaction was heated to 80 °C overnight. After the reaction was exhaustive as determined by LCMS, the reaction product was diluted with water, the organic phase was extracted twice with ethyl acetate, dried over anhydrous sodium sulfate, filtered, and centrifuged to obtain compound AB31897 from the crude product via flash chromatography (DCM / MeOH=50 / 1).

[0945] Compound AB31897: MS-ESI: Theoretical value [M+H] + :501.13, actual value:501.10. 1H NMR (400 MHz, DMSO-d6) δ 7.22 (s, 1H), 6.79-6.74 (m, 2H), 6.64 (d, J= 12.0 Hz, 1H), 5.97 (d, J= 4.0 Hz, 2H), 5.89 (s, 1H), 4.74-4.69 (m, 1H), 3.94-3.91 (m, 2H), 3.72 (s, 3H), 3.55-3.51 (m, 2H), 3.25-3.15 (m, 2H), 2.79-2.68 (m, 2H), 1.85-1.79 (m, 2H), 1.72-1.65 (m, 2H), 1.44 (s, 4H), 1.03 (d, J= 4.0 Hz, 3H).

[0946] Example 11 Synthesis of compound AB31898 The chemical structure of the compound AB31898 is as follows: [ka]

[0947] The method for synthesizing compound AB31898 is as follows. [ka]

[0948] Compound 1 (200 mg, 0.52 mmol, 1 eq) is dissolved in anhydrous tetrahydrofuran (10 mL), and methyl magnesium bromide (2.7 mL, 2.7 mmol, 5 eq, 1M) is added dropwise under nitrogen gas protection at 0°C, and the reaction is carried out for 0.5 hours, and the complete reaction is confirmed by LCMS inspection, and quenched with saturated aqueous ammonium chloride solution, and the organic phase is extracted with ethyl acetate, dried with anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB31898 from the crude product via thin layer chromatography (DCM / MeOH=30 / 1).

[0949] Compound AB31898: MS-ESI: Theoretical value [M+H]+ : 366.17, actual value: 366.10. 1 H NMR (400 MHz, DMSO-d6) δ 7.11 (s, 1H), 6.81 (d, J= 8.0 Hz, 1H), 6.68 (s, 1H), 6.67 (s, 1H), 5.87(s, 1H), 4.77-4.73 (m, 1H), 4.23 (s, 4H), 3.77 (d, J= 8.0 Hz, 6H), 3.28-3.20 (m, 2H), 2.79-2.66 (m, 2H), 1.05 (d, J= 8.0 Hz, 3H).

[0950] Example 12 Synthesis of compound AB35402 The chemical structure of the compound AB35402 is as follows: [ka]

[0951] The method for synthesizing compound AB35402 is as follows. [ka]

[0952] Compound 0 (10.0 g, 26.89 mmol, 1 eq) was placed in a 500 ml eggplant bottle and heated to 190° C. under vacuum for 8 hours, and the reaction was complete as determined by LCMS to give compound 1. MS-ESI: Theoretical value [M] + : 322.11, actual value: 322.30. [ka]

[0953] Compound 1 (500 mg, 1.40 mmol, 1 eq) was dissolved in acetonitrile (10 mL), compound 2 (912 mg, 4.20 mmol, 3 eq) and potassium carbonate (773 mg, 5.6 mmol, 4 eq) were added, and the reaction was carried out at room temperature overnight. After the reaction was confirmed to be exhaustive by LCMS, the reaction product was diluted with water, the organic phase was extracted twice with ethyl acetate, dried over anhydrous sodium sulfate, filtered, and centrifuged to obtain compound 3 from the crude product via flash chromatography (DCM / MeOH=30 / 1). MS-ESI: Theoretical value [M] + : 458.23, actual value: 458.30. [ka]

[0954] Compound 3 (200 mg, 0.37 mmol, 1 eq) is dissolved in anhydrous tetrahydrofuran (10 mL), and methyl magnesium bromide (0.6 mL, 1.85 mmol, 5 eq, 3M) is added dropwise at 0 ° C under the protection of nitrogen gas, and the reaction is carried out at room temperature for 0.5 hours. The reaction is complete as confirmed by LCMS inspection, and quenched with saturated aqueous ammonium chloride solution. The organic phase is extracted twice with ethyl acetate, dried over anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB35402 from the crude product via thin layer chromatography (DCM / MeOH=50 / 1).

[0955] Compound AB35402: MS-ESI: Theoretical value [M+H] + : 474.26, actual value: 474.35. 1H NMR (400 MHz, DMSO-d6) δ 7.24 (s, 1H), 6.821 (d, J= 8.0 Hz, 1H), 6. 77 (s, 1H), 6.67 (d, J= 12.0 Hz, 1H), 6.03 (s, 2H), 5.92 (s, 1H), 5.51-5.48 (m, 1H), 5.10-5.05 (m, 1H), 4.76-4.73 (m, 1H), 4.54-4.46 (m, 2H), 3.76 (s, 3H), 3.29-3.15 (m, 2H), 2.78-2.66 (m, 2H), 2.09-1.99 (m, 4H), 1.63 (s, 6H), 1.55 (s, 3H), 1.03 (d, J= 4.0 Hz, 3H).

[0956] Example 13 Synthesis of compound AB35405 The chemical structure of the compound AB35405 is as follows: [ka]

[0957] The method for synthesizing compound AB35405 is as follows. [ka]

[0958] Compound 1 (200 mg, 0.37 mmol, 1 eq) was dissolved in chloroform (5 mL), ammonia water (2 mL) was added, and the reaction was carried out at room temperature overnight. After the reaction was confirmed to be exhaustive by LCMS, the reaction product was diluted with water, the organic phase was extracted with dichloromethane, dried over anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB35405 from the crude product via flash chromatography (PE / EA= 200:1).

[0959] Compound AB35405: MS-ESI: Theoretical value [M+H] + :576.14, actual value:576.15. 1 H NMR (400 MHz, CDCl3) δ 7.17 (s, 1H), 6.98-6.86 (m, 2H), 6.62 (s, 1H), 6.10 (s, 1H), 5.95 (d, J= 4.0 Hz, 2H), 5.67 (s, 1H), 5.57-5.53 (m, 1H), 5.10-5.06 (m, 1H), 4.72-4.56 (m, 2H), 3.89-3.83 (m, 4H), 3.69-3.64 (m, 1H), 3.37-3.32 (m, 1H), 2.74-2.70 (m, 1H), 2.11-2.03 (m, 4H), 1.66 (d, J= 8.0 Hz, 6H), 1.58 (s, 3H).

[0960] Example 14 Synthesis of compound AB35407 The chemical structure of the compound AB35407 is as follows: [ka]

[0961] The method for synthesizing compound AB35407 is as follows. [ka]

[0962] Compound 0 (10.0 g, 26.89 mmol, 1 eq) was placed in a 500 ml eggplant bottle and heated to 190° C. under vacuum for 8 hours, and the reaction was complete as determined by LCMS to give compound 1. MS-ESI: Theoretical value [M] + : 322.11, actual value: 322.30. [ka]

[0963] Compound 1 (600 mg, 1.67 mmol, 1 eq) was dissolved in N,N-dimethylformamide (10 mL), compound 2 (1.9 g, 6.71 mmol, 4 eq) and potassium carbonate (926 mg, 6.71 mmol, 4 eq) were added, and the reaction was carried out overnight at 60 °C under the protection of nitrogen gas. The complete reaction was confirmed by LCMS inspection, and the reaction product was diluted with water, the organic phase was extracted twice with ethyl acetate, dried over anhydrous sodium sulfate, filtered, and centrifuged to obtain compound 3 from the crude product via flash chromatography (DCM / MeOH=50 / 1). MS-ESI: Theoretical value [M] + :521.26, actual value:521.30. [ka]

[0964] Compound 3 (200 mg, 0.33 mmol, 1 eq) was dissolved in chloroform (5 mL), and aqueous ammonia (2 mL) was added and the reaction was carried out at 40 °C for 48 h. After the reaction was thoroughly confirmed by LCMS, the reaction product was diluted with water, and the organic phase was extracted with dichloromethane, dried over anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB35407 from the crude product via flash chromatography (PE / EA= 200:1).

[0965] Compound AB35407: MS-ESI: Theoretical value [M+H] + : 639.18, actual value: 639.15. 1H NMR (400 MHz, CDCl3) δ 7.16 (s, 1H), 6.97-6.85 (m, 2H), 6.62 (s, 1H), 6.08 (s, 1H), 5.95 (d, J= 4.0 Hz, 2H), 5.62 (s, 1H), 4.52 (s, 1H), 4.28-4.23 (m, 1H), 3.89-3.82 (m, 5H), 3.69-3.67 (m, 1H), 3.36-3.31 (m, 1H), 3.16-3.09 (m, 2H), 2.76-2.72 (m, 1H), 1.83-1.69 (m, 4H), 1.58-1.51 (m, 4H), 1.44 (s, 9H).

[0966] Example 15 Synthesis of compound AB35411 The chemical structure of the compound AB35411 is as follows: [ka]

[0967] The method for synthesizing compound AB35411 is as follows. [ka]

[0968] Compound 1 (2.0 g, 5.93 mmol, 1 eq) was dissolved in alcohol / acetic acid (10 mL / 8 mL), phenylpropylaldehyde (7.9 g, 59.3 mmol, 10 eq) was added, and the mixture was stirred for 80 o The reaction is carried out in C for 4 hours, and then an appropriate amount of hydrochloric acid is added to the reaction solution and concentrated. A small amount of dichloromethane and an appropriate amount of ethyl acetate are added to the crude product, and the mixture is left for 0.5 hours, after which the solid matter is filtered off. The filtrate is left overnight to precipitate the solid matter. The solid matter is filtered off and collected to obtain compound 1 (1.4 g). [ka]

[0969] Compound 3 (200 mg, 0.41 mmol, 1 eq) is dissolved in anhydrous tetrahydrofuran (10 mL), and methyl magnesium bromide (0.7 mL, 2.05 mmol, 5 eq, 3M) is added under nitrogen gas protection at 0° C., and the reaction is carried out at room temperature for 0.5 hours. The reaction solution is quenched with saturated aqueous ammonium chloride solution, and the organic phase is extracted twice with ethyl acetate, washed with brine, dried over anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB35411 from the crude product via thin layer chromatography (DCM / MeOH=20 / 1).

[0970] Compound AB35411: MS-ESI: Theoretical value [M+H] + : 470.23, Measured value [M+H] + :470.30. 1 H NMR (400 MHz, CDCl 3 ) δ 7.34-7.28 (m, 2H), 7.24-7.16 (m, 3H), 6.97 (s, 1H), 6.90-6.76 (m, 2H), 6.65 (s, 1H), 5.97-5.96 (m, 2H), 4.77-4.73 (m, 1H), 3.89 (s, 3H), 3.86 (s, 3H), 3.24-3.22 (m, 2H), 2.84-2.65 (m, 6H), 2.14-2.08 (m, 1H), 1.90-1.81 (m, 1H), 1.07 (d, J= 4.0 Hz, 3H).

[0971] Example 16 Synthesis of compound AB35413 The chemical structure of the compound AB35413 is as follows: [ka]

[0972] The method for synthesizing compound AB35413 is as follows. [ka]

[0973] Compound 1 (100 mg, 0.28 mmol, 1 eq) is dissolved in anhydrous tetrahydrofuran (10 mL), and methyl magnesium bromide (0.5 mL, 1.4 mmol, 5 eq, 3M) is added under nitrogen gas protection at 0°C, and the reaction is carried out at room temperature for 0.5 hours. The reaction solution is quenched with saturated aqueous ammonium chloride solution, and the organic phase is extracted twice with ethyl acetate, washed with brine, dried over anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB35413 from the crude product via thin layer chromatography (DCM / MeOH=30 / 1).

[0974] Compound AB35413: MS-ESI: Theoretical value [M+H] + :336.12, Measured value [M+H] + :336.10. 1 H NMR (400 MHz, DMSO-d6) δ 7.25 (s, 1H), 6.78 (s, 1H), 6.79 (d, J= 8.0 Hz, 1H), 6.46 (d, J= 8.0 Hz, 1H), 6.04 (s, 1H), 6.00 (d, J= 4.0 Hz, 2H), 5.94 (s, 1H), 5.89 (s, 1H), 4.71-4.66 (m, 1H), 3.28-3.20 (m, 2H), 2.83-2.70 (m, 2H), 1.11 (d, J= 8.0 Hz, 3H).

[0975] Example 17 Synthesis of compound AB35415 The chemical structure of the compound AB35415 is as follows: [ka]

[0976] The method for synthesizing compound AB35415 is as follows. [ka]

[0977] Compound 1 (200 mg, 0.59 mmol, 1 eq) was dissolved in N,N-dimethylformamide (10 mL), compound 2 (661 mg, 2.36 mmol, 4 eq)) and potassium carbonate (326 mg, 2.36 mmol, 4 eq) were added, and the reaction was carried out at 60 ° C overnight. The reaction solution was diluted with water, and the organic phase was extracted twice with ethyl acetate, washed with brine, dried over anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB35415 from the crude product via reverse phase column chromatography (acetonitrile / water + 0.01% formic acid).

[0978] Compound AB35415: MS-ESI: Theoretical value [M+H] + :537.29, Measured value [M+H] + :537.35. 1 H NMR (400 MHz, CDCl 3 ) δ 7.15 (s, 1H), 6.72 (s, 2H), 6.59 (s, 1H), 5.94 (s, 2H), 5.85 (s, 1H), 4.85-4.80 (m, 1H), 4.53 (s, 1H), 4.05-4.09 (m, 2H), 3.82 (s, 3H), 3.44-3.39 (m, 1H), 3.24-3.14 (m, 3H), 2.98-2.77 (m, 2H), 1.82-1.79 (m, 2H), 1.55-1.50 (m, 4H), 1.44 (s, 11H), 1.17 (d, J= 8.0 Hz, 3H).

[0979] Example 18 Synthesis of compound AB35416 The chemical structure of the compound AB35416 is as follows: [ka]

[0980] The method for synthesizing compound AB35416 is as follows. [ka]

[0981] Compound 1 (200 mg, 0.33 mmol, 1 eq) was dissolved in chloroform (5 mL), and aqueous ammonia (2 mL) was added. The reaction was carried out at 40° C. for 48 hours. The reaction solution was diluted with water, and the organic phase was extracted with dichloromethane, washed with brine, dried over anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB35416 from the crude product via thin layer chromatography (PE / EA= 10 / 1).

[0982] Compound AB35416: MS-ESI: Theoretical value [M+H] + :583.11, Measured value [M+H] + :583.10. 1 H NMR (400 MHz, CDCl 3 ) δ 7.16 (s, 1H), 6.97-6.89 (m, 2H), 6.62 (s, 1H), 6.09 (s, 1H), 5.96 (s, 2H), 5.64 (s, 1H), 4.34 (s, 1H), 4.24 (s, 1H), 3.96-3.87 (m, 5H), 3.71 (s, 1H), 3.56-3.49 (m, 2H), 3.35-3.30 (m, 1H), 2.76-2.73 (m, 1H), 1.47 (s, 9H).

[0983] Example 19 Synthesis of compound AB35417 The chemical structure of the compound AB35417 is as follows: [ka]

[0984] The method for synthesizing compound AB35417 is as follows. [ka]

[0985] Compound 1 (200 mg, 0.41 mmol, 1 eq) was dissolved in chloroform (5 mL), and aqueous ammonia (2 mL) was added. The reaction was carried out at room temperature for 24 hours. The reaction solution was diluted with water, and the organic phase was extracted with dichloromethane, washed with brine, dried over anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB35417 from the crude product via thin layer chromatography (PE / EA= 10 / 1).

[0986] Compound AB35417: MS-ESI: Theoretical value [M+H] + :572.11, Measured value [M+H] + :572.1. 1 H NMR (400 MHz, CDCl 3 ) δ 7.32-7.30 (m, 2H), 7.24-7.20 (m, 3H), 6.99-6.90 (m, 2H), 6.85 (s, 1H), 6.68 (s, 1H), 5.99 (s, 2H), 5.58 (s, 1H), 4.09-4.03 (m, 1H), 3.93 (s, 3H), 3.90 (s, 3H), 3.46-3.44 (m, 1H), 2.75-2.56 (m, 6H), 2.12-2.04 (m, 1H), 1.88-1.77 (m, 1H).

[0987] Example 20 Synthesis of compound AB35418 The chemical structure of the compound AB35418 is as follows: [ka]

[0988] The method for synthesizing compound AB35418 is as follows. [ka]

[0989] Compound 1 (200 mg, 0.45 mmol, 1 eq) was dissolved in chloroform (5 mL), ammonia water (2 mL) was added, and the reaction was carried out at room temperature overnight. The reaction solution was diluted with water, and the organic phase was extracted with dichloromethane, washed with brine, dried over anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB35418 from the crude product via thin layer chromatography (PE / EA= 10 / 1).

[0990] Compound AB35418: MS-ESI: Theoretical value [M+H] + :524.11, Measured value [M+H] + :524.15. 1 H NMR (400 MHz, DMSO-d6) δ 7.13-7.04 (m, 2H), 6.91 (s, 1H), 6.68 (s, 1H), 5.99 (s, 2H), 5.60 (s, 1H), 4.11-4.05 (m, 1H), 3.94 (s, 3H), 3.91 (s, 3H), 3.47-3.45 (m, 1H), 2.73-2.53 (m, 4H), 1.82-1.74 (m, 1H), 1.46-1.38 (m, 5H), 0.95-0.92 (m, 3H).

[0991] Example 21 Synthesis of compound AB35420 The chemical structure of the compound AB35420 is as follows: [ka]

[0992] The method for synthesizing compound AB35420 is as follows. [ka]

[0993] Compound 1 (5.0 g, 13.97 mmol, 1 eq) and compound 2 (21.0 g, 111.76 mmol, 8 eq) were dissolved in N,N-dimethylformamide (50 mL) and reacted at 60 °C overnight. The reaction mixture was diluted with water, and the organic phase was extracted twice with dichloromethane, washed with brine, dried over anhydrous sodium sulfate, filtered, and centrifuged to obtain compound 3 from the crude product via flash chromatography (DCM / MeOH = 50 / 1 to 20 / 1). [ka]

[0994] Compound 3 (250 mg, 0.49 mmol, 1 eq) and compound 4 (167 mg, 1.96 mmol, 4 eq) were dissolved in N,N-dimethylformamide (10 mL), potassium carbonate (270 mg, 1.96 mmol, 4 eq) was added, and the reaction was allowed to proceed at 60 °C overnight. The reaction mixture was diluted with water, and the organic phase was extracted with dichloromethane, washed with brine, dried over anhydrous sodium sulfate, filtered, and centrifuged to obtain compound 5 via flash chromatography (DCM / MeOH=10 / 1). [ka]

[0995] Compound 5 (100 mg, 0.19 mmol, 1 eq) was dissolved in chloroform (5 mL), and aqueous ammonia (2 mL) was added. The reaction was carried out at room temperature for 48 hours. The reaction solution was diluted with water, and the organic phase was extracted with dichloromethane, washed with brine, dried over anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB35420 from the crude product via thin layer chromatography (PE / EA= 10 / 1).

[0996] Compound AB35420: MS-ESI: Theoretical value [M+H] + :551.12, Measured value [M+H] + :551.10. 1 H NMR (400 MHz, CDCl 3 ) δ 7.14 (s, 1H), 6.95-6.84 (m, 2H), 6.60 (s, 1H), 6.06 (s, 1H), 5.93 (s, 2H), 5.84 (s, 1H), 4.41-4.36 (m, 1H), 3.93-3.88 (m, 1H), 3.84 (s, 3H), 3.75-3.27 (m, 1H), 3.33-3.27 (m, 1H), 2.86-2.56 (m, 6H), 1.66-1.47 (m, 10).

[0997] Example 22 Synthesis of compound AB35421 The chemical structure of the compound AB35421 is as follows: [ka]

[0998] The method for synthesizing compound AB35421 is as follows. [ka]

[0999] Compound 1 (100 mg, 0.28 mmol, 1 eq) was dissolved in chloroform (5 mL), and aqueous ammonia (2 mL) was added. The reaction was carried out at room temperature for 48 hours. The reaction solution was diluted with water, and the organic phase was extracted with dichloromethane, washed with brine, dried over anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB35421 from the crude product via thin layer chromatography (PE / EA= 10 / 1).

[1000] Compound AB35421: MS-ESI: Theoretical value [M+H] + : 438.00, measured value [M+H] + :437.95. 1 H NMR (400 MHz, CDCl 3) δ 7.16 (s, 1H), 6.86 (d, J= 8.0 Hz, 1H), 6.87 (d, J= 8.0 Hz, 1H), 6.61 (s, 1H), 6.14 (s, 1H), 6.03 (s, 1H), 5.96-5.94 (m, 2H), 5.91 (s, 1H), 5.41 (s, 1H), 3.86-3.80 (m, 1H), 3.72-3.68 (m, 1H), 3.39-3.32 (m, 1H), 2.75-2.68 (m, 1H).

[1001] Example 23 Synthesis of compound AB35422 The chemical structure of the compound AB35422 is as follows: [ka]

[1002] The method for synthesizing compound AB35422 is as follows. [ka]

[1003] Compound 1 (110 mg, 0.25 mmol, 1 eq) is dissolved in anhydrous tetrahydrofuran (10 mL), and methyl magnesium bromide (0.4 mL, 1.25 mmol, 5 eq, 3M) is added dropwise under nitrogen gas protection at 0°C, and the reaction is carried out for 0.5 hours, and the complete reaction is confirmed by LCMS inspection, and quenched with saturated aqueous ammonium chloride solution, and the organic phase is extracted with ethyl acetate, dried with anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB35422 from the crude product via thin layer chromatography (DCM / MeOH=20 / 1).

[1004] Compound AB35422: MS-ESI: Theoretical value [M+H] + : 422.23, measured value [M+H] + :422.20. 1H NMR (400 MHz, DMSO-d 6 ) δ 6.88-6.83 (m, 4H), 6.00 (d, J= 8.0 Hz, 2H), 4.65-4.61 (m, 1H), 3.76 (d, J= 8.0 Hz, 6H), 3.16-3.08 (m, 3H), 2.74-2.70 (m, 3H), 1.71-1.63 (m, 1H), 1.42-1.32 (m, 5H), 0.94 (d, J= 4.0 Hz, 3H), 0.89-0.86 (m, 3H).

[1005] Example 24 Synthesis of compound AB35423 The chemical structure of the compound AB35423 is as follows: [ka]

[1006] The method for synthesizing compound AB35423 is as follows. [ka]

[1007] Compound 1 (300 mg, 0.84 mmol, 1 eq) was dissolved in N,N-dimethylformamide (10 mL), potassium carbonate (464 mg, 3.36 mmol, 4 eq) and compound 2 (847 mg, 3.36 mmol, 4 eq) were added, and the reaction was allowed to proceed at 60 °C overnight. The reaction solution was diluted with water, and the organic phase was extracted twice with dichloromethane, washed with brine, dried over anhydrous sodium sulfate, filtered, and centrifuged to obtain compound 3 from the crude product via flash chromatography (DCM / MeOH=50 / 1~20 / 1). [ka]

[1008] Compound 3 (200 mg, 0.35 mmol, 1 eq) was dissolved in chloroform (5 mL), and ammonia water (2 mL) was added. o C, the reaction is carried out for 48 hours, the reaction solution is diluted with water, the organic phase is extracted with dichloromethane, washed with brine, dried over anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB35423 from the crude product via thin layer chromatography (PE / EA=10 / 1).

[1009] Compound AB35423: MS-ESI: Theoretical value [M+H] + :611.14, Measured value [M+H] + :611.05. 1 H NMR (400 MHz, CDCl 3 ) δ 7.16 (s, 1H), 6.97-6.86 (m, 2H), 6.62 (s, 1H), 6.09 (s, 1H), 5.95-5.94 (m, 2H), 5.60 (s, 1H), 4.64 (s, 1H), 4.27-4.23 (m, 1H), 3.90-3.86 (m, 5H), 3.73-3.67 (m, 1H), 3.35-3.22 (m, 3H), 2.77-2.71 (m, 1H), 1.84-1.72 (m, 4H), 1.44 (s, 9H).

[1010] Example 25 Synthesis of compound AB35424 The chemical structure of the compound AB35424 is as follows: [ka]

[1011] The method for synthesizing compound AB35424 is as follows. [ka]

[1012] Compound 1 (300 mg, 0.84 mmol, 1 eq) was dissolved in N,N-dimethylformamide (10 mL), potassium carbonate (464 mg, 3.36 mmol, 4 eq) and compound 2 (753 mg, 3.36 mmol, 4 eq) were added, and the reaction was allowed to proceed at 60 °C overnight. The reaction solution was diluted with water, and the organic phase was extracted twice with dichloromethane, washed with brine, dried over anhydrous sodium sulfate, filtered, and centrifuged to obtain compound 3 from the crude product via flash chromatography (DCM / MeOH=50 / 1~20 / 1). [ka]

[1013] Compound 3 (50 mg, 0.09 mmol, 1 eq) is dissolved in anhydrous tetrahydrofuran (10 mL), and methylmagnesium bromide (0.15 mL, 0.45 mmol, 5 eq, 3M) is added dropwise at 0 ° C under nitrogen gas protection, the reaction is carried out for 0.5 hours, and then quenched with saturated aqueous ammonium chloride solution, and the organic phase is extracted with ethyl acetate, dried over anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB35424 from the crude product via reverse phase column chromatography (acetonitrile / water + 0.01% formic acid).

[1014] Compound AB35424: MS-ESI: Theoretical value [M+H] + : 481.23, Measured value [M+H] + :481.20. 1 H NMR (400 MHz, DMSO-d 6) δ 7.25 (s, 1H), 7.04-7.02 (m, 1H), 6.82-6.66 (m, 3H), 6.00 (d, J= 4.0 Hz, 2H), 5.92 (s, 1H), 4.86-4.81 (m, 1H), 3.96-3.91 (m, 2H), 3.75 (s, 3H), 3.28-3.26 (m, 4H), 2.84-2.74 (m, 2H), 1.39 (s, 9H), 1.03 (d, J= 8.0 Hz, 3H).

[1015] Example 26 Synthesis of compound AB35426 The chemical structure of the compound AB35426 is as follows: [ka]

[1016] The method for synthesizing compound AB35426 is as follows. [ka]

[1017] Compound 1 (200 mg, 0.56 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and hexylmagnesium bromide (3.4 mL, 3.36 mmol, 6 eq, 1 M) was added under the protection of nitrogen gas at 0 °C, and the reaction was carried out at room temperature for 0.5 hours. The reaction solution was quenched with saturated aqueous ammonium chloride solution, and the organic phase was extracted twice with ethyl acetate, washed with brine, dried over anhydrous sodium sulfate, filtered, centrifuged, and analyzed by thin layer chromatography.

[1018] Compound AB35426 is obtained from the crude product via (DCM / MeOH=30 / 1). Compound AB35426: MS-ESI: Theoretical value [M+H] + : 405.19, Measured value [M+H] + :406.25. 1H NMR (400 MHz, CDCl 3 ) δ 7.13 (s, 1H), 6.66 (d, J= 4.0 Hz, 1H), 6.59 (s, 1H), 6.51 (d, J= 8.0 Hz, 1H), 5.95-5.94 (m, 3H), 5.83 (d, J= 8.0 Hz, 2H), 4.58-4.56 (m, 1H), 3.46-3.41 (m, 1H), 3.26-3.23 (m, 1H), 2.89-2.77 (m, 2H), 1.85-1.76 (m, 1H), 1.64-1.57 (m, 1H), 1.28-1.19 (m, 8H), 0.84-0.81 (m, 3H).

[1019] Example 27 Synthesis of compound AB35427 The chemical structure of the compound AB35427 is as follows: [ka]

[1020] The method for synthesizing compound AB35427 is as follows. [ka]

[1021] Compound 1 (500 mg, 1.41 mmol, 1 eq) was dissolved in methanol (10 mL), potassium carbonate (583 mg, 4.22 mmol, 3.0 eq) was added, and the mixture was stirred at 0 o In C, sodium borohydride (53 mg, 1.41 mmol, 1.0 eq) is dissolved in 5% aqueous sodium hydroxide solution, the above solution is dripped in, and the reaction is carried out for 2 hours. When the reaction is complete, the reaction solution is filtered and the solid is washed with ethanol 2 to 3 times. The solid is filtered and collected to obtain compound 2 (800 mg, yield: 99.9%) as a yellow solid. [ka]

[1022] Compound 2 (400 mg, 1.26 mmol, 1 eq) was dissolved in alcohol / acetic acid (12 mL / 2 mL), phenylpropylaldehyde (1.69 g, 12.58 mmol, 10 eq) was added, and the mixture was stirred for 90 o C, the reaction is carried out for 4 hours, and then an appropriate amount of hydrochloric acid is added to the reaction solution and concentrated. A small amount of dichloromethane and an appropriate amount of ethyl acetate are added to the crude product, and the product is left for 0.5 hours, and the solid matter is filtered off. The filtrate is left overnight to precipitate the solid matter. The solid matter is filtered and collected to obtain compound 4 (160 mg, yield: 29.9%) as a yellow solid. [ka]

[1023] Compound 4 (90 mg, 0.21 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and methyl magnesium bromide (1 mL, 1.03 mmol, 5 eq, 3M) was added under nitrogen gas protection at 0°C, and the reaction was carried out at room temperature for 0.5 hours. The reaction solution was quenched with saturated aqueous ammonium chloride solution, and the organic phase was extracted twice with ethyl acetate, washed with brine, dried over anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB35427 from the crude product via reverse phase column chromatography (acetonitrile / water + 0.01% formic acid).

[1024] Compound AB35427: MS-ESI: Theoretical value [M+H] + : 453.20, actual value: 454.20. 1H NMR (400 MHz, DMSO-d6) δ 7.23-7.21 (m, 2H), 7.17-7.15 (m, 3H), 6.81 (s, 2H), 6.69 (d, J= 8.0 Hz, 1H), 6.53 (d, J= 8.0 Hz, 1H), 6.00-5.99 (m, 3H), 5.90 (s, 1H), 4.55-4.51 (m, 1H), 3.16-3.04 (m, 2H), 2.73-2.46 (m, 6H), 1.95-1.69 (m, 2H), 20.99 (d, J= 4.0 Hz, 3H).

[1025] Example 28 Synthesis of compound AB35428 The chemical structure of the compound AB35428 is as follows: [ka]

[1026] The method for synthesizing compound AB35428 is as follows. [ka]

[1027] Compound 1 (100 mg, 0.21 mmol, 1 eq) was dissolved in chloroform (4 mL), ammonia water (2 mL) was added, and the reaction was carried out at room temperature for 48 hours. The reaction solution was diluted with water, and the organic phase was extracted with dichloromethane, dried over anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB35428 from the crude product via thin layer chromatography (DCM / MeOH=30 / 1).

[1028] Compound AB35428: MS-ESI: Theoretical value [M+H] + : 556.08, measured value [M+H] + :556.00. 1H NMR (400 MHz, DMSO-d6) δ 7.28-7.24 (m, 2H), 7.21-7.14 (m, 3H), 6.96 (d, J= 12.0 Hz, 1H), 6.85 (s, 1H), 6.73-6.71 (m, 2H), 6.07 (s, 1H), 6.02 (d, J= 4.0 Hz, 2H), 5.97 (s, 1H), 5.44 (s, 1H), 3.80-3.75 (m, 1H), 3.63-3.61 (m, 1H), 2.70-2.53 (m, 6H), 1.88-1.74 (m, 2H).

[1029] Example 29 Synthesis of compound AB35429 The chemical structure of the compound AB35429 is as follows: [ka]

[1030] The method for synthesizing compound AB35428 is as follows. [ka]

[1031] Compound 1 (400 mg, 0.81 mmol, 1.0 eq) was dissolved in methanol (30 mL), and ammonia water (7 mL) was added. Ammonium chloride (44 mg, 0.81 mmol, 1.0 eq) was further added, and the mixture was stirred for 70 o The reaction was allowed to proceed for 16 hours at room temperature. After TLC and LCMS showed the reaction was complete, the reaction mixture was diluted with water, and the organic phase was extracted twice with dichloromethane, dried over anhydrous sodium sulfate, filtered, and centrifuged to obtain the crude compound 2 (190 mg, yield: 42.2%) as a yellow solid via flash chromatography (DCM / MeOH=100 / 1-50 / 1). [ka]

[1032] Compound 2 (80 mg, 0.19 mmol, 1.0 eq) was dissolved in tetrahydrofuran (5 mL), and methyl magnesium bromide (0.4 mL, 1.14 mmol, 6.0 eq, 3M) was added at 0 ° C under the protection of nitrogen gas, and the reaction was carried out for 0.5 hours by raising the temperature to room temperature, and the reaction was carried out by TLC inspection, and the complete reaction was achieved by LCMS inspection, and the reaction was quenched with saturated aqueous ammonium chloride solution, and the organic phase was extracted with ethyl acetate, dried with anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB35429 (10 mg, yield: 12.5%) as a yellow solid from the crude product through reverse phase column chromatography (acetonitrile / water + 0.01% formic acid).

[1033] Compound AB35429: MS-ESI: Theoretical value [M+H] + : 409.21, measured value [M+H+H2O]+: 428.10. 1H NMR (400 MHz, DMSO-d6) δ 7.23 (s, 1H), 6.80-6.64 (m, 3H), 5.98 (d, J= 4.0 Hz, 2H), 5.90 (s, 1H), 4.75-4.70 (m, 1H), 3.96-3.87 (m, 2H), 3.74-3.71 (m, 5H), 3.26-3.20 (m, 2H), 2.81-2.72 (m, 2H), 1.95-1.79 (m, 4H), 1.03 (d, J= 8.0 Hz, 3H).

[1034] Example 30 Synthesis of compound AB35430 The chemical structure of the compound AB35430 is as follows: [ka]

[1035] The method for synthesizing compound AB35430 is as follows. [ka]

[1036] Compound 1 (150 mg, 0.28 mmol, 1.0 eq) was dissolved in tetrahydrofuran (10 mL), cycloamylmagnesium bromide (1.4 mL, 1.4 mmol, 5 eq, 1M) was added at 0°C, the reaction was carried out at room temperature for 0.5 hours, TLC was performed, and the complete reaction was achieved by LCMS, quenching was performed using saturated aqueous ammonium chloride solution, the organic phase was extracted twice with ethyl acetate, dried over anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB35430 from the crude product via thin layer chromatography (DCM / MeOH=30 / 1).

[1037] Compound AB35430: MS-ESI: Theoretical value [M+H] + : 512.14, measured value [M+H] + :512.10. 1H NMR (400 MHz, CDCl3) δ 7.13 (s, 1H), 6.74 (s, 2H), 6.58 (s, 1H), 5.93 (s, 2H), 5.83 (s, 1H), 4.65 (d, J= 4.0 Hz, 1H), 4.26-4.21 (m, 1H), 4.03-3.97 (m, 1H), 3.82 (s, 3H), 3.80-3.67 (m, 2H), 3.60-3.44 (m, 2H), 2.89-2.76 (m, 2H), 2.46-2.16 (m, 3H), 1.76-1.70 (m, 1H), 1.48-1.30 (m, 7H).

[1038] Example 31 Synthesis of compound AB35434 The chemical structure of the compound AB35434 is as follows: [ka]

[1039] The method for synthesizing compound AB35434 is as follows. [ka]

[1040] Compound 1 (500 mg, 1.4 mmol, 1.0 eq) was dissolved in DMF (10 mL), compound 2 (949 mg, 8.4 mmol, 6 eq) was added, and the reaction was carried out at 75 °C under nitrogen gas protection for 16 h. TLC check was performed, and the reaction was complete by LCMS check. The organic phase was centrifuged and purified by flash chromatography (100-200 mesh silica gel, DCM / MeOH=20 / 1) to obtain the crude product as a yellow solid compound 3 (300 mg, yield: 49.3%). [ka]

[1041] Compound 3 (200 mg, 0.46 mmol, 1.0 eq) was dissolved in tetrahydrofuran (10 mL), and cycloamylmagnesium bromide (2.8 mL, 2.76 mmol, 6.0 eq, 1M) was added under the protection of nitrogen gas at 0 °C. o The reaction was carried out at C for 0.5 hours, TLC checked, and the complete reaction was confirmed by LCMS check, followed by quenching with saturated aqueous ammonium chloride solution, extracting the organic phase twice with ethyl acetate, drying with anhydrous sodium sulfate, filtering, and then centrifuging, and obtaining compound AB35434 from the crude product via reverse phase column chromatography (acetonitrile / water + 0.01% formic acid).

[1042] Compound AB35434: MS-ESI: Theoretical value [M+H] + : 468.19, actual value: 468.45. 1 H NMR (400 MHz, CDCl 3) δ 7.13 (s, 1H), 6.74 (s, 2H), 6.57 (s, 1H), 5.92 (s, 2H), 5.82 (s, 1H), 4.61 (d, J= 8.0 Hz, 1H), 4.23-4.21 (m, 1H), 4.00-3.84 (m, 2H), 3.79 (s, 4H), 3.58-3.43 (m, 2H), 2.88-2.81 (m, 2H), 2.36-2.28 (m, 2H), 2.16-2.06 (m, 1H), 1.74-1.37 (m, 8H).

[1043] Example 32 Synthesis of compound AB35436 The chemical structure of the compound AB35436 is as follows: [ka]

[1044] The method for synthesizing compound AB35436 is as follows. [ka]

[1045] Compound 2 (2.0 g, 5.93 mmol, 1 eq) was dissolved in alcohol / acetic acid (10 mL / 8 mL), phenylpropylaldehyde (7.9 g, 59.3 mmol, 10 eq) was added, and the mixture was stirred for 80 o C, the reaction is carried out for 4 hours, and then an appropriate amount of hydrochloric acid is added to the reaction solution and concentrated. A small amount of dichloromethane and an appropriate amount of ethyl acetate are added to the crude product, and the product is left for 0.5 hours, and the solid matter is filtered off. The filtrate is left overnight to precipitate the solid matter. The solid matter is filtered and collected to obtain compound 3 (1.4 g, yield: 48.2%) as a yellow solid. [ka]

[1046] Compound 3 (200 mg, 0.41 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and cycloamylmagnesium bromide (0.7 mL, 2.05 mmol, 5 eq, 3M) was added under nitrogen gas protection at 0°C, and the reaction was carried out at room temperature for 0.5 hours. The reaction solution was quenched with saturated aqueous ammonium chloride solution, and the organic phase was extracted twice with ethyl acetate, washed with brine, dried over anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB35436 from the crude product via reverse phase column chromatography (acetonitrile / water + 0.01% formic acid).

[1047] Compound AB35436: MS-ESI: Theoretical value [M+H] + :524.28, actual value:524.30. 1 H NMR (400 MHz, CDCl 3 ) δ 7.26-7.16 (m, 5H), 6.83-6.74 (m, 4H), 6.01 (d, J= 4.0 Hz, 2H), 4.40 (d, J= 8.0 Hz, 1H), 3.76 (s, 3H), 3.72 (s, 3H), 2.69-2.65 (m, 2H), 2.12-2.05 (m, 1H), 1.98-1.85 (m, 2H), 1.76-1.68 (m, 1H), 1.47-1.43 (m, 4H), 1.34-1.16 (m, 9H).

[1048] Example 33 Synthesis of compound AB35438 The chemical structure of the compound AB35438 is as follows: [ka]

[1049] The method for synthesizing compound AB35438 is as follows. [ka]

[1050] Compound 1 (2 g, 5.59 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (20 mL), and cycloamylmagnesium bromide (28 mL, 27.95 mmol, 5 eq, 1M) was added under nitrogen gas protection at 0 °C. The reaction was carried out at room temperature for 0.5 h. The reaction solution was quenched with saturated aqueous ammonium chloride solution, and the organic phase was extracted twice with ethyl acetate, washed with brine, dried over anhydrous sodium sulfate, filtered, and centrifuged to obtain compound 3 (1.2 g, yield: 54.5%) as a yellow solid from the crude product via flash chromatography (DCM / MeOH=100 / 1~50 / 1). [ka]

[1051] Compound 3 (200 mg, 0.51 mmol, 1 eq) was dissolved in dimethylformamide (10 mL), potassium carbonate (211 mg, 1.53 mmol, 3 eq) and compound 4 (222 mg, 1.02 mmol, 2 eq) were added, and the reaction was carried out at room temperature for 12 hours. The reaction solution was diluted with water, and the organic phase was extracted twice with dichloromethane, washed with brine, dried over anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB35438 from the crude product via reverse phase column chromatography (acetonitrile / water + 0.01% formic acid).

[1052] Compound AB35438: MS-ESI: Theoretical value [M+H] + :528.31, actual value:528.45. 1H NMR (400 MHz, DMSO-d6) δ 6.81 (s, 2H), 6.77 (d, J= 8.0 Hz, 1H), 6.55 (d, J= 8.0 Hz, 1H), 5.98 (d, J= 12.0 Hz, 2H), 5.09-5.00 (m, 2H), 4.58 (d, J= 8.0 Hz, 1H), 3.75 (s, 3H), 3.30-3.10 (s, 5H), 2.70-2.51 (m, 2H), 2.10-1.98 (m, 5H), 1.66 (s, 3H), 1.53 (s, 3H), 1.50 (s, 3H), 1.41-1.37 (m, 4H), 1.30-1.21 (m, 4H).

[1053] Example 34 Synthesis of compound AB35440 The chemical structure of the compound AB35440 is as follows: [ka]

[1054] The method for synthesizing compound AB35440 is as follows. [ka]

[1055] Compound 1 (500 mg, 1.40 mmol, 1 eq) was dissolved in N,N-dimethylformamide (50 mL), compound 2 (862 mg, 5.6 mmol, 4 eq) was added, and the reaction was carried out at 60 °C for 16 hours. TLC check was performed, and the reaction was complete by LCMS check. The reaction solution was diluted with water, and the organic phase was extracted twice with dichloromethane, dried over anhydrous sodium sulfate, filtered, and centrifuged to obtain the crude compound 3 (100 mg, yield: 15%) as a yellow solid via flash chromatography (DCM / MeOH=50 / 1~20 / 1). [ka]

[1056] Compound 3 (100 mg, 0.21 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (5 mL), and cycloamylmagnesium bromide (0.4 mL, 1.05 mmol, 5 eq, 3M) was added under nitrogen gas protection at 0°C, and the reaction was carried out at room temperature for 0.5 hours. The reaction solution was quenched using saturated aqueous ammonium chloride solution, and the organic phase was extracted twice with ethyl acetate, dried over anhydrous sodium sulfate, filtered, and then centrifuged to remove the liquid. Compound AB35440 was obtained from the crude product via reverse phase column chromatography (acetonitrile / water + 0.01% formic acid).

[1057] Compound AB35440: MS-ESI: Theoretical value [M+H]+: 510.24, Found value: 510.25. 1 H NMR (400 MHz, DMSO-d6) δ 7.21 (s, 1H), 6.79 (d, J= 8.0 Hz, 1H), 6.74 (s, 1H), 6.64 (d, J= 8.0 Hz, 1H), 5.97 (s, 2H), 5.89 (s, 1H), 4.50 (d, J= 8.0 Hz, 1H), 4.03-4.00 (m, 1H), 3.77-3.72 (m, 4H), 3.65-3.61 (m, 2H), 3.42-3.36 (m, 2H), 2.90-2.84 (m, 1H), 2.66-2.64 (m, 1H), 2.20-2.13 (m, 1H), 1.73-1.57 (m, 6H), 1.47-1.41 (m, 6H), 1.28-1.15 (m, 4H).

[1058] Example 35 Synthesis of compound AB35441 The chemical structure of the compound AB35441 is as follows: [ka]

[1059] The method for synthesizing compound AB35441 is as follows. [ka]

[1060] Compound 1 (100 mg, 0.23 mmol, 1 eq) is dissolved in aqueous ammonia (3 mL) and chloroform (6 mL) and stirred at room temperature for 48 hours. The reaction mixture is diluted with water, and the organic phase is extracted with dichloromethane, dried over anhydrous sodium sulfate, filtered, and centrifuged to obtain compound AB35441 from the crude product via thin layer chromatography (DCM / MeOH=50 / 1).

[1061] Compound AB35441: MS-ESI: Theoretical value [M+H]+: 516.02, Found value: 516.25. 1 H NMR (400 MHz, DMSO-d6) δ 7.31 (s, 1H), 7.09 (d, J= 12.0 Hz, 1H), 6.89 (d, J= 4.0 Hz, 1H), 6.77 (s, 1H), 6.32 (s, 1H), 5.99 (d, J= 4.0 Hz, 2H), 5.63 (s, 1H), 4.23-4.19 (m, 1H), 3.90-3.88 (m, 3H), 3.79-3.74 (m, 4H), 3.65-3.60 (m, 1H), 3.27-3.21 (m, 1H), 2.73-2.67 (m, 1H), 2.21-2.20 (m, 1H), 2.09-2.02 (m, 1H).

[1062] Example 36 Synthesis of compound AB35444 The chemical structure of the compound AB35444 is as follows: [ka]

[1063] The method for synthesizing compound AB35444 is as follows. [ka]

[1064] Compound 1 (3 g, 8.89 mmol, 1 eq) was dissolved in alcohol / acetic acid (30 mL / 5 mL), phenylpropylaldehyde (10.7 g, 88.9 mmol, 10 eq) was added, and the mixture was stirred for 90 o C, the reaction is carried out for 4 hours, and then an appropriate amount of hydrochloric acid is added to the reaction solution and concentrated. A small amount of dichloromethane and an appropriate amount of ethyl acetate are added to the crude product, and the product is left for 0.5 hours, and the solid matter is filtered off. The filtrate is left overnight to precipitate the solid matter. The solid matter is filtered and collected to obtain compound 3 (1.8 g, yield: 42.8%) as a yellow solid. [ka]

[1065] Compound 3 (300 mg, 0.63 mmol, 1 eq) was dissolved in aqueous ammonia (4 mL), chloroform (8 mL) was added, and the reaction was carried out at room temperature under nitrogen gas protection for 48 hours. The reaction solution was diluted with water, and the organic phase was extracted with dichloromethane, dried over anhydrous sodium sulfate, filtered, and centrifuged to obtain compound AB35444 from the crude product via flash chromatography (DCM / MeOH=100 / 1~50 / 1).

[1066] Compound AB35444: MS-ESI: Theoretical value [M+H] + :558.10, actual value:558.05. 1 H NMR (400 MHz, DMSO-d6) δ 7.30 (d, J= 4.0 Hz, 4H), 7.21-7.18 (m, 3H), 6.97 (s, 1H), 6.87 (s, 1H), 6.03 (s, 1H), 6.00 (s, 1H), 5.58 (s, 1H), 3.85-3.79 (m, 7H), 3.62-3.59 (m, 1H), 2.90-2.70 (m, 5H), 2.58-2.51 (m, 1H).

[1067] Example 37 Synthesis of compound AB35445 The chemical structure of the compound AB35445 is as follows: [ka]

[1068] The method for synthesizing compound AB35445 is as follows. [ka]

[1069] Compound 1 (5.0 g, 13.97 mmol, 1.0 eq) was dissolved in dichloromethane (300 mL), and trifluoromethanesulfonic anhydride (4.3 g, 15.37 mmol, 1.1 eq) was added at 0 °C. The reaction was carried out at room temperature for 1 h. TLC check was performed, and the complete reaction was confirmed by LCMS check. The reaction solution was quenched with water, and the organic phase was extracted twice with dichloromethane, dried over anhydrous sodium sulfate, filtered, and centrifuged to obtain the crude compound 2 (3.4 g, yield: 40.5%) as a yellow solid via flash chromatography (DCM / MeOH=100 / 1-50 / 1). [ka]

[1070] Compound 2 (300 mg, 0.49 mmol, 1.0 eq) was dissolved in dioxane (10 mL), and compound 3 (330 mg, 2.32 mmol, 4.6 eq), triethylamine (201 mg, 1.99 mmol, 4.0 eq), palladium acetate (22 mg, 0.099 mmol, 0.2 eq) and 1,1'-binaphthyl-2,2'-diphenylphosphine (62 mg, 0.099 mmol, 0.2 eq) were added, and the mixture was stirred for 100 minutes under the protection of nitrogen gas. oThe reaction was carried out at C for 16 h. TLC check was performed and the reaction was exhaustive by LCMS check. The reaction was diluted with water, the organic phase was extracted twice with ethyl acetate, dried over anhydrous sodium sulfate, filtered, and centrifuged, and the crude product was purified by flash chromatography (DCM / MeOH=50 / 1) to obtain compound 4 (150 mg, yield: 51.4%) as a yellow solid. [ka]

[1071] Compound 4 (150 mg, 0.25 mmol, 1.0 eq) was dissolved in chloroform (8 mL) and aqueous ammonia (4 mL), and the reaction was carried out at 40 °C overnight. TLC check was performed, and the reaction was confirmed by LCMS check. The reaction solution was diluted with water, and the organic phase was extracted twice with dichloromethane, dried over anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB35445 from the crude product via flash chromatography (DCM / MeOH=100 / 1 to 50 / 1).

[1072] Compound AB35445: MS-ESI: Theoretical value [M+H] + :564.15, actual value:564.40. 1 H NMR (400 MHz, DMSO-d6) δ 7.27 (s, 1H), 7.03-6.98 (m, 2H), 6.77 (s, 1H), 6.25 (s, 1H), 5.98 (d, J= 8.0 Hz, 2H), 5.93 (s, 1H), 3.76 (s, 3H), 3.72-3.59 (m, 3H), 3.17-3.03 (m, 2H), 2.81-2.68 (m, 4H), 2.59-2.48 (m, 1H), 2.29-2.25 (m, 2H), 2.18-2.03 (m, 2H), 1.42-1.39 (m, 2H), 1.29-1.26 (m, 2H), 0.89-0.85 (m, 3H).

[1073] Example 38 Synthesis of compound AB35448 The chemical structure of the compound AB35448 is as follows: [ka]

[1074] The method for synthesizing compound AB35448 is as follows. [ka]

[1075] Compound 1 (300 mg, 0.63 mmol, 1 eq) was dissolved in anhydrous tetrahydrofuran (10 mL), and cycloamylmagnesium bromide (3.2 mL, 3.15 mmol, 5 eq, 1M) was added at 0° C. under the protection of nitrogen gas, and the reaction was carried out at room temperature for 0.5 hours. The reaction solution was quenched using a saturated aqueous ammonium chloride solution, and the organic phase was extracted twice with ethyl acetate, dried over anhydrous sodium sulfate, filtered, and then centrifuged to remove the liquid. Compound AB35448 was obtained from the crude product through reverse phase column chromatography (acetonitrile / water + 0.01% formic acid).

[1076] Compound AB35448: MS-ESI: Theoretical value [M+H]+: 510.26, Found value: 510.20. 1 H NMR (400 MHz, DMSO-d6) δ 7.30-7.25 (m, 4H), 7.20-7.16 (m, 1H), 7.05-6.93 (m, 2H), 6.81 (d, J= 4.0 Hz, 2H), 6.00 (s, 2H), 4.43 (d, J= 8.0 Hz, 1H), 3.79 (s, 3H), 3.75 (s, 3H), 3.35-3.32 (m, 2H), 2.91-2.65 (m, 5H), 2.51-2.48 (m, 1H), 2.21-2.13 (m, 1H), 1.50-1.24 (m, 9H).

[1077] Example 39 Synthesis of compound AB35453 The chemical structure of the compound AB35453 is as follows: [ka]

[1078] The method for synthesizing compound AB35453 is as follows. [ka]

[1079] Compound 1 (700 mg, 1.16 mmol, 1.0 eq) was dissolved in dioxane (20 mL), and compound 2 (460 mg, 4.64 mmol, 4.0 eq), triethylamine (469 mg, 4.64 mmol, 4.0 eq), palladium acetate (52 mg, 0.232 mmol, 0.2 eq) and 1,1'-binaphthyl-2,2'-diphenylphosphine (144 mg, 0.232 mmol, 0.2 eq) were added, and the mixture was stirred for 100 minutes under the protection of nitrogen gas. o The reaction was run at C for 16 h. TLC check was performed and the reaction was exhaustive by LCMS check. The reaction was diluted with water, the organic phase was extracted twice with ethyl acetate, dried over anhydrous sodium sulfate, filtered, and centrifuged, and the crude product was purified by flash chromatography (DCM / MeOH=50 / 1) to give compound 3 (280 mg). [ka]

[1080] Compound 3 (150 mg, 0.27 mmol, 1.0 eq) was dissolved in chloroform (8 mL) and aqueous ammonia (4 mL), and the reaction was carried out at 40 °C overnight. TLC check was performed, and the complete reaction was confirmed by LCMS check. The reaction solution was diluted with water, and the organic phase was extracted twice with dichloromethane, dried over anhydrous sodium sulfate, filtered, and then centrifuged to obtain compound AB35453 from the crude product via flash chromatography (DCM / MeOH=100 / 1 to 50 / 1).

[1081] Compound AB35453: MS-ESI: Theoretical value [M+H] + :521.11, actual value:521.15. 1 H NMR (400 MHz, CDCl 3 ) δ 7.15 (s, 1H), 6.98-6.90 (m, 2H), 6.61 (s, 1H), 6.07 (s, 1H), 6.03 (s, 1H), 5.95 (d, J= 4.0 Hz, 2H), 3.91-3.86 (m, 1H), 3.81 (s, 3H), 3.68-3.64 (m, 1H), 3.55-3.49 (m, 1H), 3.31-3.26 (m, 1H), 3.06-2.99 (m, 2H), 2.78-2.72 (m, 2H), 1.68-1.61 (m, 1H), 1.49-1.45 (m, 1H), 1.36-1.26 (m, 3H), 0.99 (d, J= 4.0 Hz, 3H).

[1082] Example 40 Synthesis of compound AB35454 The chemical structure of the compound AB35454 is as follows: [ka]

[1083] The method for synthesizing compound AB35454 is as follows. [ka]

[1084] Compound 1 (200 mg, 0.36 mmol, 1.0 eq) is dissolved in tetrahydrofuran (10 mL), and cycloamylmagnesium bromide (2.2 mL, 2.16 mmol, 6 eq, 1M) is added at 0 ° C under the protection of nitrogen gas, and the reaction is carried out at room temperature for 0.5 hours, and TLC is performed. The reaction is complete as determined by LCMS. The reaction is quenched with saturated aqueous ammonium chloride solution, and the organic phase is extracted twice with ethyl acetate, dried with anhydrous sodium sulfate, filtered, and then centrifuged to remove the liquid. Compound AB35454 is obtained from the crude product through reverse phase column chromatography (acetonitrile / water + 0.01% formic acid).

[1085] Compound AB35454: MS-ESI: Theoretical value [M+H]+: 540.27, Found value: 540.40. 1 H NMR (400 MHz, DMSO-d6): δ 7.27-7.23 (m, 2H), 7.20 (s, 1H), 6.92-6.89 (m, 3H), 6.79 (d, J= 8.0 Hz, 1H), 6.72 (s, 1H), 6.65 (d, J= 8.0 Hz, 1H), 5.96 (s, 2H), 5.88 (s, 1H), 4.51 (d, J= 8.0 Hz, 1H), 4.11-4.02 (m, 3H), 3.81-3.79 (m, 1H), 3.71 (s, 3H), 3.35-3.28 (m, 2H), 2.89-2.79 (m, 1H), 2.61-2.56 (m, 1H), 2.18-2.12 (m, 1H), 1.91-1.82 (m, 4H), 1.54-1.15 (m, 8H).

[1086] Example 41 Synthesis of compound AB35455 The chemical structure of the compound AB35455 is as fol...

Claims

1. A compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof; 【Chemistry 1】 (R １ and R ２ each independently represents a hydrogen atom, a deuterium atom, a halogen atom, a substituted or unsubstituted C1-C16 alkyl group, a substituted or unsubstituted C3-C16 cycloalkyl group, a substituted or unsubstituted 3-12 membered heterocycloalkyl group, a substituted or unsubstituted C1-C16 halogenated alkyl group, a substituted or unsubstituted C3-C16 halogenated cycloalkyl group, a substituted or unsubstituted C6-C16 aryl group, or a substituted or unsubstituted 5-12 membered heteroaryl group; R ３ , R ４ and R ５ are each independently a hydrogen atom, a halogen atom, R １７ -O-, R １７ -S- or (R １８ R １９ )N-; or R ３ and R ４ , or R ４ and R ５ are joined to form a substituted or unsubstituted 3- to 12-membered heterocycloalkyl ring; R ６ , R ８ , R １１ , R １２ , R １３ , R １４ and R １５ each independently represents a hydrogen atom, a substituted or unsubstituted C1-C8 alkyl group, or a halogen atom; R ７ represents a hydrogen atom, a substituted or unsubstituted C1-C12 alkyl group, a substituted or unsubstituted C1-C12 halogenated alkyl group, a substituted or unsubstituted C6-C16 aryl group-substituted or unsubstituted C1-C12 alkyl group-, or a substituted or unsubstituted 5-16 membered heteroaryl group-substituted or unsubstituted C1-C12 alkyl group-; R ９ and R １０ are joined to form a substituted or unsubstituted 3- to 12-membered heterocycloalkyl ring; R １７ represents a hydrogen atom or a substituted or unsubstituted C1-C16 alkyl group; 【Chemistry 2】 Substituted or unsubstituted C3-C16 cycloalkyl group, substituted or unsubstituted 3-12 membered heterocycloalkyl group, substituted or unsubstituted C3-C16 cycloalkyl group-substituted or unsubstituted C2-C10 acyl group-, substituted or unsubstituted C3-C16 cycloalkyl group-C(O)-, substituted or unsubstituted C1-C16 halogenated alkyl group, substituted or unsubstituted C3-C16 halogenated cycloalkyl group, substituted or unsubstituted 3-12 membered heterocycloalkyl group-substituted or unsubstituted C1-C12 alkyl group-, substituted or unsubstituted C6-C16 aryl group-substituted or unsubstituted C1-C12 alkyl group-, substituted or unsubstituted C6-C16 aryl group-substituted or unsubstituted C6-C16 aryl group-substituted or unsubstituted C1-C12 alkyl group-, substituted or unsubstituted 5- 16-membered heteroaryl group-substituted or unsubstituted C1-C12 alkyl group-, substituted or unsubstituted C6-C16 aryl group-O-substituted or unsubstituted C1-C12 alkyl group-, substituted or unsubstituted C6-C16 aryl group-S-substituted or unsubstituted C1-C12 alkyl group-, substituted or unsubstituted 5-16-membered heteroaryl group-O-substituted or unsubstituted C1-C12 alkyl group-, substituted or unsubstituted 5-16-membered heteroaryl group-S-substituted or unsubstituted C1-C12 alkyl group-, substituted or unsubstituted C2-C8 alkenyl group-substituted or unsubstituted C1-C8 alkyl group-substituted or unsubstituted C2-C8 alkenyl group-substituted or unsubstituted C1-C8 alkyl group-, substituted or unsubstituted C2-C8 alkenyl group-substituted or unsubstituted C1-C8 alkyl group-, or (R ２０ R ２１ ) N-substituted or unsubstituted C1-C12 alkyl group-; R １８ and R １９ each independently represents a hydrogen atom, a substituted or unsubstituted C1-C12 alkyl group, a substituted or unsubstituted C3-C12 cycloalkyl group, or a substituted or unsubstituted C6-C16 aryl group-substituted or unsubstituted C1-C12 alkyl group-; or R １８ and R １９ are joined to form a substituted or unsubstituted 3- to 12-membered heterocycloalkyl ring; R ２０ and R ２１ each independently represents a hydrogen atom, a substituted or unsubstituted C1-C12 alkyl group, a substituted or unsubstituted C3-C12 cycloalkyl group, or a substituted or unsubstituted C2-C10 ester group; or R ２０ and R ２１ are linked to form a substituted or unsubstituted 3- to 12-membered heterocycloalkyl group; said heterocycloalkyl group, said heteroaryl group and said heterocycloalkyl ring each independently have from 1 to 4 (preferably 1, 2, 3 or 4) heteroatoms selected from N, O and S on the heterocycle; The optional "substitution" mentioned above means that one or more (preferably 1, 2, 3, 4, 5, 6, 7, or 8) hydrogen atoms on the ring or atomic group are each independently replaced with a C1-C10 alkyl group, a C2-C6 alkenyl group, a C3-C12 cycloalkyl group, a C1-C10 halogenated alkyl group, a C3-C8 halogenated cycloalkyl group, a C3-C8 cycloalkoxyl group, a C3-C8 cycloalkylthiol group, a C3-C8 halogenated cycloalkoxyl group, a C3-C8 halogenated cycloalkylthiol group, a halogen atom, a nitro group ... a nitro group, -CN, a carbonyl group (=O), a hydroxyl group, a mercapto group, an amino group, a C1-C4 carboxyl group, a C2-C8 ester group, a C2-C4 acylamino group, a C2-C6 acyl group, a C1-C10 alkoxyl group, a C1-C10 alkylthiol group, a C1-C10 halogenated alkoxyl group, a C1-C10 halogenated alkylthiol group, a C6-C12 aryl group, a C6-C12 aryl group-O-, a 5-10 membered heteroaryl group, a 5-10 membered heteroaryl group-O-, a 5-10 membered heterocycloalkyl group, and (R ２０ R ２１ )N-).

2. 2. The compound of formula I according to claim 1, characterized in that the compound has the following chemical structure: 【Chemistry 3】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】

3. (a) a compound of formula I according to claim 1, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof; and (b) a pharma- ceutically acceptable carrier. A composition comprising:

4. Use of a compound of formula I according to claim 1, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, for the preparation of a composition or preparation for use in the prevention and / or treatment of tumors; The tumor is Tumors that express low levels or no NNMT gene; Tumors that highly express DNA methyltransferases, Tumors that highly express UHRF1, Tumors that hypermethylate the nucleotide site of the NNMT gene, and / or Tumors that hypermethylate DNA CpG sites in the NNMT gene region, 2. The use according to claim 1 ,

5. the DNA methyltransferase is selected from DNMT1, DNMT3a, DNMT3b, or a combination thereof; The tumor with low or no expression of the NNMT gene refers to a tumor in which the ratio (E1 / E0) between the expression level E1 of the NNMT gene in a certain cell (e.g., a tumor cell) and the expression level E0 of the NNMT gene in the same type of cell or a normal cell is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001, or ≦0.0000001; The tumor with high expression of DNA methyltransferase refers to a tumor in which the ratio (A1 / A0) between the expression level A1 of DNA methyltransferase in tumor cells and the expression level A0 of DNA methyltransferase in the same type of cells or normal cells is >1.0, preferably ≧1.2 or ≧1.5, more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50; The tumor with high expression of UHRF1 refers to a tumor in which the ratio (F1 / F0) between the expression level F1 of UHRF1 in tumor cells and the expression level F0 of UHRF1 in similar cells or normal cells is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50; said tumor having hypermethylation of the nucleotide site of the NNMT gene refers to a tumor in which the ratio (L1 / L0) between the methylation level L1 of the nucleotide site of the NNMT gene in a certain cell (e.g., a tumor cell) and the methylation level L0 of the nucleotide site of the NNMT gene in a similar cell or a normal cell (e.g., a cancerous bladder tissue cell) is >1.0, preferably ≧1.2 or ≧1.5, more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50; and / or The tumor with hypermethylation of the DNA CpG site of the NNMT gene region refers to a tumor in which the ratio (W1 / W0) between the methylation level W1 of the DNA CpG site of the NNMT gene region of a certain cell (e.g., a tumor cell) and the methylation level W0 of the DNA CpG site of the NNMT gene region of a similar cell or a normal cell (e.g., a cancerous bladder tissue cell) is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

5. The use according to claim 4.

6. The allogeneic cells are Similar tumor cells that normally or highly express the NNMT gene; Similar tumor cells that normally express or under-express DNA methyltransferases; Similar tumor cells that normally express or under-express UHRF1; Similar tumor cells that normally methylate or hypomethylate the nucleotide site of the NNMT gene, and / or including similar tumor cells that normally methylate or hypomethylate NNMT gene region DNA CpG sites; 6. Use according to claim 5.

7. The tumor is selected from lung cancer, kidney cancer, breast cancer, colon cancer, lymphoma, leukemia, pancreatic cancer, brain cancer, liver cancer, prostate cancer, or a combination thereof; 5. The use according to claim 4.

8. 2. The compound of formula I according to claim 1, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, is used to determine whether a tumor patient is suitable for the prevention and / or treatment of a tumor, A marker comprising the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of a nucleotide site in the NNMT gene and / or the methylation level of a DNA CpG site in the NNMT gene region.

9. 2. The compound of formula I according to claim 1, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, is used for the manufacture of a companion diagnostic kit for determining whether a tumor patient is suitable for the prevention and / or treatment of a tumor, (i) Use of a detection reagent kit comprising a detection reagent used for detecting the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of a nucleotide site of the NNMT gene, and / or the methylation level of a DNA CpG site in the NNMT gene region, The accompanying diagnostic kit the content that, when there is low or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, high methylation of nucleotide sites of the NNMT gene, and / or high methylation of DNA CpG sites in the NNMT gene region in tumor cells of a tumor patient, said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, becomes suitable for the prevention and / or treatment of tumors in said tumor patient; and / or and further comprising an instruction manual or label stating that high expression of the NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, low methylation of nucleotide sites of the NNMT gene, and / or low methylation of DNA CpG sites in the NNMT gene region in tumor cells of a tumor patient renders said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, unsuitable for the prevention and / or treatment of tumors in said tumor patient. Use of a detection reagent kit comprising:

10. (i) a detection agent used to detect the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of a nucleotide site of the NNMT gene, and / or the methylation level of a DNA CpG site in the NNMT gene region; (ii) the compound of formula I according to claim 1, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, A medical kit comprising:

11. Use of an inhibitor of the NNMT gene, an agent for promoting DNA methylation enzyme, an agent for promoting UHRF1, an agent for promoting methylation of nucleotide sites in the NNMT gene, and / or an agent for promoting methylation of DNA CpG sites in the NNMT gene region for the manufacture of a composition or formulation used to enhance the antitumor effect of an antitumor drug.

12. The antitumor drug comprises a compound of formula I according to claim 1, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof; 12. The use according to claim 11 .

13. (1) a first active ingredient comprising an antitumor drug; (2) a second active ingredient comprising an inhibitor of the NNMT gene, an enhancer of DNA methyltransferase, an enhancer of UHRF1, an enhancer of methylation of a nucleotide site of the NNMT gene, and / or an enhancer of methylation of a DNA CpG site in the NNMT gene region; A composition comprising:

14. The antitumor drug comprises a compound of formula I according to claim 1, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof; The composition of claim 13.

Images