Engineered T cells for cell therapy

Abstract

The present disclosure relates generally to genetically engineered T cells that contain a modified genome that expresses a protein of interest, and their use in cell therapy.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 320,461, filed March 16, 2022, which is incorporated by reference in its entirety.

[0002] Incorporation by Reference of Electronically Submitted Materials This application contains a Sequence Listing, submitted electronically in a file entitled "57363_Seqlisting.xml", created on March 16, 2023, and having a size of 3,161 bytes, which is incorporated herein by reference.

[0003] The present disclosure relates generally to genetically engineered T cells that contain a modified genome that expresses a protein of interest, and their use in cell therapy. [Background technology]

[0004] T lymphocytes or T cells are adaptive immune cells derived from lymphoid lineage precursors of hematopoietic stem cells in the bone marrow. T cells express at least CD3 and CD45 on their surface membrane. T cells are one of the most abundant white blood cells in blood and can be easily extracted from the periphery. Upon activation through the T cell receptor (TCR), T cells can further differentiate into memory T cells that can survive for decades.

[0005] Due to the durability of the treatment and the low risk of rejection by the patient, genetic modification of autologous T cells has been explored for the treatment of cancer and autoimmune diseases. The CRISPR / Cas9 system offers a method to alter specific genes of interest by creating targeted double-strand breaks (DSBs) that trigger the formation of small insertions or deletions created by semi-random repair via the non-homologous end joining (NHEJ) pathway. Summary of the Invention

[0006] The present disclosure provides a gene editing system for targeted insertion of a single gene or multiple gene coding sequences of a protein or enzyme in T cells, and the use of the engineered T cells as cell-based gene therapy. It is contemplated that the gene-edited T cells are useful as cell-based protein / enzyme replacement therapy for protein deficiency or enzyme disease.

[0007] Provided herein is a method for genetically engineering a T cell or a population of T cells to overexpress a gene of interest, comprising introducing into the T cell or population of T cells a viral vector, plasmid, nanoplasmid, or minicircle comprising an expression cassette comprising a homology arm (HA), a polynucleotide encoding the gene of interest, a splice acceptor site, a promoter, and a targeting site for a nuclease-dependent cleavage system targeting molecule, wherein the expression cassette is inserted into the locus targeted by the targeting molecule.

[0008] Also contemplated is a method for genetically engineering a T cell or population of T cells to overexpress an endogenous gene, comprising introducing into the T cell or population of T cells a viral vector, plasmid, nanoplasmid, or minicircle comprising an expression cassette comprising a homology arm (HA), a splice acceptor site, a promoter, and a targeting site for a nuclease-dependent cleavage system targeting molecule, wherein the expression cassette is inserted upstream of the target gene to be overexpressed.

[0009] In various embodiments, the homology arms are between 35 and 1000 nucleotides. In various embodiments, the homology arms are between 50 and 900 nucleotides, between 50 and 750 nucleotides, between 100 and 600 nucleotides, between 100 and 500 nucleotides, or between 200 and 400 nucleotides. In various embodiments, the homology arms are between 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 90, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000 nucleotides.

[0010] In various embodiments, the nuclease-dependent cleavage system comprises a CRISPR / Cas system, a Cas-CLOVER system, a zinc finger nuclease (ZFN) system, a transcription activator-like effector nuclease (TALEN) system, or a meganuclease system. In various embodiments, the CRISPR / Cas system comprises Cas9, Cas12a, Cas13a, or Cas13b.

[0011] In various embodiments, the nuclease-dependent cleavage system is a CRISPR / Cas system and the targeting molecule is a guide RNA.

[0012] In various embodiments, the method further comprises transfecting the T cell or population of T cells with a Cas protein or a polynucleotide encoding a Cas protein and a guide RNA molecule that directs integration of the expression cassette into a target locus in the genome of the T cell. In various embodiments, the target locus is the AAVS1 locus or the T cell receptor alpha constant (TRAC) locus.

[0013] In various embodiments, the plasmid, viral vector, nanoplasmid, or minicircle comprises inverted terminal repeats flanking a polynucleotide encoding a gene of interest for transposon delivery, in various embodiments, the plasmid, viral vector, nanoplasmid, or minicircle for transposon delivery comprises a promoter, a gene of interest, a biomarker, a regulatory element, and optionally a chimeric intron.

[0014] In various embodiments, the method further comprises introducing into the T cell or T cell population a polynucleotide encoding a biomarker molecule useful for enriching the T cell or population of T cells. In various embodiments, the biomarker molecule comprises a fragment of CD34 and a fragment of CD20. In various embodiments, the biomarker polynucleotide is on the same expression cassette as the homology arms, splice acceptor site, targeting site for a nuclease-dependent cleavage system targeting molecule, and promoter.

[0015] In various embodiments, the viral vector is a lentiviral vector, an adenoviral vector, or an AAV vector. In various embodiments, the viral vector is selected from the group consisting of a VSVg-pseudotyped lentiviral vector, an adenoviral vector, an AAV6 vector, an AAV1 vector, or an AAV-DJ vector.

[0016] In various embodiments, the gene of interest is integrated into the T cell genome via homology directed repair (HDR), homology mediated end joining (HMEJ), or a combination of HDR / HMEJ.

[0017] In various embodiments, the introduction of the plasmid, nanoplasmid, or minicircle is by transfection or electroporation. In various embodiments, the introduction of the viral vector is by electroporation. In various embodiments, the viral vector is at least 3×10 5 ~1×10 7 In various embodiments, a plasmid, viral vector, nanoplasmid, or minicircle for transposon delivery is electroporated with transposase mRNA and an expression cassette expressing a gene of interest.

[0018] In various embodiments, the efficiency of transduction is greater than 15%. In various embodiments, the efficiency of transduction is greater than 17%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55% or greater. In various embodiments, the T cell population has a viability of greater than 60%, 70%, 80%, 90% or greater after 3 days. In various embodiments, the T cell population has a viability of greater than 60% after 3 days.

[0019] In various embodiments, the T cells or population of T cells are CD4+ T cells, CD8+ T cells, a T cell line, primary T cells, naive T cells, effector T cells, regulatory T cells, memory T cells, or gamma-delta T cells.

[0020] In various embodiments, the viral vector, plasmid, nanoplasmid, or minicircle comprises a promoter next to or near the gene of interest. In various embodiments, the promoter is an exogenous T cell promoter. In various embodiments, the promoter is an MND promoter, a CMV promoter, a CAG promoter, a PGK promoter, an EF1A promoter, or a T cell specific promoter.

[0021] In various embodiments, the gene of interest is a therapeutic gene or encodes a therapeutic protein. In various embodiments, the therapeutic gene encodes an enzyme, a cytokine, a chemokine, a T-cell receptor, or a cell surface receptor. In various embodiments, the therapeutic gene encodes an enzyme, a cancer antigen, a cytokine, a chemokine, a T-cell receptor, or a cell surface receptor.

[0022] In various embodiments, the therapeutic protein is an enzyme, a cancer antigen, a cytokine, a chemokine, a T cell receptor, a cell surface receptor, a protein associated with a protein deficiency, or an extracellular membrane protein.

[0023] In various embodiments, the gene of interest is a donor polynucleotide that corrects a mutant genotype in a subject.

[0024] In various embodiments, the viral vector, plasmid, nanoplasmid, or minicircle further comprises a polynucleotide encoding a T cell receptor or a fragment thereof, or a chimeric antigen receptor (CAR).

[0025] Also provided is a method of generating a gene edited T cell or population of T cells, comprising: i) contacting a T cell or population of T cells with a viral vector, plasmid, nanoplasmid, or minicircle comprising an expression cassette comprising a polynucleotide comprising a homology arm (HA), a splice acceptor site, a promoter, and a targeting site for a nuclease dependent cleavage system targeting molecule, and optionally encoding a gene of interest; ii) culturing the T cell or population of T cells of i) in a medium that promotes expansion of T cells; iii) isolating the T cell or population of T cells of ii) based on identification of a marker expressed only on the T cells or population of T cells harboring the viral vector, plasmid, nanoplasmid, or minicircle; and iv) culturing the isolated cells of iii) in a culture medium to expand the isolated cells expressing the gene of interest.

[0026] Also provided is a method of generating a gene edited T cell or population of T cells, comprising: i) contacting a T cell or population of T cells with a viral vector, plasmid, nanoplasmid, or minicircle comprising an expression cassette comprising a polynucleotide comprising a homology arm (HA), a splice acceptor site, a promoter, and a targeting site for transposon delivery, and optionally encoding a gene of interest; ii) culturing the T cell or population of T cells of i) in a medium that promotes expansion of T cells; iii) isolating the T cell or population of T cells of ii) based on identification of a marker expressed only on T cells or population of T cells harboring the viral vector, plasmid, nanoplasmid, or minicircle; and iv) culturing the isolated cells of iii) in a culture medium to expand the isolated cells expressing the gene of interest.

[0027] In various embodiments, the method of generating a gene-edited T cell or population of T cells further comprises stimulating, expanding, or activating the T cell or population of T cells prior to the contacting step. In various embodiments, stimulating, expanding, or activating the T cell or population of T cells comprises contacting the cells with one or more of IL-2, IL-7, IL-15, IFN-gamma (IFN-γ), N-acetylcysteine ​​(NAC).

[0028] In various embodiments, the method of generating gene-edited T cells or populations of T cells produces gene-edited T cells with an efficiency of greater than 15%. In various embodiments, the method maintains 60% cell viability in culture after 3 days.

[0029] Also contemplated are gene-edited T cells or populations of T cells generated by the methods described herein. In various embodiments, gene-edited T cells are provided that include: i) a heterologous polynucleotide sequence encoding a gene of interest integrated into the T cell genome at a target location mediated by a nuclease-dependent cleavage system, the heterologous polynucleotide sequence also flanked by a portion of the homology arms and expressed via an endogenous promoter; and ii) a heterologous biomarker molecule.

[0030] In various embodiments, the gene edited T cells are CD4+ T cells, CD8+ T cells, T cell lines, primary T cells, naive T cells, effector T cells, regulatory T cells, memory T cells, or gamma-delta T cells.

[0031] In various embodiments, the gene-edited T cell or population of cells comprises a gene of interest that is a therapeutic gene or encodes a therapeutic protein. In various embodiments, the therapeutic gene encodes an enzyme, a cancer antigen, a cytokine, a chemokine, a T cell receptor, or a cell surface receptor. In various embodiments, the therapeutic gene encodes an enzyme, a cytokine, a chemokine, a T cell receptor, or a cell surface receptor. In various embodiments, the gene of interest is a donor polynucleotide that corrects a mutant genotype in the subject.

[0032] Further contemplated are methods of treating a disease or condition in a subject in need thereof, comprising administering to the subject a gene-edited T cell or population of T cells described herein. In various embodiments, the disease is an enzymopathy, an infectious disease, or a genetic disorder.

[0033] In various embodiments, the disease is an enzymopathy. In various embodiments, the enzymopathy is aspartylglucosaminuria, cholesterol ester storage disease, Wolman disease, metachromatic leukodystrophy, Danon disease, Fabry disease, Farber lipogranulomatosis, Farber disease, fucosidosis, galactosialidosis I / II, Gaucher disease I / II / III, globoid cell leukodystrophy, Krabbe disease, glycogen storage disease II, Pompe disease, GM1-gangliosidosis I / II / III, GM2-gangliosidosis I, Tay-Sachs disease, GM2-gangliosidosis II, Sandhoff disease, or the like. disease, GM2-gangliosidosis, α-mannosidosis type I / II, β-mannosidosis, mucolipidosis type I, sialidosis type I / II, mucolipidosis type II / III, Eissel's disease, mucolipidosis type IIIC, pseudo-Hurler polydystrophy, mucopolysaccharidosis type I, mucopolysaccharidosis type II, Hunter syndrome, mucopolysaccharidosis type IIIA, Sanfilippo syndrome type B, Sanfilippo syndrome type C, Sanfilippo syndrome type D, mucopolysaccharidosis type IIIB, mucopolysaccharidosis type IIIC, mucopolysaccharidosis type IIID, mucopolysaccharidosis type IVA, mucopolysaccharidosis type IVB The patient is selected from the group consisting of Morquio syndrome type A, Morquio syndrome type B, mucopolysaccharidosis type VI, mucopolysaccharidosis type VII, Sly syndrome, mucopolysaccharidosis type IX, multiple sulfatase deficiency, neuronal ceroid lipofuscinosis, CLN1 Batten disease, CLN2 Batten disease, Niemann-Pick disease type A / B, Niemann-Pick disease, Niemann-Pick disease type C1, Niemann-Pick disease type C2, pyknodysostosis, Schindler disease type I / II, and sialic acid storage diseases, hemophilia A, hemophilia B, Christmas disease, factor VII deficiency, spinal muscular atrophy, and epidermolysis bullosa dystrophy.

[0034] In various embodiments, the enzymopathy is mucopolysaccharidosis type I (MPS I) and the gene of interest is iduronidase.

[0035] In various embodiments, the administration alleviates one or more symptoms of MPS I. In various embodiments, the one or more symptoms of MPS I are selected from the group consisting of a reduction in glycosaminoglycan (GAG) species in tissues and / or urine, an increase in IDUA expression in tissues, improved cognition, and a reduction in vacuolated endothelial / foam cells in tissues.

[0036] In various embodiments, the genetic disorder is selected from the group consisting of muscular dystrophy, cystic fibrosis, sickle cell anemia, beta-thalassemia, lysosomal storage diseases, adenosine deaminase deficiency, severe combined immunodeficiency (SCID), retinitis pigmentosa, macular degeneration, and Wiskott-Aldrich syndrome.

[0037] In various embodiments, the T cells are CD4+ T cells, CD8+ T cells, T cell lines, primary T cells, naive T cells, effector T cells, regulatory T cells, memory T cells, or gamma-delta T cells. In various embodiments, the T cells are first isolated from the subject to be treated and then genetically modified according to the methods described herein. In various embodiments, the isolated genetically modified T cells are replaced back into the subject from which they originated.

[0038] Also provided by the present disclosure is a polynucleotide expression cassette comprising homology arms (HA), a polynucleotide encoding a gene of interest, a splice acceptor site, a promoter, and a targeting site for a nuclease-dependent cleavage system targeting molecule, wherein the expression cassette can be inserted into a locus targeted by the targeting molecule.

[0039] Further contemplated is a polynucleotide expression cassette comprising a homology arm (HA), a splice acceptor site, a promoter, and a targeting site for a nuclease-dependent cleavage system targeting molecule, wherein the expression cassette can be inserted upstream of a target gene to be overexpressed.

[0040] In various embodiments, the homology arms are between 35 and 1000 nucleotides. In various embodiments, the homology arms are between 50 and 900 nucleotides, between 50 and 750 nucleotides, between 100 and 600 nucleotides, between 100 and 500 nucleotides, or between 200 and 400 nucleotides. In various embodiments, the homology arms are between 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 90, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000 nucleotides.

[0041] In various embodiments, the nuclease-dependent cleavage system comprises a CRISPR / Cas system, a Cas-CLOVER system, a zinc finger nuclease (ZFN) system, a transcription activator-like effector nuclease (TALEN) system, or a meganuclease system. In various embodiments, the nuclease-dependent cleavage system is a CRISPR / Cas system and the targeting molecule is a guide RNA.

[0042] In various embodiments, the targeted locus is the AAVS1 locus or the T cell receptor alpha constant (TRAC) locus.

[0043] In various embodiments, the expression cassette further comprises a polynucleotide encoding a biomarker molecule useful for enriching T cells or a population of T cells, hi various embodiments, the biomarker molecule comprises a fragment of CD34 and a fragment of CD20.

[0044] In various embodiments, the expression cassette comprises a promoter next to or near the gene of interest.

[0045] In various embodiments, the promoter is an MND promoter, a CMV promoter, a CAG promoter, a PGK promoter, an EF1A promoter, an AAV promoter, or a T cell specific promoter.

[0046] In various embodiments, the expression cassette encodes a gene of interest that is a therapeutic gene or encodes a therapeutic protein. In various embodiments, the therapeutic gene encodes an enzyme, a cancer antigen, a cytokine, a chemokine, a T-cell receptor, or a cell surface receptor. In various embodiments, the therapeutic gene encodes an enzyme, a cytokine, a chemokine, a T-cell receptor, or a cell surface receptor. In various embodiments, the gene of interest is a donor polynucleotide that corrects a mutant genotype in the subject.

[0047] In various embodiments, the expression cassette further comprises a polynucleotide encoding a T cell receptor or fragment thereof, or a chimeric antigen receptor.

[0048] Also provided are viral vectors, plasmids, nanoplasmids, or minicircles comprising the expression cassettes described herein.

[0049] In various embodiments, the viral vector is a lentiviral vector, an adenoviral vector, or an AAV vector. In various embodiments, the viral vector is selected from the group consisting of a VSVg-pseudotyped lentiviral vector, an adenoviral vector, an AAV6 vector, an AAV1 vector, or an AAV-DJ vector.

[0050] Further aspects and advantages will be apparent to those skilled in the art from review of the following detailed description taken in conjunction with the drawings. While the compositions, articles, and methods are susceptible to embodiment in various forms, the following description includes specific embodiments, with the understanding that the disclosure is illustrative and is not intended to limit the invention to the specific embodiments described herein. For the compositions, articles, and methods described herein, optional features, including but not limited to components, compositional ranges thereof, substituents, conditions, and steps, are contemplated to be selected from the various aspects, embodiments, and examples provided herein. [Brief description of the drawings]

[0051] [Figure 1] rAAV Vector Construct. A promoterless GFP cassette consisting of a splice acceptor (SA) and GFP coding sequence flanked by homology arms targeting the AAVS1 locus was subcloned into the rAAV backbone and packaged into a rAAV vector. rAAV SA-GFP together with CRISPR / Cas9 mediated targeted insertion of GFP into the T cell genome. Upon successful integration, GFP can be expressed under the regulation of the endogenous AAVS1 promoter. [Figure 2A-2B] CRISPR / Cas9 with rAAV AAVS1 SA-GFP mediated efficient GFP transgene insertion in the T cell genome. (Figure 2A). No GFP-positive cells were observed in samples that received only the rAAV donor template (rAAV vector only). (Figure 2B) CRISPR / Cas9 mediated an engineering efficiency of up to 68%, as indicated by % GFP-positive T cells. [Diagram 3] Experimental outline for the pilot study. T cells were isolated from peripheral blood mononuclear cells from healthy donors and stimulated for 2 days prior to manipulation. Engineered cells were expanded for an additional 7 days before being sorted. Eight million sorted engineered T cells were injected intraperitoneally (IP) into IDUA-deficient mice. Blood was collected for plasma IDUA over a period of 4 months post-engraftment. At the end of the study, mice were euthanized to determine the persistence of T cells and IDUA / GAG in vital organs. [Figure 4A-4B] CRISPR / Cas9 with rAAV AAVS1 MND-IDUA-RQR9 mediated efficient transgene insertion in T cells. (Figure 4A) The MND-IDUA-RQR8 cassette consists of the MND promoter followed by the IDUA-T2A-RQR8 coding sequence, flanking both sides of the construct with homology arms targeting the AAVS1 locus. (Figure 4B) CRISPR / Cas9 mediated integration in 58% of T cells. [Diagram 5]High levels of IDUA expression were produced and secreted by engineered T cells in culture: greater than 400 nmol / hr / mL of IDUA was measured in medium containing engineered T cells, whereas no IDUA was observed in medium containing unengineered T cells. [Figure 6] The engineered T cells can be enriched using the RQR8 positive sorting strategy. The engineered T cells were enriched using the RQR8 positive enrichment strategy with a yield of 99.6% purity. [Figure 7] Assessment of plasma IDUA over 24 weeks post-engraftment. A single IP injection of purified engineered T cells into NSG-IDUA-deficient mice showed upregulation of IDUA levels in the third week, peaking at 6 weeks post-engraftment. Over a 24-week period post-engraftment, plasma IDUA levels in treated mice were comparable to or higher than those in heterozygous mice. [Figure 8] Human T cells were observed in all vital organs examined, including the heart, lungs, liver, spleen, kidneys, brain, and bone marrow, of treated IDUA-deficient mice, whereas no human T cells were observed in untreated heterozygous mice. [Figure 9] IDUA activity above physiological levels was observed in most of the vital organs tested. Relative IDUA activity was measured in tissue lysates from the organs. IDUA activity above physiological levels was observed in the lungs, liver, spleen, kidneys, spinal cord, brain, and bone marrow of treated mice compared to heterozygous levels. Only 50% of heterozygous IDUA was observed in the hearts of treated mice. [Figure 10]Exemplary plasmid constructs for non-viral T cell engineering approaches. Using the MND promoter sequence followed by the IDUA-T2A-RQR8 coding sequence, with homology arms targeting AAVS1 on a pAAV plasmid backbone, we demonstrated the feasibility of using plasmids for a non-viral approach to engineer T cells. [Figure 11A-11B] Using CRISPR / Cas9 reagents and transgene donor DNA template plasmids, T cells can be non-virally engineered. CRISPR / Cas9 and pAAV AAVS1 MND-IDUA-RQR8 plasmids were co-transfected via electroporation. Control samples were electroporated with PBS only. Flow cytometry analysis showed 0.92% RQR8 positive T cells in engineered samples, while no RQR8 was observed in control samples. The low engineering efficiency is due to the plasmids not being optimized for T cell engineering. [Figure 12] Non-viral plasmid engineered T cells express and secrete IDUA. Culture medium from the samples was used to assess IDUA expression using an IDUA enzyme activity assay. Engineered T cells (0.92% RQR8 positive cells, figure) expressed and secreted IDUA in the medium higher than background IDUA levels in control samples. [Figure 13] Total RQR8-positive Tm cells virally engineered with the IDUA-RQR8 expression cassette on day 11 of culture post-engineering, as measured by flow cytometry. [Figure 14] Tissue IDUA content in treated NSG-IDUA-deficient mice 12 weeks after cell injection. [Figure 15] Pathological tissue GAG ​​content in treated NSG-IDUA-deficient mice 12 weeks after cell injection. [Figure 16] Percentage of human CD4 positive cells in organs of treated NSG-IDUA-deficient mice 12 weeks after cell injection, as measured by flow cytometry. [Figure 17]Plasma IDUA levels in NSG-IDUA-deficient mice treated for 22 weeks [Figure 18A] Pathological urinary GAG content in treated NSG-IDUA-deficient mice over 18 weeks after cell injection. [Figure 18B] Creatinine levels in treated NSG-IDUA-deficient mice over 18 weeks after cell injection. [Figure 19] Tissue IDUA content in treated NSG-IDUA-deficient mice 22 weeks after cell injection. [Figure 20] Percentage of human CD45 positive cells in organs of treated NSG-IDUA-deficient mice 22 weeks after cell injection. [Figure 21] Effect of administration of engineered cells on neurocognitive performance of control and treated NSG-IDUA-deficient mice as measured by latency to exit the Barnes maze. [Figure 22] Levels of IDUA activity secreted into culture medium from engineered human Tm isolated from spleen and bone marrow of NSG-IDUA-deficient mice 22 weeks after engraftment. [Fig. 23A-23D] H&E staining of liver tissue after 22 weeks. (FIG. 23A) Heterozygous NSG mouse. (FIG. 23B) NSG-IDUA-deficient mouse. (FIG. 23C-D) NSG-IDUA-deficient mouse treated with engineered Tm cell IP injection. [Figures 24A-24C] H&E staining of brain tissue after 22 weeks. (FIG. 24A) Heterozygous NSG mouse. (FIG. 24B) NSG-IDUA-deficient mouse. (FIG. 24C) NSG-IDUA-deficient mouse treated with engineered Tm cell IP injection. [Fig. 25A-25B] IDUA immunohistochemistry (IHC) staining of liver. 400x magnification. (FIG. 25A) Untreated MPS I diseased tissue with foam cell clusters indicated by black squares. (FIG. 25B) Treated MPS I diseased tissue. Black arrows indicate round lymphocytes with moderate IDUA immunopositivity. Grey arrows indicate irregularly shaped Kupffer cells (macrophages) with strong IDUA immunopositivity. Inset shows Kupffer cells. [Figures 26A-26C] IDUA staining of brain tissue after 22 weeks. (FIG. 26A) Heterozygous NSG mice. (FIG. 26B) NSG-IDUA-deficient mice. (FIG. 26C) NSG-IDUA-deficient mice with IP injection of engineered Tm cells. [Figures 27A-27C] LAMP-1 IHC staining of brain. (FIG. 27A) Heterozygous healthy tissue. (FIG. 27B) Untreated MPS I diseased tissue. (FIG. 27C) Treated MPS I diseased tissue. Black arrows, astrocytes; red arrows, neurons. [Fig. 28A-28D] CD3 staining of brain tissue after 22 weeks. (Figure 28A) Heterozygous NSG mouse. (Figure 28B) NSG-IDUA-deficient mouse. (Figure 28C-D) NSG-IDUA-deficient mouse with engineered Tm cell IP injection. Red arrows indicate non-specific staining of astrocytes. Black arrows indicate CD3+ round lymphocytes in the pia mater. [Figure 29] Two possible transposon cassettes containing the IDUA gene and the EGFR reporter. [Diagram 30] EGFR+ human bulk T cells transfected with two IDUA transposon cassettes measured by flow cytometry. [Diagram 31] Non-viral transposon delivery of the IDUA gene into bulk T cells results in the expression and secretion of IDUA. [Diagram 32] Levels of EGFR-expressing CD4 and CD8 T cell subsets from transposon gene delivery. [Diagram 33] EGFR+ murine P14 TCRVα2Vβ8 CD8 T cells transfected with two IDUA transposon cassettes measured by flow cytometry. [Diagram 34] Non-viral transposon delivery of the IDUA gene into murine P14 TCR Vα2Vβ8 CD8 T cells expresses and secretes IDUA. [Diagram 35] An expression construct in which homology arms target the endogenous COL7A1 locus. [Diagram 36]Frequency of successfully targeted γδ T cells as measured by tEGFR expression. [Figure 37] Relative gene expression of COL7A1 from engineered gamma delta T cells. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0052] Precise genetic modification of primary human T cells has multiple applications in the field of immunotherapy for cancer, infectious diseases, autoimmune diseases, and enzymopathies. Due to the durability of the treatment and the low risk of rejection by the patient, genetic modification of T cells is attractive to open new avenues for therapy. Alternatively, precise genetic modification can be achieved by the introduction of the CRISPR / Cas9 system to induce targeted DSBs together with a DNA template for homology-directed repair (HDR), thereby integrating the DNA template into the host genome. This DNA template can be designed to encode a transgene of interest, such as a therapeutic protein / enzyme, which can be used as a cell-based gene therapy for protein / enzyme deficiency.

[0053] definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs. The following references provide those skilled in the art with general definitions of many of the terms used in this invention: Singleton et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY (3d ed.2006), THE CAMBRIDGE DICTIONARY OF SCIENCE AND TECHNOLOGY (Walker ed.,1990), THE GLOSSARY OF GENETICS,5TH ED.,R.Rieger et al.(eds.),Springer Verlag(1991), and Hale & Marham,THE COLLINS DICTIONARY OF BIOLOGY(3d,2005).

[0054] Each publication, patent application, patent, and other reference cited herein is incorporated by reference in its entirety, to the extent that it does not contradict this disclosure.

[0055] It is noted herein that, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise.

[0056] "Amplification" refers to any means by which a polynucleotide sequence is copied and thus expanded into a greater number of polynucleotide molecules, for example, by reverse transcription, polymerase chain reaction, and ligase chain reaction.

[0057] "cDNA" refers to a DNA that is complementary or identical to mRNA in either single-stranded or double-stranded form.

[0058] Conventional notation is used herein to describe polynucleotide sequences, with the left-hand end of a single-stranded polynucleotide sequence being the 5'-end and the left-hand direction of a double-stranded polynucleotide sequence being referred to as the 5'-direction. The direction of 5' to 3' addition of nucleotides to the nascent RNA transcript is referred to as the transcription direction. The DNA strand having the same sequence as the mRNA is referred to as the "coding strand", the sequence on the DNA strand having the same sequence as the mRNA transcribed from that DNA that is located 5' to the 5' end of the RNA transcript is referred to as the "upstream sequence", and the sequence on the DNA strand having the same sequence as the RNA that is 3' to the 3' end of the coding RNA transcript is referred to as the "downstream sequence".

[0059] "Complementary" refers to the topological compatibility or matching together of the interacting surfaces of two polynucleotides. Thus, the two molecules can be described as complementary, and the characteristics of the contacting surfaces are complementary to each other. A first polynucleotide is complementary to a second polynucleotide if the nucleotide sequence of the first polynucleotide is identical to the nucleotide sequence of the polynucleotide binding partner of the second polynucleotide. Thus, a polynucleotide with the sequence 5'-TATAC-3' is complementary to a polynucleotide with the sequence 5'-GTATA-3'. A nucleotide sequence is "substantially complementary" to a reference nucleotide sequence if the sequence complementary to the nucleotide sequence of interest is substantially identical to the reference nucleotide sequence.

[0060] "Conservative substitution" refers to the replacement in a polypeptide of an amino acid with a functionally similar amino acid. Each of the following six groups contains amino acids that are conservative substitutions for one another: 1) Alanine (A), Serine (S), Threonine (T), 2) Aspartic acid (D), glutamic acid (E), 3) Asparagine (N), Glutamine (Q), 4) Arginine (R), Lysine (K), 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V), and 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W).

[0061] The term "fragment," when used in reference to a polypeptide, refers to a polypeptide that is shorter than the full-length polypeptide by virtue of truncation at either the N-terminus or C-terminus or both of the protein and / or deletion of an internal portion or region of the protein. Fragments of polypeptides can be generated by methods known in the art.

[0062] "Encoding" refers to the inherent property of a particular sequence of nucleotides in a polynucleotide, such as a gene, cDNA, or mRNA, to serve as a template for the synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA, and mRNA) or a defined sequence of amino acids, and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of the mRNA produced by that gene produces the protein in a cell or other biological system. Both the coding strand, whose nucleotide sequence is identical to the mRNA sequence and is usually provided in the sequence listing, and the non-coding strand, used as a template for transcription of the gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA. Unless otherwise specified, "nucleotide sequences encoding an amino acid sequence" include all nucleotide sequences that are degenerate versions of each other and encode the same amino acid sequence. Protein- and RNA-encoding nucleotide sequences can include introns.

[0063] "Expression control sequence" refers to a nucleotide sequence within a polynucleotide that regulates the expression (transcription and / or translation) of a nucleotide sequence operably linked to it. "Operably linked" refers to a functional relationship between two moieties in which the activity of one moiety (e.g., the ability to regulate transcription) results in the action of the other moiety (e.g., transcription of a sequence). Expression control sequences can include, for example, but are not limited to, promoters (e.g., inducible or constitutive), enhancers, transcription terminators, start codons (i.e., ATG), splicing signals for introns, and stop codon sequences.

[0064] The term "promoter" as used herein refers to a region of DNA that functions to control the transcription of one or more DNA sequences and is structurally specified by the presence of a binding site for DNA-dependent RNA polymerase and other DNA sequences that interact to regulate promoter function. Functional expression promoting fragments of a promoter are shortened or truncated promoter sequences that retain activity as a promoter. Promoter activity can be measured by any of the assays known in the art, for example, reporter assays using luciferase as a reporter gene (Wood, 1991; de Wet et al. (1985) or commercially available.

[0065] The term "vector" refers to any carrier of exogenous DNA or RNA useful for transferring the exogenous DNA into a host cell for replication and / or appropriate expression of the exogenous DNA by the host cell. An "expression vector" refers to a vector containing a recombinant polynucleotide comprising an expression control sequence operably linked to a nucleotide sequence to be expressed. An expression vector contains sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or an in vitro expression system. Expression vectors include those known in the art, such as viral vectors, cosmids, plasmids (e.g., naked or contained in liposomes), nanoplasmids, or minicircles, incorporating a recombinant polynucleotide.

[0066] "Nanoplasmid™" refers to a 500 base pair circular plasmid that lacks conventional bacterial genes or antibiotic resistance genes, which reduces cytotoxicity and inflammation in cells transfected with the plasmid compared to conventional plasmids. Minicircles also lack bacterial genes.

[0067] "Minicircle" refers to a small circular plasmid derivative of approximately 4 kb that lacks bacterial polynucleotide sequences. Minicircles may be non-replicating and lack an origin of replication, or may be modified to contain non-bacterial replicating elements (e.g., S / MAR elements).

[0068] "Viral vector" refers to a vector that uses a viral backbone to carry a polynucleotide expression cassette. Viral vectors include lentiviral vectors, adenoviral vectors, or adeno-associated vectors (AAV).

[0069] "Expression cassette" or "cassette" refers to a component of a vector or plasmid DNA that controls the expression of a gene or protein, is interchangeable, and can be easily inserted or removed from a vector. Expression cassettes often contain a promoter sequence, an open reading frame, and a 3' untranslated region that contains a polyadenylation site. "Therapeutic expression cassette" or "therapeutic cassette" refers to an expression cassette that expresses a therapeutic protein for use in treating a disease.

[0070] "Enhancer region" refers to a region of DNA that functions to increase the transcription of one or more genes. More specifically, the term "enhancer" as used herein is a DNA regulatory element that enhances, strengthens, improves, or moderates the expression of a gene, regardless of its location and orientation. It is contemplated that an enhancer can enhance the expression of more than one promoter.

[0071] "Homology arms" refers to polynucleotide sequences in the 5' and 3' regions that immediately flank a DNA sequence of interest in an expression cassette that have homology to a selected insertion site in genomic DNA / RNA for the purposes of achieving homologous recombination.

[0072] "Transposon delivery" refers to the use of transposon sequences and transposase enzymes for site-specific delivery of DNA into a cell genome. DNA transposases make staggered cuts at the target site, generating sticky ends, cleaving the DNA transposon, and ligating it to the target site. Exemplary transposons include, but are not limited to, Tn5, Tn3, Tn10, Sleeping Beauty, piggyBac, and Tol2.

[0073] "Polynucleotide" refers to a polymer composed of nucleotide units. Polynucleotides include naturally occurring nucleic acids, such as deoxyribonucleic acid ("DNA"), including cDNA, and ribonucleic acid ("RNA"), as well as nucleic acid analogs. Nucleic acid analogs include those that contain non-naturally occurring bases, nucleotides that are linked to other nucleotides other than naturally occurring phosphodiester bonds, or bases that are linked via bonds other than phosphodiester bonds. Nucleotide analogs thus include, for example, but are not limited to, phosphorothioates, phosphorodithioates, phosphorotriesters, phosphoramidates, boranophosphates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, peptide nucleic acids (PNAs), and the like. Such polynucleotides can be synthesized, for example, using an automated DNA synthesizer. The term "nucleic acid" typically refers to large polynucleotides. The term "oligonucleotide" typically refers to short polynucleotides, generally no more than about 50 nucleotides. Where a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), it will be understood that this also includes RNA sequences in which "U" replaces "T" (i.e., A, U, G, C).

[0074] "Polypeptide" refers to a polymer composed of amino acid residues linked via peptide bonds, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof. Synthetic polypeptides can be synthesized, for example, using an automated polypeptide synthesizer. The term "protein" typically refers to large polypeptides. The term "peptide" typically refers to short polypeptides. Conventional notation is used herein to depict polypeptide sequences. The left-hand end of a polypeptide sequence is the amino-terminus, and the right-hand end of a polypeptide sequence is the carboxyl-terminus.

[0075] "Recombinant polynucleotide" refers to a polynucleotide having sequences that are not naturally joined together. The amplified or assembled recombinant polynucleotide may be included in a suitable vector, and the vector can be used to transform a suitable host cell. A host cell containing a recombinant polynucleotide is referred to as a "recombinant host cell." Genes are then expressed in the recombinant host cell to produce, for example, a "recombinant polypeptide." Recombinant polynucleotides may serve non-coding functions as well (e.g., promoter, origin of replication, ribosome binding site, etc.). Recombinant protein refers to a protein encoded by a recombinant polynucleotide.

[0076] "Substantially pure" or "isolated" means that the species of interest is the predominant species present (i.e., more abundant, on a molar basis, than any other individual macromolecular species in the composition) and that a substantially purified fraction is a composition in which the species of interest comprises at least about 50% (on a molar basis) of all macromolecular species present. Generally, a substantially pure composition means that about 80%-90% or more of the macromolecular species present in the composition are the purified species of interest. A species of interest is purified to essentially homogeneity when the composition consists essentially of a single macromolecular species (contaminating species cannot be detected in the composition by conventional detection methods). Solvent species, small molecules (less than 500 Daltons), stabilizers (e.g., BSA), and elemental ion species are not considered macromolecular species for purposes of this definition. In various embodiments, recombinant proteins of the present disclosure are substantially pure or isolated with respect to the macromolecular starting materials used in their synthesis. In various embodiments, pharmaceutical compositions of the present disclosure comprise a substantially purified or isolated therapeutic protein mixed with one or more pharma- ceutically acceptable carriers, diluents, or excipients.

[0077] The term "specifically binds" refers to a T cell receptor or polypeptide that is "antigen-specific," "specific for," "selective binding agent," "specific binding agent," "antigen target," or "immunoreactive" with an antigen, that binds to a target antigen with greater affinity than other antigens of related proteins.

[0078] The term "endogenous" refers to a protein, polynucleotide, or other molecule that is naturally found in or expressed by a subject, e.g., a cell, organ, or tissue. The term "exogenous" refers to a protein, polynucleotide, or other molecule that is not naturally found in a subject, e.g., a cell, organ, or tissue.

[0079] The term "genetically engineered" as used herein refers to a polynucleotide or polypeptide sequence that has been altered from its naturally occurring sequence, for example by insertion, deletion, or polynucleotide or amino acid substitutions / modifications, and uses recombinant DNA expression techniques to produce a polypeptide or polynucleotide sequence that differs from the previously unaltered sequence.

[0080] The term "nuclease-dependent cleavage system" as used herein refers to gene editing technology that uses a DNA- or RNA-dependent nuclease to cleave target DNA or RNA, respectively, and a molecule or guide that directs the nuclease to the target DNA / RNA to be cleaved. Examples of nuclease-dependent cleavage systems include the CRISPR / Cas system, the Cas-CLOVER system, the zinc finger nuclease (ZFN) system, the transcription activator-like effector nuclease (TALEN) system, or the meganuclease system.

[0081] As used herein, the "homozygosity" of a donor polynucleotide refers to the result of a genetic modification in which both alleles of a modified gene express the donor polynucleotide.As used herein, the "heterozygosity" of a donor polynucleotide refers to the result of a genetic modification in which only one allele of a gene expresses the donor polynucleotide.

[0082] T cells Upon activation through the T cell receptor (TCR), T cells can differentiate into memory T cells that can survive for decades. The abundance of T cells and their ability to differentiate into long-lived cells make T cells attractive candidates for use as cell-based gene therapy.

[0083] "T cell receptor" or "TCR" refers to a multisubunit protein containing either an alpha and beta chain (TCRαβ) or a gamma and delta subunit (TCRγδ) that together bind a peptide MHC ligand. Each chain is composed of two extracellular domains containing a variable (V) region and a constant (C) region. The variable regions bind to the peptide / MHC complex. The variable domains of both the TCR alpha and beta chains each have three hypervariable or complementarity determining regions (CDRs). The TCRαβ is complexed with CD3 and other proteins in the T cell to mediate signaling through the T cell receptor.

[0084] It is contemplated that TCRs specific for a particular infectious microorganism, such as a virus or bacteria, or other known binding antigen, can be engineered as described herein. Exemplary TCRs include, but are not limited to, TCRs specific for Hepatitis B Virus (HBV), Human Immunodeficiency Virus (HIV), Epstein-Barr Virus (EBV), Influenza A, Coronavirus Covid19, Cytomegalovirus (CMV), Yellow Fever Vaccine, Salmonella Typhoid, Tetanus, Diphtheria, and Tuberculosis.

[0085] In various embodiments, the T cells may be CD4+ cells. In various embodiments, the T cells may be CD8+ cells. In various embodiments, the T cells may be primary T cells. As used herein, "primary T cells" are non-immortalized T cells. In various embodiments, "primary T cells" are freshly isolated T cells. In various embodiments, the T cells may be derived from blood or serum.

[0086] In various embodiments, a "primary T cell" is a T cell that has undergone up to 5 replications or divisions after isolation, up to 10 replications or divisions after isolation, up to 15 replications or divisions after isolation, up to 20 replications or divisions after isolation, up to 25 replications or divisions after isolation, up to 30 replications or divisions after isolation, up to 35 replications or divisions after isolation, or up to 40 replications or divisions after isolation.

[0087] In various embodiments, a "primary T cell" is a T cell that has undergone up to 5 replications or divisions after induction, up to 10 replications or divisions after induction, up to 15 replications or divisions after induction, up to 20 replications or divisions after induction, up to 25 replications or divisions after induction, up to 30 replications or divisions after induction, up to 35 replications or divisions after induction, or up to 40 replications or divisions after induction.

[0088] In various embodiments, the primary T cells are non-clonal cells. In various embodiments, the primary T cells are proliferating cells. In various embodiments, the T cells are cultured in the presence of IL-2 or other T cell growth media.

[0089] In various embodiments, the T cell is a naive T cell. In various embodiments, the T cell is an effector T cell. In various embodiments, the T cell may be a memory T cell. In various embodiments, a "memory T cell" expresses CD45RO. In various embodiments, the T cell is an activated memory T cell. In various embodiments, the T cell is a resident memory T cell. In various embodiments, the T cell is a regulatory T cell. In various embodiments, the regulatory T cell expresses FOXP3 + or FOXP3 - In various embodiments, the T cells are gamma-delta T cells.

[0090] In various embodiments, the T cell is a mammalian cell. In various embodiments, the T cell is a human cell. In various embodiments, the T cell is a mouse cell.

[0091] A T cell is "gene edited" if the T cell contains modifications to its genome compared to a non-gene-edited T cell. In some embodiments, the non-gene-edited T cell is a wild-type T cell. In some embodiments, the non-gene-edited T cell is a freshly isolated T cell.

[0092] In various embodiments, the gene-edited T cells include modifications of non-coding regions of the genome and / or coding regions of the genome (e.g., genes). In various embodiments, the non-coding regions of the genome may include sequences for small regulatory non-coding RNAs, including, for example, microRNAs (miRNAs). In various embodiments, the non-coding regions of the genome are preferably involved in regulating T cell function, activation, and / or survival.

[0093] In various embodiments, a portion of the genomic information and / or gene may be deleted. In various embodiments, a portion of the genomic information and / or gene may be added. In various embodiments, the added genomic information and / or gene is exogenous. In various embodiments, the "exogenous" genomic information or "exogenous" gene may be genomic information or gene from a non-T cell. In various embodiments, the "exogenous" genomic information or "exogenous" gene may be an additional copy of genomic information or gene already present in the T cell. In various embodiments, the "exogenous" genomic information or "exogenous" gene may be genomic information or gene from another species of cell other than the T cell being modified. In various embodiments, the "exogenous" genomic information or "exogenous" gene may be artificially generated, including, for example, a nucleic acid encoding a chimeric antigen receptor. In various embodiments, the genomic information and / or gene may be altered, for example, by a point mutation.

[0094] In various embodiments, the gene-edited T cells comprise a modification that alters the expression or activity of the gene-edited T cells compared to a non-gene-edited T cell. For example, in various embodiments, the gene-edited T cells can comprise an expression cassette or therapeutic cassette described herein.

[0095] In various embodiments, the gene-edited primary T cells include modifications of a nucleic acid encoding an endogenous T cell receptor (TCR). In various embodiments, the modifications result in modification of the expression of the endogenous TCR. For example, the expression of the endogenous TCR can be abrogated compared to a non-gene-edited primary T cell. In some embodiments, the expression of the endogenous TCR can be enhanced compared to a non-gene-edited primary T cell.

[0096] In various embodiments, the gene-edited T cells include modifications in a nucleic acid encoding a cytokine, which may include, for example, IL-2, IL-4, IL-7, IL-12, IL-13, IL-15, IL-17, IL-21, IL-32, IL-33, IFN-gamma, or a combination thereof.

[0097] In various embodiments, the gene-edited T cells comprise a nucleic acid encoding a chemokine receptor, including CXCR1, CXCR2, CXCR3, CXCR4, CXCR5, CXCR6, CCR1, CCR2, CCR3, CCR4, CCR5, CCR6, CCR7, CCR8, CCR9, CCR10, or CCR11.

[0098] vector Exemplary expression vectors include, but are not limited to, a viral vector, a plasmid, a nanoplasmid, or a minicircle.

[0099] Viral vectors include, but are not limited to, the following: Viral vectors based on vaccinia virus, poliovirus, adenovirus (see, e.g., Li et al., Invest Opthalmol Vis Sci 35:2543 2549 (1994); Borras et al., Gene Ther 6:515 524 (1999); Li and Davidson, PNAS 92:7700-7704 (1995); Sakamoto et al., H Gene Ther 5:1088-1097 (1999); WO94 / 12649, WO93 / 03769, WO93 / 19191, WO94 / 28938, WO95 / 11984, and WO95 / 00655); viral vectors based on adeno-associated virus (see, e.g., Ali et al., Hum Gene Ther 9:81 86(1998), Flanner et al., PNAS 94:6916-6921(1997), Bennett et al., Invest Opthalmol Vis Sci 38:2857-2863(1997), Jomary et al., Gene Ther 4:683-690(1997), Rolling et al., Hum Gene Ther 10:641-648,(1999), Ali et al.,Hum Mol Genet 5:591-594(1996), Srivastava in WO 93 / 09239,Samulski et al.,J.Vir.63:3822-3828(1989),Mendelson et al.,Virol.166:154-165 (1988), and Flotte et al. al., PNAS 90:10613-10617 (1993); viral vectors based on SV40, herpes simplex virus, or human immunodeficiency virus (see, e.g., Miyoshi et al., PNAS 94:10319-23 (1997); Takahashi et al., J Virol 73:7812-7816 (1999); retroviral vectors (e.g., vectors derived from retroviruses such as murine leukemia virus, spleen necrosis virus, and Rous sarcoma virus, Harvey sarcoma virus, avian leukosis virus, lentiviruses, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus).

[0100] Recombinant adeno-associated viral vectors (rAAV) are small DNA viruses with a packaging capacity of 4.7 kilobases (Kb) that have been widely used as vehicles for DNA template delivery for CRISPR / Cas9-mediated transgene insertion in immune cells, including T cells. 1、2 The methods for genome editing described herein can be used to insert promoters or splice acceptors to drive expression of transgenes encoding secreted proteins or enzymes using either rAAV or plasmids as HDR or HMEJ DNA donor templates.

[0101] Adenoviral vectors are non-enveloped double-stranded DNA vectors that can be made replication-defective by deleting the E1 region of the viral genome.Typical adenoviral vectors have a packaging capacity of up to 7.5 kbp.Adenoviral vectors are commonly used in clinical trials of gene therapy.Useful adenoviral vectors are described in Wold et al., (Curr Gene Ther.2013 Dec;13(6):421-433), which is incorporated herein by reference.

[0102] Lentivirus vectors are enveloped retroviruses with a single-stranded RNA genome. Lentiviruses can infect dividing and non-dividing cells. Lentiviruses have a genome capacity of approximately 10 kb.

[0103] Plasmids contemplated herein include, for example, naked plasmids or are contained within a liposome or another delivery vehicle. "Nanoplasmid™" refers to a 500 base pair circular plasmid that lacks traditional bacterial or antibiotic resistance genes. Nanoplasmid constructs reduce cytotoxicity and inflammation in plasmid-transfected cells compared to traditional plasmids.

[0104] Minicircles are small circular plasmid derivatives of approximately 4 kb that also lack bacterial genes and bacterial polynucleotide sequences. Minicircles may be non-replicating and lack an origin of replication or may be modified to contain non-bacterial replicating elements (e.g., S / MAR elements).

[0105] A vector for transposon delivery of genetic information is also contemplated. The vector comprises an inverted terminal repeat flanking a polynucleotide encoding a gene of interest for transposon delivery. The vector for transposon delivery comprises a promoter, a gene of interest, a biomarker, a regulatory element, and optionally a chimeric intron. In various embodiments, the transposon is selected from the group consisting of Tn5, Tn3, Tn10, Sleeping Beauty, piggyBac, and Tol2.

[0106] Genome manipulation CRISPR / Cas and other nuclease-based gene editing systems open new avenues for altering genes of interest by creating targeted double-strand breaks (DSBs) that trigger the formation of small insertions or deletions created by semi-random repair via the non-homologous end joining (NHEJ) pathway. Alternatively, precise genome modification can be achieved by the introduction of CRISPR / Cas9 to induce DSBs together with a DNA template for homology-directed repair (HDR). The DNA template can be designed to code for a transgene of interest, such as a T-cell receptor (TCR), or to code for a therapeutic protein / enzyme that can be used for cancer immunotherapy or protein / enzyme deficiency, respectively.

[0107] In various embodiments, the method includes techniques for introducing proteins or nucleic acids into T cells or populations of T cells. Any suitable method of introducing proteins or nucleic acids may be used. In various embodiments, the method includes electroporation of T cells or populations of T cells to introduce genetic material, including, for example, DNA, RNA, and / or mRNA. As used herein, electroporation may include nucleofection. Because plasmid DNA may be toxic to T cells, in some embodiments, mRNA or protein-based approaches of genome editing are used. In various embodiments, techniques for introducing proteins or nucleic acids may include introducing proteins or nucleic acids via electroporation, microinjection, exosomes, liposomes, biolistics, jet injection, hydrodynamic injection, ultrasound, magnetic field-mediated gene transfer, electric pulse-mediated gene transfer, the use of nanoparticles, including, for example, lipid-based nanoparticles, incubation with endosomolytic agents, the use of cell-penetrating peptides, and the like. In various embodiments, the methods include electroporation of T cells using the NEON transfection system, the Lonza transfection system, or the MaxCyte transfection system.

[0108] In various embodiments, the method includes editing a gene. Editing a gene can include introducing one or more copies of a gene, altering a gene, deleting a gene, upregulating expression of a gene, downregulating expression of a gene, mutating a gene, methylating a gene, demethylating a gene, acetylating a gene, and / or deacetylating a gene. Mutating a gene can include introducing an activating mutation, introducing an inactivating and / or inhibitory mutation, and / or introducing a point mutation.

[0109] In various embodiments, the method includes inducing a double-stranded break in the genome of the T cell. The double-stranded break can be introduced using a nuclease-dependent cleavage system, including, for example, a transcription activator-like effector nuclease (TALEN), a zinc finger nuclease (ZFN), or a CRISPR-associated nuclease.

[0110] Double-stranded breaks can also be introduced using transposase delivery systems or nuclease-dependent cleavage systems, including, for example, transcription activator-like effector nucleases (TALENs), zinc finger nucleases (ZFNs), or CRISPR-associated nucleases.

[0111] When using a CRISPR / Cas system, it involves the use of a guide RNA (gRNA) or DNA (gDNA) targeting molecule. The gRNA or gDNA target can include any suitable target. In various embodiments, the target includes a portion of the T cell genome, including, for example, a gene or a portion of a gene.

[0112] Disclosed herein is a method for genetically engineering a T cell or a population of T cells to overexpress a gene of interest, comprising introducing into the T cell or population of T cells a viral vector, plasmid, nanoplasmid, or minicircle comprising an expression cassette comprising a homology arm (HA), a polynucleotide encoding the gene of interest, a splice acceptor site, a promoter, and a targeting site for a nuclease dependent cleavage system targeting molecule, wherein the expression cassette is inserted into the locus targeted by the targeting molecule.

[0113] Disclosed herein is a method for genetically engineering a T cell or a population of T cells to overexpress a gene of interest, comprising introducing into the T cell or population of T cells a viral vector, plasmid, nanoplasmid, or minicircle comprising an expression cassette comprising homology arms (HA), a polynucleotide encoding the gene of interest, a splice acceptor site, a promoter, and a targeting site for transposon delivery of the gene of interest, wherein the expression cassette is inserted into the locus targeted by the targeting molecule.

[0114] Also provided is a method for genetically engineering a T cell or a population of T cells to overexpress an endogenous gene, comprising introducing into the T cell or population of T cells a viral vector, plasmid, nanoplasmid, or minicircle comprising an expression cassette comprising a homology arm (HA), a splice acceptor site, a promoter, and a targeting site for a nuclease dependent cleavage system targeting molecule, wherein the expression cassette is inserted upstream of the target gene to be overexpressed.

[0115] Also provided is a method for genetically engineering a T cell or a population of T cells to overexpress an endogenous gene, comprising introducing into the T cell or population of T cells a viral vector, plasmid, nanoplasmid, or minicircle comprising an expression cassette comprising homology arms (HA), a splice acceptor site, a promoter, and a targeting site for transposon delivery of a gene of interest, wherein the expression cassette is inserted upstream of the target gene to be overexpressed.

[0116] In some embodiments where transfection may be used to deliver the CRISPR / Cas9 system, the gRNA may preferably comprise a chemically modified gRNA. In some embodiments, the chemical modification to the gRNA preferably reduces the cell's ability to degrade the RNA. In some embodiments, the chemically modified gRNA comprises one or more of the following modifications: 2'-fluoro (2'-F), 2'-O-methyl (2'-O-Me), S-constrained ethyl (cEt), 2'-O-methyl (M), 2'-O-methyl-3'-phosphorothioate (MS), and / or 2'-O-methyl-3'-thiophosphonoacetate (MSP). In some embodiments, the chemically modified gRNA may comprise a gRNA and / or chemical modifications described in Hendel et al., Nature Biotechnology, 2015, 33(9):985-989 or Rahdar et al., PNAS, 2015, 112(51):E7110-7.

[0117] Introduction of the plasmid, nanoplasmid or minicircle into the cells can be performed by transfection or electroporation.

[0118] The introduction of the viral vector is by electroporation. In various embodiments, the viral vector is at a concentration of 3×10 5 ~1×10 7 In various embodiments, the MOI is 5×10 5 ~1×10 7 , 5×10 5~5×10 6 , 5×10 5 ~1×10 6 Or 3 x 10 5 ~1×10 6 It is.

[0119] The vector for transposon delivery is electroporated with the transposase mRNA and an expression cassette for transposon delivery expressing the gene of interest.

[0120] It is contemplated that the method provides efficient transfer of a gene of interest and provides improved survival rate of T cells after genome modification. For example, the efficiency of transfer of a gene of interest or overexpression of an endogenous polynucleotide is 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% or more. In various embodiments, the T cell population has a survival rate of more than 60%, 70%, 80%, 90% or more after 3 days. In various embodiments, the T cell population has a survival rate of more than 60% after 3 days.

[0121] In various embodiments, the method includes selecting the gene-edited T cells. In various embodiments, the selection is performed after editing the gene. In various embodiments, the T cells can be selected using one or more of the following methods: flow sorting (including, for example, for cell surface marker expression), magnetic bead separation (including, for example, targeting cell surface markers), transient drug resistance gene expression (including, for example, antibiotic resistance).

[0122] In various embodiments, the method includes expanding the gene-edited T cells. In various embodiments, the expansion can occur after selecting the gene-edited T cells. In various embodiments, the T cells can be expanded by co-incubation with an antigen recognized by the T cell receptor or a cell expressing an antigen recognized by the T cell receptor. In various embodiments, the T cells can be expanded (e.g., stimulated, expanded or activated) by co-incubation with a cytokine or ligand, including, for example, contacting the cells with one or more of interleukin-2 (IL-2), interleukin-7 (IL-7), interleukin-15 (IL-15), interferon-gamma (IFN-gamma, IFN-γ), or N-acetylcysteine ​​(NAC).

[0123] In various embodiments, the T cells can be stimulated for at least 18 hours, at least 1 day, at least 36 hours, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, or at least 7 days. In some embodiments, the T cells can be simulated for up to 1 day, up to 2 days, up to 3 days, up to 4 days, up to 5 days, up to 6 days, up to 7 days, up to 8 days, up to 9 days, up to 10 days, up to 12 days, up to 14 days, up to 3 weeks, up to 4 weeks, or up to 2 months. In some embodiments, the T cells are preferably stimulated for 14 days.

[0124] Nuclease-dependent cleavage system Zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) are customizable DNA-binding proteins that contain DNA-modifying enzymes. Both can be designed and targeted to specific sequences in various organisms (Esvelt and Wang, Mol Syst Biol. (2013) 9:641). ZFNs and TALENs are useful for introducing a wide range of genetic modifications by inducing DNA double-strand breaks that stimulate error-prone non-homologous end joining (NHEJ) or homology-directed repair (HDR) at specific genomic locations. These DNA-binding modules can be combined with a number of effector domains to affect genome structure and function, including nucleases, transcription activators and repressors, recombinases, transposases, DNA and histone methyltransferases, and histone acetyltransferases. Therefore, the ability to carry out genetic alterations is highly dependent on the DNA binding specificity and affinity of the designed zinc finger and TALEN proteins (Gaj et al., Trends in Biotechnology, (2013) 31(7):397-405). The following U.S. issued patents (incorporated by reference) describe the use of ZFNs and TALENs in mammalian cells (U.S. Patent No. 8,685,737 and U.S. Patent No. 8,697,853):

[0125] CRISPR-Cas (Regularly Interspersed Short Palindromic Repeats - CRISPR-associated) is an RNA-mediated adaptive immune system found in bacteria and archaea that provides adaptive immunity against foreign nucleic acids (Wiedenheft et al., Nature (2012) 482:331-8; Jinek et al., Science (2012) 337:816-21). Recent studies have shown that the biological components of this system can be used to engineer into the genome of mammalian cells. CRISPR-Cas systems are generally defined by genomic loci called CRISPR arrays, a series of 20-50 base pair (bp) direct repeats separated by unique "spacers" of similar length preceded by an AT-rich "leader" sequence (J. Immunol. (2016) 164:29-44).

[0126] There are three types of CRISPR / Cas systems: type I, type II, and type III. Type II CRISPR-Cas systems require a single protein, e.g., Cas9, to catalyze DNA cleavage (Sapranauskas et al., Nucleic Acids Res. (2011) 39(21):9275-9282). Cas9 functions as an RNA-guided DNA endonuclease. Cas9 generates blunt-end double-strand breaks (DSBs) at sites defined by a 20-nucleotide guide sequence contained within the associated CRISPR RNA (crRNA) transcript. Cas9 requires both a guide crRNA and a trans-activating crRNA (tracrRNA) that is partially complementary to the crRNA for site-specific DNA recognition and cleavage (Deltcheva et al., Nature (2011) 4 71(7340):602-7; Jinek et al., Science (2012) 337:816-21).

[0127] The crRNA:tracrRNA complex can be synthesized as two separate molecules or as a single transcript (single guide RNA or sgRNA) that encompasses the necessary features for both Cas9 binding and DNA target site recognition. Using sgRNA, Cas from bacterial species such as S. pyogenes can be programmed to cleave double-stranded DNA at any site defined by the guide RNA sequence and containing a protospacer adjacent (PAM) motif (Sapranauskas et al., Nucleic Acids Res. (2011) 39(21):9275-9282; Jinek et al., Science (2012) 337:816-21). DSBs are error-prone and result in either non-homologous end joining (NHEJ), which promotes frameshift mutations that knock out gene alleles, or homology-directed repair (HDR), which can be utilized using exogenously introduced double-stranded or single-stranded DNA repair templates to knock in or correct mutations in the genome. Thus, in the presence of a homology repair donor, the CRISPR / Cas9 system can be used to generate precise and defined modifications and insertions at targeted loci by the HDR process. In the absence of a homology repair donor, the single DSBs generated by CRISPR / Cas9 are repaired by error-prone NHEJ, which generates insertion or deletion (indel) mutations.

[0128] Other publications describing CRISPR systems and Cas9 include the following, which are incorporated by reference: Cong et al. Science (2013) 339:819-23; Jinek et al., eLife 2013;2:e00471.(2013)2:e00471; Lei et al. Cell (2013) 152:1173-1183; Gilbert et al. Cell (2013) 154:442-51; Lei et al. eLife (2014) 3:e04766; Perez-Pinela et al. Nat Methods (2013) 10:973-976; Maider et al. Nature Methods (2013) 10,977-979. The following U.S. and international patents and patent applications describe methods of using CRISPR: 8,697,359, 8,771,945, 8,795,965, 8,865,406, 8,871,445, 8,889,356, 8,895,308, 8,906,616, 8,932,814, 8,945,839, 8,993,233, 8,999,641, 2014 / 0068797, and WO 2014 / 197568, each of which is incorporated by reference in its entirety.

[0129] The CRISPR associated protein Cas9 may be from any number of species, including but not limited to, Streptococcus pyogenes, Staphylococcus aureus, Listeria innocua, and Streptococcus thermophilus.

[0130] Additional Cas proteins known in the art are contemplated for use in the present methods, including Cas12a (Cpf1) and Cas 13a / Cas13b (56). See also Yan et al., Cell Biology and Toxicology 35:489-492 (2019).

[0131] The Cas-CLOVER™ system is a recently designed gene editing system that utilizes Clo51 nuclease instead of CRISPR protein. Cas-CLOVER™ contains a nuclease-inactivated Cas9 protein fused to Clo51 endonuclease. Cas-CLOVER uses two guide RNAs and the nuclease activity that utilizes the dimerization of subunits associated with each guide RNA to provide target specificity.

[0132] In one embodiment, the method uses a CRISPR-Cas system and one or more guide RNAs to repair the template and HDR to insert nucleotide bases into the genome of a T cell locus. In various embodiments, the T cell locus is the (TCR) alpha chain (TRAC) locus or the AAVS1 locus.

[0133] nucleic acid molecule The nucleic acid of the present disclosure can be cloned into a vector, such as a viral vector, a plasmid, a nanoplasmid, or a minicircle, into which another gene sequence or element (either DNA or RNA) can be inserted to effect replication of the linked sequence or element. In various embodiments, the expression vector contains a constitutively active promoter segment (such as, but not limited to, CMV, SV40, elongation factor, or LTR sequence), or an inducible promoter sequence, such as the steroid-inducible pIND vector (Invitrogen), in which expression of the nucleic acid can be regulated. The expression vector of the present disclosure can further include a regulatory sequence. The vector can be introduced into a cell, for example, by transfection.

[0134] A secretory signal peptide sequence may also optionally be encoded by an expression vector operably linked to a coding sequence of interest such that the expressed polypeptide may be secreted by the recombinant host cell, if desired, for easier isolation of the polypeptide of interest from the cell. For example, in some embodiments, a signal peptide sequence may be added / fused to the amino terminus of any of the donor polynucleotides, CRISPR-Cas or other nuclease-dependent cleavage systems described herein.

[0135] The vector may also include a nucleic acid comprising a promoter, a coding sequence for a transgene of interest, optionally a polyA sequence, and a homology arm. In various embodiments, the nucleic acid comprises a homology arm (HA), a splice acceptor site, a promoter, and a targeting site for a nuclease-dependent cleavage system targeting molecule.

[0136] In various embodiments, the homology arms are between 35 and 1000 nucleotides. In various embodiments, the homology arms are between 50 and 900 nucleotides, between 50 and 750 nucleotides, between 100 and 600 nucleotides, between 100 and 500 nucleotides, or between 200 and 400 nucleotides. In various embodiments, the homology arms are between 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 90, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000 nucleotides.

[0137] In various embodiments, the viral vector, plasmid, nanoplasmid, or minicircle comprises a nucleic acid further comprising a promoter next to or near the gene of interest / gene to be overexpressed. In various embodiments, the promoter is an endogenous T cell promoter. In various embodiments, the promoter is an MND promoter, a CMV promoter, a CAG promoter, a PGK promoter, an EF1A promoter, or a T cell specific promoter.

[0138] Cell culture method The mammalian T cells containing the DNA or RNA encoding the recombinant protein are cultured under conditions suitable for cell growth and expression of the DNA or RNA. Those cells expressing the recombinant protein can be identified using known methods and described herein, and the recombinant protein can be isolated and purified, with or without amplification of recombinant protein production, also using known methods and described herein. Identification can be performed by screening the genetically modified mammalian cells for a phenotype indicative of the presence of the DNA or RNA encoding the recombinant protein, such as, for example, PCR screening, screening by Southern blot analysis, or screening for expression of the recombinant protein. Selection of cells containing DNA encoding the integrated recombinant protein can be achieved by including a selectable marker in the DNA construct, with subsequent culturing of transfected or infected cells containing the selectable marker gene under conditions suitable for survival of only cells expressing the selectable marker gene. Further amplification of the introduced DNA construct can be performed by culturing the genetically modified T cells under suitable conditions (e.g., culturing the genetically modified T cells containing the amplifiable marker gene in the presence of a concentration of a drug that allows only cells containing multiple copies of the amplifiable marker gene to survive).

[0139] Genetically modified T cells expressing a recombinant protein of interest can be identified by detection of the expression product or cell surface markers, as described herein.

[0140] Protein purification methods are known in the art and are utilized herein for the recovery of recombinant proteins from cell culture media. For example, methods of protein and antibody purification are known in the art and can be used with the production of antibodies of the present disclosure. In some embodiments, methods for protein and antibody purification include filtration, affinity column chromatography, cation exchange chromatography, anion exchange chromatography, and concentration. The filtration step can include ultrafiltration, and optionally ultrafiltration and dialysis. Filtration is preferably performed at least about 5-50 times, more preferably 10-30 times, and most preferably 14-27 times. Affinity column chromatography can be performed, for example, using PROSEP® Affinity Chromatography (Millipore, Billerica, Mass.). In various embodiments, the affinity chromatography step includes PROSEP®-vA column chromatography. The eluate can be washed with a solvent detergent. Cation exchange chromatography can include, for example, SP-Sepharose cation exchange chromatography. Anion exchange chromatography may include, for example, but is not limited to, Q-Sepharose Fast Flow anion exchange. The anion exchange step is preferably non-binding, thereby allowing for the removal of contaminants including DNA and BSA. The antibody product is preferably nanofiltered, for example, using a Pall DV 20 Nanofilter. The antibody product may be concentrated, for example, using ultrafiltration and dialysis. The method may further include a size exclusion chromatography step to remove aggregates.

[0141] How to use The engineered gene-edited T cells of the present disclosure are useful as cell-based therapies for protein deficiencies, enzymopathies, immunotherapy for infectious diseases, and in autoimmune diseases.

[0142] In various embodiments, the engineered T cells comprise an expression cassette comprising a polynucleotide that is overexpressed by the T cells, hi various embodiments, the engineered T cells comprise an exogenous polynucleotide integrated into the genome.

[0143] In various embodiments, the engineered T cell comprises a polynucleotide or an expression cassette comprising an exogenous polynucleotide overexpressed by the T cell, the polynucleotide encoding an enzyme, a cytokine, a chemokine, a T cell receptor, or a cell surface receptor. In various embodiments, the polynucleotide encodes an enzyme, a cancer antigen, a cytokine, a chemokine, a T cell receptor, or a cell surface receptor. In various embodiments, the polynucleotide encodes an antigen that is an enzyme, an autoimmune antigen, a microbial antigen, a viral antigen, or a bacterial antigen.

[0144] In various embodiments, the overexpressed polynucleotide encodes a therapeutic protein, which in various embodiments is an enzyme, a cancer antigen, a cytokine, a chemokine, a T cell receptor, a cell surface receptor, a protein associated with a protein deficiency, or an extracellular membrane protein.

[0145] In various embodiments, the enzyme is an enzyme deficient in an enzymatic disease. In various embodiments, the enzyme is L-iduronidase, iduronate-2-sulfatase, heparan-N-sulfatase, α-N-acetylglucosaminidase, acetyl-CoA:N-acetyltransferase, N-acetylglucosamine 6-sulfatase, galactose 6-sulfatase, β-galactosidase, N-acetylgalactosamine 4-sulfatase, β-glucuronidase, hyaluronoglucosaminidase, aspartylglucosaminidase, acid lipase, cystine transporter, LAMP, α-galactosidase A, ceramidase, α-L-fucosidase, α-galactosidase B, α-galactosidase C, α-galactosidase D, α-galactosidase E, α-galactosidase H, α-galactosidase I ... In some embodiments, the protein is selected from the group consisting of glyceryl phosphate, glyceryl phosphate, glyceryl phosphate gamma subunit ...

[0146] In various embodiments, the overexpressed polynucleotide encodes a collagen protein or a subunit thereof, hi various embodiments, the polynucleotide is COL7A1 and the protein is type VII collagen alpha 1 chain.

[0147] In various embodiments, the enzymopathy is aspartylglucosaminuria, cholesterol ester storage disease, Wolman disease, metachromatic leukodystrophy, Danon disease, Fabry disease, Farber lipogranulomatosis, Farber disease, fucosidosis, galactosialidosis type I / II, Gaucher disease type I / II / III, globoid cell leukodystrophy, Krabbe disease, glycogen storage disease II, Pompe disease, GM1-gangliosidosis type I / II / III, GM2-gangliosidosis type I, Tay-Sachs disease, GM2-gangliosidosis type II, Sandhoff disease, or the like. disease, GM2-gangliosidosis, α-mannosidosis type I / II, β-mannosidosis, mucolipidosis type I, sialidosis type I / II, mucolipidosis type II / III, Eissel's disease, mucolipidosis type IIIC, pseudo-Hurler polydystrophy, mucopolysaccharidosis type I, mucopolysaccharidosis type II, Hunter syndrome, mucopolysaccharidosis type IIIA, Sanfilippo syndrome type B, Sanfilippo syndrome type C, Sanfilippo syndrome type D, mucopolysaccharidosis type IIIB, mucopolysaccharidosis type IIIC, mucopolysaccharidosis type IIID, mucopolysaccharidosis type IVA, mucopolysaccharidosis type IVB The patient is selected from the group consisting of Morquio syndrome type A, Morquio syndrome type B, mucopolysaccharidosis type VI, mucopolysaccharidosis type VII, Sly syndrome, mucopolysaccharidosis type IX, multiple sulfatase deficiency, neuronal ceroid lipofuscinosis, CLN1 Batten disease, CLN2 Batten disease, Niemann-Pick disease type A / B, Niemann-Pick disease, Niemann-Pick disease type C1, Niemann-Pick disease type C2, pyknodysostosis, Schindler disease type I / II, and sialic acid storage diseases, hemophilia A, hemophilia B, Christmas disease, factor VII deficiency, spinal muscular atrophy, and epidermolysis bullosa dystrophy.

[0148] In various embodiments, the enzymopathy is Mucopolysaccharidosis type I (MPS I) and the overexpressed gene of interest is iduronidase. The methods described herein are contemplated to alleviate one or more symptoms of MPS I. In various embodiments, the one or more symptoms of MPS I are selected from the group consisting of a reduction in glycosaminoglycan (GAG) species in tissues and / or urine, an increase in IDUA expression in tissues, improved cognition, and a reduction in vacuolated endothelial / foam cells in tissues.

[0149] In various embodiments, the protein deficiency is epidermolysis bullosa dystrophy (also known as dystrophic epidermolysis bullosa) and the gene of interest that is overexpressed is type VII collagen α1 chain.

[0150] In various embodiments, the autoimmune antigen is associated with an autoimmune disease. In various embodiments, the autoimmune antigen is associated with an autoimmune disease, including achalasia, Addison's disease, adult Still's disease, agammaglobulinemia, alopecia areata, amyloidosis, ankylosing spondylitis, anti-gbm / anti-tbm nephritis, antiphospholipid syndrome, autoimmune angioedema, autoimmune autonomic neuropathy, autoimmune encephalitis, autoimmune hepatitis, autoimmune inner ear disease (AIED), autoimmune myocarditis, autoimmune oophoritis, autoimmune orchitis, autoimmune pancreatitis, autoimmune retinopathy. Autoimmune urticaria, Axonal Neuropathy (AMAN), Baro's disease, Behçet's disease, Benign mucous membrane pemphigoid (cicatricial pemphigoid), Bullous pemphigoid, Castleman's disease (CD), Celiac disease, Chagas disease, Chronic inflammatory demyelinating polyneuropathy (CIDP), Chronic relapsing polymyelitis (CRMO), Churg-Strauss syndrome (CSS) or Eosinophilic granulomatosis with polyangiitis (EGPA), Cicatricial pemphigoid, Cogan's syndrome, Cold agglutinin disease, Complex Regional pain syndrome (previously known as reflex sympathetic dystrophy), congenital heart block, Coxsackie myocarditis, CREST syndrome, Crohn's disease, dermatitis herpetiformis, dermatomyositis, Devic's disease (neuromyelitis optica), discoid lupus erythematosus, Dressler syndrome, endometriosis, eosinophilic esophagitis (EoE), eosinophilic fasciitis, erythema nodosum, essential mixed cryoglobulinemia, Evans syndrome, fibromyalgia, pulmonary fibrosis, giant cell arteritis (temporal arterial hyperplasia), Phlebitis), Giant cell myocarditis, Glomerulonephritis, Goodpasture's syndrome, Granulomatosis with polyangiitis, Graves' disease, Guillain-Barré syndrome, Hashimoto's thyroiditis, Hemolytic anemia, Henoch-Schönlein purpura (HSP), Herpes gestationis or pemphigoid of gestationis (PG), Hidradenitis suppurativa (HS) (Acne inversa), IgA nephropathy, IgG4-related sclerosing disease, Immune thrombocytopenic purpura (ITP), Inclusion body myositis (IBM), Interstitial cystitis (IC), Juvenile arthritis, Juvenile diabetes mellitus (type 1 diabetes), juvenile myositis (JM), Kawasaki disease, Lambert-Eaton syndrome, lichen planus, lichen sclerosus, lignified conjunctivitis, linear immunoglobulin A disease (LAD), lupus, chronic Lyme disease, Meniere's disease, microscopic polyangiitis (MPA), mixed connective tissue disease (MCTD), Mucca-Habermann disease, multifocal motor neuropathy (MMN) or MMNCB, multiple sclerosis, myasthenia gravis, myelin oligodendrocyte glycoprotein antibody disorder, myositis,Narcolepsy, neonatal lupus erythematosus, neuromyelitis optica / Devic's disease, neutropenia, ocular pemphigoid, optic neuritis, relapsing rheumatoid arthritis (PR), PANDAS (pediatric autoimmune neuropsychiatric disorders associated with streptococcal infection), paraneoplastic cerebellar degeneration (PCD), paroxysmal nocturnal hemoglobinuria (PNH), pars planitis (peripheral uveitis), Parsonage-Turner syndrome, pemphigus, peripheral nephritis neuropathy, perivenous encephalomyelitis, pernicious anemia (PA), POEMS syndrome, polyarteritis nodosa, polyglandular syndrome type I, II, III, polymyalgia rheumatica, polymyositis, post-myocardial infarction syndrome, post-pericardiotomy syndrome, primary biliary cholangitis, primary sclerosing cholangitis, progesterone dermatitis, progressive facial hemifacial atrophy (PHA), Parry-Romberg syndrome, psoriasis, psoriatic arthritis, pure red cell aplasia (PRCA), pyoderma gangrenosum, Raynaud's phenomenon, reactive arthritis, relapsing polychondritis, restless legs syndrome (RLS), retroperitoneal fibrosis, rheumatic fever, rheumatoid arthritis, sarcoidosis, Schmidt's syndrome or autoimmune polyendocrine syndrome type II, scleritis, scleroderma, Sjogren's disease, stiff-person syndrome (SPS), Susac's syndrome, sympathetic ophthalmia (SO), Takayasu's arteritis, temporal arteritis / giant cell arteritis, thrombocytopenic purpura (TTP), thrombotic thrombocytopenic purpura (Ttp), thyroid eye disease (Ted), Tolosa-Hunt syndrome (THS), transverse myelitis, type 1 diabetes mellitus, ulcerative colitis (UC), undifferentiated connective tissue disease (UCTD), uveitis, vasculitis, vitiligo, Vogt-Koyanagi-Harada disease, and warm autoimmune hemolytic anemia. ,

[0151] In various embodiments, the engineered T cells comprise an expression cassette comprising a polynucleotide encoding a cytokine, including but not limited to, IL-2, IL-4, IL-7, IL-12, IL-13, IL-15, IL-17, IL-21, IL-32, IL-33, IFN-γ, or a combination thereof.

[0152] In various embodiments, the method further comprises inactivating a gene encoding a target antigen of interest in the non-human animal, hi various embodiments, the gene encoding the target antigen is inactivated using a nuclease-dependent cleavage system.

[0153] kit The polynucleotides, plasmid systems, or vectors described herein may be provided in a kit. The kit may include, in addition to the polynucleotides, plasmid systems, or vectors, any reagents that may be used in the use of the system. In one embodiment, the kit includes reagents necessary to transform the vector into mammalian cells. The kit may include growth medium or reagents necessary to make a growth medium, e.g., DMEM for the growth of mammalian cells. Components supplied in the kit may be provided in suitable vials or containers (e.g., plastic or glass vials). The kit may include suitable labeling instructions for storage, and suitable instructions for use. EXAMPLES

[0154] Example 1 - Materials and Methods Culture medium: OPTIMIZERS™ T-Cell Expansion Basal Medium (Gibco), 2.6% OPTIMIZERS™ T-Cell Expansion Supplement (Gibco), 2.5% CTS™ Immune Cell Serum Replacement (Gibco)

[0155] Recovery medium: 400 mL OPTIMIZER™ T-Cell Expansion Basal Medium (Gibco), 10.4 mL 2.5% CTS™ Immune Cell Serum Replacement (Gibco), 10 mL Immune Cell SR, 4 mL 1% L-Glutamine (Gibco), 7.3 mL 10 mM N-Acetyl-L-Cysteine ​​(Sigma).

[0156] 1x TCM (Complete T-cell medium): 400mL OPTIMIZER™ T-Cell Expansion Basal Medium (Gibco), 10.4mL 2.5% CTS™ Immune Cell Serum Replacement (Gibco), 10mL Immune Cell SR, 4mL 1% L-glutamine (Gibco), 4mL 1% Penicillin / Streptomycin (Millipore), 7.3mL 10mM N-Acetyl-L-Cysteine ​​(NAC) (Sigma), 20uL each of 300IU / ml recombinant human IL-2 (Peprotech), 5ng / ml recombinant human IL-7 (Peprotech) and 5ng / ml recombinant human IL-15 (Peprotech).

[0157] Stimulation of T cells for manipulation: First, incubate 1 × 10 TCM in tissue culture plates (G-Rex 24-well cell culture plates (Wilson Wolf)) for at least 15 min before use. 6 Pre-equilibrate at 1 mL per 10 cells. Aliquot 2 mL of 1x TCM into 15 ml conical tubes and incubate in a 37°C water bath for 10 minutes. Thaw the cryopreserved T cells and once thawed, add 1 mL of pre-warmed medium from the 15 mL conical tube dropwise into the cryopreservation tube containing the T cells. Transfer the entire volume of the cell suspension from the cryopreservation tube back into the 15 mL conical tube with pre-warmed medium and bring the volume to 15 mL with 1x PBS. Centrifuge the cells at 400xg for 5 minutes. While waiting, vortex a DYNABEADS™ Human T Expander (Fisher Scientific, Hampton, NH) and then add 1x10 cells. 6Take 50ul of beads per T cells to give a ratio of 2:1 (beads:cells). Wash beads once with 1x PBS on a DYNAMAG™-2 magnet (Fisher Scientific, Hampton, NH). Resuspend beads using 100ul of 1x TCM and transfer beads to a tissue culture plate containing pre-equilibrated 1x TCM. After centrifugation of cells, remove supernatant without disturbing pellet and resuspend pellet in complete medium to obtain 1x10 T cells. 6 Bring to a concentration of 10000 cells / mL. Transfer the cell suspension to tissue culture plates containing 1×TCM and beads and place in a tissue culture incubator at 37° C., 5% CO2 with humidity for 36 hours (plasmid manipulations) or 48 hours (virus manipulations).

[0158] T cell manipulation: Detach T cells from the DYNABEADS™ by harvesting 1 mL of cells from the tissue culture plate into a well of a 24-well plate, press the pipette tip containing the cells at a 45 degree angle against the bottom of the plate, pipette up and down 10 times, and transfer the detached cells into a clean 15 mL conical. Transfer the 15 mL conical to an EASYEIGHTS™ EASYSEP™ Magnet (STEMCELL Technologies, Vancouver, Canada) and incubate for 1 hour at room temperature, without the cap. This allows the DYNABEADS™ to stick to the wall of the tube. Transfer the cell suspension to a tissue culture plate and place in a tissue culture incubator until use. 1 x 10 6 Transfer 300 μl of recovery medium per cell into a well of a tissue culture plate and incubate at 1 × 10 6 Transfer 700 μl of 1x TCM per cell into a separate well of the tissue culture plate. The medium is pre-equilibrated for at least 15 min prior to use.

[0159] Transfer 2uL of CRISPR / Cas9 substrate or PBS to an appropriate PCR tube. 6Transfer 10 T cells (per electroporation reaction) to a 15 mL conical tube and centrifuge at 200 x g for 10 min. Remove the supernatant and resuspend the cell pellet in 14 mL of 1x PBS. Centrifuge the tube at 200 x g for 10 min and completely remove the supernatant without disturbing the cell pellet. The cell pellet should be approximately 1 x 10 6 Cells are resuspended in 20 μL of nucleofection reagent per T cell. 20 ul of cell suspension is transferred to a PCR tube containing 2 uL of CRISPR / Cas9 substrate for the electroporation reaction, without mixing. The entire volume of the electroporation reaction is transferred from the PCR tube to a cuvette in a 16-cuvette strip, without mixing. Cells are electroporated using EO-115 (for viral approach) or (FI-115 for plasmid approach) on a Lonza 4D system, then allowed to rest in the cuvette for 15 minutes at room temperature. 80 μl of pre-equilibrated recovery medium is transferred to the electroporated cells, and the cells are immediately transferred to the wells containing 300 μl of recovery medium. The plate is returned to the tissue culture incubator and incubated for 30 minutes.

[0160] Waiting, 1×10 6 12.5 μl of DYNABEADS per electroporated cells are washed and transferred to wells containing 700 μL of 1×TCM. After 30 minutes, 700 μL of 1×TCM with DYNABEADS™ is transferred to wells containing cells in recovery medium. The final concentration of cells at this step is 1×10 6 cells / ml. Place the plate back into the tissue culture incubator for 24-48 h. If a plasmid is used as the donor template, add DNase1 at a final concentration of 1 µg / mL medium. Immediately transfer the rAAV viral vector to virus access conditions at a multiplicity of infection (MOI) of 500,000.

[0161] Transfer at least 1-5 million engineered cells from tissue culture plates into wells of a 24-well G-Rex containing 6.6 ml of pre-equilibrated 1x TCM. Replace half of the medium in the G-Rex wells without disturbing the cells every 3 days or when the medium turns orange / yellow. Count cells on day 6 and harvest 200,000 cells for flow cytometry analysis and sample culture medium for IDUA assay.

[0162] The remaining cells can be used for downstream analysis and / or engraftment. For engraftment, cells are harvested and the Dynabeads removed as described above. Cells are centrifuged at 200 x g for 10 min, the supernatant removed, and cells are resuspended in 1x PBS for injection.

[0163] CRISPR / Cas9: Chemically modified sgRNA 1. AAVS1 sgRNA sequence: GTCACCAATCCTGTCCCTAG (SEQ ID NO: 1) - targets the AAVS1 locus in T cells. 2. CLEANCAP™ S. pyogenes (Sp) Cas9 mRNA. 2. AAVS1 sgRNA sequence: GTCACCAATCCTGTCCCTAG (SEQ ID NO: 1) - targets the AAVS1 locus in B cells. 3. Universal sgRNA sequence: GGGAGGCGTTCGGGCCACAG (SEQ ID NO: 2) - targets the universal target sequence on the nano plasmid for the HMEJ mechanism. 3. CLEANCAP™ SpCas9 mRNA.

[0164] rAAV vector constructs targeting the AAVS1 locus in T cells: 1. rAAV AAVS1 SA-EGFP (Figure 1). 2. rAAV AAVS1 MND-IDUA-RQR8 (Figure 4A).

[0165] Plasmid Constructs Construct: Targeting the AAVS1 locus in T cells. pAAV AAVS1 MND-IDUA-RQR8 (Figure 10).

[0166] Electroporation: Lonza 4D Electroporator System; AMAXA™ P3 Primary Cell 4D-NUCLEOFECTOR™ X Kit contains: 2x16-cuvette strips, P3 primary cell solution, supplement 1, DNase1 solution 1mg / ml (STEMCELL Technologies).

[0167] Flow cytometry: Cells were stained with PerCP-conjugated CD4, viability dye (eF780), Cy7PE-conjugated anti-CD45RO and PE-conjugated anti-CD34 (anti-RQR8) antibody clone QBEND / 10.

[0168] Example 2 Engineering T cells to express therapeutic proteins A successful T cell engineering process inserts a transgene onto the T cell genome, allowing the T cell to overexpress the transgene of interest. The field of CRISPR / Cas9-mediated T cell engineering has focused primarily on the expression of chimeric antigen receptors (CARs) for cancer therapy (Li, et al. (2020). Brief. Funct. Genomics 19, 175-182; Rupp et al. (2017) Sci. Rep. 7, 737; Choi et al. (2019) J. Immunother. Cancer 7, 1-8), and on autoimmune diseases and infections (Maldini et al. (2018). Nat. Rev. Immunol. 2018 1810 18, 605-616.). Experiments in which T cells are engineered to express or overexpress proteins or enzymes, as well as the use of engineered T cells as therapy for protein deficiency or enzymopathies, such as Mucopolysaccharidosis Type I (MPS I), have not been described.

[0169] To examine CRISPR / Cas9 with recombinant adeno-associated virus (rAAV) vector donor templates to mediate site-specific insertion of transgenes, we constructed a promoterless GFP expression cassette with homology arms (Has) targeting the AAVS1 locus and packaged it into a rAAV vector (rAAV AAVS1 SA-GFP, Figure 1). T cells were stimulated for 48 hours before manipulation. Once stimulated for 48 hours, CRISPR / Cas9 reagents were transfected in the cells via an electroporator. Electroporated cells were immediately transduced with rAAV AAVS1-SA-GFP at an MOI of 500,000. Successful integration of the GFP cassette into the T cell genome allows for the expression of GFP under the regulation of the endogenous promoter of the AAVS1 locus (Figure 1), whereas non-integrated DNA templates do not express GFP. No GFP-positive T cells were observed in vector-only samples (Figure 2A), and up to 68% GFP-positive T cells were observed after manipulation (Figure 2B), indicating that CRISPR / Cas9 and rAAV donor templates can efficiently mediate transgene integration and expression in T cells.

[0170] We performed a pilot study to engraft engineered T cells in a mouse model of MPS I (Figure 3). First, we tested whether T cells could be engineered to express IDUA by using the existing rAAV AAVS1 MND-IDUA-RQR8 vector as a donor template to engineer T cells (Figure 4A). Up to 58% RQR8-positive T cells were observed (Figure 4B), indicating efficient engineering efficiency. In addition, medium containing engineered T cells showed elevated IDUA activity levels (approximately 400 nmol / hr / ml), whereas only background IDUA levels were observed in medium from control unengineered T cells (Figure 5). This indicates that RQR8-positive T cells are expressing and secreting IDUA in the culture medium. Next, T cells were enriched using an RQR8-positive sorting strategy, resulting in a purity of 99.8% (Figure 6).

[0171] 8×10 6 The engineered T cells were engrafted into 3-week-old NOD-SCID-IDUA-deficient mice (NSG-IDUA- / -, NSG-MPSI). MPS I is an autosomal recessive disease. In the mouse model, affected mice must carry two IDUA knockout alleles, while heterozygotes are considered "wild type". Plasma IDUA was monitored in treated NSG-MPSI mice versus heterozygous littermates over the course of 24 weeks. Blood was collected in EDTA tubes and processed for plasma at the indicated time points (Figure 7) to measure IDUA activity in plasma. A slight increase in IDUA was observed in plasma as early as 1 week after engineering (Figure 7) and continued to increase, peaking at 6 weeks after engraftment (Figure 7). IDUA began to decline to levels similar to those in heterozygous littermates and persisted throughout the study period (at least 24 weeks) after engraftment (Figure 7). At the end of the study (week 25), mice were euthanized and vital organs were collected and processed to determine the presence of T cells and IDUA levels in these tissues. Flow cytometry showed human T cells in all organs examined (Figure 8). A high ratio of human T cells to mouse lymphocytes was observed in the lung, liver, and spleen (Figure 8). This may be due to the presence of secondary lymph nodes found in these organs. This indicates that the engineered T cells can persist for at least 24 weeks in treated animals. No human T cells were observed in heterozygous littermates. T cell infiltration in the brain and bone marrow was also observed, suggesting that T cells migrate into the brain and bone marrow. Tissue IDUA showed IDUA levels above physiological levels in all organs examined except the heart (50% of heterozygous levels, Figure 9). This indicates that the engineered T cells express and secrete IDUA for systemic cross-collection in treated animals.

[0172] The ability to use the plasmid to non-virally engineer T cells was also tested. CRISPR / Cas9 (Figure 10) was transfected into T cells via electroporation along with a plasmid DNA donor template. The cells were cultured and expanded in culture for an additional 5 days. Low engineering efficiency of T cells using the plasmid was observed (Figure 11). The reduced engineering efficiency is due to pAAV not being an optimal plasmid for engineering. Nevertheless, IDUA activity in culture medium cultures of engineered T cells showed elevated IDUA activity compared to culture medium cultures of control T cells (Figure 12). This indicates that the plasmid can be used as a donor template for CRISPR / Cas9-mediated targeted insertion and expression of transgenes.

[0173] These results demonstrate an engineered protocol for CRISPR / Cas9-mediated targeted insertion of transgenes in T cells, demonstrating that engineered T cells are able to express and secrete the proteins / enzymes inserted into their genome. In the animal model, engineered cells can be transplanted and sustained for at least 24 weeks. In addition, IDUA-expressing T cells can produce the enzyme to levels comparable to non-diseased xenogeneic NSG littermates. Furthermore, the IDUA enzyme can be taken up by tissues within the tested vital organs of NSG-MPSI mice, resulting in supra-physiological levels of the enzyme. Finally, it was shown that T cells can be transferred into the brains of MPS I animals, suggesting the potential use of engineered T cells for diseases with neurological involvement.

[0174] Example 3 - In vivo analysis of therapeutic gene expression To explore CRISPR / Cas9 with recombinant adeno-associated virus (rAAV) vector donor templates to mediate site-specific insertion of therapeutic transgenes, CRISPR-Cas9 in combination with rAAV6 was used for site-specific insertion of SA-STOP-pA-uMND-IDUA-RQR8 cassette. T cells were stimulated for 48 hours before manipulation. Once stimulated for 48 hours, CRISPR / Cas9 reagents were transfected intracellularly via electroporator. Electroporated cells were immediately transduced with rAAV SA-STOP-pA-uMND-IDUA-RQR8 at 500,000 MOI as described above. The DNA donor template delivered by rAAV6 targeted the AAVS1 locus in memory T cells. We detected up to 49% RQR8+ at 11 days post-manipulation, whereas no detectable RQR8+ cells were detected in non-manipulated controls (Figure 13). This indicates that CRISPR-Cas9 in combination with rAAV6 can mediate efficient insertion and expression of IDUA-RQR8 within the AAVS1 locus in T cells.

[0175] To determine the ability of engineered T cells to express therapeutic proteins in vivo, engineered Tm cells from the two donors mentioned above (pAAV AAVS1 MND-IDUA-RQR8) were engrafted into eight NSG-IDUA-deficient mice. Eight NSG-IDUA-deficient mice were injected with engineered human Tm cells at 1e^6 cells per mouse. Increased levels of IDUA activity were observed in all vital organs examined 12 weeks after engraftment (Figure 14). There was no significant difference in IDUA levels in the liver, spleen, kidney, spinal cord, and bone marrow of heterozygous NSG and Tm-treated NSG-IDUA-deficient mice. Higher levels of IDUA activity were measured in lung tissue in Tm-treated NSG-IDUA-deficient mice compared to heterozygous NSG mice. Overall, higher levels of IDUA were observed in Tm-treated NSG-IDUA-deficient mice than in untreated NSG-IDUA-deficient mice. This indicates that the IDUA measured in Tm-treated NSG-IDUA-deficient mice is secreted from engineered human Tm cells.

[0176] Twelve weeks after injection, tissue GAG ​​content was significantly lower in the heart, lung, liver, spleen, kidney, brain, and bone marrow. The spinal cord had no significant difference in GAG content between heterozygous and treated NSG-IDUA-deficient mice (FIG. 15). Treated NSG-IDUA-deficient mice had no significant difference in GAG content levels from heterozygous NSG mice in the lung, liver, spleen, kidney, brain, and bone marrow. This indicates that IDUA secreted from engineered Tm cells reduces GAG content in vital organs.

[0177] Human CD4 positive cells were observed in all tested vital organs of Tm-treated NSG-IDUA-deficient mice 12 weeks after injection (Figure 16). No CD4+ cells were observed in untreated NSG-IDUA-deficient or heterozygous mice, indicating that these cells can persist in pathological IDUA-deficient tissues for at least 12 weeks.

[0178] IDUA levels were also analyzed. Measurable IDUA activity was observed in the plasma of tm-treated NSG-IDUA-deficient mice at all observed time points (Figure 17). Six weeks after injection, IDUA activity levels peaked in treated mice above heterozygous IDUA activity levels. Over a 22-week period, plasma IDUA levels were significantly higher compared to untreated NSG-IDUA-deficient mice.

[0179] Pathological urinary GAG content in treated NSG-IDUA-deficient mice was also determined. NSG-IDUA-deficient mice were injected with engineered human Tm cells at 1e^6 cells per mouse. At 6, 12, and 18 weeks post-injection, urinary GAG content was significantly lower (Figure 18). At 6 and 12 weeks, there was no significant difference in urinary GAG content in treated NSG-IDUA-deficient and heterozygous mice. This indicates that IDUA secreted from engineered Tm cells reduces GAG content in NSG-IDUA-deficient mice overall.

[0180] Analysis of tissue IDUA showed that increased levels of IDUA activity were observed in all vital organs examined 22 weeks after engraftment (FIG. 19). IDUA activity in treated NSG-IDUA-deficient mice exceeded heterozygous IDUA activity levels in lung and spleen. Overall, higher levels of IDUA were observed in Tm-treated NSG-IDUA-deficient mice than in untreated NSG-IDUA-deficient mice. This indicates that the IDUA measured in Tm-treated NSG-IDUA-deficient mice is secreted from engineered human Tm cells for a minimum of 22 weeks.

[0181] Human CD45 positive cells were over-delivered in all tested vital organs of Tm-treated NSG-IDUA-deficient mice 22 weeks after injection (Figure 20). No CD45 positive cells were observed in untreated NSG-IDUA-deficient or heterozygous mice, indicating that these cells can persist in pathological IDUA-deficient tissues for at least 22 weeks.

[0182] Twenty-two weeks after cell injection, mice underwent a Barnes maze neurocognitive assay. Untreated NSG-IDUA-deficient mice had the longest Barnes maze escape latency (FIG. 21). Treated NSG-IDUA mice had a trend toward decreased latency to find the escape hole over a series of four test days. Heterozygous mice performed best on test days 2, 3, and 4. This indicates that there may be beneficial neurocognitive effects from engineered human Tm cells.

[0183] Engrafted human cells were isolated in NSG-IDUA deficient mice 22 weeks after engraftment. These cells were cultured in activated T cell medium for 8 days. Cell expansion was observed in T cell medium (TCM) and by Dynabead stimulation. Dynabead stimulation produced the highest IDUA activity secreted into the culture medium (Figure 22), indicating that these cells are not senescent or exhausted. This also indicates that the engineered cells can be restimulated.

[0184] Histological profile Liver tissues from treated and untreated animals were stained by H&E staining after 22 weeks. NSG-IDUA-deficient mice had individual small clusters of round cells with amphophilic finely vacuolated cytoplasm (indicative of lysosomal storage pathology) and often peripherally located nuclei (interpreted as foam cells) (Figure 23). These foam cells were mainly clustered around the central vein and, less frequently, around the portal triad and randomly throughout the liver. NSG-IDUA-deficient mice with engineered Tm cells (Figure 23C) did not have pathological vacuolization comparable to heterozygous NSG mice (Figure 23A). Figure 23D shows reduced pathological cytoplasmic vacuolization in NSG-IDUA-deficient mice with fewer individual dispersed foam cells (Figure 23B).

[0185] Staining of brain tissue after 22 weeks showed that NSG-IDUA-deficient mice (FIG. 24B) had rare neurons with finely vacuolated cytoplasm, mainly in the thalamus, indicative of lysosomal storage pathology. Within the cerebrum and pia, there were small clusters of rare foam cells around small caliber blood vessels, and rare endothelial cells had finely vacuolated cytoplasm. NSG-IDUA-deficient mice treated with engineered Tm cells (FIG. 24C) appeared to have fewer vacuolated endothelial / foam cells.

[0186] At the cellular level, lysosomal storage diseases are manifested in larger size and number of lysosomes. We expect that diseased tissues will be characterized by numerous clusters of finely vacuolated macrophages called foam cells, in addition to increased vacuolization of other cell types. IDUA immunohistochemistry (IHC) staining of liver (Figure 25) shows (A) untreated MPS I diseased tissue with foam cell clusters indicated by black squares (Figure 25A), whereas (B) treated MPS I diseased tissue. Black arrows indicate that round lymphocytes with moderate IDUA immunopositivity are observed (black arrow, Figure 25B), as well as irregularly shaped Kupffer cells (macrophages) with strong IDUA immunopositivity (red arrow, inset shows Kupffer cells). Any round lymphocytes in treated mice are interpreted as therapeutic cells due to the NSG background of the disease model. By IDUA IHC, we observed that IDUA from treatment was localized to several cell types and was largely absent from hepatocytes, yet foam cells were almost completely eliminated from all treated mice, indicating amelioration of the disease phenotype.

[0187] Lysosomal membrane associated protein 1 (LAMP-1) IHC in liver shows a mitigated disease phenotype (Figure 26). Endothelial cells and bile duct epithelium of treated mice retain the intense globular staining seen in untreated diseased tissue, but LAMP-1 staining in hepatocytes and sinusoids is coarse and granular like healthy tissue. Although the blood-brain barrier prevents a significant challenge to existing MPS I therapies, the engineered Tm approach of the present invention resulted in a healthier brain, shown in Figure 27. Astrocytes in this treated mouse are as strongly immunopositive as in untreated mice, but the neurons and surrounding tissue are significantly less immunopositive. This translates to fewer and smaller lysosomes and reduced tissue pathology.

[0188] Further analysis of brain tissue from treated and untreated mice (FIG. 28) shows that NSG-IDUA-deficient mice with engineered Tm cells (FIG. 28C) exhibited greater amounts of hIDUA immunopositivity in the choroid plexus of treated NSG-IDUA-deficient mice than in heterozygous and NSG-IDUA-untreated mice. The hIDUA immunopositivity in heterozygous and NSG-IDUA-deficient mice shows background hIDUA staining.

[0189] A summary of the histological results is shown in Table 1 below. [Table 1]

[0190] The levels of CD3+ T cells were also assessed. Heterozygous and NSG-IDUA-deficient mice (FIG. 28A-B) show a nonspecific CD3+ immunopositive background. NSG-IDUA-deficient mice treated with engineered Tm cells (FIG. 28C) contain CD3+ lymphocytes, indicated by black arrows. These CD3+ cells are localized within the pia mater of the brain tissue. [Table 2]

[0191] Example 4: Additional constructs can express therapeutic proteins To determine whether additional constructs containing a therapeutic gene of interest could deliver therapeutic proteins to T cells in a site-specific manner, delivery constructs were generated that contained transposon elements and expressed therapeutic proteins.

[0192] Two IDUA expression plasmids were designed with inverted terminal repeats flanking the gene cassette for transposon delivery (Figure 29). One cassette contained EGFR-WPRE-pA truncated with uMND-IDUA-P2A, and the second cassette contained EGFR-WPRE-pA truncated with uMND-chimeric intron-IDUA-P2A. After 48 hours of T cell stimulation, cells are electroporated with TcBuster™ (R&D Systems, Minneapolis, MN) mRNA and a plasmid cassette containing the Transposon ITR element for integration. Bulk T cells from two separate donors were electroporated with transposase mRNA and DNA IDUA expression cassettes. The cells were then transferred to culture medium and continued in culture for 96 hours after which expression of electroporated human EGFR was measured by flow cytometry. Both transposon delivery plasmids had EGFR expression indicating integration of the IDUA cassette into the genome (FIG. 30).

[0193] IDUA activity in cell culture medium was measured 96 hours after electroporation with T cell culture medium replaced 24 hours before harvest. Cell expansion was observed in T cell medium and by Dynabead stimulation. The two conditions with the highest IDUA activity had all the components for transposon delivery of the IDUA expression cassette indicating integration into the genome (Figure 31).

[0194] Flow cytometry of engineered bulk T cells was performed 7 days after the cells were engineered. EGFR-positive CD4 and CD8 cells were present in the cultures (FIG. 32). This indicates that transposon delivery of the IDUA expression cassette is capable of engineering multiple T cell subsets within a bulk population of T cells.

[0195] CD8 T cells from P14 mice were electroporated with the transposase mRNA and DNA IDUA expression cassettes described above. 96 hours after electroporation, expression of mouse EGFR was measured by flow cytometry. Both transposon delivery plasmids had EGFR expression indicating integration of the IDUA cassette into the genome (Figure 33).

[0196] We evaluated the secreted enzyme IDUA activity from mouse P14 CD8 T cells engineered with transposon elements. IDUA activity in cell culture medium was measured 96 hours after electroporation with T cell culture medium replaced 24 hours before harvesting. Cell expansion was observed in the T cell medium. The two conditions with the highest IDUA activity had all the components for transposon delivery of the IDUA expression cassette, indicating integration into the genome (Figure 34).

[0197] Expression of larger genes can be more difficult using the AAV method described above. To express larger genes of interest, constructs were designed in which longer polynucleotides were split and used as homology arms of vectors. Figure 35 shows an expression construct that contains the MND promoter followed by the tEGFR-T2A-TSS or mCCR10-T2A-TSS coding sequence, flanked by 1000 bp homology arms on either side that target the endogenous COL7A1 locus.

[0198] γδ T cells were isolated from PBMCs and stimulated for 2 days prior to electroporation and AAV6 delivery. Cells were expanded for 9 days followed by secondary stimulation and expansion for an additional 11 days. CAS9 RNP was electroporated into γδ T cells followed by addition of HDR template delivered by AAV6, resulting in coordinated expression of tEGFR or mCCR10 and endogenous COL7A1. CRISPR / Cas9 electroporation with MND-tEGFR-T2A-TSS resulted in efficient integration in γδ T cells. The frequency of successfully targeted γδ T cells as measured by tEGFR expression is shown in FIG. 36.

[0199] Next, the relative gene expression of COL7A1 from the engineered T cells was measured. The edited cells expressed approximately 100,000-fold more COL7A1 mRNA than the pulsed controls (FIG. 37). For both tEGFR and mCCR10 AAVs, 5'-end junction PCR detected proper integration in COL7A1 using primers inside the MND promoter and outside the left homology arm.

[0200] These results indicate that larger genes of interest can be used in the expression cassettes described herein to generate edited T cells that express therapeutic proteins.

[0201] Numerous modifications and variations of the present disclosure as set forth in the illustrative examples set forth above will be anticipated by those skilled in the art, and therefore only such limitations as appear in the appended claims should be placed on this disclosure.

Claims

1. A method for genetically modifying T cells or a population of T cells to overexpress a target gene, comprising introducing a viral vector, plasmid, nanoplasmid, or minicircle into the T cells or T cell population, the expression cassette containing a homology arm (HA), a polynucleotide encoding the target gene, a splice acceptor site, a promoter, and a targeting site for a nuclease-dependent cleavage targeting molecule. A method comprising inserting the expression cassette into a gene locus targeted by the targeting molecule.

2. A method for genetically modifying T cells or a population of T cells to overexpress endogenous genes, comprising introducing a viral vector, plasmid, nanoplasmid, or minicircle into the T cells or T cell population, the expression cassette containing homology arms (HAs), splice acceptor sites, promoters, and targeting sites for nuclease-dependent cleavage targeting molecules. A method comprising inserting the expression cassette upstream of a target gene to be overexpressed.

3. i) The gene of interest is a therapeutic gene or codes for a therapeutic protein, and optionally the therapeutic gene codes for an enzyme, cytokine, chemokine, T cell receptor, or cell surface receptor, and / or ii) The target gene is a donor polynucleotide that corrects the mutant genotype in the target. The method according to claim 1.

4. i) The homology arm is 35 to 1000 nucleotides, ii) The nuclease-dependent cleavage system includes a CRISPR / Cas system, a Cas-CLOVER system, a zinc finger nuclease (ZFN) system, a transcription activator-like effector nuclease (TALEN) system, or a meganuclease system, wherein the CRISPR / Cas system optionally includes Cas9, Cas12a, Cas13a, or Cas13b. iii) The nuclease-dependent cleavage system is a CRISPR / Cas system, and the targeting molecule is a guide RNA. iv) The plasmid includes a reverse terminal repeat adjacent to the polynucleotide encoding the gene of interest for transposon delivery, v) The viral vector is a lentiviral vector, an adenovirus vector, or an AAV vector, and the viral vector is optionally selected from the group consisting of a VSVg-pseudotype lentiviral vector, an AAV6 vector, an AAV1 vector, or an AAV-DJ vector. vi) The promoter is the MND promoter, CMV promoter, CAG promoter, PGK promoter, EF1A promoter, AAV promoter, or T cell-specific promoter, and / or vii) The T cells or population of T cells are CD4+ T cells, CD8+ T cells, T cell lines, primary T cells, naive T cells, effector T cells, regulatory T cells, memory T cells, or gamma-delta T cells. The method according to any one of claims 1 to 3.

5. The method further comprises transfecting the T cells or population of T cells with a Cas protein or a polynucleotide encoding a Cas protein, and a guide RNA molecule that leads to the incorporation of the expression cassette into a target locus in the T cell genome, wherein optionally i) the target locus is AAVS1 or the T cell receptor α constant (TRAC) locus, and / or ii) The plasmid for transposon delivery comprises a promoter, a gene of interest, a biomarker, a regulatory element, and optionally a chimeric intron. The method according to claim 4.

6. The method further includes introducing a polynucleotide encoding a biomarker molecule useful for enriching the T cells or T cell population into the T cells or T cell population, optionally i) The biomarker molecule comprises a fragment of CD34 and a fragment of CD20, and / or ii) The biomarker polynucleotide is located on the same expression cassette as the homology arm, splice acceptor site, promoter, and targeting site for the nuclease-dependent cleavage targeting molecule. The method according to claim 1.

7. The method according to claim 1, wherein the target gene is incorporated into the T cell genome via homology-directed repair (HDR), homology-mediated end joining (HMEJ), or a combination of HDR / HMEJ.

8. i) The introduction of the plasmid, nanoplasmid, or minicircle is by transfection or electroporation. ii) The viral vector, plasmid, nanoplasmid, or minicircle contains the promoter immediately following or near the gene of interest, and / or iii) The viral vector, plasmid, nanoplasmid, or minicircle further comprises a polynucleotide encoding a T cell receptor or a fragment thereof or a chimeric antigen receptor, The method according to claim 1.

9. The method according to claim 1, wherein the introduction of the viral vector is by electroporation, and the viral vector is introduced selectively with an infection multiplicity of 3 × 10⁵ to 1 × 10⁷.

10. The method according to claim 8, wherein transposase mRNA is electroporated together with a plasmid for transposon delivery and an expression cassette for expressing the target gene.

11. A method for producing gene-edited T cells or a population of T cells, i) Contacting T cells or a population of T cells with a viral vector, plasmid, nanoplasmid, or minicircle containing an expression cassette that includes homology arms (HAs), splice acceptor sites, promoters, and targeting sites for nuclease-dependent cleavage targeting molecules, and optionally contains polynucleotides encoding a gene of interest; ii) Culturing the T cells or population of T cells described in i) in a culture medium that promotes the expansion of T cells, iii) Isolating the T cells or T cell population in ii) based on the identification of a marker expressed only on T cells or T cell populations possessing the viral vector, plasmid, nanoplasmid, or minicircle, A method comprising culturing the isolated cells of iv)iii) in a culture medium to enlarge the isolated cells that express the target gene.

12. i) The method further comprises a step of stimulating, proliferating, or activating the T cells or population of T cells prior to the contact step, wherein the step of optionally stimulating, proliferating, or activating the T cells or population of T cells comprises contacting the cells with one or more of IL-2, IL-7, IL-15, IFN-γ, and N-acetylcysteine ​​(NAC). ii) The method produces gene-edited T cells with an efficiency of more than 15%, and / or iii) The method according to claim 11, wherein the method maintains a 60% cell viability rate in the culture after 3 days.

13. Gene-edited T cells, i) A heterologous polynucleotide sequence encoding a target gene integrated into the T cell genome at a target site via a nuclease-dependent cleavage system, wherein the heterologous polynucleotide sequence is also adjacent to a portion of a homology arm and is expressed via an endogenous promoter, ii) Gene-edited T cells containing heterologous biomarker molecules.

14. i) The T cell is a CD4+ T cell, a CD8+ T cell, a T cell line, a primary T cell, a naive T cell, an effector T cell, a regulatory T cell, a memory T cell, or a gamma-delta T cell. ii) The gene of interest is a therapeutic gene or codes for a therapeutic protein, optionally the therapeutic gene codes for an enzyme, cytokine, chemokine, T cell receptor, or cell surface receptor, and / or iii) the gene of interest is a donor polynucleotide that modifies a mutant genotype in a subject, according to claim 13.

15. A composition for use as a pharmaceutical product, comprising gene-edited T cells or a population of T cells as described in claim 13 or 14.

16. A composition comprising gene-edited T cells or a population of T cells according to claim 13 or 14 for the treatment of a disease or disorder in a subject requiring treatment, wherein the disease or condition is an enzyme disease, an infectious disease, a genetic disorder, or a disease related to tissue regeneration, and optionally the disease is an enzyme disease, and optionally the enzyme disease is aspartylglucosamiuria, cholesterol ester storage disease, Wolmann disease, metachromatic leukodystrophy, Danon disease, Fabry disease, Faber lipogranulomatosis, Faber disease, fucosidosis, galactosialidosis type I / II, Gaucher disease type I / II / III, globoid cell leukodystrophy, Krabbe disease, glycogen storage disease II, Pompe disease, GM1 gangliosidosis type I / II / III, GM2 gangliosidosis type I, Tay-Sachs disease, GM2 - Gangliosidosis type II, Sandhoff disease, GM2-gangliosidosis, α-mannosidosis type I / II, β-mannosidosis, mucolipidosis type I, sialidosis type I / II, mucolipidosis type II / III, Aysell's disease, mucolipidosis type IIIC, pseudo-Haller polydystrophy, mucopolysaccharidosis type I, mucopolysaccharidosis type II, Hunter syndrome, mucopolysaccharidosis type IIIA, Sanfilippo syndrome type B, Sanfilippo syndrome type C, Sanfilippo syndrome type D, mucopolysaccharidosis type IIIB, mucopolysaccharidosis type IIIC, mucopolysaccharidosis type IID, mucopolysaccharidosis type IVA, mucopolysaccharidosis type IVB A composition selected from the group consisting of Morquio syndrome type A, Morquio syndrome type B, mucopolysaccharidosis type VI, mucopolysaccharidosis type VII, Sly syndrome, mucopolysaccharidosis type IX, multiple sulfatase deficiency, neuronal ceroid lipofuscinosis, CLN1 Batten disease, CLN2 Batten disease, Niemann-Pick disease type A / B, Niemann-Pick disease, Niemann-Pick disease type C1, Niemann-Pick disease type C2, concentrated dysostosis, Schindler disease type I / II, and sialic acid storage, hemophilia A, hemophilia B, Christmas disease, and factor VII deficiency, spinal muscular atrophy, and epidermolysis bullosa dystrophy, wherein the enzyme disease is optionally mucopolysaccharidosis type I (MPS I), and the gene of interest is idulonidase.

17. i) an expression cassette comprising a homology arm (HA), a polynucleotide encoding the gene of interest, a splice acceptor site, a promoter, and a targeting site for a nuclease-dependent cleavage targeting molecule, which can be inserted into a gene locus targeted by the targeting molecule. ii) An expression cassette can be inserted upstream of the overexpressed target gene, including homology arms (HAs), splice acceptor sites, promoters, and targeting sites for nuclease-dependent cleavage targeting molecules, or iii) Homology arms (HAs), splice acceptor sites, promoters, and targeting sites for transposon delivery of the gene of interest, which can be inserted into a gene locus targeted by a transposon delivery site and / or upstream of the overexpressed target gene. A polynucleotide expression cassette containing [the specified component].

Images