Therapeutic adeno-associated virus using codon-optimized nucleic acid encoding alpha-glucosidase (GAA) with signal peptide modification for treating Pompe disease

Abstract

Disclosed herein is a method for treating Pompe disease comprising administering a recombinant AAV (rAAV) vector comprising a heterologous nucleic acid encoding a GAA signal peptide or a portion thereof, the heterologous signal peptide, and a rAAV genome comprising an acid alpha-glucosidase (GAA) polypeptide or an N-terminal truncation thereof, wherein the heterologous nucleic acid is operably linked to a liver-specific promoter, and the nucleic acid encoding the GAA polypeptide may be a wild-type nucleic acid sequence, or a modified nucleic acid sequence, or a codon-optimized nucleic acid sequence, optionally modified to reduce or completely eliminate CG and CpG dinucleotides, and optionally excluding alternative reading frame (ARF) content.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit under 35 U.S.C. §119(e) of U.S. Provisional Application No. 63 / 321,336, filed March 18, 2022, U.S. Provisional Application No. 63 / 348,862, filed June 3, 2022, and U.S. Provisional Application No. 63 / 444,804, filed February 10, 2023, the contents of each of which are incorporated herein by reference in their entirety.

[0002] Sequence Listing This application contains a sequence listing in Table 9 herein, which is incorporated by reference in its entirety.

[0003] FIELD OF THE INVENTION The present invention relates to methods for treating Pompe disease by administering adeno-associated virus (AAV) particles, virions, and vectors for expression of alpha-glucosidase (GAA) polypeptides, wherein the nucleic acid encoding GAA may be codon-optimized or truncated. The compositions disclosed herein can be used in methods for treating Pompe disease, for example, without the clinical need for administration of long-term GAA enzyme replacement therapy (ERT) over long periods of time. [Background technology]

[0004] background Pompe disease (glycogen storage disease type II; acid maltase deficiency; MIM 232300) is caused by a recessive mutation in the GAA gene, resulting in complete or partial deficiency of the lysosomal enzyme acid α-glucosidase (GAA). Absence of GAA leads to the progressive accumulation of glycogen in the lysosomes of many tissues, particularly skeletal muscle and cardiac muscle cells. Impaired energy metabolism then leads to severely disrupted muscle structure, impaired function, autophagy, and, in adults, significant fat replacement of skeletal muscle myocytes.

[0005] Clinically, the condition ranges from fulminant infantile-onset Pompe disease (IOPD), which typically leads to death before 12 months of age, to slowly progressive late-onset Pompe disease (LOPD), which results in a myopathy causing loss of motor function and typically results in death from respiratory failure 5–15 years after diagnosis. Infantile-onset patients have cardiomyopathy, often noticeable at birth or even prenatally, accompanied by elevated creatine kinase (CK) levels. They then develop severe hypotonia, respiratory compromise requiring ventilator support, and cardiac enlargement within weeks to months of birth. Death most often results from cardiopulmonary failure, aspiration pneumonia, or ventricular arrhythmias. Patients with late-onset Pompe disease (LOPD), mostly adults but some juveniles, often experience delayed diagnosis, slowly progressive muscle weakness, excessive fatty replacement of trunk and proximal limb muscles, and progression to respiratory failure, the leading cause of death (Carlier et al. 2011). Basilar artery aneurysms can develop and rupture, which can be life-threatening (El-Gharbawy et al. 2011; Hobson-Webb et al. 2012). As an alternative or adjunct to enzyme therapy, the feasibility of gene therapy approaches to treat GSD-II has been investigated (Amalfitano, A., et al., (1999) Proc. Natl. Acad. Sci. USA 96:8861-8866; Ding, E., et al. (2002) Mol. Ther. 5:436-446; Fraites, TJ, et al., (2002) Mol. Ther. 5:571-578; Tsujino, S., et al. (1998) Hum. Gene Ther. 9:1609-1616).

[0006] MYOZYME® (alglucosidase alfa) was the first U.S.-approved product for the treatment of Pompe disease (2006), and LUMIZYME® (alglucosidase alfa) was approved in 2010 and is the current standard of care (SOC) treatment for infantile-onset and late-onset Pompe disease patients. Alglucosidase alfa is administered intravenously as an infusion at a dose of 20 mg / kg every two weeks (LUMIZYME package insert 2014). Alglucosidase alfa provides an exogenous source of GAA. Binding to the mannose-6-phosphate receptor on the cell surface occurs via the carbohydrate group of the GAA molecule, which is then internalized and transported to lysosomes, where it has been shown to undergo proteolytic cleavage, resulting in increased enzymatic activity. It then exhibits enzymatic activity in the cleavage of glycogen. While this enzyme replacement therapy (ERT) prolongs survival in most patients with pediatric Pompe disease, some either die, suffer progressive muscle weakness, or remain severely hypotonic requiring ventilator support despite adherence to SOC ERT. In patients with late-onset disease, ERT initially modestly improves parameters of muscle and lung function, followed by stable or declining function, remaining far from an ideal treatment (Schoser et al. 2017).

[0007] In infantile-onset patients, especially those with severe or null mutations (cross-reactive immunoglobulin [CRIM] negative), high and persistent anti-rhGAA immunoglobulin G (IgG)-mediated immunity to the GAA enzyme is a major reason for impaired or inadequate responses to ERT. ERT is known to induce antibody responses in both IgG and IgE forms and can also result in infusion-related reactions (Kishnani et al. 2007; Kishnani et al. 2010). Current practice is to initiate immune modulation with ERT in patients with LOPD who are at risk for antibody formation.

[0008] Additionally, enzyme replacement therapy (ERT) with alglucosidase alfa (MYOZYME® / LUMIZYME®), delivered as cumbersome biweekly or weekly infusions, is the only treatment currently available. In individuals with infantile-onset Pompe disease (IOPD), GAA is absent (CRIM-negative) or minimal (approximately 1% of normal), causing rapidly progressive cardiopulmonary failure and, if untreated, death by age 2 years (Parini et al. 2018). Subjects with significant GAA deficiency present as juveniles or adults (late-onset Pompe disease [LOPD]), with less severe and more slowly progressing symptoms. Failure to receive biweekly treatment can also result in significant regression, requiring several months of ERT to restore the same levels.

[0009] Therefore, despite temporary therapeutic success, alglucosidase alfa ERT remains a clear unmet medical need in both IOPD and LOPD. Long-term data in subjects confirm that ERT does not result in complete correction or normalization in patients with Pompe disease. Ultimately, subjects typically decline, albeit at a slower rate, and the inevitable progression to death is delayed (Kuperus et al. 2017; Parini et al. 2018). Although alglucosidase alfa extends survival for subjects with both IOPD and LOPD (LUMIZYME package insert, 2014), the antibody response to GAA and reduced efficacy pose some drawbacks.

[0010] Therefore, from a clinical perspective, long-term treatment of Pompe patients with ERT has had limited success. In a subset of IOPD patients, many experience high and persistent anti-rhGAA antibody titers (HSAT). Pompe patients who lack any residual GAA protein are considered CRIM-negative. CRIM-negative patients develop HSAT, and the subset of CRIM-positive patients who also develop high or persistent moderate titers suffer from significantly increased mortality (Banugaria et al. 2011). Furthermore, the use of immunosuppression to prevent antibody formation in patients at risk for HSAT significantly prolonged survival, confirming the clinical relevance of HSAT (Mendelsohn et al. 2009; Banugaria et al. 2011). Furthermore, the literature indicates that only approximately 1% of ERTs are pharmacologically active. Thus, although enzyme therapy has demonstrated reasonable efficacy for severe pediatric GSD II, the benefits of GAA enzyme therapy are limited by the need for frequent infusions and the development of inhibitors or neutralizing antibodies against recombinant hGAA protein in patients (Amalfitano, A., et al. (2001) Genet. In Med. 3:132-138), and there is a need for improved methods and alternative therapies for treating patients with Pompe disease. Adeno-associated virus (AAV) vector-mediated gene transfer provides a suitable and viable alternative. [Prior art documents] [Non-patent literature]

[0011] [Non-Patent Document 1] Amalfitano, A., et al., (1999) Proc. Natl. Acad. Sci. USA 96:8861-8866 [Non-patent document 2] Ding, E., et al. (2002) Mol. Ther. 5:436-446 [Non-patent document 3] Fraites, TJ, et al., (2002) Mol. Ther. 5:571-578 [Non-patent document 4] Tsujino, S., et al. (1998) Hum. Gene Ther. 9:1609-1616 Summary of the Invention [Means for solving the problem]

[0012] Summary of the Invention The technology described herein generally involves the incorporation into a genome of a heterologous nucleic acid sequence encoding all or a portion of an endogenous GAA signal peptide, a heterologous signal peptide, and an alpha-glucosidase (GAA) polypeptide, the heterologous signal peptide being located between the 5' and 3' AAV inverted terminal repeat (ITR) sequences, and (b) an endogenous GAA signal peptide, a heterologous signal peptide, and an alpha-glucosidase (GAA) polypeptide, the endogenous GAA polypeptide comprising amino acid residues 28-952 of SEQ ID NO:1, amino acid residues 57-952 of SEQ ID NO:1, or an N-terminal GAA polypeptide fragment, e.g., amino acids 28, 28-29, 28-30, 28-31, 28-32, or 28-33 of SEQ ID NO:1, and the next 5 amino acids to about the next 5 amino acids after the N-terminal GAA polypeptide fragment of SEQ ID NO:1. The present invention relates to a recombinant adenovirus-associated (rAAV) vector comprising a heterologous nucleic acid sequence, including an N-terminal GAA polypeptide fragment containing a deletion of any number of amino acids from 40 amino acids, wherein a heterologous signal peptide may be inserted at or immediately after the N-terminal GAA polypeptide fragment and immediately before the remaining amino acids of the GAA polypeptide (e.g., a heterologous signal peptide may be optionally fused at position 57 of the remaining amino acids of the GAA polypeptide, extending the GAA polypeptide to amino acid 952 of SEQ ID NO: 1 or a functional fragment thereof), wherein the nucleic acid sequence encoding the GAA polypeptide may be codon-optimized, and wherein the heterologous nucleic acid is operably linked to a liver-specific promoter. In certain embodiments, a homologous GAA signal peptide or a fragment thereof may be present.

[0013] A recombinant adenovirus-associated (rAAV) vector comprising within its genome (a) 5' and 3' AAV inverted terminal repeat (ITR) sequences, and (b) optionally, a heterologous nucleic acid sequence encoding all or a portion of an endogenous GAA signal peptide, a heterologous signal peptide, and an alpha-glucosidase (GAA) polypeptide located between the 5' and 3' ITRs, wherein the GAA polypeptide comprises amino acid residues 28-952 of SEQ ID NO:1, amino acids 57-952 of SEQ ID NO:1, or an N-terminal GAA polypeptide fragment comprising, for example, amino acids 28, 28-29, 28-30, 28-31, 28-32, or 28-33 of SEQ ID NO:1, and a deletion which may be any number of amino acids from about 5 amino acids to about 40 amino acids after the N-terminal GAA polypeptide fragment of SEQ ID NO:1, wherein a heterologous signal peptide may be inserted immediately prior to the remaining amino acids of the GAA polypeptide. In one embodiment, a heterologous signal peptide is optionally fused at position 57 of the remaining amino acids of the GAA polypeptide, which may extend up to amino acid 952 of SEQ ID NO: 1 or a functional fragment thereof, the nucleic acid sequence encoding the GAA polypeptide may be wild-type or codon-optimized, and the heterologous nucleic acid is operably linked to a liver-specific promoter.

[0014] In some embodiments, the nucleic acid sequence encoding the endogenous GAA signal peptide encodes at least 1-5, or at least 1-10, or at least 1-20, or at least about 1-23, or at least about 1-24, or at least about 1-25, or at least about 1-26, or at least about 1-27 consecutive amino acids of the endogenous GAA signal peptide of SEQ ID NO:59. In some embodiments, the nucleic acid sequence encoding the GAA signal peptide encodes a modified GAA signal peptide that includes a deletion of at least 1, or at least 2, or at least 3, or at least 4, or at least 5, or at least 6, or at least 7, or at least 8, or at least 9, or at least 10, or at least 11, or at least 12, or at least 13, or at least 14, or at least 15, or at least 16, or at least 17, or at least 18, or at least 19, or at least 20 amino acids of SEQ ID NO: 59, and the deletions can be contiguous or discontinuous deletions.

[0015] In some embodiments, the nucleic acid sequence encoding the GAA signal peptide encodes at least 1-5, or at least 1-10, or at least 1-20, or at least about 1-23, or at least about 1-24, or at least about 1-25, or at least about 1-26, or at least about 1-27 consecutive amino acids of the endogenous GAA signal peptide.

[0016] In one embodiment of any aspect herein, there is a codon-optimized nucleic acid sequence encoding a GAA polypeptide selected from the group consisting of SEQ ID NOs: 1-18, or a functional fragment thereof.

[0017] In one embodiment of any aspect herein, the nucleic acid encoding SEQ ID NO: 3 is wild-type.

[0018] In one embodiment of any aspect herein, the vector comprises the nucleic acid sequence of SEQ ID NO: 23 or a functional variant thereof.

[0019] In one embodiment of any aspect of the present specification, the heterologous nucleic acid sequence encodes a GAA protein comprising a signal peptide fused to a GAA polypeptide, wherein the signal peptide is an endogenous GAA signal peptide or a heterologous signal peptide, or a combination thereof.

[0020] In one embodiment of any aspect herein, the AAV genome includes, from 5' to 3', (a) a 5' ITR, (b) a liver-specific promoter sequence, (c) a 5' UTR sequence, (d) a nucleic acid encoding part or all of the endogenous GAA signal peptide, (e) a nucleic acid encoding a heterologous signal peptide or an N-terminal GAA polypeptide fragment, (f) a nucleic acid encoding an alpha-glucosidase (GAA) polypeptide, wherein the GAA polypeptide can be in its entirety or a functionally active fragment thereof, (g) a polyA sequence, and (h) an inverted RNA pol II terminator sequence.

[0021] In one embodiment of any aspect herein, the vector further comprises at least one of a UTR or an inverted RNA pol II terminator sequence.

[0022] In one embodiment of any aspect herein, the UTR is 5' or 3'.

[0023] In one embodiment of any aspect herein, the nucleic acid encoding a signal peptide encodes a signal sequence selected from any of the endogenous GAA signal peptide, fibronectin signal peptide (FN1), IL-2 wt signal peptide, modified IL-2 signal peptide, IL2(1-3) signal peptide, IgG signal peptide, AAT signal peptide, A2M signal peptide, or PZP signal peptide, or an active fragment thereof having signal peptide activity.

[0024] In one embodiment of any aspect herein, the nucleic acid sequence encodes a GAA polypeptide having the amino acid sequence of SEQ ID NO:1, or a polypeptide having at least 80% sequence identity to SEQ ID NO:1, wherein amino acid residue 199 is R (199R), amino acid residue 223 is H (223H), and amino acid residue 780 is I (780I).

[0025] In one embodiment of any aspect of the present specification, the nucleic acid sequence encoding the GAA polypeptide is SEQ ID NO:3, or a nucleic acid sequence having at least 80%, or at least 85%, or at least 90% sequence identity to SEQ ID NO:3, which encodes a GAA polypeptide having at least 80% sequence identity to SEQ ID NO:1, wherein amino acid residue 199 is R (199R), amino acid residue 223 is H (223H), and amino acid residue 780 is I (780I).

[0026] In one embodiment of any aspect herein, the 5'UTR sequence comprises SEQ ID NO:41, or a nucleic acid having at least 80% sequence identity to SEQ ID NO:41.

[0027] In one embodiment of any aspect herein, the 5'UTR sequence comprises SEQ ID NO:40, or a nucleic acid having at least 80% sequence identity to SEQ ID NO:40.

[0028] In one embodiment of any aspect herein, the vector further comprises an intron sequence located 5' of the nucleic acid sequence encoding a signal peptide and 3' of the promoter.

[0029] In one embodiment of any aspect herein, the intron sequence is selected from the group consisting of an MVM sequence, an HBB2 sequence, a CMVIE intron sequence, or a UBC intron sequence, or an SV40 sequence.

[0030] In one embodiment of any aspect herein, the GAA polypeptide is an N-terminally truncated GAA polypeptide selected from any disclosed in Table 1.

[0031] In one embodiment of any aspect herein, the vector further comprises at least one polyA sequence located 3' of the nucleic acid encoding the GAA gene and 5' of the 3' ITR sequence.

[0032] In one embodiment of any aspect herein, the heterologous nucleic acid sequence further comprises a 3'UTR sequence, which is located 3' of the nucleic acid encoding the GAA polypeptide and 5' of the 3'ITR sequence, or is located between the nucleic acid encoding the GAA polypeptide and the polyA sequence, and may also include an RNA pol II terminator sequence.

[0033] In one embodiment of any aspect of the present specification, the heterologous nucleic acid sequence further comprises a 3' intron sequence, which is located 3' of the nucleic acid encoding the GAA polypeptide and 5' of the 3' ITR sequence, or is located between the nucleic acid encoding the GAA polypeptide and the polyA sequence and / or RNA polII terminator sequence.

[0034] In one embodiment of any aspect herein, the ITR comprises an insertion, deletion, or substitution.

[0035] In one embodiment of any aspect herein, one or more CpG islands in the ITRs are removed.

[0036] In one embodiment of any aspect herein, the nucleic acid encoding the signal peptide is an AAT signal peptide (e.g., SEQ ID NO: 67) or an active fragment thereof having secretory signal activity, for example, a nucleic acid encoding an amino acid sequence having at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 67; a fibronectin signal peptide (FN1) (e.g., SEQ ID NOs: 73-75) or an active fragment thereof having secretory signal activity, for example, a nucleic acid encoding an amino acid sequence having at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 73-75; an endogenous GAA signal peptide (SEQ ID NO: 51) or an active fragment thereof having secretory signal activity, for example, a nucleic acid encoding an amino acid sequence having at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 51. a nucleic acid encoding an amino acid sequence having sequence identity to SEQ ID NO: 72; a nucleic acid encoding an hIGF2 signal peptide (e.g., SEQ ID NO: 72), or an active fragment thereof having secretory signal activity, for example, an amino acid sequence having at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 72; a nucleic acid encoding an IgG1(201) signal peptide (SEQ ID NO: 54), or an active fragment thereof having secretory signal activity, for example, an amino acid sequence having at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 54; a nucleic acid encoding a wtIL2 leader peptide (SEQ ID NO: 55), or an active fragment thereof having secretory signal activity, for example, an amino acid sequence having at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 55;The nucleic acid encoding a GAA polypeptide is selected from the group consisting of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, or a nucleic acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 98%, or 99% sequence identity to SEQ ID NOs:1-18;

[0037] In one embodiment of any aspect of the present specification, the nucleic acid encoding a GAA polypeptide is selected from SEQ ID NO: 3 or a fragment thereof having functional GAA activity, or a nucleic acid sequence having at least 60%, or 70%, or 80%, 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 3, encoding a GAA polypeptide with at least 85% sequence identity to SEQ ID NO: 1, wherein amino acid residue 199 is R (199R), amino acid residue 223 is H (223H), and amino acid residue 780 is I (780I).

[0038] In one embodiment of any aspect herein, the nucleic acid encoding a GAA polypeptide encodes a GAA polypeptide starting at any of amino acid residues 35, 40, 50, 57, 60, 68, 69, 70, 72, 74, 779, 790, 791, 792, 793, or 796 of SEQ ID NO:1, or a sequence 80% identical to SEQ ID NO:1, where amino acid residue 199 is R (199R), amino acid residue 223 is H (223H), and amino acid residue 780 is I (780I).

[0039] In one embodiment of any aspect herein, the GAA polypeptide has an endogenous GAA signal peptide or fragment thereof attached to the N-terminus of the GAA polypeptide and a heterologous signal peptide attached thereto or followed thereto, wherein the endogenous signal peptide has the amino acid sequence of SEQ ID NO: 59 or a sequence with at least 80% sequence identity to SEQ ID NO: 59, and the heterologous signal peptide is selected from the group consisting of SEQ ID NO: 60 (201 IgG signal peptide), or IL2 wild-type signal peptide (SEQ ID NO: 61), modified IL2 signal peptide (SEQ ID NO: 62), A2M signal peptide (SEQ ID NO: 63), or PZP signal peptide (SEQ ID NO: 64), or an artificial signal peptide (SEQ ID NO: 65), or cathepsin L signal peptide (SEQ ID NO: 66), or a signal peptide with at least 90% sequence identity to SEQ ID NOs: 60-66.

[0040] In one embodiment of any aspect herein, the liver-specific promoter is selected from any of SEQ ID NOs: 86, 88, 91-96, 146-150, or 439-441, or a liver-specific promoter having at least 80% sequence identity to SEQ ID NOs: 86, 88, 91-96, 146-150, or 439-441.

[0041] In one embodiment of any aspect herein, the liver-specific promoter is selected from any of SEQ ID NOs: 98 or 99, or a liver-specific promoter having at least 80% sequence identity to SEQ ID NO: 98 or 99.

[0042] In one embodiment of any aspect herein, the liver-specific promoter is SEQ ID NO:97, or a liver-specific promoter having at least 80% sequence identity to SEQ ID NO:97.

[0043] In one embodiment of any aspect herein, the recombinant vector is produced from the plasmid of SEQ ID NO:27.

[0044] In one embodiment of any aspect herein, the nucleic acid comprises SEQ ID NO: 25 or a functional fragment thereof.

[0045] In one embodiment of any aspect herein, the recombinant AAV vector is a chimeric AAV vector, a haploid AAV vector, a hybrid AAV vector, or a polyploid AAV vector.

[0046] In one embodiment of any aspect herein, the recombinant AAV vector is a rational haploid vector, a mosaic AAV vector, a chemically modified AAV vector, or an AAV vector derived from any AAV serotype.

[0047] In one embodiment of any aspect herein, the recombinant AAV vector is selected from the group consisting of AAVXL32 vector, AAVXL32.1 vector, AAV8 vector, or haploid AAV8 vector containing at least one AAV8 capsid protein.In one embodiment of any aspect herein, the serotype is AAV3b.In one embodiment of any aspect herein, the AAV3b serotype comprises one or more mutations in the capsid protein selected from 265D, 549A, and Q263Y.In one embodiment of any aspect herein, the AAV3b serotype is selected from AAV3b265D, AAV3b265D549A, AAV3b549A, or AAV3bQ263Y, or AAV3bSASTG.

[0048] In one embodiment of any aspect herein, the poly A sequence is a full-length HGF poly A sequence. In one embodiment, it may be a functional fragment of the hGH poly A sequence.

[0049] In one embodiment of any aspect herein, the polyA sequence is selected from SEQ ID NO: 42, 43 or 44, or a nucleic acid sequence having at least 80% sequence identity to SEQ ID NOs: 42-44.

[0050] In one embodiment of any aspect herein, the inverse RNA pol II terminator sequence comprises SEQ ID NO: 45, or a nucleic acid sequence with at least 80% sequence identity to SEQ ID NO: 45. In one embodiment, it is that sequence.

[0051] Another aspect described herein provides a pharmaceutical composition comprising any of the recombinant AAV vectors described herein in a pharmaceutically acceptable carrier.

[0052] Another aspect described herein provides a method for treating a subject having Pompe disease or glycogen storage disease type II (GSD II, acid maltase deficiency) or having a defect in an alpha-glucosidase (GAA) polypeptide, comprising administering to the subject any of the recombinant AAV vectors, or any of the rAAV genomes or nucleic acid sequences described herein.

[0053] In one embodiment of any aspect herein, the AAV vector was produced from the plasmid of SEQ ID NO:27.

[0054] In one embodiment of any aspect herein, the recombinant AAV vector comprises the nucleic acid sequence of SEQ ID NO: 3, or a functional fragment thereof.

[0055] In one embodiment of any aspect herein, the recombinant AAV vector comprises the nucleic acid sequence of SEQ ID NO: 23, or a functional variant thereof.

[0056] In one embodiment of any aspect of the present specification, the GAA polypeptide is secreted from the subject's liver, and the secreted GAA is taken up by skeletal muscle tissue, cardiac muscle tissue, diaphragm muscle tissue, or a combination thereof, and the uptake of the secreted GAA results in a reduction of lysosomal glycogen storage in the tissue.

[0057] In one embodiment of any aspect herein, the step of administering to the subject is selected from intramuscular, subcutaneous, intraspinal, intracisternal, intrathecal, or intravenous administration.

[0058] In one embodiment of any aspect herein, the recombinant AAV vector is a chimeric AAV vector, a haploid AAV vector, a hybrid AAV vector, or a polyploid AAV vector.

[0059] In one embodiment of any aspect herein, the recombinant AAV vector is a rational haploid vector, a mosaic AAV vector, a chemically modified AAV vector, or an AAV vector derived from any AAV serotype.

[0060] In one embodiment of any aspect herein, the recombinant AAV vector is an AAVXL32 vector, or an AAVXL32.1 vector, or an AAV8 vector, or a haploid AAV8 vector comprising at least one AAV8 capsid protein.

[0061] In one embodiment of any aspect herein, the recombinant AAV vector is an AAV8 vector.

[0062] In one embodiment of any aspect herein, the recombinant AAV vector is administered in a dosage range of 1.0E9 vg / kg to 5.0E13 vg / kg, e.g., 1.0E9 vg / kg to 5.0E12 vg / kg; 5.0E9 vg / kg to 5.0E12 vg / kg; 5.0E9 vg / kg to 1.0E12 vg / kg; 5.0E9 vg / kg to 5.0E11 vg / kg; 5.0E9 vg / kg to 5.0E10 vg / kg; and 1.0E9 vg / kg to 1.0E10 vg / kg.

[0063] In one embodiment of any aspect herein, the method further comprises undergoing GAA protein enzyme replacement therapy, and weaning the GAA protein enzyme replacement therapy (ERT) on the same day as administration of the recombinant AAV vector, the next day, or any time between 1 day and 26 weeks thereafter.

[0064] Another embodiment described herein provides a nucleic acid construct comprising SEQ ID NO:3, or a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO:3.

[0065] In one embodiment of any aspect herein, expression of the nucleic acid sequence of SEQ ID NO: 3, or a nucleic acid having 80% sequence identity thereto, encodes a GAA polypeptide having at least 80% sequence identity to SEQ ID NO: 1, wherein an R is present at position 199, an H is present at position 223, and an I is present at position 780.

[0066] Another embodiment described herein provides a nucleic acid construct comprising SEQ ID NO:23, or a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO:23.

[0067] In one embodiment of any aspect herein, the nucleic acid comprises SEQ ID NO:3 or SEQ ID NO:25, or a nucleic acid sequence with at least 80% sequence identity to SEQ ID NO:3 or SEQ ID NO:25.

[0068] In one embodiment of any aspect herein, expression of the nucleic acid sequence of SEQ ID NO: 3, or a nucleic acid having 80% sequence identity thereto, encodes a GAA polypeptide having at least 80% sequence identity to SEQ ID NO: 1, wherein an R is present at position 199, an H is present at position 223, and an I is present at position 780.

[0069] Another aspect described herein provides a recombinant AAV comprising any of the nucleic acid constructs described herein.

[0070] In one embodiment of any aspect herein, the AAV lacks at least one amino acid at the N-terminus of GAA.

[0071] In one embodiment of any aspect herein, the AAV lacks at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or more amino acids at the N-terminus of GAA.

[0072] In one embodiment of any aspect herein, the heterologous signal peptide is inserted immediately after the endogenous GAA signal peptide or portion thereof.

[0073] Aspects of the present invention teach certain advantages in construction and use that give rise to the exemplary benefits described below. Other features and advantages of aspects of the present invention will become apparent from the following more detailed description, taken in conjunction with the accompanying drawings which illustrate, by way of example, the principles of aspects of the present invention.

[0074] The application file contains at least one drawing executed in color. Copies of this patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. The accompanying drawings illustrate aspects of the invention. In such drawings: [Brief explanation of the drawings]

[0075] [Figure 1] Figures 1A-1D show serum GAA protein quantification by Western blot densitometry. Serum GAA protein was measured by Western blot densitometry at week 1 (Figure 1A), week 2 (Figure 1B), week 3 (Figure 1C), and week 4 (heart serum) (Figure 1D). Serum GAA was normalized to total protein (A-D).

[0076] [Figure 2] Figures 2A-2D show serum GAA activity measured by the 4MU assay. Serum GAA activity was measured by the 4MU assay at weeks 1 (Figure 2A), 2 (Figure 2B), 3 (Figure 2C), and 4 (heart serum) (Figure 2D).

[0077] [Figure 3]Figures 3A-3C show GAA protein quantification in target organs by Western blot densitometry. GAA protein was measured in the heart (Figure 3A), diaphragm (Figure 3B), and liver (Figure 3C) by Western blot densitometry 4 weeks after dosing. GAA was normalized to total protein.

[0078] [Figure 4] Figures 4A-4D show GAA activity in target organs measured by the 4MU assay. GAA activity was measured in the heart (Figure 4A), diaphragm (Figure 4B), quadriceps (Figure 4C), and liver (Figure 4D) 4 weeks after administration.

[0079] [Figure 5] Figures 5A-5D show glycogen content in target organs. Glycogen content was measured in the heart (Figure 5A), diaphragm (Figure 5B), quadriceps (Figure 5C), and liver (Figure 5D) 4 weeks after administration.

[0080] [Figure 6] Figures 6A-6C show serum GAA protein quantification by Western blot densitometry for 3-week sacrificed animals. Serum GAA protein was measured by Western blot densitometry at week 1 (Figure 6A), week 2 (Figure 6B), and week 3 (Figure 6C). Serum GAA was normalized to total protein.

[0081] [Figure 7] Figures 7A-7C show serum GAA activity by 4MU assay for 3-week sacrifice animals. Serum GAA activity was measured by 4MU assay at week 1 (Figure 7A), week 2 (Figure 7B), and week 3 (Figure 7C).

[0082] [Figure 8]Figures 8A-8C show target organ GAA activity by 4MU assay for 3-week sacrifice animals. GAA activity was measured by 4MU assay in the heart (Figure 8A), diaphragm (Figure 8B), and liver (Figure 8C) 3 weeks after dosing.

[0083] [Figure 9] Figures 9A-9C show target organ glycogen content for 3-week sacrificed animals. Glycogen content was measured in the heart (Figure 9A), diaphragm (Figure 9B), and liver (Figure 9C) 3 weeks after dosing.

[0084] [Figure 10] Figures 10A-10H show serum GAA protein quantification by Western blot densitometry for 8-week sacrificed animals. Serum GAA protein was measured by Western blot densitometry at weeks 1 (Figure 10A), 2 (Figure 10B), 3 (Figure 10C), 4 (Figure 10D), 5 (Figure 10E), 6 (Figure 10F), 7 (Figure 10G), and 8 (Figure 10H). Serum GAA was normalized to total protein.

[0085] [Figure 11] Figures 11A-11H show serum GAA activity by 4MU assay for 8-week sacrificed animals. Serum GAA activity was measured by 4MU assay at weeks 1 (Figure 11A), 2 (Figure 11B), 3 (Figure 11C), 4 (Figure 11D), 5 (Figure 11E), 6 (Figure 11F), 7 (Figure 11G), and 8 (Figure 11H).

[0086] [Figure 12] Figures 12A-12C show target organ GAA protein quantification by Western blot densitometry for 8-week sacrifice animals. GAA protein was measured in the heart (Figure 12A), diaphragm (Figure 12B), and liver (Figure 12C) by Western blot densitometry 8 weeks after dosing.

[0087] [Figure 13] Figures 13A-13C show target organ GAA activity by 4MU assay for 8-week sacrifice animals. GAA activity was measured by 4MU assay in the heart (Figure 13A), diaphragm (Figure 13B), and liver (Figure 13C) at 8 weeks post-dose.

[0088] [Figure 14-1] Figures 14A-14F show target organ glycogen content for 8-week sacrifice animals. Glycogen content was measured in the heart (Figures 14A, 14D), diaphragm (Figures 14B, 14E), and liver (Figures 14C, 14F) after 8 weeks of dosing and expressed normalized to dose per kg body weight (Figures 14D-14F). [Figure 14-2] Same as above.

[0089] [Figure 15] Figure 15 shows a schematic diagram of the Actus, M3, and M4 constructs. Actus contains the liver promoter of SEQ ID NO:97, and the M3 construct is similar to the M2 construct; the M3 construct contains the promoter of SEQ ID NO:99, while the M2 construct contains the promoter of SEQ ID NO:98, which contains a mutation within a muscle transcription factor binding site. The coding sequence in the M3 construct was modified to remove predicted alternative open reading frames and known immunostimulatory hexanucleotide CpG motifs. In the M4 construct, all CG dinucleotides were removed from the entire coding sequence. Alternative frames were not removed in the selected M4 construct. The amino acid sequence across the M3 and M4 constructs is identical to that found in Actus 101 (the amino acid sequence of myozyme / lumizyme).

[0090] [Figure 16]Figures 16A and 16B show analysis of target tissue uptake of hGAA. Figure 16A shows the expression of GAA activity (upper graph) and glycogen levels (lower graph) in the liver, heart, and diaphragm after administration of M4 compared to Actus 101 and vehicle control (VC). Figure 16B shows the expression of GAA activity (upper graph) and glycogen levels (lower graph) in the liver, heart, and diaphragm after administration of M4 from two different lots compared to Actus 101 and vehicle control (VC).

[0091] [Figure 17] Figures 17A and 17B show an analysis of serum hGAA expressed by Actus 101 and M4. Figure 17A shows the protein expression of hGAA expressed from Actus 101, M4, and a vehicle control (VC). hGAA protein is 2.48-fold higher when expressed from M4 compared to Actus 101. Figure 17B shows the total protein of hGAA activity present in serum after administration of two different lots of M4 compared to Actus 101 and a vehicle control (VC) 4 weeks after injection.

[0092] [Figure 18] Figures 18A-18C show the performance of wild-type (pM3-NCBI) and Actus 101 hGAA proteins in mouse hearts 4 weeks after vector injection. Figure 18A is a bar graph showing hGAA uptake after administration of the indicated constructs. Figure 18B is a bar graph showing hGAA activity after administration of the indicated constructs. Figure 18C is a bar graph showing glycogen levels after administration of the indicated constructs. Actus 101 performed better than the M3 construct in mouse hGAA activity (Figure 18B) and glycogen reduction (Figure 18C) in the heart, in stark contrast to the M4 construct, which performed better than Actus 101.

[0093] [Figure 19]Figure 19 shows a 4MU activity assay for hGAA activity 4 weeks after transduction in mouse serum with the indicated constructs. M4 performs better than Actus 101 in promoting GAA activity.

[0094] [Figure 20] Figure 20 shows the liver retention observed after injection with saline (control), Actus 101, or M4. Liver retention appeared to be comparable between Actus 101 and M4.

[0095] [Figure 21-1] Figures 21A-21D show analyses of target tissue uptake of hGAA. Figure 21A shows the expression of GAA activity in the heart after administration of M4, Actus 101, and a saline control. Figure 21B shows the expression of GAA activity in the diaphragm after administration of M4, Actus 101, and a saline control. Figure 21C shows the expression of GAA activity in the quadriceps muscle after administration of M4, Actus 101, and a saline control. Figure 21D shows the expression of GAA activity in the soleus muscle after administration of M4, Actus 101, and a saline control. [Figure 21-2] Same as above.

[0096] [Figure 22]Figure 22 presents Western blots showing hGAA expression from vehicle control (VC), Actus 101, and various M4 constructs Seq12 (SEQ ID NO: 30), Seq99 (SEQ ID NO: 29), Seq3 (SEQ ID NO: 28), and Seq100 (SEQ ID NO: 27) at 7, 14, and 21 days after injection. Low and high doses (as indicated) were administered to GAA-KO mice. Levels were assessed on the indicated days. Seq100 results in higher expression levels that persist for a longer period of time compared to VC, Actus 101, and the other indicated M4 constructs. "HST 1" and "HST 2" refer to HIGH DOSE STUDY 1 and HIGH DOSE STUDY 2, respectively. SEQ ID NOs: 27, 28, 29, and 30 are plasmids for expression of an rAAV vector that expresses a GAA polypeptide having the sequence of SEQ ID NO: 1, wherein the rAAV vector comprises a codon-optimized nucleic acid sequence selected from SEQ ID NO: 3 (Seq100), SEQ ID NO: 4 (Seq3), SEQ ID NO: 7 (Seq12), and SEQ ID NO: 13 (Seq99).

[0097] [Figure 23] Figure 23 shows hGAA levels in GAA-KO mice 21 days after administration of the indicated constructs. Seq100 results in higher expression levels of hGAA in serum (top Western blot) and liver (bottom Western blot) 21 days after administration compared to VC, Actus 101, and the other indicated M4 constructs.

[0098] [Figure 24] Figure 24 shows normalized hGAA RNA levels in the liver of GAA-KO mice 21 days after administration with the indicated constructs. Seq100 results in higher expression levels of hGAA RNA in serum 21 days after administration compared to VC, Actus 101, and the other indicated M4 constructs.

[0099] [Figure 25]Figure 25 presents Western blots showing GAA uptake in the indicated target tissues (i.e., heart or diaphragm) 21 days after administration with the indicated constructs. Seq100 results in higher expression levels of hGAA in the respective tissues 21 days after administration compared to VC, Actus 101, and the other indicated M4 constructs.

[0100] [Figure 26] Figures 26A and 26B present bar graphs showing GAA and glycogen levels in the indicated tissues of GAA-KO mice after 21 days of administration. Figure 26A shows GAA activity in the indicated tissues of GAA-KO mice after 21 days of administration with the indicated constructs. Seq100 results in higher expression levels of hGAA in the respective tissues after 21 days of administration compared to VC, Actus 101, and the other indicated M4 constructs. Figure 26B shows glycogen in the indicated tissues of GAA-KO mice after 21 days of administration with the indicated constructs. Seq100 results in higher levels of glycogen clearance in the respective tissues after 21 days of administration compared to VC, Actus 101, and the other indicated M4 constructs.

[0101] [Figure 27] Figure 27 presents Western blots showing hGAA expression in GAA-KO mice over time. Seq100 results in higher expression levels of hGAA at 7 and 14 days post-administration compared to VC, Actus 101, and the other indicated M4 constructs.

[0102] [Figure 28] Figure 28 presents a bar graph showing the results of a 4MU assay in GAA-KO mice 21 days after administration. Seq100 results in higher expression levels of hGAA at 21 days after administration compared to VC, Actus 101, and the other indicated M4 constructs.

[0103] [Figure 29]Figure 29 is a schematic diagram showing several modified GAA constructs comprising (i) a GAA signal peptide or portion thereof, and (ii) a heterologous signal peptide attached to a GAA polypeptide. An N-terminally truncated GAA polypeptide beginning at amino acid 57 is shown as an exemplary GAA polypeptide; however, any N-terminally truncated GAA polypeptide disclosed in Table 1 can be used.

[0104] [Figure 30] Figure 30 presents a Western blot showing hGAA expression in GAA-KO mice 4 weeks after administration of the indicated constructs. Black arrows indicate GAA expression. Gray triangles indicate non-specific binding.

[0105] [Figure 31] Figure 31 presents a bar graph showing total GAA protein in the serum of GAA-KO mice 4 weeks after administration of the indicated constructs. Saline is used as a control.

[0106] [Figure 32] Figure 32 presents a bar graph showing total GAA activity in the serum of GAA-KO mice 4 weeks after administration of the indicated constructs. Saline was used as a control. 4MU activity in serum corresponds to GAA expression levels.

[0107] [Figure 33] Figure 33 presents a bar graph showing total GAA activity in the hearts of GAA-KO mice 4 weeks after administration of the indicated constructs. Saline was used as a control. 4MU activity in the hearts is consistent with GAA expression levels, and expression of the constructs achieved wild-type levels.

[0108] [Figure 34]Figure 34 presents a bar graph showing total glycogen levels in the hearts of GAA-KO mice 4 weeks after administration of the indicated constructs. Saline was used as a control. Glycogen levels in the hearts are consistent with GAA expression levels, and expression of the constructs achieved wild-type levels.

[0109] [Figure 35] Figure 35A shows a Western blot showing total GAA activity in the liver of GAA-KO mice 4 weeks after administration of the indicated construct. Figure 35B shows a bar graph showing total GAA activity in the heart of GAA-KO mice 4 weeks after administration of the indicated construct. Saline is used as a control. A reduction in the retention of modified GAA in the liver is observed.

[0110] [Figure 36] FIG. 36 presents a table showing the levels of GAA in serum, GAA activity in serum and heart, glycogen levels in heart, and retained GAA levels in liver in mice after administration of the indicated AAV (left column).

[0111] [Figure 37] Figure 37 presents a schematic diagram of the modified constructs. Mod-Actus is an Actus construct modified to remove wtAAV DNA sequences 5' and 3' relative to the ITRs. Mod-P072 is a P072 construct modified to replace the 5'UTR with 5'UTR plus intron sequence, remove the 3'UTR, and add an SV40 bidirectional polyA sequence. Mod-P092 is a P092 construct modified to replace the 5'UTR with 5'UTR plus intron sequence, remove the 3'UTR, and add an SV40 bidirectional polyA sequence. Mod-072 and mod-092 have also been modified to remove wtAAV DNA sequences 5' and 3' relative to the ITRs.

[0112] [Figure 38]Figures 38A and 38B present bar graphs showing GAA expression in huh7 cell cultures for the indicated AAVs. Figure 38A shows GAA activity in huh7 cell lysates. Figure 38B shows GAA activity in huh7 cell supernatants. Mod-P072 secretes the highest levels of GAA into the supernatant. Mod-Actus promotes the highest GAA activity in cells.

[0113] [Figure 39] Figures 39A-39C present data showing in vivo expression of AAV at various levels in wild-type mice (C57BL / 6J). Figure 39A is a graph showing GAA activity in serum after various weeks of administration in male mice. Figure 39B is a graph showing GAA activity in serum after various weeks of administration in female mice. Figure 39C is a graph showing GAA activity in serum after various weeks of administration in male and female mice (combined). Mod-P072 achieves the highest GAA activity levels in mouse serum 4 weeks after administration.

[0114] [Figure 40-1] Figures 40A-40C present bar graphs representing semi-quantitative analysis of GAA levels in Western blots in liver, heart, and quadriceps tissues after in vivo expression of various levels of the indicated AAVs in wild-type mice (C57BL / 6J). Figure 40A is a graph showing GAA levels in liver tissues of male and female mice. Figure 40B is a graph showing GAA levels in heart tissues of male and female mice. Figure 40C is a graph showing GAA levels in quadriceps tissues of male and female mice. Mod-Actus achieves the highest GAA uptake in liver tissues after administration. Mod-P072 achieves the highest GAA uptake in heart and quadriceps tissues after administration. [Figure 40-2] Same as above.

[0115] [Figure 41]Figure 41 presents a bar graph of glycogen levels in cardiac tissue after administration of the indicated doses of Actus 101, pP110, and pP113. A higher reduction in glycogen in cells was observed after administration of pP110 compared to Actus 101 or pP113. Saline was used as a control.

[0116] [Figure 42] Figure 42 presents a bar graph of glycogen levels in cardiac tissue after administration of the indicated doses of M4, pP065, pP072, and pP092. Higher doses of pP065 and pP072 resulted in the greatest reduction in glycogen levels in the cells. Saline was used as a control. DETAILED DESCRIPTION OF THE INVENTION

[0117] The above-described drawings illustrate aspects of the present invention in at least one of its exemplary embodiments, which are further defined in detail in the following description. Features, elements, and aspects of the present invention referenced by the same numerals in different drawings represent the same, equivalent, or similar features, elements, or aspects according to one or more embodiments.

[0118] Detailed Description The technology described herein is directed to a recombinant AAV (rAAV) vector and rAAV construct for delivering a GAA polypeptide to a subject in a method for treating Pompe disease, wherein the heterologous nucleic acid encoding the GAA polypeptide is codon-optimized to reduce immune response and enhance and improve expression efficiency in human subjects. That is, the rAAV construct described herein for delivering a GAA polypeptide to a subject includes an improved, for example, but not limited to, codon-optimized nucleic acid sequence encoding a GAA polypeptide, wherein the codon-optimized nucleic acid sequence encoding the GAA polypeptide has been modified to include features such as (i) enhanced in vivo expression, (ii) reduced CpG island and / or eliminated CG dinucleotide content, (iii) modified STOP sequence or eliminated alternative reading frame (ARF), and (iv) reduced innate immune response. Alternatively, wild-type GAA is used and modified to enhance expression. Furthermore, the rAAV constructs described herein for delivering GAA polypeptides to a subject include improvements, such as the incorporation of a 5'UTR located between the nucleic acid expressing the GAA polypeptide and the liver-specific promoter, as well as the use of a 3' nucleic acid of a specific terminator sequence expressing the GAA polypeptide, such as a specific polyA sequence and / or terminator sequence, multiple polyA sequences, etc.

[0119] The technology described herein relates to improved recombinant AAV (rAAV) vectors and constructs for rAAV for delivering GAA polypeptides to a subject in methods for treating Pompe disease, previously disclosed in International Patent Applications WO2020102645 and WO2021102107, both of which are incorporated herein by reference in their entireties.

[0120] In particular, for example, described herein are targeted viral vectors, using as illustrative examples rAAV vectors, which include nucleotide sequences containing inverted terminal repeats (ITRs), a liver-specific promoter, a heterologous gene, a polyA tail, and other regulatory elements potentially for use in treating Pompe disease, where the heterologous gene is human GAA, and the vector, e.g., rAAV, can be administered to a patient at a therapeutically effective dose, which is delivered to the appropriate tissues and / or organs for expression of the heterologous gene and treatment of the disease, e.g., Pompe disease.

[0121] One embodiment described herein provides a recombinant adenovirus-associated (AAV) vector comprising within its genome (a) 5' and 3' AAV inverted terminal repeat (ITR) sequences, and (b) a heterologous nucleic acid sequence located between the 5' and 3' ITRs, encoding a polypeptide comprising an alpha-glucosidase (GAA) polypeptide, wherein the heterologous nucleic acid is operably linked to a liver-specific promoter disclosed herein.

[0122] In one embodiment of any aspect herein, the heterologous nucleic acid sequence encodes a GAA polypeptide comprising a secretory signal fused to the GAA polypeptide, wherein the secretory signal (also referred to herein as a "signal peptide") is an endogenous GAA polypeptide or an exogenous GAA polypeptide.

[0123] In one embodiment of any aspect herein, the nucleic acid sequence encoding a GAA polypeptide is a human GAA gene, or a human codon-optimized GAA gene (coGAA), or a modified GAA nucleic acid sequence. As disclosed herein, the nucleic acid encoding the human GAA protein is selected from any of SEQ ID NOs: 1-18, or a functional variant having at least 80%, or at least about 85%, or at least about 90%, or at least about 95%, or at least about 98% sequence identity to any of SEQ ID NOs: 1-18.

[0124] In some embodiments, the expressed GAA comprises at least a signal peptide that facilitates secretion of the GAA polypeptide from the liver. In some embodiments, the GAA polypeptide or modified GAA is expressed as a fusion protein that comprises at least a signal peptide that facilitates secretion of the GAA polypeptide from the liver.

[0125] In all aspects of all embodiments of the technology described herein, liver-specific promoter preferentially expresses hGAA polypeptide in the liver.In all aspects of all embodiments of the technology described herein, in some embodiments, AAV vector comprises at least one capsid protein that targets the liver. I. Recombinant AAV expressing GAA

[0126] As disclosed herein, one aspect of the present technology relates to a method for treating Pompe disease using an rAAV vector comprising a capsid and a nucleotide sequence within the capsid referred to as an "rAAV vector genome." The rAAV vector genome (also referred to as an "rAAV genome") comprises multiple elements including, but not limited to, two inverted terminal repeats (ITRs, e.g., 5'-ITR and 3'-ITR), with additional elements located between the ITRs including a promoter, a heterologous gene encoding a GAA polypeptide, and a polyA tail, and the heterologous gene encoding the GAA polypeptide is codon-optimized, for example, but not limited to, by reducing CpG, reducing CpG islands, and minimizing or eliminating internal start codons.

[0127] In some embodiments, the rAAV genome disclosed herein comprises 5' ITR and 3' ITR sequences, and a promoter, e.g., a liver-specific promoter sequence disclosed herein, operably linked to a heterologous nucleic acid encoding an alpha-glucosidase (GAA) polypeptide, located between the 5' ITR and 3' ITR, wherein the heterologous nucleic acid is codon-optimized as disclosed herein, with a 5' UTR located between the GAA polypeptide-encoding nucleic acid and the liver-specific promoter sequence. In some examples, a 3' UTR is also present. Furthermore, the UTR can contain an intron. In one embodiment, the heterologous nucleic acid sequence can optionally further comprise one or more of the following elements: an intron sequence, a nucleic acid encoding a secretory signal peptide, which may be an endogenous signal peptide (SP) disclosed herein or a heterologous SP, a polyA sequence, and a terminator sequence. In some embodiments, the 5' UTR sequence comprises SEQ ID NO: 41, or comprises SEQ ID NO: 40, or comprises a sequence having at least 85%, or at least 90%, or more, sequence identity to SEQ ID NO: 40 or 41. In some embodiments, the polyA sequence is a full-length HGH polyA sequence comprising SEQ ID NO: 42, or a sequence having at least 85%, or at least 90%, or more, sequence identity to SEQ ID NO: 42. In some embodiments, the terminator sequence is a reverse RNA pol II terminator sequence. In some embodiments, the reverse RNA pol II terminator sequence comprises SEQ ID NO: 45, or a sequence having at least 85%, or at least 90%, or more, sequence identity to SEQ ID NO: 45.

[0128] In some embodiments, the nucleic acid encoding an alpha-glucosidase (GAA) polypeptide encodes a full-length GAA polypeptide, e.g., starting at residue 28 of SEQ ID NO: 1. In some embodiments, the nucleic acid encoding an alpha-glucosidase (GAA) polypeptide encodes a truncated GAA polypeptide, e.g., starting at amino acid residues 35, 40, 50, 57, 60, 68, 69, 70, 72, 74 of SEQ ID NO: 1, and / or a C-terminal truncation starting at residues 779, 790, 791, 792, 793, and 796 of SEQ ID NO: 1, or amino acid residues 35-952, 40-952, 5 ... and encoding a GAA polypeptide having at least 80%, or at least 85%, or at least 90%, or at least 95% sequence identity to SEQ ID NO: 1 over sequences 0-952, 57-952, 60-952, 68-952, 69-952, 70-952, 72-952, 74-952, 779-952, 790-952, 791-952, 792-952, 793-952, and 796-952.

[0129] In some embodiments, the nucleic acid encoding an alpha-glucosidase (GAA) polypeptide encodes a full-length GAA polypeptide (e.g., residues 28-952 of SEQ ID NO:1), or a truncated GAA polypeptide, e.g., a GAA polypeptide starting at any of residues 35, 40, 50, 57, 60, 68, 69, 70, 72, 74 of SEQ ID NO:1, and / or a second truncation starting at residues 779, 790, 791, 792, 793, and 796 of SEQ ID NO:1, with an endogenous GAA signal peptide attached to the N-terminus of the GAA polypeptide, e.g., containing an endogenous signal peptide comprising residues of SEQ ID NO:59, e.g., SEQ ID NO:1, and only one heterologous or homologous signal peptide. In alternative embodiments, the nucleic acid encoding an alpha-glucosidase (GAA) polypeptide encodes a full-length GAA polypeptide (e.g., residues 28-952 of SEQ ID NO:1) or a truncated GAA polypeptide having a heterologous signal peptide attached to the N-terminus of the full-length or truncated GAA polypeptide, e.g., a GAA polypeptide starting at any of residues 35, 40, 50, 57, 60, 68, 69, 70, 72, 74, 779, 790, 791, 792, 793, and 796 of SEQ ID NO:1.

[0130] In alternative embodiments, the nucleic acid encoding an alpha-glucosidase (GAA) polypeptide encodes a full-length GAA polypeptide (e.g., residues 28-952 of SEQ ID NO:1), or an N-terminally truncated GAA polypeptide, e.g., a GAA polypeptide starting at any of residues 35, 40, 50, 57, 60, 68, 69, 70, 72, 74, 779, 790, 791, 792, 793, and 796 of SEQ ID NO:1, and also encodes a GAA signal peptide or a portion or fragment thereof, and a heterologous signal peptide attached to the N-terminus of the full-length or truncated GAA polypeptide. In some embodiments, the GAA polypeptide is an N-terminally truncated GAA polypeptide having a truncation starting at any of amino acids 29-35 of SEQ ID NO:1. In some embodiments, the nucleic acid encoding an alpha-glucosidase (GAA) polypeptide comprises (i) a GAA signal peptide or a portion thereof, e.g., an N-terminal portion thereof, (ii) a portion of a GAA polypeptide (e.g., any portion of residues 28-56 of SEQ ID NO: 1), (iii) a heterologous signal peptide disclosed herein, and (iv) a GAA polypeptide, e.g., an N-terminally truncated GAA polypeptide, e.g., a GAA polypeptide starting at any of residues 35, 40, 50, 57, 60, 68, 69, 70, 72, 74, 779, 790, 791, 792, 793, and 796 of SEQ ID NO: 1. In some embodiments, the GAA polypeptide comprises a C-terminal truncation of at least 1, or at least 2, or at least 3, or at least 4, or at least 5, or at least 5-10, or 10-20, or 20-30 amino acid residues of the C-terminus of the GAA polypeptide. Exemplary heterologous signal peptides are disclosed herein, including, but not limited to, a signal peptide comprising an amino acid selected from any of SEQ ID NOs: 60-78. In some embodiments, the signal peptide is attached to the N-terminus of SEQ ID NOs: 60, 61, 62, 63, and 64. A. Alpha-glucosidase (GAA) polypeptide

[0131] The GAA gene (NM_000152.3) is approximately 18.3 kilobases (kb) long and contains 20 exons (Dasouki et al. 2014). Its complementary DNA has a coding sequence of 2,859 nucleotides encoding a premature 952-amino acid enzyme. GAA is synthesized as a membrane-bound, catalytically inactive precursor (relative to its natural substrate, glycogen) sequestered in the endoplasmic reticulum. It undergoes glycosylation in the Golgi complex and is subsequently transported to the (minor) secretory pathway or to lysosomes, where it is trimmed in a stepwise process at both the amino and carboxyl termini. Phosphorylation of mannose residues ensures efficient transport of the enzyme to lysosomes via the mannose 6-phosphate receptor. In lysosomes, GAA catalyzes the hydrolysis of the α1→4 glycosidic linkage in glycogen to glucose under low pH conditions. The specificity for the natural substrate (glycogen) increases during its maturation.

[0132] Many normal allelic variants exist in GAA, resulting in three known atypical enzymes (GAA1, GAA2, and GAA4). Over 450 mutations in GAA have been reported in individuals with Pompe disease. Nonsense mutations, large and small gene rearrangements, and splicing defects have been observed, with many mutations potentially specific to families, geographic regions, or ethnicities. Mutation combinations resulting in the complete or near-complete absence of GAA enzyme activity (typically <1% of normal activity in skin fibroblasts) are more commonly seen in individuals with IOPD, while those combinations allowing partial enzyme activity (approximately 2-40% of normal activity in skin fibroblasts) typically present with LOPD. GAA mutations result in messenger RNA instability and / or a severely truncated acid α-glucosidase or an enzyme with significantly reduced activity. Impaired or absent GAA function leads to the accumulation of glycogen in the lysosomes and cytoplasm of multiple tissues, resulting in the destruction of skeletal, smooth, and cardiac muscle. The effects of the enzyme deficiency may also extend to the vesicular system linked to lysosomes, affecting receptors that cycle through these organelles, such as glucose transporter 4. Evidence also showed a lack of productive autophagy and a progressive accumulation of autophagosomes that disrupt the contractile apparatus in muscle fibers, which correlated with the lack of correction in skeletal muscle during ERT.

[0133] Alpha-glucosidase (GAA) polypeptide is a member of family 31 of glycoside hydrolyases. Human GAA is synthesized as a 110 kDa precursor (Wisselaar et al. (1993) J. Biol. Chem. 268(3): 2223-31). The mature form of the enzyme is a mixture of 70 and 76 kDa monomers (Wisselaar et al. (1993) J. Biol. Chem. 268(3): 2223-31). The precursor enzyme has seven potential glycosylation sites, four of which are retained in the mature enzyme (Wisselaar et al. (1993) J. Biol. Chem. 268(3): 2223-31). The proteolytic cleavage events that produce the mature enzyme occur in late endosomes or lysosomes (Wisselaar et al. (1993) J. Biol. Chem. 268(3): 2223-31).

[0134] The rAAV vector genome can encode a GAA polypeptide, which can include, for example, amino acid residues 40-952 of human GAA, or a smaller portion, such as amino acid residues 40-790.

[0135] The C-terminal 160 amino acids are absent from the 70- and 76-kDa mature GAA polypeptide species. However, certain Pompe alleles, such as Val949Asp, that result in a complete loss of GAA activity have been mapped to this region (Becker et al. (1998) J. Hum. Genet. 62:991). The phenotype of this mutant indicates that the C-terminal portion of the protein, although not part of the 70- or 76-kDa species, plays an important role in the function of the protein. It has also been reported that the C-terminal portion of the protein is cleaved from the rest of the protein during processing but remains associated with the major species (Moreland et al. (Nov. 1, 2004) J. Biol. Chem., Manuscript 404008200). Therefore, the C-terminal residues may play a direct role in the catalytic activity of the protein and / or may be involved in promoting proper folding of the N-terminal portion of the protein.

[0136] The native GAA gene encodes a precursor polypeptide possessing a signal sequence and adjacent putative transmembrane domain, a trefoil domain (PFAM PF00088) (Thim (1989) FEBS Lett. 250:85), a cysteine-rich domain of approximately 45 amino acids containing three disulfide linkages, a domain defined by the 70 / 76 kDa mature polypeptide, and a C-terminal domain. It has been reported that both the trefoil domain and the C-terminal domain are required for the production of functional GAA, and that the C-terminal domain may interact with the trefoil domain during protein folding, possibly promoting proper disulfide bond formation in the trefoil domain.

[0137] In some embodiments of the methods and compositions disclosed herein, the human GAA protein expressed by AAV comprises the amino acid sequence of SEQ ID NO:1, or a protein that is at least 60%, or 70%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% identical to SEQ ID NO:1.

[0138] In some embodiments, the hGAA polypeptide comprises a signal peptide (SP). Those skilled in the art will recognize specific positions in GAA to which the signal peptide (SP) can be fused.

[0139] In some embodiments of the methods and compositions disclosed herein, the human GAA protein expressed by AAV comprises an amino acid of SEQ ID NO: 1, or a fragment or variant thereof, e.g., a human GAA protein starting at any of residues selected from 40, 50, 57, 68, 69, 70, 71, 72, 779, 787, 789, 790, 791, 792, 793, or 796 of SEQ ID NO: 1. Thus, in one aspect, the invention relates to a GAA protein in which an SP is fused to the N-terminal amino acid 40, 50, 57, 68, 69, 70, 71, 72, 779, 787, 789, 790, 791, 792, 793, or 796 of human GAA of SEQ ID NO: 1. In some embodiments, the GAA polypeptide expressed by the AAV vector disclosed herein has at least 80%, or at least 85%, or at least 90%, or at least 95% sequence identity to amino acid residues selected from 28-952, 35-952, 40-952, 50-952, 57-952, 60-952, 68-952, 69-952, 70-952, 72-952, 74-952, 779-952, 790-952, 791-952, 792-952, 793-952, and 796-952 of SEQ ID NO: 1, and may further include an N-terminal signal peptide, which may be an endogenous GAA signal peptide or a heterologous signal peptide disclosed herein.

[0140] In some embodiments of the methods and compositions disclosed herein, the human GAA protein expressed by AAV comprises amino acids of a human GAA protein starting with any of residues selected from 40, 50, 57, 68, 69, 70, 71, 72, 779, 787, 789, 790, 791, 792, 793, or 796 of SEQ ID NO: 1, or a protein at least 60%, or 70%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% identical thereto. (i) modified GAA (modGAA) polypeptide

[0141] In some embodiments, the modified human GAA protein comprises a polypeptide having at least one modification selected from H199R, R223H, V780I, or H201L of SEQ ID NO: 1, or a variant having at least one of these modifications that is at least 80%, 90%, 95%, or 99% homologous to at least 500, 550, 600, 650, 700, 750, 800, 850, or 900 amino acids of SEQ ID NO: 1. In some embodiments, the modified human GAA protein comprises a polypeptide having at least two modifications selected from H199R, R223H, V780I, or H201L of SEQ ID NO: 1, or a variant having at least two of these modifications that is at least 80%, 90%, 95%, or 99% homologous to at least 500, 550, 600, 650, 700, 750, 800, 850, or 900 consecutive amino acids of SEQ ID NO: 1. In some embodiments, the modified human GAA protein comprises a polypeptide having three modifications selected from H199R, R223H, V780I and H201L of SEQ ID NO: 1 (GAA-H199R-H201L-R223H or GAA-H199R-H201L-V780I), or a variant having these three modifications and at least 80%, 90%, 95%, or 99% homologous to at least 500, 550, 600, 650, 700, 750, 800, 850, or 900 consecutive amino acids of SEQ ID NO: 1.

[0142] These modified GAA polypeptides and fragments thereof can be used. In some embodiments, the human modified GAA protein expressed by AAV comprises the GAA polypeptide of SEQ ID NO: 1 modified as described above, or a protein at least 60%, or 70%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% identical to SEQ ID NO: 1, or a nucleic acid encoding such a sequence (SEQ ID NO: 3), or a fragment of SEQ ID NO: 1, wherein the fragment is SEQ ID NO: 1 (modGAA; H199R, R223H , V780I), or any protein at least 60%, or 70%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% identical to SEQ ID NO: 1, starting at any residue selected from 40, 50, 57, 68, 69, 70, 71, 72, 779, 787, 789, 790, 791, 792, 793, or 796, with an R at amino acid position 199; an H at amino acid position 223; and an I at amino acid position 780. Actus 101 (SEQ ID NO: 1) contains three point mutations but is considered wild-type GAA.

[0143] In some embodiments, GAA is modified to add or remove glycosylation sites, such as N-linked glycosylation sites, O-linked glycosylation sites, or both. In certain embodiments, the addition or removal of glycosylation sites is achieved by N-terminal deletion, C-terminal deletion, internal deletion, random point mutagenesis, or site-directed mutagenesis. In some embodiments, exemplary GAA modifications include the addition of one or more asparagine (Asn) residues, or one or more mutations that result in asparagine (Asn) residues, or the deletion of one or more asparagine (Asn) residues. In certain embodiments, all or some of the N-linked and / or O-linked glycosylation sites present in GAA are mutated. In some embodiments, GAA modifications will provide information pertaining to the biological activity, physical structure, and / or substrate binding potential of GAA.

[0144] In one embodiment, the modified human GAA protein comprises a deletion of a stretch of amino acids between and including 29 to 56 of SEQ ID NO: 1. In one embodiment, the modified human GAA protein comprises a deletion of a stretch of amino acids between and including 29 to 56 of SEQ ID NO: 1 is no longer maintained intracellularly.

[0145] In one embodiment, the modified human GAA protein comprises a polypeptide having at least one modification selected from Table 12. The modifications listed in Table 12 are commonly identified GAA polymorphisms, but are not associated with disease, e.g., Pompe disease. [Table 12-1] [Table 12-2] [Table 12-3] [Table 12-4] [Table 12-5] [Table 12-6] [Table 12-7] [Table 12-8] [Table 12-9] [Table 12-10] [Table 12-11] [Table 12-12] [Table 12-13] [Table 12-14] [Table 12-15] [Table 12-16] [Table 12-17] [Table 12-18] (ii) Nucleotide sequences: N-terminal GAA polypeptide truncations, and nucleic acid sequences encoding GAA polypeptides and N-terminal truncations, with endogenous or heterologous signal peptides.

[0146] As disclosed herein, the nucleic acids encoding the GAA proteins disclosed herein, e.g., the codon-optimized GAA nucleic acid sequences SEQ ID NOs: 1-18, have been modified from the NCBI GAA sequence of NM_00152.5 to include, for example, any one or more of: (i) enhanced expression in vivo; (ii) reduced CpG islands or reduced or eliminated CG dinucleotides; (iii) reduced innate immune response; and (iv) reduced or eliminated alternative reading frames (ARFs) or open reading frames (ORFs). Exemplary codon-optimized GAA nucleic acid sequences encompassed for use in the methods and rAAV compositions disclosed herein can be selected from any of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, or SEQ ID NO:18 disclosed herein, or a nucleic acid sequence having at least 60%, or 70%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NOs:1-18, wherein SEQ ID NOs:1-18 or variants thereof with at least 80% sequence identity thereto encode a GAA polypeptide, wherein the amino acid at position 199 is R (199R); the amino acid at position 233 is H (233H), and the amino acid at position 780 is I (780I).

[0147] In some embodiments, the codon-optimized GAA nucleic acid sequence encompassed for use in the methods and rAAV compositions disclosed herein can be selected from either SEQ ID NO:3 or SEQ ID NO:4, or a nucleic acid sequence having at least 60%, or 70%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO:3 or SEQ ID NO:4.

[0148] In some embodiments, an rAAV genome useful in the methods for treating Pompe disease disclosed herein comprises a heterologous nucleic acid sequence encoding a signal peptide (SP) fused in-frame to the 5' end of a GAA nucleic acid sequence encoding a GAA polypeptide or an N-terminally truncated GAA polypeptide as disclosed herein. For example, a heterologous nucleic acid sequence encoding a signal peptide (SP) is fused in-frame to the 5' end of a GAA nucleic acid sequence encoding a GAA polypeptide or an N-terminally truncated GAA polypeptide, such that both polypeptides are expressed from the rAAV genome when the rAAV vector transduces a mammalian cell.

[0149] In some embodiments, an rAAV genome useful in the methods for treating Pompe disease disclosed herein comprises a heterologous nucleic acid sequence comprising SEQ ID NO:3 or a portion of SEQ ID NO:3, wherein expression of the portion of the nucleic acid of SEQ ID NO:3 produces a functional hGAA protein, which can comprise an N-terminal deletion of SEQ ID NO:1, or an N- and C-terminal truncation of SEQ ID NO:1, as disclosed herein.

[0150] In some embodiments, an rAAV genome useful in the methods for treating Pompe disease disclosed herein comprises a heterologous nucleic acid sequence comprising SEQ ID NO:3, or nucleotides 82-2859 of SEQ ID NO:3, or a nucleic acid having at least 85% sequence identity thereto, wherein nucleotides 1-81 of SEQ ID NO:3 (corresponding to SEQ ID NO:53), which encode a codon-optimized hGAA signal peptide, are replaced with a nucleic acid selected from any of the nucleic acids encoding a heterologous signal peptide disclosed herein, e.g., SEQ ID NOs:54-58, 67, 72, or 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0151] In some embodiments, an rAAV genome useful in the methods for treating Pompe disease disclosed herein comprises a heterologous nucleic acid sequence comprising a deletion of one or more base pairs 5' of SEQ ID NO:3.

[0152] For example, in some embodiments, the heterologous nucleic acid sequence in the AAV genome is from 82 to 2859 of SEQ ID NO:3, from 82 to 2859 bp of SEQ ID NO:3, from 103 to 2859 bp of SEQ ID NO:3, from 118 to 2859 of SEQ ID NO:3, from 148 to 2859 bp of SEQ ID NO:3, from 169 to 2859 bp of SEQ ID NO:3, from 199 to 2859 bp of SEQ ID NO:3, from 205 to 2859 bp of SEQ ID NO:3, from 208 to 2859 bp of SEQ ID NO:3, from 214 to 2859 bp of SEQ ID NO:3, from 220 to 2859 bp of SEQ ID NO:3, from 265 to 2859 bp of SEQ ID NO:3, from 2335 to 2859 bp of SEQ ID NO:3, from 2368 to 2859 bp of SEQ ID NO:3, from 2371 to 2859 bp of SEQ ID NO:3 p, can comprise nucleotides selected from 2374 to 2859 bp of SEQ ID NO: 3, 2377 to 2859 bp of SEQ ID NO: 3, 2386 to 2859 bp of SEQ ID NO: 3, or a nucleic acid having at least 85% sequence identity thereto, and can be attached to nucleotides 1 to 81 of SEQ ID NO: 3 5' of said sequence (corresponding to SEQ ID NO: 53, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto), encoding a codon-optimized hGAA signal peptide.

[0153] In an alternative embodiment, the heterologous nucleic acid sequence in the AAV genome is selected from the group consisting of 82 to 2859 of SEQ ID NO:3, 82 to 2859 bp of SEQ ID NO:3, 103 to 2859 bp of SEQ ID NO:3, 118 to 2859 of SEQ ID NO:3, 148 to 2859 bp of SEQ ID NO:3, 169 to 2859 bp of SEQ ID NO:3, 199 to 2859 bp of SEQ ID NO:3, 205 to 2859 bp of SEQ ID NO:3, 208 to 2859 bp of SEQ ID NO:3, 214 to 2859 bp of SEQ ID NO:3, 220 to 2859 bp of SEQ ID NO:3, 265 to 2859 bp of SEQ ID NO:3, 2335 to 2859 bp of SEQ ID NO:3, 2368 to 2859 bp of SEQ ID NO:3, 2371 to 2859 bp of SEQ ID NO:3, 2374 to 2859 bp of SEQ ID NO:3, 2377 to 2859 bp of SEQ ID NO:3 The codon-optimized hGAA signal peptide may comprise nucleotides selected from any of nucleotides 1 to 81 of SEQ ID NO: 3 (corresponding to SEQ ID NO: 53) encoding the codon-optimized hGAA signal peptide, wherein nucleotides 1 to 81 of SEQ ID NO: 3 (corresponding to SEQ ID NO: 53) are replaced with a nucleic acid encoding a heterologous signal peptide disclosed herein, e.g., any of SEQ ID NOs: 54 to 58, 67, 72 or 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0154] The truncated GAA may be wild-type or codon-optimized. For example, exemplary 5' deletions of SEQ ID NO: 3 are disclosed in Table 1 herein, which encode N-terminally truncated GAA polypeptides. In some embodiments, the 5' of the 5' deletion of SEQ ID NO: 3 can be attached to the 3' of a nucleic acid encoding any signal peptide selected from any of the signal peptides disclosed herein, e.g., SEQ ID NOs: 53-58, 67, 72, or 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0155] Table 1: Table of exemplary N-terminal truncations of the GAA polypeptide of SEQ ID NO: 1 and 5' deletions of the nucleic acid sequence of SEQ ID NO: 3. [Table 1-1] [Table 1-2]

[0156] In some embodiments, an rAAV genome useful in the methods for treating Pompe disease disclosed herein comprises a heterologous nucleic acid sequence comprising nucleotides 103-2859 of SEQ ID NO:3, and when attached 5' to said sequence, there is a nucleic acid sequence selected from any of a nucleic acid encoding a wild-type or codon-optimized hGAA signal peptide (i.e., a nucleic acid comprising SEQ ID NO:53) or a fragment thereof, or a nucleic acid sequence encoding a heterologous signal peptide disclosed herein, e.g., SEQ ID NOs:54-58, 67, 72, or 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0157] In some embodiments, an rAAV genome useful in the methods for treating Pompe disease disclosed herein comprises a heterologous nucleic acid sequence comprising nucleotides 118-2859 of SEQ ID NO:3, and when attached 5' to said sequence, there is a nucleic acid sequence selected from any of a nucleic acid encoding a wild-type or codon-optimized hGAA signal peptide (i.e., a nucleic acid comprising SEQ ID NO:53), or a nucleic acid sequence encoding a heterologous signal peptide disclosed herein, e.g., SEQ ID NOs:54-58, 67, 72, or 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0158] In some embodiments, an rAAV genome useful in the methods for treating Pompe disease disclosed herein comprises a heterologous nucleic acid sequence comprising nucleotides 148-2859 of SEQ ID NO:3, and when attached 5' to said sequence is a nucleic acid sequence selected from any of a nucleic acid encoding a wild-type or codon-optimized hGAA signal peptide (i.e., a nucleic acid comprising SEQ ID NO:53), or a nucleic acid sequence encoding a heterologous signal peptide disclosed herein, e.g., SEQ ID NOs:54-58, 67, 72, or 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0159] In some embodiments, an rAAV genome useful in the methods for treating Pompe disease disclosed herein comprises a heterologous nucleic acid sequence comprising nucleotides 169-2859 of SEQ ID NO: 3 attached 5' to said sequence, e.g., a nucleic acid encoding a codon-optimized hGAA signal peptide (i.e., a nucleic acid comprising SEQ ID NO: 53), or a nucleic acid sequence encoding a heterologous signal peptide disclosed herein, e.g., SEQ ID NOs: 54-58, 67, 72, or 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0160] In some embodiments, an rAAV genome useful in the methods for treating Pompe disease disclosed herein comprises a heterologous nucleic acid sequence comprising nucleotides 199-2859 of SEQ ID NO:3, and when attached 5' to said sequence, there is a nucleic acid sequence selected from any of a nucleic acid encoding a wild-type or codon-optimized hGAA signal peptide (i.e., a nucleic acid comprising SEQ ID NO:53) or a fragment thereof, and / or a nucleic acid sequence encoding a heterologous signal peptide disclosed herein, e.g., SEQ ID NOs:54-58, 67, 72, or 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0161] In some embodiments, an rAAV genome useful in the methods for treating Pompe disease disclosed herein comprises a heterologous nucleic acid sequence comprising nucleotides 205-2859, or nucleotides 208-2859, or nucleotides 214-2859 of SEQ ID NO:3, wherein, when attached 5' to said sequence, there is present a nucleic acid sequence selected from any of a nucleic acid encoding a wild-type or codon-optimized hGAA signal peptide (i.e., a nucleic acid comprising SEQ ID NO:53), and / or a nucleic acid sequence encoding a heterologous signal peptide disclosed herein, e.g., SEQ ID NOs:54-58, 67, 72, or 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0162] In some embodiments, an rAAV genome useful in the methods for treating Pompe disease disclosed herein comprises a heterologous nucleic acid sequence comprising nucleotides 220-2859, or nucleotides 208-2859, or nucleotides 214-2859 of SEQ ID NO:3, wherein, when attached 5' to said sequence, there is present a nucleic acid sequence selected from any of a nucleic acid encoding a wild-type or codon-optimized hGAA signal peptide (i.e., a nucleic acid comprising SEQ ID NO:53), and / or a nucleic acid sequence encoding a heterologous signal peptide disclosed herein, e.g., SEQ ID NOs:54-58, 67, 72, or 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0163] In some embodiments, an rAAV genome useful in the methods for treating Pompe disease disclosed herein comprises a heterologous nucleic acid sequence comprising any of nucleotides 265-2859 of SEQ ID NO:3, or nucleotides 2335-2859 of SEQ ID NO:3, or nucleotides 2368-2859 of SEQ ID NO:3, or nucleotides 2371-2859 bp of SEQ ID NO:3, wherein, when attached 5' to said sequence, there is a nucleic acid sequence selected from any of a nucleic acid encoding a wild-type or codon-optimized hGAA signal peptide (i.e., a nucleic acid comprising SEQ ID NO:53) or a fragment thereof, and / or a nucleic acid sequence encoding a heterologous signal peptide disclosed herein, e.g., SEQ ID NOs:54-58, 67, 72, or 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0164] In some embodiments, an rAAV genome useful in the methods for treating Pompe disease disclosed herein comprises a signal sequence disclosed herein and a heterologous nucleic acid sequence encoding a GAA polypeptide or an N-terminally truncated GAA polypeptide, wherein the GAA polypeptide starts at an amino acid residue selected from any of 28, 35, 40, 50, 57, 57, 68, 69, 70, 72, 74, 89, 779, 790, 791, 792, 793 or 796, and optionally, the GAA polypeptide also has a C-terminal deletion of at least about 10, or about 20, or about 30, or about 40, or about 50, or about 60, or about 70, or about 80, or about 90, or about 100, or about 110, or more than 110 amino acid residues from the C-terminus of SEQ ID NO:1. In some embodiments, an rAAV genome useful in the methods for treating Pompe disease disclosed herein comprises a signal sequence disclosed herein and a heterologous nucleic acid sequence encoding a GAA polypeptide or an N-terminally truncated GAA polypeptide, wherein the GAA polypeptide begins at an amino acid residue selected from any of 28, 35, 40, 50, 57, 57, 68, 69, 70, 72, 74, 89, 779, 790, 791, 792, 793, or 796, and the C-terminus of the GAA polypeptide is present at any residue after amino acid residue 500, 600, 700, 800, 842, 852, 862, 875, 885, 895, 900, 905, 915, 920, 925, 930, 935, 940, 945, 950, or 951 of SEQ ID NO:1.

[0165] In some embodiments, an rAAV genome useful in the methods for treating Pompe disease disclosed herein comprises: (i) a nucleic acid sequence encoding a wild-type or codon-optimized hGAA signal peptide (i.e., a nucleic acid comprising SEQ ID NO: 53) or a fragment thereof, and / or a heterologous signal peptide disclosed herein, e.g., a nucleic acid sequence selected from any of SEQ ID NOs: 54-58, 67, 72, or 75, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity to SEQ ID NOs: 53-58, 67, 72, or 65; and (ii) a GAA polypeptide, starting at base pairs selected from any of 82, 103, 118, 148, 169, 199, 205, 208, 214, 220, 265 of SEQ ID NO: 3 and ending at 2553 (i.e., a deletion of 100 C-terminal residues, 851 aa), 2583 (i.e., a deletion of 100 C-terminal residues, 851 aa), 2593 (i.e., a deletion of 100 C-terminal residues, 851 aa), 2594 (i.e., a deletion of 100 C-terminal residues, 851 aa), 2595 (i.e., a deletion of 100 C-terminal residues, 851 aa), 2596 (i.e., a deletion of 100 C-terminal residues, 851 aa), 2597 (i.e., a deletion of 100 C-terminal residues, 851 aa), 2598 (i.e., a deletion of i.e., deletion of 90 C-terminal residues, ending at 861 aa), 2613 (i.e., deletion of 80 C-terminal residues, ending at 871 aa), 2643 (i.e., deletion of 70 C-terminal residues, ending at 871 aa), 2673 (i.e., deletion of 60 C-terminal residues, ending at 881 aa), 2703 (i.e., deletion of 50 C-terminal residues, ending at 891 aa), 2733 (i.e., deletion of 40 C-terminal residues, ending at 901 aa), 2763 (i.e., deletion of 30 C-terminal residues, ending at 891 aa), 2763 (i.e., deletion of 30 C-terminal residues, ending at 891 aa), 2763 (i.e., deletion of 40 C-terminal residues, ending at 901 aa), 2763 (i.e., deletion of 40 C-terminal residues, ending at 911 aa), 2763 (i.e., deletion of 40 C-terminal residues, ending at 921 aa), 2763 (i.e., deletion of 40 C-terminal residues, ending at 931 aa), 2763 (i.e., deletion of 40 C-terminal residues, ending at 941 aa), 2763 (i.e., deletion of 40 C-terminal residues, ending at 951 aa), 2763 (i.e., deletion of 40 C-terminal residues, ending at 961 aa), 2763 (i.e., deletion of 40 C-terminal residues, ending at 971 aa), 2763 (i.e., deletion of 40 C-terminal residues and 2826 (i.e., deletion of 10 C-terminal residues, ending at 942 aa), or 2823 (i.e., deletion of 20 C-terminal residues, ending at 911 aa), 2775 (i.e., deletion of 27 C-terminal residues, ending at 925 aa), 2826 (i.e., deletion of 10 C-terminal residues, ending at 942 aa), or terminating anywhere between base pairs 2553 and 2859 of SEQ ID NO:3. B. Signal peptide (SP)

[0166] The native GAA signal peptide is not cleaved in the ER, thereby causing the native GAA polypeptide to be membrane-bound in the ER (Tsuji et al. (1987) Biochem. Int. 15(5):945-952). Disruption of membrane association of GAA can be achieved by replacing the endogenous GAA signal peptide (and, optionally, adjacent sequences) with a surrogate signal peptide for GAA.

[0167] Thus, in representative embodiments, the rAAV vectors and rAAV genomes useful in the methods for treating Pompe disease disclosed herein further comprise a heterologous nucleic acid encoding a GAA polypeptide that is transferred into a target cell and attached to a heterologous nucleic acid sequence encoding a heterologous signal peptide in place of the endogenous GAA signal peptide. The heterologous nucleic acid encoding a GAA polypeptide comprising an N-terminal truncation of the GAA polypeptide is operably associated with a segment encoding a secretory signal peptide such that, upon transcription and translation, a fusion polypeptide is produced that contains a secretory signal sequence operably associated with (e.g., directing the secretion of) the GAA polypeptide or the N-terminally truncated GAA polypeptide.

[0168] In some embodiments, the endogenous signal peptide of hGAA (i.e., amino acids 1-27 of SEQ ID NO:1 (encoded by the codon-optimized nucleic acid sequence corresponding to SEQ ID NO:59)) is replaced with a heterologous signal peptide (also referred to herein as a "signal sequence" or "leader sequence") of SEQ ID NO:60 (201 IgG signal peptide), or IL2 wild-type signal peptide (SEQ ID NO:61), modified IL2 signal peptide (SEQ ID NO:62), A2M signal peptide (SEQ ID NO:63), or PZP signal peptide (SEQ ID NO:64), or artificial signal peptide (SEQ ID NO:65), or cathepsin L signal peptide (SEQ ID NO:66), or a signal peptide with at least 90% sequence identity to SEQ ID NOs:60-66.

[0169] In some embodiments, an AAV vector encodes a GAA polypeptide comprising an endogenous GAA signal peptide (e.g., amino acids 1-27 of SEQ ID NO: 1 (also referred to as the "native GAA" or "cognate GAA" signal peptide). In some embodiments, an AAV vector encodes a GAA polypeptide comprising an endogenous GAA signal peptide (e.g., amino acids 1-27 of SEQ ID NO: 1, or a portion thereof) and an additional heterologous (i.e., non-native) signal sequence. In some embodiments, a GAA polypeptide disclosed herein lacking the endogenous signal peptide of amino acids 1-27 of GAA of SEQ ID NO: 1, or an N-terminal GAA polypeptide, is fused to a heterologous signal peptide (also referred to as a "secretory signal peptide").

[0170] In certain embodiments, the heterologous nucleic acid sequence encodes a GAA polypeptide comprising a signal peptide fused to the GAA polypeptide, wherein the signal peptide is a heterologous GAA polypeptide. In some embodiments, a heterologous nucleic acid encoding a GAA polypeptide fused to a heterologous (e.g., exogenous or non-GAA) signal peptide can further comprise, at its 5' end, a nucleic acid sequence encoding a portion of the cognate (e.g., endogenous) GAA signal peptide, e.g., at least 1-5, or at least 1-10, or at least 1-20, or at least about 1-23, or at least about 1-24, or at least about 1-25, or at least about 1-26 GAA signal peptide, or the entire GAA signal peptide, e.g., or at least about 1-27 contiguous amino acids of the endogenous GAA signal peptide. In other words, in some embodiments, a heterologous nucleic acid sequence can comprise, from 5' to 3', a nucleic acid sequence encoding the entire GAA signal peptide of SEQ ID NO: 59 or a portion of the endogenous GAA signal peptide of SEQ ID NO: 59, a nucleic acid sequence encoding a heterologous signal peptide (e.g., a non-GAA signal peptide), and a codon-optimized nucleic acid sequence encoding a GAA polypeptide, e.g., a wild-type nucleic acid sequence, or a sequence encoding at least one to three amino acid variants, or an N-terminal GAA truncation. For example, in some embodiments, the nucleic acid sequence encoding a GAA polypeptide encodes an N-terminally truncated GAA polypeptide, e.g., one disclosed in Table 1 herein.

[0171] In some embodiments, the order of the signal peptides is altered, for example, in some embodiments, the heterologous nucleic acid sequence can comprise, from 5' to 3', a nucleic acid sequence encoding a heterologous signal peptide disclosed herein, the entire GAA signal peptide of SEQ ID NO: 59 or a portion of the endogenous GAA signal peptide of SEQ ID NO: 59, and a codon-optimized nucleic acid sequence encoding a GAA polypeptide, including a wild-type or N-terminal GAA truncation.

[0172] In some embodiments, there can be a portion of a GAA polypeptide, e.g., any one or two amino acids, or more than two contiguous amino acids, located in the region of amino acids 28-56 of SEQ ID NO: 1, located between the GAA signal peptide (or portion thereof) and the heterologous signal peptide and upstream (e.g., N-terminal) of the N-terminally truncated GAA polypeptide. For example, without wishing to be bound by theory, in some embodiments, the heterologous nucleic acid sequence can comprise, in the 5' to 3' direction, (i) the entire full-length GAA signal peptide disclosed herein or a portion thereof, (ii) a portion of a GAA polypeptide, e.g., amino acids 28-35 of SEQ ID NO: 1, amino acid 28 of SEQ ID NO: 1, or amino acids 28-31 of SEQ ID NO: 1, (iii) the heterologous signal peptide, and (iv) a GAA polypeptide, e.g., an N-terminally truncated GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1. It is contemplated that the portion of the GAA polypeptide located between the GAA polypeptide and the heterologous signal peptide can be any length, e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 10-12, 12-14, 14-16, 16-18, 18-20, or more than 20 amino acids from residues 28-56 of SEQ ID NO: 1, and the N-terminal GAA polypeptide need not begin at the amino acid next to or following the earlier portion of the GAA polypeptide. Certain amino acids in this 28-56 amino acid region can cause cellular retention. In one embodiment, these amino acids are removed or replaced.

[0173] In some embodiments, the nucleic acid sequence encoding the GAA signal peptide encodes at least 1-5, or at least 1-10, or at least 1-20, or at least about 1-23, or at least about 1-24, or at least about 1-25, or at least about 1-26, or at least about 1-27 contiguous amino acids (i.e., the entire GAA signal peptide sequence) or non-contiguous amino acids of the endogenous GAA signal peptide of SEQ ID NO: 59. In some embodiments, the nucleic acid sequence encoding the GAA signal peptide encodes a GAA signal peptide that includes at least one deletion of at least 1, or at least 2, or at least 3, or at least 4, or at least 5, or at least 6, or at least 7, or at least 8, or at least 9, or at least 10, or at least 11, or at least 12, or at least 13, or at least 14, or at least 15, or at least 16, or at least 17, or at least 18, or at least 19, or at least 20 amino acids of SEQ ID NO: 59, and the one or more deletions can be contiguous or non-contiguous deletions.

[0174] In some embodiments, the nucleic acid sequence encoding the GAA signal peptide can comprise the entire nucleic acid of SEQ ID NO: 57 (encoding a GAA signal peptide comprising amino acids 1-27 of SEQ ID NO: 59). In alternative embodiments, the nucleic acid sequence encoding the GAA signal peptide can comprise a portion of the nucleic acid sequence of SEQ ID NO: 53, e.g., 1-3 bp, 1-4 bp, 1-5 bp, 1-6 bp, 1-7 bp, 1-8 bp, 1-9 bp, 1-10 bp, 1-11 bp, 1-12 bp, 1-13 bp, 1-14 bp, 1-15 bp, 1-16 bp, 1-17 bp, 1-18 bp, 1-19 bp, 1-20 bp, 1-21 bp, 1-22 bp, 1-23 bp, or any portion of the nucleic acid sequence of SEQ ID NO: 53. , 1 to 24 bp, 1 to 25 bp, 1 to 26 bp, 1 to 27 bp, 1 to 28 bp, 1 to 29 bp, 1 to 30 bp, 1 to 33 bp, 1 to 36 bp, 1 to 39 bp, 1 to 42 bp, 1 to 45 bp, 1 to 48 bp, 1 to 51 bp, 1 to 54 bp, 1 to 57 bp, 1 to 60 bp, 1 to 63 bp, 1 to 66 bp, 1 to 69 bp, 1 to 72 bp, 1 to 75 bp, and 1 to 78 bp. That is, using a 21 bp portion of SEQ ID NO: 53 as an illustrative example, the GAA signal peptide can comprise a nucleic acid that is a 21 bp portion of SEQ ID NO: 53, and the 21 bp can be any 21 consecutive base pairs of SEQ ID NO: 53. For example, a 1-21 bp portion starting at base pair 1 of SEQ ID NO:53 would encode a GAA signal peptide containing amino acids 1-7 of SEQ ID NO:59, while a 1-21 bp portion starting at base pair 15 of SEQ ID NO:53 would encode a GAA signal peptide containing amino acids 5-12 of SEQ ID NO:59.In some embodiments, the portion of the GAA signal peptide of SEQ ID NO:59 is the N-terminal portion of SEQ ID NO:59 (i.e., having a deletion of at least 1, or at least 2, or at least 3, or at least 4, or at least 5, or at least 6, or at least 7, or at least 8, or at least 9, or at least 10, or at least 11, or at least 12, or at least 13, or at least 14, or at least 15, or more than 15 amino acids at the C-terminus of SEQ ID NO:59).

[0175] In some embodiments, a nucleic acid encoding a heterologous signal peptide disclosed herein can be inserted into a nucleic acid sequence encoding a GAA signal peptide. The insertion can occur anywhere from 1 to 81 bp of SEQ ID NO:53. In some embodiments, a nucleic acid sequence encoding a heterologous signal peptide disclosed herein is inserted into a portion of a nucleic acid encoding a GAA signal peptide, e.g., a nucleic acid encoding a heterologous signal peptide disclosed herein, that includes a 5' nucleic acid sequence encoding a portion of the GAA signal peptide (e.g., the portion of SEQ ID NO:53 discussed above) and attached 3' to said sequence, e.g., resulting in a chimeric signal peptide. In some embodiments, a nucleic acid encoding the N-terminal portion of a GAA polypeptide with a subsequent amino acid deletion, e.g., a deletion of amino acids 28, 28-29, 28-30, 28-31, 28-32, 28-33, etc., encoded by SEQ ID NO:1, followed by a deletion of approximately 4 to 40 amino acids of SEQ ID NO:1, can also be present. In some embodiments, the heterologous signal peptide can be inserted immediately after the N-terminal amino acid, e.g., after position 28, 29, 30, 31, 32, or 33.

[0176] In some embodiments of the compositions and methods described herein, the signal peptide serves the general purpose of assisting the secretion of the GAA polypeptide from liver cells into the blood, and as described herein, can transport and target it to the lysosomes of mammalian cells, such as human cardiac muscle cells and skeletal muscle cells. In some embodiments, the heterologous signal peptide is selected from the AAT signal peptide, fibronectin signal peptide (FN1), 201 signal peptide, wtIL2 signal peptide, mutIL2 signal peptide, A2M signal peptide, PZP signal peptide, or active fragments of AAT, FN1, 201, wtIL2, mutIL2, A2M, or PZP signal peptides that have secretory signal activity.

[0177] In some embodiments, the signal peptide is heterologous (i.e., foreign or exogenous) to the polypeptide of interest. For example, the heterologous signal peptide is a fibronectin secretory signal peptide, and the polypeptide of interest is not fibronectin. In some embodiments, the signal peptide is selected from the group consisting of FN1, 201 signal peptide, wtIL2 signal peptide, mutIL2 signal peptide, A2M signal peptide, and PZP signal peptide, all of which have secretory signal activity. In alternative embodiments, the signal peptide is not heterologous to GAA, i.e., the signal peptide is a GAA signal peptide (i.e., residues 1-27 of SEQ ID NO: 1, the endogenous GAA polypeptide).

[0178] In some embodiments, the endogenous GAA signal sequence at amino acids 1-27 of SEQ ID NO: 1 (i.e., MGVRHPPCSHRLLAVCALVSLATAALL, SEQ ID NO: 59) is replaced with a different signal peptide (leader peptide). For example, the endogenous signal peptide of GAA (SEQ ID NO: 59) can be replaced with (i) an IgG1 signal peptide (referred to herein as "201 signal peptide" or "201lp") having the amino acid sequence MEFGLSWVFLVALLKGVQCE (SEQ ID NO: 60) encoded by the nucleic acid sequence of SEQ ID NO: 54, (ii) wtIL2 lp:MYRMQLLSCIALSLALVTNS (SEQ ID NO: 61) encoded by the nucleic acid sequence of SEQ ID NO: 55, or (iii) mutIL2 lp:MYRMQLLSCIALSLALVTNS encoded by the nucleic acid sequence of SEQ ID NO: 56. [ka] (SEQ ID NO: 62), (iv) the A2M signal peptide MGKNKLLHPSLVLLLLVLLPTDA (SEQ ID NO: 63) encoded by the nucleic acid sequence of SEQ ID NO: 57, or (iv) the PZP signal peptide MRKDRLLHLCLVLLLILLSASDSNS (SEQ ID NO: 64) encoded by the nucleic acid sequence of SEQ ID NO: 58. In some embodiments, the heterologous signal peptide may be shortened.

[0179] In some embodiments, the endogenous GAA signal peptide (SEQ ID NO:59) or a fragment or portion thereof remains present, and an additional signal peptide is added, e.g., any one or more of the signal peptides AAT, FN1,201, wtIL2, mutIL2, A2M, and PZP disclosed herein. In some embodiments, the endogenous GAA signal peptide at amino acids 1-27 of SEQ ID NO:1 (i.e., MGVRHPPCSHRLLAVCALVSLATAALL, SEQ ID NO:59) is replaced with a different or heterologous signal peptide. For example, the endogenous signal peptide of GAA (SEQ ID NO: 59) is a signal peptide that can be encoded by (i) an IgG1 signal peptide (referred to herein as "201 signal peptide" or "201lp") having an amino acid sequence of MEFGLSWVFLVALLKGVQCE (SEQ ID NO: 60) encoded by the nucleic acid sequence of SEQ ID NO: 54, (ii) a wtIL2 lp:MYRMQLLSCIALSLALVTNS (SEQ ID NO: 61) encoded by the nucleic acid sequence of SEQ ID NO: 55, or (iii) a mutIL2 lp:MYRMQLLSCIALSLALVTNS encoded by the nucleic acid sequence of SEQ ID NO: 56. [ka] (iv) the A2M signal peptide MGKNKLLHPSLVLLLLVLLPTDA (SEQ ID NO: 63) encoded by the nucleic acid sequence of SEQ ID NO: 57; or (iv) the PZP signal peptide MRKDRLLHLCLVLLLILLSASDSNS (SEQ ID NO: 64) encoded by the nucleic acid sequence of SEQ ID NO: 58.

[0180] In some embodiments, the nucleic acid sequence in the rAAV vector or rAAV genome is a sequence selected from SEQ ID NOs: 470 to 515. In one embodiment, the nucleic acid sequence in the rAAV vector or rAAV genome comprises at least a portion of a sequence selected from SEQ ID NOs: 470 to 515 (i.e., a sequence that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more of the sequence of SEQ ID NOs: 470 to 515).

[0181] In some embodiments, exemplary nucleic acid sequences in the rAAV vectors or rAAV genomes disclosed herein are shown in the exemplary constructs provided herein below. pP065, which is a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[GAA-SP from 1 to 28 aa]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, e.g., SEQ ID NO: 470. pP066, which is a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[GAA-SP of 1 to 28 aa]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, e.g., SEQ ID NO: 471. pP067, a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[aa 1 from GAA-SP]-[aa 28-31 of GAA]-[IL-2 signal sequence]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, e.g., SEQ ID NO: 472. pP068, a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[aa 1 from GAA-SP]-[GAA 28-31 aa]-[201Ig]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, e.g., SEQ ID NO: 473. pP069, a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[GAA from seq 100-aa 1 from SP]-[GAA from seq 3]-[IL-2 signal sequence]-[GAA polypeptide starting at amino acid 57 of seq 3]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[ITR adjacent]-[R-ITR]. See, e.g., SEQ ID NO: 474. pP070, which is a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[aa 1 from GAA-SP]-[GAA 28-31 aa]-[201Ig]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, e.g., SEQ ID NO: 475. pP071, which is a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[GAA 1-24 aa]-[IL-2 signal sequence]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, e.g., SEQ ID NO: 476. pP072, which is a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[GAA 1-24 aa]-[201Ig]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, e.g., SEQ ID NO: 477. pP073, which is a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[GAA 1-24 aa]-[IL-2 signal sequence]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, e.g., SEQ ID NO: 478. pP074, which is a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[GAA 1-24 aa]-[201Ig]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, e.g., SEQ ID NO: 479. pP075, which is a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[GAA 1-23 aa]-[IL-2 signal sequence]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, e.g., SEQ ID NO: 480. pP076, which is a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[GAA 1-23 aa]-[201Ig]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, e.g., SEQ ID NO: 481. pP077, which is a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[GAA 1-23 aa]-[IL-2 signal sequence]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, e.g., SEQ ID NO: 482. pP078, which is a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[GAA 1-23 aa]-[201Ig]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, e.g., SEQ ID NO: 483. pP079, which is a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[1-2 aa GAA]-[IL-2 signal sequence (Met1 removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, e.g., SEQ ID NO: 484. pP080, which is a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[1-2 aa GAA]-[201Ig (Met1 removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, e.g., SEQ ID NO: 485. pP081, a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[1-2 aa GAA]-[IL-2 signal sequence (Met1 removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, e.g., SEQ ID NO: 486. pP082, a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[1-2 aa GAA]-[201Ig (Met1 removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, e.g., SEQ ID NO: 487. pP083, a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[GAA 1-4 aa]-[IL-2 signal sequence (Met1 removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, e.g., SEQ ID NO: 488. pP084, which is a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[GAA 1-4 aa]-[201Ig (Met1 removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, e.g., SEQ ID NO: 489. pP085, which is a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[GAA 1-4 aa]-[IL-2 signal sequence (Met1 removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, e.g., SEQ ID NO: 490. pP086, which is a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[GAA 1-4 aa]-[201Ig (Met1 removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, e.g., SEQ ID NO: 491. pP087, a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[GAA 1-10 aa]-[IL-2 signal sequence (Met1 removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO:1]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, e.g., SEQ ID NO:492. pP088, a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[GAA 1-10 aa]-[201Ig (Met1 removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, e.g., SEQ ID NO: 493. pP089, which is a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[GAA 1-10 aa]-[IL-2 signal sequence (Met1 removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO:1]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, e.g., SEQ ID NO:494. pP090, which is a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[GAA 1-10 aa]-[201Ig (Met1 removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, e.g., SEQ ID NO: 495. pP091, a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[GAA from 1 to 27 aa]-[IL-2 signal sequence (Met1 removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, e.g., SEQ ID NO: 496. pP092, a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[GAA from aa 1 to 27]-[201Ig (Met1 removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, e.g., SEQ ID NO: 497. pP093, a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[GAA 1-27 aa]-[IL-2 signal sequence (Met1 removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO:1]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[ITR adjacent]-[R-ITR]. See, e.g., SEQ ID NO:498. pP094, which is a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[GAA from aa 1 to 27]-[201Ig (Met1 removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, e.g., SEQ ID NO: 499. pP098, which is a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[GAA 1-24 aa]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, e.g., SEQ ID NO: 500. pP099, which is a plasmid containing, from 5' to 3', [L-ITR]-[(LSP: liver-specific promoter)]-[5'UTR]-[GAA 1-24 aa]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA signal and terminator]-[RNA polymerase II transcription pause signal]-[R-ITR]. See, e.g., SEQ ID NO: 501. pP110, which is a plasmid containing, in 5' to 3' direction, [ITR2]-[LSP]-[GAA 1-28 aa]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA]-[ITR2]. See, e.g., SEQ ID NO: 502. pP111, which is a plasmid containing, in 5' to 3' direction, [ITR2]-[LSP]-[GAA 1-24 aa]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA]-[ITR2]. See, e.g., SEQ ID NO: 503. pP112, which is a plasmid containing, from 5' to 3', [ITR2]-[LSP]-[GAA 1-27 aa]-[2011p (Met1 removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA]-[ITR2]. See, e.g., SEQ ID NO: 504. pP113, which is a plasmid containing, from 5' to 3', [ITR2]-[LSP]-[GAA 1-24 aa]-[2011p]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA]-[ITR2]. See, e.g., SEQ ID NO: 505. pP114, which is a plasmid containing, from 5' to 3', [ITR2]-[LSP]-[1-2 aa of GAA]-[IL-2 signal sequence (Met1 removed)]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO:1]-[3'UTR]-[hGH polyA]-[ITR2]. See, e.g., SEQ ID NO:506. pP150, which is a plasmid containing, in 5' to 3' direction, [ITR2]-[LSP]-[GAA 1-24 aa]-[201Ip]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA]-[ITR2]. See, e.g., SEQ ID NO: 507. pP151, which is a plasmid containing, from 5' to 3', [ITR2]-[LSP]-[5'UTR]-[GAA 1-24 aa]-[201Ip]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA]-[ITR2]. See, e.g., SEQ ID NO: 508. pP152, which is a plasmid containing, in 5' to 3' direction, [ITR2]-[LSP]-[GAA 1-24 aa]-[201Ip]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA]-[ITR2]. See, e.g., SEQ ID NO: 509. pP153, which is a plasmid containing, from 5' to 3', [ITR2]-[LSP]-[5'UTR]-[GAA 1-24 aa]-[201Ip]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA]-[ITR2]. See, e.g., SEQ ID NO: 510. pP155, which is a plasmid containing, in 5' to 3' direction, [L-ITR]-[fragment of P5]-[LSP]-[GAA 1-24 aa]-[201Ip]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]-[3'UTR]-[hGH polyA]-[R-ITR]. See, e.g., SEQ ID NO: 511. pP157, which is a plasmid containing, in 5' to 3' direction, [L-ITR]-[fragment of P5]-[LSP]-[GAA 1-28 aa from ACTUS]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO:1]-[3'UTR]-[hGH polyA]-[R-ITR]. See, e.g., SEQ ID NO:512.

[0182] In some embodiments, exemplary constructs have a codon-optimized GAA, including a codon-optimized GAA signal peptide or portion thereof, e.g., the GAA and / or GAA signal peptide is encoded by seq 100 (SEQ ID NO:3) or seq3 (SEQ ID NO:4), or a fragment thereof. In some embodiments of the invention, the GAA and / or GAA signal peptide, or portion thereof, in exemplary constructs is not codon-optimized, e.g., the GAA and / or GAA signal peptide is encoded by SEQ ID NO:2, or a fragment thereof.

[0183] In some embodiments, the exemplary constructs described herein may be in a plasmid DNA backbone, or in a closed-ended linear double-stranded DNA backbone or a precursor plasmid of a closed-ended linear double-stranded DNA backbone.

[0184] In some embodiments, the exemplary constructs described herein comprise a 5'UTR described in the present application, including but not limited to SEQ ID NO:40 or SEQ ID NO:41.

[0185] In some embodiments, nucleic acids encoding GAA of the invention, including but not limited to exemplary constructs, have a 130 bp ITR. In some embodiments, nucleic acids encoding GAA of the invention, including but not limited to exemplary constructs, have a 145 bp ITR.

[0186] In some embodiments, exemplary nucleic acid sequences in an rAAV vector or rAAV genome are disclosed herein and shown in Table 10.

[0187] Table 10: Exemplary constructs encoding, from 5' to 3', a GAA signal peptide or portion thereof, a heterologous signal peptide, and a GAA polypeptide (see, e.g., Figure 29). In Table 10, a GAA polypeptide beginning at amino acid 57 of SEQ ID NO: 1 is shown for illustrative purposes; however, any GAA polypeptide is contemplated, including any N-terminal truncations disclosed in Table 1 herein, as well as wild-type GAA polypeptides, codon-optimized GAA polypeptides, ACTUS-101 GAA polypeptides, and N-terminal truncations thereof (Hetero-SP, or SP, refers to a heterologous signal peptide disclosed herein; GAA-SP refers to the endogenous (cognate) signal peptide of GAA of SEQ ID NO: 59, or a portion thereof). [Table 10-1] [Table 10-2]

[0188] In one embodiment, the constructs described in Table 10 achieve the titers described in Table 11 after in vivo administration after 4 weeks of administration. [Table 11]

[0189] In Table 11, "Serum GAA" describes the level of GAA expression found in the serum of injected mice 4 weeks after administration, "Serum 4MU" describes the level of GAA activity found in the serum of injected mice 4 weeks after administration, "Heart 4MU" describes the level of GAA activity found in the hearts of injected mice 4 weeks after administration, "Heart Glycogen" describes the level of glucose found in the hearts of injected mice 4 weeks after administration, and "Liver Retention" describes the level of GAA expression found in the livers of injected mice 4 weeks after administration.

[0190] Generally, the GAA signal peptide and / or heterologous signal peptide is present at the amino-terminus (N-terminus) of the GAA polypeptide (i.e., the nucleic acid segment encoding the signal peptide is present 5' to the heterologous nucleic acid encoding the GAA peptide in an rAAV vector or rAAV genome disclosed herein). Alternatively, the signal peptide can be present at the carboxy-terminus or embedded within the GAA polypeptide, so long as the signal peptide is operably associated therewith and directs secretion of the GAA polypeptide or GAA fusion polypeptide of interest from the cell (either by cleavage of the signal peptide from the GAA polypeptide or without cleavage).

[0191] The signal peptide is operably associated with the GAA polypeptide, including the N-terminally truncated GAA polypeptides disclosed in Table 1 herein, that are targeted to the secretory pathway. In other words, the signal peptide is operably associated with the GAA polypeptide such that the GAA polypeptide is secreted from the cell at a higher level (i.e., in greater amounts) than in the absence of the secretory signal peptide. Generally, when a signal peptide is attached, typically at least about 20%, 30%, 40%, 50%, 70%, 80%, 85%, 90%, 95% or more of the GAA polypeptide is secreted from the cell compared to the absence of the secretory signal peptide. In other embodiments, essentially all of the detectable polypeptide (single and / or in the form of a fusion polypeptide) is secreted from the cell.

[0192] The phrase "secreted from the cell" means that the polypeptide can be secreted into any compartment (e.g., body fluid or space) outside the cell, including, but not limited to, the interstitial space, blood, lymph, cerebrospinal fluid, renal tubules, respiratory tract (e.g., alveoli, bronchioles, bronchi, nasal cavity, etc.), gastrointestinal tract (e.g., esophagus, stomach, small intestine, colon, etc.), vitreous humor of the eye, and endolymphatic cysts of the cochlea.

[0193] Thus, in some embodiments, an AAV expressing GAA useful in the methods for treating Pompe disease disclosed herein comprises 5'ITR and 3'ITR sequences, and a liver-specific promoter operably linked to a heterologous nucleic acid encoding a secretory peptide and a nucleic acid encoding an alpha-glucosidase (GAA) polypeptide located between the 5'ITR and 3'ITR (i.e., the heterologous nucleic acid encodes a GAA polypeptide comprising a signal peptide-GAA polypeptide or an N-terminal GAA polypeptide).

[0194] In an alternative embodiment, the GAA-expressing AAV useful in the methods for treating Pompe disease disclosed herein comprises 5'ITR and 3'ITR sequences, and a promoter operably linked to a heterologous nucleic acid encoding a secretory peptide and a nucleic acid encoding an alpha-glucosidase (GAA) polypeptide located between the 5'ITR and 3'ITR.

[0195] Generally, secretory signal peptides are cleaved in the endoplasmic reticulum, and in some embodiments, the signal peptide is cleaved from the GAA polypeptide before secretion. However, as long as the secretion of the GAA polypeptide from the cell is enhanced and the GAA polypeptide is functional, it is not necessary for the signal peptide to be cleaved. Thus, in some embodiments, the signal peptide is partially or completely retained.

[0196] In some embodiments, the rAAV genome or isolated nucleic acid disclosed herein comprises a nucleic acid encoding a chimeric polypeptide comprising a GAA polypeptide operably linked to a secretory signal peptide, wherein the chimeric polypeptide is expressed and produced from a cell transduced with the rAAV vector, and the GAA polypeptide is secreted from the cell. The GAA polypeptide may be secreted after cleavage of all or part of the secretory signal peptide. Alternatively, the GAA polypeptide may retain the signal peptide (i.e., the signal peptide is not cleaved). Thus, in this context, a "GAA polypeptide" may be a chimeric polypeptide comprising a secretory peptide.

[0197] Other signal peptides are encompassed for use in the methods and compositions disclosed herein. For example, numerous secreted proteins and sequences that direct secretion from cells are known in the art and are disclosed in U.S. Patent No. 9,873,868, which is incorporated herein by reference in its entirety. Exemplary secreted proteins (and their secretion signals) include, but are not limited to, erythropoietin, coagulation factor IX, cystatin, lactotransferrin, plasma protease C1 inhibitor, apolipoproteins (e.g., APO A, C, E), MCP-1, α-2-HS-glycoprotein, α-1-microglobulin, complement (e.g., C1Q, C3), vitronectin, lymphotoxin-α, azurocidin, VIP, metalloproteinase inhibitor 2, glypican-1, pancreatic hormones, clusterin, hepatocyte growth factor, insulin, α-1-antichymotrypsin, growth hormone, type IV collagenase, guanylin, properdin, proenkephalin A, inhibin β (e.g., A chain), prealbumin, angiogenin, lutropin (e.g., β chain), insulin-like growth factor binding protein 1 and 2, proactivator polypeptide, fibrinogen (e.g., β chain), gastric triacylglycerol lipase, midkine, neutrophil defensins 1, 2, and 3, α-1-antitrypsin, matrix gla-protein, α-tryptase, bile salt-activated lipase, chymotrypsinogen B, elastin, IG lambda chain V region, platelet factor 4 variant, chromogranin A, WNT-1 proto-oncogene protein, oncostatin M, β-neoendorphin-dynorphin, von Willebrand factor, plasma serine protease inhibitor, serum amyloid A protein, nidogen, fibronectin, rennin, osteonectin, histatin 3, phospholipase A2, cartilage matrix protein, GM-CSF, matrilysin, neuroendocrine protein 7B2, placental protein 11, gelsolin, M-CSF, transcobalamin I, lactase-phlorizin hydrolase, elastase 2B, pepsinogen A, MIP1-beta, prolactin, trypsinogen II, gastrin-releasing peptide II, atrial natriuretic factor, secretory alkaline phosphatase, pancreatic alpha-amylase, secretogranin I, beta-casein, serotransferrin, tissue factor pathway inhibitor, follitropin beta chain, coagulation factor XII, growth hormone-releasing factor, prostate seminal plasma protein, interleukins (e.g., 2, 3, 4, 5, 9, 11), inhibin (e.g., alpha chain), angiotensinogen, thyroglobulin, IG heavy or light chain, plasminogen activator inhibitor-1, lysozyme C, plasminogen activator, anti-leukoproteinase 1, statherin, fibulin-1, isoform B, uromodulin, thyroxine-binding globulin, axonin-1, endometrial alpha-2 globulin, interferons (e.g., alpha, beta, gamma), beta-2-microglobulin, procholecystokinin, progastricsin, prostatic acid phosphatase, bone sialoprotein II, colipase, Alzheimer's amyloid A4 protein, PDGF (e.g., A or B chain), coagulation Factor V, triacylglycerol lipase, haptoglobin-2, corticosteroid-binding globulin, triacylglycerol lipase, prorelaxin H2, follistatin 1 and 2, platelet glycoprotein IX, GCSF, VEGF, heparin cofactor II, antithrombin-III, leukemia inhibitory factor, interstitial collagenase, pleiotrophin, small inducible cytokine A1, melanin-concentrating hormone, angiotensin-converting enzyme, pancreatic trypsin inhibitor, coagulation factor VIII, α-fetoprotein Protein, alpha-lactalbumin, senogelin II, kappa-casein, glucagon, thyrotropin beta chain, transcobalamin II, thrombospondin 1, parathyroid hormone, vasopressin copeptin, tissue factor, motilin, MPIF-1, kininogen, neuroendocrine convertase 2, stem cell factor procollagen alpha 1 chain, plasma kallikrein, keratinocyte growth factor, as well as any other secreted hormones, growth factors, cytokines, enzymes, clotting factors, milk proteins, immunoglobulin chains, and the like.

[0198] In one embodiment, the secretory signal peptide is not the secretory signal peptide of alpha-1-antitrypsin (e.g., amino acids 1-24 of alpha-1-antitrypsin), chymotrypsinogen B2 (e.g., amino acids 1-20 of chymotrypsinogen B2), iduronate-2-sulfatase (e.g., amino acids 1-25 of iduronate-2-sulfatase), or protease C1 inhibitor (e.g., amino acids 1-23 of protease CI inhibitor).

[0199] In some embodiments, other secretory signal peptides encoded by the rAAV genomes and in the rAAV vectors disclosed herein can be selected from, but are not limited to, signal peptide sequences from prepro-cathepsin L (e.g., GenBank Accession Nos. KHRTL, NP_037288; NP_034114, AAB81616, AAA39984, P07154, CAA68691; the disclosures of which are incorporated herein by reference in their entireties), and prepro-alpha type 2 collagen (e.g., GenBank Accession Nos. CAA98969, CAA26320, CGHU2S, NP_000080, BAA25383, P08123; the disclosures of which are incorporated herein by reference in their entireties), as well as allelic variations, modifications, and functional fragments thereof (as discussed above with respect to fibronectin signal peptide sequences). Exemplary signal peptide sequences include those for preprocathepsin L (Rattus norvegicus, MTPLLLLAVLCLGTALA [SEQ ID NO: 77]; Accession No. CAA68691) and for prepro-alpha type 2 collagen (Homo sapiens, MLSFVDTRTLLLLAVTLCLATC [SEQ ID NO: 78]; Accession No. CAA98969). Longer amino acid sequences containing full-length signal peptide sequences from preprocathepsin L and prepro-alpha type 2 collagen, or functional fragments thereof (as discussed above with respect to the fibronectin signal peptide sequence), are also encompassed.

[0200] In some embodiments, the signal peptide is derived in whole or in part from a secretory polypeptide produced by liver cells. In some embodiments, the signal peptide may further be synthetic or artificial, in whole or in part. Synthetic or artificial secretory signal peptides are known in the art; see, e.g., Barash et al., "Human signal peptide description by hidden Markov model and generation of a strong artificial signal peptide for secreted protein expression," Biochem. Biophys. Res. Comm. 294:835-42 (2002), the disclosure of which is incorporated herein in its entirety. In certain embodiments, the signal peptide comprises, consists essentially of, or consists of the artificial secretory signal: MWWRLWWLLLLLLLLWPMVWA (SEQ ID NO: 65), or a variant thereof with 1, 2, 3, 4, or 5 amino acid substitutions (optionally conservative amino acid substitutions, where conservative amino acid substitutions are known in the art).

[0201] Exemplary signal peptides for use in the methods and compositions disclosed herein can be selected from any signal peptide disclosed in Table 2, or portions or functional variants thereof. Exemplary signal peptides are fibronectin (FN1) or AAT. In some embodiments of the methods and compositions disclosed herein, the rAAV vector composition includes a nucleic acid encoding a secretory signal peptide, e.g., a nucleic acid encoding a signal peptide selected from the AAT signal peptide (e.g., SEQ ID NO: 67), the fibronectin signal peptide (FN1) (e.g., SEQ ID NOs: 68-71), the hIGF2 signal peptide (e.g., SEQ ID NO: 72), or an active fragment thereof having secretory signal activity, e.g., a nucleic acid encoding an amino acid sequence having at least about 75%, 80%, 85%, 90%, 95%, 98%, or 99% sequence identity to SEQ ID NOs: 67-72.

[0202] In some embodiments of the methods and compositions disclosed herein, the nucleic acid encoding the signal peptide is selected from any of SEQ ID NOs: 54-58, 67, 72-76, and 72, or a nucleic acid sequence having at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to any of SEQ ID NOs: 54-58, 67, 72-76, and 72.

[0203] Fibronectin secretory signal peptide:

[0204] In some embodiments, the signal peptide is a fibronectin secretory signal peptide, or a portion or functional variant thereof, which term includes modifications of the naturally occurring sequence (as described in more detail below).

[0205] In some embodiments, the signal peptide is a fibronectin signal peptide, such as a human fibronectin signal sequence or a rat fibronectin-derived signal sequence. Fibronectin (FN1) signal sequences and modified FN1 signal peptides encompassed for use in the rAAV genomes and rAAV vectors described herein are disclosed in U.S. Patent No. 7,071,172, and Provisional Application No. 62 / 937,556, filed November 19, 2019, Table 3, or International Application WO2021102107, which is incorporated herein by reference in its entirety. Exemplary fibronectin signal peptide sequences include, but are not limited to, those listed in Table 1 of U.S. Patent No. 7,071,172, which is incorporated herein by reference in its entirety.

[0206] Table 2: Exemplary fibronectin (FN1) secretory signal peptides [Table 2]

[0207] Peptidase cleavage site

[0208] In some embodiments, one or more exogenous peptidase cleavage sites may be inserted into the signal peptide-GAA polypeptide, for example, between the signal peptide and the GAA polypeptide. In certain embodiments, an autoprotease (e.g., foot-and-mouth disease virus 2A autoprotease) is inserted between the signal peptide and the GAA polypeptide. In other embodiments, a protease recognition site that can be controlled by the addition of an exogenous protease is used (e.g., a Lys-Arg recognition site for trypsin, a Lys-Arg recognition site for Aspergillus KEX2-like protease, a recognition site for a metalloprotease, a recognition site for a serine protease, etc.). Modifications of GAA polypeptides that delete or inactivate native protease sites are disclosed in U.S. Provisional Application No. 62,937,556, filed November 19, 2019, and International Application WO2021102107, both of which are incorporated herein by reference. D. Spacer and Fusion Junction of the GAA Polypeptide

[0209] When GAA is expressed with a heterologous signal peptide, the signal peptide can be fused directly to the GAA polypeptide or separated from the GAA polypeptide by a linker. An amino acid linker (also referred to herein as a "spacer") incorporates one or more amino acids other than those that appear at that position in the native protein. Spacers generally can be designed to be flexible or to insert a structure such as an a-helix between two protein moieties.

[0210] Thus, in some embodiments of the methods and compositions disclosed herein, the recombinant AAV vector comprises a heterologous nucleic acid sequence encoding a GAA polypeptide, and the GAA protein further comprises a spacer comprising a nucleotide sequence at least one amino acid in length positioned at the N-terminus of the GAA polypeptide.

[0211] In one embodiment, the spacer is at least 50% identical to the sequence GGGTVGDDDDK.

[0212] In some embodiments, the spacer or linker can be relatively short, e.g., at least 1, 2, 3, 4, or 5 amino acids, e.g., the sequence Gly-Ala-Pro or Gly-Gly-Gly-Gly-Gly-Pro, or can be longer, e.g., 5 to 10 amino acids in length, or 10 to 25 amino acids in length. For example, flexible repeat linkers of 3 to 4 copies of the sequence (e.g., GGGGS) and a-helical repeat linkers of 2 to 5 copies of the sequence (e.g., EAAAK) have been described (Arai et al. (2004) Proteins: Structure, Function and Bioinformatics 57:829-838). In some embodiments, a linker comprising GGGTVGDDDDK is also encompassed for use. Linkers incorporating the a-helical portion of a human serum protein can be used to minimize the immunogenicity of the linker region. In some embodiments, the spacer is encoded by the nucleic acid GCGCGCCCG, which encodes an amino acid spacer comprising the amino acids GAP or Gly-Ala-Pro.

[0213] The site of the fusion junction in the GAA polypeptide for fusing to either of the signal peptides should be carefully selected to promote proper folding and activity of each polypeptide in the fusion protein and to prevent premature separation of the signal peptide from the GAA polypeptide.

[0214] In some embodiments, the spacer has a helical structure. In another specific embodiment, the spacer is at least 50% identical to the sequence GGGTVGDDDDK.

[0215] In some embodiments, the signal peptide may be fused directly or via a spacer to an amino acid of a GAA polypeptide disclosed in Table 1 herein, which enables expression of a GAA polypeptide or an N-terminally truncated GAA polypeptide and proper secretion of the GAA polypeptide, as described herein in the Examples.

[0216] To facilitate folding of the signal peptide, the GAA amino acid residue adjacent to the fusion junction can be modified. For example, because the GAA cysteine ​​residue can interfere with proper folding of the signal peptide, the terminal GAA cysteine ​​952 can be deleted or replaced with serine to accommodate a C-terminal signal peptide. The signal peptide can also be fused just before the final Cys952. In conjunction with the mutation of the final Cys952 to serine, the penultimate Cys938 can be changed to proline. F. Liver-specific promoter (LSP)

[0217] In some embodiments, to achieve an appropriate level of GAA expression, the rAAV genotype comprises a liver-specific promoter (LSP). The LSP allows the expression of an operably linked gene in the liver, and in some embodiments, may be an inducible LSP. In some embodiments, the LSP is located 5' upstream and operably linked to the heterologous nucleic acid sequence encoding the GAA protein.

[0218] Exemplary liver-specific promoters useful in AAV for treating Pompe according to the methods disclosed herein are disclosed in International Patent Applications WO2020102645 and WO2021102107, which are incorporated by reference in their entireties.

[0219] In some embodiments, any of the liver-specific promoters disclosed in WO2020102645 and WO2021102107 with improved LSPs are encompassed herein. For example, a liver-specific promoter useful in the rAAV vectors disclosed herein is any of the LSPs disclosed in WO2020102645 and WO2021102107 that has been modified so as to replace, in any of the LSP sequences of WO2021102107, the sequence of SEQ ID NO:450 (corresponding to SEQ ID NO:126 of WO2021102107, or referred to as the CRE0052 or LVR_CRE_0052_G6PC sequence) with a sequence selected from SEQ ID NO:40 or 41, or a sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% nucleotide sequence identity thereto. Using the SP131A1 (or LVR131_A1) promoter disclosed as SEQ ID NO: 94 in WO2021102107 as an exemplary promoter, in the present application, the promoter has been modified to replace SEQ ID NO: 450 (corresponding to SEQ ID NO: 126 in WO2021102107) with SEQ ID NO: 40 or 41, or a sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% nucleotide sequence identity thereto. Any promoter disclosed in WO2021102107 is encompassed for use herein, and where a promoter comprises SEQ ID NO: 450 (corresponding to SEQ ID NO: 126 in WO2021102107), this can be replaced with SEQ ID NO: 40 or 41, or a sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% nucleotide sequence identity thereto.

[0220] In some embodiments, the promoter is the LP1 promoter (SEQ ID NO: 432) or a variant having at least a sequence of at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto.

[0221] In some embodiments of the methods for treating Pompe disease disclosed herein, the synthetic liver-specific promoter useful in the AAV vector is any LSP promoter selected from SEQ ID NOs: 86, 88, 91-96, 146-150, 439-441 disclosed herein, or SEQ ID NOs: 270-341 or 342-430 disclosed herein, or SEQ ID NO: 431 in International Application WO2021102107, which is capable of driving liver-specific transgene expression. or any LSP selected from the synthetic liver-specific promoters disclosed in Table 4 of International Application WO2021102107, the entire contents of which are incorporated herein by reference.

[0222] In some embodiments, the synthetic liver-specific promoter is selected from any of SEQ ID NOs: 86, 88, 91-96, 146-150, or 270-430 disclosed herein, or a nucleic acid sequence that is at least 80%, or at least 90%, or 95% identical thereto or to a source regulatory nucleic acid sequence.

[0223] In some embodiments, the liver-specific promoter (LSP) in an AAV expressing a GAA polypeptide disclosed herein and useful in the methods for treating Pompe disease disclosed herein is selected from the group consisting of SEQ ID NO:86 (CRM 0412), SEQ ID NO:91 (SP0412), or SEQ ID NO:92 (SP0422), SEQ ID NO:93 (SP0239), SEQ ID NO:94 (SP0265), SEQ ID NO:95 (SP0240), or SEQ ID NO:96 (SP0246), or SEQ ID NO:146 (SP0265-UTR), SEQ ID NO:147 (SP0239-UTR), SEQ ID NO:148 (SP0240-UTR), SEQ ID NO:149 (SP0246-UTR), or SEQ ID NO:150 (SP0131-A1-UTR), as disclosed herein. TR), SEQ ID NO: 439 (LVR_0243), SEQ ID NO: 440 (LVR_0412) and SEQ ID NO: 441 (A1 promoter), or a functional fragment or variant of any LSP selected from SEQ ID NOs: 270-341 or 342-430, or a functional fragment or variant thereof of SEQ ID NOs: 86, 88, 91-96, or 146-150, 439-441, or 270-430.

[0224] In some embodiments of the methods for treating Pompe disease disclosed herein, the synthetic liver-specific promoter is selected from the group consisting of SEQ ID NO:86 (CRM 0412), SEQ ID NO:91 (SP0412), or SEQ ID NO:92 (SP0422), SEQ ID NO:93 (SP0239), SEQ ID NO:94 (SP0265), SEQ ID NO:95 (SP0240), or SEQ ID NO:96 (SP0246), or SEQ ID NO:146 (SP0265-UTR), SEQ ID NO:147 (SP0239-UTR), SEQ ID NO:148 (SP0240-UTR), SEQ ID NO:149 (SP0246-UTR), or SEQ ID NO:150 (SP0131-A1-UTR), SEQ ID NO:439 (LVR_0243), SEQ ID NO:440 (LVR_0412), and SEQ ID NO: A synthetic liver-specific promoter selected from any LSP promoter selected from sequence number 441 (A1 promoter), or any LSP selected from SEQ ID NOs: 270-341 or 342-430 disclosed herein, can drive liver-specific transgene expression and has activity in liver cells that is at least 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350% or 400% of the activity of the TBG promoter of SEQ ID NO: 435.

[0225] In some embodiments of the methods for treating Pompe disease disclosed herein, the synthetic liver-specific promoter is selected from any LSP promoter selected from any of SEQ ID NO:97, SEQ ID NO:98, or SEQ ID NO:99, or a variant having at least a sequence of at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% nucleotide sequence identity thereto. In some embodiments of the methods for treating Pompe disease disclosed herein, the synthetic liver-specific promoter is selected from any LSP promoter selected from SEQ ID NO:97, SEQ ID NO:98, or SEQ ID NO:99, or a variant having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% nucleotide sequence identity thereto, wherein the synthetic liver-specific promoter is capable of driving liver-specific transgene expression and has activity in liver cells that is at least 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350%, or 400% of the activity of the TBG promoter of SEQ ID NO:435.

[0226] In some embodiments, to achieve an appropriate level of GAA expression, the rAAV genotype includes a liver-specific promoter (LSP). The LSP enables expression of an operably linked gene in the liver and, in some embodiments, may be an inducible LSP. In embodiments, the LSP is located 5' upstream and operably linked to a heterologous nucleic acid sequence encoding a GAA protein. Exemplary liver-specific promoters are disclosed herein, including, for example, the M3 liver-specific promoter comprising the sequence of SEQ ID NO:99 or a functional variant thereof having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more of SEQ ID NO:99.

[0227] In one embodiment, the liver promoter is a promoter that has some expression in the liver. In one embodiment, the promoter that has some expression in the liver is an M2 liver promoter comprising the sequence of SEQ ID NO: 98 or a functional variant thereof that has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more of SEQ ID NO: 98.

[0228] In some embodiments, the synthetic liver-specific promoter comprises a nucleic acid sequence that is at least 50%, preferably 60%, 70%, 80%, 90%, or 95% identical to SEQ ID NO:99, or a source regulatory nucleic acid sequence. In some embodiments, the synthetic liver-specific promoter comprises a nucleic acid sequence that is at least 80%, or at least 90% or 95% identical to SEQ ID NO:99, or nucleotides 1-26 of SEQ ID NO:99.

[0229] In some embodiments, a synthetic liver-specific promoter that is at least 50%, 60%, 70%, 80%, 90%, or 95% identical to SEQ ID NO: 99 comprises a nucleic acid sequence in which 2%, 1%, or fewer of the nucleotides of SEQ ID NO: 99 are altered. In some embodiments, a synthetic liver-specific promoter useful in the methods and compositions disclosed herein is the same length as, or substantially unaltered from, SEQ ID NO: 99, or is 1, 2, 3, 4, 5, or 6 nucleotides longer or 1, 2, 3, 4, 5, or 6 nucleotides shorter than the length of SEQ ID NO: 99. In some embodiments, no nucleotides are deleted when compared to SEQ ID NO: 99. In some embodiments, no nucleotides are inserted when compared to SEQ ID NO: 99. In some embodiments, all modifications made to SEQ ID NO: 99 are nucleotide substitutions.

[0230] In some embodiments, the synthetic liver-specific promoter that is at least 50%, 60%, 70%, 80%, 90% or 95% identical to SEQ ID NO: 99 comprises a source regulatory nucleic acid sequence that is active in the liver and the second type of cell or tissue is muscle; or a source regulatory nucleic acid sequence that is active in the liver and the second type of cell or tissue is the CNS; or a source regulatory nucleic acid sequence that is active in muscle and the second type of cell or tissue is the liver; or a source regulatory nucleic acid sequence that is active in muscle and the second type of cell or tissue is the CNS.

[0231] In some embodiments, a liver-specific promoter that is a functional variant of a given promoter element preferably retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and even more preferably 100% of its activity (compared to a reference promoter that comprises an unmodified promoter element). Suitable assays for assessing the activity of liver-specific promoters are disclosed in Examples 12 and 13 of International Application WO2021102107, the entire contents of which are incorporated herein by reference.

[0232] In some embodiments, the liver-specific promoter includes, but is not limited to, transthyretin promoter (TTR), LSP promoter (LSP), and synthetic liver-specific promoter.For example, in some embodiments of the methods and compositions disclosed herein, the promoter is a liver-specific promoter (LSP), and can be selected from any liver-specific promoter, including, but not limited to, transthyretin promoter (TTR), for example, the liver-specific promoter (LSP) (TTR promoter) disclosed in No. 5,863,541, or LSP promoter (PNAS; 96: 3906-3910, 1999. For example, see p. 3906, Materials and Methods, rAAV construction), and synthetic liver promoter, and these references are incorporated herein by reference in their entirety.Other liver promoters, such as synthetic liver promoters, can be used.

[0233] In some embodiments, the TTR promoter is a truncated TTR promoter, such as a truncated TTR promoter comprising at least the sequence of SEQ ID NO: 431 or SEQ ID NO: 12, as disclosed in International Publication No. WO2020102645, herein incorporated by reference in its entirety, or a variant having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% nucleotide sequence identity thereto. In some embodiments, the LSP is a TBG promoter, such as a TBG promoter comprising at least the sequence of SEQ ID NO: 435, or a variant having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% nucleotide sequence identity thereto.

[0234] Other liver-specific promoters include, but are not limited to, promoters for LDL receptor, factor VIII, factor IX, phenylalanine hydroxylase (PAH), ornithine transcarbamylase (OTC), and α-antitrypsin (hAAT), as well as the HCB promoter. Other liver-specific promoters include the AFP (alpha fetal protein) gene promoter and albumin gene promoter disclosed in EP Patent Publication No. 0 415 731, the α-1 antitrypsin gene promoter disclosed in Rettenger, Proc. Natl. Acad. Sci. 91 (1994) 1460-1464, the fibrinogen gene promoter, the APO-A1 (apolipoprotein A1) gene promoter, and promoter genes for liver transferase enzymes such as SGOT, SGPT, and g-glutamyltransferase. See also PCT Patent Publication No. 2001 / 0051611, and PCT Patent Publications WO90 / 07936 and WO91 / 02805, which are incorporated by reference in their entirety. In some embodiments, the liver-specific promoter is a recombinant liver-specific promoter, such as the recombinant liver-specific promoter disclosed in US20170326256A1, which is incorporated by reference in its entirety.

[0235] In some embodiments, the liver-specific promoter is a hepatitis B X gene promoter and a hepatitis B core protein promoter. In some embodiments, liver-specific promoters can be used with their respective enhancers. The enhancer element can be linked to either the 5' or 3' end of the nucleic acid encoding the GAA polypeptide. The hepatitis B X gene promoter and its enhancer can be obtained from the viral genome as a 332-base pair EcoRV-NcoI DNA fragment using the method described by Twu, J Virol. 61 (1987) 3448-3453. The hepatitis B core protein promoter can be obtained from the viral genome as a 584-base pair BamHI-Bglll DNA fragment using the method described by Gerlach, Virol 189 (1992) 59-66. It may be necessary to remove the negative regulatory sequence in the BamHI-Bglll fragment before inserting it.

[0236] It is assumed that the liver-specific promoter used for expressing GAA polypeptide is selected in combination with or in conjunction with the selection of signal sequence.In particular, without being bound by theory, when a strong liver-specific promoter is selected, the signal sequence should be selected to be sufficient to make the expressed GAA secrete out of cells, in order to avoid GAA accumulation in cells and any associated cytotoxicity, and / or to avoid the generation of anti-GAA antibody.

[0237] The LSP is selected in conjunction with a signal sequence, so that the strength of the liver-specific promoter (LSP) operably linked to the nucleic acid encoding the GAA polypeptide can be offset by the ability of the cell to secrete the expressed GAA protein. Therefore, if the liver-specific promoter is strong, the specific signal sequence must be sufficiently effective so that the expressed GAA can be secreted from the cell, so that the GAA does not accumulate, produce cytotoxicity, and / or induce an immune response. Therefore, the cellular secretory pathway and the selected signal sequence must be able to match the level of GAA expressed by AAV, and the level of GAA expression depends on both the AAV transduction efficiency (determined by AAV dose and capsid) and the strength of the liver-specific promoter. G. UTR, regulatory and intron sequences

[0238] In some embodiments, the liver-specific promoter described above is operably linked to one or more additional regulatory sequences.For example, the additional regulatory sequence can enhance expression compared with the liver-specific promoter that is not operably linked to the additional regulatory sequence.Generally, it is preferred that the additional regulatory sequence does not substantially reduce the specificity of the liver-specific promoter.

[0239] For example, a liver-specific promoter can be operably linked to a sequence encoding a UTR (e.g., 5' and / or 3' UTR), an intron, a UTR (e.g., 5' or 3') plus an intron, etc. In some embodiments, a liver-specific promoter is operably linked to a sequence encoding a UTR, for example, a 5' UTR. The 5' UTR can contain various elements that can regulate gene expression. The 5' UTR in a native gene begins at the transcription start site and ends one nucleotide before the start codon of the coding region. It should be noted that the 5' UTR referred to herein can be the entire naturally occurring 5' UTR or a portion of a naturally occurring 5' UTR. The 5' UTR can also be partially or entirely synthetic. In eukaryotes, 5' UTRs have a median length of approximately 150 nt, but in some cases, they can be significantly longer. Regulatory sequences that can be found in 5' UTRs are disclosed in International Application WO2021102107, the entire contents of which are incorporated herein by reference.

[0240] In some embodiments, the 5-UTR sequence is located 3' of a liver-specific promoter disclosed herein and 5' of a heterologous nucleic acid sequence (eg, encoding a signal peptide and a GAA polypeptide).

[0241] In one embodiment, an exemplary 5-UTR sequence includes, for example, the 24 bp sequence of SEQ ID NO:41, or a functional variant having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more of SEQ ID NO:41.

[0242] In one embodiment, an exemplary 5-UTR sequence comprising SEQ ID NO:41 is the sequence of SEQ ID NO:40 or a functional variant having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more of SEQ ID NO:40.

[0243] In some embodiments, the 5-UTR sequence comprises a nucleic acid sequence that is at least 50%, preferably 60%, 70%, 80%, 90%, or 95% identical to SEQ ID NO:41 or SEQ ID NO:40, or a source regulatory nucleic acid sequence. In some embodiments, the 5-UTR sequence comprises SEQ ID NO:41 or SEQ ID NO:40, or a nucleic acid sequence that is at least 80%, or at least 90%, or 95% identical to the nucleotides of SEQ ID NO:41 or SEQ ID NO:40.

[0244] In some embodiments, a 5-UTR that is at least 50%, 60%, 70%, 80%, 90%, or 95% identical to SEQ ID NO: 41 or SEQ ID NO: 40 comprises a nucleic acid sequence in which 2%, 1%, or fewer of the nucleotides of SEQ ID NO: 41 or SEQ ID NO: 40 are altered. In some embodiments, a 5-UTR sequence useful in the methods and compositions disclosed herein is the same length as, or substantially unaltered from, SEQ ID NO: 41 or SEQ ID NO: 40, or is 1, 2, 3, 4, 5, or 6 nucleotides longer or 1, 2, 3, 4, 5, or 6 nucleotides shorter than the length of SEQ ID NO: 41 or SEQ ID NO: 40.

[0245] The intron in the 5'UTR is included for regulating gene expression and mRNA export. In some embodiments, the liver-specific promoter described above is operably linked to the sequence encoding the 5'UTR derived from the main immediate early gene of CMV (CMV-IE gene). For example, the 5'UTR derived from the CMV-IE gene preferably comprises CMV-IE gene exon 1 and CMV-IE gene exon 1, or a portion thereof. In some cases, the promoter element may be modified in consideration of the linkage to the 5'UTR, for example, the sequence downstream of the transcription start site (TSS) in the promoter element may be removed (for example, replaced with 5'UTR).

[0246] The CMV-IE 5'UTR is described in Simari, et al., Molecular Medicine 4: 700-706, 1998, "Requirements for Enhanced Transgene Expression by Untranslated Sequences from the Human Cytomegalovirus Immediate-Early Gene," which is incorporated herein by reference. Variants of the CMV-IE 5'UTR sequence discussed in Simari, et al. are also set forth in WO2002 / 031137, which is incorporated herein by reference, and the regulatory sequences disclosed therein can also be used. Other UTRs that can be used in combination with promoters are known in the art, for example, in Leppek, K., Das, R. & Bama, M., "Functional 5' UTR mRNA structures in eukaryotic translation regulation and how to find them," Nat Rev Mol Cell Biol 19, 158-174 (2018), which is incorporated herein by reference.

[0247] In some embodiments, the sequence encoding the 5'UTR comprises SEQ ID NO: 145 disclosed herein, or a functional variant thereof. In some embodiments, a functional variant may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto. SEQ ID NO: 145 disclosed herein encodes the CMV-IE 5'UTR.

[0248] In some embodiments, the sequence encoding the 5'UTR comprises SEQ ID NO:446 disclosed herein, or a functional variant thereof. In some embodiments, the functional variant may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto. SEQ ID NO:446 disclosed herein is a modified CMV-IE intron sequence.

[0249] In some embodiments, the 5' UTR contains a nucleic acid motif that functions as a protein translation initiation site, e.g., a sequence that defines a Kozak sequence in the produced mRNA. For example, in some embodiments, the sequence encoding the 5' UTR contains the sequence motif GCCACC at or near its 3' end. Other Kozak sequences or other protein translation initiation sites can be used, as known in the art (e.g., Marilyn Kozak, "Point Mutations Define a Sequence Flanking the AUG Initiator Codon That Modulates Translation by Eukaryotic Ribosomes," Cell, Vol. 44, 283-292, January 31, 1986; Marilyn Kozak, "At Least Six Nucleotides Preceding the AUG Initiator Codon Enhance Translation in Mammalian Cells," J. Mol. Rid. (1987) 196, 947-950; Marilyn Kozak, "An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs," Nucleic Acids Research, Vol. 15 (20) 1987, all of which are incorporated herein by reference). A protein translation initiation site (eg, a Kozak sequence) is preferably placed immediately adjacent to the start codon.

[0250] In some embodiments, the sequence encoding the 5'UTR comprises SEQ ID NO:438, as disclosed herein, or a functional variant thereof. In some embodiments, the functional variant may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto. The 5'UTR contains the 6 nucleotides GCCACC that define a Kozak sequence at the 3' end of the CMV-IE 5'UTR.

[0251] In some embodiments, the rAAV expressing GAA for use in the methods for treating Pompe disclosed herein comprises an intron sequence located 3' of the promoter sequence and 5' of the heterologous nucleic acid (i.e., 5' of the nucleic acid encoding the signal peptide and GAA polypeptide). The intron sequence functions to increase one or more of mRNA stability, mRNA transport from the nucleus, and / or expression and / or regulation of the expressed GAA polypeptide. In an alternative embodiment, the rAAV genotype does not comprise an intron sequence.

[0252] In one embodiment, the UTR sequences described herein can be used as the 3'UTR.

[0253] The synthetic liver-specific promoters of the present invention can be operably linked to sequences encoding UTRs (e.g., 5' and / or 3' UTRs), introns, and the like. In some embodiments, the synthetic liver-specific promoters described herein are operably linked to sequences encoding 5' UTRs and introns. In some embodiments, the 5' UTRs and introns are derived from the CMV major immediate-early gene (CMV-IE gene). The CMV-IE 5' UTR and intron are described in Simari, et al., Molecular Medicine 4: 700-706, 1998, "Requirements for Enhanced Transgene Expression by Untranslated Sequences from the Human Cytomegalovirus Immediate-Early Gene," which is incorporated herein by reference. Variants of the CMV-IE 5' UTR and intron sequences discussed in Simari, et al. are also described in WO2002 / 031137, which is incorporated herein by reference, and the regulatory sequences disclosed therein can also be used. In some embodiments, the 5' UTR or the 5' UTR and intron suitably comprises a nucleic acid motif that functions as a protein translation initiation site, e.g., a sequence that defines a Kozak sequence in the produced mRNA. For example, in some embodiments, the sequence encoding the 5' UTR comprises the sequence motif GCCACC at or near its 3' end.Other Kozak sequences or other protein translation initiation sites can be used, as known in the art (e.g., Marilyn Kozak, "Point Mutations Define a Sequence Flanking the AUG Initiator Codon That Modulates Translation by Eukaryotic Ribosomes," Cell, Vol. 44, 283-292, January 31, 1986; Marilyn Kozak, "At Least Six Nucleotides Preceding the AUG Initiator Codon Enhance Translation in Mammalian Cells," J. Mol. Rid. (1987) 196, 947-950; Marilyn Kozak, "An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs," Nucleic Acids Research, Vol. 15 (20) 1987, all of which are incorporated herein by reference). A protein translation initiation site (eg, a Kozak sequence) is preferably placed immediately adjacent to the start codon.

[0254] In some embodiments, any one of the promoters described herein, or variants thereof, is linked to a sequence encoding a 5'UTR and / or a 5'UTR and an intron to provide a composite promoter. Such a composite promoter may be referred to herein simply as a "composite promoter," or in some cases, for brevity, simply as a "promoter."

[0255] In some embodiments, the intron sequence is an MVM intron sequence, such as, but not limited to, the intron sequence of SEQ ID NO: 442, or a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% nucleotide sequence identity thereto.

[0256] In some embodiments, the intron sequence is an HBB2 intron sequence, such as, but not limited to, the intron sequence of SEQ ID NO: 443 or SEQ ID NO: 444, or a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% nucleotide sequence identity thereto.

[0257] In some embodiments of the methods and compositions disclosed herein, the recombinant AAV vector comprises a heterologous nucleic acid sequence further comprising an intron sequence located 5' to a sequence encoding a secretory signal peptide and 3' to the promoter. In some embodiments, the intron sequence comprises an MVM sequence or an HBB2 sequence, wherein the MVM sequence comprises the nucleic acid sequence of SEQ ID NO:442 or a nucleic acid sequence with at least about 75%, 80%, 85%, 90%, 95%, 98%, or 99% sequence identity to SEQ ID NO:442, and the HBB2 sequence comprises the nucleic acid sequence of SEQ ID NO:443 or SEQ ID NO:444 or a nucleic acid sequence with at least about 75%, 80%, 85%, 90%, 95%, 98%, or 99% sequence identity to SEQ ID NO:443 or SEQ ID NO:444.

[0258] In some embodiments, the intron sequence is a ubiquitin C (UBC) intron sequence, such as intron 1 from the UBC gene, or a portion thereof, such as that disclosed in Bianchi et al, 2009, Gene, 448(1);88-101, wherein the intron 1 sequence of the UBC gene is 812 bp and starts at chromosomal position 124,914,586 and ends at 124,913,775. In some embodiments, the intron sequence is a UBC intron, such as, but not limited to, the intron sequence of SEQ ID NO:445, or a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% nucleotide sequence identity to SEQ ID NO:445.

[0259] In some embodiments, the rAAV genotype comprises an intron sequence selected from the group consisting of a human beta globin b2 (or HBB2) intron, a FIX intron, a chicken beta globin intron, a CMVIE intron, a UBC intron, an HBB intron sequence, an MVM sequence, and an SV40 intron. In some embodiments, the intron is intron 1 from human RNA pol II. In some embodiments, the intron is optionally a modified HBB2 intron (e.g., see SEQ ID NO: 17 in WO2018046774A1), a modified FIX intron (e.g., see SEQ ID NO: 19 in WO2018046774A1), or a modified chicken beta globin intron (e.g., see SEQ ID NO: 21 in WO2018046774A1), or a modified intron such as the modified HBB2 or FIX introns disclosed in WO2015 / 162302, the entire contents of which are incorporated herein by reference. H. PolyA Sequence and Terminator Sequence

[0260] In some embodiments, the rAAV vector genome comprises at least one polyA tail located 3' and downstream of the heterologous nucleic acid gene encoding the GAA polypeptide. Any polyA sequence can be used, including, but not limited to, hGH polyA, BGH polyA, SV40 polyA, synpA polyA, etc. In some embodiments, the polyA is a synthetic polyA sequence. In some embodiments, the rAAV vector genome comprises two polyA tails, for example, an hGH polyA sequence and another polyA sequence, with a spacer nucleic acid sequence located between the two polyA sequences.

[0261] In some embodiments, the polyA signal is 3' of the heterologous nucleic acid sequence encoding the GAA polypeptide. In some embodiments, the rAAV genome comprises a first polyA sequence and a reverse RNA polymerase II terminator sequence (rev RNA Pol II terminator sequence) 3' of the nucleic acid encoding the GAA polypeptide, and a 3' ITR. Non-limiting examples of the first polyA are hGH polyA, BGH polyA, SV40 polyA, or any functional fragment thereof in a 5' to 3' direction. Non-limiting examples of the reverse RNA polymerase II terminator sequence are hGH polyA, BGH polyA, SV40 polyA, or any functional fragment thereof in a 3' to 5' direction.

[0262] In some embodiments, the rAAV genome includes a nucleic acid 3' encoding a GAA polypeptide, a first polyA sequence, a spacer nucleic acid sequence (e.g., 100 to 400 bp, or about 100 to 250 bp, or about 250 to 400 bp), a second polyA sequence, a spacer nucleic acid sequence, and a 3' ITR.

[0263] In some embodiments, the first and / or second poly A sequence is an hGH poly A sequence, and in some embodiments, the first and second poly A sequences are synthetic poly A sequences. In some embodiments, the first poly A sequence is an hGH poly A sequence and the second poly A sequence is a synthetic sequence, or vice versa, i.e., in alternative embodiments, the first poly A sequence is a synthetic poly A sequence and the second poly A sequence is an hGH poly A sequence.

[0264] In some embodiments, the polyA sequence is selected from any of SEQ ID NO:42, SEQ ID NO:43, or SEQ ID NO:44, wherein SEQ ID NO:44 comprises the signal AATAAA, or a polyA nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% nucleotide sequence identity to any of SEQ ID NOs:42, 43, or 44.

[0265] In some embodiments, the polyA sequence is selected from either SEQ ID NO:46 or SEQ ID NO:47, or a polyA nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity to either SEQ ID NO:46 or 47.

[0266] In some embodiments, the polyA sequence is, for example, SEQ ID NO: 15 (hGH polyA sequence) disclosed in International Application WO2021102107, or a polyA nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% nucleotide sequence identity to SEQ ID NO: 15 disclosed in International Application WO2021102107. In some embodiments, hGH polyA sequences encompassed for use are those described in Anderson et al. J. Biol. Chem 264(14); 8222-8229, 1989 (see, e.g., page 8223, column 2, paragraph 1), which is incorporated herein by reference in its entirety.

[0267] In one embodiment, the recombinant AAV disclosed herein comprises a transcription terminator signal sequence or transcription pause signal sequence in reverse orientation between the polyA and the 3' ITR in its genome. In one embodiment, the recombinant AAV disclosed herein comprises a transcription terminator signal sequence or transcription pause signal sequence in 3'-5' orientation between the polyA and the 3' ITR in its genome. Any transcription termination signal can be used, including, for example, an inverted natural polyA sequence from any species, or a synthetic polyA signal or fragment thereof, or other nucleic acid structure terminators known in the art. Exemplary polyA signals and / or transcription terminators include, but are not limited to, RNA polymerase II transcription pause signals from BGH, SV40, HGH, beta globin, and alpha2 globin genes, polyA signals of transcription termination signals for pol III, or fragments thereof, and any combination thereof.

[0268] In some embodiments, the transcription terminator signal sequence is a reverse RNA polymerase II terminator sequence that is SEQ ID NO:45 in the 5' to 3' direction, or a rev RNA PolII terminator sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% nucleotide sequence identity to either SEQ ID NO:45, wherein SEQ ID NO:45 in the 5' to 3' direction is located between the 3' of the polyA sequence and the 5' of the right ITR sequence (or 3' ITR).

[0269] The transcription terminator signal or reverse RNA polymerase II terminator sequence described herein is also interchangeably referred to as "reverse polyA," which refers to a polyA signal sequence located downstream of the nucleic acid encoding GAA and upstream of the 3' ITR in a 3'-5' orientation. Any natural or synthetic polyA in a 3'-5' orientation can be used as the reverse polyA. In some embodiments, the reverse polyA is the polyA (pA) described in International Publication No. WO2019143950 and U.S. Application Publication No. US20200340013, the entire contents of which are incorporated herein by reference.

[0270] For clarity, the terms "reverse poly A," "double-stranded RNA termination element," and "reverse RNA polymerase II terminator sequence" are used interchangeably herein. In the 3' to 5' direction, the reverse poly A or termination element disables transcription from the 3' ITR, so that double-stranded RNA is not transcribed from the 3' ITR. The reverse poly A or double-stranded RNA termination element can be heterologous, for example, from a different gene, for example, a gene other than the gene of interest, or a gene homologous to, for example, the same gene as, the gene of interest. In various embodiments, the poly A signal comprises a double-stranded RNA transcription element or a reverse poly A. For example, the poly A signal of some aspects of the invention described herein comprises a full-length poly A signal in the 5' to 3' direction and another poly A signal in the 3' to 5' direction. In some embodiments, the 5' end of the double-stranded RNA termination element or inverted polyA sequence and the 3' end of the polyA signal are immediately adjacent, or at least 1 nucleotide apart, or at least 2 nucleotides apart, or at least 3 nucleotides apart, or at least 4 nucleotides apart, or at least 5 nucleotides apart, or at least 6 nucleotides apart, or at least 7 nucleotides apart, or at least 8 nucleotides apart, or at least 9 nucleotides apart, or at least 10 nucleotides apart, or more. In some embodiments, the polyA signal does not comprise a double-stranded RNA transcription element or an inverted polyA. In some embodiments, the polyA signal comprises AATAAA (SEQ ID NO: 467) or AAUAAA (SEQ ID NO: 468). In some embodiments, the polyA signal comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or more repeats of AATAAA (SEQ ID NO: 467) or AAUAAA (SEQ ID NO: 468).In some embodiments, the poly A signal comprises a transcription termination signal for Pol III described in "Delineation of the Exact Transcription Termination Signal for Type 3 Polymerase III. Mol Ther Nucleic Acids. 2018 Mar 2;10:36-44, which is incorporated by reference in its entirety. In some embodiments, one or more transcription termination signals for Pol III are in a 3' to 5' orientation. In some embodiments, the poly A signal comprises TTTT. In some embodiments, the poly A signal comprises AAAAAAA (SEQ ID NO: 469). Poly A sequences are described in "Definition of an efficient synthetic poly(A) site" Genes Dev. 1989 Jul;3(7):1019-25. doi: 10.1101 / gad.3.7.1019., which is incorporated by reference in its entirety. All of the above poly A sequences and / or terminator sequences described herein can be used as inverted sequences, e.g., in a 3' to 5' orientation.

[0271] In some embodiments of the invention described herein, the polyA sequence comprises a polyA sequence and a terminator sequence, for example, the polyA sequence comprises an hGH polyA sequence and a Pol III terminator sequence. In various embodiments of the invention, the polyA sequence and the Pol III terminator sequence are interchangeably referred to as "polyA." In some embodiments of the invention described herein, the polyA sequence further comprises an inverted RNA polymerase II terminator sequence, or an RNA polymerase II transcription pause signal sequence, or an inverted polyA. An example of an inverted RNA polymerase II terminator sequence, or an RNA polymerase II transcription pause signal sequence, or an inverted polyA, without any limitation, is the 3' sequence of the human hemoglobin alpha gene.

[0272] In some embodiments, the polyA tail may be engineered to stabilize RNA transcripts transcribed from the rAAV vector genome, including transcripts for heterologous genes, which in one embodiment are GAA; in alternative embodiments, the polyA tail may be engineered to contain destabilizing elements.

[0273] In one embodiment, the polyA is a bidirectional polyA sequence. Bidirectional polyA sequences are commonly isolated from viral DNA, for example, SV40 polyA is a bidirectional polyA.

[0274] In some embodiments of the methods for treating Pompe disease disclosed herein, the recombinant AAV vector comprises at least one polyA sequence located 3' of the nucleic acid encoding the GAA gene and 5' of the 3' ITR sequence. In some embodiments, the polyA is a full-length polyA (fl-polyA) sequence. In some embodiments, the polyA is a truncated polyA sequence as disclosed in International Publication No. WO2021102107, the entire contents of which are incorporated herein.

[0275] In embodiments, the polyA tail may be engineered to be an instability element by altering the length of the polyA tail. In embodiments, the polyA tail may be made longer or shorter.

[0276] In some embodiments, there is a 3' untranslated region (3'UTR) located between the heterologous gene encoding the GAA polypeptide and the polyA tail. In some embodiments, there is a 3'UTR located 3' of the nucleic acid encoding the GAA polypeptide. In some embodiments, the 3' untranslated region (3'UTR) comprises the GAA 3'UTR (SEQ ID NO: 50) or 3'UTR (SEQ ID NO: 49) disclosed herein.

[0277] In another embodiment, the promoter region, or 3'UTR or polyA region, can contain unstable elements and is a target sequence for microRNA (miRNA), which has the ability to silence RNA transcription (repress transcription and promote degradation) when the miRNA binds to the miRNA target sequence. Thus, in some embodiments, adding or deleting a seed region within the 3'UTR or polyA tail can increase or decrease the expression of a protein such as a GAA polypeptide. In some embodiments, the miRNA target region is a synthetic miRNA target region that is targeted by an artificial miRNA (amiRNA) according to methods known in the art.

[0278] In another embodiment, the seed region can be engineered into the 3' untranslated region (3'UTR), located between the heterologous gene and the polyA tail. In a further embodiment, the destabilizing agent can be an siRNA. The coding region for the siRNA can be included in the rAAV vector genome and is generally located 3' downstream of the polyA tail.

[0279] In all aspects of the methods for treating Pompe disease disclosed herein, the rAAV genome may also include a stuffer DNA nucleic acid sequence. An exemplary stuffer DNA sequence is SEQ ID NO: 71, as disclosed in International Application WO2021102107, or a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% nucleotide sequence identity thereto. In some embodiments, the stuffer sequence is located, for example, 3' of the polyA tail and 5' of the 3' ITR sequence. In some embodiments, the stuffer DNA sequence includes a synthetic polyadenylation signal in reverse orientation.

[0280] In some embodiments, a stuffer nucleic acid sequence (also referred to as a "spacer" nucleic acid fragment) can be located between the polyA sequence and the 3' ITR (i.e., the stuffer nucleic acid sequence is located 3' of the polyA sequence and 5' of the 3' ITR). Such stuffer nucleic acid sequences can be about 30 bp, 50 bp, 75 bp, 100 bp, 150 bp, 200 bp, 250 bp, 300 bp, or greater than 300 bp. In some embodiments of the methods and compositions disclosed herein, the stuffer nucleic acid fragment is between 20-50 bp, 50-100 bp, 100-200 bp, 200-300 bp, 300-500 bp, or any integer between 20-500 bp. Exemplary stuffer (or spacer) nucleic acid sequences can be selected from any of SEQ ID NO: 16, SEQ ID NO: 71 or SEQ ID NO: 78 disclosed in International Application WO2021102107, or a nucleic acid sequence that is at least about 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% identical to SEQ ID NO: 16 or SEQ ID NO: 71 or SEQ ID NO: 78 disclosed in International Application WO2021102107. E.CS sequence

[0281] In some embodiments of the methods and compositions disclosed herein, the recombinant AAV vector comprises a heterologous nucleic acid sequence, which may further comprise a collagen stability (CS) sequence located 3' of the nucleic acid encoding the GAA polypeptide and 5' of the 3' ITR sequence. In some embodiments, the rAAV genome disclosed herein comprises a heterologous nucleic acid sequence, which may optionally comprise a collagen stability sequence (CS or CSS) located 3' of the nucleic acid encoding the GAA polypeptide and 5' of the nucleic acid encoding the polyA signal. In some embodiments, the CS sequence may be replaced by the 3' UTR sequence disclosed herein.

[0282] Exemplary collagen stabilization sequences include CCCAGCCCACTTTTCCCCAA, or a sequence with at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. Exemplary collagen stabilization sequences can have the amino acid sequence of PSPLFP, or an amino acid sequence with at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. CS sequences are disclosed in Holick and Liebhaber, Proc. Nat. Acad. Sci. 94: 2410-2414, 1997 (see, e.g., Figure 3, page 5205), which is incorporated herein by reference in its entirety. I.AAV ITR

[0283] The rAAV vectors or genomes disclosed herein for use in methods for treating Pompe disease can include AAV ITRs that have desirable characteristics and can be designed to modulate the activity of, and cellular responses to, vectors into which the ITRs are incorporated. In another embodiment, the AAV ITRs are synthetic AAV ITRs that have desirable characteristics and can be designed to manipulate the activity of, and cellular responses to, vectors containing one or two synthetic ITRs, as described in U.S. Patent No. 9,447,433, incorporated herein by reference.

[0284] In another embodiment, the ITR exhibits altered transcriptional activity compared to a naturally occurring ITR, such as ITR2 from AAV2. The ITR2 sequence is known to have promoter activity in nature. It also has termination activity essentially similar to a poly(A) sequence. The minimal functional ITR of the present invention exhibits transcriptional activity, albeit at a reduced level compared to ITR2, as shown in the Examples. Thus, in some embodiments, the ITR is transcriptionally functional. In other embodiments, the ITR is transcriptionally defective. In certain embodiments, the ITR can act as a transcriptional insulator, for example, preventing transcription of a transgenic cassette present in a vector when the vector is integrated into a host chromosome.

[0285] One aspect of the present invention relates to an rAAV vector genome comprising at least one synthetic AAV ITR, wherein the nucleotide sequence of one or more transcription factor binding sites in the ITR has been deleted and / or substituted compared to the sequence of a naturally occurring AAV ITR, such as ITR2. In some embodiments, it is a minimal functional ITR in which one or more transcription factor binding sites have been deleted and / or substituted. In some embodiments, at least one transcription factor binding site has been deleted and / or substituted, for example, at least five or more, or ten or more, transcription factor binding sites have been deleted and / or substituted, for example, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 transcription factor binding sites have been deleted and / or substituted.

[0286] In another embodiment, an rAAV vector comprising the rAAV vector genome described herein comprises a polynucleotide containing at least one synthetic AAV ITR, typically with one or more CpG islands (a cytosine base immediately followed by a guanine base (CpG), where cytosines in such arrangements tend to be methylated) deleted and / or substituted, occurring at or near the transcription start site in the ITR. In embodiments, deleting or reducing the number of CpG islands can reduce the immunogenicity of the rAAV vector. This is due to the reduced or complete inhibition of TLR-9 binding to the rAAV vector DNA sequence, which occurs at the CpG islands. It is also well known that methylation of CpG motifs leads to transcriptional silencing. Removal of CpG motifs in the ITR is expected to result in reduced TLR-9 recognition and / or reduced methylation, and therefore reduced transgene silencing. In some embodiments, it is a minimal functional ITR with one or more CpG islands deleted and / or replaced. In embodiments, AAV ITR2 is known to contain 16 CpG islands, one or more of which, or all 16 of which may be deleted.

[0287] In some embodiments, at least one CpG motif has been deleted and / or substituted, for example at least four or more, or eight or more CpG motifs, for example at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 CpG motifs.

[0288] In another embodiment, the synthetic ITR comprises, consists essentially of, or consists of one of the nucleotide sequences listed in Table 4. In other embodiments, the synthetic ITR comprises, consists essentially of, or consists of a nucleotide sequence that is at least 80% identical, e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical, to any one of the nucleotide sequences listed in Table 4. In some embodiments, the ITR is the sequence disclosed in Figure 1 of Samulski et al., 1983, Cell, 33; 135-143 (referring to "Samulski et al, 1983," which is incorporated herein by reference in its entirety), which discloses modified ITR sequences in Figure 1. In some embodiments, the ITR sequence comprises or consists of a nucleotide sequence that is at least 80% identical, e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical, to one of the ITR sequences in Figure 1 disclosed in Samulski et al., 1993. In some embodiments, the ITR comprises or consists of a nucleotide sequence that is at least 80% identical, e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99%, or 99.5% identical, to the pSM609 right ITR sequence (missing 9 bp) disclosed in the middle panel of Figure 1 disclosed in Samulski et al., 1983. In some embodiments, the ITR comprises a nucleotide sequence that is at least 80% identical, e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99%, or 99.5% identical, to the ITR sequence of any of SEQ ID NOs: 79-84 and 450-451.

[0289] In some embodiments, the ITR sequence, e.g., the right ITR (or 3'ITR), is SEQ ID NO: 80 or SEQ ID NO: 82, or a nucleotide sequence that is at least 80% identical, e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99%, or 99.5% identical to SEQ ID NO: 80 or SEQ ID NO: 82. In some embodiments, the ITR sequence, e.g., the left ITR (or 5'ITR), is SEQ ID NO: 79 or SEQ ID NO: 81, or a nucleotide sequence that is at least 80% identical, e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99%, or 99.5% identical to SEQ ID NO: 79 or SEQ ID NO: 81.

[0290] Table 4: Exemplary synthetic ITR sequences [Table 4-1] [Table 4-2] II. Vectors and Virions

[0291] In one embodiment, the rAAV vector (also referred to as an rAAV virion) disclosed herein comprises a capsid protein and an rAAV genome within the capsid protein. The rAAV capsid of the rAAV virion used to treat Pompe disease is any of those listed in Table 3 herein or in Table 1 disclosed in International Applications WO2020 / 102645 and WO2020 / 102667, each of which is incorporated herein in its entirety. In one embodiment, the rAAV capsid of the rAAV virion used to treat Pompe disease is an AAV8 capsid. In one embodiment, the rAAV vector is an rAAV8 vector.

[0292] Table 3: Table 3: AAV serotypes and exemplary published corresponding capsid sequences [Table 3-1]

Table 3-2

Table 3-3

Table 3-4

Table 3-5

Table 3-6

Table 3-7

Table 3-8

Table 3-9

Table 3-10

Table 3-11

Table 3-12

Table 3-13

Table 3-14

Table 3-15

Table 3-16

Table 3-17

Table 3-18

[0293] In one embodiment, the AAV vector (also referred to as a rAAV virion) disclosed herein comprises a capsid protein from any of those disclosed in WO2019 / 241324, which is specifically incorporated herein by reference in its entirety. In some embodiments of the invention disclosed herein, the rAAV vector comprises a liver-specific capsid, for example, a liver-specific capsid selected from XL32 and XL32.1, which are disclosed in WO2019 / 241324, which is specifically incorporated herein by reference in its entirety. In some embodiments, the rAAV vector is AAVXL32 or AAVXL32.1, which are disclosed in WO2019 / 241324, which is specifically incorporated herein by reference in its entirety.

[0294] Exemplary chimeric or variant capsid proteins that can be used as AAV capsids in the rAAV vectors described herein can be selected from Table 2 from U.S. Provisional Application No. 62,937,556, filed November 19, 2019, which is specifically incorporated herein by reference, or can be used in any combination with wild-type capsid proteins and / or other chimeric or variant capsid proteins now known or later identified, each of which is incorporated herein by reference. In some embodiments, the rAAV vectors encompassed for use are chimeric vectors, such as those disclosed in U.S. Patent Nos. 9,012,224 and 7,892,809, which are incorporated herein by reference in their entireties.

[0295] In some embodiments, the rAAV vector is a haploid rAAV vector as disclosed in U.S. Application Nos. US2018 / 0371496 and PCT / US18 / 22725, or a polyploid rAAV vector as disclosed, for example, in PCT / US2018 / 044632 filed July 31, 2018, and U.S. Application No. 16 / 151,110, each of which is incorporated by reference in its entirety. In some embodiments, the rAAV vector is an rAAV3 vector as disclosed in U.S. Application Nos. 9,012,224 and WO2017 / 106236, each of which is incorporated by reference in its entirety.

[0296] In certain embodiments, the rAAV is an AAVXL32 or AAVXL32.1 AAV vector disclosed in WO2019 / 241324, the entire contents of which are incorporated herein by reference. In some embodiments, the rAAV vector comprises a capsid disclosed in WO2019241324A1 or International Patent Application No. PCT / US2019 / 036676, the entire contents of which are incorporated herein by reference. In some embodiments, the AAV vector is an AAV8 vector or a rational haploid comprising an AAV8 capsid protein. In some embodiments, the recombinant AAV vector is a chimeric AAV vector, a haploid AAV vector, a hybrid AAV vector, or a polyploid AAV vector. In some embodiments, the recombinant AAV vector is a rational haploid vector, a mosaic AAV vector, a chemically modified AAV vector, or an AAV vector derived from any AAV serotype, for example, an AAV vector derived from any AAV serotype disclosed in Table 1 disclosed in International Applications WO2020 / 102645 and WO2020 / 102667, each of which is incorporated herein in its entirety.

[0297] In embodiments, the rAAV vector useful in the treatment of Pompe disease disclosed herein is AAV3b capsid.The AAV3b capsid that can be used is described in 2017 / 106236, 9,012,224, and 7,892,809, and in International Application No. PCT / US19 / 61653 filed on November 15, 2019, and in International Applications WO2020 / 102645 and WO2020 / 102667, each of which is incorporated herein in its entirety.In addition, the AAV3b capsid of the AAV vector that can be used according to the methods disclosed herein is described in International Patent Applications WO2020 / 102645 and WO2021102107, each of which is incorporated herein in its entirety by reference.

[0298] In some embodiments, the AAV3b capsid comprises SEQ ID NO: 44, as disclosed in International Patent Applications WO2020 / 102645 and WO2021102107. In embodiments, an AAV capsid used in the treatment of Pompe disease may be a modified AAV capsid derived from all or a portion of the AAV capsid set forth in SEQ ID NO: 44. In some embodiments, amino acids from the AAV3b capsid set forth in SEQ ID NO: 44 may be or are substituted with amino acids from another capsid of a different AAV serotype, and the substituted and / or inserted amino acids may be from any AAV serotype and may include either naturally occurring or partially or fully synthetic amino acids.

[0299] In another embodiment, the AAV capsid used in the treatment of Pompe disease is AAV3b265D capsid.In this particular embodiment, AAV3b265D capsid comprises a modification in the amino acid sequence of the two-fold axial loop of AAV3b capsid by replacing the amino acid G265 of AAV3b capsid with D265.In some embodiments, AAV3b265D capsid comprises SEQ ID NO: 46.However, the modified virus capsid of the present invention is not limited to the AAV capsid described in SEQ ID NO: 46 in International Patent Application WO2020 / 102645 and WO2021102107. In some embodiments, the amino acids from AAV3b265D set forth in SEQ ID NO:46 may be or are substituted with amino acids from a capsid from an AAV of a different serotype, and the substituted and / or inserted amino acids may be from any AAV serotype and may include either naturally occurring or partially or fully synthetic amino acids.

[0300] In another embodiment, the rAAV vector useful in the treatment of Pompe disease disclosed herein is an AAV3b265D549A capsid.In this specific embodiment, the AAV3b265D549A capsid comprises a modification in the amino acid sequence of the two-fold axial loop of the AAV3b capsid, by replacing the amino acid G265 of the AAV3b capsid with D265 and replacing the amino acid T549 of the AAV3b capsid with A549.In some embodiments, the AAV3b265D549A capsid comprises SEQ ID NO: 50, as disclosed in International Patent Applications WO2020 / 102645 and WO2021102107.However, the modified virus capsid of the present invention is not limited to the AAV capsid described in SEQ ID NO: 50. In some embodiments, amino acids from AAV3b265D549A set forth in SEQ ID NO:50 can be or are substituted with amino acids from a capsid from an AAV from a different serotype, and the substituted and / or inserted amino acids can be from any AAV serotype and can include either naturally occurring or partially or fully synthetic amino acids. In some embodiments, amino acids from AAV3bSASTG (i.e., an AAV3b capsid containing the Q263A / T265 mutations) can be or are substituted with amino acids from a capsid from an AAV of a different serotype, and the substituted and / or inserted amino acids can be from any AAV serotype and can include either naturally occurring or partially or fully synthetic amino acids.

[0301] In another embodiment, the rAAV vector useful in the treatment of Pompe disease disclosed herein is an AAV3b549A capsid.In this particular embodiment, the AAV3b549A capsid comprises a modification in the amino acid sequence of the two-fold axial loop of the AAV3b capsid by replacing the amino acid T549 of the AAV3b capsid with A549.In some embodiments, the AAV3b549A capsid comprises SEQ ID NO: 52, as disclosed in International Patent Applications WO2020 / 102645 and WO2021102107.However, the modified viral capsid of the present invention is not limited to the AAV capsid described in SEQ ID NO: 52. In some embodiments, the amino acids from AAV3b549A set forth in SEQ ID NO:52 can be or are substituted with amino acids from a capsid from an AAV of a different serotype, and the substituted and / or inserted amino acids can be from any AAV serotype and can include either naturally occurring or partially or fully synthetic amino acids.

[0302] In another embodiment, the rAAV vector useful in the treatment of Pompe disease disclosed herein is an AAV3bQ263Y capsid.In this particular embodiment, the AAV3bQ263Y capsid comprises a modification in the amino acid sequence of the two-fold axial loop of the AAV3b capsid by replacing the amino acid Q263 of the AAV3b capsid with Y263.In some embodiments, the AAV3b549A capsid comprises SEQ ID NO:54, as disclosed in International Patent Applications WO2020 / 102645 and WO2021102107.However, the modified viral capsid of the present invention is not limited to the AAV capsid described in SEQ ID NO:54. In some embodiments, amino acids from AAV3bQ263Y set forth in SEQ ID NO: 54 may be or are substituted with amino acids from a capsid from an AAV of a different serotype, and the substituted and / or inserted amino acids may be from any AAV serotype and may include either naturally occurring or partially or fully synthetic amino acids.

[0303] In another embodiment, the rAAV vectors useful in treating Pompe disease disclosed herein are of the AAV3bSASTG serotype or comprise an AAV3bSASTG capsid. In this particular embodiment, the AAV3bSASTG capsid contains modifications in the amino acid sequence to include the SASTG mutation; in particular, the AAV3b capsid has been modified to resemble the AAV2 Q263A / T265 subvariant by introducing these modifications at analogous positions in the AAV3b capsid (Messina EL, et al., Adeno-associated viral vectors based on serotype 3b use components of the fibroblast growth factor receptor signaling complex for efficient transduction. Hum. Gene Ther. 2012 Oct: 23(10):1031-4; Piacentino III, Valentino, et al. "X-linked inhibitor of apoptosis protein-mediated attenuation of apoptosis, using a novel cardiac-enhanced adeno-associated viral vector." Human gene therapy 23.6 (2012): 635-646). Thus, in some embodiments, the rAAV vectors useful in treating Pompe disease disclosed herein are of the AAV3bSASTG serotype or comprise an AAV3bSASTG capsid, including an AAV3b Q263A / T265 capsid. In some embodiments, amino acids from AAV3bSASTG can be or are substituted with amino acids from a capsid from an AAV of a different serotype, and the substituted and / or inserted amino acids can be from any AAV serotype and can include either naturally occurring or partially or fully synthetic amino acids.

[0304] Appropriate capsid can be used to target desired tissue.For example, AAV9 or rhesus capsid can be used to target the central nervous system, or at least one of AAV9 or rhesus virus proteins can be used to target rational haploid.Myo AAV can be used to target muscle, for example, see WO2019 / 2071323 and WO2022 / 020616, which are incorporated herein by reference in their entirety.

[0305] To facilitate their introduction into cells, rAAV vector genomes useful in the present invention are recombinant nucleic acid constructs containing (1) a heterologous sequence to be expressed (in one embodiment, a polynucleotide encoding a GAA polypeptide) and (2) viral sequence elements that facilitate the integration and expression of the heterologous gene. The viral sequence elements may include sequences of the AAV vector genome required in cis for DNA replication and packaging into AAV capsids (e.g., functional ITRs). In embodiments, the heterologous gene encodes GAA, which is useful for correcting GAA deficiency in patients suffering from Pompe disease. In embodiments, such rAAV vector genomes may also contain a marker or reporter gene. In embodiments, the rAAV vector genome may have one or more of the AAV3b wild-type (WT) cis genes replaced or deleted in whole or in part, but may retain functional flanking ITR sequences. III. Optimized rAAV Vector Genome

[0306] In some embodiments of the methods and compositions disclosed herein, optimized rAAV vector genomes are generated from any of the elements disclosed herein in any combination, including a nucleic acid sequence encoding a promoter, ITRs, a polyA tail, elements that can increase or decrease expression of a heterologous gene, and in one embodiment, a nucleic acid sequence that has been codon-optimized for expression of the GAA protein in vivo (i.e., wild-type GAA or codon-optimized GAA), and, optionally, one or more elements that reduce immunogenicity. Such optimized rAAV vector genomes can be used with any AAV capsid that has tropism for the tissues and cells in which the rAAV vector genome is transduced and expressed.

[0307] In some embodiments, the rAAV genome lacks the AAV P5 promoter or a fragment thereof that is typically located upstream of the liver-specific promoter disclosed herein. Typically, the P5 promoter controls expression of the AAV rep / cap proteins during AAV replication. In some embodiments, this P5 promoter fragment is present in the rAAV vector disclosed herein, which contains predicted transcription factor binding sites, such as cyclic AMP response element-binding protein 3 (CREB3), which can be activated by endoplasmic reticulum (ER) / Golgi stress (Sampieri 2019), activating transcription factor 2 (ATF2), and is also involved in stress responses (Watson 2017). Nuclear receptor subfamily 1 group I member 2 (NR1I2) (also known as pregnane X receptor [PXR]) is known to be enriched in the liver and is activated by other molecules, including pregnane steroids, rifampin, and dexamethasone (NR1I2_HGNC) (Xing 2020). Therefore, in some embodiments, the AAV P5 promoter fragment in the rAAV genome is removed without affecting the intended performance of the GAA cassette.In some embodiments, the rAAV vector also comprises an RNA polymerase II termination sequence located between the polyA signal and the 3'ITR.An exemplary termination sequence is SEQ ID NO:45 or SEQ ID NO:465, the latter of which introduces two termination codons and replaces one restriction site (e.g., XhoI) with TAG, and is located immediately downstream of the last encoded amino acid of hGAA and immediately upstream of the 3'UTR. IV. Subjects Suitable for Treatment A. Pompe disease

[0308] The recombinant AAV expressing the GAA protein disclosed herein can be used in methods for treating Pompe disease. Pompe disease is a rare genetic disorder caused by a deficiency of the enzyme acid alpha-glucosidase (GAA), which is necessary for breaking down glycogen, a storage form of sugar used for energy. Pompe disease is also known as glycogen storage disorder type II, GSD II, type II glycogen storage disorder, glycogen storage disease type II, acid maltase deficiency, alpha-1,4-glucosidase deficiency, diffuse glycogenic cardiac hypertrophy, and generalized glycogen storage disease cardiac type. Glycogen accumulation causes progressive muscle weakness (myopathy) throughout the body, affecting various body tissues, particularly the heart, skeletal muscles, liver, respiratory system, and nervous system.

[0309] Glycogen storage disease type II, also known as Pompe disease, is a rare metabolic disorder inherited in an autosomal recessive manner, caused by a deficiency of the lysosomal enzyme acid alpha-glucosidase (GAA). This disorder results in the accumulation of glycogen in lysosomes and the destruction of skeletal, smooth, and cardiac muscles. Pompe disease ranges in severity from severe infantile-onset myopathy (infantile-onset Pompe disease [IOPD]) accompanied by severe hypotonia and hypertrophic cardiomyopathy to late-onset myopathy (LOPD). GAA deficiency can vary from complete to partial GAA deficiency, which correlates with clinical severity. LOPD manifests as proximal leg weakness and, in some cases, respiratory impairment without significant cardiac involvement, which can progress to fatal respiratory failure.

[0310] Early-onset (or infantile-onset, IOPD) is the result of complete or near-complete deficiency of GAA. Symptoms begin in the first month of life and progress rapidly, with feeding problems, poor weight gain, muscle weakness, floppiness, and head lag. Respiratory difficulties are often complicated by lung infections. The heart is significantly enlarged. Many infants with Pompe disease also have an enlarged tongue. If not treated with Lumizyme, most infants die from cardiac or respiratory complications before their first birthday.

[0311] Late-onset (or young-onset / adult-onset, LOPD) Pompe disease is the result of a partial deficiency of GAA. Onset can occur in the first decade of childhood or in the sixth decade of adulthood and is therefore characterized as slowly progressive. The primary symptom is proximal muscle weakness that progresses to respiratory weakness, which persists for several years before death from respiratory failure. The heart is usually not involved.

[0312] The primary clinical manifestations of Pompe disease vary widely depending on the age of disease onset and residual GAA activity. Residual GAA activity correlates with both the amount and tissue distribution of glycogen stores, as well as the severity of the disease. Pompe disease with onset in childhood (<1% of normal GAA activity) is the most severe form and is characterized by hypotonia, generalized muscle weakness, and hypertrophic cardiomyopathy, as well as massive glycogen accumulation in the heart and other muscle tissues. Death usually occurs within the first year of life due to cardiopulmonary insufficiency. Juvenile-onset (1-10% of normal GAA activity) and adult-onset (10-40% of normal GAA activity) Pompe disease are more clinically heterogeneous, with greater variability in age of onset, clinical findings, and disease progression. Pompe disease, which begins in young people and adults, is generally characterized by the absence of severe cardiac involvement, a later age of onset, and slower disease progression, although eventual involvement of the respiratory or limb muscles results in significant morbidity and mortality. Life expectancy can vary, but death generally occurs due to respiratory failure.

[0313] In any embodiment of the methods disclosed herein, GAA enzymes suitable for treating Pompe disease include wild-type human GAA or fragments or sequence variants thereof that retain the ability to cleave the α1-4 linkage of linear oligosaccharides. In some embodiments of the methods and compositions disclosed herein, the GAA protein is encoded by a GAA nucleic acid sequence, e.g., SEQ ID NOS: 1-18, as disclosed herein, or an N-terminal truncation thereof as disclosed in Table 1 herein. In some embodiments of the methods and compositions disclosed herein, the GAA protein is encoded by a GAA nucleic acid sequence that has been codon-optimized for one or more of: (1) enhanced in vivo expression, (2) reduced CpG islands, or (3) reduced innate immune response. In some embodiments of the methods and compositions disclosed herein, the GAA protein is encoded by a codon-optimized GAA nucleic acid sequence, e.g., any nucleic acid sequence selected from SEQ ID NOs: 1-18, or any nucleic acid sequence that encodes a GAA polypeptide and has at least 60%, or 70%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NOs: 1-18, where the amino acid at position 199 is R (199R), the amino acid at position 233 is H (233H), and the amino acid at position 780 is I (780I) compared to the wild-type GAA protein.

[0314] In some embodiments of the methods and compositions disclosed herein, the rAAV vectors described herein transduce the subject's liver and secrete the hGAA polypeptide into the blood perfusing the patient's tissues, where it is taken up by cells and transported to lysosomes, where the GAA enzyme acts to eliminate material that has accumulated in the lysosomes due to enzyme deficiency. For lysosomal enzyme replacement therapy to be effective, the therapeutic enzyme must be delivered to the lysosomes in the appropriate cells in the tissue where storage deficiency occurs.

[0315] In some embodiments, upon administration, the AAV vector selectively expresses and secretes GAA from transduced hepatocytes. The main mechanism of action of the AAV vector expressing the hGAA polypeptide disclosed herein is to continuously secrete low levels of endogenous GAA from the liver into the systemic circulation, providing a therapeutic exposure level of GAA to tissues (e.g., muscle, but not only muscle), resulting in glycogen removal and restoration of cellular structure and function. B. Increased GAA Activity in Subjects with Pompe Disease

[0316] In any embodiment of the methods disclosed herein, administration of the AAV vector expressing GAA is intramuscular and can be by any suitable method, including intravenous, intraarterial, and / or intraperitoneal administration. Exemplary mechanisms of administration include oral, rectal, transmucosal, intranasal, inhalation (e.g., via aerosol), buccal (e.g., sublingual), vaginal, intrathecal, intraocular, transdermal, intrauterine (or intraovo), parenteral (e.g., intravenous, subcutaneous, intradermal, intramuscular [including administration to skeletal muscle, diaphragm muscle, and / or cardiac muscle], intradermal, intrapleural, intracerebral, and intraarticular), topical (e.g., to both mucosal surfaces, including skin and respiratory tract surfaces, and transdermal administration), intralymphatic, etc., and direct injection into a tissue or organ (e.g., into the liver, skeletal muscle, cardiac muscle, diaphragm muscle, or brain). The most suitable route in any given case will depend on the nature and severity of the condition being treated and / or prevented and the nature of the particular vector used.

[0317] In any embodiment of the methods disclosed herein, the AAV vector expressing the GAA disclosed herein is administered to skeletal muscles according to the present invention, including but not limited to, the skeletal muscles of the limbs (e.g., upper arm, forearm, thigh, and / or lower leg), back, neck, head (e.g., tongue), chest, abdomen, pelvis / perineum, and / or fingers. Suitable skeletal muscles that can be injected are disclosed in International Application WO2021102107, the entire contents of which are incorporated herein by reference.

[0318] In any embodiment of the methods disclosed herein, the rAAV vector and / or rAAV genome is administered to the subject's skeletal muscle, liver, diaphragm, rib, and / or cardiac muscle cells. For example, a conventional syringe and needle can be used to inject an rAAV virion suspension into an animal. Parenteral administration of the rAAV vector and / or rAAV genome by injection can be performed, for example, by bolus injection or continuous infusion. The injection preparation can be presented in unit dosage form, for example, in an ampule or a multi-dose container with an added preservative. The composition can take the form of a suspension, solution, or emulsion in an oily or aqueous vehicle, and can contain pharmaceutical formulation agents such as suspending agents, stabilizers, and / or dispersing agents. Alternatively, the rAAV vector and / or rAAV genome disclosed herein can be in powder form (e.g., lyophilized) for constitution with a suitable vehicle, for example, sterile pyrogen-free water, before use.

[0319] In certain embodiments, two or more administrations (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, etc., or more administrations) may be used to achieve a desired level of gene expression over various intervals, e.g., hours, days, weeks, months, years, etc. Dosing may be single dosage or cumulative (continuous dosing), and can be readily determined by one of skill in the art. As disclosed herein, treatment of Pompe disease by the methods disclosed herein is contemplated to involve a single administration of an effective dose of a pharmaceutical composition comprising an AAV vector encoding a GAA polypeptide.

[0320] However, in alternative embodiments, treatment of a subject with Pompe disease may include multiple administrations of a pharmaceutical composition containing an AAV vector encoding a GAA polypeptide if the subject is not receiving long-term ERT, where the multiple administrations can be administered over a range of time periods, such as once a year, or every six months, or about every two years, or about every three years, or about every four years, or about every five years, or at intervals longer than five years. The timing of administration can vary from individual to individual, depending on factors such as the severity of the individual's symptoms. For example, in some embodiments, an effective dose of an AAV vector encoding a GAA polypeptide disclosed herein can be administered to an individual once a year, once every two years, or once every six months indefinitely, or until the individual no longer requires treatment. Those skilled in the art will recognize that the individual's condition can be monitored throughout the course of treatment, and the effective amount of the AAV vector encoding a GAA polypeptide disclosed herein administered can be adjusted accordingly.

[0321] Injectable materials containing AAV vectors encoding the GAA polypeptides disclosed herein can be prepared in any conventional form, such as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or emulsions. Alternatively, AAV vectors encoding the GAA polypeptides disclosed herein can be administered in a localized rather than systemic manner, for example, in a depot or sustained-release formulation. Furthermore, viral vectors and / or viral capsids can be delivered by being attached to a surgically implantable matrix (e.g., as described in U.S. Patent Publication No. US-2004-0013645-A1). In some embodiments, AAV vectors encoding the GAA polypeptides disclosed herein can be administered to a subject's lungs by any suitable means, optionally by administering an aerosol suspension of inhalable particles composed of viral vectors and / or viral capsids, which the subject inhales. The inhalable particles can be liquid or solid. As known to those skilled in the art, aerosols of liquid particles containing viral vectors and / or viral capsids can be generated by any suitable means, such as pressure-driven aerosol nebulizers or ultrasonic nebulizers. See, e.g., U.S. Patent No. 4,501,729. Aerosols of solid particles containing viral vectors and / or capsids can similarly be generated in any solid particle pharmaceutical aerosol generator by techniques known in the pharmaceutical arts.

[0322] In some embodiments, an AAV vector encoding a GAA polypeptide disclosed herein can be formulated in a solvent, emulsion, or other diluent in an amount sufficient to dissolve the rAAV vector disclosed herein. In other aspects of this embodiment, the rAAV vectors and / or rAAV genomes encoding the GAA polypeptides disclosed herein may be formulated in an amount of solvent, emulsion, or diluent, e.g., less than about 90% (v / v), less than about 80% (v / v), less than about 70% (v / v), less than about 65% (v / v), less than about 60% (v / v), less than about 55% (v / v), less than about 50% (v / v), less than about 45% (v / v), less than about 40% (v / v), less than about 35% (v / v), less than about 30% (v / v), less than about 25% (v / v), less than about 20% (v / v), less than about 15% (v / v), less than about 10% (v / v), less than about 5% (v / v), or less than about 1% (v / v).In other embodiments, the rAAV vector and / or rAAV genome encoding the GAA polypeptides disclosed herein is, for example, about 1% (v / v) to 90% (v / v), about 1% (v / v) to 70% (v / v), about 1% (v / v) to 60% (v / v), about 1% (v / v) to 50% (v / v), about 1% (v / v) to 40% (v / v), about 1% (v / v)~30%(v / v), approx. 1%(v / v)~20%(v / v), approx. 1%(v / v)~10%(v / v), approx. 2%(v / v)~50%(v / v), approx. 2%(v / v) ~40%(v / v), approx. 2%(v / v)~30%(v / v), approx. 2%(v / v)~20%(v / v), approx. 2%(v / v)~10%(v / v), approx. 4%(v / v)~50%( v / v), approximately 4%(v / v)~40%(v / v), approximately 4%(v / v)~30%(v / v), approximately 4%(v / v)~20%(v / v), approximately 4%(v / v)~10%(v / v) , approximately 6%(v / v)~50%(v / v), approximately 6%(v / v)~40%(v / v), approximately 6%(v / v)~30%(v / v), approximately 6%(v / v)~20%(v / v), approximately 6%( The composition may contain a solvent, emulsion, or other diluent in an amount ranging from about 8% (v / v) to 10% (v / v), about 8% (v / v) to 50% (v / v), about 8% (v / v) to 40% (v / v), about 8% (v / v) to 30% (v / v), about 8% (v / v) to 20% (v / v), about 8% (v / v) to 15% (v / v), or about 8% (v / v) to 12% (v / v).

[0323] In any embodiment of the methods disclosed herein, the AAV vector encoding the GAA polypeptide can be of any AAV serotype, including, but not limited to, any AAV8 capsid, or any AAV3b capsid selected from an AAV3b capsid (SEQ ID NO: 452); an AAV3b265D capsid (SEQ ID NO: 454), an AAV3b ST(S663V+T492V) capsid (SEQ ID NO: 456), an AAV3b265D549A capsid (SEQ ID NO: 458); an AAV3b549A capsid (SEQ ID NO: 460); an AAV3bQ263Y capsid (SEQ ID NO: 462), or an AAV3bSASTG capsid (i.e., an AAV3b capsid containing the Q263A / T265 mutations).

[0324] To facilitate the delivery of the AAV vector encoding the GAA polypeptide disclosed herein, it can be mixed with carrier or excipient.Carriers and excipients that can be used include saline (particularly sterile pyrogen-free saline), salt buffer (for example, citrate buffer, phosphate buffer, acetate buffer and bicarbonate buffer), amino acids, urea, alcohol, ascorbic acid, phospholipids, proteins (for example, serum albumin), EDTA, sodium chloride, liposomes, mannitol, sorbitol and glycerol.USP-grade carriers and excipients are particularly useful for the delivery of virions to human subjects.

[0325] In addition to the formulations described above, the AAV vector encoding the GAA polypeptide disclosed herein can also be formulated as a depot preparation.Such long-acting formulations can be administered by implantation (for example, subcutaneously or intramuscularly) or by IM injection.Therefore, for example, the rAAV vector and / or rAAV genome disclosed herein can be formulated with suitable polymeric or hydrophobic materials (for example, as an emulsion in acceptable oil) or ion exchange resin, or as a poorly soluble derivative.

[0326] In any embodiment of the methods disclosed herein, the method is directed to treating Pompe disease caused by a deficiency of GAA in a subject, wherein an AAV vector encoding a GAA polypeptide disclosed herein is administered to a patient suffering from Pompe disease, and following administration, GAA is secreted from cells in the liver, and there is uptake of the secreted GAA by cells in skeletal muscle tissue, cardiac muscle tissue, diaphragm muscle tissue, or a combination thereof, and the uptake of the secreted GAA results in a reduction of lysosomal glycogen storage in tissues including, but not limited to, muscle. In some embodiments, the AAV vector encoding the GAA polypeptide disclosed herein is encapsulated in a capsid, for example, any AAV3b capsid selected from an AAV3b capsid (sequence number 452); an AAV3b265D capsid (sequence number 454), an AAV3b ST(S663V+T492V) capsid (sequence number 456), an AAV3b265D549A capsid (sequence number 458); an AAV3b549A capsid (sequence number 460); an AAV3bQ263Y capsid (sequence number 462), or an AAV3bSASTG capsid (i.e., an AAV3b capsid containing the Q263A / T265 mutations).

[0327] In certain embodiments, at least about 1.6 x 10 per dose 12 ~Approx. 4.0×10 12 vg / kg is administered in a pharmaceutically acceptable carrier. In further embodiments, the dosage of viral vector and / or capsid administered to a subject depends on the mechanism of administration, the severity and type of Pompe disease (i.e., LOPD or IOPD) to be treated and / or prevented, the condition, age, and sex of the individual subject, as well as the particular viral vector or capsid, nucleic acid encoding the GAA polypeptide to be delivered, etc., and can be determined by routine methods.

[0328] Exemplary doses to achieve a therapeutic effect are at least about 1.0E9vg / kg to 5.0E13vg / kg, e.g., 1.0E9vg / kg to 5.0E12vg / kg; 5.0E9vg / kg to 5.0E12vg / kg; 5.0E9vg / kg to 1.0E12vg / kg; 5.0E9vg / kg to 5.0E11vg / kg; 5.0E9vg / kg to 5.0E10vg / kg; and 1.0E9vg / kg to 1.0E10vg / kg, 1.5×10 11 vg / kg, or at least about 1.5 × 10 12 vg / kg, or at least about 4.0 × 10 12 The potency is 1.6 x 10 6 vg / kg. It is contemplated that the dose to achieve the therapeutic effect disclosed herein may also be determined by the strength of the liver-specific promoter (LSP) operably linked to the nucleic acid encoding the GAA polypeptide, as well as the specific signal sequence and the ability of the cell to cleave the signal sequence when secreted from the cell. In contrast, the dose of AAV encoding the GAA polypeptide disclosed herein is about 1.6 x 10 6 vg / kg when the liver-specific promoter is stronger than the LPS (SEQ ID NO: 97) used in the AAV8-LSPhGAA vector. 12 However, the dose of AAV should be titrated and determined based on the level of GAA expressed in the cells, as determined by the transduction efficiency of the AAV capsid and LSP, as well as the ability of the cells to secrete the expressed GAA polypeptide, to avoid GAA accumulation in the transfected cells and any associated cytotoxicity.

[0329] In another aspect, disclosed herein is a method for treating Pompe disease by administering a nucleic acid encoding GAA to a cell, comprising contacting the cell with an rAAV vector and / or rAAV genome disclosed herein under conditions in which the nucleic acid is introduced into the cell and expressed to produce GAA. In some embodiments, the cell is an in vivo cell. In some embodiments, the cell is a mammalian cell in vivo. C. Increased motor neuron function in mammals

[0330] In any embodiment of the methods disclosed herein, AAV vectors encoding the GAA polypeptides disclosed herein are useful in methods for increasing phrenic nerve activity in mammals with Pompe disease and / or insufficient GAA levels. For example, an AAV vector encoding a GAA polypeptide disclosed herein, e.g., a rAAV vector and / or rAAV genome encapsulated in a capsid, e.g., AAV8, or any AAV3b capsid selected from an AAV3b capsid (sequence number 452); an AAV3b265D capsid (sequence number 454), an AAV3b ST(S663V+T492V) capsid (sequence number 456), an AAV3b265D549A capsid (sequence number 458); an AAV3b549A capsid (sequence number 460); an AAV3bQ263Y capsid (sequence number 462) or an AAV3bSASTG capsid, can be administered to the central nervous system (e.g., a neuron). In another embodiment, retrograde delivery of an AAV vector encoding a GAA polypeptide disclosed herein from the diaphragm (or other muscle) to the phrenic nerve or other motor neuron can result in biochemical and physiological correction of Pompe disease. These same principles can be applied to other neurodegenerative diseases.

[0331] In embodiments, the rAAV capsid of the rAAV virion used to treat Pompe disease is any of those described in Table 1 disclosed in International Patent Applications WO2020 / 102645 and WO2020 / 102667, which are incorporated by reference in their entireties, and may be any serotype, e.g., AAV8 or AAV3, or AAV3b (including, but not limited to, AAV3b265D, AAV3b265D549A, AAV3b549A, AAV3bQ263Y, AAV3bSASTG (i.e., AAV3b capsids containing the Q263A / T265 mutations) serotypes of AAV3b). The GAA construct can reduce any one or more of the following symptoms in patients suffering from Pompe disease, for example, by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%, compared to patients not receiving the same treatment.In other aspects of this embodiment, an AAV GAA of any serotype may reduce any one or more of the following symptoms in patients with Pompe disease, compared to the same untreated patient: (i) a feeling of weakness in the patient's lower extremities, including the legs, trunk, and / or arms; (ii) shortness of breath, strenuous exercise, lung infections, large curvatures in the spine, difficulty breathing during sleep, enlarged liver, enlarged tongue, and / or stiff joints; (iii) a decrease in the level of serotonin in patients with Pompe disease, e.g., by about 10% to about 100%, about 20% to about 100%, about 30% to about 100%, about 40% to about 100%, about 50% to about 100%, about 60% to about 60%, or more. The concentration can be reduced by about 10% to about 100%, about 70% to about 100%, about 80% to about 100%, about 10% to about 90%, about 20% to about 90%, about 30% to about 90%, about 40% to about 90%, about 50% to about 90%, about 60% to about 90%, about 70% to about 90%, about 10% to about 80%, about 20% to about 80%, about 30% to about 80%, about 40% to about 80%, about 50% to about 80%, or about 60% to about 80%, about 10% to about 70%, about 20% to about 70%, about 30% to about 70%, about 40% to about 70%, or about 50% to about 70%.

[0332] In any embodiment of the methods and compositions disclosed herein, at least one symptom associated with Pompe disease or at least one adverse side effect associated with Pompe disease is reduced by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%, and the severity of at least one symptom associated with Pompe disease or at least one adverse side effect is reduced by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%. In another embodiment, the improvement of at least one symptom associated with Pompe disease or at least one adverse side effect associated with Pompe disease is achieved by about 10% to about 100%, about 20% to about 100%, about 30% to about 100%, about 40% to about 100%, about 50% to about 100%, about 60% to about 100%, about 70% to about 100%, about 80% to about 100%, about 10% to about 90%, about 20% to about 9 ... Reduced by 0% to about 90%, about 40% to about 90%, about 50% to about 90%, about 60% to about 90%, about 70% to about 90%, about 10% to about 80%, about 20% to about 80%, about 30% to about 80%, about 40% to about 80%, about 50% to about 80%, or about 60% to about 80%, about 10% to about 70%, about 20% to about 70%, about 30% to about 70%, about 40% to about 70%, or about 50% to about 70%. V. Method of Administration

[0333] Without wishing to be bound by theory, the only current treatment for Pompe disease is the long-term administration of recombinant human GAA (rhGAA) ERT, which is typically administered on an every-other-week regimen. Herein, the inventors have demonstrated that subjects with Pompe disease can discontinue their usual ERT regimen (e.g., long-term ERT hiatus) for extended periods without clinical regression when the subjects are administered a specific dose of an AAV vector expressing a GAA polypeptide disclosed herein. In some embodiments, weaning from long-term ERT begins approximately at the time (e.g., the day before, the day of, or the day after) of administration of the AAV vector to the subject, or in some embodiments, weaning from long-term ERT can occur about 26 weeks after administration of the AAV vector, or any time within about 24 to about 26 weeks after administration of the AAV vector.

[0334] In some embodiments, a subject administered with an AAV vector expressing a GAA disclosed herein may be administered supplemental ERT after an initial period of withdrawal from long-term ERT administration for a long period of time, and the supplemental ERT may be administered about 6 months, about 1 year, or more than 1 year after the cessation of long-term ERT. In other words, and without wishing to be bound by theory, the technology disclosed herein relates to a method in which a subject with Pompe disease administered with an AAV vector expressing a GAA disclosed herein can have a break or "drug holiday" from regular long-term ERT administration. That is, according to the method disclosed herein, a subject administered with an AAV vector expressing a GAA disclosed herein can have a long period without the administration of long-term ERT. In some embodiments, the method disclosed herein allows flexibility in the regular ERT regimen in that the interruption or prolonged withdrawal of long-term ERT administration does not result in clinical deterioration, i.e., the subject remains clinically stable despite not having ongoing long-term ERT.

[0335] In some embodiments, the methods disclosed herein involve re-administration of ERT after a prolonged cessation of ERT administration (referred to herein as "complementary ERT"), allowing for flexibility in the normal ERT regimen, since the continuous production of GAA expressed by AAV allows for flexibility in ERT. In some embodiments, the complementary ERT is pulsed administration of ERT as disclosed herein. In some embodiments, the complementary ERT is administered at less frequent intervals, or at lower doses, or at irregular doses, or at irregular intervals, compared to before administration of long-term ERT.

[0336] Therefore, the method disclosed herein provides significant benefits to subjects with Pompe disease, including but not limited to, reducing or eliminating the rigorous and painful weekly or every other week infusion of long-term rhGAA ERT treatment, which is very time-consuming, geographically restricted, and prevents patients with Pompe disease from traveling for long periods from the area where ERT infusion is administered.In addition, as disclosed herein, the absence of ERT administration also reduces any side effects caused by anti-rhGAA antibodies to ERT, and also avoids the need for the administration of immunosuppressants that are usually co-administered with ERT.Therefore, the method for treating Pompe disease disclosed herein provides greater flexibility in Pompe treatment and improves the quality of life and lifestyle of subjects with Pompe disease.

[0337] Thus, in one embodiment, the present technology relates to a method of treating Pompe disease in a subject, comprising administering to the subject, in the absence of administration of long-term GAA enzyme replacement therapy (ERT) over an extended period of time (e.g., ERT administration can be weaned or stopped about 24 weeks, or about 26 weeks, or earlier than 24 or 26 weeks after administration of the recombinant AAV), a pharmaceutical composition comprising a recombinant adeno-associated virus (AAV) vector comprising in its genome a heterologous nucleic acid sequence encoding an alpha-glucosidase (GAA) polypeptide in an expressible form, wherein the heterologous nucleic acid is operably linked to a liver-specific promoter. In some embodiments, the dosage of the recombinant AAV comprising a nucleic acid encoding a GAA polypeptide is in the range of 1.0E11 vg / kg and 5.0E13 vg / kg, and in some embodiments, GAA is expressed to a level such that the subject obtains a serum level of GAA expressed by the AAV with pharmaceutically active activity in the range of 160 to ≦2,260 nmol / mL / hr, 165 to ≦2,260 nmol / ml / hr, 175 to ≦2,260, 180 to ≦2,260, 185 to ≦2,260, or 189 to ≦2,260 within at least two weeks of administration. In some embodiments, the dosage of the AAV expressing the GAA polypeptide is in the range of 11.0E11 vg / kg and 5.0E13 vg / kg, and in some embodiments, 4.0E 12 In some embodiments, the dosage of the AAV expressing GAA is 4.0 E or less, and in some embodiments, the GAA is expressed to a level such that the subject obtains a serum level of GAA expressed by the AAV with pharmacological activity in the range of 189 to ≦2,260 nmol / mL / hr within at least two weeks of administration. 12 vg / kg or less, and in some embodiments, GAA is expressed to a level such that the subject has a serum level of GAA expressed by the AAV with pharmacological activity in the range of 189 to ≦2,260 nmol / mL / hr within at least two weeks of administration.

[0338] In some embodiments, the dosage of the AAV expressing GAA is 5.0 E 11 In some embodiments, the dosage is 1.0 E vg / kg or less. 9vg / kg~5.0E 11 vg / kg range.

[0339] In some embodiments, the dosage of the AAV expressing GAA is 5.0E13 vg / kg or less, hi some embodiments, the dosage ranges from 1.0E9 vg / kg or 5.0E13 vg / kg.

[0340] In particular, the technology described herein relates to the discovery that a single injection of a rAAV vector expressing human acid alpha-glucosidase (GAA) can independently replace repeated injections of enzyme replacement therapy (ERT) with recombinant human GAA protein (rhGAA). The inventors demonstrate that a single administration of an AAV expressing GAA results in long-term transduction of the normal GAA gene into hepatocytes and continuous constitutive expression of GAA in the systemic circulation. Thus, the inventors herein demonstrate that administration of a composition comprising an AAV expressing hGAA can replace the biweekly exogenous administration of ERT that subjects with Pompe disease normally undergo. That is, the inventors herein demonstrate that subjects with Pompe disease administered the AAV expressing hGAA disclosed herein can have long-term cessation of ERT.

[0341] In particular, described herein are methods for treating Pompe in a subject in need thereof by administering to the subject a composition comprising an AAV vector expressing an alpha-glucosidase (GAA) protein, wherein the subject is not concurrently receiving GAA enzyme replacement therapy. In some embodiments, the technology relates to methods for administering an AAV expressing GAA, wherein the subject can be weaned from GAA enzyme replacement therapy (ERT) for an extended period of time, for example, at least 3 months, at least 4 months, at least 5 months, at least 1 year, at least 1.5 years, and 6 months or longer. In some embodiments, the subject is weaned from ERT on or just before the day of administration of the AAV expressing GAA and is clinically stable with respect to at least one or more symptoms as disclosed herein. In some embodiments, the subject is weaned from ERT any time between 1-2 days before and after administration of the AAV expressing GAA, and about 6 months after administration, and is clinically stable with respect to at least one or more Pompe symptoms as disclosed herein for at least 6 months.

[0342] Additionally, the inventors have discovered that in Pompe patients administered AAV expressing GAA according to the methods and dose ranges disclosed herein, there is a minimal immune response to the GAA protein expressed by the AAV. Thus, in some embodiments, there is minimal or no need for the administration of immunomodulatory or immunosuppressive drugs at, before, or after administration of the AAV to the subject, and thus the usual immunosuppressive drug protocols typically administered when a subject receives a viral vector or undergoes gene therapy are not required.

[0343] Thus, in all embodiments herein, the method for treating Pompe comprises, or consists essentially of, or consists of administering an AAV vector expressing a GAA disclosed herein in the absence of administration of an ERT for Pompe and in the absence of immune modulation. In some embodiments, the subject has late-onset Pompe disease (LOPD) or infantile-onset Pompe disease.

[0344] In all aspects disclosed herein, the AAV comprises a nucleotide sequence containing inverted terminal repeats (ITRs), a promoter, a heterologous gene, a polyA tail, and potentially other regulatory elements for use in treating Pompe disease, e.g., late-onset Pompe disease (LOPD), wherein the heterologous gene is GAA, and the vector, e.g., rAAV, can be administered to a patient at a therapeutically effective dose that is delivered to the appropriate tissues and / or organs for expression of the heterologous GAA gene and treatment of the disease, e.g., Pompe disease.

[0345] In some embodiments, a subject administered with an AAV vector expressing a GAA disclosed herein may be administered supplemental ERT after an initial period of withdrawal from long-term ERT administration, and the supplemental ERT may be administered about 6 months, about 1 year, or more than 1 year after the cessation of long-term ERT. In other words, and without wishing to be bound by theory, the technology disclosed herein relates to a method in which a subject with Pompe disease administered with an AAV vector expressing a GAA disclosed herein can have a break or "drug holiday" from regular long-term ERT administration. That is, according to the method disclosed herein, a subject administered with an AAV vector expressing a GAA disclosed herein can have a long period without the administration of long-term ERT. In some embodiments, the method disclosed herein allows flexibility in the regular ERT regimen in that the interruption or prolonged withdrawal of long-term ERT administration does not result in clinical deterioration, i.e., the subject remains clinically stable despite not having ongoing long-term ERT.

[0346] In some embodiments, the methods disclosed herein involve re-administration of ERT after a prolonged cessation of ERT administration (referred to herein as "complementary ERT"), allowing for flexibility in the normal ERT regimen, since the continuous production of GAA expressed by AAV allows for flexibility in ERT. In some embodiments, the complementary ERT is pulsed administration of ERT as disclosed herein. In some embodiments, the complementary ERT is administered at less frequent intervals, or at lower doses, or at irregular doses, or at irregular intervals, compared to before administration of long-term ERT.

[0347] Therefore, the method disclosed herein provides significant benefits to subjects with Pompe disease, including but not limited to, reducing or eliminating the rigorous and painful weekly or every other week infusion of long-term rhGAA ERT treatment, which is very time-consuming, geographically restricted, and prevents patients with Pompe disease from traveling for long periods from the area where ERT infusion is administered.In addition, as disclosed herein, the absence of ERT administration also reduces any side effects caused by anti-rhGAA antibodies to ERT, and also avoids the need for the administration of immunosuppressants that are usually co-administered with ERT.Therefore, the method for treating Pompe disease disclosed herein provides greater flexibility in Pompe treatment and improves the quality of life and lifestyle of subjects with Pompe disease.

[0348] Thus, in one embodiment, the present technology relates to a method of treating Pompe disease in a subject, comprising administering to the subject, in the absence of administration of long-term GAA enzyme replacement therapy (ERT) over an extended period of time (e.g., ERT administration can be weaned or stopped about 24 weeks, or about 26 weeks, or earlier than 24 or 26 weeks after administration of the recombinant AAV), a pharmaceutical composition comprising a recombinant adeno-associated virus (AAV) vector comprising in its genome a heterologous nucleic acid sequence encoding an alpha-glucosidase (GAA) polypeptide in an expressible form, wherein the heterologous nucleic acid is operably linked to a liver-specific promoter. In some embodiments, the dosage of the recombinant AAV comprising a nucleic acid encoding a GAA polypeptide is in the range of 1.0E9 vg / kg to 5.0E13 vg / kg, and in some embodiments, the GAA is expressed to a level such that the subject obtains a serum level of GAA expressed by the AAV with pharmaceutically active activity in the range of 160 to ≦2,260 nmol / mL / hr, 165 to ≦2,260 nmol / ml / hr, 175 to ≦2,260, 180 to ≦2,260, 185 to ≦2,260, or 189 to ≦2,260 within at least two weeks of administration. In some embodiments, the dosage of the AAV expressing GAA is in the range of 1.0E9 vg / kg and 5.0E13 vg / kg, and in some embodiments, GAA is expressed to a level where the subject obtains serum levels of GAA expressed by the AAV with pharmaceutical activity in the range of 189 to ≦2,260 nmol / mL / hour within at least two weeks of administration. In some embodiments, the dosage of the AAV expressing GAA is in the range of 1.0E9 vg / kg and 5.0E13 vg / kg, and in some embodiments, GAA is expressed to a level where the subject obtains serum levels of GAA expressed by the AAV with pharmaceutical activity in the range of 189 to ≦2,260 nmol / mL / hour within at least two weeks of administration.

[0349] In particular, the technology described herein relates to the discovery that a single injection of a rAAV vector expressing human acid alpha-glucosidase (GAA) can independently replace repeated injections of enzyme replacement therapy (ERT) with recombinant human GAA protein (rhGAA). The inventors demonstrate that a single administration of an AAV expressing GAA results in long-term transduction of the normal GAA gene into hepatocytes and continuous constitutive expression of GAA in the systemic circulation. Thus, the inventors herein demonstrate that administration of a composition comprising an AAV expressing hGAA can replace the biweekly exogenous administration of ERT that subjects with Pompe disease normally undergo. That is, the inventors herein demonstrate that subjects with Pompe disease administered the AAV expressing hGAA disclosed herein can have long-term cessation of ERT.

[0350] In particular, described herein are methods for treating Pompe in a subject in need thereof by administering to the subject a composition comprising an AAV vector expressing an alpha-glucosidase (GAA) protein, wherein the subject is not concurrently receiving GAA enzyme replacement therapy. In some embodiments, the technology relates to methods for administering an AAV expressing GAA, wherein the subject can be weaned from GAA enzyme replacement therapy (ERT) for an extended period of time, for example, at least 3 months, at least 4 months, at least 5 months, at least 1 year, at least 1.5 years, and 6 months or longer. In some embodiments, the subject is weaned from ERT on or just before the day of administration of the AAV expressing GAA and is clinically stable with respect to at least one or more symptoms as disclosed herein. In some embodiments, the subject is weaned from ERT any time between 1-2 days before and after administration of the AAV expressing GAA, and about 6 months after administration, and is clinically stable with respect to at least one or more Pompe symptoms as disclosed herein for at least 6 months.

[0351] Additionally, the inventors have discovered that in Pompe patients administered AAV expressing GAA according to the methods and dose ranges disclosed herein, there is a minimal immune response to the GAA protein expressed by the AAV. Thus, in some embodiments, there is minimal or no need for the administration of immunomodulatory or immunosuppressive drugs at, before, or after administration of the AAV to the subject, and thus the usual immunosuppressive drug protocols typically administered when a subject receives a viral vector or undergoes gene therapy are not required.

[0352] Thus, in all embodiments herein, the method for treating Pompe comprises, or consists essentially of, or consists of administering an AAV vector expressing a GAA disclosed herein in the absence of administration of an ERT for Pompe and in the absence of immune modulation. In some embodiments, the subject has late-onset Pompe disease (LOPD) or infantile-onset Pompe disease.

[0353] The disclosure herein generally relates to a method for treating a subject with Pompe disease, comprising administering to the subject a pharmaceutical composition comprising, or consisting essentially of, a recombinant adenovirus-associated (AAV) vector comprising in its genome a heterologous nucleic acid sequence encoding a polypeptide comprising an alpha-glucosidase (GAA) polypeptide, wherein the heterologous nucleic acid is operably linked to a liver-specific promoter, and the subject may not be administered GAA enzyme replacement therapy (ERT) or may have an extended period of withdrawal from ERT. In one embodiment, ERT is continued but at least one of dosage or frequency is reduced.

[0354] While not wishing to be bound by theory, the inventors have discovered a method for treating Pompe disease using AAV-mediated delivery of GAA to a subject, wherein the rAAV expresses GAA to a steady state shortly after administration, such that the subject can be weaned from ERT early, at the time of, or around the time of rAAV administration, for example, ERT can be weaned the day before, the same day of, or the day after administration, or within one or two weeks of administration. As disclosed herein, steady-state GAA expression by the rAAV disclosed herein results in serum levels of GAA in the pharmaceutically active range of 189 to ≦2,260 nmol / mL / hr.

[0355] In some embodiments, methods for treating Pompe disease using a GAA-expressing rAAV disclosed herein include administration of a therapeutically effective amount of rAAV to result in serum levels of expressed hGAA within a pharmaceutically active range of between 189 and 410 nmol / mL / hour, or between 410 and ≦2,260 nmol / mL / hour.

[0356] In some embodiments, methods for treating Pompe disease using rAAV expressing GAA disclosed herein include administering the rAAV to produce a serum level of expressed hGAA within the range of 189 to ≦2,260 nmol / mL / hour, and the subject achieves clinical stability of one or more symptoms of Pompe disease. Clinical stability includes a steady state in one or more of the following parameters: 6MWT (6-minute walk test) and FVC (forced vital capacity). In some embodiments, clinical stability refers to a stable level of either motor function (as determined by 6MWT) and / or pulmonary function (as determined by FVC) at two consecutive assessments separated by at least three months. In some embodiments, a clinically stable level of motor function as determined by 6MWT is a ≦12% decline from baseline or a decrease of less than 43 meters at two consecutive assessments separated by at least three months. In other words, a clinically stable level of motor function as determined by 6MWT is a decline of no more than 0-12% from baseline at two consecutive assessments separated by at least three months.

[0357] In some embodiments, a clinically stable level of lung function as determined by FVC% predicted in an upright position is a decrease of ≦15% from baseline on two consecutive assessments at least three months apart. Stated another way, a clinically stable level of lung function as determined by FVC% predicted in an upright position is between 1-14% from baseline on two consecutive assessments at least three months apart.

[0358] In some embodiments, the baseline 6MWT or FVC level is a level measured at or before administration of a GAA-expressing rAAV. In some embodiments, the baseline 6MWT or FVC level is a level measured at or before administration of a GAA-expressing rAAV when the subject is concurrently administered GAA ERT. In some embodiments, the baseline 6MWT or FVC level is a level measured at or before administration of a GAA-expressing rAAV when the subject is weaned from GAA ERT. In some embodiments, the baseline 6MWT or FVC level is a level measured before weaning from GAA ERT, for example, about 24 to about 26 weeks before. In some embodiments, clinical stability is maintained in a Pompe patient before and after ERT weaning, where the patient receives a single dose of an AAV comprising a nucleic acid encoding GAA administered at the time of, before, or after ERT administration. Maintained clinical stability indicates that 6MWT and / or FVC are within the range from baseline described herein.

[0359] In some embodiments, methods for treating Pompe disease using a rAAV expressing GAA disclosed herein include administering an amount of rAAV to result in a reduction of glycogen levels in one or more tissues to within the normal range, the normal range being the glycogen levels in control tissues of a subject without Pompe disease. A. AAV-hGAA Dosage

[0360] In some embodiments, the methods disclosed herein relate to administering a rAAV expressing a GAA disclosed herein to a human subject at a dose ranging from 1.0E11 vg / kg to 5.0E13 vg / kg. In some embodiments, ERT withdrawal can occur at the time of administration of the rAAV expressing a GAA, or about 24 or 26 weeks after administration of the recombinant AAV. In some embodiments, therapeutic correction of disease pathophysiology by administration of a rAAV expressing a GAA disclosed herein can occur even in the absence of ERT, and there can also be protection against immune responses to the expressed hGAA, for example, as measured by antibodies against the expressed hGAA. Thus, subjects with Pompe disease administered an AAV expressing hGAA disclosed herein can have long-term cessation of ERT, as further discussed, for example, in International Patent Application No. PCT / US2023 / 013713, the entire contents of which are incorporated herein by reference.

[0361] In some embodiments, the dose of rAAV vector or rAAV genome administered to a subject in accordance with the methods for treating Pompe disease disclosed herein depends on the mechanism of administration, the promoter used, the signal peptide used, the severity of Pompe disease or other condition being treated and / or prevented, the condition of the individual subject, the particular viral vector or capsid, the liver-specific promoter used, and the nucleic acid being delivered, including, but not limited to, the nucleic acid encoding a signal peptide attached 5' to the nucleic acid encoding an expressible GAA polypeptide, and can be determined by routine methods.

[0362] In some embodiments, a therapeutically effective amount of a GAA-expressing rAAV vector is an amount that results in a steady-state serum GAA concentration similar to the pharmacological activity of GAA achieved by long-term GAA ERT (e.g., within 5%, 10%, or 20% of such a level). For example, the steady-state target GAA serum concentration is in the range of about 160 to ≦2,260 nmol / mL / hour, about 189 to ≦2,260 nmol / mL / hour, or about 410 to ≦2,260 nmol / mL / hour. In some embodiments, the dose of a GAA-expressing rAAV vector is a therapeutically effective amount that achieves a steady-state target GAA serum concentration that confers a pharmacological activity range of 189 to ≦2,260 nmol / mL / hour. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that increases tissue GAA levels in a subject to >0.30 μmol 4MU / min / gram tissue, and the normal range of tissue GAA content in subjects without Pompe disease is 0.36±0.13 μmol 4MU / min / gram tissue. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that increases tissue GAA levels in a subject to between 0.25-0.4 μmol 4MU / min / gram tissue. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that results in a normal tissue GAA content of about 0.36 μmol 4MU / min / gram of tissue, e.g., about 0.25, or about 0.26, or about 0.27, or about 0.28, or about 0.29, or about 0.30, or about 0.31, or about 0.32, or about 0.33, or about 0.34, or about 0.35, or about 0.36, or about 0.37, or about 0.38, or about 0.39, or about 0.40 μmol 4MU / min / gram of tissue.

[0363] In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that increases tissue GAA levels in a subject to between 0.1 and 0.5 μmol 4MU / min / gram tissue. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that results in normal tissue GAA content greater than about 0.36 μmol 4MU / min / gram tissue. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that increases tissue GAA content or levels in a subject to between 0.2 and 0.4 μmol 4MU / min / gram tissue. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that increases tissue GAA content in a subject to within 40%, or within 30%, or within 20%, or within 10%, or within 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% of the normal muscle tissue GAA content of 0.36±0.13 (μmol 4MU / min / gram tissue), where normal muscle tissue GAA content is the reference level of GAA in subjects without Pompe disease. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that increases tissue GAA content in a subject to greater than 0.1 mol 4MU / min / gram tissue, where the normal range of GAA content in subjects with Pompe disease is 0.05±0.04 (μmol 4MU / min / gram tissue). In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that increases tissue GAA content in the subject by more than 2-fold, or 3-fold, or 4-fold, or 5-fold, or 6-fold, or 7-fold, or 8-fold, or 9-fold, or more than 10-fold the level of GAA tissue content in a subject with Pompe. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that increases tissue GAA content in the subject by about 50%, or about 40%, or about 30%, or about 20%, or about 10%, or about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2%, or about 1% of the level of GAA tissue content in a subject with Pompe.In some embodiments, GAA activity in muscle is at least 1.5-fold, at least 2-fold, at least 3-fold, at least 5-fold, at least 8-fold, or at least 10-fold increased compared to levels before AAV administration, hi some embodiments, GAA activity in muscle is at least 1.5-fold, at least 2-fold, at least 3-fold, at least 5-fold, at least 8-fold, or at least 10-fold increased compared to levels after at least about 24 weeks of withdrawal from long-term ERT.

[0364] In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that reduces tissue glycogen levels in a subject to within 0.25% wet tissue weight to about 1.5% wet tissue weight. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that reduces muscle tissue glycogen levels in a subject to within 40%, or within 30%, or within 20%, or within 10%, or within 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% of the normal muscle tissue glycogen content of 0.99%±0.74 (% wet tissue weight), which is the normal muscle tissue glycogen content (measured as % wet tissue weight) in subjects without Pompe disease.

[0365] In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount of GAA that exhibits a 3-5 fold improvement in therapeutic index.

[0366] In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that results in the subject having clinically stable levels of hGAA 10 weeks, or at least 20 weeks, or 30 weeks after AAV administration.

[0367] In embodiments, as used herein, without limitation, the term "effective amount" is synonymous with "therapeutically effective amount," "effective dose," or "therapeutically effective dose." In embodiments, the effectiveness of the therapeutic compounds disclosed herein for treating Pompe disease can be determined by observing an improvement in an individual based on, without limitation, one or more clinical symptoms and / or physiological indicators associated with Pompe disease. In embodiments, an improvement in symptoms associated with Pompe disease can be indicated by a reduced need for concomitant treatment.

[0368] In some embodiments, an exemplary dose to achieve a therapeutic effect of an rAAV vector expressing hGAA disclosed herein is 1.0 E 9 vg / kg~5.0E 11 In some embodiments, the dose administered to a subject is in the range of at least about 1.0 E 9 vg / kg, at least about 1.0E 10vg / kg, at least about 1.0E11vg / kg, at least about 1.0E12vg / kg, about 1.1E12vg / kg, about 1.2E12vg / kg, about 1.3E12vg / kg, about 1.4E12vg / kg, about 1.5E12vg / kg, about 1.6E12vg / kg, about 1.7E12vg / kg, about 1.8E12vg / kg, about 1.9E12vg / kg, about 2.0E12vg / kg, about 3.0E12vg / kg, about 4.0E12vg / kg, about 5.0E12vg / kg, about 6.0E12vg / kg, about 7.0E12vg / kg, about 8.0E12vg / kg, about 9.0E12vg / kg g, about 1.0E13vg / kg, about 1.2E13vg / kg, about 1.2E13vg / kg, about 1.2E13vg / kg, about 1.3E13vg / kg, about 1.4E13vg / kg, about 1.5E13vg / kg, about 1.6E13vg / kg, about 1.7E13vg / kg, about 1.8E13vg / kg, about 1.9E13vg / kg, about 2.0E13vg / kg, about 3.0E13vg / kg, about 4.0E13vg / kg, about 5.0E13vg / kg, about 6.0E13vg / kg, about 7E13vg / kg, about 8E13vg / kg, about 9E13vg / kg, or about 10E14vg / kg. In some embodiments, rAAV administration is accompanied by an immune modulator, such as prednisone, methotrexate, or a combination thereof. In some embodiments, the rAAV of the present invention is packaged within an AAV XL 32 or AAV XL 32.1 capsid.

[0369] In a preferred embodiment, exemplary doses for achieving a therapeutic effect according to the methods disclosed herein are 1.2E12 to 4.0E12 vg / kg, e.g., at least about 1.0E12 vg / kg, about 1.1E12 vg / kg, about 1.2E12 vg / kg, about 1.3E12 vg / kg, about 1.4E12 vg / kg, about 1.5E12 vg / kg, about 1.6E12 vg / kg, about 1.7E12 vg / kg, about 1.8E12 vg / kg, about 1.9E12 vg / kg, about 2.0E12 vg / kg, about 2.1E12 vg / kg, about 2.2E12 vg / kg, g, about 2.3E12vg / kg, about 2.4E12vg / kg, about 2.5E12vg / kg, about 2.6E12vg / kg, about 2.7E12vg / kg, about 2.8E12vg / kg, about 2.9E12vg / kg, about 3.0E12vg / kg, about 3.1E12vg / kg, about 3.2E12vg / kg, about 3.3E12vg / kg, about 3.4E12vg / kg, about 3.5E12vg / kg, about 3.6E12vg / kg, about 3.7E12vg / kg, about 3.8E12vg / kg, about 3.9E12vg / kg, and about 4.0E12vg / kg.

[0370] In a preferred embodiment, exemplary doses for achieving a therapeutic effect according to the methods disclosed herein are 1.0E11vg / kg to 5.0E13vg / kg, e.g., 1.0E11vg / kg, 1.1E11vg / kg, 1.2E11vg / kg, 1.3E11vg / kg, 1.4E11vg / kg, 1.5E11vg / kg, 1.6E11vg / kg , 1.7E11vg / kg, 1.8E11vg / kg, 1.9E11vg / kg, approximately 1.0E12vg / kg, approximately 1.1E12vg / kg, approximately 1.2E12vg / kg, approximately 1 .3E12vg / kg, approximately 1.4E12vg / kg, approximately 1.5E12vg / kg, approximately 1.6E12vg / kg, approximately 1.7E12vg / kg, approximately 1.8E12vg / kg, approximately 1. 9E12vg / kg, approximately 2.0E12vg / kg, approximately 3.0E12vg / kg, approximately 4.0E12vg / kg, approximately 5.0E12vg / kg, approximately 6.0E12vg / kg, approximately 7. 0E12vg / kg, approx. 8.0E12vg / kg, approx. 9.0E12vg / kg, approx. 1.0E13vg / kg, approx. 1.2E13vg / kg, approx. 1.2E13vg / kg, approx. 1.2 The titers are about 1.0E13vg / kg, about 1.3E13vg / kg, about 1.4E13vg / kg, about 1.5E13vg / kg, about 1.6E13vg / kg, about 1.7E13vg / kg, about 1.8E13vg / kg, about 1.9E13vg / kg, about 2.0E13vg / kg, about 3.0E13vg / kg, about 4.0E13vg / kg, and about 5.0E13vg / kg.

[0371]

[0372] In some embodiments of the rAAV vectors expressing hGAA disclosed herein useful for methods for treating Pompe disease, exemplary doses to achieve a therapeutic effect are titers of at least about 1.0E12 to 4.0E12 vg / kg, or about 1.2E12 to 3.0E12 vg / kg, or about 1.2E12 to 2.5E12 vg / kg, or about 2.5E12 to 4.0E12 vg / kg.

[0373] In some embodiments, the dosage may be modified by one skilled in the art; for example, the administered dose may be lower than 1.0E12 vg / kg or lower than about 5.0E11 vg / kg when a promoter stronger than the LSP of SEQ ID NO: 97 is operably linked to a nucleic acid encoding GAA. In contrast, in alternative embodiments, the dosage may be modified by one skilled in the art; for example, the administered dose of the rAAV vector may be higher than about 1.6E12 vg / kg or higher than about 5.0E12 vg / kg when a liver-specific promoter weaker than the LSP of SEQ ID NO: 97 used in the AAV8-LSPhGAA vector is operably linked to a nucleic acid encoding GAA. An exemplary dose to achieve a therapeutic effect is at least about 1.0E12 vg / kg. 5 , 1.0E 6 , 1.0E 7 , 1.0E 8 , 1.0E 9 , 1.0E 10 , 1.0E 11 , 1.0E 12 vg / kg, as needed, approximately 1.0E 10 ~approx. 1.0E 12 The titer of transducing units (vg / kg) and the dose, if necessary, is approximately 4.0E 12 Not to exceed vg / kg, or approximately 3.0E, if necessary 12 Transducing units (vg / kg).

[0374] In one embodiment, a percentage of an administered dose of an rAAV vector expressing hGAA disclosed herein is not retained in the liver following administration, for example, for at least 1, 2, 3, 4 weeks, or longer, following administration.

[0375] In one embodiment, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, %, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or less is maintained in the liver after administration, for example, at least 1, 2, 3, 4, or more weeks after administration.

[0376] In one embodiment, the administered rAAV vector expressing hGAA disclosed herein is 1.0E 9 vg / kg or less ~ 5.0E 11 vg / kg is maintained in the liver after administration, for example, for at least 1, 2, 3, 4 weeks, or longer after administration.

[0377] In one embodiment, the administered rAAV vector expressing hGAA disclosed herein is 1.0E 9 vg / kg, 1.0E 10vg / kg, 1.0E11vg / kg, 1.0E12vg / kg, 1.1E12vg / kg, 1.2E12vg / kg, 1.3E12vg / kg, 1.4E12vg / kg, 1.5E12vg / kg, 1.6E12vg / kg, 1.7E12vg / kg, 1.8 E12vg / kg, 1.9E12vg / kg, 2.0E12vg / kg, 3.0E12vg / kg, 4.0E12vg / kg, 5.0E12vg / kg, 6.0E12vg / kg, 7.0E12vg / kg, 8.0E12vg / kg, 9.0E12vg / kg, Less than 1.0E13vg / kg, 1.2E13vg / kg, 1.2E13vg / kg, 1.2E13vg / kg, 1.3E13vg / kg, 1.4E13vg / kg, 1.5E13vg / kg, 1.6E13vg / kg, 1.7E13vg / kg, 1.8E13vg / kg, 1.9E13vg / kg, 2.0E13vg / kg, 3.0E13vg / kg, 4.0E13vg / kg, or 5.0E13vg / kg is maintained in the liver following administration, for example, for at least 1, 2, 3, 4, or more weeks following administration.

[0378] In further embodiments, administration of an rAAV vector or rAAV genome according to the methods disclosed herein for treating a subject with Pompe disease can result in the production of a GAA protein with a circulating half-life of 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, or longer.

[0379] In some embodiments, the methods for treating Pompe disease disclosed herein involve a single dose of rAAV expressing hGAA used to treat a subject in a single administration. However, in some embodiments, the administered dose of rAAV can be given to a subject in multiple doses, for example, the dose of rAAV can be divided into subdoses and administered in multiple doses.

[0380] In some embodiments, it is contemplated that the methods for treating Pompe disclosed herein may include multiple administrations of a single dose of rAAV expressing hGAA, i.e., a subject may be treated with booster doses (i.e., second, third, fourth, etc.) of rAAV expressing hGAA after a defined period of time following the initial or first administration. The dose of the booster doses (i.e., second, third, fourth, fifth, etc.) may be the same dose (amount) as the rAAV-hGAA administered in the first administration, or may be a higher or lower dose, depending on the factors described above, including, but not limited to, a therapeutically effective dose for achieving any one or more of one or more Pompe symptoms, including (i) serum GAA levels indicative of a steady state of GAA expression, (ii) reduction of glycogen levels and / or maintenance of glycogen levels within the normal range in muscle, and (iii) muscle and / or lung function within clinically stable levels. As disclosed herein, steady-state GAA expression by the rAAVs disclosed herein is a serum level of GAA in the pharmacologically active range of 165 to ≦2,260 nmol / ml / hr, or 189 to ≦2,260 nmol / mL / hr. Stability of one or more symptoms of Pompe disease can be determined by the clinical stability parameters disclosed herein, including steady-state results in the 6MWT (6-minute walk test) and / or FVC (forced vital capacity) at two consecutive assessments at least three months apart. In some embodiments, a clinically stable level of motor function as determined by the 6MWT is a ≦12% decline from baseline or a decline of less than 43 meters at two consecutive assessments at least three months apart. In some embodiments, a clinically stable level of pulmonary function as determined by FVC% predicted in the standing position is a ≦15% decline from baseline at two consecutive assessments at least three months apart.

[0381] In certain embodiments, the period between administration of the first dose and subsequent doses (i.e., booster doses) of an rAAV vector according to the methods for treating Pompe disclosed herein is selected from any of the following: about 4 months, about 6 months, about 7 months, about 8 months, about 9 months, about 12 months, about 18 months, about 24 months, or about 3 years, about 4 years, about 5 years, or more than 5 years.

[0382] In another embodiment, administration of an rAAV vector or rAAV genome disclosed herein for the treatment of Pompe disease results in a weight gain of, e.g., at least 0.5 pounds, at least 1 pound, at least 1.5 pounds, at least 2 pounds, at least 2.5 pounds, at least 3 pounds, at least 3.5 pounds, at least 4 pounds, at least 4.5 pounds, at least 5 pounds, at least 5.5 pounds, at least 6 pounds, at least 6.5 pounds, at least 7 pounds, at least 7.5 pounds, at least 8 pounds, at least 8.5 pounds, at least 9 pounds, at least 9.5 pounds, at least 10 pounds, at least 10.5 pounds, at least 11 pounds, at least 11.5 pounds, at least 12 pounds, at least 12.5 pounds, at least 13 pounds, at least 13.5 pounds, at least 14 pounds, at least 14.5 pounds, at least 15 pounds, at least 20 pounds, at least 25 pounds, at least 30 pounds, or at least 50 pounds.

[0383] In another embodiment, an AAV GAA of any serotype disclosed herein for the treatment of Pompe disease results in a weight gain of, for example, 0.5 lbs to 50 lbs, 0.5 lbs to 30 lbs, 0.5 lbs to 25 lbs, 0.5 lbs to 20 lbs, 0.5 lbs to 15 lbs, 0.5 lbs to 10 lbs, 0.5 lbs to 7.5 lbs, 0.5 lbs to 5 lbs, 1 lb to 15 lbs, 1 lb to 10 lbs, 1 lb to 7.5 lbs, 1 lb to 5 lbs, 2 lbs to 10 lbs, or 2 lbs to 7.5 lbs. B. Withdrawal of Long-Term ERT

[0384] Treatment of Pompe disease, usually with long-term enzyme replacement therapy (ERT) using recombinant human acid α-glucosidase (rhGAA), has previously been reported to prolong survival in both LOPD and IOPD patients by improving lung and muscle function. However, Schoser et al. reported that after a period of stabilization, both of these parameters continued to decline over time (see Schoser et al., 2017 Neurol, 264: 621-30). Additionally, ERT with recombinant GAA protein has numerous disadvantages, including, but not limited to, the short half-life of administered recombinant GAA in the blood, lack of efficient skeletal muscle uptake, the potential for high-titer antibody responses, and the failure of some patients to respond to ERT, as well as the rigorous administration of recombinant GAA infusions every 2 weeks, which can be taken up within 5–8 hours. And although disease progression is slowed compared to untreated subjects, the benefits of ERT may be short-lived, and many patients die or remain in poor health despite adherence to treatment (Tarnopolsky et al. 2016 Can J Neurol Sci, 43: 472-85).

[0385] The gradually declining efficacy in subjects receiving recombinant GAA protein ERT is partly explained by an immune response to ERT, resulting in the formation of high and persistent anti-GAA antibody titers (HSAT). Subjects with HSAT showed a significantly increased mortality rate compared with patients who did not develop antibodies or developed only low titers of antibodies (Banugaria et al. 2011). Furthermore, the ability of immunosuppression to prevent antibody formation in subjects at risk for HSAT, significantly prolonging survival, confirmed the clinical relevance of HSAT (Mendelsohn et al. 2009; Banugaria et al. 2013; Kazi et al. 2017).

[0386] Subjects with Pompe disease are considered cross-reactive immunoglobulin (CRIM) positive if they have residual GAA enzyme activity and CRIM negative if no residual GAA activity is detected. Based on pooled clinical study data, 28% of Pompe disease cases have the infantile-onset form, of which approximately 85% have the classic infantile-onset form, three-quarters of which are CRIM positive (Kemper, Comeau, and Green 2013). Determining CRIM status in newly diagnosed IOPD patients is important because it allows for the establishment of prophylactic immune modulation measures before initiating ERT, thus offsetting the most damaging effects of HSAT. CRIM-negative Pompe disease subjects developed HSAT and showed significantly reduced efficacy from ERT with rhGAA (Amalfitano et al. 2001). In the first pilot study of ERT in Pompe disease using Chinese hamster ovary cell-derived rhGAA, two subjects who were CRIM-negative produced higher titers of anti-GAA antibodies than a third subject who was CRIM-positive. This corresponded to significantly reduced efficacy of ERT in CRIM-negative subjects. The relationship between antibody formation and treatment efficacy in Pompe disease was highlighted by the poor response of CRIM-negative subjects to ERT, which correlated with the onset of HSAT (Kishnani et al. 2010).

[0387] Although LOPD subjects are not CRIM negative, some mount high antibody responses to rhGAA that may interfere with optimal efficacy of ERT (Patel et al. 2012; de Vries et al. 2017; Lumizyme Package Insert 2014). Additionally, all Pompe subjects mount some level of anti-GAA antibody response, with unknown effects on ERT efficacy.

[0388] In some embodiments, a rAAV vector expressing a GAA polypeptide disclosed herein can be used in a method for treating a subject with Pompe disease, the method comprising administering an AAV expressing hGAA disclosed herein, which allows the subject to have a long-term cessation of long-term ERT administration.In particular, a rAAV vector expressing a GAA polypeptide disclosed herein can be administered to a subject with Pompe disease, which allows the subject to have the ability to reduce or eliminate the clinical need for long-term hGAA ERT administration for a long period of time.

[0389] Accordingly, another aspect of the technology disclosed herein relates to a method for treating Pompe disease by administering to a subject with Pompe disease a composition comprising an rAAV vector expressing a GAA polypeptide disclosed herein. In some embodiments, the method allows a subject with Pompe disease to wean or discontinue long-term administration of recombinant human GAA (rhGAA) ERT, which is typically administered on a weekly or every other week regimen. In some embodiments, the method disclosed herein allows a subject with Pompe disease to discontinue their usual ERT regimen for an extended period of time (e.g., long-term ERT hiatus) when the subject is administered a particular dose of an AAV vector expressing a GAA polypeptide disclosed herein. In some embodiments, weaning from long-term ERT begins approximately at the time (e.g., the day before, the day of, or the day after) of administration of the AAV vector to the subject, or in some embodiments, weaning from long-term ERT can occur about 24 weeks after administration of the AAV vector, or any time within about 24 to 26 weeks after administration of the AAV vector.

[0390] As disclosed herein, "long-term ERT" refers to the standard of care (SOC) treatment for subjects with Pompe disease, including IOPD and LOPD, and is typically a regimen of intravenous administration of recombinant human alglucosidase alpha protein (rhGAA) to a subject on a regular and frequent basis, e.g., weekly or biweekly, without any interruption to the regimen, where the administered rhGAA protein provides an exogenous source of GAA. MYOZYME® (alglucosidase alfa), the first U.S.-approved product for the treatment of Pompe disease in 2006, and LUMIZYME® (alglucosidase alfa), approved in 2010, are exemplary current SOC treatments for infantile-onset and late-onset Pompe disease patients. A typical long-term ERT administration regimen is intravenous administration of alglucosidase alfa as an infusion every two weeks at a dose of 20 mg / kg (LUMIZYME package insert 2014).

[0391] As disclosed herein, in some embodiments, the methods disclosed herein by administering an AAV expressing hGAA disclosed herein allow for weaning or cessation of long-term ERT administration for an extended period of time. In some embodiments, the extended period is at least about 3 months, or at least about 6 months, or at least about 1 year, or longer than 1 year.

[0392] As disclosed herein, "long-term," when referring to a period during which administration of long-term ERT is stopped, refers to a period of more than one month, and in some embodiments, more than up to five missed doses of ERT.

[0393] Thus, in some embodiments, a method for treating a subject with Pompe disease using an AAV expressing hGAA disclosed herein includes administering to the subject a pharmaceutical composition comprising an AAV expressing GAA, wherein the subject is not administered long-term GAA enzyme replacement therapy (ERT) for an extended period of time. In some embodiments, the cessation or withdrawal of long-term ERT occurs any time between 1-2 days after administration of the AAV-GAA vector and at least 24 weeks after administration. That is, in some embodiments, a treated subject may be stopped from administering ERT on the day of, or the day before or the day after, administration of AAV-GAA. In some embodiments, a subject treated by a method disclosed herein may be stopped from ERT about 1 week, or about 2 weeks, or about 3 weeks, or about 1 month, or about 2 months, or about 3 months, or about 4 months, or about 5 months, or about 6 months after administration of AAV-GAA.

[0394] The exact time frame for stopping or pausing ERT for each subject according to the methods disclosed herein can be determined by one skilled in the art, but without wishing to be limited by theory, encompassed herein are methods for treating a subject with Pompe disease by administering an AAV expressing hGAA as disclosed herein, wherein ERT is stopped when the serum GAA level achieved from expression by AAV-hGAA is at least 165 nmol / ml / hour, or at least 189 nmol / ml / hour, for example, close to or approximately a serum level within the pharmacologically active range of 189 to ≦2,260 nmol / mL / hour. In some embodiments, encompassed herein are methods in which ERT is stopped when the serum GAA level achieved from expression by AAV-hGAA is within 50%, or within 60%, or within 70%, or within 80% of a serum level within the pharmacologically active range of 189 nmol / mL / hour. In some embodiments, encompassed herein are methods for treating Pompe disease by administering an AAV expressing an hGAA polypeptide disclosed herein, wherein ERT is terminated at a time when serum GAA levels achieved from expression by AAV-hGAA are within 50%, or within 60%, or within 70%, or within 80% of serum levels within the pharmacologically active range of between 165 and about 2000 nmol / mL / hour.

[0395] In some embodiments, the present invention encompasses the method for treating Pompe disease by administering AAV expressing hGAA polypeptide as disclosed herein, wherein ERT is stopped at the time when the serum GAA level that achieves from normal ERT regimen is replaced by the GAA serum level that achieves from AAV-hGAA expression.For example, as the serum GAA level that results from recombinant hGAA from the last ERT administration decreases, there is a simultaneous increase in the serum GAA level that achieves from AAV-hGAA expression, so that ERT withdrawal or cessation does not cause a decrease in the clinical stability of one or more symptoms of Pompe disease in subjects, as measured by 6MWT or FVC according to the method disclosed herein. For illustrative purposes only, in some embodiments, ERT weaning or cessation occurs when the administered AAV-hGAA results in expressed GAA levels that achieve clinical stability of one or more symptoms of Pompe disease in the subject, e.g., a clinically stable level of motor function as determined by a ≦12% decline in 6MWT or a decrease of less than 43 meters from baseline in two consecutive assessments separated by at least three months, or a clinically stable level of pulmonary function as determined by a ≦15% decline in standing FVC% from baseline in two consecutive assessments separated by at least three months, thus obviating the need for recombinant hGAA since the last ERT administration.

[0396] In some embodiments, methods for treating Pompe disease by administering an AAV expressing an hGAA polypeptide disclosed herein allow for extended cessation of ERT for about 1 year, or about 15 months, or about 18 months, or about 24 months, or about 30 months, or longer than 30 months, while maintaining clinical stability of one or more symptoms of Pompe disease as measured by 6MWT and / or FVC% as disclosed herein.

[0397] Therefore, the rAAV vectors encoding the GAA polypeptides disclosed herein and the methods disclosed herein provide significant benefits to subjects with Pompe disease, including, but not limited to, the reduction or elimination of the rigorous and painful weekly or every other week infusions of long-term rhGAA ERT treatment, which is very time-consuming, geographically restricted, and prevents patients with Pompe disease from traveling for long periods of time from the area where the ERT infusions are administered.In addition, as disclosed herein, the absence of ERT administration also reduces any side effects caused by anti-rhGAA antibodies to ERT and avoids the need for administration of immunosuppressants that are usually co-administered with ERT.Therefore, the methods for treating Pompe disease by administering AAVs expressing hGAA polypeptides disclosed herein provide greater flexibility in Pompe treatment and improve the quality of life and lifestyle of subjects with Pompe disease. C. Administration of complementary ERT

[0398] In some embodiments, the method for treating Pompe disease by administering an AAV expressing a hGAA polypeptide disclosed herein allows a subject to have a break or "drug holiday" from the usual regimen of administering long-term ERT. That is, according to the method disclosed herein, a subject administered an AAV vector expressing a GAA disclosed herein can take a long period of time without administering long-term ERT. Also, in some embodiments, a subject administered an AAV vector expressing a GAA disclosed herein can be administered supplemental ERT after an initial period of withdrawal from long-term ERT administration, where the supplemental ERT is administered about 6 months, about 1 year, or more than 1 year after the cessation of long-term ERT. Thus, the methods for treating Pompe disease by administering an AAV expressing an hGAA polypeptide disclosed herein allow flexibility in the usual long-term ERT administration regimen, allowing for both interruptions in administration or extended absence of long-term ERT that do not result in clinical deterioration, i.e., subjects remain clinically stable despite not having ongoing long-term ERT administration for an extended period of time.

[0399] In some embodiments, the method for treating Pompe disease by administering an AAV expressing a hGAA polypeptide disclosed herein comprises re-administration of ERT after a long period of cessation of ERT administration (referred to herein as "complementary ERT"), allowing for flexibility in the normal ERT regimen, since the continuous production of GAA expressed by AAV allows for flexibility in ERT. In some embodiments, the complementary ERT is pulsed administration of ERT as disclosed herein. In some embodiments, the complementary ERT is administered at less frequent intervals, or at lower doses, or at irregular doses, or at irregular intervals, compared to before administration of long-term ERT.

[0400] In some embodiments, methods for treating Pompe disease by administering an AAV expressing an hGAA polypeptide disclosed herein include resuming ERT (referred to herein as "complementary ERT") after an extended period of at least 6 months to about 1 year of absence from long-term ERT administration. In some embodiments, the complementary ERT can be for a shorter period of time followed by a second extended period of ERT cessation. In some embodiments, the complementary ERT can be for any period of time between 3 months and about 2 years, e.g., about 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, or about 1 year.

[0401] In some embodiments, the method for treating Pompe disease by administering an AAV expressing a hGAA polypeptide disclosed herein comprises administering a rAAV expressing GAA to a subject with Pompe disease, and the administration of long-term ERT continues after the administration of the recombinant AAV. However, the ERT is administered at a lower dose and / or frequency than before the administration of the recombinant AAV vector. For example, after the administration of the AAV vector, the long-term ERT can be administered every 3 weeks, once a month, every other month, once every 3 months, every 4 months, every 5 months, or every 6 months for at least 24 weeks after the administration of AAV-GAA. In one embodiment, the dosage of the long-term ERT can be reduced. In one method, a pulsed administration regimen of long-term ERT can be used after the administration of the AAV vector, so that irregular dosing schedules and / or amounts can be used. As discussed herein, in some embodiments, the administration of long-term ERT can be discontinued at 24 weeks or earlier, as disclosed herein.

[0402] In some embodiments, due to the continuous expression of GAA by the administered AAV vector, the methods disclosed herein allow for the flexibility of administering both long-term ERT or supplemental ERT, so that if a subject is scheduled to miss one or more ERT doses of a long-term ERT or supplemental ERT regimen, or if the subject inadvertently or unintentionally misses one or more ERT doses, the subject maintains clinical stability.Currently, if ERT is missed, a large amount of ERT is required to return to the same clinical level.

[0403] In some embodiments, the complementary ERT is administered at less frequent intervals, or at lower doses, or at irregular doses, or at irregular intervals, compared with before the administration of long-term ERT.For example, in some embodiments, the dose of rhGAA administered in the complementary ERT is less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, less than 55%, less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 2%, or less than 1% of the usual dose of rhGAA administered in the long-term ERT regimen.

[0404] In some embodiments, supplemental ERT is administered as a pulse dose.In alternative embodiments, the subject who receives the rAAV vector composition disclosed herein can interrupt or discontinue the regular dosing regimen of long-term ERT administration or supplemental ERT, so long-term ERT or supplemental ERT is administered by pulse dose.For example, in some embodiments, the administration of long-term ERT or supplemental ERT can be administered by pulse dose.In certain embodiments, the subject who receives the composition can have pulse dose of long-term ERT or supplemental ERT.

[0405] In certain embodiments, pulsed administration of complementary ERT is administered to a subject to maintain clinical stability and / or maintain serum GAA levels below 189 nmol / hour. * It is suitable, provided that the AAV vector compositions disclosed herein are administered at a dose sufficient to maintain continuous expression of GAA at or above that level (e.g., during an entire period of ERT interruption or "ERT holiday" during which regularly scheduled ERT is not administered). In certain embodiments, the methods disclosed herein allow a subject to receive pulsed administration of complementary ERT throughout the subject's lifetime.

[0406] In some embodiments, the regimen of administration of the complementary ERT can have intermittent interruptions during which the administration of the ERT is discontinued (e.g., during an interruption or "ERT holiday" during which the regimen of administration of the ERT is discontinued).

[0407] In some embodiments, the method includes administering the complementary ERT in a pulsed manner, wherein the pulsed administration of the complementary ERT is at least monthly, at least every other month, or at least every six months, or at least annually, or every other year. The methods disclosed herein are for the continuous expression of GAA in a subject and for maintaining serum GAA levels above 189 nmol / hour. * Since the pulsed administration method includes administering an AAV vector at a dose sufficient to maintain the patient at or above the rhGAA protein level, when complementary ERT is administered, the pulsed administration can substantially reduce the amount of ERT administered to the patient per dose or per total treatment regimen, with increased efficacy, allowing for increased flexibility in ERT administration regimens. This represents a significant savings in time, effort, and cost, and more importantly, an improvement in quality of life for Pompe patients, as well as a lower ERT dose that may reduce any side effects, including anti-GAA antibodies to the administered rhGAA protein.

[0408] In some embodiments, the administration of the complementary ERT is pulsed. In certain embodiments, the pulsed administration comprises administering the complementary ERT for about 8 weeks, followed by about 4 weeks without administering the complementary ERT. In some embodiments, the pulsed administration comprises administering the complementary ERT for about 6 weeks (i.e., 6 weekly infusions, or 3 infusions every 2 weeks), followed by about 2 weeks without administering the complementary ERT. In certain embodiments, the pulsed administration comprises administering the complementary ERT for about 4 weeks, followed by about 2 weeks without administering the complementary ERT. In some embodiments, the pulsed administration comprises administering the complementary ERT for about 2 weeks, followed by about 2 weeks without administering the complementary ERT. D. Absence of long-term immunosuppression

[0409] In another aspect, the present technology relates to a method for treating Pompe disease by administering an AAV expressing an hGAA polypeptide as disclosed herein, wherein the composition comprising an AAV-GAA vector is administered to a subject without ongoing immunosuppression, i.e., in some embodiments, immunosuppression is not administered to the subject for an extended period of time.

[0410] In some embodiments, an immunosuppressant or immunomodulator is administered to a subject intermittently or for a temporary period, for example, as immunoprophylaxis to the subject to prevent or reduce any immune response to the administered AAV vector, thus allowing subsequent or booster administration of an AAV vector expressing GAA according to the methods disclosed herein, if necessary.

[0411] In some embodiments, the immune modulator is administered at or around the time when the AAV vector expressing GAA disclosed herein is administered to the subject. For example, the immune modulator is administered starting about 24 hours before the AAV vector expressing GAA is administered to the subject. In some embodiments, the immune modulator is administered starting about 24 hours before AAV administration and is administered at least 1 day, or at least 2 days, or at least 3 days, or at least 4 days, or at least 5 days, or at least 6 days, or about 1 week, or more than 1 week after the administration of the AAV vector expressing GAA. In some embodiments, the immune modulator is administered starting at or about 24 hours before AAV administration and is administered within 1 day, or within 2 days, or within 3 days, or within 4 days, or within 5 days, or within 6 days, or within 1 week, or within 2 weeks, or within 3 weeks, or within 1 month after the administration of the AAV vector expressing GAA.

[0412] In some embodiments, the immune modulator is administered to a subject at gradually decreasing doses, e.g., a first dose for a first period, a second lower dose for a second period, and a third dose lower than the second dose for a third period, until an immune response to the AAV or GAA no longer occurs. For example, in some embodiments, the first dose of the immune modulator is administered starting at or about 24 hours before AAV administration and is administered for at least 1 day, or at least 2 days, or at least 3 days, or at least 4 days, or at least 5 days, or at least 6 days, or about 1 week, or about 2 weeks, or about 3 weeks, or about 4 weeks, after which the immune modulator is reduced to a third dose (lower than the second dose) for a third period (e.g., at least 1 day, or at least 2 days, or at least 3 days, or at least 4 days, or at least 5 days, or at least 6 days, or about 1 week).

[0413] For illustrative purposes only, in some embodiments, a method for treating Pompe disease disclosed herein includes administering an immunosuppressant, i.e., prednisone, as immunoprophylaxis, at a first dose of 60 milligrams (given orally) beginning 24 hours prior to AAV vector administration. In some embodiments, prednisone is continued at 60 mg / day po until the completion of week 4 after vector administration, after which, beginning at week 5, the prednisone dose is tapered to a second dose level of 55 mg / day po and maintained for 7 days. In some embodiments, beginning at week 6, the dose is tapered to a third dose level of 50 mg / day po and maintained for 7 days, etc., such that the immunosuppressant (i.e., prednisone) dose is tapered by 5 mg / day per week after 4 weeks of the initial immunosuppressant dose.

[0414] The use of prednisone is exemplified herein as an immunosuppressant for immunoprophylaxis in accordance with the methods disclosed herein, however, it is contemplated that prednisone can be readily substituted with different immune modulators and administration regimens known to those skilled in the art.

[0415] In some embodiments, conventional immunoprophylaxis to prevent immune reactivity to the expressed GAA is stopped or withdrawn on day 1, or immediately before or after administration of the rAAV expressing GAA according to the methods disclosed herein. (i) Immunomodulation and immunosuppression:

[0416] As disclosed herein, in some embodiments, a method for treating Pompe disease by administering to a subject an AAV expressing a hGAA polypeptide disclosed herein without ongoing immunosuppression. That is, in some embodiments, immunosuppression is not administered chronically to the subject, but is administered only for a short and predefined period after administration of the AAV vector expressing GAA to the subject, including an initial period (at an initial dose) and a tapering period (at a gradual tapering dose). Thus, in some embodiments, immunosuppression is administered for 4 weeks to a maximum of about 15 weeks after administration of the AAV vector expressing GAA to the subject, and can be administered at the initial and tapering doses disclosed herein.

[0417] Thus, in some embodiments, methods and compositions using the AAV vectors and AAV genomes described herein for treating Pompe further comprise administering an immune modulator over an initial period followed by a tapering period, hi some embodiments, the immune modulator can be administered at the time of rAAV vector administration, before administration of the rAAV vector, or after administration of the rAAV vector.

[0418] In any embodiment of the methods and compositions disclosed herein, a subject receiving an rAAV vector or rAAV genome disclosed herein is also administered an immunosuppressant. Various methods are known for immunosuppressing the immune response of a patient receiving AAV. Methods known in the art include administering an immunosuppressant, such as a proteasome inhibitor, to the patient. For example, one such proteasome inhibitor known in the art is bortezomib, disclosed in U.S. Patent No. 9,169,492 and U.S. Patent Application No. 15 / 796,137, both of which are incorporated herein by reference. In some embodiments, the immunosuppressant can be an antibody, including polyclonal, monoclonal, scfv, or other antibody-derived molecules that can suppress the immune response, for example, through the elimination or suppression of antibody-producing cells. In further embodiments, the immunosuppressant element can be a short hairpin RNA (shRNA). In such embodiments, the coding region for the shRNA is included in the rAAV cassette and is generally located 3' downstream of the polyA tail. shRNAs can be targeted to reduce or eliminate expression of immune stimulators such as cytokines, growth factors (including transforming growth factors β1 and β2, TNF, and others publicly known).

[0419] In some embodiments, the immune modulator is an immunoglobulin-degrading enzyme such as IdeS, IdeZ, IdeS / Z, Endo S, or a functional variant thereof. Non-limiting examples of references to such immunoglobulin-degrading enzymes and their uses are described in US 7,666,582, US 8,133,483, US 20180037962, US 20180023070, US 20170209550, US 8,889,128, WO 2010 / 057626, US 9,707,279, US 8,323,908, US 20190345533, US 20190262434, and WO 2020 / 016318, each of which is incorporated by reference in its entirety.

[0420] In some embodiments, the immunomodulator or immunosuppressant is a proteasome inhibitor.In certain aspects, the proteasome inhibitor is bortezomib.In some aspects of the embodiment, the immunomodulator comprises bortezomib and the anti-CD20 antibody rituximab.In other aspects of the embodiment, the immunomodulator comprises bortezomib, rituximab, methotrexate, and intravenous gamma globulin.Non-limiting examples of such references that disclose proteasome inhibitors and their combinations with rituximab, methotrexate, and intravenous gamma globulin are described in US10,028,993, US9,592,247, and US8,809,282, each of which is incorporated by reference in its entirety. For example, one such proteasome inhibitor known in the art is bortezomib, disclosed in US Pat. No. 9,169,492 and US patent application Ser. No. 15 / 796,137, both of which are incorporated herein by reference.

[0421] In another embodiment, the immunosuppressant may be an antibody, including a polyclonal, monoclonal, scfv, or other antibody-derived molecule that can suppress the immune response, for example, through the elimination or suppression of antibody-producing cells. In a further embodiment, the immunosuppressive element may be a short hairpin RNA (shRNA). In such an embodiment, the coding region for the shRNA is included in the rAAV cassette and is generally located 3' downstream of the polyA tail. The shRNA may be targeted to reduce or eliminate the expression of immune stimulatory agents, such as cytokines, growth factors (including transforming growth factors β1 and β2, TNF, and others publicly known).

[0422] In alternative embodiments, the immunomodulator is an inhibitor of the NF-kB pathway. In certain embodiments, the immunomodulator is rapamycin or a functional variant. Non-limiting examples of references disclosing rapamycin and its uses are described in US10,071,114, US20160067228, US20160074531, US20160074532, US20190076458, and US10,046,064, which are incorporated in their entirety. In other embodiments, the immunomodulator is a synthetic nanocarrier comprising an immunosuppressant. Non-limiting examples of immunosuppressant drugs, immunosuppressant drugs coupled to synthetic nanocarriers, synthetic nanocarriers comprising rapamycin, and / or tolerogenic synthetic nanocarriers, their dosages, administration, and uses references include US20150320728, US20180193482, US20190142974, US20150328333, US20160243253, US10,039,822, US20190076522, US20160022650, US10,441,651, US1 US20150320870, US2014035636, US10,434,088, US10,335,395, US20200069659, US10,357,483, US20140335186, US10,668,053, US10,357,482, US20160128986, US20160128987, US20200038462, US20200038463, each of which is incorporated by reference in its entirety.

[0423] In some embodiments, the immune modulator is a synthetic nanocarrier (ImmTOR™ nanoparticles) comprising rapamycin, as disclosed in US20200038463, U.S. Patent No. 9,006,254 (Kishimoto, et al., 2016, Nat Nanotechnol, 11(10): 890-899; Maldonado, et al., 2015, PNAS, 112(2): E156-165), each of which is incorporated herein by reference in its entirety. In some embodiments, the immune modulator is an engineered cell, for example, an immune cell modified using SQZ technology as disclosed in WO2017192786, which is incorporated herein by reference in its entirety.

[0424] In some embodiments, the immune modulator is Poly ICLC, 1018 ISS, aluminum salts, Amplivax, AS15, BCG, CP-870,893, CpG7909, CyaA, dSLIM, GM-CSF, IC30, IC31, Imiquimod, ImuFact IMP321, IS Patch, ISS, ISCOMATRIX, Juvlmmune, LipoVac, MF59, monophosphoryl lipid A, Montanide IMS 1312, Montanide ISA 206, Montanide ISA 50V, Montanide In another further embodiment, the immune modulator or adjuvant is selected from the group consisting of ISA-51, OK-432, OM-174, OM-197-MP-EC, ONTAK, PEPTEL, vector systems, PLGA microparticles, resiquimod, SRL172, virosomes and other virus-like particles, YF-17D, VEGF trap, R848, beta-glucan, Pam3Cys, and Aquila's QS21 stimulon.

[0425] In some embodiments, the immune modulator is a small molecule that inhibits the innate immune response in cells, such as chloroquine (a TLR signaling inhibitor) and 2-aminopurine (a PKR inhibitor), and can also be administered in combination with a composition comprising at least one rAAV vector disclosed herein. Some non-limiting examples of commercially available TLR signaling inhibitors include BX795, chloroquine, CLI-095, OxPAPC, polymyxin B, and rapamycin (all available from INVIVOGEN™). In addition, inhibitors of pattern recognition receptors (PRRs) (involved in innate immune signaling), such as 2-aminopurine, BX795, chloroquine, and H-89, can also be used in compositions and methods comprising at least one rAAV vector disclosed herein for in vivo protein expression.

[0426] In some embodiments, the rAAV vector can also encode a negative regulator of innate immunity, such as NLRX1. Thus, in some embodiments, the rAAV vector can optionally encode one or more of NLRX1, NS1, NS3 / 4A, or A46R, or any combination thereof. In addition, in some embodiments, a composition comprising at least one rAAV vector disclosed herein can also include a synthetic modified RNA encoding an inhibitor of the innate immune system to avoid an innate immune response generated by a tissue or subject.

[0427] In some embodiments, the immune modulator for use in the administration methods disclosed herein is an immunosuppressant. As used herein, the term "immunosuppressant drug or immunosuppressant" is intended to include pharmaceutical agents that inhibit or interfere with normal immune function. Examples of immunosuppressants suitable for the methods disclosed herein include agents that inhibit the T cell / B cell costimulatory pathway, such as agents that prevent the coupling of T cells and B cells via the CTLA4 and B7 pathways disclosed in U.S. Patent Publication No. 2002 / 0182211. In one embodiment, the immunosuppressant is cyclosporin A. Other examples include mycophenolate mofetil, rapamicin, and antithymocyte globulin. In one embodiment, the immunosuppressant is administered in a composition comprising at least one rAAV vector disclosed herein, or in a separate composition, but can be administered simultaneously with, before, or after administration of a composition comprising at least one rAAV vector according to the methods of administration disclosed herein. The immunosuppressant is administered to the subject in a formulation compatible with the route of administration and in a dosage sufficient to achieve the desired therapeutic effect, hi some embodiments, the immunosuppressant is administered transiently for a time sufficient to induce tolerance to the rAAV vectors disclosed herein.

[0428] Various methods are known for immunosuppressing the immune response of patients receiving AAV. Methods known in the art include administering to patients an immunosuppressant, such as a proteasome inhibitor. For example, one such proteasome inhibitor known in the art is bortezomib, disclosed in U.S. Patent No. 9,169,492 and U.S. Patent Application No. 15 / 796,137, both of which are incorporated herein by reference. In some embodiments, the immunosuppressant can be an antibody, including polyclonal, monoclonal, scfv, or other antibody-derived molecules that can suppress the immune response, for example, through the elimination or suppression of antibody-producing cells. In further embodiments, the immunosuppressive element can be a short hairpin RNA (shRNA). In such embodiments, the coding region of the shRNA is included in the rAAV cassette and is generally located 3' downstream of the polyA tail. shRNAs can be targeted to reduce or eliminate expression of immune stimulators such as cytokines, growth factors (including transforming growth factors β1 and β2, TNF, and others publicly known).

[0429] The use of such immune modulating agents facilitates the ability to use multiple dosages (e.g., multiple administrations) over the course of months and / or years, which allows for the use of multiple agents, e.g., rAAV vectors encoding multiple genes, or multiple administrations to a subject, as discussed below.

[0430] In some aspects of the present invention, recombinant AAVs containing nucleic acids encoding human GAA are produced by a triple transfection method using closed-ended linear double-stranded DNA molecules lacking bacterial backbone sequences, such as those described in PCT / US2021 / 013689, published as WO / 2021 / 146591, the entire contents of which are incorporated herein by reference. In some embodiments, rAAVs of the present invention are produced using plasmid DNA as the starting material. In some embodiments, rAAVs of the present invention are produced using closed-ended linear double-stranded DNA as the starting material. Non-limiting examples of closed-ended linear double-stranded nucleic acids include dog-bone DNA (dbDNA) or dumbbell-shaped DNA. Closed-ended linear double-stranded nucleic acids can be produced intracellularly or using an in vitro cell-free system. The cell-free in vitro synthesis of dumbbell-shaped DNA and dogbone-shaped DNA is described in U.S. Patent No. 6,451,563; Efficient production of superior dumbbell-shaped DNA minimal vectors for small hairpin RNA expression-Nucleic Acids Res. 2015 Oct 15; 43(18): e120; High-Purity Preparation of a Large DNA Dumbbell-Antisense & nucleic acid drug development 11:149-153 (2001); U.S. Patent No. 9,109,250; U.S. Patent No. 9,499,847; U.S. Patent No. 10,501,782; and WO2018033730A1, all of which are incorporated herein by reference in their entirety. DNA derived from cell-free in vitro synthesis lacks any prokaryotic DNA modification (e.g., is substantially free of bacterial DNA).

[0431] One example of an in vitro process for producing closed linear DNA (e.g., containing the ITRs described herein) includes: (a) contacting a DNA template flanked on either side by protelomerase target sequences with at least one DNA polymerase in the presence of one or more primers under conditions that promote amplification of the template; and (b) contacting the amplified DNA produced in (a) with at least one protelomerase under conditions that promote the formation of a closed linear expression cassette DNA. The closed linear DNA can be a closed DNA expression cassette DNA product that can comprise, consist of, or consist essentially of a eukaryotic promoter operably linked to a coding sequence of interest and, optionally, a eukaryotic transcription termination sequence. The closed linear expression cassette DNA product may further lack one or more bacterial or vector sequences, typically selected from the group consisting of: (i) a bacterial origin of replication; (ii) a bacterial selectable marker (typically an antibiotic resistance gene); and (iii) an unmethylated CpG motif. E. Pharmaceutical Compositions

[0432] The rAAV vectors disclosed herein for use in the methods of administration disclosed herein can be formulated into pharmaceutical compositions with a pharmaceutically acceptable excipient, i.e., one or more pharmaceutically acceptable carrier substances and / or additives, such as buffers, carriers, excipients, stabilizers, etc. The pharmaceutical composition may also be provided in the form of a kit. Pharmaceutical compositions comprising the rAAV vectors disclosed herein for use in the methods of administration disclosed herein, and their uses, are known in the art.

[0433] Accordingly, a further aspect of the present invention provides pharmaceutical compositions comprising the rAAV vectors disclosed herein for use in the methods of administration disclosed herein. The relative amounts of the active ingredient (e.g., the rAAV vectors disclosed her...

Claims

1. Within that genome, a. 5' and 3' AAV inverted terminal repeat (ITR) sequences, and b. A heteronucleotide that encodes all or part of an endogenous GAA signal peptide, or a heterologous signal peptide or a combination thereof, fused to the N-terminus of an alpha-glucosidase (GAA) polypeptide located between the 5'ITR and the 3'ITR and containing amino acid residues corresponding to amino acids 28-952, 35-952, 40-952, 50-952, 57-952, 60-952, 68-952, 69-952, 70-952, 72-952, or 74-952 of SEQ ID NO: 1, The nucleic acid may be codon-optimized and further operably linked to a liver-specific promoter, heterologous nucleic acid A recombinant adeno-associated virus (rAAV) vector containing this virus.

2. The recombinant AAV vector according to claim 1, wherein the codon-optimized nucleic acid encoding the GAA polypeptide is selected from the group consisting of SEQ ID NOs: 3 to 18 or functional fragments thereof.

3. The recombinant AAV vector according to claim 1, wherein the genome further comprises at least one of UTR or reverse RNA poll II terminator sequences.

4. The recombinant AAV vector according to claim 1, wherein the genome comprises the nucleotide sequence of SEQ ID NO: 23 or a functional variant thereof.

5. The recombinant AAV vector according to claim 1, wherein the signal peptide is a heterologous signal peptide.

6. The recombinant AAV vector according to claim 1, wherein the GAA polypeptide comprises amino acid residues corresponding to amino acids 28 to 952 of SEQ ID NO: 1, or amino acid residues corresponding to amino acids 57 to 952 of SEQ ID NO:

1.

7. The AAV genome is in the direction from 5' to 3', a. 5'ITR, b. Liver-specific promoter, c. 5'UTR, d. A nucleic acid encoding part or all of the endogenous GAA signal peptide, or a heterologous signal peptide, or a combination thereof, e. A nucleic acid encoding an alpha-glucosidase (GAA) polypeptide, wherein the GAA polypeptide is functionally active. f. Poly-A signal, and g. Reverse RNA Pol II Terminator Sequence A recombinant AAV vector according to claim 1, comprising:

8. The recombinant AAV vector according to claim 3, wherein the UTR is 5' or 3'.

9. The recombinant AAV vector according to claim 1, wherein the signal peptide is selected from any of the following: endogenous GAA signal peptide, fibronectin signal peptide (FN1), IL-2 wt signal peptide, modified IL-2 signal peptide, IL2(1-3) signal peptide, IgG signal peptide, AAT signal peptide, A2M signal peptide, or PZP signal peptide, or active fragments thereof having signal peptide activity.

10. The recombinant AAV vector according to claim 1, wherein the nucleic acid sequence encodes a GAA polypeptide having the amino acid sequence of SEQ ID NO: 1, or a polypeptide having at least 80% sequence identity with SEQ ID NO: 1, where amino acid residue 199 is R (199R), amino acid residue 223 is H (223H), and amino acid residue 780 is I (780I).

11. The recombinant AAV vector according to claim 8, wherein the 5'UTR includes SEQ ID NO: 40 or SEQ ID NO: 41, or has a nucleotide sequence having at least 80% sequence identity with SEQ ID NO: 40 or SEQ ID NO:

41.

12. The recombinant AAV vector according to claim 1, further comprising an intron located at 5' of the nucleic acid encoding the signal peptide and at 3' of the promoter.

13. The recombinant AAV vector according to claim 12, wherein the intron is selected from the group consisting of an MVM intron, an HBB2 intron, a CMVIE intron, a UBC intron, or an SV40 intron.

14. The recombinant AAV vector according to claim 1, further comprising at least one polyA signal located at 3' of the nucleic acid encoding the GAA polypeptide and 5' of the 3'ITR.

15. The recombinant AAV vector according to claim 8, wherein the 3'UTR sequence is located at 3' of the nucleic acid encoding the GAA polypeptide and 5' of the 3'ITR sequence, or is located between the nucleic acid encoding the GAA polypeptide and a polyA signal or RNA poll II terminator sequence.

16. The recombinant AAV vector according to claim 1, wherein the genome further comprises a 3' intron, the 3' intron being located at 3' of the nucleic acid encoding the GAA polypeptide and 5' of the 3'ITR sequence, or between the nucleic acid encoding the GAA polypeptide and a polyA sequence or an RNA pollII terminator sequence.

17. The recombinant AAV vector according to claim 1, wherein the ITR includes insertion, deletion, or substitution, and, if necessary, one or more CpG islands in the ITR are removed.

18. a. The nucleic acid encoding the signal peptide is AAT signal peptide (e.g., SEQ ID NO: 67), or an active fragment thereof encoding a polypeptide having secretory signaling activity, for example, a nucleic acid encoding an amino acid sequence having at least about 75%, 80%, 85%, 90%, 95%, 98%, or 99% sequence identity with the one encoded by SEQ ID NO: 67; Nucleic acids encoding amino acid sequences having at least about 75%, 80%, 85%, 90%, 95%, 98%, or 99% sequence identity with fibronectin signal peptides (FN1) (e.g., SEQ ID NOs. 73-75), or active fragments thereof encoding polypeptides having secretory signaling activity, e.g., those encoded by SEQ ID NOs. 73-75; An endogenous GAA signal peptide (SEQ ID NO: 51), or an active fragment thereof encoding a polypeptide having secretory signaling activity, for example, a nucleic acid encoding an amino acid sequence having at least about 75%, 80%, 85%, 90%, 95%, 98%, or 99% sequence identity with the one encoded by SEQ ID NO: 51; hoGF2 signal peptide (e.g., SEQ ID NO: 72), or an active fragment thereof encoding a polypeptide having secretory signaling activity, for example, a nucleic acid encoding an amino acid sequence having at least about 75%, 80%, 85%, 90%, 95%, 98%, or 99% sequence identity with the one encoded by SEQ ID NO: 72; IgG1(201) signal peptide (SEQ ID NO: 54), or an active fragment thereof encoding a polypeptide having secretory signaling activity, for example, a nucleic acid encoding an amino acid sequence having at least about 75%, 80%, 85%, 90%, 95%, 98%, or 99% sequence identity with that encoded by SEQ ID NO: 54; wtIL2 leader peptide (SEQ ID NO: 55), or an active fragment thereof encoding a polypeptide having secretory signaling activity, for example, a nucleic acid encoding an amino acid sequence having at least about 75%, 80%, 85%, 90%, 95%, 98%, or 99% sequence identity with that encoded by SEQ ID NO: 55; A mutant IL2 leader peptide (SEQ ID NO: 56), or an active fragment thereof encoding a polypeptide having secretory signaling activity, for example, a nucleic acid encoding an amino acid sequence having at least about 75%, 80%, 85%, 90%, 95%, 98%, or 99% sequence identity with the one encoded by SEQ ID NO:

56. Selected from any of the groups consisting of; b. The nucleic acid encoding the GAA polypeptide is selected from any of the group consisting of nucleic acid sequences having at least 60%, 70%, 80%, 85%, 90%, 95%, 98%, or 99% sequence identity with SEQ ID NOs. 3, SEQ ID NOs. 4, SEQ ID NOs. 5, SEQ ID NOs. 6, SEQ ID NOs. 7, SEQ ID NOs. 8, SEQ ID NOs. 9, SEQ ID NOs. 10, SEQ ID NOs. 11, SEQ ID NOs. 12, SEQ ID NOs. 13, SEQ ID NOs. 14, SEQ ID NOs. 15, SEQ ID NOs. 16, SEQ ID NOs. 17, SEQ ID NOs. 18, or SEQ ID NOs. 3 to 18. The recombinant AAV vector according to claim 1.

19. The recombinant AAV vector according to claim 1, wherein the liver-specific promoter is selected from any of the following: SEQ ID NOs: 86, 88, 91-99, 146-150 or 439-441, or a liver-specific promoter having at least 80% sequence identity with SEQ ID NOs: 86, 88, 91-99, 146-150 or 439-441.

20. The recombinant AAV vector according to claim 1, wherein the recombinant vector is produced from a plasmid having the nucleotide sequence of SEQ ID NO:

27.

21. The recombinant AAV vector according to claim 1, which is a chimeric AAV vector, a haploid AAV vector, a hybrid AAV vector, or a polyploid AAV vector.

22. The recombinant AAV vector according to claim 1, which is a rational haploid vector, a mosaic AAV vector, a chemically modified AAV vector, or an AAV vector derived from any AAV serotype.

23. A recombinant AAV vector according to claim 1, selected from the group consisting of an AAVXL32 vector, an AAVXL32.1 vector, an AAV8 vector, or a haploid AAV8 vector containing at least one AAV8 capsid protein.

24. The recombinant AAV vector according to claim 1, wherein the serotype is AAV3b.

25. The recombinant AAV vector according to claim 24, wherein the AAV3b serotype comprises one or more mutations in the capsid protein, selected from 265D, 549A, and Q263Y.

26. The recombinant AAV vector according to claim 25, wherein the AAV3b serotype is selected from AAV3b265D, AAV3b265D549A, AAV3b549A, AAV3bQ263Y, and AAV3bSASTG.

27. The recombinant AAV vector according to claim 7, wherein the polyA signal is a full-length HGF polyA signal.

28. A pharmaceutical composition comprising a recombinant AAV vector according to any one of claims 1 to 27 in a pharmaceutically acceptable carrier.

29. A pharmaceutical composition according to claim 28 for use in a method of treating a subject having Pompe disease or glycogen storage disorder type II (GSD II, acid maltase deficiency), or having a deficiency in alpha-glucosidase (GAA) polypeptide, wherein the method comprises the step of administering the pharmaceutical composition to the subject.

30. The pharmaceutical composition according to claim 29, wherein the recombinant AAV vector expresses a GAA protein secreted from the liver of the subject, and the secreted GAA protein is taken up by skeletal muscle tissue, cardiac muscle tissue, diaphragmatic muscle tissue, or a combination thereof, and the uptake of the secreted GAA protein results in a reduction of lysosomal glycogen storage in the tissue.

31. The pharmaceutical composition according to claim 30, wherein the administration step is by intramuscular, subcutaneous, intraspinal, intracisional, intracerebral, intrathecal, or intravenous administration.

32. The pharmaceutical composition according to claim 29, characterized in that the recombinant AAV vector is administered in a dosage range of 1.0E11 vg / kg to 5.0E13 vg / kg.

33. The pharmaceutical composition according to claim 29, wherein the subject is receiving GAA protein enzyme replacement therapy, and the GAA protein enzyme replacement therapy is discontinued on the same day as the administration of the recombinant AAV vector, the following day, or any day from day 1 to 26 weeks thereafter.