A novel compound that induces expression of the anti-aging gene klotho

Abstract

The present invention relates to a novel compound that induces the expression of the anti-aging gene klotho. The compound according to the present invention is not only excellent in the effect of increasing the expression level of the klotho gene, which is an aging-related gene, but also has a protective effect against oxidative stress in retinal pigment epithelial cells (RPE), and therefore can be usefully used as a pharmaceutical composition for preventing or treating macular degeneration, or a functional health food composition.

Description

Detailed Description of the Invention

[0001] [Technical field] This application claims priority to Korean Patent Application No. 10-2022-0035142, filed on March 22, 2023, the entire specification of which is incorporated herein by reference.

[0002] The present invention relates to a novel compound that induces the expression of the anti-aging gene klotho. [Background technology] The fact that there may be genes that can regulate aging in animals was known from SAM (senescence-accelerated mice), reported in 1981. These rats, which were created by chance while crossbreeding AKR / J family rats, aged much faster than rats of the same lineage, but it was confirmed that these rats had mutations in multiple genes. The discovery of a group of aging-related genes was subsequently reported in the 1990s. The reported genes were genes in the RecQ family that express an enzyme called DNA helicase. It has been reported that mutations in these genes cause premature aging and the development of cancer, which was found to occur by affecting DNA repair. A single gene related to aging is the klotho gene, reported in 1997. The klotho gene was discovered by chance while creating a transgenic animal model of hypertensive rats, and rats that were unable to express this gene showed premature aging and a shortened lifespan. A more interesting fact is that rats in which the expression of this gene was later increased showed a 20.0-30.8% increase in male lifespan and a 18.8-19.0% increase in female lifespan. This was the first time that the world was informed of the fact that the expression of a single gene may increase or decrease a rat's lifespan. It was also reported that the base sequence of the Klotho gene is very similar between animals, with about 98% of the sequence being identical between rats and humans. This indicates that lifespan can also be controlled in humans depending on the expression of the Klotho gene.

[0003] In humans, the klotho gene is located on chromosome 13 and produces a membrane protein with a base sequence similar to that of β-glucosidase. Klotho protein is mainly expressed in ureteral epithelial cells in the kidney and choroid gun in the brain, and has been reported to be expressed in some parathyroid glands. The klotho gene is involved in various aging phenotypes, and rats lacking the klotho gene develop syndromes similar to the aging process, such as reduced lifespan, reduced activity, growth retardation, atherosclerosis, arterial calcification, osteoporosis, genital immaturity, infertility, skin atrophy, and emphysema. In klotho mutant rats, arteriosclerosis similar to the Monckeberg type of arteriosclerosis caused by aging in humans is observed in all arteries from the aorta to the small arteries, and angiogenesis and vasculogenesis are impaired.

[0004] Klotho mRNA is expressed significantly higher in renal tissue than in other tissues, but expression of klotho mRNA is reduced in the kidneys of disease model rats with hypertension, type 2 diabetes, diabetic nephropathy, and chronic renal failure. In rats with reduced Klotho expression, production of nitric oxide (NO), a vascular endothelium-derived relaxing factor, is reduced, and when the klotho gene is injected into OLETF (Otsuka Long-Evans Tokushima fatty rat) rats, which simultaneously have many risk factors for cardiovascular disease, using a viral gene carrier, abnormal vascular intima function is improved, NO production is increased, vascular thickening and fibrosis are suppressed, and blood pressure is reduced. Furthermore, the Klotho gene also affects glucose and insulin metabolism in rats, and statins, a representative hypercholesterolemia treatment drug, increase the expression of Klotho mRNA in renal myotubular cells. In rats with reduced Klotho expression, osteopenia, a hyposkeletal state due to impaired differentiation of both osteoblasts and osteoclasts, occurs. In addition, in Klotho mutant rats, abnormal kidneys and abnormal bone histology in the epiphyseal bone were observed in micro-computed tomography, which is due to an impairment of the bone resorption process. The clinical phenotype changes due to Klotho gene mutations observed in humans are various. KL-VS (functional variant of klotho) modification, which has a mutation in three sites in Klotho gene exon2, is associated with lipid metabolism, blood pressure, lifespan, cognitive function, coronary artery disease and cerebrovascular disease, and it has been reported that microsatellite polymorphisms and single nucleotide polymorphisms of the Klotho gene are associated with bone mineral density, and that single nucleotide polymorphisms of the Klotho gene are associated with cardiovascular disease risk factors and bone mineral density in healthy adult women. Recently, the association between the Klotho gene and Alzheimer's has also been reported through several papers. It has been reported that overexpressing Klotho in an Alzheimer's dementia rat model increases the rat's lifespan by 30% and suppresses cognitive decline. Furthermore, it was observed that expression of klotho reduced the production of amyloid beta protein in the brain by 50%.In humans, it has been reported that the expression level of Klotho is inversely proportional to the progression of Alzheimer's disease, and that Klotho protein reduces the amount of inflammatory cytokines in the blood of Alzheimer's patients. Several research results have also shown that Klotho promotes the function of the retinal pigment epithelium (RPE) and protects RPE cells from oxidative stress. In the retinas of rats in which the Klotho gene was deleted (KL- / -), photoreceptor degeneration and pigment production in RPE cells were reduced. It was confirmed that Klotho is also expressed in cultured RPE cells, and experiments confirmed that the expressed Klotho protein increases the synthesis of L-3,4-dihydorxyphenylalanine (L-DOPA) and inhibits the production of vascular endothelial growth factor (VEGF) from the basement membrane. Research results also confirmed that Klotho reduces the production of reactive oxygen species (ROS) in RPE cells and protects RPE cells from oxidative stress. In a study of patients with age-related macular degeneration (AMD), it was found that klotho expression in the ocular waterproof fluid was reduced, and that this reduction was associated with oxidative stress and inflammation.

[0005] As a result of continuing research into compounds that induce klotho expression, the inventors have experimentally confirmed that the novel compounds they have developed are highly stable and have excellent protective effects against oxidative stress (oxidative toxicity) in retinal pigment epithelial cells (RPE), thereby completing the present invention.

[0006] [Summary of the Invention] [Problem to be solved by the invention] An object of the present invention is to provide novel compounds represented by Chemical Formula 1 and pharma- ceutically acceptable salts thereof.

[0007] However, the technical problem that the present invention is to achieve is not limited to the above problem, and other problems not mentioned will be clearly understood by those skilled in the art from the following description. [Means for solving the problem] In order to achieve the above object, the present invention provides a compound represented by the following chemical formula 1, or a pharma- ceutically acceptable salt thereof:

[0008] [ka]

[0009] In the above Chemical Formula 1, R1 and R2 are each -H, halogen, or C 1-6 A straight or branched alkyl group of R3 and R4 can each be -H or a halogen.

[0010] In a preferred embodiment of the present invention, the compound represented by the above Chemical Formula 1 may be a compound represented by the following Chemical Formula 1-1:

[0011] [ka]

[0012] In the above formula 1-1, R1 and R2 are each -H, halogen, or C. 1-6 It may be a straight or branched chain alkyl. In another preferred embodiment of the present invention, the compound represented by the above formula 1-1 is A compound represented by the following chemical formula 1-1A:

[0013] [ka]

[0014] A compound represented by the following chemical formula (1-1B):

[0015] [ka]

[0016] A compound represented by the following chemical formula 1-1C:

[0017] [ka]

[0018] A compound represented by the following chemical formula 1-1D:

[0019] [ka] It may be any one or more selected from the group consisting of: In another preferred embodiment of the present invention, the compound is capable of increasing the expression of the Klotho gene.

[0020] In another preferred embodiment of the invention, the compound is capable of protecting retinal pigment epithelial cells from oxidative stress. [Effects of the invention] The compound according to the present invention not only has an excellent effect of increasing the expression level of the Klotho gene, which is an aging-related gene, but also has a protective effect against oxidative stress in retinal pigment epithelial cells (RPE), and can therefore be usefully used as a pharmaceutical composition for preventing or treating macular degeneration, or a functional health food composition. [Brief description of the drawings]

[0021] [Figure 1] FIG. 1 shows the results of MS / MS analysis confirming the stability of the KS compounds according to Example 1 of the present invention: KS101 (compound of formula 1-1A), KS102 (compound of formula 1-1B), KS103 (compound of formula 1-1C), and KS104 (compound of formula 1-1D). [Figure 2a] FIG. 2 shows the results of PCR confirmation of the expression level of the klotho gene by the KS compound according to Example 1 of the present invention. [Figure 2b]FIG. 2 shows the results of PCR confirmation of the expression level of the klotho gene by the KS compound according to Example 1 of the present invention. [Diagram 3] FIG. 3 shows the results of confirming the cytotoxicity of the KS compound according to Example 1 of the present invention. [Figure 4] FIG. 4 shows the results of confirming the change in the amount of intracellular reactive oxygen species (ROS) after treating renal tubular epithelial cells (RPTEC) with the KS compound of Example 1 of the present invention. [Diagram 5] FIG. 5 shows the results of confirming changes in expression of oxidative stress-related genes by the KS compound of Example 1 of the present invention. [Figure 6] FIG. 6 shows the results of confirming changes in expression of oxidative stress-related genes by the KS compound of Example 1 of the present invention. [Figure 7] FIG. 7 shows the results of confirming the cell protective effect against oxidative stress of the KS compound of Example 1 of the present invention. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0022] The present invention will be described in detail below. Compounds that induce expression of the anti-aging gene klotho The present invention relates to a compound represented by the following chemical formula (1), or a pharma- ceutically acceptable salt thereof:

[0023] [ka]

[0024] (In the above chemical formula 1, R1 and R2 are each -H, halogen, or C 1-6 A straight or branched alkyl group of R3 and R4 can each be -H, or a halogen.

[0025] Preferably, the compound represented by the above Chemical Formula 1 may be a compound represented by the following Chemical Formula 1-1:

[0026] [ka]

[0027] (In the above chemical formula 1-1, R1 and R2 are each -H, halogen, or C 1-6 (which may be a straight or branched chain alkyl). More preferably, the compound represented by the above chemical formula (1-1) is A compound represented by the following chemical formula 1-1A:

[0028] [ka]

[0029] A compound represented by the following chemical formula (1-1B):

[0030] [ka]

[0031] A compound represented by the following chemical formula 1-1C:

[0032] [ka]

[0033] A compound represented by the following chemical formula 1-1D:

[0034] [ka]

[0035] It may be any one or more selected from the group consisting of: The compounds of the present invention can be used in the form of pharmaceutically acceptable salts, and useful salts include acid addition salts formed with pharmaceutically acceptable free acids. The term pharmaceutically acceptable salts refers to any organic or inorganic addition salt of the base compound of formula 1 at a concentration that is relatively non-toxic and harmless to the patient and does not cause side effects that reduce the beneficial efficacy of the base compound of formula 1. These salts can be used as free acids, including inorganic and organic acids, and inorganic acids can be used as hydrochloric acid, bromic acid, nitric acid, sulfuric acid, perchloric acid, phosphoric acid, etc., and organic acids can be used as citric acid, acetic acid, lactic acid, maleic acid, fumaric acid, gluconic acid, methanesulfonic acid, glyconic acid, succinic acid, tataric acid, galacturonic acid, embonic acid, glutamic acid, aspartic acid, oxalic acid, (D) or (L) malic acid, maleic acid, methanesulfonic acid, ethynyl phosphate, 4-toluenesulfonic acid, salicylic acid, citric acid, benzoic acid, or malonic acid, etc. These salts also include alkali metal salts (sodium salt, potassium salt, etc.) and alkaline earth metal salts (calcium salt, magnesium salt, etc.), etc. For example, acid addition salts include acetate, aspartate, benzate, besylate, bicarbonate / carbonate, bisulfate / sulfate, borate, camsylate, citrate, edisylate, esylate, formate, fumarate, gluceptate, gluconate, glucuronate, hexafluorophosphate, hybenzate, hydrochloride / chloride, hydrobromide / bromide, hydroiodide / iodide, isethionate, lactate, malonate, mesylate, methylsulfate, naphthylate, 2- These may include naphsylate, nicotinate, nitrate, orotate, oxalate, palmitate, pamoate, phosphate / hydrogen phosphate / dihydrogen phosphate, saccharate, stearate, succinate, tartrate, tosylate, trifluoroacetate, aluminum, arginine, benzathine, calcium, choline, diethylamine, diolamine, glycine, lysine, magnesium, meglumine, potassium, sodium, tromethamine, zinc salts, and the like, of which the hydrochloride or trifluoroacetate is preferred.

[0036] Furthermore, the compounds of the present invention include not only pharma- ceutically acceptable salts, but also all salts, isomers, hydrates and solvates that can be prepared by conventional methods. The addition salt according to the present invention can be prepared by a conventional method, for example, by dissolving the compound in a water-miscible organic solvent such as acetone, methanol, ethanol, acetonitrile, etc. and adding an excess of an organic acid thereto, or by crystallizing the compound by precipitation after application of an aqueous solution of an inorganic acid. The solvent or excess acid in the mixture is then evaporated, and the mixture is dried to obtain the addition salt, or the precipitated salt is filtered by suction.

[0037] The compounds of the present invention are capable of increasing the expression of the Klotho gene. Furthermore, oxidative stress experiments using retinal pigment epithelium confirmed that the compound exhibits the effect of protecting cells from oxidative stress, indicating that the compound of the present invention can be usefully used as an agent for the prevention or treatment of macular degenerative disease.

[0038] Pharmaceutical composition for preventing or treating macular degeneration In another aspect, the present invention relates to a pharmaceutical composition for preventing or treating macular degeneration, comprising, as an active ingredient, a compound represented by the following chemical formula 1 or a pharma- ceutical acceptable salt thereof:

[0039] [ka]

[0040] (In the above chemical formula 1, R1 and R2 are each -H, halogen, or C 1-6 A straight or branched alkyl group of R3 and R4 can each be -H, or a halogen.

[0041] Preferably, the compound represented by Chemical Formula 1 may be a compound represented by the following Chemical Formula 1-1:

[0042] [ka]

[0043] (In the above chemical formula 1-1, R1 and R2 are each -H, halogen, or C 1-6 (which may be a straight or branched chain alkyl). More preferably, the compound represented by the above chemical formula (1-1) is A compound represented by the following chemical formula 1-1A:

[0044] [ka]

[0045] A compound represented by the following chemical formula (1-1B):

[0046] [ka]

[0047] A compound represented by the following chemical formula 1-1C:

[0048] [ka]

[0049] A compound represented by the following chemical formula 1-1D:

[0050] [ka] It may be any one or more selected from the group consisting of: The macular degeneration may be age-related macular degeneration. The composition of the present invention can increase the expression level of the Klotho gene.

[0051] Furthermore, the composition of the present invention can protect retinal pigment epithelial cells from oxidative stress. The compound of the present invention can be administered in various oral and parenteral formulations at the time of clinical administration, and when formulated, they are produced using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, surfactants, etc.

[0052] Solid preparations for oral administration include tablets, tablets, powders, granules, capsules, lozenges, etc. They are prepared by mixing sucrose, lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate talc are also used. Liquid preparations for oral administration include suspensions, liquid preparations, emulsions, syrups, etc., and may contain various excipients such as wetting agents, sweeteners, flavorings, preservatives, etc. in addition to water and liquid paraffin, which are commonly used simple diluents.

[0053] Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations, suppositories, etc. As non-aqueous solvents and suspensions, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, etc. can be used. As suppository bases, witepsol, macrogol, twin 61, cacaodi, laurindi, glycerol, gelatin, etc. can be used.

[0054] Furthermore, the effective dosage of the compound of the present invention for the human body may vary depending on the age, weight, sex, dosage form, health condition and degree of disease of the patient, and is generally about 0.001-100 mg / kg / day, preferably 0.01-35 mg / kg / day. Based on an adult patient weighing 70 kg, it is generally 0.07-7000 mg / day, preferably 0.7-2500 mg / day, and can be administered once or several times a day at regular intervals according to the judgment of a doctor or pharmacist.

[0055] Food composition for preventing or improving macular degeneration From another aspect, the present invention relates to a food composition or a health functional food composition for preventing or improving macular degeneration, which contains the compound represented by the above chemical formula 1 or a pharma- ceutical acceptable salt thereof as an active ingredient.

[0056] The composition of the present invention can increase the expression level of the Klotho gene. Furthermore, the composition of the present invention can protect retinal pigment epithelial cells from oxidative stress.

[0057] The macular degeneration may be age-related macular degeneration. There is no particular limitation on the type of food. Examples of foods to which the effective substance of the present invention can be added include drinks, meat, sausages, bread, biscuits, rice cakes, chocolate, candies, snacks, confectionery, pizza, ramen, other noodles, gums, dairy products including ice cream, various soups, drinking water, alcoholic beverages, vitamin complexes, dairy products, and dairy products, etc., including all health foods and health functional foods in the usual sense.

[0058] The health food and health functional food composition containing the active substance according to the present invention can be added to food as it is, or can be used in combination with other foods or food ingredients, and can be used appropriately according to conventional methods. The amount of the active substance mixed can be appropriately determined depending on the purpose of use (for prevention or improvement). In general, the amount of the composition in the food or health functional food can be added in an amount of 0.1 to 90 parts by weight based on the total food weight (based on a total of 100 parts by weight). However, in the case of long-term intake for the purpose of maintaining health or regulating health, the amount may be less than the above range, and since there is no problem in terms of safety, the active substance can be used in an amount greater than the above range.

[0059] The food and health functional food composition of the present invention contains the active substance of the present invention as an essential component in the indicated ratio, but other components are not particularly limited, and may contain various flavorings or natural carbohydrates as additional components along with ordinary beverages. Examples of the above-mentioned natural carbohydrates are monosaccharides, such as glucose, fructose, etc.; disaccharides, such as maltose, sucrose, etc.; and polysaccharides, such as ordinary sugars such as dextrin, cyclodextrin, etc., and sugar alcohols such as xylitol, sorbitol, erythritol, etc. As flavorings other than those mentioned above, natural flavorings (thaumatin, stevia extracts (e.g. rebaudioside A, glycyrrhizin, etc.) and synthetic flavorings (saccharin, aspartame, etc.) can be advantageously used. The ratio of the natural carbohydrates is generally about 1 to 20 g, preferably about 5 to 12 g, per 100 g of the health functional food composition of the present invention.

[0060] In addition to the above, the health food and health functional food compositions containing the active substances of the present invention may contain various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, colorants and enhancers (cheese, chocolate, etc.), pectinic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH regulators, stabilizers, preservatives, glycerin, alcohol, carbonation agents used in carbonated drinks, etc. In addition, the health food and health functional food compositions of the present invention may contain fruit pulp for the production of natural fruit juices and fruit juice drinks and vegetable drinks.

[0061] These ingredients can be used independently or in combination. The ratio of these additives is not particularly important, but is generally selected in the range of 0.1 to about 20 parts by weight per 100 parts by weight of the health food and health functional food composition containing the active substance of the present invention.

[0062] The present invention will now be described in more detail with reference to the following examples, although it should be noted that the following examples are merely illustrative of the present invention and are not intended to limit the scope of the present invention.

[0063] Example 1. Compound synthesis 1-1: Synthesis of KS101 compound Step 1: Preparation of 1-(3,4-difluorophenyl)-3-(2-hydroxyphenyl)thiourea (FCCS-19025-2-1) Under an Ar gas atmosphere, 2-aminophenol (150 mg, 1.37 mmol) was dissolved in methanol (8 mL), and then 3,4-difluorophenyl isothiocyanate (224 μL, 1.65 mmol) was slowly added and stirred at room temperature for 13 hours. After confirming the completion of the reaction by TLC (thin layer chromatography), methanol was removed under reduced pressure. The reaction mixture was purified by silica-gel column chromatography (20% acetone / n-hexane) to obtain 1-(3,4-difluorophenyl)-3-(2-hydroxyphenyl)thiourea (FCCS-19025-2-1) as a pale yellow solid (354 mg, 92%).

[0064] 1 H-NMR (400MHz, MeOH-d4) δ 7.62 (d, J = 8.0 Hz, 1H), 7.55 (ddd, J= 2.4 Hz, 1H), 7.25-7.13 (m, 2H), 7.11-7.05 (m, 1H), 6.92-6.82 (m, 2H); ESI-(+) 281.3 [M+H] + .

[0065] Step 2: Preparation of N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine (FCCS-19025) Under an Ar gas atmosphere, FCCS-19025-2-1 (224 mg, 0.80 mmol) obtained in step 1 above and potassium superoxide (KO2) (284 mg, 4.00 mmol) were dissolved in acetonitrile (MeCN) (25 mL), and then stirred at room temperature for 14 hours. After confirming the completion of the reaction by TLC (thin layer chromatography), acetonitrile (MeCN) was removed under reduced pressure. The reaction mixture was purified by chromatography (Silica-gel column chromatography) (10-20% Ethyl acetate / n-hexane) to obtain the target compound, N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine (FCCS-19025), as a white solid (160 mg, 82%).

[0066] [ka]

[0067] 1 H-NMR (400MHz, MeOH-d4) δ 7.82 (ddd, J= 2.8 Hz, 1H), 7.42 (d, ■ ESI-(+) 247.2 [M+H] + .

[0068] 1-2: Synthesis of KS102 compound 2-Aminophenol (1.0 equiv.) and 3,4-difluorophenyl isothiocyanate (1.2 equiv.) were mixed in THF (2 mL / mmol) and stirred at room temperature. After stirring for 3 h, ferric chloride (FeCl3·6H2O) was added to the solution and the reaction mixture was stirred at 90 °C for 12 h. The reaction mixture was cooled to room temperature and extracted with ethyl acetate (EtOAc). The combined organic layer was extracted with magnesium sulfate (MgSO 4) The mixture was dried over 1000 ml of ethyl acetate and concentrated in vacuo. The residue was dissolved in dichloromethane (CHCl 2) Trituration with ethyl acetate, filtration and washing with dichloromethane gave the desired product (3,4-difluorophenylisothiocyanate) as a solid.

[0069] Next, 3,4-difluorophenyl isothiocyanate (210 mg, 1.23 mmol) and 2-amino-4-fluorophenol (130 mg, 1.02 mmol) were reacted to obtain the KS102 compound (N-(3,4-difluorophenyl)-5-fluorobenzo[d]oxazol-2-amine) represented by the following chemical formula 1-1B as a light brown solid (195 mg, 72%).

[0070] [ka]

[0071] mp 222.9-223.9℃; R f 0.40 (EtOAc / n-hexane = 1:3); HPLC R T 5.15 min (purity: 99.7%); 1H-NMR (DMSO-d6, 800 MHz) δ 6.97 (ddd, J = 9.8, 8.7, 2.6 Hz, 1H), 7.36 (dd, J = 9.0, 2.6 Hz, 1H), 7.43-7.48 (m, 2H), 7.52 (dd, J = 8.7, 4.4 Hz, 1H), 7.91 (ddd, J = 12.8, 7.1, 2.3 Hz, 1H), 11.0 (s, 1H); 13 C-NMR (DMSO-d6, 200 MHz) 159.4 (J CF = 234.9 Hz), 159.1, 149.2 (J CF = 241.9, 13.0 Hz), 144.7 (J CF = 239.0, 12.4 Hz), 143.4, 143.2 (J CF = 13.7 Hz), 135.5 (J CF = 9.2, 2.2 Hz), 117.8 (J CF = 17.9 Hz), 114.1 (J CF = 5.8, 3.1 Hz), 109.5 (J CF = 10.3 Hz), 108.5 (J CF = 25.6 Hz), 106.7 (J CF = 22.1 Hz), 103.9 (J CF = 26.3 Hz) ppm, LR-MS (FAB) m / z 265 (M+H) + ; HR-MS (FAB) calculation for C 13 H8F3N2O (M+H) + 265.0589, found 265.0588.

[0072] 1-3: Synthesis of KS103 compound The KS103 compound (N-(3,4-difluorophenyl)-6-fluorobenzo[d]oxazol-2-amine) represented by the following chemical formula 1-1C was obtained as an ivory solid (203) mg, 75%) by reacting the 3,4-difluorophenyl isothiocyanate (210 mg, 1.23 mmol) obtained in Example 1-2 above with 2-amino-5-fluorophenol (130 mg, 1.02 mmol).

[0073] [ka]

[0074] mp 231.7-232.6℃; R f 0.40 (EtOAc / n-hexane = 1:3); HPLC R T 5.12 min (purity: 98.4%); 1 H-NMR (DMSO-d6, 800 MHz) δ 7.10 (ddd, J = 10.1, 8.6, 2.5 Hz, 1H), 7.42-7.45 (m, 2H), 7.47 (dd, J = 8.6, 4.9 Hz, 1H), 7.54 (dd, J = 8.4, 2.5 Hz, 1H), 7.91 (ddd, J = 12.6, 7.0, 2.1 Hz, 1H), 10.9 (s, 1H); 13 C-NMR (DMSO-d6, 200 MHz) 158.1, 158.0 (J CF = 235.9 Hz), 149.2 (J CF = 241.8, 13.2 Hz), 146.8 (J CF = 15.0 Hz), 144.6 (J CF = 238.8, 12.6 Hz), 138.4. 135.7 (J CF = 7.3 Hz), 117.8 (J CF = 17.9 Hz), 116.8 (J CF= 9.6 Hz), 113.8 (J CF = 5.5, 3.3 Hz), 111.0 (J CF = 23.7 Hz), 106.4 (J CF = 22.1 Hz), 98.0 (J CF = 28.9 Hz) ppm, LR-MS (FAB) m / z 265 (M+H) + ; HR-MS (FAB) calcd for C 13 H8F3N2O (M+H) + 265.0589, found 265.0586.

[0075] 1-4: Synthesis of KS104 compound The KS104 compound (N-(3,4-difluorophenyl)-5,6-difluorobenzo[d]oxazol-2-amine) represented by the following chemical formula 1-1D was obtained as a bright purple solid (187 mg, 64%) by reacting 3,4-difluorophenyl isothiocyanate (212 mg, 1.24 mmol) and 2-amino-4,5-difluorophenol (150 mg, 1.03 mmol) obtained in Example 1-2 above.

[0076] [ka]

[0077] mp 242.1-243.2℃; R f 0.40 (EtOAc / n-hexane = 1:3); HPLC R T 5.44 min (purity: 99.1%); 1H-NMR (DMSO-d6, 800 MHz) δ 7.41-7.42 (m, 1H), 7.46 (dd, J = 19.3, 9.0 Hz, 1H), 7.62 (dd, J = 10.5, 7.5 Hz, 1H), 7.83 (dd, J = 9.8, 6.9 Hz, 1H), 7.89 (ddd, J = 13.0, 7.2, 2.5 Hz, 1H), 11.0 (s, 1H); 13 C-NMR (DMSO-d6, 200 MHz) 158.9, 149.2 (J CF = 242.0, 13.1 Hz), 147.3 (J CF = 237.0, 13.7 Hz), 145.5 (J CF = 238.0, 14.7 Hz), 144.8 (J CF = 239.0. 13.5 Hz), 142.1 (J CF = 12.6 Hz), 138.0 (J CF = 11.5, 1.5 Hz), 135.4 (J CF = 13.2, 1.8 Hz), 117.8 (J CF = 17.8 Hz), 114.0 ((J CF = 5.7, 3.1 Hz), 106.6 (J CF = 22.1 Hz), 104.9 (J CF = 21.7 Hz), 99.5 (J CF = 24.1 Hz) ppm, LR-MS (FAB) m / z 283 (M+H) + ; HR-MS (FAB) calcd for C 13 H7F4N2O (M+H) + 283.0495, found 283.0505.

[0078] Experimental Example 1. Compound stability evaluation Each KS compound in Example 1 was dissolved in DMSO at 10 mM before use, and tolbutamide used as a standard substance was dissolved in methanol at a concentration of 10 mM before use.

[0079] A glass test tube (13 x 100 mm) was filled with 0.1 M KH2PO4 (147.5 μl), 0.1 M MgCl2 (25 μl), and 50 μl of 0.5 mg / mL human liver microsomes (mixed-gender pool) purchased from Corning Life Sciences. Each KS compound solution was mixed to a final concentration of 1 μM. The mixture was pre-incubated for 3 minutes in a shaking water bath (37°C, 40 rpm), and then incubated for 30 minutes with or without the addition of 25 μl of 10 mM NADPH.

[0080] Before and after the reaction, 50 μl of each sample was taken, 2 mL of acetonitrile was added to stop the reaction, and the mixture was vortexed for 1 minute. The mixture was centrifuged for 20 minutes (4,000 rpm, 4 °C), and each supernatant was transferred to a new glass test tube and dried for 2 hours using a centrifugal concentrator. After confirming that the mixture was completely dry, 200 μl of 40% acetonitrile was added to each glass test tube, and the mixture was vortexed for 1 minute to resuspend the mixture. The resuspended solution was centrifuged for 10 minutes (4,000 rpm, 4 °C), and 150 μl of the supernatant was taken and used for HPLC-UV analysis. The HPLC-UV analysis was performed using an Agilent 1200 series, and the MS / MS analysis was performed using an Agilent 6410. The analysis conditions were as follows.

[0081] [Table 1]

[0082] [Table 2]

[0083] Figure 1 shows the quantitative confirmation of KS compounds incubated with human liver microsomes by MS / MS analysis. Since microsomal enzymes function dependent on the coenzyme NADPH(+), the compound was metabolized only in the reaction in which NADPH(+) was added. The KS compounds showed higher stability than tolbutamide used as a control, and it was confirmed that KS104 had the best microsomal stability.

[0084] Experimental Example 2. Comparison of Klotho gene expression effects Each KS compound in Example 1 was applied to human renal proximal tubular epithelial cells (RPTEC) at different concentrations, and after 6 hours, mRNA was collected from the cells, and the mRNA expression of the klotho gene was confirmed by PCR. Renal proximal tubular epithelial cells (RPTEC) were purchased from Lonza, cultured at 37°C and 5% CO2, and used in the experiment. After each KS compound was placed in the cell culture medium and exposed for 6 hours, RNA was isolated from the cells, converted to cDNA using reverse transcriptase, and the clot was amplified by PCR to confirm the expression level. DMSO was added to the control group instead of the compound.

[0085] The information on the primers used in the experiment is as follows: KL-F: GATAGAGAAAAATGGCTTCCCTCC (SEQ ID NO: 1) KL-R: GGTCGGTAAACTGAGACAGAGTGG (SEQ ID NO: 2) GAPDH-F: TGACAACTTTGGTATCGTGGAAGG (SEQ ID NO: 3) GAPDH-R: AGGGATGATGTTCTGGAGAGCC (SEQ ID NO: 4)

[0086] Figure 2 shows the results of PCR to confirm the expression of the klotho gene. The gel photograph and the expression level of the bands that appeared in the gel photograph were quantified using Image J and shown in a graph. In the gel photograph, the upper band represents the secreted form of klotho, and the lower band represents the membranous form of klotho. The quantitative graph shows both bands together. KS104 showed the most excellent expression effect, and it was confirmed that its ability to express the klotho gene was more than twice as high as not only KS101 but also other fluorine-binding compounds.

[0087] Experimental example 3. Cytotoxicity evaluation Cultured human retinal epithelial cells (ARPE) were treated with the KS compound of Example 1 at different concentrations, and after 24 hours of incubation, EX-cytox from GOGEN was added and reacted for 1 hour, and the change in absorbance was measured. A decrease in absorbance indicated that the cells were destroyed by toxicity. As shown in Figure 3, it was confirmed that KS104 had the lowest cytotoxicity.

[0088] Experimental Example 4. Analysis of Intracellular Reactive Oxygen Species (ROS) Renal tubular epithelial cells (RPTEC) were treated with each of the KS compounds of Example 1, and the change in the amount of intracellular reactive oxygen species (ROS) was examined.

[0089] Each KS compound was added at 2.5 μM to cultured RPTEC cells and incubated for 6 hours. The amount of ROS present in the cells was then measured by adding Invitrogen's Reactive Oxygen Detection Reagents and incubating for 1 hour. The change in fluorescence was then measured using a spectrophotometer.

[0090] Figure 4 is a graph showing the amount of ROS remaining in RPTEC cells. It can be seen that the amount of ROS in cells treated with the KS103 and KS104 compounds was reduced by about 30% compared to cells treated with only the solvent (DMSO).

[0091] Experimental Example 5. Confirmation of changes in expression of oxidative stress-related genes Relatively senescent 7th passage (#7) renal tubular epithelial cells (RPTEC) were cultured for 6 hours with 2.5 μM of each compound, and mRNA was collected and total gene expression was confirmed using a next generation sequencer (NGS). To confirm gene expression changes due to aging, genes (TXN, AKT1, NR4A3, NLRP3, FOXP3 genes) whose expression increased in young cells were confirmed by comparing gene expression with relatively young 4th passage (#4) RPTEC cells. The expression level of the relevant genes in young cells was compared with the expression change value due to the treatment with the compound of Example 1 (treatment of senescent cells with the compound of Example 1). As a result of the confirmation, it was confirmed that the expression of the relevant genes was more greatly induced in senescent cells than in young cells when treated with the KS104 compound (FIGS. 5 and 6).

[0092] Experimental Example 6. Protective effect on retinal pigment epithelium cells In order to confirm the preventive or therapeutic effect of the KS compound of Example 1 on macular degeneration, the effect of protecting retinal pigment epithelial cells from oxidative stress was confirmed. First, human retinal pigment epithelial cells (ARPE) purchased from ATCC in the United States were used for the experiment. 10,000 ARPE cells were placed in each well in the same way, cultured for 18 hours, and then replaced with serum (FBS)-free DMEM F-12 medium.

[0093] At this time, each KS compound was added at a concentration of 2.5 μM, and then treated with buthionine sulfoximine (BSO) at a concentration of 50 mM for 6 hours to cause oxidative stress. To measure the viability of these cells, Cyto X (Cell viability assay kit) was added and the absorbance over time was measured at 450 nm.

[0094] As a result, it was confirmed that both the KS103 and KS104 compounds suppressed apoptosis caused by oxidative stress (Figure 7).

Claims

1. A compound represented by the following chemical formula 1-1D, or a pharma- ceutically acceptable salt thereof: 【Chemistry 1】

2. A compound represented by the following chemical formula 1-1C, or a pharma- ceutically acceptable salt thereof: 【Chemistry 2】

3. 3. The compound according to claim 1 or 2, or a pharma- ceutically acceptable salt thereof, which increases the expression of the Klotho gene.

4. 3. The compound according to claim 1 or 2, or a pharma- ceutically acceptable salt thereof, which protects retinal pigment epithelial cells from oxidative stress.

5. 3. The compound according to claim 1 or 2, or a pharma- ceutical acceptable salt thereof, which is used as a pharmaceutical composition for preventing or treating macular degeneration.

6. 3. The compound according to claim 1 or 2, or a pharma- ceutical acceptable salt thereof, characterized in that the compound is used as a food composition for preventing or improving macular degeneration.

Images