Cochlear and / or vestibular cell specific promoters and uses thereof

Abstract

Cochlea and / or vestibular cell specific promoters and their uses, specifically, specific promoters STRC, Slc26a5, otof, Sox10, Ngfr1, Ngfr2, Dnah5 and their uses in cochlea and / or vestibular cells, the nucleotide sequences of the specific promoters are shown in SEQ ID NOs: 1, 6, 11, 16, 21, 26, 31. Also provided is a recombinant vector containing the specific promoter. Based on the identification that the promoter is specifically expressed in the cochlea and / or vestibule, the use of the tissue-specific promoter, amplification primer, recombinant vector or pharmaceutical composition in aspects such as gene therapy for hearing-related diseases, construction of related animal models, and related research on pathogenesis is provided.

Description

[Technical field]

[0001] The present invention belongs to the field of biomedicine and relates to cochlear and / or vestibular cell specific promoters and their uses, in particular to the specific promoters STRC, Slc26a5, otof, Sox10, Ngfr 1, Ngfr 2, Dnah5 and their uses in cochlear and / or vestibular cells. [Background technology]

[0002] Hearing loss is one of the most common neurological susceptibility diseases in the world. According to statistical data from the World Health Organization, as of March 2020, there are approximately 466 million hearing-impaired people in the world, accounting for 5% of the world's population, of which 34 million are children. For every 1,000 newborns, there are three patients with congenital hearing impairment. Genetic factors are considered to be the susceptibility factor or direct cause of 50-60% of sensorineural hearing impairments. The main functional cells in the cochlea are divided into hair cells, supporting cells, and spiral ganglion neurons. Since deafness genes are distributed there, specific regulation of gene expression is of great significance for gene therapy of hearing.

[0003] Currently, scientists mainly rely on genetically modified animals to perform functional analysis of specific types of cells. However, genetically modified animals, such as mice, rats, dogs, pigs, and monkeys, have long reproductive cycles, high breeding costs, and can flexibly carry genes of interest to manipulate cells and treat diseases, so the continued development of methods that can be used to label and manipulate specific types of cells is of great significance. With the development of bioinformatics and molecular biology, mediating the expression of exogenous genes through specific promoters has become an efficient approach for targeting and manipulating specific tissues and gene therapy.

[0004] Deafness genes are often distributed in hair cells. Therefore, specific regulation of gene expression in hair cells is of great significance for gene therapy of hearing. At present, a promoter that specifically expresses an exogenous gene in hair cells of the auditory system has not yet been found. Because the promoters used in gene therapy are the widely expressed promoters CAG or CMV, the exogenous gene is expressed in cells other than hair cells, leading to side effects of gene therapy. In addition, when introducing an exogenous gene by means of injecting a virus, for example, when injecting a virus into a baby mouse through the round window, the virus enters the brain tissue via the cerebrospinal fluid and infects cells in the brain tissue. Therefore, there is a strong demand for the development of a method that can reduce the expression of an exogenous gene in cells other than hair cells, for example, cells of brain tissue, and increase the safety of gene therapy.

[0005] Hair cells are further divided into outer hair cells and inner hair cells, with the inner hair cells responsible for analyzing sound information and the outer hair cells responsible for amplifying sound. There are many proteins that are specifically expressed in outer hair cells, which are of great significance to the function of outer hair cells. Some deafness genes are specifically distributed in inner or outer hair cells, so more specific regulation is of great significance for accurate treatment. Prestin is a highly specialized anion transporter that belongs to the solute carrier protein superfamily SLC26 and is specifically distributed in the lateral walls of the outer hair cells (OHCs) of the organ of Corti in the inner ear. It is the molecular basis of the electrical drive and hearing amplification effect of outer hair cells, and is also known as a motor protein. Similarly, prestin is also a deafness gene. Therefore, specific regulation of gene expression in outer hair cells is of great significance to the study of the function of outer hair cells and gene therapy of hearing.

[0006] At present, a promoter that specifically expresses an exogenous gene in the outer hair cells of the auditory system has not yet been found. Because the promoters used in gene therapy are the widely expressed promoters CAG or CMV, the exogenous gene is expressed in cells other than the outer hair cells, leading to side effects of gene therapy. Some deafness genes are specifically distributed in the inner or outer hair cells, so more specific regulation is of great significance for accurate treatment. In addition, when a virus is injected into a baby mouse through the round window, the virus enters the brain tissue via the cerebrospinal fluid and infects cells in the brain tissue. Therefore, there is a strong demand for the development of a method that can reduce the expression of exogenous genes in cells other than the outer hair cells, such as cells in the brain tissue, and increase the safety of gene therapy.

[0007] Hair cells are further divided into inner hair cells and outer hair cells, with outer hair cells responsible for amplifying sound, and inner hair cells responsible for analyzing sound information. Some deafness genes, such as otof and vglut3, are mainly distributed in inner hair cells, so specific regulation of gene expression in inner hair cells is of great significance for the study of inner hair cell functions and gene therapy for hearing. At present, a promoter that specifically expresses exogenous genes in the inner hair cells of the auditory system has not yet been discovered. Because the promoters used in gene therapy are the widely expressed promoters CAG or CMV, the exogenous genes are expressed in cells other than inner hair cells, leading to side effects of gene therapy. Some deafness genes are specifically distributed in inner hair cells, so more specific regulation is of great significance for accurate treatment. In addition, when the virus is injected into a baby mouse through the round window, the virus enters the brain tissue via the cerebrospinal fluid and infects cells in the brain tissue. Therefore, there is a strong demand for the development of a method that can reduce the expression of exogenous genes in cells other than inner hair cells, such as cells of brain tissue, and thereby increase the safety of gene therapy.

[0008] Deafness genes are often distributed in hair cells. However, the most common deafness gene in China, Gjb2, is mainly expressed in supporting cells, accounting for more than 30% of congenital deafness cases. And the transformation of supporting cells into hair cells is considered to be an important pathway for hair cell regeneration. Therefore, specific regulation of gene expression in supporting cells is of great significance for the study of supporting cell function and gene therapy of hearing and hair cell regeneration.

[0009] At present, a promoter that specifically expresses an exogenous gene in the supporting cells of the auditory system has not yet been found. Because the promoters used in gene therapy are the widely expressed promoters CAG or CMV, the exogenous gene is expressed in cells other than the supporting cells, leading to side effects of gene therapy. Some deafness genes are specifically distributed in hair cells or supporting cells, so more specific regulation is of great significance for accurate treatment. In addition, when the virus is injected into a baby mouse through the round window, the virus enters the brain tissue through the cerebrospinal fluid, infects cells in the brain tissue, and reduces the expression of the exogenous gene in cells other than the supporting cells, such as cells in the brain tissue, and there is a strong demand for the development of a method that can increase the safety of gene therapy.

[0010] Spiral ganglion neurons (SGNs) are the primary afferent neurons in the auditory system, which transmit sound information from hair cells to the cochlear nucleus in the brainstem to produce hearing. Therefore, specific regulation of gene expression in spiral ganglion cells is of great significance for the study of spiral ganglion cell functions and gene therapy of hearing. Among them, spiral ganglion cells are divided into type I spiral ganglion cells and type II spiral ganglion cells, of which type I spiral ganglion cells connect with inner hair cells, account for 95% of all spiral ganglion cells, and are involved in the transmission of sound information analysis, and type II spiral ganglion cells connect with outer hair cells, account for 5% of all spiral ganglion cells, and are involved in the amplification of sound. However, the structure and function of type I and type II spiral ganglion cells have not yet been elucidated by research.

[0011] At present, a promoter that specifically expresses an exogenous gene in type I spiral ganglion cells of the auditory system has not yet been found. Because the promoters used in gene therapy are the widely expressed promoters CAG or CMV, the exogenous gene is expressed in cells other than the target cells, leading to side effects of gene therapy. Some deafness genes are specifically distributed in type I or type II spiral ganglion cells, so more specific regulation is of great significance for accurate treatment. In addition, when a virus is injected into a baby mouse through the round window, the virus enters the brain tissue via the cerebrospinal fluid and infects cells in the brain tissue. There is a strong need to develop a method that can reduce the expression of exogenous genes in cells other than spiral ganglion cells, such as cells in brain tissue, and increase the safety of gene therapy.

[0012] Vertigo is a common and frequent disease with a high human prevalence of 4.9% and diverse and complex etiology, which involves many disciplines. The vestibular system is an important component of the human balance system, and its receptors are the otolithic organs and semicircular canals in the inner ear. When they receive appropriate stimulation signals, they transmit them to the vestibular nuclei via the vestibular nerve, where they are integrated with other sensory signals and then perform specific or non-specific functions via multiple transmission pathways. Vestibular hair cells are mechanosensory receptors that can sense changes in head position, allowing animals to maintain posture and coordinate movements. The function of vestibular hair cells is to convert mechano-motor signals into bioelectrical signals. Vestibular dysfunction is mainly caused by damage to hair cells in the vestibular sensory epithelium. Vestibular hair cells are susceptible to ototoxic drugs, aging and genetic factors, which can lead to permanent vestibular dysfunction. Gene mutations can lead to the loss of vestibular hair cells, for example, the Myo15a:whirlin:Esp8 complex at the tip of the cilia is important for cilia growth, and mutations in genes related to cilia function can lead to damage to vestibular hair cells. Therefore, specific regulation of gene expression in vestibular hair cells is of great significance for the study of vestibular hair cell function and for gene therapy of hearing and vestibular hair cell regeneration.

[0013] At present, a promoter that specifically expresses an exogenous gene in vestibular hair cells has not yet been found. Because the promoters used in gene therapy are the widely expressed promoters CAG or CMV, the exogenous gene is expressed in cells other than hair cells, leading to side effects of gene therapy. Some vestibular-related disease genes are specifically distributed in vestibular hair cells or supporting cells, so more specific regulation is of great significance for accurate treatment. In addition, when a virus is injected into a baby mouse through the round window, the virus enters the brain tissue via the cerebrospinal fluid and infects cells in the brain tissue, but our promoter can reduce the expression of the exogenous gene in the brain tissue and increase the safety of gene therapy. There is a strong demand for the development of a method that can reduce the expression of the exogenous gene in cells other than vestibular hair cells, such as cells in brain tissue, and increase the safety of gene therapy. Summary of the Invention

[0014] I. Cochlear and / or vestibular hair cell specific promoter STRC The present invention discloses a cochlear and / or vestibular hair cell specific promoter and its use, the promoter is a hair cell specific promoter obtained from the genome of C57BL / 6J mouse, and can regulate the specific expression of genes in hair cells. The present invention is capable of labeling or manipulating hair cells by carrying the promoter in an adeno-associated virus vector and infecting the cochlea and vestibule of a mouse in vivo, mediating the expression of target genes in the cochlear and vestibular hair cells. The promoter has a wide range of application value and market potential in the analysis of the structure and function of cochlear and vestibular hair cells, auditory neuroscience, construction of hearing loss disease models, gene therapy, etc.

[0015] One object of the present invention is to provide a cochlear and / or vestibular hair cell specific promoter, a) comprises the nucleotide sequence shown in SEQ ID NO:1; or b) containing a nucleotide fragment having 80% or more sequence identity with SEQ ID NO: 1 and having the function of a specific promoter as defined in a); The aim is to provide a promoter.

[0016] In the present invention, the nucleotide fragment in b) is specifically a nucleotide fragment obtained by substituting, deleting or adding one or more (specifically, 1 to 50, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 3, 1, 2, or 3) nucleotides in the nucleotide sequence shown in SEQ ID NO:1, or by adding one or more (specifically, 1 to 50, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 3, 1, 2, or 3) nucleotides to the 5'-terminus and / or 3'-terminus, and which has the function of the nucleotide fragment having a sequence shown in SEQ ID NO:1. The nucleotide sequence in b) may have 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more sequence identity to SEQ ID NO:1.

[0017] The promoter according to the present invention comprises a nucleic acid having at least 80% sequence identity, preferably at least 90% sequence identity, preferably at least 95% sequence identity, more preferably at least 98% sequence identity to the nucleotide sequence shown in SEQ ID NO: 1, and more preferably comprises the nucleotide sequence shown in SEQ ID NO: 1, and particularly preferably the promoter is the nucleotide sequence shown in SEQ ID NO: 1. The promoter may further comprise, in addition to the nucleotide having at least 80% sequence identity to the nucleotide sequence shown in SEQ ID NO: 1, base sequences such as restriction enzyme cleavage sites and sites for cloning into a vector, such as an att sequence for Gateway cloning, at its terminus.

[0018] In some preferred embodiments, the specific promoter is STRC, the nucleotide sequence of which is shown in SEQ ID NO: 1. In some preferred embodiments, the specific promoter is the truncated promoter STRC mini, the nucleotide sequence of which is shown in SEQ ID NO: 2.

[0019] Another object of the present invention is to provide a primer pair A for amplifying the specific promoter, comprising a forward primer whose nucleotide sequence is shown in SEQ ID NO:3 and a reverse primer whose nucleotide sequence is shown in SEQ ID NO:4.

[0020] Another object of the present invention is to provide a cochlea and / or vestibular hair cell-specific recombinant vector comprising the specific promoter described above.

[0021] In some preferred embodiments, the specific promoter STRC gene is inserted into the Kpn1 / Mlu1 or XbaI / BamHI multiple cloning site of the base vector. Preferably, the specific promoter STRC is inserted into the Kpn1 / Mlu1 multiple cloning site of the base vector.

[0022] In some preferred embodiments, the recombinant vector further comprises a target gene. In some preferred embodiments, the target gene is located at the 3' end of the gene of the specific promoter. In some preferred embodiments, the target gene is expressed in cochlea and / or vestibular cells. In some preferred embodiments, the target gene is one or more of human deafness genes, such as prestin, otof, vglut3, and Gjb2.

[0023] Another object of the present invention is to provide a pharmaceutical composition comprising the aforementioned recombinant vector.

[0024] Another object of the present invention is the use of the specific promoter, primer pair, recombinant vector or pharmaceutical composition as described above, 1) Use in the manufacture of a drug for preventing hearing-related diseases; 2) Use in the manufacture of drugs for gene therapy of hearing-related diseases; 3) Use in the production and screening of drugs or vectors for preventing and / or treating hearing-related diseases, 4) Use in constructing animal models of hearing-related diseases; 5) Use in constructing animal models of diseases associated with abnormalities in the deafness gene, 6) Use in research relating to in vitro cochlear and / or vestibular hair cell regeneration; 7) Use in research relating to protection of cochlear and / or vestibular hair cell damage in vitro; 8) Use in research related to in vitro inner ear development; 9) Use in research related to the pathogenesis of hearing-related diseases in vitro; 10) Use in research related to the reconstruction of auditory synapses in vitro; The present invention provides at least one use selected from the following:

[0025] Another object of the present invention is to provide a method for treating hearing-related diseases, comprising administering to a patient in need of treatment an effective amount of the aforementioned recombinant vector.

[0026] In one specific embodiment, the present invention provides the use of the cochlea-specific promoter STRC or the truncated promoter STRC mini in specific expression in the cochlea and / or vestibular hair cells. The STRC promoter was loaded into an adeno-associated virus vector and infected into mouse cochlea and vestibular hair cells in vivo, and it was shown that the STRC promoter can specifically initiate the expression of mNeonGreen gene (a type of fluorescent protein) in the cochlea and vestibular hair cells.

[0027] In one specific embodiment, the present invention provides the use of the aforementioned specific promoter STRC in constructing a genetically modified mouse model, and the promoter STRC or the truncated promoter STRC mini is carried into an adeno-associated virus vector, and at the same time, a target gene is constructed into the adeno-associated virus vector, thereby controlling the transcription and expression of the target gene and constructing a genetically modified mouse model.

[0028] The promoter STRC or the shortened promoter STRC mini described in the present invention is a promoter that acts specifically in the cochlea and vestibular hair cells, so that a gene operably linked downstream of the promoter can be specifically expressed in the cochlea and vestibular hair cells. The promoter described in the present invention can be obtained by genetic engineering methods. For example, the human promoter STRC gene is obtained from the human genome, and a promoter having a desired base sequence is obtained by deleting, inserting or substituting some bases. A promoter having a desired base sequence can also be obtained by partial or total synthesis.

[0029] Compared with existing technologies, the specific promoter STRC or the truncated promoter STRC mini of the present invention has the following advantages and beneficial effects:

[0030] The present invention provides a hair cell-specific promoter, STRC, or a truncated promoter, STRC mini, that can mediate expression of target genes in mouse cochlear and / or vestibular hair cells, thereby labeling or manipulating hair cells.

[0031] The specific promoter STRC or the truncated promoter STRC mini according to the present invention can reduce the expression of exogenous genes in other tissues, such as brain tissue, and increase the safety of gene therapy.

[0032] The expression of target genes mediated by the specific promoter STRC or the truncated promoter STRC mini described in the present invention is more flexible, convenient to apply and less costly than traditional gene recombination methods.

[0033] The specific promoter STRC or the truncated promoter STRC mini described in the present invention can be placed into a required vector and simultaneously express a therapeutic gene for gene therapy, which is not possible with genetically modified animals.

[0034] The specific promoter STRC or the truncated promoter STRC mini described in the present invention has broad application value and market potential in the fields of auditory neuroscience, construction of hearing loss disease models and gene therapy.

[0035] II. Cochlear outer hair cell specific promoter Slc26a5 The present invention discloses a cochlear outer hair cell specific promoter and its use, the promoter is an outer hair cell specific promoter obtained from the genome of C57BL / 6J mouse, which can regulate the specific expression of genes in outer hair cells. The present invention mediates the expression of target genes in cochlear outer hair cells by carrying the promoter in an adeno-associated virus vector and infecting the mouse cochlea in vivo, thereby labeling or manipulating outer hair cells. The promoter has a wide range of application value and market potential in the analysis of the structure and function of cochlear outer hair cells, auditory neuroscience, construction of hearing loss disease models, gene therapy, etc.

[0036] One object of the present invention is to provide a cochlear outer hair cell specific promoter, a) comprising the nucleotide sequence set forth in SEQ ID NO:6; or b) containing a nucleotide fragment having 80% or more sequence identity with SEQ ID NO:6 and having the function of a specific promoter defined in a); The aim is to provide a promoter.

[0037] In the present invention, the nucleotide fragment in b) is specifically a nucleotide fragment obtained by substituting, deleting or adding one or more (specifically, 1 to 50, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 3, 1, 2, or 3) nucleotides in the nucleotide sequence shown in SEQ ID NO: 6, or by adding one or more (specifically, 1 to 50, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 3, 1, 2, or 3) nucleotides to the 5'-terminus and / or 3'-terminus, and which has the function of the nucleotide fragment having a sequence shown in SEQ ID NO: 6. The nucleotide sequence in b) may have 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more sequence identity to SEQ ID NO:6.

[0038] The promoter according to the present invention comprises a nucleic acid having at least 80% sequence identity, preferably at least 90% sequence identity, preferably at least 95% sequence identity, more preferably at least 98% sequence identity to the nucleotide sequence shown in SEQ ID NO: 6, and further preferably comprises the nucleotide sequence shown in SEQ ID NO: 6, and is particularly preferably the nucleotide sequence shown in SEQ ID NO: 6. The promoter may further comprise, in addition to the nucleotide having at least 80% sequence identity to the nucleotide sequence shown in SEQ ID NO: 6, base sequences such as restriction enzyme cleavage sites and sites for cloning into a vector, such as an att sequence for Gateway cloning, at its terminus.

[0039] In some preferred embodiments, the specific promoter is Slc26a5, the nucleotide sequence of which is shown in SEQ ID NO:6.

[0040] Another object of the present invention is to provide a primer pair B for amplifying the aforementioned specific promoter, comprising a forward primer, the nucleotide sequence of which is shown in SEQ ID NO:8, and a reverse primer, the nucleotide sequence of which is shown in SEQ ID NO:9.

[0041] Another object of the present invention is to provide a cochlear outer hair cell-specific recombinant vector comprising the specific promoter.

[0042] In some preferred embodiments, the gene of the specific promoter Slc26a5 is inserted into the Kpn1 / Mlu1 or XbaI / BamHI multiple cloning site of the base vector. Preferably, the gene of the specific promoter Slc26a5 is inserted into the XbaI / BamHI multiple cloning site of the base vector.

[0043] In some preferred embodiments, the recombinant vector further comprises a target gene. In some preferred embodiments, the target gene is located at the 3' end of the gene of the specific promoter. In some preferred embodiments, the target gene is expressed in the cochlear outer hair cells. In some preferred embodiments, the target gene is one or more of human deafness genes, such as prestin, otof, vglut3, and Gjb2.

[0044] Another object of the present invention is to provide a pharmaceutical composition comprising the aforementioned recombinant vector.

[0045] Another object of the present invention is the use of the specific promoter, primer pair, recombinant vector or pharmaceutical composition as described above, 1) Use in the manufacture of a drug for preventing hearing-related diseases; 2) Use in the manufacture of drugs for gene therapy of hearing-related diseases; 3) Use in the production and screening of drugs or vectors for preventing and / or treating hearing-related diseases, 4) Use in constructing animal models of hearing-related diseases; 5) Use in constructing animal models of diseases associated with abnormalities in the deafness gene, 6) Use in research related to in vitro regeneration of cochlear outer hair cells; 7) Use in research related to protecting cochlear outer hair cells from damage in vitro; 8) Use in research related to in vitro inner ear development; 9) Use in research related to the pathogenesis of hearing-related diseases in vitro; 10) Use in research related to the reconstruction of auditory synapses in vitro; The present invention provides at least one use selected from the following:

[0046] Another object of the present invention is to provide a method for treating hearing-related diseases, comprising administering to a patient in need of treatment an effective amount of the aforementioned recombinant vector.

[0047] In one specific embodiment, the present invention provides the use of the aforementioned cochlea-specific promoter Slc26a5 in specific expression in cochlear outer hair cells. The promoter Slc26a5 was loaded onto an adeno-associated virus vector and infected into mouse cochlea in vivo, and it was shown that the promoter Slc26a5 can specifically initiate the expression of mNeonGreen gene (a type of fluorescent protein) in the cochlear outer hair cells.

[0048] In one specific embodiment, the present invention provides the use of the aforementioned specific promoter Slc26a5 in constructing a genetically modified mouse model, by carrying the promoter Slc26a5 into an adeno-associated virus vector and simultaneously constructing a target gene into the adeno-associated virus vector, the transcription and expression of the target gene can be controlled to construct a genetically modified mouse model.

[0049] The promoter Slc26a5 described in the present invention is a promoter that acts specifically in the cochlear outer hair cells, so that a gene operably linked downstream of the promoter can be specifically expressed in the cochlear outer hair cells. The promoter Slc26a5 described in the present invention can be obtained by genetic engineering methods. For example, the human promoter Slc26a5 gene is obtained from the human genome, and a promoter having a desired base sequence is obtained by deleting, inserting or substituting some bases. A promoter having a desired base sequence can also be obtained by partial or total synthesis.

[0050] Compared with existing technologies, the specific promoter Slc26a5 of the present invention has the following advantages and beneficial effects:

[0051] The present invention provides a hair cell-specific promoter, Slc26a5, that can mediate expression of target genes in mouse cochlear outer hair cells, thereby labeling or manipulating cochlear outer hair cells.

[0052] The specific promoter Slc26a5 described in the present invention can reduce the expression of exogenous genes in other tissues, such as brain tissue, and increase the safety of gene therapy.

[0053] The target gene expression mediated by the specific promoter Slc26a5 described in the present invention is more flexible, convenient to apply, and less costly than traditional gene recombinant methods.

[0054] The specific promoter Slc26a5 described in this invention can be loaded into any vector required and simultaneously express therapeutic genes for gene therapy, which is not possible with transgenic animals.

[0055] The specific promoter Slc26a5 described in the present invention has broad application value and market potential in the fields of auditory neuroscience, construction of hearing loss disease models and gene therapy.

[0056] III. Cochlear inner hair cell specific promoter otof The present invention discloses a cochlear inner hair cell specific promoter and its use, the promoter is an inner hair cell specific promoter obtained from the genome of C57BL / 6J mouse, and can regulate the specific expression of genes in inner hair cells. The present invention mediates the expression of target genes in cochlear inner hair cells by carrying the promoter in an adeno-associated virus vector and infecting the mouse cochlea in vivo, thereby labeling or manipulating the inner hair cells. The promoter has a wide range of application value and market potential in the analysis of the structure and function of cochlear inner hair cells, auditory neuroscience, construction of hearing loss disease models, gene therapy, etc.

[0057] One object of the present invention is to provide a cochlear inner hair cell specific promoter, a) comprising the nucleotide sequence set forth in SEQ ID NO: 11; or b) containing a nucleotide fragment having 80% or more sequence identity with SEQ ID NO: 11 and having the function of a specific promoter defined in a); The aim is to provide a promoter.

[0058] In the present invention, the nucleotide fragment in b) is specifically a nucleotide fragment obtained by substituting, deleting or adding one or more (specifically, 1 to 50, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 3, 1, 2, or 3) nucleotides in the nucleotide sequence shown in SEQ ID NO:11, or by adding one or more (specifically, 1 to 50, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 3, 1, 2, or 3) nucleotides to the 5'-terminus and / or 3'-terminus, and which has the function of the nucleotide fragment having a sequence shown in SEQ ID NO:11. The nucleotide sequence in b) may have 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more sequence identity to SEQ ID NO:11.

[0059] The promoter according to the present invention comprises a nucleic acid having at least 80% sequence identity, preferably at least 90% sequence identity, preferably at least 95% sequence identity, more preferably at least 98% sequence identity to the nucleotide sequence shown in SEQ ID NO: 11, and further preferably comprises the nucleotide sequence shown in SEQ ID NO: 11, and is particularly preferably the nucleotide sequence shown in SEQ ID NO: 11. The promoter may further comprise, in addition to the nucleotide having at least 80% sequence identity to the nucleotide sequence shown in SEQ ID NO: 11, base sequences such as restriction enzyme cleavage sites and sites for cloning into a vector, such as an att sequence for Gateway cloning, at its terminus.

[0060] In some preferred embodiments, the specific promoter is otof, the nucleotide sequence of which is shown in SEQ ID NO:11.

[0061] Another object of the present invention is to provide a primer pair C for amplifying the aforementioned specific promoter, comprising a forward primer, the nucleotide sequence of which is shown in SEQ ID NO:13, and a reverse primer, the nucleotide sequence of which is shown in SEQ ID NO:14.

[0062] Another object of the present invention is to provide a cochlear inner hair cell-specific recombinant vector comprising the specific promoter.

[0063] In some preferred embodiments, the specific promoter otof gene is inserted into the base vector at the Kpn1 / Mlu1 or XbaI / BamHI multiple cloning site. Preferably, the specific promoter otof is inserted into the base vector at the XbaI / BamHI multiple cloning site.

[0064] In some preferred embodiments, the recombinant vector further comprises a target gene. In some preferred embodiments, the target gene is located at the 3' end of the gene of the specific promoter. In some preferred embodiments, the target gene is expressed in cochlear inner hair cells. In some preferred embodiments, the target gene is one or more of human deafness genes, such as prestin, otof, vglut3, and Gjb2.

[0065] Another object of the present invention is to provide a pharmaceutical composition comprising the aforementioned recombinant vector.

[0066] Another object of the present invention is the use of the specific promoter, primer pair, recombinant vector or pharmaceutical composition as described above, 1) Use in the manufacture of a drug for preventing hearing-related diseases; 2) Use in the manufacture of drugs for gene therapy of hearing-related diseases; 3) Use in the production and screening of drugs or vectors for preventing and / or treating hearing-related diseases, 4) Use in constructing animal models of hearing-related diseases; 5) Use in constructing animal models of diseases associated with abnormalities in the deafness gene, 6) Use in research related to in vitro regeneration of cochlear inner hair cells; 7) Use in research related to protection of cochlear inner hair cells from damage in vitro; 8) Use in research related to in vitro inner ear development; 9) Use in research related to the pathogenesis of hearing-related diseases in vitro; 10) Use in research related to the reconstruction of auditory synapses in vitro; The present invention provides at least one use selected from the following:

[0067] Another object of the present invention is to provide a method for treating hearing-related diseases, comprising administering to a patient in need of treatment an effective amount of the aforementioned recombinant vector.

[0068] In one specific embodiment, the present invention provides the use of the aforementioned cochlea-specific promoter otof in specific expression in cochlear inner hair cells. The promoter otof was carried in an adeno-associated virus vector and infected into mouse cochlea in vivo, and it was shown that the promoter otof can specifically initiate the expression of mNeonGreen gene (a type of fluorescent protein) in cochlear inner hair cells.

[0069] In one specific embodiment, the present invention provides the use of the aforementioned specific promoter otof in constructing a transgenic mouse model, and the promoter otof is placed into an adeno-associated virus vector, and at the same time, a target gene is constructed into the adeno-associated virus vector, thereby controlling the transcription and expression of the target gene and constructing a transgenic mouse model.

[0070] The promoter otof described in the present invention is a promoter that acts specifically in the cochlear inner hair cells, so that a gene operably linked downstream of the promoter can be specifically expressed in the cochlear inner hair cells. The promoter otof described in the present invention can be obtained by genetic engineering methods. For example, a human promoter otof gene is obtained from the human genome, and a promoter having a desired base sequence is obtained by deleting, inserting or substituting some bases. A promoter having a desired base sequence can also be obtained by partial or total synthesis.

[0071] Compared with existing technologies, the specific promoter otof of the present invention has the following advantages and beneficial effects:

[0072] The present invention provides a hair cell-specific promoter, otof, that can mediate expression of target genes in mouse cochlear inner hair cells, thereby labeling or manipulating inner hair cells.

[0073] The specific promoter otof according to the present invention can reduce the expression of exogenous genes in other tissues, such as brain tissue, and increase the safety of gene therapy.

[0074] The expression of target genes mediated by the specific promoter otof described in the present invention is more flexible, convenient to apply, and less costly than traditional gene recombination methods.

[0075] The specific promoter otof described in this invention can be loaded into a required vector and simultaneously express a therapeutic gene for gene therapy, which is not possible with transgenic animals.

[0076] The specific promoter otof described in the present invention has broad application value and market potential in the fields of auditory neuroscience, construction of hearing loss disease models and gene therapy.

[0077] IV. Cochlear supporting cell-specific promoters The present invention discloses a cochlear supporting cell specific promoter and its use, the promoter is a supporting cell specific promoter obtained from the genome of C57BL / 6J mouse, which can regulate the specific expression of genes in supporting cells. The present invention uses the promoter in an adeno-associated virus vector to infect the mouse cochlea in vivo, mediating the expression of target genes in cochlear supporting cells, thereby labeling or manipulating supporting cells. The promoter has a wide range of application value and market potential in the analysis of the structure and function of cochlear supporting cells, auditory neuroscience, construction of disease models, gene therapy, etc.

[0078] One object of the present invention is to provide a cochlear supporting cell specific promoter, a) comprising the nucleotide sequence set forth in SEQ ID NO: 16; or b) containing a nucleotide fragment having 80% or more sequence identity with SEQ ID NO: 16 and having the function of a specific promoter defined in a); The aim is to provide a promoter.

[0079] In the present invention, the nucleotide fragment in b) is specifically a nucleotide fragment obtained by substituting, deleting or adding one or more (specifically, 1 to 50, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 3, 1, 2, or 3) nucleotides in the nucleotide sequence shown in SEQ ID NO:16, or by adding one or more (specifically, 1 to 50, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 3, 1, 2, or 3) nucleotides to the 5'-terminus and / or 3'-terminus, and which has the function of the nucleotide fragment having a sequence shown in SEQ ID NO:16. The nucleotide sequence in b) may have 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more sequence identity to SEQ ID NO:16.

[0080] The promoter according to the present invention comprises a nucleic acid having at least 80% sequence identity, preferably at least 90% sequence identity, preferably at least 95% sequence identity, more preferably at least 98% sequence identity to the nucleotide sequence shown in SEQ ID NO: 16, and further preferably comprises the nucleotide sequence shown in SEQ ID NO: 16, and is particularly preferably the nucleotide sequence shown in SEQ ID NO: 16. The promoter may further comprise, in addition to the nucleotide having at least 80% sequence identity to the nucleotide sequence shown in SEQ ID NO: 16, base sequences such as restriction enzyme cleavage sites and sites for cloning into a vector, such as an att sequence for Gateway cloning, at its terminus.

[0081] In some preferred embodiments, the specific promoter is Sox10, the nucleotide sequence of which is shown in SEQ ID NO:16.

[0082] Another object of the present invention is to provide a primer pair D for amplifying the aforementioned specific promoter, comprising a forward primer, the nucleotide sequence of which is shown in SEQ ID NO:18, and a reverse primer, the nucleotide sequence of which is shown in SEQ ID NO:19.

[0083] Another object of the present invention is to provide a cochlear supporting cell-specific recombinant vector comprising the specific promoter.

[0084] In some preferred embodiments, the specific promoter Sox10 gene is inserted into the base vector at the Kpn1 / Mlu1 or XbaI / BamHI multiple cloning site. Preferably, the specific promoter STRC is inserted into the base vector at the XbaI / BamHI multiple cloning site.

[0085] In some preferred embodiments, the recombinant vector further comprises a target gene. In some preferred embodiments, the target gene is located at the 3' end of the gene of the specific promoter. In some preferred embodiments, the target gene is expressed in cochlear supporting cells. In some preferred embodiments, the target gene is one or more of human deafness genes, such as prestin, otof, vglut3, and Gjb2.

[0086] Another object of the present invention is to provide a pharmaceutical composition comprising the aforementioned recombinant vector.

[0087] Another object of the present invention is the use of the specific promoter, primer pair, recombinant vector or pharmaceutical composition as described above, 1) Use in the manufacture of a drug for preventing hearing-related diseases; 2) Use in the manufacture of drugs for gene therapy of hearing-related diseases; 3) Use in the production and screening of drugs or vectors for preventing and / or treating hearing-related diseases, 4) Use in constructing animal models of hearing-related diseases; 5) Use in constructing animal models of diseases associated with abnormalities in the deafness gene, 6) Use in research related to the regeneration of cochlear supporting cells in vitro; 7) Use in research related to protection of cochlear supporting cells from damage in vitro; 8) Use in research related to in vitro inner ear development; 9) Use in research related to the pathogenesis of hearing-related diseases in vitro; 10) Use in research related to the reconstruction of auditory synapses in vitro; The present invention provides at least one use selected from the following:

[0088] Another object of the present invention is to provide a method for treating hearing-related diseases, comprising administering to a patient in need of treatment an effective amount of the aforementioned recombinant vector.

[0089] In one specific embodiment, the present invention provides the use of the aforementioned cochlea-specific promoter Sox10 in specific expression in cochlear supporting cells. The promoter Sox10 was loaded onto an adeno-associated virus vector and infected into mouse cochlear supporting cells in vivo, and it was shown that the promoter Sox10 can specifically initiate the expression of the mNeonGreen gene (a type of fluorescent protein) in the cochlear supporting cells.

[0090] In one specific embodiment, the present invention provides the use of the aforementioned specific promoter Sox10 in constructing a genetically modified mouse model, by carrying the promoter Sox10 into an adeno-associated virus vector and simultaneously constructing a target gene into the adeno-associated virus vector to control the transcription and expression of the target gene and construct a genetically modified mouse model.

[0091] The promoter Sox10 described in the present invention is a promoter that acts specifically in cochlear supporting cells, so that a gene operably linked downstream of the promoter can be specifically expressed in the cochlear supporting cells. The promoter described in the present invention can be obtained by genetic engineering methods. For example, the human promoter Sox10 gene is obtained from the human genome, and a promoter having a desired base sequence is obtained by deleting, inserting or substituting some bases. A promoter having a desired base sequence can also be obtained by partial or total synthesis.

[0092] Compared with existing technologies, the specific promoter Sox10 of the present invention has the following advantages and beneficial effects:

[0093] The present invention provides a supporting cell-specific promoter, Sox10, that can mediate expression of target genes in mouse cochlear supporting cells, thereby labeling or manipulating supporting cells.

[0094] The specific promoter Sox10 described in the present invention can reduce the expression of exogenous genes in other tissues, such as brain tissue, and increase the safety of gene therapy.

[0095] The target gene expression mediated by the specific promoter Sox10 described in the present invention is more flexible, convenient to apply, and less costly than traditional gene recombinant methods.

[0096] The specific promoter Sox10 described in this invention can be loaded into a required vector and simultaneously express a therapeutic gene for gene therapy, which is not possible with transgenic animals.

[0097] The specific promoter Sox10 described in the present invention has broad application value and market potential in the fields of auditory neuroscience, construction of hearing loss disease models and gene therapy.

[0098] V. Cochlear type I spiral ganglion cell-specific promoter Ngfr 1 The present invention discloses a cochlear type I spiral ganglion cell specific promoter and its use, the promoter being a type I spiral ganglion cell specific promoter obtained from the genome of C57BL / 6J mouse, capable of regulating the specific expression of genes in type I spiral ganglion cells. The present invention uses the promoter in an adeno-associated virus vector to infect the mouse cochlea in vivo, mediating the expression of target genes in cochlear type I spiral ganglion cells, thereby labeling or manipulating type I spiral ganglion cells. The promoter has broad application value and market potential in the analysis of the structure and function of cochlear type I spiral ganglion cells, the construction of disease models, gene therapy, etc.

[0099] One object of the present invention is to provide a cochlear type I spiral ganglion cell-specific promoter, a) comprising the nucleotide sequence set forth in SEQ ID NO: 21; or b) containing a nucleotide fragment having 80% or more sequence identity with SEQ ID NO: 21 and having the function of a specific promoter as defined in a); The aim is to provide a promoter.

[0100] In the present invention, the nucleotide fragment in b) is specifically a nucleotide fragment obtained by substituting, deleting or adding one or more (specifically, 1 to 50, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 3, 1, 2, or 3) nucleotides in the nucleotide sequence shown in SEQ ID NO:21, or by adding one or more (specifically, 1 to 50, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 3, 1, 2, or 3) nucleotides to the 5'-terminus and / or 3'-terminus, and which has the function of the nucleotide fragment having a sequence shown in SEQ ID NO:21. The nucleotide sequence in b) may have 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more sequence identity to SEQ ID NO:21.

[0101] The promoter according to the present invention comprises a nucleic acid having at least 80% sequence identity, preferably at least 90% sequence identity, preferably at least 95% sequence identity, more preferably at least 98% sequence identity to the nucleotide sequence shown in SEQ ID NO: 21, and further preferably comprises the nucleotide sequence shown in SEQ ID NO: 21, and is particularly preferably the nucleotide sequence shown in SEQ ID NO: 21. The promoter may further comprise, in addition to the nucleotide having at least 80% sequence identity to the nucleotide sequence shown in SEQ ID NO: 21, base sequences such as restriction enzyme cleavage sites and sites for cloning into a vector, such as an att sequence for Gateway cloning, at its terminus.

[0102] In some preferred embodiments, the specific promoter is Ngfr1, the nucleotide sequence of which is shown in SEQ ID NO:21.

[0103] Another object of the present invention is to provide a primer pair E for amplifying the aforementioned specific promoter, comprising a forward primer, the nucleotide sequence of which is shown in SEQ ID NO:23, and a reverse primer, the nucleotide sequence of which is shown in SEQ ID NO:24.

[0104] Another object of the present invention is to provide a cochlear type I spiral ganglion cell-specific recombinant vector comprising the specific promoter.

[0105] In some preferred embodiments, the specific promoter Ngfr1 gene is inserted into the base vector at the Kpn1 / Mlu1 or XbaI / BamHI multiple cloning site. Preferably, the specific promoter Ngfr1 is inserted into the base vector at the Kpn1 / Mlu1 multiple cloning site.

[0106] In some preferred embodiments, the recombinant vector further comprises a target gene. In some preferred embodiments, the target gene is located at the 3' end of the gene of the specific promoter. In some preferred embodiments, the target gene is expressed in cochlear type I spiral ganglion cells. In some preferred embodiments, the target gene is one or more of human deafness genes, such as prestin, otof, vglut3, and Gjb2.

[0107] Another object of the present invention is to provide a pharmaceutical composition comprising the aforementioned recombinant vector.

[0108] Another object of the present invention is the use of the specific promoter, primer pair, recombinant vector or pharmaceutical composition as described above, 1) Use in the manufacture of a drug for preventing hearing-related diseases; 2) Use in the manufacture of drugs for gene therapy of hearing-related diseases; 3) Use in the production and screening of drugs or vectors for preventing and / or treating hearing-related diseases, 4) Use in constructing animal models of hearing-related diseases; 5) Use in constructing animal models of diseases associated with abnormalities in the deafness gene, 6) Use in research related to the regeneration of cochlear type I spiral ganglion cells in vitro; 7) Use in research related to protection of cochlear type I spiral ganglion cells from injury in vitro; 8) Use in research related to in vitro inner ear development; 9) Use in research related to the pathogenesis of hearing-related diseases in vitro; 10) Use in research related to the reconstruction of auditory synapses in vitro; The present invention provides at least one use selected from the following:

[0109] Another object of the present invention is to provide a method for treating hearing-related diseases, comprising administering to a patient in need of treatment an effective amount of the aforementioned recombinant vector.

[0110] In one specific embodiment, the present invention provides the use of the aforementioned cochlea-specific promoter Ngfr1 in specific expression in cochlear type I spiral ganglion cells. The promoter Ngfr1 was carried in an adeno-associated virus vector and infected into mouse cochlear type I spiral ganglion cells in vivo, and it was shown that the promoter Ngfr1 can specifically initiate expression of the mNeonGreen gene (a type of fluorescent protein) in cochlear type I spiral ganglion cells.

[0111] In one specific embodiment, the present invention provides the use of the aforementioned specific promoter Ngfr1 in constructing a genetically modified mouse model, by carrying the promoter Ngfr1 into an adeno-associated virus vector and simultaneously constructing a target gene into the adeno-associated virus vector to control the transcription and expression of the target gene and construct a genetically modified mouse model. The promoter Ngfr1 described in the present invention is a promoter that acts specifically in cochlear type I spiral ganglion cells, so that a gene operably linked downstream of the promoter can be specifically expressed in cochlear type I spiral ganglion cells. The promoter Ngfr1 described in the present invention can be obtained by genetic engineering methods. For example, the human promoter Ngfr1 gene is obtained from the human genome, and a promoter having a desired base sequence is obtained by deleting, inserting or substituting some bases. A promoter having a desired base sequence can also be obtained by partial or total synthesis.

[0112] Compared with existing technologies, the specific promoter Ngfr1 of the present invention has the following advantages and beneficial effects:

[0113] The present invention provides a cochlear type I spiral ganglion cell-specific promoter, Ngfr1, which can mediate expression of target genes in mouse cochlear type I spiral ganglion cells, thereby labeling or manipulating type I spiral ganglion cells.

[0114] The specific promoter Ngfr1 described in the present invention can reduce the expression of exogenous genes in other tissues, such as brain tissue, and increase the safety of gene therapy.

[0115] The target gene expression mediated by the specific promoter Ngfr1 described in the present invention is more flexible, convenient to apply, and less costly than traditional gene recombinant methods.

[0116] The specific promoter Ngfr1 described in this invention can be placed into any vector required and simultaneously express therapeutic genes for gene therapy, which is not possible with transgenic animals.

[0117] The specific promoter Ngfr1 described in the present invention has broad application value and market potential in the fields of auditory neuroscience, construction of hearing loss disease models and gene therapy.

[0118] VI. Cochlear type II spiral ganglion cell-specific promoter Ngfr 2 The present invention discloses a cochlear type II spiral ganglion cell specific promoter and its use, the promoter is a type II spiral ganglion cell specific promoter obtained from the genome of C57BL / 6J mouse, and can regulate the specific expression of genes in type II spiral ganglion cells. The present invention uses the promoter in an adeno-associated virus vector to infect the mouse cochlea in vivo, mediating the expression of target genes in cochlear type II spiral ganglion cells, thereby labeling or manipulating type II spiral ganglion cells. The promoter has broad application value and market potential in the analysis of the structure and function of cochlear type II spiral ganglion cells, auditory neuroscience, construction of hearing loss disease models, gene therapy, etc.

[0119] One object of the present invention is to provide a cochlear type II spiral ganglion cell-specific promoter, a) comprising the nucleotide sequence set forth in SEQ ID NO: 26; or b) containing a nucleotide fragment having 80% or more sequence identity with SEQ ID NO: 26 and having the function of a specific promoter as defined in a); The aim is to provide a promoter.

[0120] In the present invention, the nucleotide fragment in b) is specifically a nucleotide fragment obtained by substituting, deleting or adding one or more (specifically, 1 to 50, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 3, 1, 2, or 3) nucleotides in the nucleotide sequence shown in SEQ ID NO:26, or by adding one or more (specifically, 1 to 50, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 3, 1, 2, or 3) nucleotides to the 5'-terminus and / or 3'-terminus, and which has the function of the nucleotide fragment having a sequence shown in SEQ ID NO:26. The nucleotide sequence in b) may have 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more sequence identity to SEQ ID NO:26.

[0121] The promoter according to the present invention comprises a nucleic acid having at least 80% sequence identity, preferably at least 90% sequence identity, preferably at least 95% sequence identity, more preferably at least 98% sequence identity to the nucleotide sequence shown in SEQ ID NO: 26, and further preferably comprises the nucleotide sequence shown in SEQ ID NO: 26, and is particularly preferably the nucleotide sequence shown in SEQ ID NO: 26. The promoter may further comprise, in addition to the nucleotide having at least 80% sequence identity to the nucleotide sequence shown in SEQ ID NO: 26, base sequences such as restriction enzyme cleavage sites and sites for cloning into a vector, such as an att sequence for Gateway cloning, at its terminus.

[0122] In some preferred embodiments, the specific promoter is Ngfr 2, the nucleotide sequence of which is set forth in SEQ ID NO:26.

[0123] Another object of the present invention is to provide a primer pair F for amplifying the aforementioned specific promoter, comprising a forward primer, the nucleotide sequence of which is shown in SEQ ID NO:28, and a reverse primer, the nucleotide sequence of which is shown in SEQ ID NO:29.

[0124] Another object of the present invention is to provide a cochlear type II spiral ganglion cell-specific recombinant vector comprising the specific promoter.

[0125] In some preferred embodiments, the specific promoter Ngfr2 gene is inserted into the base vector at the Kpn1 / Mlu1 or XbaI / BamHI multiple cloning site. Preferably, the specific promoter Ngfr2 gene is inserted into the base vector at the XbaI / BamHI multiple cloning site.

[0126] In some preferred embodiments, the recombinant vector further comprises a target gene. In some preferred embodiments, the target gene is located at the 3' end of the gene of the specific promoter. In some preferred embodiments, the target gene is expressed in cochlear type I spiral ganglion cells. In some preferred embodiments, the target gene is one or more of human deafness genes, such as prestin, otof, vglut3, and Gjb2.

[0127] Another object of the present invention is to provide a pharmaceutical composition comprising the aforementioned recombinant vector.

[0128] Another object of the present invention is the use of the specific promoter, primer pair, recombinant vector or pharmaceutical composition as described above, 1) Use in the manufacture of a drug for preventing hearing-related diseases; 2) Use in the manufacture of drugs for gene therapy of hearing-related diseases; 3) Use in the production and screening of drugs or vectors for preventing and / or treating hearing-related diseases, 4) Use in constructing animal models of hearing-related diseases; 5) Use in constructing animal models of diseases associated with abnormalities in the deafness gene, 6) Use in research related to the regeneration of cochlear type II spiral ganglion cells in vitro; 7) Use in research related to protection of cochlear type II spiral ganglion cells from injury in vitro; 8) Use in research related to in vitro inner ear development; 9) Use in research related to the pathogenesis of hearing-related diseases in vitro; 10) Use in research related to the reconstruction of auditory synapses in vitro; The present invention provides at least one use selected from the following:

[0129] Another object of the present invention is to provide a method for treating hearing-related diseases, comprising administering to a patient in need of treatment an effective amount of the aforementioned recombinant vector.

[0130] In one specific embodiment, the present invention provides the use of the aforementioned cochlea-specific promoter Ngfr2 in specific expression in cochlear type II spiral ganglion cells. The promoter Ngfr2 was carried in an adeno-associated virus vector and infected into mouse cochlear type II spiral ganglion cells in vivo, and it was shown that the promoter Ngfr2 can specifically initiate expression of the mNeonGreen gene (a type of fluorescent protein) in cochlear type II spiral ganglion cells.

[0131] In one specific embodiment, the present invention provides the use of the aforementioned specific promoter Ngfr2 in constructing a genetically modified mouse model, by carrying the promoter Ngfr2 into an adeno-associated virus vector and simultaneously constructing a target gene into the adeno-associated virus vector to control the transcription and expression of the target gene and construct a genetically modified mouse model.

[0132] The promoter Ngfr2 described in the present invention is a promoter that acts specifically in cochlear type II spiral ganglion cells, so that a gene operably linked downstream of the promoter Ngfr2 can be specifically expressed in cochlear type II spiral ganglion cells. The promoter Ngfr2 described in the present invention can be obtained by genetic engineering methods. For example, the human promoter Ngfr2 gene is obtained from the human genome, and a promoter having a desired base sequence is obtained by deleting, inserting or substituting some bases. A promoter having a desired base sequence can also be obtained by partial or total synthesis.

[0133] Compared with existing technologies, the specific promoter Ngfr2 of the present invention has the following advantages and beneficial effects:

[0134] The present invention provides a cochlear type II spiral ganglion cell-specific promoter, Ngfr2, that can mediate target gene expression in mouse cochlear and vestibular hair cells to label or manipulate hair cells.

[0135] The specific promoter Ngfr2 described in the present invention can reduce the expression of exogenous genes in other tissues, such as brain tissue, and increase the safety of gene therapy.

[0136] The target gene expression mediated by the specific promoter Ngfr2 described in the present invention is more flexible, convenient to apply, and less costly than traditional gene recombinant methods.

[0137] The specific promoter Ngfr2 described in this invention can be loaded into the required vector and simultaneously express therapeutic genes for gene therapy, which is not possible in transgenic animals.

[0138] The specific promoter Ngfr2 described in the present invention has broad application value and market potential in the fields of auditory neuroscience, construction of hearing loss disease models and gene therapy.

[0139] VII. Vestibular hair cell specific promoters The present invention discloses a vestibular hair cell specific promoter and its use, the promoter is a vestibular hair cell specific promoter obtained from the genome of C57BL / 6J mouse, and can regulate the specific expression of genes in vestibular hair cells. The present invention uses the promoter in an adeno-associated virus vector to infect the cochlea of ​​a mouse in vivo, mediating the expression of a target gene in the vestibular hair cells, thereby labeling or manipulating the vestibular hair cells. The promoter has a wide range of application value and market potential in the analysis of the structure and function of vestibular hair cells, auditory neuroscience, construction of hearing loss disease models, gene therapy, etc.

[0140] One object of the present invention is to provide a vestibular hair cell specific promoter, a) comprising the nucleotide sequence set forth in SEQ ID NO: 31; or b) containing a nucleotide fragment having 80% or more sequence identity with SEQ ID NO: 31 and having the function of a specific promoter defined in a); The aim is to provide a promoter.

[0141] In the present invention, the nucleotide fragment in b) is specifically a nucleotide fragment obtained by substituting, deleting or adding one or more (specifically, 1 to 50, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 3, 1, 2, or 3) nucleotides in the nucleotide sequence shown in SEQ ID NO:31, or by adding one or more (specifically, 1 to 50, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 1 to 3, 1, 2, or 3) nucleotides to the 5'-terminus and / or 3'-terminus, and which has the function of the nucleotide fragment having a sequence shown in SEQ ID NO:31. The nucleotide sequence in b) may have 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more sequence identity to SEQ ID NO:31.

[0142] The promoter according to the present invention comprises a nucleic acid having at least 80% sequence identity, preferably at least 90% sequence identity, preferably at least 95% sequence identity, more preferably at least 98% sequence identity to the nucleotide sequence shown in SEQ ID NO: 31, and further preferably comprises the nucleotide sequence shown in SEQ ID NO: 31, and is particularly preferably the nucleotide sequence shown in SEQ ID NO: 31. The promoter may further comprise, in addition to the nucleotide having at least 80% sequence identity to the nucleotide sequence shown in SEQ ID NO: 31, base sequences such as restriction enzyme cleavage sites and sites for cloning into a vector, such as an att sequence for Gateway cloning, at its terminus.

[0143] In some preferred embodiments, the specific promoter is Dnah5, the nucleotide sequence of which is shown in SEQ ID NO:31.

[0144] Another object of the present invention is to provide a primer pair G for amplifying the aforementioned specific promoter, comprising a forward primer, the nucleotide sequence of which is shown in SEQ ID NO: 33, and a reverse primer, the nucleotide sequence of which is shown in SEQ ID NO: 34.

[0145] Another object of the present invention is to provide a vestibular hair cell-specific recombinant vector comprising the specific promoter described above.

[0146] In some preferred embodiments, the specific promoter Dnah5 gene is inserted into the Kpn1 / Mlu1 or XbaI / BamHI multiple cloning site of the base vector. Preferably, the specific promoter Dnah5 is inserted into the Kpn1 / Mlu1 multiple cloning site of the base vector.

[0147] In some preferred embodiments, the recombinant vector further comprises a target gene. In some preferred embodiments, the target gene is located at the 3' end of the gene of the specific promoter. In some preferred embodiments, the target gene is expressed in cochlea and / or vestibular cells. In some preferred embodiments, the target gene is one or more of human deafness genes, such as prestin, otof, vglut3, Gjb2.

[0148] Another object of the present invention is to provide a pharmaceutical composition comprising the aforementioned recombinant vector.

[0149] Another object of the present invention is the use of the specific promoter, primer pair, recombinant vector or pharmaceutical composition as described above, 1) Use in the manufacture of a drug for preventing hearing-related diseases; 2) Use in the manufacture of drugs for gene therapy of hearing-related diseases; 3) Use in the production and screening of drugs or vectors for preventing and / or treating hearing-related diseases, 4) Use in constructing animal models of hearing-related diseases; 5) Use in constructing animal models of diseases associated with abnormalities in the deafness gene, 6) Use in research relating to in vitro vestibular hair cell regeneration; 7) Use in research related to protecting vestibular hair cells from damage in vitro; 8) Use in research related to in vitro inner ear development; 9) Use in research related to the pathogenesis of hearing-related diseases in vitro; 10) Use in research related to the reconstruction of auditory synapses in vitro; The present invention provides at least one use selected from the following:

[0150] Another object of the present invention is to provide a method for treating hearing-related diseases, comprising administering to a patient in need of treatment an effective amount of the aforementioned recombinant vector.

[0151] In one specific embodiment, the present invention provides the use of the aforementioned specific promoter Dnah5 in specific expression in vestibular hair cells. The promoter Dnah5 was loaded onto an adeno-associated virus vector and infected into mouse cochlea and vestibular hair cells in vivo, and it was shown that the promoter Dnah5 can specifically initiate the expression of the mNeonGreen gene (a type of fluorescent protein) in vestibular hair cells.

[0152] In one specific embodiment, the present invention provides the use of the aforementioned specific promoter Dnah5 in constructing a genetically modified mouse model, by carrying the promoter Dnah5 into an adeno-associated virus vector and simultaneously constructing a target gene into the adeno-associated virus vector to control the transcription and expression of the target gene and construct a genetically modified mouse model.

[0153] The promoter Dnah5 described in the present invention is a promoter that acts specifically in vestibular hair cells, so that a gene operably linked downstream of the promoter Dnah5 can be specifically expressed in vestibular hair cells. The promoter Dnah5 described in the present invention can be obtained by genetic engineering methods. For example, the human promoter Dnah5 gene is obtained from the human genome, and a promoter having a desired base sequence is obtained by deleting, inserting or substituting some bases. A promoter having a desired base sequence can also be obtained by partial or total synthesis.

[0154] Compared with existing technologies, the specific promoter Dnah5 of the present invention has the following advantages and beneficial effects:

[0155] The present invention provides a vestibular hair cell-specific promoter, Dnah5, that can mediate expression of target genes in mouse vestibular hair cells, thereby labeling or manipulating hair cells.

[0156] The specific promoter Dnah5 described in the present invention can reduce the expression of exogenous genes in other tissues, such as brain tissue, and increase the safety of gene therapy.

[0157] The expression of target genes mediated by the specific promoter Dnah5 described in the present invention is more flexible, convenient to apply, and less costly than traditional gene recombination methods.

[0158] The specific promoter Dnah5 described in this invention can be loaded into any vector required and simultaneously express therapeutic genes for gene therapy, which is not possible with transgenic animals.

[0159] The specific promoter Dnah5 described in the present invention has broad application value and market potential in the fields of auditory neuroscience, construction of hearing loss disease models and gene therapy. [Brief description of the drawings]

[0160] [Figure 1] FIG. 1 is a map of the pAAV-CMVen-STRC promoter-NLS-mNeonGreen-WPRE-SV40 expression vector. [Figure 2A] The STRC promoter can be specifically expressed in cochlear hair cells. The figure shows a section of a cochlea injected with rAAV-CMVen-STRC promoter-NLS-mNeonGreen-WPRE-SV40 virus. In Figure 2A, purple represents the marker protein Myo7a in hair cells, and green represents the cells infected with the virus, and the fluorescent protein was specifically expressed in cochlear hair cells. [Figure 2B] STRC promoter can specifically express in cochlear hair cells. The figure shows the section of the cochlea injected with rAAV-CMVen-STRC promoter-NLS-mNeonGreen-WPRE-SV40 virus. In Fig. 2B, red represents the marker Sox2 of supporting cells, and green represents the cells infected with the virus. The results show that STRC promoter can reduce the expression in supporting cells. [Diagram 3] STRC promoter can specifically express in vestibular hair cells. The figure shows the section of the vestibular utricle injected with rAAV-CMVen-STRC promoter-NLS-mNeonGreen-WPRE-SV40 virus, purple represents the marker protein Myo7a in hair cells, red represents the marker protein Sox2 in supporting cells, and green represents the virus-infected cells. The results show that STRC promoter can specifically express fluorescent protein in vestibular hair cells, but not in supporting cells other than hair cells. [Figure 4]Sections of cochlea injected with rAAV-CMVen-STRC mini promoter-NLS-mNeonGreen-WPRE-SV40 virus. Purple represents hair cell marker protein Myo7a, red represents supporting cell marker Sox2, green represents virus-infected cells, results show that STRC mini promoter can regulate fluorescent protein to be expressed specifically in hair cells but reduce expression in supporting cells. [Diagram 5] rAAV-CMVen-STRC mini promoter-Tprn restores hearing in mice. (a) Schematic diagram of Tprn KO mice. Crispr Cas9 technology cuts the region of exons 1-4, and the genotype of Tprn KO mice can be detected at about 7614 nt bases with two pairs of primers, P1, P2 and P3, P4. (b) Identification PCR gel of the tail of Tprn KO mice. WT: normal mice; KO: Tprn KO mice; -: ddH2O. (c) Hearing detection threshold. Black: normal mice; red: Tprn KO mice; green: mice treated by injection of rAAV-CMVen-STRC mini promoter-Tprn-WPRE-SV40. (d) Waveform diagram of hearing detection at 11.3 kHz. Black: normal mice, threshold 15 dB; red: Tprn KO mice, threshold 75 dB; green: mice treated with rAAV-CMVen-STRC mini promoter-Tprn-WPRE-SV40 injection, threshold 35 dB. (e) Confocal images of normal mice, Tprn KO mice, and mice treated with rAAV-CMVen-STRC mini promoter-Tprn-WPRE-SV40 injection. The results showed that rAAV-CMVen-STRC mini promoter-Tprn-WPRE-SV40 could express TPRN protein in hair cells and restore the hearing of mice. [Figure 6]Sections of cochlea (a), vestibular (b) and spiral ganglion neurons (c) from mice injected with rAAV-CAG-NLS-mNeonGreen-WPRE-SV40 virus, and d shows the infection efficiency of different types of cochlear cells. In Fig. 6a, b, purple represents the marker protein Myo7a in hair cells, red represents the marker protein Sox2 in supporting cells, and green represents the cells infected with the virus, and in Fig. 6c, purple represents the marker protein Tuj1 in spiral ganglion neurons, and green represents the cells infected with the virus. [Figure 7] 1 shows the results of sequence alignment of the degree of conservation of Slc26a5 in Example 2. [Figure 8] FIG. 14 is a map of the pAAV-Slc26a5 promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40 plasmid. [Figure 9] Section of a cochlea injected with rAAV-Slc26a5 promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40 virus shows that the Slc26a5 promoter can be expressed specifically in the cochlear outer hair cells. [Figure 10] FIG. 1 shows a map of pAAV-otof promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40 plasmid in Example 3. [Figure 11] FIG. 1 shows a section of a cochlea injected with the rAAV-otof promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40 virus in Example 3, showing that the otof promoter can be expressed specifically in the cochlear inner hair cells. [Figure 12] FIG. 14 is a map of the pAAV-Sox10 promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40 plasmid. [Figure 13A]Sections of cochleae injected with rAAV-Sox10 promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40 virus show that the Sox10 promoter can act specifically in cochlear supporting cells. Figure 13A shows the staining results of supporting cells. [Figure 13B] Sections of the cochlea injected with rAAV-Sox10 promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40 virus show that the Sox10 promoter can act specifically in the cochlear supporting cells. Figure 13B shows the staining results of hair cells. [Figure 14] Conserved regions of Ngfr gene sequences in different species, where the region boxed in red is the Ngfr 1 promoter sequence. [Figure 15] FIG. 14 is a map of the pAAV-Ngfr 1 promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40 plasmid. [Figure 16] Sections of cochleae injected with rAAV-Ngfr 1 promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40 virus show that the Ngfr 1 promoter can be specifically expressed in SGNs but not in type II spiral ganglion cells. [Figure 17] FIG. 1 shows a section of a cochlea injected with rAAV-Ngfr 1 promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40 virus, demonstrating that the Ngfr 1 promoter can be expressed specifically in type I spiral ganglion cells. [Figure 18] Conserved regions of Ngfr gene sequences in different species, where the red boxed region is the Ngfr 2 promoter sequence. [Figure 19] FIG. 14 is a map of the pAAV-Ngfr 2 promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40 plasmid. [Figure 20] FIG. 1 shows a section of a cochlea injected with rAAV-Ngfr 2 promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40 virus, showing that the Ngfr 2 promoter can be expressed specifically in SGNs and in type II spiral ganglion cells. [Figure 21] FIG. 1 shows a section of a cochlea injected with rAAV-Ngfr 2 promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40 virus, showing that the Ngfr 2 promoter cannot be expressed specifically in type I spiral ganglion cells. [Figure 22] Map of pAAV-CMVen-Dnah5 promoter-NLS-mNeonGreen-WPRE-SV40 promoter. [Figure 23] FIG. 1 shows sections of the vestibule (a) and cochlea (b) injected with rAAV-CMVen-Dnah5 promoter-NLS-mNeonGreen-WPRE-SV40 virus, demonstrating that the Dnah5 promoter can be expressed specifically in vestibular hair cells. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0161] The present invention discloses a cochlea and / or vestibular hair cell specific promoter and its use, which can regulate the specific expression of a gene in a particular cochlea and / or vestibular cell. The present invention can label or manipulate cochlea and / or vestibular cells by carrying the promoter in an adeno-associated virus vector and infecting the cochlea and / or vestibule of a mouse in vivo, thereby mediating the expression of a target gene in the cochlea and / or vestibular hair cell. The promoter has a wide range of application value and market potential in the analysis of the structure and function of cochlea and / or vestibular cells, auditory neuroscience, construction of hearing loss disease models, gene therapy, etc.

[0162] In the present invention, the type of vector is not limited, and may be a viral vector, including, but not limited to, one or more of adeno-associated viral vector, adenovirus vector, lentivirus vector, retrovirus vector, herpes simplex viral vector, herpes simplex viral amplicon vector, pseudorabies viral vector, baculovirus vector, and box virus vector. In some preferred embodiments, the vector is an adeno-associated viral vector.

[0163] In the present invention, the disease is a hearing-related disease, and preferably, the sensorineural hearing loss is selected from presbycusis, noise-induced hearing loss, hearing loss associated with ototoxic drugs, sudden hearing loss, ischemic hearing loss, autoimmune hearing loss, Meniere's disease, hearing loss associated with head injury, hereditary hearing loss, dysfunction of the organ of Corti due to other or unknown causes, or damage to the organ of Corti due to viral or bacterial infection, or a combination thereof.

[0164] In the present invention, the pharmaceutical composition may further include a pharma- ceutically acceptable carrier. The carrier may include various excipients and diluents, but these carriers themselves are not essential active ingredients and are not excessively toxic after application. Suitable carriers are well known to those skilled in the art. The acceptable carriers include, for example, sterile water or saline, stabilizers, excipients, antioxidants (such as ascorbic acid), buffers (such as phosphoric acid, citric acid, other organic acids), preservatives, surfactants (such as PEG, Tween), chelating agents (such as EDTA), binders, etc., and may include other low molecular weight polypeptides, proteins such as serum albumin, gelatin, or immunoglobulins, amino acids such as glycine, glutamine, asparagine, arginine, and lysine, sugars or carbohydrates such as polysaccharides and monosaccharides, and sugar alcohols such as mannitol and sorbitol. When preparing an aqueous solution for injection, for example, an isotonic solution containing physiological saline, glucose or other auxiliary drugs such as D-sorbitol, D-mannose, D-mannitol, or sodium chloride may be used, and a suitable solubilizing agent such as alcohol (e.g., ethanol), polyhydric alcohol (e.g., propylene glycol, PEG), or nonionic surfactant (Tween 80, HCO-50), may be used in combination.

[0165] Example 1 Promoter STRC 1. Isolation and identification of the full-length promoter STRC Primer design Based on the complete genome sequence of mouse C57BL / 6J provided by NCBI, amplification primers were designed from the sequence of mouse STRC gene, and homology arms were added to the ends of the primers according to the characteristics of the vector and target gene used, and used for recombinant synthesis of plasmids. The primer sequences are as follows: Upstream primer: ctattaccatggtgctcgag acaatatcagttcttgaggccaagtag (SEQ ID NO: 3) Downstream primer: gcccagtgtgcacctggaaat ggtacctcgacggtaagtcc (Sequence number 4). The upstream and downstream primers each have a homology arm sequence, which is underlined. The primers were synthesized by GENEWIZ, Inc.

[0166] b. Cloning of the promoter STRC Using mouse C57BL / 6J genomic DNA as a template, the STRC promoter fragment was PCR amplified with the upstream and downstream primers. The PCR amplification conditions were 95°C pre-denaturation for 5 min; 30 cycles of 95°C denaturation for 30 s, 59°C annealing for 30 s, 72°C extension for 1.5 min; and 72°C extension for 10 min. The PCR amplified product was confirmed by detection using 1% agarose gel electrophoresis, and the target fragment was excised from the gel and sent to BioSune Biotechnology (Shanghai) Co., Ltd. for sequencing verification. The amplified sequence was the STRC promoter sequence, and its nucleotide sequence was shown in SEQ ID NO:1. The concentration of the recovered fragment was detected using Nanodrop2000.

[0167] SEQ ID NO:1 [Table 1]

[0168] 2. Functional verification of the full-length promoter STRC A. Construction of recombinant expression vectors First, the sequence of the CMV enhancer was synthesized, and homology arms that link to the vector were added before and after the sequence; the homology arms are underlined, and the nucleotide sequence is shown in SEQ ID NO:5.

[0169] SEQ ID NO:5 [Table 2]

[0170] Using the method of multi-fragment homologous recombination, the promoter CMV enhancer fragment, STRC fragment, was inserted into the pAAV-CAG-mNeonGreen-WPRE-SV40 plasmid double-cleaved with Kpn1 and Mlu1 enzymes, and ligated by means of homologous recombination using a recombination kit (Vazyme, MultiS One Step Cloning Kit). The recombination system consisted of linearized pAAV-CAG-mNeonGreen-WPRE-SV40 vector, 50 ng; cloned STRC promoter fragment, 30 ng; synthetic CMV enhancer fragment, 30 ng; recombinant ligase Exnase MultiS, 1 μL; recombinant ligation buffer 5×CE MultiS Buffer, 4 μL; supplemented with ddH2O up to 20 μL; reacted at 50°C for 20 minutes to generate the recombinant product.

[0171] The ligation product was transformed into E. coli JM109 responsive cells and incubated overnight at 37°C incubator. Single clones were selected for colony PCR identification, and positive colonies were expanded and plasmid extracted. The plasmid was verified by sequencing, and the plasmid that was correct by sequencing was named pAAV-CMVen-STRC promoter-NLS-mNeonGreen-WPRE-SV40. The map of the constructed plasmid expression vector is shown in Figure 1.

[0172] b. Virus production of recombinant expression vectors Using the conventional method of packaging adeno-associated virus with three plasmids, virus packaging was performed for the recombinant expression vector. The rep-cap plasmid with AAV-ie coat, pAAV-CMVen-STRC promoter-NLS-mNeonGreen-WPRE-SV40 and pHelper plasmid 3 (AAV-ie is the same as SEQ ID NO: 12 in the patent document (CN110437317A)) were co-transfected into HEK-293T cells in appropriate amounts, and then concentrated and purified by iodixanol gradient centrifugation. Finally, the titer of the recombinant adeno-associated virus was detected by SYBR Green qPCR, and the rAAV-CMVen-STRC promoter-NLS-mNeonGreen-WPRE-SV40 virus with a titer of 1 x 1013vg / mL was finally obtained.

[0173] c. Biological validation of the full-length STRC promoter The rAAV-CMVen-STRC promoter-NLS-mNeonGreen-WPRE-SV40 virus was injected into the cochlea of ​​2-3 day-old C57BL / 6J mice through the round window. After the virus was fully expressed for 10-14 days, the mice were sacrificed by cervical dislocation, and the injected cochlea was removed and placed in 4% paraformaldehyde for fixation at room temperature for 2 hours. It was then washed three times with PBS for 5 minutes each. It was further decalcified with 0.5 mM EDTA and immersed at room temperature for 2 hours to soften the cochlea. Under a stereomicroscope, the basilar membrane was dissected into three parts, apical, middle, and basal, and the utricle tissue of the vestibule with an ophthalmic scalpel. Cochlear samples were prepared by immunofluorescence staining, with anti-Myo7a antibody to label hair cells and anti-Sox2 antibody to label supporting cells. The virus-infected cells were imaged by confocal laser scanning microscopy, and green fluorescent protein was expressed in the cell nuclei. The excitation wavelengths were 488 nm, 561 nm, and 647 nm, respectively. The results of live cell detection, as shown in Figures 2A, 2B, and 3, showed that the green fluorescent protein was almost perfectly colabeled with the hair cell marker Myo7a, shown in purple, indicating that the STRC promoter can be specifically expressed in the hair cells of the cochlea and the utricle of the vestibule.

[0174] 3. Functional validation of the truncated STRC promoter sequence A shortened STRC promoter sequence also has specificity and is called the STRC mini promoter, the sequence of which is as follows (SEQ ID NO:2):

[0175] a. Construction of STRC mini promoter-containing virus The rAAV-CMVen-STRC mini promoter-NLS-mNeonGreen-WPRE-SV40 virus was obtained according to the construction methods of Example 1, Part 2 a and b, except that the STRC promoter was changed to the STRC mini promoter.

[0176] b. The results of in vivo validation in mice are as follows:

[0177] The operation method is the same as in 2c of Example 1.

[0178] Figure 4 shows the section of cochlea injected with rAAV-CMVen-STRC mini promoter-NLS-mNeonGreen-WPRE-SV40 virus. Purple represents the marker protein Myo7a of hair cells, red represents the marker Sox2 of supporting cells, and green represents the cells infected with the virus. The results show that STRC mini promoter can regulate the fluorescent protein to be expressed specifically in hair cells, but reduce the expression in supporting cells.

[0179] 5. The mouse tprn gene was packaged using the STRC mini promoter, and its effect on hearing recovery was detected.

[0180] The pAAV-CMVen-STRC mini promoter-tprn-WPRE-SV40 plasmid was constructed by packaging the murine tprn gene with the STRC mini promoter. The gene was packaged into the rAAV-CMVen-STRC mini promoter-tprn-WPRE-SV40 virus by the above method and injected into P3tprn- / - mice. At 30 days after birth, the hearing of the mice was detected by auditory brainstem response. The results showed that the 30-day-old tprn- / - mice had severe hearing loss, while the mice injected with the rAAV-CMVen-STRC mini promoter-Tprn-WPRE-SV40 virus had a significant recovery of hearing.

[0181] Figure 5 is a diagram of the hearing recovery of mice by rAAV-CMVen-STRC mini promoter-Tprn-WPRE-SV40. (a) Schematic diagram of Tprn KO mice. Crispr Cas9 technology can cut the region of exons 1-4, and detect the genotype of Tprn KO mice at about 7614 nt bases with two pairs of primers P1, P2 and P3, P4, but those skilled in the art can design the primers according to actual needs. (b) Identification PCR gel diagram of the tail of Tprn KO mice. WT: normal mice; KO: Tprn KO mice; -: ddH2O. (c) Diagram of hearing detection threshold. Black: normal mice; Red: Tprn KO mice; Green: mice treated by injection of rAAV-CMVen-STRC mini promoter-Tprn-WPRE-SV40. (d) Waveform diagram of hearing detection at 11.3 kHz. Black: normal mice, threshold 15 dB; red: Tprn KO mice, threshold 75 dB; green: mice treated with rAAV-CMVen-STRC mini promoter-Tprn-WPRE-SV40 injection, threshold 35 dB. (e) Confocal images of normal mice, Tprn KO mice, and mice treated with rAAV-CMVen-STRC mini promoter-Tprn-WPRE-SV40 injection. The results showed that rAAV-CMVen-STRC mini promoter-Tprn-WPRE-SV40 could express TPRN protein in hair cells and restore the hearing of mice.

[0182] P1: 5'-GAGATTATGGCCCTTCAGAGTCAC-3' (SEQ ID NO: 35); P2: 5'-GAGTTGCAGAGCCCAGAGGTTAGG-3' (SEQ ID NO: 36); P3: 5'-GCTGCTTCCTTGATGCCTCCTACA-3' (SEQ ID NO: 37); P4: 5'-TGCTCAATGGCTGCTCCTCACTTC-3' (sequence number 38).

[0183] 6. Regulation of gene expression by the CAG promoter The versatile promoter CAG can regulate the expression of fluorescent proteins in supporting cells, hair cells and spiral ganglion neurons as well as in supporting cells and hair cells of the vestibular system.

[0184] a. Construction of promoter-CAG-containing viruses The rAAV-CAG-NLS-mNeonGreen-WPRE-SV40 virus was obtained according to the construction methods of the second a and b of Example 1, except that the CMV enhancer fragment was removed and the STRC promoter was changed to CAG.

[0185] b. The results of in vivo validation in mice are as follows:

[0186] The operation method is the same as in 2c of Example 1.

[0187] Figure 6 shows schematic diagrams of the cochlea (a), vestibular (b) and spiral ganglion neurons (c) of mice injected with rAAV-CAG-NLS-mNeonGreen-WPRE-SV40 virus. In a and b, purple represents the marker protein Myo7a of hair cells, red represents the marker protein Sox2 of supporting cells, and green represents the cells infected with the virus. In c, purple represents the marker protein Tuj1 of spiral ganglion neurons, and green represents the cells infected with the virus. d is the infection efficiency of different types of cochlear cells.

[0188] Example 2 Promoter Slc26a5 1. Isolation and Identification of Promoter Slc26a5 a. Synthesis of promoter Slc26a5 sequence Based on the mouse GRCm39 / mm39 genome provided by http: / / www.genome.ucsc.edu / , Slc26a5 was aligned with different species such as rat, guinea pig and rabbit, and several highly conserved sequence regions were obtained in the transcription initiation region. The two sequences were combined by synthesis, and homology arms were added upstream and downstream, as shown in Figure 7, the upstream homology arm is cacgcgttctcgattctaga (SEQ ID NO: 8), and the downstream homology arm is ctttctttctctttcttt (SEQ ID NO: 9), which was used to construct a vector, the nucleotide sequence of which is shown in SEQ ID NO: 6, and the homology arm part is underlined. The sequence of promoter Slc26a5 was synthesized by Tsingke Biotech (Shanghai) Co., Ltd.

[0189] SEQ ID NO:6 [Table 3]

[0190] b. Amplification of promoter Slc26a5 The synthesis product DNA was used as a template to amplify the promoter Slc26a5 with upstream and downstream primers. The PCR amplification conditions were 95°C pre-denaturation for 5 min; 30 cycles of 95°C denaturation for 30 s, 59°C annealing for 30 s, 72°C extension for 1.5 min; and 72°C extension for 10 min. The PCR amplification products were confirmed by detection using 1% agarose gel electrophoresis, and the gel was cut out to recover the target fragment. The target fragment was sent to BioSune Biotechnology (Shanghai) Co., Ltd. for sequencing verification. The amplified sequence was found to be the sequence of the Slc26a5 promoter, and its nucleotide sequence was shown in SEQ ID NO:6. The concentration of the recovered fragment was detected using Nanodrop2000.

[0191] 2. Functional Verification of Promoter Slc26a5 A. Construction of recombinant expression vectors First, the SHH mini promoter sequence is synthesized, and a homology arm that is linked to the vector is added downstream of the sequence, and the downstream homology arm is gctagcgaattcgccaccat (SEQ ID NO: 10). The nucleotide sequence is shown in SEQ ID NO: 7.

[0192] SEQ ID NO:7 [Table 4] Using the method of multi-fragment homologous recombination, the SHH mini promoter fragment and the Slc26a5 fragment were inserted into the pAAV-CAG-mNeonGreen-WPRE-SV40 plasmid double-cut with XbaI and NheI enzymes, and ligated by the method of homologous recombination using a recombination kit (Vazyme, MultiS One Step Cloning Kit). The recombination system consisted of linearized pAAV-CAG-mNeonGreen-WPRE-SV40 vector, 50ng; cloned Slc26a5 promoter fragment, 30ng; synthetic SHH mini promoter fragment, 30ng; recombinant ligase Exnase MultiS, 1μL; recombinant ligation buffer 5×CE MultiS Buffer, 4μL; supplemented with ddH2O up to 20μL; reacted at 50℃ for 20 minutes to generate the recombinant product.

[0193] The ligation product was transformed into E. coli JM109 responsive cells and placed in a 37℃ incubator overnight. Single clones were selected for colony PCR identification, and positive colonies were expanded and plasmid extracted. The plasmid was verified by sequencing. The plasmid that was sequenced correctly was named pAAV-Slc26a5promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40. The map of the constructed plasmid recombinant expression vector is shown in Figure 8.

[0194] b. Virus production of recombinant expression vectors Using the conventional method of packaging adeno-associated virus with three plasmids described in Section 2b of Example 1, except that the plasmid recombinant expression vector is different, the virus was packaged for the recombinant expression vector, and then concentrated and purified by iodixanol gradient centrifugation. Finally, the titer of the recombinant adeno-associated virus was detected by SYBR Green qPCR. Finally, the rAAV-Slc26a5 promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40 virus with a titer of 1 x 1013vg / mL was obtained.

[0195] 3. Biological validation of the Slc26a5 promoter rAAV-Slc26a5 promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40 virus was injected into the cochlea of ​​2-3 day old C57BL / 6J mice through the round window. After the virus was fully expressed for 10-14 days, the mice were sacrificed by cervical dislocation, and the injected cochlea was removed and placed in 4% paraformaldehyde for 2 hours at room temperature. It was then washed three times with PBS for 5 minutes each. It was further decalcified with 0.5 mM EDTA and immersed at room temperature for 2 hours to soften the cochlea. Under a stereomicroscope, the basilar membrane was dissected into three parts, apical, middle, and basal, and the utricle tissue of the vestibule with an ophthalmic scalpel. Cochlear samples were prepared by immunofluorescence staining, with anti-Myo7a antibody to label hair cells and anti-Sox2 antibody to label supporting cells. By imaging with a confocal laser scanning microscope, the virus-infected cells expressed green fluorescent protein in the cell nucleus. The wavelengths of excitation light were 488nm, 561nm, and 647nm, respectively. The results of the detection in vivo are shown in Figure 9, which shows a section of the cochlea injected with rAAV-Slc26a5 promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40 virus; purple represents the marker protein Myo7a in hair cells, which are divided into three rows of outer hair cells on the top and one row of inner hair cells on the bottom; green represents the virus-infected cells, which shows that the Slc26a5 promoter specifically expresses fluorescent protein in the outer hair cells of the cochlea.

[0196] Example 3 Promoter otof 1. Isolation and Identification of the Promoter otof a. Design of primers for promoter otof Based on the complete genome sequence of mouse C57BL / 6J strain provided by NCBI, amplification primers were designed from the sequence of mouse otof gene, and homology arms were added to the ends of the primers according to the characteristics of the vector and target gene used, and used for recombinant synthesis of plasmids. The primer sequences are as follows: Upstream primer: cacgcgttctcgattctaga gtactacagcccacagaagag (SEQ ID NO: 13), Downstream primer: cttcccgctgctctggaactgcc ctttctttctctctttcttt (Sequence number 14). The upstream and downstream primers each have a homology arm sequence, which is underlined. The primers were synthesized by GENEWIZ, Inc.

[0197] b. Amplification of promoter otof Using mouse C57BL / 6J genomic DNA as a template, the otof promoter fragment was PCR amplified with the upstream and downstream primers. The PCR amplification conditions were 95°C pre-denaturation for 5 min; 30 cycles of 95°C denaturation for 30 s, 59°C annealing for 30 s, 72°C extension for 1.5 min; 72°C extension for 10 min. The PCR amplified product was confirmed by detection using 1% agarose gel electrophoresis, and the gel was cut out to recover the target fragment. The target fragment was sent to BioSune Biotechnology (Shanghai) Co., Ltd. for sequencing verification. The amplified sequence was the otof promoter sequence, the nucleotide sequence of which is shown in SEQ ID NO: 11, and the homology arms are underlined. The concentration of the recovered fragment was detected using Nanodrop2000.

[0198] SEQ ID NO:11 [Table 5]

[0199] 2. Functional Verification of the Promoter otof A. Construction of recombinant expression vectors First, the SHH mini promoter sequence is synthesized, and a homology arm that is linked to the vector is added downstream of the sequence, and the downstream homology arm is gctagcgaattcgccaccat (SEQ ID NO: 15). The nucleotide sequence is shown in SEQ ID NO: 12.

[0200] SEQ ID NO:12 [Table 6] By using the method of multi-fragment homologous recombination, the SHH mini promoter fragment and the otof fragment were inserted into the pAAV-CAG-mNeonGreen-WPRE-SV40 plasmid double-cut with XbaI and NheI enzymes, and ligated by the method of homologous recombination using a recombination kit (Vazyme, MultiS One Step Cloning Kit). The recombination system consisted of linearized pAAV-CAG-mNeonGreen-WPRE-SV40 vector, 50ng; cloned otof promoter fragment, 30ng; synthetic SHH mini promoter fragment, 30ng; recombination ligase Exnase MultiS, 1μL; recombination ligation buffer 5×CE MultiS Buffer, 4μL; supplemented with ddH2O up to 20μL; reacted at 50℃ for 20 minutes to generate the recombination product.

[0201] The ligation product was transformed into E. coli JM109 responsive cells and incubated overnight at 37°C incubator. Single clones were selected for colony PCR identification, and positive colonies were expanded and plasmid extracted. The plasmid was verified by sequencing, and the plasmid that was correct by sequencing was named pAAV-otof promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40. The map of the constructed expression vector is shown in Figure 10.

[0202] b. Virus production of recombinant expression vectors Using the conventional method of packaging adeno-associated virus with three plasmids described in Section 2b of Example 1, except that the plasmid recombinant expression vector is different, the recombinant expression vector is packaged with the virus, and then concentrated and purified by iodixanol gradient centrifugation. Finally, the titer of the recombinant adeno-associated virus is detected by SYBR Green qPCR. Finally, the rAAV-otof promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40 virus with a titer of 1 x 1013vg / mL is obtained.

[0203] 3. Biological validation of the otof promoter rAAV-otof promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40 virus was injected into the cochlea of ​​2-3 day old C57BL / 6J mice through the round window. After the virus was fully expressed for 10-14 days, the mice were sacrificed by cervical dislocation, and the injected cochlea was removed and placed in 4% paraformaldehyde for 2 hours at room temperature. It was then washed three times with PBS for 5 minutes each. It was further treated with 0.5 mM EDTA for decalcification and immersed at room temperature for 2 hours to soften the cochlea. Under a stereomicroscope, the basilar membrane was dissected into three parts, apical, middle, and basal, with an ophthalmic scalpel. Cochlear samples were prepared by immunofluorescence staining, which labeled hair cells with anti-Myo7a antibody and supporting cells with anti-Sox2 antibody. Imaging was performed by confocal laser scanning microscope, and the virus-infected cells expressed green fluorescent protein in the cell nucleus. The wavelengths of excitation light are 488nm, 561nm, and 647nm, respectively. The biodetection results are shown in Figure 11. This figure shows a section of the cochlea injected with rAAV-otof promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40 virus, the purple represents the Myo7a marker protein of hair cells, which is divided into three rows of outer hair cells on the top and one row of inner hair cells on the bottom, and the green represents the cells infected with the virus, showing that the otof promoter specifically expresses fluorescent protein in the cochlear inner hair cells.

[0204] Example 4 Promoter Sox10 1. Isolation and Identification of the Promoter Sox10 a. Synthesis of promoter Sox10 sequence The sequence of promoter Sox10 is derived from MCS7 in Identification of neural crest and glial enhancers at the mouse Sox10locus through transgenesis in zebrafish.G, and homology arms were designed upstream and downstream of the sequence and used to construct the vector, with the upstream homology arm being cacgcgttctcgattctaga (SEQ ID NO: 18) and the downstream homology arm being ctttctttctctttcttt (SEQ ID NO: 19). The nucleotide sequence is shown in SEQ ID NO: 16, and the homology arm portion is underlined. The sequence was synthesized by Tsingke Biotech (Shanghai) Co., Ltd.

[0205] SEQ ID NO:16 [Table 7]

[0206] b. Amplification of promoter Sox10 Using the DNA synthesis product as a template, the promoter Sox10 was amplified by PCR using upstream and downstream primers. The PCR amplification conditions were: 5 min pre-denaturation at 95°C; 30 cycles of 30 s denaturation at 95°C, 30 s annealing at 59°C, 1.5 min extension at 72°C; 10 min extension at 72°C. The PCR amplified products were confirmed by detection using 1% agarose gel electrophoresis, and the target fragments were excised from the gel and sent to BioSune Biotechnology (Shanghai) Co., Ltd. for sequencing verification. The amplified sequence was found to be the sequence of the Sox10 promoter, and its nucleotide sequence was shown in SEQ ID NO:1. The concentration of the recovered fragments was detected using Nanodrop2000.

[0207] 2. Functional verification of promoter Sox10 A. Construction of recombinant expression vectors First, the SHH mini promoter sequence was synthesized, and a homology arm was added downstream of the sequence to link with the vector, and the downstream homology arm was gctagcgaattcgccaccat (SEQ ID NO: 20). The sequence was synthesized by Tsingke Biotech (Shanghai). The nucleotide sequence is shown in SEQ ID NO: 17, and the homology arm portion is underlined.

[0208] SEQ ID NO:17 [Table 8] Using the method of multi-fragment homologous recombination, the SHH mini promoter fragment and the Sox10 fragment were inserted into the pAAV-CAG-mNeonGreen-WPRE-SV40 plasmid double-cut with XbaI and NheI enzymes, and ligated by the method of homologous recombination using a recombination kit (Vazyme, MultiS One Step Cloning Kit). The recombination system consisted of linearized pAAV-CAG-mNeonGreen-WPRE-SV40 vector, 50ng; cloned Sox10 promoter fragment, 30ng; synthetic SHH mini promoter fragment, 30ng; recombinant ligase Exnase MultiS, 1μL; recombinant ligation buffer 5×CE MultiS Buffer, 4μL; supplemented with ddH2O to 20μL; reacted at 50℃ for 20 minutes to generate the recombinant product.

[0209] The ligation product was transformed into E. coli JM109 responsive cells and incubated overnight at 37℃ incubator. Single clones were selected for colony PCR identification, and positive colonies were expanded and plasmid extracted. The plasmid was verified by sequencing. The plasmid that was found to be correct by sequencing was named pAAV-Sox10 promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40. The map of the constructed plasmid recombinant expression vector is shown in Figure 12.

[0210] b. Virus production of recombinant expression vectors Using the conventional method of packaging adeno-associated virus with three plasmids described in Section 2b of Example 1, except that the plasmid recombinant expression vector is different, the virus was packaged for the recombinant expression vector, and then concentrated and purified by iodixanol gradient centrifugation. Finally, the titer of the recombinant adeno-associated virus was detected by SYBR Green qPCR. Finally, the rAAV-Sox10 promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40 virus with a titer of 1 x 1013vg / mL was obtained.

[0211] 3. Biological validation of the Sox10 promoter rAAV-Sox10 promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40 virus was injected into the cochlea of ​​2-3 day old C57BL / 6J mice through the round window. After the virus was fully expressed for 10-14 days, the mice were sacrificed by cervical dislocation, and the injected cochlea was removed and placed in 4% paraformaldehyde for 2 hours at room temperature. It was then washed three times with PBS for 5 minutes each. It was further treated with 0.5 mM EDTA for decalcification and immersed at room temperature for 2 hours to soften the cochlea. Under a stereomicroscope, the basilar membrane was dissected into three parts, apical, middle, and basal, with an ophthalmic scalpel. Cochlear samples were prepared by immunofluorescence staining, in which hair cells were labeled with anti-Myo7a antibody and supporting cells were labeled with anti-Sox2 antibody. Imaging was performed by confocal laser scanning microscope, and the virus-infected cells expressed green fluorescent protein in the cell nucleus. The wavelengths of excitation light are 488nm, 561nm, and 647nm, respectively. The results of biodetection are shown in Figure 13. This figure shows a section of the cochlea injected with rAAV-Sox10 promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40 virus, in which the red represents the marker protein Sox2 in supporting cells, the purple represents the marker protein Myo7a in hair cells, and the green represents the cells infected with the virus, showing that the Sox10 promoter specifically expresses fluorescent protein in cochlear supporting cells.

[0212] Example 5 Promoter Ngfr 1 1. Isolation and Identification of the Promoter Ngfr-1 a. Synthesis of promoter Ngfr 1 sequence Based on the mouse GRCm39 / mm39 genome provided by http: / / www.genome.ucsc.edu / , Ngfr was aligned with different species such as rat, guinea pig and rabbit, and several highly conserved sequence regions were obtained in the transcription initiation region. The three sequences were synthesized into one, and homology arms were added to both ends, as shown in Figure 14, the upstream homology arm is cacgcgttctcgattctaga (SEQ ID NO: 23), and the downstream homology arm is ctttctttctctttcttt (SEQ ID NO: 24), which was used to construct a vector, the nucleotide sequence of which is shown in SEQ ID NO: 21, and the homology arm part is underlined. Promoter Ngfr 1 was synthesized by Tsingke Biotech (Shanghai) Co., Ltd.

[0213] SEQ ID NO:21 [Table 9]

[0214] b. Amplification of the promoter Ngfr 1 The synthesis product DNA was used as a template to amplify the promoter Ngfr 1 with the upstream and downstream primers. The PCR amplification conditions were 95°C pre-denaturation for 5 min; 30 cycles of 95°C denaturation for 30 s, 59°C annealing for 30 s, 72°C extension for 1.5 min; 72°C extension for 10 min. The PCR amplification products were confirmed by detection using 1% agarose gel electrophoresis, and the target fragment was excised from the gel and sent to BioSune Biotechnology (Shanghai) Co., Ltd. for sequencing verification. The amplified sequence was found to be the sequence of the Ngfr 1 promoter, and its nucleotide sequence was shown in SEQ ID NO:1. The concentration of the recovered fragment was detected using Nanodrop2000.

[0215] 2. Functional Verification of the Promoter Ngfr-1 A. Construction of recombinant expression vectors First, the SHH mini promoter sequence was synthesized, and a homology arm that links to a vector was added downstream of the sequence, and the downstream homology arm is gctagcgaattcgccaccat (SEQ ID NO: 25). The nucleotide sequence is shown in SEQ ID NO: 22, and the homology arm portion is underlined.

[0216] SEQ ID NO:22 [Table 10]

[0217] Using the method of multi-fragment homologous recombination, the SHH mini promoter fragment and the Ngfr 1 fragment were inserted into the pAAV-CAG-mNeonGreen-WPRE-SV40 plasmid double-cut with XbaI and NheI enzymes, and ligated by the method of homologous recombination using a recombination kit (Vazyme, MultiS One Step Cloning Kit). The recombination system consisted of linearized pAAV-CAG-mNeonGreen-WPRE-SV40 vector, 50ng; cloned Ngfr 1 promoter fragment, 30ng; synthetic SHH mini promoter fragment, 30ng; recombinant ligase Exnase MultiS, 1μL; recombinant ligation buffer 5×CE MultiS Buffer, 4μL; supplemented with ddH2O up to 20μL; reacted at 50℃ for 20 minutes to generate the recombinant product.

[0218] The ligation product was transformed into E. coli JM109 responsive cells and incubated overnight at 37℃ incubator. Single clones were selected for colony PCR identification, and positive colonies were expanded and plasmid extracted. The plasmid was verified by sequencing. The plasmid that was sequenced correctly was named pAAV-Ngfr 1 promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40. The map of the constructed plasmid recombinant expression vector is shown in Figure 15.

[0219] b. Virus production of recombinant expression vectors Using the conventional method of packaging adeno-associated virus with three plasmids described in Section 2b of Example 1, except that the plasmid recombinant expression vector is different, the virus was packaged for the recombinant expression vector, and then concentrated and purified by iodixanol gradient centrifugation. Finally, the titer of the recombinant adeno-associated virus was detected by SYBR Green qPCR. Finally, the rAAV-Ngfr 1 promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40 virus with a titer of 1 x 10 vg / mL was obtained.

[0220] 3. Biological validation of the Ngfr-1 promoter The rAAV-Ngfr 1 promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40 virus was injected into the cochlea of ​​2-3 day old C57BL / 6J mice through the round window. After the virus was fully expressed for 10-14 days, the mice were killed by cervical dislocation, and the injected cochlea was removed and placed in 4% paraformaldehyde and fixed at room temperature for 2 hours. It was then washed three times with PBS for 5 minutes each. It was further decalcified with 0.5 mM EDTA and immersed at room temperature for 2 hours to soften the cochlea. It was further dehydrated overnight in gradient sucrose and cut into 0.2 mm samples with a frozen slicer. Cochlear samples were prepared by immunofluorescence staining to label spiral ganglion cells with anti-Tuj1 antibody, type I spiral ganglion cells with anti-Calb2 antibody, and type II spiral ganglion cells with anti-TH antibody. The virus-infected cells were imaged by confocal laser scanning microscope, and green fluorescent protein was expressed in the cell nucleus. The excitation wavelengths were 488 nm, 561 nm, and 647 nm, respectively. The biodetection results are shown in Figures 16 and 17.

[0221] Figure 16 shows that the Ngfr 1 promoter can specifically express in SGNs but not in type II spiral ganglion cells. The figure shows a section of a cochlea injected with rAAV-Ngfr 1 promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40 virus. Purple represents the marker protein Tuj1 of spiral ganglion cells, red represents the marker protein TH of type II spiral ganglion cells, and green represents the cells infected with the virus, in which the Ngfr 1 promoter specifically expresses fluorescent protein in non-type II spiral ganglion cells.

[0222] Figure 17 shows that the Ngfr 1 promoter can specifically express in type I spiral ganglion cells. The figure shows a section of the cochlea injected with rAAV-Ngfr 1 promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40 virus. The red represents the marker protein Calb2 of type I spiral ganglion cells, and the green represents the cells infected with the virus. The Ngfr 1 promoter specifically expresses fluorescent protein in type I spiral ganglion cells.

[0223] Example 6 Promoter Ngfr2 1. Isolation and Identification of the Promoter Ngfr2 a. Synthesis of promoter Ngfr2 sequence Based on the mouse GRCm39 / mm39 genome provided by http: / / www.genome.ucsc.edu / , Ngfr was aligned with different species such as rat, guinea pig, and rabbit, and several highly conserved sequence regions were obtained in the transcription initiation region, which were synthesized and added with homology arms at both ends, as shown in Figure 18, the upstream homology arm is cacgcgttctcgattctaga (SEQ ID NO: 28), and the downstream homology arm is ctttctttctctttcttt (SEQ ID NO: 29), which was used to construct a vector, the nucleotide sequence of which is shown in SEQ ID NO: 26. The sequence was synthesized by Tsingke Biotech (Shanghai) Co., Ltd.

[0224] SEQ ID NO:26 [Table 11]

[0225] b. Amplification of the promoter Ngfr 2 The synthesis product DNA was used as a template to amplify the promoter Ngfr2 with upstream and downstream primers. The PCR amplification conditions were 95℃ pre-denaturation for 5 min; 30 cycles of 95℃ denaturation for 30 s, 59℃ annealing for 30 s, 72℃ extension for 1.5 min; 72℃ extension for 10 min. The PCR amplification products were confirmed by detection using 1% agarose gel electrophoresis, and the target fragment was excised from the gel and sent to BioSune Biotechnology (Shanghai) Co., Ltd. for sequencing verification. The amplified sequence was the sequence of the Ngfr2 promoter, and its nucleotide sequence was shown in SEQ ID NO:26. The concentration of the recovered fragment was detected using Nanodrop2000.

[0226] 2. Functional Verification of the Promoter Ngfr 2 A. Construction of recombinant expression vectors First, the SHH mini promoter sequence was synthesized, and a homology arm that links to the vector was added downstream of the sequence, and the downstream homology arm is gctagcgaattcgccaccat (SEQ ID NO: 30). The nucleotide sequence is shown in SEQ ID NO: 27, and the homology arm is underlined.

[0227] SEQ ID NO:27 [Table 12] Using the method of multi-fragment homologous recombination, the SHH mini promoter fragment and the Ngfr 2 fragment were inserted into the pAAV-CAG-mNeonGreen-WPRE-SV40 plasmid double-cut with XbaI and NheI enzymes, and ligated by the method of homologous recombination using a recombination kit (Vazyme, MultiS One Step Cloning Kit). The recombination system consisted of linearized pAAV-CAG-mNeonGreen-WPRE-SV40 vector, 50ng; cloned Ngfr 2 promoter fragment, 30ng; synthetic SHH mini promoter fragment, 30ng; recombinant ligase Exnase MultiS, 1μL; recombinant ligation buffer 5×CE MultiS Buffer, 4μL; supplemented with ddH2O to 20μL; reacted at 50℃ for 20 minutes to generate the recombinant product.

[0228] The ligation product was transformed into E. coli JM109 responsive cells and incubated overnight at 37°C incubator. Single clones were selected for colony PCR identification, and positive colonies were expanded and plasmid extracted. The plasmid was verified by sequencing, and the plasmid that was found to be correct by sequencing was named pAAV-Ngfr 2 promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40. The map of the constructed plasmid recombinant expression vector is shown in Figure 19.

[0229] b. Virus production of recombinant expression vectors Using the conventional method of packaging adeno-associated virus with three plasmids described in Section 2b of Example 1, except that the plasmid recombinant expression vector is different, the recombinant expression vector is packaged with the virus, and then concentrated and purified by iodixanol gradient centrifugation. Finally, the titer of the recombinant adeno-associated virus is detected by SYBR Green qPCR. Finally, the rAAV-Ngfr 2 promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40 virus with a titer of 1 x 1013vg / mL is obtained.

[0230] 3. Biological validation of the Ngfr 2 promoter The rAAV-Ngfr 2 promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40 virus was injected into the cochlea of ​​2-3 day old C57BL / 6J mice through the round window. After the virus was fully expressed for 10-14 days, the mice were killed by cervical dislocation, and the injected cochlea was removed and placed in 4% paraformaldehyde and fixed at room temperature for 2 hours. It was then washed three times with PBS for 5 minutes each. It was further decalcified with 0.5 mM EDTA and immersed at room temperature for 2 hours to soften the cochlea. It was further dehydrated overnight in gradient sucrose and then cut into 0.2 mm samples with a frozen slicer. Cochlear samples were prepared by immunofluorescence staining to label spiral ganglion cells with anti-Tuj1 antibody, type I spiral ganglion cells with anti-Calb2 antibody, and type II spiral ganglion cells with anti-TH antibody. The virus-infected cells were imaged by confocal laser scanning microscope, and green fluorescent protein was expressed in the cell nucleus. The excitation wavelengths were 488 nm, 561 nm, and 647 nm, respectively. The biodetection results are shown in Figures 20 and 21.

[0231] Figure 20 shows that Ngfr2 promoter can specifically express in SGNs and in type II spiral ganglion cells. The figure shows a section of a cochlea injected with rAAV-Ngfr2 promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40 virus. Purple represents the marker protein Tuj1 of spiral ganglion cells, red represents the marker protein TH of type II spiral ganglion cells, and green represents the cells infected with the virus, and Ngfr2 promoter can specifically express fluorescent protein in type II spiral ganglion cells.

[0232] Figure 21 shows that Ngfr2 promoter cannot express specifically in type I spiral ganglion cells. This figure shows a section of the cochlea injected with rAAV-Ngfr2 promoter-SHH mini promoter-NLS-mNeonGreen-WPRE-SV40 virus. The red represents the marker protein Calb2 of type I spiral ganglion cells, and the green represents the cells infected with the virus. The Ngfr2 promoter did not express fluorescent protein specifically in type I spiral ganglion cells.

[0233] Example 7 Promoter Dnah5 1. Isolation and Identification of the Promoter Dnah5 a. Primer design for promoter Dnah5 Based on the complete genome sequence of mouse C57BL / 6J provided by NCBI, a primer was designed upstream of the transcription start site of mouse Dnah5 gene, and homology arms were added to both ends. The upstream primer is ctattaccatggtgctcgag gtcacatgttgacaatgttctcgg (SEQ ID NO: 33), The downstream primer was gccatcccagattgctggggg tacctcgacggtaagtcc (SEQ ID NO: 34), The homology arms are underlined and used in the construction of the vector.

[0234] b. Amplification of promoter Dnah5 Using DNA from a C57BL / 6J mouse as a template, the promoter Dnah5 was amplified by PCR using upstream and downstream primers. The PCR amplification conditions were: 5 min pre-denaturation at 95°C; 30 cycles of 30 s denaturation at 95°C, 30 s annealing at 59°C, 1.5 min extension at 72°C; 10 min extension at 72°C. The PCR amplification product was confirmed by detection using 1% agarose gel electrophoresis, and the gel was cut out to recover the target fragment. The target fragment was sent to BioSune Biotechnology (Shanghai) Co., Ltd. for sequencing verification. The amplified sequence was found to be the sequence of the Dnah5 promoter, and its nucleotide sequence was shown in SEQ ID NO:31. The concentration of the recovered fragment was detected using Nanodrop2000.

[0235] SEQ ID NO:31 [Table 13]

[0236] 2. Functional verification of promoter Dnah5 A. Construction of recombinant expression vectors First, a CMV enhancer sequence was synthesized and a homology arm that links to a vector was added upstream of the sequence; the homology arm is underlined and its nucleotide sequence is shown in SEQ ID NO:32.

[0237] SEQ ID NO:32 [Table 14]

[0238] Using the method of multi-fragment homologous recombination, the promoter CMV enhancer fragment, Dnah5 fragment, were inserted into the pAAV-CAG-mNeonGreen-WPRE-SV40 plasmid double-cleaved with Kpn1 and Mlu1 enzymes, and ligated by means of homologous recombination using a recombination kit (Vazyme, MultiS One Step Cloning Kit). The recombination system consisted of linearized pAAV-CAG-mNeonGreen-WPRE-SV40 vector, 50 ng; cloned Dnah5 promoter fragment, 30 ng; synthetic CMV enhancer fragment, 30 ng; recombinant ligase Exnase MultiS, 1 μL; recombinant ligation buffer 5×CE MultiS Buffer, 4 μL; supplemented with ddH2O to 20 μL; reacted at 50°C for 20 minutes to generate the recombinant product.

[0239] The ligation product was transformed into E. coli JM109 responsive cells and incubated overnight at 37°C incubator. Single clones were selected for colony PCR identification, and positive colonies were expanded and plasmid extracted. The plasmid was verified by sequencing. The plasmid that was sequenced correctly was named pAAV-CMVen-Dnah5 promoter-NLS-mNeonGreen-WPRE-SV40. The map of the constructed expression vector is shown in Figure 22.

[0240] b. Virus production of recombinant expression vectors Using the conventional method of packaging adeno-associated virus with three plasmids described in Section 2b of Example 1, except that the plasmid recombinant expression vector was different, the recombinant expression vector was subjected to virus packaging, and then concentrated and purified by iodixanol gradient centrifugation. Finally, the titer of the recombinant adeno-associated virus was detected by SYBR Green qPCR. Finally, the rAAV-CMVen-Dnah5 promoter-NLS-mNeonGreen-WPRE-SV40 virus with a titer of 1 x 1013vg / mL was obtained.

[0241] 3. Biological validation of the Dnah5 promoter rAAV-CMVen-Dnah5 promoter-NLS-mNeonGreen-WPRE-SV40 virus was injected into the cochlea of ​​2-3 day old C57BL / 6J mice through the round window. After the virus was fully expressed for 10-14 days, the mice were sacrificed by cervical dislocation, and the injected cochlea was removed and placed in 4% paraformaldehyde for 2 hours at room temperature. It was then washed three times with PBS for 5 minutes each. It was further decalcified with 0.5 mM EDTA and immersed at room temperature for 2 hours to soften the cochlea. Under a stereomicroscope, the basilar membrane was dissected into three parts, apical, middle, and basal, and the utricle tissue of the vestibule with an ophthalmic scalpel. Immunofluorescent staining was performed to label hair cells with anti-Myo7a antibody and supporting cells with anti-Sox2 antibody, and samples were prepared. The virus-infected cells were imaged by confocal laser scanning microscope, and green fluorescent protein was expressed in the cell nucleus. The wavelengths of excitation light were 488nm, 561nm, and 647nm, respectively. The results of biodetection are shown in Figure 23. The figure shows the sections of the vestibule (a) and the cochlea (b) injected with rAAV-CMVen-Dnah5 promoter-NLS-mNeonGreen-WPRE-SV40 virus. Purple represents the marker protein Myo7a of hair cells, red represents the marker protein Sox2 of supporting cells, and green represents the virus-infected cells, where the Dnah5 promoter specifically expressed the fluorescent protein in the vestibular hair cells.

[0242] The above description is merely a preferred embodiment of the present invention, and does not impose any formal or substantial restrictions on the present invention. However, those skilled in the art may make some improvements and supplements without departing from the method of the present invention, and these improvements and supplements are also considered to be within the scope of protection of the present invention. Those skilled in the art may make equivalent changes such as changes, modifications and developments in the technical content disclosed above without departing from the spirit and scope of the present invention, and these are all embodiments of the present invention with equivalent effects. At the same time, the changes, modifications and developments of the equivalent changes made to the above embodiments based on the substantial technology of the present invention all fall within the scope of the technical solution of the present invention.

Claims

1. A cochlear and / or vestibular cell specific promoter, a) comprising the nucleotide sequence set forth in SEQ ID NO: 1, 6, 11, 16, 21, 26, 31, or b) containing a nucleotide fragment having 80% or more sequence identity with SEQ ID NO: 1, 6, 11, 16, 21, 26, 31 and having the function of a specific promoter defined in a); A promoter characterized in that

2. A primer pair for amplifying the specific promoter according to claim 1, comprising a forward primer and a reverse primer, Primer pair A: the nucleotide sequence of the forward primer is shown in SEQ ID NO:3, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO:4; Primer pair B: the nucleotide sequence of the forward primer is shown in SEQ ID NO: 8 and the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 9; Primer pair C: the nucleotide sequence of the forward primer is shown in SEQ ID NO: 13, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 14; Primer pair D: the nucleotide sequence of the forward primer is shown in SEQ ID NO: 18, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 19; Primer pair E: the nucleotide sequence of the forward primer is shown in SEQ ID NO: 23 and the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 24; Primer pair F: the nucleotide sequence of the forward primer is shown in SEQ ID NO:28 and the nucleotide sequence of the reverse primer is shown in SEQ ID NO:29; Primer pair G: the nucleotide sequence of the forward primer is shown in SEQ ID NO: 33, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 34; A primer pair selected from the following primer pairs:

3. A cochlea and / or vestibular hair cell-specific recombinant vector, comprising the specific promoter according to claim 1.

4. The recombinant vector according to claim 3, characterized in that the recombinant vector is one or more selected from an adeno-associated virus vector, an adenovirus vector, a lentivirus vector, a retrovirus vector, a herpes simplex virus vector, a herpes simplex virus amplicon vector, a pseudorabies virus vector, a baculovirus vector, and a box virus vector, and is preferably an adeno-associated virus vector.

5. The recombinant vector according to claim 4, wherein the gene of the specific promoter is inserted into the Kpn1 / Mlu1 or XbaI / NheI multiple cloning site of the base vector.

6. 1) The specific promoter shown in SEQ ID NO: 1 is inserted into the Kpn1 / Mlu1 multicloning site of the base vector; 2) The specific promoter represented by SEQ ID NO:6 is inserted into the XbaI / NheI multicloning site of the base vector; 3) The specific promoter represented by SEQ ID NO: 11 is inserted into the XbaI / NheI multicloning site of the base vector; 4) A specific promoter represented by SEQ ID NO: 16 is inserted into the XbaI / NheI multicloning site of the base vector; 5) A specific promoter represented by SEQ ID NO: 21 is inserted into the XbaI / NheI multicloning site of the base vector; 6) The specific promoter represented by SEQ ID NO: 26 is inserted into the XbaI / NheI multicloning site of the base vector; 7) Including those in which a specific promoter represented by SEQ ID NO: 31 is inserted into the Kpn1 / Mlu1 multicloning site of a basic vector; The recombinant vector according to claim 5, which is at least one selected from the vectors.

7. The recombinant vector according to claim 3, further comprising a target gene and / or the target gene is located at the 3' end of the gene of the specific promoter.

8. 1) the target gene is selected from human deafness genes; 2) the target gene is expressed in the cochlea and / or vestibular cells; 3) the target gene is selected from prestin, otof, vglut3, and Gjb2; The recombinant vector according to claim 7, characterized in that it comprises at least one.

9. A pharmaceutical composition comprising the recombinant vector according to any one of claims 3 to 8.

10. 1) Use in the manufacture of a drug for preventing hearing-related diseases; 2) Use in the manufacture of drugs for gene therapy of hearing-related diseases; 3) Use in the production and screening of drugs or vectors for preventing and / or treating hearing-related diseases; 4) Use in constructing animal models of hearing-related diseases; 5) Use in constructing animal models of diseases associated with abnormalities in deafness genes, 6) Use in research relating to the regeneration of cochlear outer hair cells, cochlear inner hair cells, cochlear supporting cells, vestibular hair cells, and cochlear type I and type II spiral ganglion cells in vitro; 7) Use in research related to protecting hair cells from damage in vitro; 8) Use in research relating to in vitro inner ear development; 9) Use in research related to the pathogenesis of hearing-related diseases in vitro; 10) Use in research related to the reconstruction of auditory synapses in vitro; Use of the specific promoter according to claim 1, or the primer pair according to claim 2, or the recombinant vector according to any one of claims 3 to 8, or the pharmaceutical composition according to claim 9, which is at least one selected from the group consisting of:

11. A method for treating a hearing-related disease, comprising administering to a patient in need of treatment an effective amount of the recombinant vector according to any one of claims 3 to 8.

12. The use of claim 10 or the method of claim 11, wherein the disease is a hearing-related disease, preferably the hearing-related disease is selected from sensorineural hearing loss or tinnitus, more preferably the sensorineural hearing loss is selected from presbycusis, noise-induced hearing loss, hearing loss associated with ototoxic drugs, sudden hearing loss, ischemic hearing loss, autoimmune hearing loss, Meniere's disease, hearing loss associated with head injury, hereditary hearing loss, dysfunction of the organ of Corti due to other or unknown causes, or damage to the organ of Corti due to viral or bacterial infection, or a combination thereof.

Images