Genetically engineered antibody-resistant (GEAR) cells for adoptive cell therapy

Abstract

The method entails modifying non-malignant cells for transplantation or therapy to avoid recognition and attack by monoclonal antibodies and antibody-derived therapeutics. Many therapies using monoclonal antibodies or antibody-derived therapeutics not only bind to the intended target epitope on malignant cells, but also to the same target epitope on normal non-malignant cells that express the target antigen. This phenomenon is called the on-target off-tumor effect. This phenomenon can cause rejection, immune cell attack, or opsonization of the non-malignant cells, resulting in severe side effects that often inhibit the efficacy of the treatment. In the same way, cytokines in cytokine therapy can bind to receptors on bystander cells, potentially causing unintended effects. The method of the present invention alters antigen epitopes or cytokine receptors on non-malignant and bystander cells for adoptive cell therapy, thereby inhibiting the binding of therapeutics - antibodies or cytokines - to target antigens or receptors on non-malignant cells.

Description

[Technical field]

[0001] Priority and Incorporation by Reference This application claims priority to U.S. Provisional Patent Application No. 63324172, filed March 28, 2022, the contents of which are incorporated herein by reference. All references cited herein are expressly incorporated by reference.

[0002] The present invention relates to mutant proteins that are targets for biologics, cells expressing such mutant proteins, methods for producing such mutant proteins and cells, and therapies involving the use of such mutant proteins and cells (such as adoptive therapy, a treatment in which the target antigen of an autoantibody can cause organ rejection (e.g., after transplantation or in autoimmune disease). These proteins or cells can be made in vivo or ex vivo, and the resulting cells can be used as therapeutics. [Background technology]

[0003] Modern medicine is increasingly treating patients with monoclonal antibodies as a therapeutic tool. Many therapies using monoclonal antibodies or antibody-derived therapeutics bind not only to the intended target epitope on malignant cells, but also to the same target epitope on normal non-malignant cells if the normal cells also express the target antigen. This phenomenon is called the on-target off-tumor effect. This phenomenon can lead to rejection, immune cell attack, or opsonization of the non-malignant cells, resulting in severe side effects, and in many cases, this phenomenon can even inhibit the efficacy of the treatment. In the same way, cytokines in cytokine therapy can bind to receptors on bystander cells, potentially resulting in unintended effects. The present invention relates to a method of altering antigen epitopes or cytokine receptors on non-malignant and bystander cells for adoptive cell therapy, with the goal of inhibiting the binding of therapeutics (antibodies or cytokines) to target antigens or receptors on non-malignant cells.

[0004] B-cell malignancies are blood cancers. They include a diverse group of diseases that arise from the B-cell lineage of hematopoietic cells. Treatments for B-cell malignancies include radiation and chemotherapy, autologous or allogeneic stem cell transplants, infusions of immunomodulators, proteasome inhibitors, antibodies and antibody-derived therapeutics such as CAR T cells, bi- or tri-specific engagers, and small molecules that activate or inhibit specific parts of the immune system or cancer cell metabolism. B-cell malignancies include multiple myeloma ("MM"), B-cell chronic lymphocytic leukemia ("CLL") / small lymphocytic lymphoma ("SLL"), precursor B-cell lymphoblastic leukemia / lymphoma, B-cell ALL, Burkitt's lymphoma, acute promyelocytic leukemia, acute lymphocytic leukemia, mature B-cell neoplasms, mantle cell lymphoma (MCL), follicular lymphoma, diffuse large B-cell lymphoma, Hodgkin's lymphoma, primary effusion These include: myeloma, AIDS-related non-Hodgkin's lymphoma, cutaneous follicle center lymphoma, marginal zone B-cell lymphoma (MALT type, nodal and splenic types), hairy cell leukemia, diffuse large B-cell lymphoma (DLBCL), plasmacytoma, plasma cell leukemia, post-transplant lymphoproliferative disorder, Waldenstrom's hypergammaglobulinemia, plasma cell leukemia, anaplastic large cell lymphoma (ALCL) and hairy cell leukemia.

[0005] The approximate annual incidence and number of newly diagnosed B-cell malignancies in the United States are shown in Table 1.

[0006] [Table 1]

[0007] MM is a monoclonal plasma cell malignancy that represents 10% of all hematologic cancers. It is the third most common hematologic malignancy with an incidence of approximately 160,000 cases and 106,000 deaths worldwide. The cause of MM is unknown, but risk factors include obesity and familial predisposition exists. MM can arise from smoldering myeloma (SM) and monoclonal gammopathy of undetermined significance (MGUS) that ultimately progresses to MM. Some cases of MM progress to highly aggressive plasma cell leukemia (1). The standard treatment for MM is autologous hematopoietic stem cell transplantation (SCT) and high-dose chemotherapy with immunomodulatory drugs (IMiDs), proteasome inhibitors (PIs), and monoclonal antibodies (mAbs) (2). Relapse is common, with a median survival of 6 years and a 10-year survival rate of up to 50% (3).

[0008] Therapy with monoclonal antibodies specific for antigens expressed by malignant cells has been introduced in the treatment of MM. Many new types of monoclonal antibodies and antibody-derived therapeutics (illustrated in Figure 1), such as bi- or trispecific engagers and CAR T or CAR NK cells, are in preclinical trials. Daratumumab ("Dara"), an anti-CD38 antibody, has been approved for the treatment of patients with relapsed MM, and other anti-CD38 antibodies have been recently approved or are currently in development (isatuximab and MOR-202, described in U.S. Patent No. 8,263,746). Dara recognizes CD38, which is overexpressed on MM cells and other B-cell malignancies (4). Dara kills target cells primarily by antibody-dependent cellular cytotoxicity (ADCC). It induces tumor cell death by binding to Fc receptors on NK cells, which kill tumor cells, and by inducing complement-dependent cytotoxicity. (4,5) Recently, Dara has also been introduced as a frontline treatment for newly diagnosed MM patients.

[0009] In addition to Dara, there are a number of promising new antibody drugs under investigation for MM. Isatuximab is indicated for relapsed / refractory MM (RRMM) in conjunction with pomalidomide and dexamethasone or carfilzomib and dexamethasone (31, 32). When added to the MM standard treatment regimen of pomalidomide and low-dose dexamethasone, isatuximab significantly improved progression-free survival in patients with RRMM (6). Clinical trials using isatuximab as monotherapy are ongoing (7). Mezagitamab (TAK-079), another anti-CD38 monoclonal antibody, is currently being tested in a Phase Ib clinical trial (33).

[0010] Other antibodies or antibody-derived therapeutics in development for the treatment of MM include anti-BCMA CAR These include T cells, BCMA bispecific T cell engager (BIKE), anti-SLAMF7 / CRACC mAb elotuzumab, anti-B cell activating factor (tavalumab) molecules, antibody drug conjugates targeting B cell maturation antigen (GSK2857916), alpha emitters (astatine-211) coupled with anti-CD38 antibodies, CD138 (indatuximab ravtansine), anti-GPRRC5D CAR T cells or GPRC5D bispecific engagers. Moreover, monoclonal antibodies made against molecules involved in stress sensing, such as ligands for the NK cell receptor NKG2D, or involved in MM-induced bone destruction, such as RANK-L (denosumab), or DDKK1 (BHQ880), could possibly be interesting therapeutic agents.

[0011] Antibodies and antibody-derived therapeutics (illustrated in Figure 1) represent a new class of agents that stimulate tumor cell death by intrinsic mechanisms or by stimulating immune competent cells to kill or phagocytose tumor plasma cells. The safety profile is manageable, usually for antibody targets or for intravenous injection. These agents may be combined with other agents without adding significant toxicity, increasing duration and deepening effect. Indeed, many treatments using antibodies or antibody-derived therapeutics are being performed as combination trials with IMiDs or PIs.

[0012] CD38 is expressed by cancer cells of many B-cell malignancies. This molecule is an important prognostic factor in many B-cell cancers, including B-cell CLL (8). CD38 is expressed at high levels on malignant plasma cells and is associated with a variety of hematological malignancies. CD38 is also expressed on non-malignant cells, including T cells, B cells, and NK cells, and at lower levels on monocytes and osteoclast precursor cells. CD38 is encoded on human chromosome 4. CD38 mediates lymphocyte proliferation and cytokine secretion and activation (9, 10).

[0013] CD38 is an ectoenzyme that controls intracellular Ca2+ levels. CD38 catalyzes the synthesis and hydrolysis of ADP-ribose from NAD+-derived cyclic ADP-ribose and NAADP from NADP+. CD38 is also expressed in many hematological malignancies, including multiple myeloma, leukemias and lymphomas, such as T-cell and B-cell acute lymphocytic leukemia, B-cell chronic lymphocytic leukemia, primary systemic amyloidosis, Waldenstrom's hypergammaglobulinemia, mantle cell lymphoma, prolymphocytic / myeloid leukemia, acute myeloid leukemia, chronic myeloid leukemia, follicular lymphoma, Burkitt's lymphoma, large granular lymphocytic (LGL) leukemia, NK cell leukemia, and plasma cell leukemia.

[0014] Several researchers have generated CD38 knockout (CD38KO) NK cells (11, 12). Under culture conditions and in immunodeficient mice, these CD38-KO NK The cells appear to retain most of their effector functions. However, several studies have highlighted the importance of CD38 for NK cell function in vitro and in vivo (13-18). Indeed, CD38 is a triggering factor for activated NK cells, and antibodies against CD38 caused NK cell-mediated cytotoxicity and CD38-dependent lysis of target cells (15). Furthermore, it is known that CD38 can be used by NK cells to bind target cells, which promotes target cell lysis (15). Moreover, CD38 cross-linking induces NK cell Ca2+ mobilization (14, 17) and downstream phosphorylation events (17), which are important activation pathways for cytotoxic cells. In mice, CD38+ NK cells are required for in vivo killing of tumor cells (14) and protection against bacterial (16) and viral infections (19).

[0015] Recently, two Phase I clinical trials using CD38-KO NK cells for adoptive therapy have been initiated. The first, supported by Fate Therapeutics, uses iPSC-derived CD38-KO BCMA-CAR NK cells in combination with daratumumab (FT538). The other Phase I trial, supported by Kiadis and Sanofi, uses CD38-KO mbIL21-expanded NK cells in combination with isatuximab (KDS-1001 / SAR445419). However, considering the various enzymatic activities of CD38 and the important biological pathways such as proliferation, survival, metabolism, calcium signaling, response to hypoxia, migration and homing, CD38-KO NK cells are expected to show defects in some or most of these pathways in vivo. Tumor homing and persistence in the tumor microenvironment characterized by hypoxia and low levels of metabolites are recognized to be critical for the success of cell therapy.

[0016] In addition to Cd38, targets for antibody therapy contemplated herein include CD19, CD20, CD22, CD25, CD28, CD30, CD33, CD52, CD117, PDGFRA (platelet-derived growth factor alpha receptor), Her2, FFR3, and CEACAM-1. Summary of the Invention

[0017] Disclosed herein are cells comprising a wild-type protein that is otherwise wild-type, having at least one mutation in a therapeutic agent binding site, the at least one mutation being configured to retain a physiological function of the wild-type protein while inhibiting specific binding of a therapeutic agent to the protein.

[0018] Also disclosed herein are such cells, wherein the therapeutic agent is a therapeutic antibody.

[0019] Also disclosed herein are such cells, wherein at least one mutation is induced by gene editing.

[0020] Also disclosed herein are such cells, wherein the at least one mutation is at least one amino acid substitution relative to a naturally occurring amino acid in the binding site.

[0021] In one embodiment, such cells may be primate cells, preferably human cells, more preferably primary human cells.

[0022] In one embodiment, the cell may be selected from an immune cell (e.g., a plasma cell, a B cell, a macrophage, a NK cell, a dendritic cell, a neutrophil, a monocyte, a T cell), a stem cell (e.g., a hematopoietic stem cell, an induced pluripotent stem cell), or a somatic cell.

[0023] As used herein, the term "immunoglobulin" refers to a nucleic acid that is administered to a subject, preferably a human subject, whether allogeneic and / or otherwise. Also disclosed are such cells configured for adoptive therapy in cancer.

[0024] Also disclosed herein are cells as described above, wherein the therapeutic agent binding site is present on a protein expressed on the surface of the cell, the protein being selected from CD38, SLAMF7, CD19, CD20, CD22, CD25, CD28, CD30, CD33, CD47, CD52, or PDGFRA.9.

[0025] In one embodiment, the therapeutic agent binding site is present on CD38, the therapeutic agent is an antibody, and the antibody is daratumumab or isatuximab.

[0026] In one embodiment, the therapeutic agent binding site is present in SLAMF7, the therapeutic agent is an antibody, and the antibody is elotuzumab.

[0027] In one embodiment, the therapeutic agent binding site is present on CD19, the therapeutic agent is an antibody, and the antibody is blinatumomab.

[0028] In one embodiment, the therapeutic agent binding site is present on CD19 and the therapeutic agent is a CD19-CAR-T cell or an NK cell, such as Abecma, Breyange, Kymriah, Tecartus, or Yescarta.

[0029] In one embodiment, the therapeutic agent binding site is present on CD20 and the therapeutic agent is an antibody, and the antibody is ibritumomab, tiuxetan, obinutuzumab, ocrelizumab, ofatumumab, or rituximab.

[0030] In one embodiment, the therapeutic agent binding site is present on CD22, the therapeutic agent is an antibody, and the antibody is inotuzumab.

[0031] In one embodiment, the therapeutic agent binding site is present on CD30 and the therapeutic agent is an antibody, and the antibody is brentuximab.

[0032] In one embodiment, the therapeutic agent binding site is present on CD33 and the therapeutic agent is an antibody, and the antibody is gemtuzumab or ozogamicin.

[0033] In one embodiment, the therapeutic agent binding site is present on CD52 and the therapeutic agent is an antibody, and the antibody is alemtuzumab or ANT1034.

[0034] In one embodiment, the therapeutic agent binding site is present on CD47 and the therapeutic agent is an antibody, said antibody being Ti-061 or CC-90002 or Magrolimab or AK117 or AO-176 or CPO107, JMT601 (CPO107) or DSP107 or Evorpacept (ALX148) or HX009 or IBI188 or IBI322 or IMC-002 or IMM0306 or OSE-172PF-07257876 or SHR-1603 or SHR2150 or SRF231 or STI-6643 or TG-1801 or TJ011133 or TTI-621 or ZL-1201.

[0035] In one embodiment, the therapeutic agent binding site is present on PDGFRA, the therapeutic agent is an antibody, and the antibody is olaratumab.

[0036] Provided herein is a method for detecting a cell that comprises (i) a wild-type protein that is otherwise wild-type, the cell having at least one mutation in a therapeutic agent binding site, the at least one mutation being configured to inhibit specific binding of a therapeutic agent to the protein while retaining a physiological function of the wild-type protein. Also disclosed is a method of treating a patient comprising administering to the patient the cells and (ii) a therapeutic agent.

[0037] Also disclosed herein are such methods, wherein the at least one mutation comprises at least one amino acid substitution in the binding site.

[0038] Also disclosed herein are such methods, wherein the cell is selected from an immune cell (e.g., a plasma cell, a B cell, a macrophage, a NK cell, a dendritic cell, a neutrophil, a monocyte, a T cell), a stem cell (e.g., a hematopoietic stem cell, an induced pluripotent stem cell), or a somatic cell.

[0039] Also disclosed herein are such methods, wherein the therapeutic agent binding site is present on a protein selected from CD38, SLAMF7, CD19, CD20, CD22, CD25, CD28, CD30, CD33, CD47, CD52, or PDGFRA, expressed on the surface of the cell.

[0040] Also disclosed herein are such methods, wherein the therapeutic agent binding site is present on CD38 and the therapeutic agent is an antibody, wherein the antibody is daratumumab or isatuximab or TAK-079.

[0041] Also disclosed herein are such methods, wherein the therapeutic agent binding site is present in SLAMF7 and the therapeutic agent is an antibody, wherein the antibody is elotuzumab.

[0042] Also disclosed herein are such methods, wherein the therapeutic agent binding site is present on CD19 and the therapeutic agent is an antibody, wherein the antibody is blinatumomab.

[0043] Also disclosed herein are such methods, wherein the therapeutic agent binding site is present on CD20 and the therapeutic agent is an antibody, wherein the antibody is ibritumomab tiuxetan, obinutuzumab, ocrelizumab, ofatumumab, rituximab, or rituximab / hyaluronidase.

[0044] Also disclosed herein are such methods, wherein the therapeutic agent binding site is present on CD22 and the therapeutic agent is an antibody, wherein the antibody is inotuzumab.

[0045] Also disclosed herein are such methods, wherein the therapeutic agent binding site is present on CD30 and the therapeutic agent is an antibody, wherein the antibody is brentuximab.

[0046] Also disclosed herein are such methods, wherein the therapeutic agent binding site is present on CD33 and the therapeutic agent is an antibody, wherein the antibody is gemtuzumab ozogamicin.

[0047] Also disclosed herein are such methods, wherein the therapeutic agent binding site is present on CD52 and the therapeutic agent is an antibody, wherein the antibody is alemtuzumab or ANT1034.

[0048] Also disclosed herein are such methods, wherein the therapeutic agent binding site is present on CD47 and the therapeutic agent is an antibody, wherein the antibody is Ti-061 or CC-90002 or Magrolimab or AK117 or AO-176 or CPO107, JMT601(CPO107) or DSP107 or Evorpacept(ALX148) or HX009 or IBI188 or IBI322 or IMC-002 or IMM0306 or OSE-172PF-07257876 or SHR-1603 or SHR2150 or SRF231 or STI-6643 or TG-1801 or TJ011133 or TTI-621 or ZL-1201.

[0049] Also disclosed herein are such methods, wherein the therapeutic agent binding site is present in PDGFRA and the therapeutic agent is an antibody, wherein the antibody is olaratumab.

[0050] Also disclosed herein are such methods, wherein the protein expressed on the surface of the cell is functional for all purposes other than therapeutic agent binding.

[0051] Also disclosed herein are such methods, wherein CD38 on the surface of the cells is functional for all purposes other than daratumumab binding.

[0052] Also disclosed herein are such methods, wherein the binding site of daratumumab on the cell has been modified such that it is no longer recognized by daratumumab.

[0053] Also disclosed herein are such methods having at least one amino acid substitution in the daratumumab binding site.

[0054] Also disclosed herein are such methods, wherein at least one amino acid substitution is made at amino acids 233-246 or 267-286 of SEQ ID NO:5.

[0055] Also disclosed herein are such methods, wherein at least one amino acid substitution is made at amino acid 237, 239, 272, 274 and / or 276 of SEQ ID NO:5.

[0056] Also disclosed herein are such methods, wherein the at least one amino acid substitution is selected from the following: T237A, E239F, Q272R, S274F, and / or K276F.

[0057] Also disclosed herein are such methods, wherein CD38 on the surface of the cell comprises SEQ ID NO: 6, 7, 8, 9, or 10.

[0058] Also disclosed herein are such methods, wherein CD38 on the surface of the cells is functional for all purposes other than isatuximab binding.

[0059] Also disclosed herein are such methods, wherein the binding site of isatuximab on the cell has been modified such that it is no longer recognized by isatuximab.

[0060] Also disclosed herein are such methods having at least one amino acid substitution in the isatuximab binding site.

[0061] Also disclosed herein are such methods, wherein amino acid substitutions are made at one or more of amino acids 77-80, 111-118, or 232-234 of SEQ ID NO:5.

[0062] Also disclosed herein are such methods, wherein amino acid substitutions are made at amino acids 77, 78, 79, 80, 111, 112, 113, 114, 115, 116, 117, 118, 232, 233 and / or 234 of SEQ ID NO:5.

[0063] Also disclosed herein are such methods, wherein the amino acid substitutions are selected from the following: M77F, R78F, H79F, V80F, K111F, L112F, G113F, T114F, Q115F, T116F, V117F, P118F, P232F, E233F and / or K234F.

[0064] As used herein, CD38 on the surface of a cell is represented by SEQ ID NOs: 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, Also disclosed are such methods, including 6, 17, 18, 19, 20, 21, 22, 23, 24, or 25.

[0065] Also disclosed herein are such methods, wherein the therapeutic agent binding site is present on CD47 and the therapeutic agent is an antibody, wherein the antibody is magrolimab.

[0066] Also disclosed herein are such methods, wherein the amino acid substitutions are made in a region of CD47 that includes amino acids 1-3, 34-36, or 97-104 of SEQ ID NO:27.

[0067] Also disclosed herein are such methods, wherein amino acid substitutions are made to one or more amino acids 1, 2, 3, 34, 35, 36, 97, 98, 99, 100, 101, 102, 103, and / or 104 of SEQ ID NO:27.

[0068] As used herein, amino acid substitutions include the following: Also disclosed are such methods, wherein the antibody is selected from Q1F, L2F, L3F, T34F, E35F, V36F, E97F, V98F, T99F, E100F, L101F, T102F, R103F and / or E104F.

[0069] Also disclosed herein are such methods, wherein CD47 on the surface of the cell comprises SEQ ID NO: 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, and / or 41.

[0070] Also disclosed herein are such methods, wherein the therapeutic agent binding site is present on CD52 and the therapeutic agent is an antibody, wherein the antibody is alemtuzumab.

[0071] Also disclosed herein are such methods, wherein amino acid substitutions are made in a region of CD52 including amino acids 43, or 31-36.

[0072] Also disclosed herein are such methods, wherein amino acid substitutions are made at amino acids 31, 32, 33, 34, 35 and / or 36 of SEQ ID NO:43.

[0073] Also disclosed herein are such methods, wherein the amino acid substitutions are selected from the following: Q31F, T32F, S33F, S34F, P35F, and / or S36F.

[0074] Also disclosed herein are such methods, wherein CD52 on the surface of the cell comprises SEQ ID NO: 45, 46, 47, 48, 49, or 50.

[0075] Also disclosed herein is an adoptive cell therapy method comprising administering the above-mentioned cells to a patient in need thereof.

[0076] Also disclosed herein is such an adoptive cell therapy in which the therapeutic agent binding site is present on CD38 expressed on the surface of the cell, and the cell is functional for all purposes other than daratumumab binding.

[0077] Also disclosed herein is such an adoptive cell therapy, wherein the therapeutic agent binding site is a binding site for daratumumab, and the daratumumab binding site has been modified such that it is no longer recognized by daratumumab.

[0078] Also disclosed herein are such adoptive cell therapies, wherein the daratumumab binding site comprises at least one amino acid substitution.

[0079] Also disclosed herein is such an adoptive cell therapy, wherein at least one amino acid substitution is made within an extracellular domain subsequence of amino acids present in SEQ ID NO:5, preferably within amino acids 233-246 or 267-286 of SEQ ID NO:5.

[0080] Also disclosed herein are such adoptive cell therapy methods, wherein at least one amino acid substitution is made at amino acid 237, 239, 272, 274 and / or 276 of SEQ ID NO:5.

[0081] Also disclosed herein is such an adoptive cell therapy method, wherein the amino acid substitution is selected from the following: T237A, E239F, Q272R, S274F, K276F.

[0082] Also disclosed herein is such an adoptive cell therapy in which the therapeutic agent binding site is present on CD38 expressed on the surface of the cells, and the cells are functional for all purposes other than isatuximab binding.

[0083] Also disclosed herein is such an adoptive cell therapy, wherein the therapeutic agent binding site is a binding site for isatuximab, and the isatuximab binding site has been modified such that it is no longer recognized by isatuximab.

[0084] Also disclosed herein are such adoptive cell therapies, wherein the isatuximab binding site comprises at least one amino acid substitution.

[0085] Also disclosed herein is such an adoptive cell therapy method, wherein at least one amino acid substitution is made within an extracellular domain subsequence of an amino acid present in SEQ ID NO:5.

[0086] Also disclosed herein are such adoptive cell therapies, wherein amino acid substitutions are made in regions of CD38 that include amino acids 77-80, 111-118, or 232-234 of SEQ ID NO:5.

[0087] Also disclosed herein are such adoptive cellular therapies, wherein amino acid substitutions are made at amino acids 77, 78, 79, 80, 111, 112, 113, 114, 115, 116, 117, 118, 232, 233 and / or 234.

[0088] Also disclosed herein are such adoptive cell therapies, wherein the amino acid substitutions are selected from the following: M77F, R78F, H79F, V80F, K111F, L112F, G113F, T114F, Q115F, T116F, V117F, P118F, P232F, E233F and / or K234F.

[0089] Also disclosed herein are such adoptive cell therapies, wherein CD38 on the surface of the cells comprises SEQ ID NO: 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25.

[0090] The present disclosure also includes cells configured for adoptive therapy, comprising a cell surface and / or transmembrane protein having at least one mutation in a binding site of a therapeutic antibody, wherein the at least one mutation is configured to inhibit specific binding of the therapeutic antibody to the cell surface and / or transmembrane protein.

[0091] In one embodiment, the cells may comprise SEQ ID NOs: 6, 7, 8, 9, and / or 10.

[0092] In another embodiment, the cells comprise the sequence of SEQ ID NO: 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, and / or 25. may include:

[0093] In another embodiment, the cells may comprise SEQ ID NO: 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, and / or 41.

[0094] In another embodiment, the cells may comprise SEQ ID NO: 45, 46, 47, 48, 49, and / or 50.

[0095] Also contemplated herein are the above-mentioned cells, in which at least one mutation is introduced by knocking out (KO) of a native protein and knocking in (KI) of a modified native protein, CRISPR editing of the native protein at a desired nucleotide, and / or editing using TALENs (transcription activator-like effector nucleases) or ZFNs (zinc finger nucleases).

[0096] In one embodiment, CRISPR editing may include introducing a guide RNA represented by SEQ ID NO:1 and / or SEQ ID NO:2.

[0097] In one embodiment, the cell may comprise a wild-type protein that is wild-type except for having at least one mutation in the binding site of a first therapeutic antibody, the at least one mutation being configured to retain the physiological function of the wild-type protein while inhibiting specific binding of the therapeutic antibody to the protein.

[0098] In one embodiment, the cells may be configured to carry a binding site for a second therapeutic antibody.

[0099] Also disclosed herein is a therapeutic method comprising administering an antibody to a subject in need thereof, wherein the above-mentioned cells are administered to the subject prior to administration of the antibody, and the antibody is a monoclonal antibody, CAR T, BIKE, or TRIKE.

[0100] Also disclosed herein are such methods, wherein the method is the treatment of a hematological malignancy.

[0101] Also disclosed herein are such methods, wherein the malignant hematological disease is selected from multiple myeloma, leukemias and lymphomas, such as T-cell and B-cell acute lymphocytic leukemia, B-cell chronic lymphocytic leukemia, primary systemic amyloidosis, Waldenstrom's hypergammaglobulinemia, mantle cell lymphoma, prolymphocytic / myeloid leukemia, acute myeloid leukemia, chronic myeloid leukemia, follicular lymphoma, Burkitt's lymphoma, large granular lymphocytic (LGL) leukemia, NK cell leukemia, or plasma cell leukemia.

[0102] The present disclosure also includes therapeutic cells that contain at least one mutation to one or more therapeutic antibody target sites such that the therapeutic antibody no longer binds to the cell.

[0103] In one embodiment, the mutation may be induced by gene editing.

[0104] In one embodiment, the antibody target site may be selected from sites present in CD38, SLAMF7, CD19, CD20, CD22, CD25, CD28, CD30, CD33, CD47, CD52, and / or PDGFRA.

[0105] The present invention relates to an exogenous nucleic acid encoding a variant of a human cell surface or transmembrane protein. Also disclosed are cells containing an optide sequence, where the mutant form has been engineered to lack an epitope that enables specific binding to a therapeutic antibody, but has all the same functional capabilities as the corresponding wild-type cell surface or transmembrane protein.

[0106] Also disclosed herein are such cells, wherein the exogenous nucleotide sequence encodes a variant of human CD38, SLAMF7, CD19, CD20, CD22, CD25, CD28, CD30, CD33, CD47, CD52, or PDGFRA, or a variant thereof having at least 80% sequence identity thereto.

[0107] Also disclosed herein is a method of producing cells for adoptive therapy, which may include: (a) obtaining allogeneic and / or stem cells comprising a nucleic acid sequence encoding a protein to be expressed on the surface of the allogeneic and / or stem cells, the protein comprising a therapeutic antibody binding site; (b) identifying the amino acid residues of the therapeutic antibody binding site; and (c) introducing one or more mutations into the nucleic acid sequence encoding the protein so as to inhibit specific binding of the therapeutic antibody to the binding site while maintaining all other functions of the expressed protein.

[0108] Also disclosed herein are such methods, wherein the therapeutic antibody binding site is selected from sites present on CD38, SLAMF7, CD19, CD20, CD22, CD25, CD28, CD30, CD33, CD47, CD52, or PDGFRA.

[0109] Also disclosed herein are such methods, wherein the therapeutic antibody is daratumumab and the amino acid substitutions are made at amino acids 233-246 or 267-286 of CD38, as represented by SEQ ID NO:5.

[0110] Also disclosed herein are such methods, wherein amino acid substitutions are made at amino acids 237, 239, 272, 274 and / or 276 of SEQ ID NO:5.

[0111] Also disclosed herein are such methods, wherein the amino acid substitutions are selected from the following: T237A, E239F, Q272R, S274F, and / or K276F.

[0112] Also disclosed herein are such methods, wherein the therapeutic antibody is isatuximab and the amino acid substitutions are made in a region of CD38 that includes amino acids 77-80, 111-118, or 232-234 of SEQ ID NO:5.

[0113] Also disclosed herein are such methods, wherein amino acid substitutions are made at amino acids 77, 78, 79, 80, 111, 112, 113, 114, 115, 116, 117, 118, 232, 233 and / or 234.

[0114] Also disclosed herein are such methods, wherein the amino acid substitutions are selected from the following: M77F, R78F, H79F, V80F, K111F, L112F, G113F, T114F, Q115F, T116F, V117F, P118F, P232F, E233F and / or K234F.

[0115] One embodiment of the present invention described herein includes a series of methods to genetically alter epitopes of target antigens on non-malignant cells to avoid recognition by antibodies. These antibodies may be part of a treatment regimen or may be autoantibodies, for example from autoimmune diseases. The genetic modification may allow the non-malignant cells to persist and function, since recognition of the target antigen would result in the unwanted destruction of the non-malignant cells.

[0116] The present invention relates to the use of native sequences of proteins, either therapeutic or autoantibodies or antibody-derived therapeutics. This involves modifications to the sequence that have been altered sufficiently so that it is no longer recognized. This should reduce side effects on non-malignant cells, also referred to as "on-target-off-tumor" effects. This can increase the antibody concentration available to the intended target cells, either increasing the desired effect or potentially reducing the dose administered. This modification is made without significantly affecting protein function to ensure the functional integrity of the modified cells.

[0117] The modifications can be introduced by different methods of genetic engineering such as, but not limited to, CRISPR editing, knock-out-knock-in strategies, TALEN, zinc finger nucleases.

[0118] In some embodiments, the protein modification is introduced into cells ex vivo, the cells are expanded, and administered to a patient, hi other embodiments, the protein modification is performed in vivo.

[0119] Although the examples herein currently focus on modifying the recognition site of an anti-CD38 monoclonal antibody in the context of treating multiple myeloma (as depicted in FIG. 2), one of skill in the art will recognize that the methods disclosed herein can be used to prevent antibody recognition in any cell.

[0120] Combining some of these targets allows dual or sequential targeting of multiple tumor-associated antigens in the same patient, for example by mAbs, bispecific antibodies, CAR T cells, or CAR NK cells. This not only improves existing therapies, but also allows the use of existing therapies for new indications, for example the use of CD19-CAR T cells in MM. This therapy has not been used to date because it removes all precursor cells of the B-cell lineage, causing lifelong B-cell aplasia. This is a severe side effect, so CD19 CAR T cell therapy is only used if the benefits outweigh the side effects, although other therapies exist in MM. [Brief description of the drawings]

[0121] [Figure 1] Figure 1 is a schematic diagram showing different potential immunotherapies that may benefit from the present invention. Any type of immunotherapy that uses antibody recognition domains may potentially be improved by GEAR modified cells. [Diagram 2] FIG. 2 shows the beta sheet that contains the binding site of daratumumab. [Diagram 3] FIG. 3 shows a representation of the extracellular domain of CD38 (PDB accession number: 1YH3) showing the proximity of E239F and S274F. [Figure 4-1] FIG. 4-1 shows an in silico analysis of the CD38 mutations E239F and S274F, showing decreased hydrogen bonds and increased hydrophobic contacts. [Figure 4-2] FIG. 4-2 shows in silico analysis of CD38 mutations E239F and S274F, showing decreased hydrogen bonds and increased hydrophobic contacts. [Diagram 5] FIG. 5 shows an assay performed to confirm the functionality of cells containing modified CD38. [Figure 6] Figure 6 shows that S274F and E239F modifications inhibit daratumumab from binding to CD38. Different mutant versions of CD38 were introduced into NK92 CD38KO and sorted cells were incubated with daratumumab at 55μg / ml in PBS for 30 minutes in the refrigerator or with HIT2 as a positive control. Percentage of bound cells is shown, N=4, expressed as mean + / - SD, statistics from one-way ANOVA of CD38KO Dara vs Dara samples, ns is not significant, **** is p<0.0001. [Figure 7] Figure 7 shows that S274F and E239F modifications inhibit daratumumab from binding to CD38. Different mutant versions of CD38 were introduced into NK92 CD38KO, and sorted cells were incubated with 55 μg / ml daratumumab in PBS in the refrigerator for 30 minutes, or with HIT2 as a positive control. A representative experiment is shown. [Figure 8] Figure 8 shows that S274F and E239F modifications inhibit Daratumumab from binding to CD38. Different mutant versions of CD38 were introduced into NK92 CD38CO and sorted cells were incubated with Daratumumab at 55μg / ml in PBS for 30 minutes in the refrigerator or with HIT2 as a positive control. Mean fluorescence intensity (MFI) of Daratumumab samples is shown, N=3, expressed as mean + / - SD, statistics by one-way ANOVA of Dara samples vs. CD38KO Dara, ns is not significant, *** is p<0,001, **** is p<0,000. WT is significantly different as CD38 is not overexpressed. [Figure 9]Figure 9 shows the vector design used to generate NK cells containing modified CD38. Codon-optimized sequences were used to avoid degradation from Cas9, and single amino acid mutations E239F and S274F were designed, and other test mutations were generated using the same principles. [Figure 10] Figure 10 shows the workflow of antigen modification on NK cells: modification of the target antigen CD38, followed by expansion of the cell product, safety analysis, and infusion into patients. [Figure 11] FIG. 11 is a schematic diagram showing the steps of the present invention for hematopoietic stem cells with modified CD38. [Figure 12] FIG. 12 is a schematic diagram showing the steps of the present invention for hematopoietic stem cells with modified CD19. [Figure 13] Figure 13 shows that daratumumab inhibits the binding of HIT2 to CD38. However, the modifications S274F and E239F are not recognized by daratumumab, and therefore do not inhibit the binding of HIT2. HIT2 has a different epitope from daratumumab. Daratumumab and HIT2 were incubated alone or simultaneously with NK92 cells with different types of CD38. Signal intensity is expressed as the geometric mean (MFI) of the incubation alone and the incubation together. MFI of HIT2, N=3, + / -SD, T-test between HIT2 alone and daratumumab combination is shown. [Figure 14] Figure 14 shows that HIT2 inhibits the binding of daratumumab to CD38. HIT2 has a different epitope from daratumumab. Daratumumab and HIT2 were incubated alone or simultaneously with NK92 cells with different types of CD38. Signal intensity is expressed as the geometric mean (MFI) of the incubation alone and the incubation together. MFI of daratumumab, N=3, mean + / - SD, T-test between daratumumab alone and HIT2 combination is shown. [Figure 15]Figure 15 shows that isatuximab inhibits HIT2 binding to CD38. HIT2 has a different epitope from isatuximab. The S274F and E239F modifications do not affect binding by isatuximab, and therefore these modifications do not change the competition between isatuximab and HIT2. Signal intensity is expressed as the geometric mean (MFI) of the incubation alone and the co-incubation. MFI of HIT2, N=3, + / -SD, unpaired T-test between HIT2 alone and with isatuximab. [Figure 16] Figure 16 shows that HIT2 does not inhibit the binding of isatuximab to CD38. HIT2 has a different epitope from isatuximab. Signal intensity is expressed as the geometric mean (MFI) of incubation alone and co-incubation. MFI of isatuximab, N=3, mean + / - SD, independent T-test between HIT2 alone and isatuximab combination. [Figure 17] Figure 17 shows degranulation of NK92 cells modified with different CD38 constructs. Degranulation is measured by CD107 and tested upon PMA / ionomycin (P / I) stimulation and upon co-incubation with K562 target cells. Overexpression of CD38 slightly reduces degranulation, but there is no difference between codon-optimized (i.e., WT amino acid sequence) and S274F or E239F modifications. 100,000 NK92 were seeded and stimulated with PMA / ionomycin (50 ng / ml and 500 ng / ml, respectively) and K562 at a 1:1 ratio. Δ%CD107a indicates the difference between the percentage of CD107a in stimulated samples minus the percentage of cells expressing CD107a before activation (medium as unstimulated control). [Figure 18]Figure 18 shows IFNγ release of NK92 cells modified with different CD38 constructs. IFNγ release is measured by intracellular staining and tested upon PMA / ionomycin (P / I) stimulation and upon co-incubation with K562 target cells. Overexpression of CD38 slightly reduces IFNγ release, but there is no difference between codon-optimized (i.e., WT amino acid sequence) and S274F or E239F modifications. 100,000 NK92 were seeded and stimulated with PMA / ionomycin (50 ng / ml and 500 ng / ml, respectively) and K562 at a 1:1 ratio. Δ% IFNγ represents the difference between the percentage of IFNγ in stimulated samples minus the percentage of cells expressing IFNγ before activation (medium as unstimulated control). [Figure 19] FIG. 19 shows the percentage of live K562 in the same assay when exposed to NK cells carrying different CD38 constructs. [Figure 20] Figure 20 shows that transduced primary NK cells transduced into ex vivo expanded PBMCs degranulate 16 days after isolation. Transduced NK cells were gated CD56+ / CD3- / GFP+ from PBMCs. 100,000 PBMCs were seeded and stimulated with PMA / ionomycin (50ng / ml and 500ng / ml, respectively) or K562, and Δ%CD107a represents the difference in the percentage of CD107a in stimulated samples minus the percentage of cells expressing CD107a before activation (medium as unstimulated control). Data are presented as mean + / - SD of two donors. There was no difference between primary NK cells expressing WT CD38 and those transduced with any of the CD38 overexpression constructs. [Figure 21]Figure 21 shows that transduced primary NK cells transduced into ex vivo expanded PBMCs release IFNγ 16 days after isolation. Transduced NK cells were gated CD56+ / CD3- / GFP+ from PBMCs. 100,000 PBMCs were seeded and stimulated with PMA / ionomycin (50 ng / ml and 500 ng / ml, respectively) or K562, and Δ% IFNγ represents the difference in the percentage of IFNγ in stimulated samples minus the percentage of cells expressing CD107a before activation (medium as unstimulated control). Data are presented as mean + / - SD of two donors. There was no difference between primary NK cells expressing WT CD38 and those transduced with either of the CD38 overexpression constructs. [Figure 22] Figure 22 shows that transduced primary NK cells isolated from PBMCs prior to transduction degranulate 16 days after isolation. Transduced NK cells were gated CD56+ / CD3- / GFP+ from PBMCs. 100,000 PBMCs were seeded and stimulated with PMA / ionomycin (50 ng / ml and 500 ng / ml, respectively) or K562, and Δ%CD107a represents the difference in the percentage of CD107a in stimulated samples minus the percentage of cells expressing CD107a before activation (medium as unstimulated control). Data are presented as mean + / - SD of two donors. There was no difference between primary NK cells expressing WT CD38 and those transfected with any of the CD38 overexpression constructs. [Diagram 23] Figure 23 shows that transduced primary NK cells isolated from PBMCs before transduction release IFNγ 16 days after isolation. Transduced NK cells were gated CD56+ / CD3- / GFP+ from PBMCs. 100,000 PBMCs were seeded and stimulated with PMA / ionomycin (50 ng / ml and 500 ng / ml, respectively) or K562, and Δ% IFNγ represents the difference in the percentage of IFNγ in stimulated samples minus the percentage of cells expressing CD107a before activation (medium as unstimulated control). Data are presented as mean + / - SD of two donors. There was no difference between primary NK cells expressing WT CD38 and those transfected with any of the CD38 overexpression constructs. [Figure 24] Figure 24 shows that the NAD+ / NADH ratio in modified NK92 cells is affected by CD38. NAD+ / NADH assay was performed to measure the absorbance of NADH and NAD total in 1 million cells per sample. Concentrations in pmol / μl were calculated using a standard curve, and [NAD+] was calculated as follows: [NAD total]-[NADH]. Data represent the mean + / - SD of [NAD+] / [NADH] ratio in NK92 of three technical replicates (CD38-CO=2 for codon optimization). [Diagram 25] Figure 25 shows CD38 expression as mean fluorescence intensity (MFI) on NK cells from four healthy donors and on the NK92 cell line before (Medium) and after stimulation with K562 target cells (K562). CD38 expression increases during stimulation of NK cells and the NK92 cell line. [Figure 26] FIG. 26 shows CD38 expression on NK in ex vivo expanded PBMCs cultured for 14 days. [Figure 27] FIG. 27 shows CD38 expression on NK cells isolated from PBMCs on day 0 and cultured for 14 days. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0122] Detailed Description of the Invention The features described herein are presented by way of example and for the sole purpose of illustrative discussion of the various embodiments, and to provide what is believed to be the most useful and readily understood explanation of the principles and conceptual aspects of the methods and compositions described herein. In this regard, no attempt has been made to show details beyond those necessary for a fundamental understanding, and the description will be apparent to those skilled in the art as to how some embodiments may be embodied in practice.

[0123] The present invention will now be described with reference to more detailed embodiments. However, the present invention may be embodied in different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey its scope to those skilled in the art.

[0124] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs. The terms used in the description herein are for the purpose of describing particular embodiments only and are not intended to be limiting. When used in the description and the appended claims, the singular forms "a", "an" and "the" are intended to include the plural forms as well, unless the context clearly dictates otherwise. All publications, patent applications, patents and other references mentioned herein are expressly incorporated by reference in their entirety.

[0125] Unless otherwise indicated, the numerical parameters set forth in the following specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained and, as such, may be modified by the term "about." At the very least, and without attempting to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should be construed in light of significant digits and ordinary rounding approaches.

[0126] Although the numerical ranges and parameter conditions describing broad ranges are approximations, the numerical values ​​set forth in the specific examples are reported as precisely as possible. However, any numerical value inherently contains certain errors necessarily resulting from the standard deviation found in each testing measurement. All numerical ranges given throughout this specification include all narrower numerical ranges that fall within such broader numerical ranges, as if such narrower numerical ranges were all expressly set forth herein. Applicants also intend ranges derived from the data points and express ranges disclosed herein.

[0127] The present technology describes strategies to improve antibody-mediated immunotherapy and to generate antibody-tolerant cells for adoptive transfer or transplantation. Many clinically relevant antibodies bind antigens to tumor cells as well as to other cells. They also target non-malignant cells that express the antibody, which can recognize, attack and deplete bystander cells, which can cause severe side effects and even limit the effectiveness of therapeutic antibodies.

[0128] An example of this phenomenon is seen in the treatment of multiple myeloma with the antibodies daratumumab or elotuzumab. Both antibodies target protein antigens on malignant MM cells, thereby triggering the recognition and destruction of the target cells (malignant MM cells) by the immune system. NK cells play a key role in immune recognition, since they express CD16, a receptor for the Fc region (non-variable region) of antibodies. If NK cells recognize malignant cells via a CD16-binding antibody, for example daratumumab, which binds to CD38 on MM cells, the NK cells are able to kill the malignant cells by antibody-dependent cellular cytotoxicity (ADCC). However, the protein antigens of both antibodies are also expressed on NK cells, and in the case of CD38, the target protein of daratumumab, it is even increased upon NK cell activation. Moreover, recent studies have shown that NK cells expressing CD38 alone are able to be activated and perform effector functions (13). Moreover, ample scientific literature highlights the importance of CD38 for NK cell function (13-18). Furthermore, these functions of CD38 may have played a role in the previously mentioned clinical trials using CD38-KO NK cells.

[0129] Similarly, many antibodies used in tumor therapy also recognize antigens on non-malignant cells, an effect also referred to as an "on-target off-tumor effect." A non-exhaustive list of these antibodies can be found in Table 2 below.

[0130] [Table 2-1]

[0131] Table 2 continued [Table 2-2]

[0132] Table 2 continued [Table 2-3]

[0133] The present invention can be applied not only to monoclonal antibody therapy, but also to any and all therapies that use the antigen specificity of mAbs (illustrated in FIG. 1). Such therapies include antibody-mediated drug delivery, where toxins, prodrugs, cytokines or radionuclides are transported to malignant cells via antibodies, bispecific antibodies, CAR-modified cells and much more. Many of these therapies are applied after the patient has received multiple prior therapies.

[0134] The invention can also be applied to several proteins in the same cell to allow dual or sequential use of several therapeutic approaches, e.g., mAbs, bispecific antibodies, CAR cells, etc. Unless a feature of a particular embodiment is expressly specified otherwise as being inconsistent with a feature of another embodiment, a particular embodiment can include combinations of non-inconsistent features described herein with respect to one or more embodiments.

[0135] Proteins contemplated for mutation and / or expression on the surface of adoptive therapy cells include, but are not limited to, CD38, CD19, CD20, CD22, CD25, CD28, CD30, CD33, CD47, CD52, CD117, PDGFRA (platelet-derived growth factor alpha receptor), Her2, FFR3, and CEACAM-1, and homologous variants thereof. , 24, or 25, and variants thereof. Embodiments of the CD47 proteins mentioned above include proteins represented by SEQ ID NO: 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, or 38. Embodiments of the CD52 proteins mentioned above include proteins represented by SEQ ID NO: 42, 43, 44, 45, 46, or 47.

[0136] Proteins having an amino acid sequence homologous to the amino acid sequence represented by SEQ ID NO: 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 include proteins having an amino acid sequence identical to the amino acid sequence represented by SEQ ID NO: 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25, except that one or more amino acids have been deleted, substituted, inserted, and / or added. In the case of substitutions, insertions, or additions, conservative variations resulting from conservative substitutions, insertions, or additions of one or more amino acids are possible. Similarly, such proteins having an amino acid sequence homologous to an amino acid sequence represented by SEQ ID NO: 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, or 38 include proteins having an amino acid sequence identical to an amino acid sequence represented by SEQ ID NO: 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, or 38, except for one or more amino acids being deleted, substituted, inserted, and / or added. Similarly, such proteins having an amino acid sequence homologous to an amino acid sequence represented by SEQ ID NO: 42, 43, 44, 45, 46, or 47 include proteins having an amino acid sequence identical to an amino acid sequence represented by SEQ ID NO: 42, 43, 44, 45, 46, or 47, except for one or more amino acids being deleted, substituted, inserted, and / or added.

[0137] As used herein, "one or more amino acids" means 1 to 50, preferably 1 to 20, more preferably 1 to 10, and even more preferably 1 to 5 or 1 to 3 or 1 to 2 amino acids.

[0138] Furthermore, proteins having an amino acid sequence homologous to the amino acid sequence represented by SEQ ID NO: 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 include proteins having an amino acid sequence in its full length form that has 70% or more identity to the amino acid sequence represented by SEQ ID NO: 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25. The proteins include proteins having an amino acid sequence in its full length form that has preferably 80% or more, more preferably 90% or more, and even more preferably 95% or more identity to the above-mentioned amino acid sequences. Similarly, such proteins having an amino acid sequence homologous to an amino acid sequence represented by SEQ ID NO: 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, or 38 include proteins having an amino acid sequence in its full-length form that has 70%, 80%, 90%, or 95% or more identity to an amino acid sequence represented by SEQ ID NO: 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, or 38. Similarly, such proteins having an amino acid sequence homologous to an amino acid sequence represented by SEQ ID NO: 42, 43, 44, 45, 46, or 47 include proteins having an amino acid sequence in its full-length form that has 70%, 80%, 90%, or 95% or more identity to an amino acid sequence represented by SEQ ID NO: 42, 43, 44, 45, 46, or 47.

[0139] "Sequence identity" may refer to the percentage of identical nucleotides or amino acids in a nucleotide or amino acid sequence that are shared between two sequences, as determined by aligning the two sequences in an optimal pairwise alignment, optionally using conventional or commercially available algorithms.

[0140] In any method disclosed herein that includes separate steps, the steps may be performed in any feasible order, and, where appropriate, any combination of two or more steps may be performed simultaneously.

[0141] An example of a combination of two or more features would be to modify both CD19 and CD38 of HSCs prior to transplantation.

[0142] One of the most common treatments is bone marrow ("BM") transplantation or stem cell therapy ("SCT"). Often, patients relapse after SCT. If the editing strategy described herein is applied to hematopoietic stem cells before infusion or transplantation, these patients can be treated later with mAb therapy. An example is the B cell surface marker CD19, which is uniformly expressed by all mature B cells, including most B cell clones in B cell malignancies. If the CD19 gene of stem cells has already been edited, these create genetically edited B cells that are antibody resistant to subsequent treatment with, for example, CD19-CAR T cells.

[0143] The present invention can be used to engineer cells that are resistant to any monoclonal antibody. Such engineered cells can be used to address the off-target effects of therapeutic antibodies that have failed in clinical trials for safety reasons due to off-target effects.

[0144] Types of cells to which the present invention can be applied include NK cells, T cells, B cells, macrophages, hepatocytes, cardiomyocytes, hematopoietic stem cells, pancreatic cells, and MSCs.

[0145] Disease conditions include multiple myeloma ("MM"), B-cell chronic lymphocytic leukemia ("CLL") / small lymphocytic lymphoma ("SLL"), precursor B-cell lymphoblastic leukemia / lymphoma, B-cell ALL, Burkitt's lymphoma, acute promyelocytic leukemia, acute lymphocytic leukemia, mature B-cell neoplasms, mantle cell lymphoma (MCL), follicular lymphoma, diffuse large B-cell lymphoma, Hodgkin's lymphoma, primary effusion lymphoma, and idiopathic leukemia. These include lymphoma, AIDS-related non-Hodgkin's lymphoma, cutaneous follicle center lymphoma, marginal zone B-cell lymphoma (MALT type, nodal and splenic types), hairy cell leukemia, diffuse large B-cell lymphoma (DLBCL), plasmacytoma, plasma cell leukemia, post-transplant lymphoproliferative disorder, Waldenstrom's hypergammaglobulinemia, plasma cell leukemia, anaplastic large cell lymphoma (ALCL) and hairy cell leukemia.

[0146] definition

[0147] CD38 refers to the CD38 protein, preferably human CD38 protein (synonyms: ADP-ribosyl cyclase 1, ADP-ribosyl cyclase / cyclic ADP-ribose hydrolase 1, 2'-phosphocyclic ADP-ribose transferase, 2'-phosphocyclic ADP-ribose cyclase, cyclic ADP-ribose hydrolase 1, NAD(+) nucleosidase, CD38 antigen (P45), ADPRC1, 2'-phospho ADP-ribosyl cyclase / 2'-phosphocyclic ADP-ribose transferase, ecto-nicotinamide adenine dinucleotide glycohydrolase, cADPr hydrolase 1, EC 2.4.99.20, EC 3.2.2.6, T10). The extracellular domain of CD38 is shown in FIG. 3.

[0148] SLAMF7 refers to the SLAMF7 protein, preferably human SLAMF7 protein (synonyms: SLAM family member 7, membrane protein FOAP-12, CD2 subset 1, protein 19A, CRACC, CS1, Novel LY9 (lymphocyte antigen 9) )-like protein, CD2-like receptor that activates cytotoxic cells, CD2-like receptor that activates cytotoxic cells, 19A24 protein, CD319 antigen, Novel Ly9, CD319, 19A).

[0149] CD19 refers to the CD19 protein, preferably the human CD19 protein (synonyms: B-lymphocyte surface antigen B4, T cell surface antigen Leu-12, differentiation antigen CD19, B-lymphocyte antigen CD19, CD19 antigen, CVID3B4).

[0150] CD20 refers to the CD20 protein, preferably the human CD20 protein (synonyms: MS4A1, transmembrane 4 domain A1, Bp35, FMC7, CD20, B1, transmembrane 4 domain, subfamily A, member 1, leukocyte surface antigen Leu-16, B-lymphocyte antigen CD20, CD20 antigen, transmembrane 4 domain subfamily A member 1, B-lymphocyte cell surface antigen B1, B-lymphocyte surface antigen B1, CD20 receptor, LEU-16, CVID5, S7).

[0151] CD47 refers to the CD47 protein, preferably human CD47 protein (synonyms: IAP, antigen surface determinant protein OA3, leukocyte surface antigen CD47, MER6, OA3, CD47 antigen (Rh-associated antigen, Integrin-associated signaling factor) antigen recognized by monoclonal antibody 1D8, integrin-associated protein, Rh-associated antigen, CD47 glycoprotein, integrin-associated signaling factor, integrin-associated protein, protein MER6, CD47 antigen).

[0152] CD52 refers to the CD52 protein, preferably human CD52 protein (synonyms: HE5, EDDM5, CDW52, human epididymis-specific protein 5, CD52 antigen (CAMPATH-1 antigen), epididymis secretory protein E5, Cambridge Pathology 1 antigen, CAMPATH-1 antigen, epididymis secretory sperm-binding protein Li 171mP, CDW52 antigen (CAMPATH-1 antigen), CD52 antigen, HEL-S-171mP, CDw52, He5).

[0153] CD22 refers to the CD22 protein, preferably human CD22 protein (synonyms: CD22 molecule, SIGLEC2, CD22 antigen, SIGLEC-2, sialic acid-binding Ig-like lectin 2, B-lymphocyte cell adhesion molecule, T cell surface antigen Leu-14, B cell receptor CD22, BL-CAM, sialic acid-binding Ig-like lectin 2, Siglec-2).

[0154] CD25 refers to the CD25 protein, preferably the human CD25 protein (synonyms: IL2RA, interleukin 2 receptor subunit alpha, CD25, interleukin 2 receptor subunit alpha, interleukin 2 receptor, alpha, IL-2 receptor subunit alpha, IL-2R subunit alpha, TAC antigen, IDDM10, IL2R, P55, insulin-dependent diabetes mellitus 10, CD25 antigen, IL-2-RA, IL2-RA, IMD41, TCGFR).

[0155] CD28 refers to the CD28 protein, preferably the human CD28 protein (synonyms: CD28 molecule, T-cell specific surface glycoprotein CD28, T-cell specific surface glycoprotein, CD28 antigen (Tp44), CD28 antigen, Tp44, TP44).

[0156] CD30 refers to the CD30 protein, preferably the human CD30 protein (synonyms: TNFRSF8, TNF receptor superfamily member 8, D1S166E, CD30, tumor necrosis factor receptor superfamily member 8, lymphocyte activation antigen CD30, CD30L receptor, Ki-1 antigen, KI-1, tumor necrosis factor receptor superfamily, member 8, cytokine receptor CD30, CD30 antigen, Ki-1).

[0157] CD33 refers to the CD33 protein, preferably human CD33 protein (synonyms: CD33 molecule, SIGLEC3, SIGLEC-3, P67, Sialic Acid-Binding Ig-Like Lectin 3, Myeloid Cell Surface Antigen CD33, CD33 Antigen (Gp67), FLJ00391, Gp67, Sialic Acid-Binding Ig-Like Lectin 3, CD33 Molecule Transcript, CD33 Antigen, Siglec-3).

[0158] CD117 refers to the CD117 protein, preferably the human CD117 protein (synonyms: KIT, KIT proto-oncogene, receptor tyrosine kinase, SCFR, V-Kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homologous, mast / stem cell growth factor receptor Kit, CD117, C-Kit, PBT, tyrosine protein kinase Kit, piebald trait protein, proto-oncogene C-Kit, EC 2.7.10.1, P145 C-Kit, V-Kit Hardy-Zuckerman 4 feline sarcoma viral oncogene-like protein, proto-oncogene tyrosine protein kinase Kit, C-Kit proto-oncogene, piebald trait, CD117 antigen, EC 2.7.10, MASTC).

[0159] PDGFRA refers to a PDGFRA protein, preferably a human PDGFRA protein (synonyms: platelet-derived growth factor receptor alpha, PDGFR2, platelet-derived growth factor receptor, alpha polypeptide, alpha-type platelet-derived growth factor receptor, platelet-derived growth factor receptor alpha, platelet-derived growth factor receptor 2, CD140 antigen-like family member A, CD140a antigen, PDGF-R-alpha, EC 2.7.10.1, PDGFR-2, CD140a, GAS9, alpha platelet-derived growth factor receptor, platelet-derived growth factor alpha receptor, PDGFR-alpha, RHEPDGFRA, EC 2.7.10, CD140A).

[0160] "Antibody" as used herein is intended to have a broad meaning and includes immunoglobulin molecules produced by plasma cells that recognize a specific antigen via the antigen-binding fragment (Fab) variable region. It includes all subtypes of immunoglobulins, with or without an Fc region. "Antibody" as used herein includes all species, as well as nanobodies and VHHs.

[0161] As used herein, "monoclonal antibody" or "monoclonal" refers to an antibody molecule that has a monovalent affinity, in that the antibody binds to the same epitope on an antigen. Monoclonal antibodies are produced by the same immune cell that is a clone of a unique parent cell.

[0162] As used herein, "antibody-derived therapeutic" refers to antibodies acting alone and those linked to a payload such as antibody drug conjugates, CAR T or NK cells, bispecific antibodies, etc.

[0163] "Bispecific antibodies" or BIKEs are antibodies that are designed to recognize two different epitopes or antigens.

[0164] A "trispecific antibody" or TRIKE is an antibody that is designed to recognize three different epitopes or antigens.

[0165] As used herein, "autoantibody" refers to an antibody that can be formed against a self-antigen. These autoantibodies can cause the immune system to recognize and destroy normal cells, resulting in autoimmune disease. Examples of autoimmune diseases that have an autoantibody component include type 1 diabetes, autoimmune hepatitis, or Graves' disease.

[0166] As used herein, "epitope" or "antigenic determinant" refers to the portion of an antigen that is specifically recognized by an antibody. An epitope may be composed of adjacent or non-adjacent amino acids that form the three-dimensional structure of the epitope. An epitope may be mutated to recognize the antibody longer. Disclosed herein is the epitope of daratumumab on CD38, including the amino acids involved in binding disruption. Figure 4 shows the in silico mutation prediction using the freeware DynaMute.

[0167] As used herein, a "variant" refers to a nucleotide or polypeptide sequence that differs from a reference nucleotide or polypeptide sequence by one or more modifications, such as a substitution, insertion or deletion.

[0168] "On-target off-tumor effect" refers to the binding of an antibody or antibody-derived therapeutic not only to its intended target epitope on malignant cells, but also to the same target epitope on normal, non-malignant cells if they express the target antigen. Cells affected by on-target off tumor are often called "bystander cells."

[0169] "CAR-T or CAR-NK cells" refer to chimeric antigen receptor cells that have receptor proteins that have been engineered to target the cells to specific proteins and confer on the receptor the ability to have cytotoxic cell activation function.

[0170] "Effector cell" refers to a cell that carries out a function in response to a stimulus.

[0171] The antibodies and antibody-derived therapeutics used in the methods of the invention disclosed herein include those in the numbered embodiments listed below, but may be selected de novo from publications, clinical trials and in silico analysis.

[0172] The present invention is illustrated by the following examples, in which the specific examples, materials, amounts, and procedures are to be interpreted broadly in accordance with the scope and spirit of the invention described herein. EXAMPLES

[0173] Example 1: Creation of constructs for generating adoptive GEAR cells

[0174] As an example of a cell that contains one or more antibody binding sites that have been modified such that they no longer bind the relevant antibody or have a significantly lower affinity for the antibody, the modified epitope of daratumumab on CD38 is shown in Figure 2.

[0175] With reference to Figures 1-2 and 10-12, cells for adoptive therapy are engineered to be resistant to antibody-mediated effects such as antibody-dependent cellular cytotoxicity (ADCC) or antibody-dependent cellular phagocytosis (ADCP). To achieve this goal, one or more specific surface proteins of the cells of the cell product are modified. These surface proteins are themselves potential targets for subsequent antibody therapy.

[0176] The epitope of a specific protein of interest bound by an antibody is identified, and this epitope binding site is engineered with specific amino acid substitutions such that the antibody no longer binds to the engineered binding site. Epitope engineering is performed to preserve the underlying protein function. As an example, the modified epitope of Daratumumab on CD38 is shown in Figure 2.

[0177] The subject's cells can be modified in several ways. Genetic modification can be achieved by a variety of techniques, such as knocking out (KO) the native protein and knocking in (KI) the modified protein, or by CRISPR (clustered irregular gene transcription) at the desired nucleotides of the native protein. These can be introduced by editing using correctly interspaced short palindromic repeats (PICs), TALENs (transcription activator-like effector nucleases) or ZFNs (zinc finger nucleases). These nucleases can be delivered by electroporation, viral vector gene transfer, piggyback or sleeping beauty delivery systems, synthetic or biological nanoparticles, extracellular vesicles or exosomes, and many more techniques.

[0178] Knockout and Insertion

[0179] The engineered protein is translated into a cDNA that can be inserted into a cell.

[0180] The DNA encoding the sequence of the antibody binding epitope is identified.

[0181] DNA encoding a protein with an engineered epitope binding site is inserted into cells using a variety of techniques, such as knocking out (KO) the native protein and knocking in (KI) the modified CD38. The KI of the modified CD38 contains a single triplet nucleotide modification of the human CD38 exon sequence, a codon-optimized (CO) nucleotide sequence that encodes the amino acid sequence of the modified CD38 molecule (i.e., a single amino acid modification or modifications by two or more amino acids).

[0182] CRISPR-Mediated Gene Editing

[0183] Gene editing techniques include CRISPR (clustered regularly interspaced short palindromic repeats) editing of native proteins at the desired nucleotide, TALEN (transcription activator-like effector nucleases) or ZNF (zinc finger nucleases) editing. These nucleases can be delivered by electroporation, viral vector transfection, piggyback or sleeping beauty delivery systems, and many more techniques.

[0184] Gene editing approaches involve identifying the region of DNA to be modified and designing a guide RNA ("gRNA") that targets Cas9 to the DNA sequence of the gene encoding the antibody binding epitope.

[0185] Examine the targeting efficiency of these gRNAs (using the gRNAs to create a knockout of the protein of interest in relevant cell lines).

[0186] Design a homology-directed repair ("HDR") template of those gRNAs that show Cas9 cleavage activity. The HDR template performs editing of several amino acids adjacent to the induced double-stranded break in cells. The HDR template can be in the form of a short dsDNA or ssDNA molecule, or in the form of a plasmid, thus providing the option of inserting larger edits as needed.

[0187] The process of finding and substituting relevant amino acid substitutions

[0188] This process can be divided into three separate steps: 1) identification of relevant amino acids, 2) modifying the nt sequence to create modified amino acid sequences, and 3) screening all the resulting modified proteins (one amino acid at a time) for inhibitory binding to the antibody.

[0189] The epitope of the antibody in question was identified using literature searches, Uniprot and other They must be identified either by searching public databases, by crystallization of the antibody with its antigen, or by mutation studies in which single amino acids are repeatedly substituted and antibody binding is measured.

[0190] After epitope identification, the amino acids in that region need to be identified using public databases such as NCBI, Uniprot or many others. Based on the three-dimensional structure of the antigen in question, amino acids that are accessible to binding and therefore potentially relevant for binding can be identified (as seen in Figure 2).

[0191] These related amino acids can be replaced with amino acids that have the opposite physicochemical properties. Often, the natural amino acid is replaced with phenylalanine (F) (see FIG. 2) because size and structure alone can inhibit specific binding by a therapeutic agent and provide different physicochemical contacts. However, amino acid substitutions are not limited to replacement with F, and represent substitutions of amino acids including any change from the WT sequence and substitution with any other amino acid is possible, which would be expected to alter or inhibit specific binding by a therapeutic agent.

[0192] Related amino acids are those in which the substitution of a single amino acid, or a combination of two or more amino acid substitutions, alters antibody binding / recognition.

[0193] Amino acid substitutions include any change from the wt sequence, meaning replacement with any other amino acid.

[0194] The amino acid substitution or substitutions are made based on the nucleotide sequence, where either the simplest sequence change (i.e. the minimum number of nucleotides required) or the replacement of the entire codon with another codon can be made. It is recommended to use the codons most frequently used in humans, i.e. to codon-optimize the sequence at this stage. This needs to be done for all amino acids to be screened.

[0195] Screening of all resulting versions of the protein can be done by antibody binding assays. There are many different techniques to achieve this. The authors identified substitutions that abrogate antibody binding by expressing all modified molecules on the cell surface and performing staining with the antibodies described further below and shown in Figures 6-8 and 13-16.

[0196] Since antibody epitopes contain a finite number of amino acids, the number of amino acid substitutions to be screened is usually finite. Amino acids adjacent to the epitope that are important for the three-dimensional structure may also be considered, but are given a lower priority in the authors' algorithm because they are less likely to both abrogate antibody binding and maintain the overall structure and functionality of the protein. In addition to screening for any single amino acid substitution, combinations of substitutions of two or more amino acids may alter antibody binding and should be taken into consideration.

[0197] Substitutions can be screened with freeware such as DynaMute, which predicts three-dimensional structures (see Figure 4), but these software still need to be significantly improved before they can be used as a surrogate for functional screening.

[0198] Testing of engineered cells

[0199] The resulting cells are tested by functional assays as shown in FIG. 5, i.e., functionality such as recognition by the antibody that is being blocked, recognition by other antibodies specific for the same molecule, killing / degranulation, cytokine production, potential proliferation and depletion, and, in the case of enzymes, enzyme activity as it relates to the particular clinical application.

[0200] Cells modified by either knockout / knockin or gene editing strategies are then expanded as needed for therapy, with appropriate quality controls ensuring sterility, phenotype and overall safety (mycoplasma, endotoxins, etc.) of the cells in situ.

[0201] The expanded cells, after appropriate quality control, are administered to a patient in need thereof along with the corresponding therapeutic antibody as outlined in Figures 10-12. The cells may be administered prior to, simultaneously with, or after administration of the antibody. The cells may be administered once or multiple times. The cells may be administered with each antibody administration, less frequently than the antibody administration, or more frequently than the antibody administration.

[0202] During treatment, the patient may be tested to determine the presence or absence of engineered cells, and dosage may be adjusted based on the test results.

[0203] Example 2: CD38-GEAR NK cells

[0204] The present efforts focus on NK adoptive cell transfer and subsequent or simultaneous anti-CD38 therapy. For the treatment of plasma cell malignancies such as multiple myeloma and other diseases, antibody therapies have become important. These include monoclonal antibodies, antibody drug conjugates, bi- or trispecific antibodies or CAR cells, where the antibody recognition domain is genetically introduced into T cells or NK cells. Often, these antibodies target antigens not only on malignant cells but also on normal bystander cells, a process called on-target-off-tumor effect. In the case of anti-CD38 therapies such as daratumumab or isatuximab, they target and eliminate malignant cells expressing high levels of CD38, but also deplete cells expressing intermediate levels of CD38. This has been shown for NK cells (21, 22). This is undesirable, as NK cells are also important mediators of the ADCC effect of anti-CD38 antibodies. Furthermore, CD38+ NK cells activated by daratumumab release interferon-γ, which is important for increasing phagocytosis of CD38+ MM cells by monocytes and inducing Th1-mediated immune responses against MM cells (13). Although NK effector cells are rapidly depleted, treatment with daratumumab is advantageous. However, the long-term presence of functional NK cells increases their efficacy, potentially lowering the required dose of daratumumab.

[0205] NK cells may be administered as a cellular product in adoptive cell therapy to demonstrate antitumor effects (23-25). However, these cells still express CD38 and are therefore susceptible to anti-CD38 targeted therapy. This complicates the combination of daratumumab and NK adoptive cell therapy and may even inhibit this particular therapeutic combination.

[0206] Following the process of Example 1, and referring to Figure 12, the feasibility of treating MM with NK cells and daratumumab can be improved. NK cell products can be genetically engineered to be resistant to daratumumab-mediated depletion. This is accomplished by altering one or more amino acids in the daratumumab binding site of CD38 (as shown in Figure 2), such that the antibody is unable to or only weakly recognizes CD38 on NK cells (as shown in Figures 6-8, and Figures 13-14).

[0207] Figure 2 is a diagram of CD38 showing the Dara binding site. The diagram is based on structures available in the pdb database, the publication by Liu et al. (20) https: / / www.rcsb.org / structure / 1YH3. Figure 2 shows the proposed and tested substitutions in the Dara binding site to inhibit binding. All of these substitutions were examined and the results are shown in Figures 6-8 and 13-24.

[0208] Genetic modification can be achieved by a variety of techniques, such as knocking out (KO) native CD38 (gRNAs TGGAATCGATTATAAGCAAAAGG (SEQ ID NO: 1), GGAATATTCAATTTTCCTGCAAG (SEQ ID NO: 2), or TTTTCCTGCAAGAATATCTACAG (SEQ ID NO: 51)), knock-in (KI) of modified CD38 (e.g., by the plasmid depicted in FIG. 9), CRISPR (clustered regularly interspaced short palindromic repeats) editing of native CD38 at the desired nucleotide (similar gRNAs targeting CD38 in addition to homologous recombination repair encoding amino acid substitutions depicted in FIG. 2), editing using TALEN (transcription activator-like effector nucleases) or ZFN (zinc finger nucleases). These nucleases can be delivered by electroporation, viral vector gene transfer, piggyback or sleeping beauty delivery systems, synthetic or biological nanoparticles, extracellular vesicles or exosomes, and many more techniques.

[0209] The sequence of the editing step may vary, and the nucleotide sequence of the modified CD38 can be codon optimized (CO) to ensure that the newly introduced gene is not targeted by the knockout or editing strategy.

[0210] NK cells can be collected from peripheral blood of healthy donors or patients (diagrammed in FIG. 10). These cells can then be expanded from PBMCs in in vitro culture systems under GMP conditions. Several different expansion protocols exist and are used in current clinical trials of adoptive NK cell therapy (26, 27), cytokine cocktails to induce memory-like NK cells (28), expansion from iPSCs (29), and expansion from PBMCs (25, 30). Automated, fully enclosed blood culture systems such as commercial forms from Miltenyi, GE, and others are available and are often used for the expansion of NK cells in GMP facilities.

[0211] After proliferation (15-25 days), perform quality control of the cells, which require sterility evaluation and functionality evaluation.

[0212] Sterility testing is performed throughout the growth and manufacturing process to test samples representative of the final cell product for sterility and microbial contamination. Testing includes Mycoplasma, Staphylococcus aureus, Pseudomonas aeruginosa, Bacillus subtilis, Aspergillus braziliensis, Candida albicans, and Clostridium sporogenes. Additional testing of isolates representative of the manufacturing environment may also be performed.

[0213] To test for functionality, NK cells are stimulated using a standard 4-hour in vitro stimulation assay using K562 erythroleukemia cells to stimulate NK cells. Degranulation as a surrogate for death, and IFN-gamma production as a surrogate for cytokine secretion are assessed using flow cytometry (31,32). This assay was used to generate the data shown in Figures 17-24. From these figures, it can be seen that the modified NK cells containing the modified CD38 molecule are functional in terms of degranulation, a recognized marker of death, and IFN-gamma release, the most commonly tested cytokine in NK cells. Other functional assays include a standard 4-hour in vitro stimulation assay using K562 erythroleukemia cells to stimulate NK cells. Degranulation as a surrogate for death, and IFN-gamma production as a surrogate for cytokine secretion are assessed using flow cytometry (31,32). This assay was used to generate the data shown in Figures 17-24. From these figures, it can be seen that the modified NK cells containing the modified CD38 molecule are functional in terms of degranulation, a recognized marker of death, and IFN-gamma release, the most commonly tested cytokine in NK cells. 51 These include direct testing of target cell killing using chromium release assays, or flow cytometry- or microscopy-based killing assays.

[0214] As illustrated in FIG. 10, the cell product is frozen and stored frozen until needed.

[0215] Genetic modification can be performed at any time during the expansion culture. Early in the culture, the frequency of NK cells in the PBMCs is low, and the genes of mainly non-NK cells in the culture are altered. Adoptive cell therapy requires large amounts of cells (0.5-50 * 10e6 cells / kg body weight) is required At later time points, the cell numbers are very large and large amounts of reagents are required for genetic modification. In our control, the best results were observed when the genetic modifications were introduced from day 3 to day 14. After introducing the genetic modifications, either editing of native CD38 or KO of native CD38 and KI of modified CD38, the cells can be further expanded until the desired number and release criteria are reached (illustrated in Figure 10).

[0216] Modifications of the CD38 antigen include one or more amino acid changes that alter the recognition and binding of anti-CD38 antibodies, see FIG. 2. In this example, we focused on daratumumab. These are predicted to be in the daratumumab epitope, namely amino acids 233-246, 267-286, but potentially could also be found in parts of the sequence that are 3D close to the binding site. The substitutions are from natural amino acids to ones with different physicochemical properties, e.g. different charge or structure, both of which may abolish / impair binding to daratumumab. With reference to FIG. 2, examples of such substitutions are T237A, E239F, Q272R, S274F, K276F. Further substitutions that, alone or in combination, alter the three-dimensional structure of the epitope may have similar results.

[0217] Once these substitutions were introduced into the cells, evaluation of binding to daratumumab and other CD38 antibodies indicates that two of these modifications, S274F and E239F, abrogate daratumumab recognition (Figures 6-8 and 13-14). Furthermore, functionality for NK cell activation or target cell killing was assessed by one or more of the described assays. Cells were grown under standard growth conditions and assessed for quality and release criteria similar to the unmodified cell product.

[0218] Using the same procedures, the CD38GEAR NK cell product can then be administered to the patient, with follow-up criteria as for any unmodified NK cell product.

[0219] procedure

[0220] The binding site of Daratumumab, including the proposed amino acid substitutions, is shown in Figure 2. Substitutions were identified within amino acid sequences 233-246, 267-286 that eliminate or reduce binding of the Daratumumab epitope. With reference to Figure 2, examples of such substitutions are T237A, E239F, Q272R, S274F, K276F. Additional substitutions, alone or in combination, may produce similar results. The modifications S274F and E239F completely abrogate recognition by Daratumumab, as shown in Figures 6-8 and 13-14, and thus protect cells from Daratumumab-dependent ADCC-mediated killing of cells bearing this modified molecule. While these modifications mask Daratumumab recognition, CD38, as shown in Figures 4-6 and 13-14, is not KO'd, as other CD38-specific antibodies, such as clone HIT2, can bind and detect the molecule on the cell surface.

[0221] In embodiments, the CD38 amino acid sequence may be an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to a CD38 amino acid sequence transcribed and translated from a somatic cell genome, which can function like wild-type CD38 as described herein. In embodiments, an exemplary CD38 nucleotide sequence may be a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to a CD38 nucleotide sequence of a somatic cell, which can be transcribed and translated into a CD38 protein as described herein.

[0222] gRNAs: TGGAATCGATTATAAGCAAAAGG (SEQ ID NO: 1), GGAATATTCAATTTTCCTGCAAG (SEQ ID NO: 2), or TTTTCCTGC AAGAATATCTACAG (sequence number 51).

[0223] Human CD38 has the nucleotide (cDNA) SEQ ID NO: 3, the nucleotides encoding the daratumumab epitope are in bold, and the nucleotides encoding the isatuximab epitope are underlined.

[0224] Nucleotide sequence (903nt):

[0225] [ka]

[0226] Below is the human genomic CD38nt sequence (SEQ ID NO: 4). Exons are in bold. The nucleotide sequence encoding the amino acids that comprise the daratumumab epitope is in bold and underlined.

[0227] CD38 sequence NCBI 20220206>NC_000004.12:15778328-15853232 Human chromosome 4, GRCh38.p13 primary assembly

[0228] [ka]

[0229] [ka]

[0230] [ka]

[0231] [ka]

[0232] [ka]

[0233]

change

[0234]

change

[0235]

change

[0236]

change

[0237]

change

[0238]

change

[0239]

change

[0240]

change

[0241]

change

[0242]

change

[0243]

change

[0244]

change

[0245]

change

[0246]

change

[0247]

change

[0248]

change

[0249]

change

[0250]

change

[0251]

change

[0252]

change

[0253]

change

[0254]

change

[0255]

change

[0256]

change

[0257]

change

[0258]

change

[0259]

change

[0260]

change

[0261]

change

[0262]

change

[0263]

change

[0264]

change

[0265]

change

[0266]

change

[0267]

change

[0268]

change

[0269]

change

[0270]

change

[0271]

change

[0272]

change

[0273]

change

[0274]

change

[0275]

change

[0276] SEQ ID NO: 5: Human CD38 amino acid sequence

[0277] [ka]

[0278] The sequence of CD38 containing the substitution T237A in the daratumumab epitope. The substitution is in bold. The three-dimensional structure containing this amino acid substitution is shown in Figure 2.

[0279] [ka]

[0280] The sequence of CD38 containing the substitution E239F in the daratumumab epitope. The substitution is in bold. The three-dimensional structure containing this amino acid substitution is shown in Figure 2.

[0281] [ka]

[0282] The sequence of CD38 containing the substitution Q272R in the daratumumab epitope. The substitution is in bold. The three-dimensional structure containing this amino acid substitution is shown in Figure 2.

[0283] [ka]

[0284] The sequence of CD38 containing the substitution S274F in the daratumumab epitope. The substitution is in bold. The three-dimensional structure containing this amino acid substitution is shown in Figure 2.

[0285] [ka]

[0286] The sequence of CD38 containing the substitution K276F in the daratumumab epitope. The substitution is in bold. The three-dimensional structure containing this amino acid substitution is shown in Figure 2.

[0287] [ka]

[0288] Sequence of CD38 containing the substitution M77F in the isatuximab epitope. The substitution is in bold.

[0289] [ka]

[0290] Sequence of CD38 containing the substitution R78F in the isatuximab epitope. The substitution is in bold.

[0291] [ka]

[0292] Sequence of CD38 containing the substitution H79F in the isatuximab epitope. The substitution is in bold.

[0293] [ka]

[0294] Sequence of CD38 containing the substitution V80F in the isatuximab epitope. The substitution is in bold.

[0295] [ka]

[0296] Sequence of CD38 containing the substitution K111F in the isatuximab epitope. The substitution is in bold.

[0297] [ka]

[0298] Sequence of CD38 containing the substitution L112F in the isatuximab epitope. The substitution is in bold.

[0299] [ka]

[0300] Sequence of CD38 containing the substitution G113F in the isatuximab epitope. The substitution is in bold.

[0301] [ka]

[0302] Sequence of CD38 containing the substitution T114F in the isatuximab epitope. The substitution is in bold.

[0303] [ka]

[0304] Sequence of CD38 containing the substitution Q115F in the isatuximab epitope. The substitution is in bold.

[0305] [ka]

[0306] Sequence of CD38 containing the substitution T116F in the isatuximab epitope. The substitution is in bold.

[0307] [ka]

[0308] Sequence of CD38 containing the substitution V117F in the isatuximab epitope. The substitution is in bold.

[0309] [ka]

[0310] Sequence of CD38 containing the substitution P118F in the isatuximab epitope. The substitution is in bold.

[0311] [ka]

[0312] Sequence of CD38 containing the substitution P232F in the isatuximab epitope. The substitution is in bold.

[0313] [ka]

[0314] Sequence of CD38 containing the substitution E233F in the isatuximab epitope. The substitution is in bold.

[0315] [ka]

[0316] Sequence of CD38 containing the substitution K234F in the isatuximab epitope. The substitution is in bold.

[0317] [ka]

[0318] NK cell CD38 knockout was created by lentiviral transduction of Cas9 and a gRNA targeting the first intron (5'TGTACTTGACGCATCGCGCCAGG3' (SEQ ID NO: 52)). Other gRNAs have also been tested and can be used with this protocol.

[0319] NK92 CD38KO cells were further modified to add different mutated versions of CD38 (CD38 codon-optimized (CD38-CO), which is not recognized by gRNA; CD38 S274F, E239F, Q272R, T237A, K276F, with the first letter being the chromosome 1 (K274F)). where A is the natural amino acid, the number is the position on the protein chain, and the last number is the amino acid substitution. TG2 is an empty vector used as a control (GFP only). All plasmids were designed by the inventors, and cloning was ordered and performed by GenScript.

[0320] Lentiviruses were generated in HEK293FT cells at passages 3–15 by calcium phosphate-based transfection (Sigma, CAPHOS-1KT) according to the manufacturer's recommendations. DMEM complete medium was used throughout the experiment and consisted of 500 ml DMEM (Gibco) containing 55 ml FBS (Gibco), 5.5 ml L-glutamine solution (Sigma), 5.5 ml sodium pyruvate solution (Sigma), 5.5 ml non-essential amino acid solution (Sigma), and 11 ml HEPES solution (Gibco). Cells were seeded on Poly-D-lysine-coated 150 mm dishes (BD Biosciences). After 6 h of incubation at 37 °C 5% CO2, the medium was replaced with 20 ml complete medium (Sigma) containing 25 μM chloroquine, and 1 ml of 2xHeBS (Sigma) buffer containing 1 ml of the plasmid of interest was co-transfected with the envelope plasmid pCMV-VSV-G and the two packaging plasmids, pDMLg / pPRE and pRSV-Rev, to generate a VSV-G pseudotyped lentiviral plasmid solution (30 μg vector, 15 μg Gag / pol, 10 μg envelope, 0,25 M CaCl2 (Sigma) and ddH2O to 1000 μl). After 16 h of incubation, the medium was replaced with 20 ml fresh complete medium, and after 24 h the medium was collected for virus recovery by filtering the supernatant through a 0,45 μm filter (Milipore) using a 20 ml syringe. After another 24 hours, a second harvest was performed and Lenti-X concentrator (Takara Bio) was added to the total content of viral supernatant from both harvests in one dose of Lenti-X with three doses of supernatant. After 6 hours in the refrigerator, the virus solution was centrifuged at 1500g, 4°C for 45 minutes (no brake). The virus was resuspended in PBS 5% FBS at 1 / 10 or 1 / 50 of the original volume.

[0321] Viruses other than lentiviruses may also be used for transduction, such as alpha retroviruses, gamma retroviruses, adenoviruses, or AAV.

[0322] Lentiviruses or other viruses may be pseudotyped with envelope proteins other than VSV-G, such as Baboon env, RD114, GALV or engineered chimeric envelope proteins.

[0323] Viral titers were measured by transducing different amounts of virus solution into HEK293FT cells. HEK293FT cells were seeded at 50,000 cells per well in 24-well plates (Corning) containing DMEM + Glutamax medium (Gibco) + 8 μg / ml protamine sulfate (Sigma Aldrich). After adding the virus solution and diluting it in serial solutions, the cells were centrifuged at 1000 g for 1 h (without brake) at 32 °C. The plates were incubated at 37 °C, 5% CO2 for 6 h before the medium was replaced with DMEM without protamine sulfate. After 3 days, transduction efficiency was evaluated by flow cytometry after fixing the cells in 1% PFA at room temperature for 5 min or after staining and fixation, if applicable, for GFP reporter-bearing constructs.

[0324] The titer is calculated as follows:

number

[0325] For transduction of NK92 cells, 30,000 cells were seeded in 96-well flat-bottom plates (Corning) supplemented with 8 μg / ml protamine sulfate (Sigma Aldrich) and 7 μg / ml Vy-OZ (Vycellix) and virus solution at MOI 8. The plates were then centrifuged at 1000 g for 1 h (no brake) at 32 °C, followed by centrifugation for 5 h at 37 °C 5% CO2, after which the medium was replaced with IL2 (final concentration 500 U / ml). IL2 was added every 2 days and the medium was replaced until pure transduced cells were obtained for expression assessment by flow cytometry (3-5 days after transduction) and expansion for selection.

[0326] PBMCs and isolated primary NK cells were transduced as above but using an MOI of 15. Either 30,000 cells in flat 96-well plates or 250,000 cells in 24-well plates (Corning) were transduced.

[0327] Peripheral blood mononuclear cells (PBMCs) were isolated from the buffy coat by gradient centrifugation using Lymphoprep (Stemcell technologies) gently mixed with the buffy coat (2 parts buffy coat to 1 part Lymphoprep), followed by centrifugation at 800 g for 30 min (without brake) at 20 °C to collect the leukocyte band. They were then washed twice with phosphate-buffered saline (PBS, Gibco), centrifuged at 300 x g for 10 min between the two washes and at 200 x g 10 min after the second wash. Cell viability was assessed by trypan blue exclusion. If required, PBMCs were directly frozen in human serum albumin containing 10% DMSO for subsequent phenotypic analysis and cytotoxicity experiments. Primary NKs were isolated using the Miltenyi Biotec NK cell isolation kit Human, following the manufacturer's recommendations. Phenotypic analysis was performed by incubating in the refrigerator for 20 min, washing with PBS, and surface staining with live dead markers (Invitrogen) and CD3, CD56, and fixing with 1% PFA for 5 min at room temperature in the dark. Analysis was performed by flow cytometry.

[0328] For in vitro expansion of NK cells in PBMCs, PBMCs were cultured at 0.5 °C in SCGM medium (CellGenix) supplemented with 5% human serum, 500 U / ml IL2, and 10 ng / ml CD3 antibody after lymphoprep separation. * 10 6 Cells were directly seeded at 1000 cells / ml. IL2 500U / ml was added daily for 5 days, and IL-2 was added 3 times a week from day 5 onwards. Figure 26 shows that CD38 expression is detectable during 14 days of expansion.

[0329] For ex vivo expansion of isolated primary NK cells, immediately after isolation, the cells were cultured in SCGM medium (CellGenix) supplemented with 10% human serum, 1000 U / ml IL2, and 20 ng / ml IL21 for 1 h. * 10 6 Cells / ml were seeded. IL2 500U / ml was added daily for 5 days thereafter, and IL-2 was added 3 times a week from day 5 onwards. Figure 27 shows that CD38 expression is detectable during 14 days of expansion.

[0330] Several in vitro assays can be employed to test which substitutions are most usable for therapy (Figure 5). To enable clinical use of cells containing these modified CD38 molecules, it is necessary to confirm that the cells are no longer recognized by daratumumab and that they are still functional in terms of degranulation / killing of target cells. It is speculated that avoiding recognition by daratumumab renders them inactive for ADCC, since ADCC is only possible if binding of the antibody to the antigen epitope a) has occurred and b) has a sufficiently high affinity. The results of shielding from daratumumab binding are shown in Figures 6-8 and 13-14, and the evaluation of the functionality of the modified cells is shown in Figures 17-24.

[0331] Recognition by Daratumumab: Once endogenous CD38 was removed and mutated CD38 was expressed, binding studies using daratumumab and other CD38 antibodies were performed to evaluate the recognition of the mutated epitope by daratumumab. The results for daratumumab are shown in Figures 6-8 and 13-14, and for isatuximab in 15-16. For this, modified cells were incubated with daratumumab (c=10 μg / ml) for 40 min at 4 °C. Excess daratumumab was removed by washing the cells twice with PBS + 2% FBS. The cells were then incubated with a fluorescently labeled secondary antibody that recognizes the Fc domain of daratumumab. This allows visualization of cells recognized by daratumumab. After removal of excess secondary antibody, the cells were fixed with 1% PFA for 5 min at 4 °C, washed, and resuspended in PBS. CD38 expression analysis was performed by flow cytometry. Alternatively, daratumumab was tagged with a fluorophore prior to CD38 staining of cells. Alternatively, cells were first incubated with daratumumab and subsequently stained with an anti-CD38 antibody that recognizes a different epitope from daratumumab to determine whether preincubation reduces binding of the second antibody, thus demonstrating binding competition (Figures 13-16). Optionally, cells may be stained simultaneously with several anti-CD38 antibodies, including daratumumab, to detect total CD38 versus mutant CD38. Sorted CD38 NK cells, wild type, and CD38KO cells were seeded at 80000 cells / well in V-bottom 96-well plates (Corning). Daratumumab was added to cells at 55 μg / ml (determined at time of titration) (Sigma) in 50 μl PBS. After 40 min incubation in the refrigerator, cells were washed twice with PBS and incubated with secondary antibody anti-Fc (Cedarlane) using 1 / 100. Commercially available monoclonal anti-CD38 HIT2 was used as a control to assess the presence of CD38 surface expression. Cells were fixed in 1% PFA at room temperature and analyzed by flow cytometry (Cytoflex S Beckman coulter). Isatuximab was also used to assess exclusivity of the mutants, following the same protocol except at 4 μg / ml (determined by titration).

[0332] Functionality of the modified NK cells: The functionality of the cells expressing the mutated CD38 is then assessed. For this, several functional assays may be employed. The most common are flow cytometry-based in vitro responsiveness assays to determine degranulation (measuring available CD107 during the release of cytotoxic granules) and cytokine production (IFNγ is commonly used as the standard cytokine for NK cells). For the in vitro responsiveness assays, modified NK cells were co-incubated with target cells at an effector-to-target ratio (E:T ratio) of 1:1 or 1:3 for 4-6 hours or overnight. During the incubation, a fluorescently labeled antibody targeting CD107 is present. CD107 is a membrane protein present in intracellular vesicles. When NK cells degranulate, the CD107 molecule can bind to the CD107-targeting antibody, allowing the subsequent detection of degranulated NK cells by flow cytometry. After co-incubation, modified NK cells are further stained for surface and intracellular markers such as CD3, CD56, CD38, live and dead cell markers, and intracellular cytokines such as INFγ. Flow cytometry analysis allows assessment of the percentage of NK cells responding with either degranulation or a cytokine response, as shown in Figures 17-23. Moreover, the extent of response can be measured by comparing the mean fluorescence intensity (MFI) of CD107 or IFNγ. NK cells (cell lines, PBMCs or isolated NK cells) were co-cultured with target cells at a 1:1 ratio in a final volume of 200 μL in round-bottom 96-well plates for 4 hours at 37°C, 5% CO2. Fluorescent dye-conjugated anti-CD107aM Ab was added at the start of the assay. As controls, 100,000 effector cells were incubated alone or with phorbol 12-myristate 13-acetate (PMA, 50 ng / ml, Sigma-Aldrich) and ionomycin (500 ng / mL, Sigma-Aldrich). After 1 h of co-incubation, monensin (GolgiStop, BD Biosciences) was added at a 1:300 dilution to inhibit protein transport. Surface staining was performed for intracellular staining of IFNγ. Four hours after the start of the assay, cells were incubated with the selected antibodies for 30 minutes in the refrigerator, followed by permeabilization with Cytofix / Cytoperm (BD). Cells were then washed, resuspended in PBS, and fixed by incubation with 1% PFA for 5 minutes. Samples were analyzed on a Beckman Coulter Cytoflex or BD Symphony flow cytometer.

[0333] Inactivity of modified NK cells to ADCC: By using modified NK cells as target cells, the resistance of modified NK cells to antibody-mediated cytotoxicity (ADCC) by other immune effector cells can be measured. For this, the in vitro responsiveness assay described above can be modified to include the antibody of interest, in this case daratumumab, during the co-incubation of effector and target cells. By using unmodified NK cells or macrophages as effectors and modified or control-engineered NK cells as target cells, the level of ADCC that modified NK cells induce in other immune cells, i.e., the level of resistance to NK cell-mediated ADCC or macrophage-mediated ADCC or ADCP, can be assessed. Evaluating the degranulation (CD107 expression) and cytokine response (IFNγ expression) of unmodified effector NK cells to modified target NK cells is expected to show that the inserted CD38 mutations result in resistance to daratumumab-mediated ADCC. In addition to measuring the effector cell response, the killing of modified target cells can also be measured directly. For this purpose, modified target NK cells were co-incubated with propidium iodide (PI) and annexin V (AnnV) antibodies, followed by staining to distinguish between apoptotic and necrotic cell death of modified NK cells. Since inactivity to ADCC essentially relies on avoiding antibody (daratumumab) recognition, it is certain that if cells are protected from recognition by daratumumab, they will also be inactive to ADCC.

[0334] The criteria for what constitutes a good / optimal amino acid substitution in CD38 are: 1) the modified NK cells are not recognized by daratumumab, but can be stained with an anti-CD38 antibody specific for an epitope different from the daratumumab epitope (as shown in Figures 6-8 and 13-14); 2) the modified NK cells are still recognized by other clinically relevant antibodies targeting the same antigen, such as isatuximab (i.e., the modification is specific to only one of the antibodies, in this case daratumumab), as shown in Figures 15-16; and the modified NK cells are functional with respect to degranulation (as a surrogate marker of killing) and IFNγ (as shown in Figures 17-23). However, these criteria are not absolute, and even if the modified NK cells are only slightly recognized by daratumumab, this specific modification is not excluded, and in a competitive environment where cells with high wt / endogenous CD38 expression are preferentially killed (33), the modified NK cells may be preserved, so that the cells with low recognition rates may eventually be preserved in the patient. Moreover, since inactivity against ADCC essentially relies on avoiding antibody (daratumumab) recognition, it is presumed that once the cells are protected from recognition by daratumumab, they will also be inactive against ADCC. Therefore, ADCC does not need to be tested in every situation.

[0335] Modified CD38 molecules with amino acid changes are also able to perform enzymatic functions. This is shown in Figure 24, which shows that CD38KO and CD38KO+TG2 (empty vector control) use less NAD+ as substrate, thus increasing the NAD+ / NADH ratio. On the other hand, CD38 codon-optimized (CD38-CO) and E239F modified CD38 molecules decrease the NAD+ / NADH ratio, confirming the enzymatic function of cells containing modified CD38 molecules. The assay is performed according to the manufacturer's instructions (Abcam, ab65348). One million cells were harvested and washed with PBS, after which NAD+ and NADH were extracted with extraction buffer by two cycles of freeze / thaw (20 min dry ice, 10 min room temperature). Then, after centrifugation, the supernatant was divided into two 1.5 ml Eppendorf tubes. One for NAD total and the other for NADH alone. NADH alone is heated on a heating block at 60°C for 30 minutes and NAD total is left on ice in the dark. After 30 minutes, the samples are transferred to a flat clear 96-well plate (20 μl for NAD total, 30 μl for NADH, up to 50 μl with extraction buffer). Cycling enzymes are then added to the solution to convert the NAD+ of NADH in the NAD total sample, and after a 10-minute incubation, 10 μl of developer is added, followed by covering with aluminum foil and incubation at room temperature for 1 hour and 30 minutes. Analysis was performed at absorbance of 450 nm on a Tecan FT500. The absorbance of the standard at 0 pmol was subtracted from all samples. The standard curve was used to calculate the amount of NADH in the samples in pmol. The amount per well was divided by the volume added to the well to calculate the concentration in pmol / μl. The amount of NAD+ was calculated as follows: NAD+ = sum of NAD - NADH.

[0336] Example 2.1 CD47 and Magrolimab

[0337] CD47 is a target for immunotherapy of solid and hematological malignancies, including MDS and AML. There are over 23 therapeutic agents targeting CD47, including the monoclonal antibody magrolimab, which is currently in 27 clinical trials for various cancers. CD47 is a transmembrane protein that is ubiquitously expressed on human cells and overexpressed on many types of cancer cells, and is critical for cancer development and progression. CD47 protects cells from phagocytosis by binding to SIRPα on macrophages and emitting a "don't-eat-me" signal that inhibits phagocytosis. Many CD47 mAbs not only block CD47 from binding to SIRPα, but also simultaneously induce Fc receptor γ on macrophages, which acts as an "eat-me" signal and thus transmits a strong signal to macrophages to destroy tumor cells via ADCP.

[0338] CD47 cDNA sequence

[0339] Nucleotide sequence(918):cDNA

[0340] [ka]

[0341] Amino acid sequence of CD47. The binding site (epitope) for magrolimab is in bold.

[0342] Translation(305aa):

[0343] [ka]

[0344] Sequence of CD47 containing the substitution Q1F in the maglolimab epitope. The substitution is in bold. The amino acid position is counted from the protein after removal of the leader peptide.

[0345] [ka]

[0346] Sequence of CD47 containing the substitution L2F in the maglolimab epitope. The substitution is in bold. The amino acid position is counted from the protein after removal of the leader peptide.

[0347] [ka]

[0348] Sequence of CD47 containing the substitution L3F in the maglolimab epitope. The substitution is in bold. The amino acid position is counted from the protein after removal of the leader peptide.

[0349] [ka]

[0350] Sequence of CD47 containing the substitution T34F in the maglolimab epitope. The substitution is in bold. The amino acid position is counted from the protein after removal of the leader peptide.

[0351] [ka]

[0352] Sequence of CD47 containing the substitution E35F in the magrolimab epitope. The substitution is in bold. The amino acid position is counted from the protein after removal of the leader peptide.

[0353] [ka]

[0354] Sequence of CD47 containing the substitution V36F in the maglolimab epitope. The substitution is in bold. The amino acid position is counted from the protein after removal of the leader peptide.

[0355] [ka]

[0356] Sequence of CD47 containing the substitution E97F in the magrolimab epitope. The substitution is in bold. The amino acid position is counted from the protein after removal of the leader peptide.

[0357] [ka]

[0358] Sequence of CD47 containing the substitution V98F in the maglolimab epitope. The substitution is in bold. The amino acid position is counted from the protein after removal of the leader peptide.

[0359] [ka]

[0360] Sequence of CD47 containing the substitution T99F in the maglolimab epitope. The substitution is in bold. The amino acid position is counted from the protein after removal of the leader peptide.

[0361] [ka]

[0362] Sequence of CD47 containing the substitution E100F in the magrolimab epitope. The substitution is in bold. The amino acid position is counted from the protein after removal of the leader peptide.

[0363] [ka]

[0364] Sequence of CD47 containing the substitution L101F in the maglolimab epitope. The substitution is in bold. The amino acid position is counted from the protein after removal of the leader peptide.

[0365] [ka]

[0366] Sequence of CD47 containing the substitution T102F in the maglolimab epitope. The substitution is in bold. The amino acid position is counted from the protein after removal of the leader peptide.

[0367] [ka]

[0368] Sequence of CD47 containing the substitution R103F in the maglolimab epitope. The substitution is in bold. The amino acid position is counted from the protein after removal of the leader peptide.

[0369] [ka]

[0370] Sequence of CD47 containing the substitution E104F in the magrolimab epitope. The substitution is in bold. The amino acid position is counted from the protein after removal of the leader peptide.

[0371] [ka]

[0372] Example 2.2: CD52 and Alemtuzumab

[0373] Alemtuzumab is an important antibody for the treatment of relapsing-remitting multiple sclerosis (RRMS) under the trademark Lemtrada. Recently, it has been used as a treatment for chronic lymphocytic leukemia under the trademark CAMPATH-1HH. It is also used to treat T-cell lymphoma, non-Hodgkin's lymphoma, and rheumatoid arthritis. The mechanism of action includes NK cell-mediated ADCC and complement-dependent cytotoxicity (CDC), as well as direct apoptotic effects. The antibody binds to CD52, which is expressed at high levels in lymphomas. However, alemtuzumab is also expressed on cells of the immune system, such as B cells, T cells, NK cells, monocytes, and macrophages. Despite its apparent success, alemtuzumab exhibits considerable toxicity due to the immunosuppression associated with its use, especially the increased risk of viral and other opportunistic infections, likely due to immune cell exhaustion.

[0374] CD52 is a molecule of only 12 amino acids that binds to a glycosylphosphatidylinositol (GPI) anchor in the membrane. The exact biological function of CD52 is so far unknown, but some evidence suggests a function in T cell migration and costimulation. The amino acids important for recognition by alemtuzumab are the C-terminal amino acids (QTSSPS). The protein is heavily glycosylated, but glycosylation does not appear to affect alemtuzumab binding.

[0375] Nucleotide sequence (186 nt): cDNA

[0376] [ka]

[0377] Translation (61aa): (with leader peptide, before post-translational modification)

[0378] [ka]

[0379] 12 peptide final CD52 protein sequences. These are amino acids 25-36 of the peptide without the leader peptide, before post-translational modifications. The alemtuzumab epitope is in bold.

[0380] [ka]

[0381] Sequence of CD52 containing the substitution Q31F in the alemtuzumab epitope. The substitution is in bold. The amino acid position is counted from the protein including the leader peptide, before post-translational modifications.

[0382] [ka]

[0383] Sequence of CD52 containing the substitution T32F in the alemtuzumab epitope. The substitution is in bold. The amino acid position is counted from the protein including the leader peptide, before post-translational modifications.

[0384] [ka]

[0385] Sequence of CD52 containing the substitution S33F in the alemtuzumab epitope. The substitution is in bold. The amino acid position is counted from the protein including the leader peptide, before post-translational modifications.

[0386] [ka]

[0387] Sequence of CD52 containing the substitution S34F in the alemtuzumab epitope. The substitution is in bold. The amino acid position is counted from the protein including the leader peptide, before post-translational modifications.

[0388] [ka]

[0389] Sequence of CD52 containing the substitution P35F in the alemtuzumab epitope. The substitution is in bold. The amino acid position is counted from the protein including the leader peptide, before post-translational modifications.

[0390] [ka]

[0391] Sequence of CD52 containing the substitution S36F in the alemtuzumab epitope. The substitution is in bold. The amino acid position is counted from the protein including the leader peptide, before post-translational modifications.

[0392] [ka]

[0393] Example 3: MM patients receiving daratumumab and autologous expanded GEAR NK cells (CD38-GEAR-NK)

[0394] According to Examples 1-2 and with reference to FIG. 10, a patient is diagnosed with MM. The patient undergoes standard treatment, autologous stem cell transplantation (autologous SCT), in which hematopoietic stem cells are harvested from the blood, either by apheresis or by removing bone marrow from the pelvis (iliac crest) with a special needle. During apheresis, NK cells are also harvested from the blood. After harvesting the hematopoietic stem cells, the patient undergoes high-dose chemotherapy and is then reinfused with the patient's own stem cells. These stem cells are capable of repopulating all blood cell lineages. The harvested NK cells are expanded in a sealed automated in vitro expansion procedure under GMP conditions and genetically modified with one of the constructs identified and described in Example 2 above. Successfully modified NK cells express a CD38 variant with small changes in the amino acid sequence and are therefore no longer recognized by the therapeutic anti-CD38 mAb Daratumumab. The expanded NK cells are tested for activity, quality and sterility and then frozen in a viable state.

[0395] Meanwhile, patients are receiving standard treatment including autologous SCT, as well as treatment with immunomodulatory drugs (IMiDs), proteasome inhibitors (PIs) and potentially mAbs.

[0396] Although the treatment of MM has undergone some pioneering advances in the past decade, MM is still considered an incurable disease, as all patients eventually relapse (34, 35). If relapse occurs, patients proceed to treatment with approved monoclonal therapeutic antibodies or experimental immunotherapies if they are able to participate in ongoing clinical trials. Recently, the mAb daratumumab (Dara) has been introduced as a frontline treatment for newly diagnosed MM patients. This mAb recognizes CD38, which is highly and ubiquitously expressed on MM cells. Dara induces tumor cell death by several mechanisms of action, including binding to Fc receptors on NK cells, which kill target cells via antibody-dependent cellular cytotoxicity (ADCC) (36).

[0397] Another treatment tested in a Phase I / IIa clinical trial completed at Karolinska University Hospital was: The first step is to inject the patient's own ex vivo expanded NK cells (30). NK cells from cancer patients often have altered receptor surface expression profiles and reduced functionality, a phenomenon also observed in MM. However, autologous NK cells expanded under GMP controlled conditions have a normalized expression profile with increased expression of activating receptors and decreased expression of inhibitory receptors (37). Functionality was also shown to be restored when tested in an in vitro responsiveness assay measuring CD107 shedding (37). These NK cells were reinfused into the patients and showed an objective, measurable response to NK cell infusion in terms of a reduction in M ​​components and / or minimal residual disease (MRD), increased overall survival, and a reduction in measurable disease parameters such as M components in plasma (30).

[0398] We propose to combine these two therapies by injecting CD38-GEAR engineered NK cells and daratumumab. In intermittent cycles, patients receive daratumumab and their own expanded and genetically modified (antibody resistant) NK cells. Daratumumab depletes all NK cells with endogenous CD38 through ADCC and activation-induced depletion, while the genetically modified NK cells are not recognized by the Fab region of daratumumab and therefore are not depleted. However, the cells can bind to the Fc region of daratumumab through the Fc receptors CD16a and CD32c and effect ADCC of MM cells opsonized with daratumumab. This allows for sustained activity of daratumumab, which may ultimately lead to a longer clearance time, improved efficacy, and longer daratumumab concentrations required.

[0399] The treatment can be repeated for several cycles depending on the yield of patient-derived autologous expanded NK cells from the initial apheresis.

[0400] The infused autologous NK cells can be detected in the patient's circulation by flow cytometry for up to 4 weeks after the last infusion.

[0401] The efficacy of the treatment can be evaluated by electrophoresis of M components in the plasma of patients with measurable disease (=M components) at the onset of relapse. Furthermore, next generation sequencing (NGS) of minimal residual disease (MRD) can also be performed. Moreover, flow cytometric detection (EuroFlow) of MRD can also be performed. Finally, overall survival (OS) and progression-free survival (PFS) are determined for each patient based on clinical parameters.

[0402] To assess the engraftment, reconstitution and persistence of adoptively transferred, genetically modified and ex vivo expanded autologous NK cells, flow cytometry or PCR can be performed. For flow cytometry, CD38 antibodies and daratumumab can be combined with a standard panel of blood cells (e.g. CD3, CD14, CD19, CD56, Gr-1, etc.) and an extended panel of marker combinations such as Ki67 or HLA-DR (30) specific for ex vivo expanded NK cells. For PCR, primers can be designed to target the specifically modified mutations. Alternatively, universal primers for the engineered CD38 can be designed, since the introduced transgene is codon-optimized (and therefore has a different nt sequence from endogenous CD38, despite only minor changes in the amino acid sequence).

[0403] For this purpose, blood samples will be taken and analyzed before injection, and 1 day, 3 days, 1 week, and 1 month after injection.

[0404] Patients receive antiviral prophylactic treatment (valaciclovir, 500 mg twice daily for 6 months) to avoid varicella-zoster virus reactivation, which has been observed after adoptive transfer of autologous nonmodified NK cells ( 30 ).

[0405] CD38 is also expressed in many other hematological malignancies, including multiple myeloma, leukemias and lymphomas, such as T-cell and B-cell acute lymphocytic leukemia, B-cell chronic lymphocytic leukemia, primary systemic amyloidosis, Waldenstrom's hypergammaglobulinemia, mantle cell lymphoma, prolymphocytic / myeloid leukemia, acute myeloid leukemia, chronic myeloid leukemia, follicular lymphoma, Burkitt's lymphoma, large granular lymphocytic (LGL) leukemia, NK cell leukemia, and plasma cell leukemia. The method of this example can also be applied to other diseases that are treated with antibodies against CD38.

[0406] The modifications of GEAR-38 are specific for daratumumab, see Figures 6 and 13-14. To confirm that the modified CD38 molecules only protect NK cells from recognition by daratumumab and not other CD38-targeting antibodies, binding of isatuximab was tested. Figures 6 and 15-16 show that these modifications are particularly specific for daratumumab, as binding by isatuximab was not inhibited.

[0407] Example 4: GEAR-38 hematopoietic stem cells

[0408] As in Example 3, see Figure 11, but now modify HSCs instead of mature NK cells. The result is that all hematopoietic cells derived from transplantation will be resistant to daratumumab-mediated killing / depletion. For MM patients whose malignant cells are well-differentiated cells, autologous HSCs can be used. For hematopoietic cancers whose malignant cells are a less differentiated cell population, allogeneic HSCs should be used.

[0409] The patient is diagnosed with MM. The patient undergoes standard treatment, autologous stem cell transplantation (autologous SCT), in which hematopoietic stem cells are harvested from the blood, either by apheresis or by removal of bone marrow from the pelvis (iliac crest) with a special needle. During apheresis, HSCs are also harvested from the blood. The HSCs are then genetically modified and quality controlled. These stem cells are capable of repopulating all blood cell lineages. The harvested HSCs are expanded in a sealed automated in vitro expansion procedure under GMP conditions and genetically modified with one of the constructs identified and described in Example 2 above. Successfully modified HS cells express a CD38 variant with small changes in the amino acid sequence and are therefore no longer recognized by the therapeutic anti-CD38 mAb daratumumab. The expanded HS cells are tested for activity, quality, and sterility, and then frozen in a viable state. Once the HSCs are harvested according to standard release criteria, the patient is administered high-dose chemotherapy and then reinfused with the patient's own stem cells.

[0410] We propose to combine two therapies by injecting CD38-GEAR modified HSCs and then treating the patient with daratumumab. The patient is first transplanted with his / her own genetically engineered HSCs, which reconstitute all hematopoietic lineages. In multiple cycles, the patient is then administered daratumumab. While daratumumab depletes all CD38+ cells derived from unmodified HSCs via ADCC, ADCP and activation-induced depletion, genetically modified HSCs and their progeny are not recognized by the Fab region of daratumumab and therefore are not depleted. However, NK cells derived from modified HSCs can bind to the Fc region of daratumumab via Fc receptors CD16a and CD32c and perform ADCC of MM cells opsonized with daratumumab. This allows for sustained activity of daratumumab, which may ultimately increase clearance time, improve efficacy and increase the required concentration of daratumumab. Furthermore, it would expand the population of mature NK cells that could use daratumumab for ADCC-mediated killing of MM cells.

[0411] The infused autologous HSCs and their progeny were analyzed by flow cytometry or PCR. It can be put out.

[0412] The efficacy of the treatment can be evaluated by electrophoresis of M components in the plasma of patients with measurable disease (=M components) at the onset of relapse. Furthermore, next generation sequencing (NGS) of minimal residual disease (MRD) can also be performed. Moreover, flow cytometric detection (EuroFlow) of MRD can also be performed. Finally, overall survival (OS) and progression-free survival (PFS) are determined for each patient based on clinical parameters.

[0413] To assess the engraftment, reconstitution and persistence of adoptively transferred, genetically modified and ex vivo expanded autologous HSCs, flow cytometry or PCR can be performed on BM biopsies (for modified HSCs) or peripheral blood cells (for blood cells derived from modified HSCs). For flow cytometry, CD38 antibodies and daratumumab can be combined with a standard panel of blood cells (CD3, CD14, CD19, CD56, Gr-1, etc.), while for PCR, primers can be designed to target the specifically modified mutation. Alternatively, universal primers for the engineered CD38 can be designed, since the introduced transgene is codon-optimized (and therefore has a different nt sequence from endogenous CD38, despite only minor changes in the amino acid sequence).

[0414] For this reason, blood will be drawn and analyzed before and at multiple time points after injection.

[0415] To avoid reactivation of varicella zoster virus observed after adoptive transfer of autologous non-modified NK cells, patients receive antiviral prophylactic treatment (valacyclovir, 500 mg twice daily for 6 months).

[0416] In addition to the functional studies outlined in Examples 1-3, GEAR-CD38 HSCs need to be further evaluated for their ability to develop into all hematopoietic cell lineages. This will be done by in vitro differentiation and phenotypic analysis of different blood cell lineages, as well as differentiation in humanized mice.

[0417] Example 5: GEAR-38 NK cells derived from patient iPSCs

[0418] In this example, the methods of Examples 1, 2, 3, and 4 are followed, but here induced pluripotent stem cells (iPSCs) are modified and differentiated into mature NK cells (or T cells). iPSCs are used to generate many different cell types with different functions. Several protocols have been developed to derive NK cells from iPSCs. These iPSC-derived NK cells exhibit cytotoxicity, target cell specificity, phenotype, and proliferation capacity comparable to NK cells derived from peripheral blood of healthy donors. Genetic modifications can be introduced during differentiation of iPSCs to HSCs or HSCs to NK cells (38). By using the procedures described in Examples 1, 2, 3, and 4, large quantities of modified NK cells required for clinical use can be generated. In addition to the use of fully mature iPSC-derived NK cells, some precursor stages such as immature NK cells (iNK) may be used as genetically modified clinical products.

[0419] In addition to the functional tests outlined in Examples 1-3, GEAR-CD38 iPSCs should be further evaluated for their ability to develop into functional NK cells. This can be done by the functional assays described above and phenotypic analysis of NK cell surface markers such as CD56, NKp46, DNAM-1, and other surface markers.

[0420] Example 6: GEAR-38 NK cell line

[0421] In this example, the methods of Examples 1, 2, 3, and 4 are followed, but here an NK cell line such as NK-92, KHYG-1 or the like is modified and used as a cell product. Using a cell line as a source of NK cells offers several advantages, such as unlimited proliferation capacity and the possibility to use these cells as an off-the-shelf product. The NK-92 cell line has been used as an unmodified or genetically engineered cell product in many clinical trials, mainly in the context of hematological malignancies, but also in some solid cancers. Other NK cell lines, such as KHYG-1, are also being tested for clinical use. Genetic modification of NK cell lines is feasible, and CD38-GEAR NK-92 cells can be generated using procedures similar to those described in Examples 1, 2, 3, and 4. As most of the currently available NK cell lines lack expression of the Fc receptor CD16, these cells need to be modified to express CD16 for clinical use in antibody therapy. To increase the ADCC capacity of the modified NK cell line product, naturally occurring high affinity mutants and non-cleaved forms of CD16 may be introduced (38).

[0422] Example 7: GEAR-19 hematopoietic stem cells

[0423] Following the process of Examples 1-5 and with reference to FIG. 12, hematopoietic stem cells for bone marrow transplantation are genetically modified so that blood cells arising from the stem cell graft are not recognized by certain mAbs that can be used for therapy. In this way, the cells that comprise the patient's new blood system are resistant to antibody-mediated effects such as antibody-dependent cellular cytotoxicity (ADCC), antibody-dependent complement activation, or antibody-dependent cellular phagocytosis (ADCP). To achieve this goal, one or more specific surface proteins of the cells of the cell product are modified. These proteins are potential targets for subsequent antibody therapy. As an example, consider HSC transplantation and subsequent treatment with CD19-CAR T cells.

[0424] Antibody therapies have become important for the treatment of B-cell malignancies such as acute myeloid leukemia (AML), acute lymphocytic leukemia (ALL), chronic myeloid leukemia (CML), chronic lymphocytic leukemia (CLL), multiple myeloma (MM) and other diseases. These include monoclonal antibodies, antibody-drug conjugates, bi- or trispecific antibodies or CAR cells, where the antibody recognition domain is genetically introduced into T cells or NK cells. Often, these antibodies target antigens not only on malignant cells but also on normal bystander cells, a process referred to as the on-target-off-tumor effect.

[0425] HSC transplantation is the standard treatment for these patients, which prolongs their survival and can sometimes be curative. However, many patients relapse because some cancer cells remain. These patients are treated with a variety of therapies, including chemotherapy, radiation therapy, and more recently immunotherapy.

[0426] In the case of anti-CD19 therapy, such as CD19-CAR T cells, malignant cells expressing high levels of CD19 are targeted and eliminated. However, as long as the CD19-CAR T cells remain in the patient's body, the patient will suffer from B cell aplasia, a complete loss of CD19 positive cells. This can be a lifelong condition, weakening the patient's immune system and making them more susceptible to recurrent infections (39). Therefore, it is not performed in MM patients. Currently approved CAR T therapies are sold under the trade names Abecma® (BCMA, idecabtagene vicleuce), Carbicti® (BCMA, siltacabtagene autolucel), Breyangi® (CD19, lysocabtagene malareucel), Kymriah® (CD19, tisagenlecleuce), Tecartus® (CD19, brexacabtagene autolucel) or Yescarta® (CD19, axicabtagene siloreucel).

[0427] To alleviate this particular drawback of CD19-CAR T cells, HSC grafts are genetically engineered to be resistant to anti-CD19-mediated depletion. This is accomplished by modifying one or more amino acids in the anti-CD19 binding site of CD19, so that the antibody or CAR T cells are unable to recognize CD19 on B cells generated from the genetically engineered HSC graft. For MM patients whose malignant cells are well-differentiated cells, autologous HSCs can be used. For hematopoietic cancers whose malignant cells are a less differentiated cell population, such as CD19+ malignancies, allogeneic HSCs must be used.

[0428] Genetic modifications can be introduced by various techniques, such as knocking out (KO) native CD19 and knocking in (KI) modified CD19, CRISPR (clustered regularly interspaced short palindromic repeats) editing of native CD19 at the desired nucleotides, editing using TALEN (transcription activator-like effector nucleases) or ZFN (zinc finger nucleases). These nucleases can be delivered by electroporation, viral vector gene transfer, piggyback or sleeping beauty delivery systems, engineered or biological nanoparticles, extracellular vesicles or exosomes, and many more techniques.

[0429] The sequence of the editing step may be altered by codon optimising the nucleotide sequence of the modified CD19, ensuring that the newly introduced gene is not targeted by the knockout or editing strategy.

[0430] Figure 12 shows the steps involved in the development and administration of CD19 cells. HSC apheresis is currently the primary method to obtain HSCs for stem cell transplantation. HSCs are mobilized from the bone marrow by treatment with cytokines, mainly G-CSF, and are therefore more abundant in the blood. HSCs are quality controlled and cryopreserved in liquid nitrogen or used directly for transplantation. Moreover, HSCs can be assessed for CFU-GM, which is currently the most reliable functional indicator.

[0431] Particularly for haploidentical transplants, some transplant centers prefer to harvest HSCs from bone marrow rather than apheresis, as the risk of severe GvHD appears to be lower, which is essential for children and patients with aplastic anemia.

[0432] Genetic modification can be performed immediately after harvesting the HSCs. It can either be done very early in the procedure to avoid long graft culture times, or later to specifically target CD19+ B cells and their progenitors. Modification of the CD19 antigen includes all changes of one or more amino acids that alter the recognition and binding of CAR-CD19. These are predicted to be present in the epitope of the anti-CD19 antibody used to generate the ScFv of the CAR construct. This substitution, if any, is from a natural amino acid to one with different physicochemical properties, e.g., different charge or structure, both of which may abolish / impair binding to the CAR.

[0433] Once these substitutions are introduced into the HSCs, they are assessed for binding to CAR-19 cells and other CD19 antibodies. Furthermore, functionality is assessed by differentiating the HSCs into cells of the hematopoietic lineage to confirm that the modified cells can grow into all lineages. Furthermore, the differentiated B cells need to be evaluated in terms of differentiation, BCR rearrangement, and antibody production. The cells are grown under standard growth conditions and evaluated for quality and release criteria similar to the unmodified cell product.

[0434] Using the same procedures, the CD19-GEAR HSC product can then be administered to the patient, with follow-up criteria as with any HSC graft.

[0435] Following the teachings of Example 1, appropriate substitutions to eliminate or reduce CD19-scFv epitopes and antibody binding within the CD19 gene are identified. Once it is determined what needs to be modified in the CD19 gene, a strategy is developed to replace or edit the CD19 gene, either by knock-out-knock-in or targeted editing strategies.

[0436] In the knockout-knockin approach, the CD19 gene is disrupted using CRISPR, ZFN, or TALEN. The sequence encoding the modified CD19 can then be introduced by electroporation, viral vector gene transfer, piggyback or sleeping beauty delivery systems, engineered or biological nanoparticles, extracellular vesicles, and many more techniques.

[0437] In the CRISPR editing strategy, gRNAs are designed to target Cas9 towards the DNA sequence of the CD19 gene that encodes the CD19-CAR binding epitope. These gRNAs are tested for B cell targeting efficiency (used to create CD19-ko). Homologous directed repair (HDR) templates are designed for gRNAs that display Cas9 cleavage activity to perform editing of several amino acids adjacent to the induced double-stranded break in HSCs. The resulting cells are tested using functional assays, i.e., CD19 antibody binding, CD19-CAR T / NK cells, proliferation, potential to create all hematopoietic lineages with functional capacity, mainly B cell growth, etc.

[0438] We evaluate the use of base editors (mutated Cas9 variants) that, in theory, can induce j-editing without generating double-strand breaks.

[0439] The engineered cells are expanded as required for therapy, with appropriate quality controls ensuring sterility, phenotype and overall safety of the cells in situ.

[0440] Example 8: All patients receiving CD19-CAR T cells and allogeneic GEAR hematopoietic stem cells (CD19-GEAR-HSC)

[0441] The patient is diagnosed with ALL. The patient undergoes standard treatment, allogeneic stem cell transplantation (SCT), in which hematopoietic stem cells are harvested from the blood of a relative or unrelated donor, either by apheresis or by removing bone marrow from the pelvis (iliac crest) with a special needle. After harvesting the hematopoietic stem cells, these cells are genetically modified with the constructs outlined in Examples 4 and 7. Successfully modified HSCs contain a CD19 gene with a variant that has a small change in the amino acid sequence, so that they are no longer recognized by therapeutic antibodies and the single-chain variable fragment (scFv) of CD19-CAR-T or CD19-CAR-NK cells. The quality of the modified HSCs is tested and then reinfused into the patient after the patient has received high-dose chemotherapy. These stem cells are capable of repopulating all blood cell lineages.

[0442] In case of relapse, the patient may be eligible for treatment with autologous CD19-CAR-T cells or autologous or pre-made CD19-CAR-NK cells (derived from allogeneic HSC grafts). Currently approved CD19-CAR-T cells are sold under the trade names Abecma® (BCMA, idecabtagene vicleuce), Carbicti® (BCMA, siltacabtagene autolucel), Breyangi® (CD19, lysocabtagene malareucel), Kymriah® (CD19, tisagenlecleucel), Tecartus® (CD19, brexacabtagene autolucel) or Yescarta® (CD19, axicabtagene siloleucel). These cells are marketed under the trade names Abecma® (BCMA, idecabtagene vicleuce), Carbicti® (BCMA, siltacabtagene autolucel), Breyangi® (CD19, lysocabtagene malareucel), Kymriah® (CD19, tisagenlecleucel), Tecartus® (CD19, brexacabtagene autolucel) or Yescarta® (CD19, axicabtagene siloleucel). CAR consisting of mAb scFv, transmembrane domain, and intracellular signaling domain GEAR-HSCs are transduced to express CD19, which upon recognition of the CD19 antigen initiates the killing of antigen-expressing cells. However, normal cells derived from the patient's modified GEAR-HSCs are resistant because they contain a CD19 variant that is not recognized by the CD19-CAR cells. This results in a situation where malignant CD19+ ALL cells are efficiently killed by the CD19-CAR cells while normal cells remain. This patient may be less susceptible to the long-term side effects of CD19-CAR cell therapy, such as recurrent infections due to the total loss of antibody-producing cells (39).

[0443] Example 9: GEAR-19 / 38 hematopoietic stem cells

[0444] According to Examples 1-8, HSCs for bone marrow transplantation are genetically modified so that blood cells arising from the stem cell graft are not recognized by specific mAbs that can be used for therapy. In this way, the cells that comprise the patient's new blood system are resistant to antibody-mediated effects such as antibody-dependent cellular cytotoxicity (ADCC), antibody-dependent complement activation, or antibody-dependent cellular phagocytosis (ADCP). To achieve this goal, one or more specific surface proteins of the cells of the cell product are modified. These proteins are potential targets for subsequent antibody therapy. As an example, consider HSC transplantation and subsequent treatment with CD19-CAR T cells and CD38-targeting antibodies such as daratumumab.

[0445] HSC transplantation is the standard of care for these patients, which can prolong survival and in some cases be curative. However, many patients relapse because some cancer cells remain. These patients are treated with a variety of treatments, including chemotherapy, radiation therapy, and more recently immunotherapy. Recently, CD19-CAR T cells have been approved for relapsed / refractory (R / R) diffuse large B-cell lymphoma (DLBCL) in adults and R / R acute lymphoblastic leukemia (ALL) in children and young adults, large B-cell lymphoma or follicular lymphoma, high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, R / R mantle cell lymphoma, and R / R ALL in adults. We can expect these cell products to be approved for many more indications soon. Additionally, CAR cells with specificities different from CD19, such as BCMA and CD38, are currently being tested and may be approved soon.

[0446] In the case of anti-CD19 therapies, such as CD19-CAR T cells, malignant cells expressing high levels of CD19 are targeted and eliminated. However, as long as the CD19-CAR T cells remain in the patient's body, the patient will suffer from B cell aplasia, a complete loss of CD19 positive cells, which can be a lifelong condition that weakens the patient's immune system and makes them more susceptible to recurrent infections (39).

[0447] We propose to combine the two therapies by infusing CD19 / 38-GEAR engineered HSCs and then sequentially treating patients with daratumumab and CD19-CAR T cells. Patients are first transplanted with their own genetically engineered HSCs, which reconstitute all hematopoietic lineages.

[0448] The patient is then administered daratumumab in multiple cycles. While daratumumab depletes all CD38+ cells derived from unmodified HSCs via ADCC, ADCP and activation-induced depletion, genetically modified HSCs and their progeny are not recognized by the Fab region of daratumumab and therefore are not depleted. However, NK cells derived from modified HSCs can bind to the Fc region of daratumumab via Fc receptors CD16a and CD32c and perform ADCC of MM cells opsonized with daratumumab. This may result in sustained activity of daratumumab, which ultimately increases the time of clearance, improves efficacy and increases the required concentration of daratumumab. Furthermore, This results in an expanded population of mature NK cells that can use daratumumab for ADCC-mediated killing of MM cells.

[0449] If the patient relapses or becomes resistant to daratumumab treatment, one may consider treating this patient with CD19-CAR T cells. Hematopoietic cells derived from the modified stem cell graft are resistant to CD19-CAR T cell-mediated elimination, thus preventing B-cell aplasia. Malignant MMB cells do not originate from the modified graft and are therefore effectively killed by CD19-CAR T cells.

[0450] For MM patients where the malignant cells are well-differentiated cells, autologous HSCs can be used. For hematopoietic cancers where the malignant cells are a less differentiated cell population, such as CD19+ malignancies, allogeneic HSCs should be used.

[0451] Collection of HSCs, introduction of genetic modifications, and functional and sterility tests are performed as in Examples 1-8.

[0452] Example 10: Patients with non-Hodgkin's lymphoma receiving anti-CD20 mAb (rituximab) and allogeneic GEAR hematopoietic stem cells (CD20-GEAR-HSC)

[0453] According to the methods of Examples 1-4 and 7-9, HSCs can be engineered to be resistant to anti-CD20 antibodies. Rituximab is a currently approved therapeutic antibody. The package insert for Rituximab is incorporated herein in its entirety. HSC grafts can be engineered to differentiate into cells, particularly B cells, that are resistant to recognition by anti-CD20 mAbs such as Rituximab. The generation of this CD20-GEAR HSC product is similar to the CD19-GEAR HSC product of Examples 7-9.

[0454] Apart from rituximab, many other CD20-specific antibodies have been approved as therapeutic agents, examples being ocrelizumab, veltuzumab, obinutuzumab, ofatumumab and many more.

[0455] Modifications of the CD20 antigen include any change in one or more amino acids that alter the recognition and binding of an anti-CD20 mAb, such as rituximab, that are predicted to be in the epitope of the anti-CD20 antibody. If present, the substitutions are from the natural amino acid to one with different physicochemical properties, e.g., different charge or structure, both of which may abolish / impair binding to the mAb.

[0456] Following the teachings of Example 1, identify CD20 antibody epitopes within the CD20 gene and appropriate substitutions to eliminate or reduce antibody binding. Once it is determined what needs to be altered in the CD20 gene, develop a strategy to replace or edit the CD20 gene, either by knock-out-knock-in or targeted editing strategies.

[0457] In the knockout-knockin approach, the CD20 gene is disrupted using CRISPR, ZFN, or TALEN. The modified CD20 coding sequence can then be introduced by electroporation, viral vector gene transfer, piggyback or sleeping beauty delivery systems, engineered or biological nanoparticles, extracellular vesicles, and many more techniques.

[0458] In the CRISPR editing strategy, gRNAs are designed to target Cas9 towards the DNA sequence of the CD20 gene that encodes the CD19-CAR binding epitope. These gRNAs are tested for B cell targeting efficiency (used to create CD20-ko). Homologous recombination repair ( HDR) templates are designed for gRNAs that exhibit Cas9 cleavage activity to perform editing of several amino acids adjacent to the induced double-stranded break in HSCs. The resulting cells are tested using functional assays, i.e., CD20 antibody binding, CD20-CAR T / NK cells, proliferation, potential to generate all hematopoietic lineages with functional competence, primarily B cell growth, etc.

[0459] We will evaluate the use of base editors (mutated Cas9 variants) that, in theory, can induce editing without creating double-strand breaks.

[0460] The engineered cells are expanded as required for therapy, with appropriate quality controls ensuring sterility, phenotype and overall safety of the cells in situ.

[0461] The patient is diagnosed with non-Hodgkin's lymphoma. The patient undergoes standard treatment, allogeneic stem cell transplantation (SCT), in which hematopoietic stem cells (HSCs) are harvested from the blood, either by apheresis or by removing bone marrow from the pelvis (iliac crest) with a special needle. After harvesting the hematopoietic stem cells, these cells are genetically modified with one of the constructs identified and described in this invention. Successfully modified HSCs contain a CD20 gene with a variant that has a small change in the amino acid sequence, so that they are no longer recognized by therapeutic antibodies such as rituximab, ocrelizumab, ofatumumab, and obinutuzumab. The quality of the modified HSCs is tested and then reinfused into the patient after the patient has received high-dose chemotherapy. These stem cells are capable of repopulating all blood cell lineages.

[0462] In the event of relapse, the patient may be eligible for treatment with a therapeutic antibody that targets CD20+ cells. Doctors have determined that the treatment of choice is rituximab. This antibody treatment eradicates the malignant cells, but also depletes all cells expressing the endogenous CD20 antigen. However, normal cells derived from the patient's modified GEAR-HSCs are resistant because they contain a CD20 variant that is not recognized by rituximab. This results in a situation where the malignant CD20+ cells are efficiently eradicated while normal cells remain. The patient may be less susceptible to the long-term side effects of rituximab therapy, such as recurrent infections due to the loss of all antibody-producing cells.

[0463] Example 11: Acute myeloid lymphoma patients receiving anti-CD117 (anti-cKIT) mAb (KITMAB) or anti-cKIT-ADC (LOP628) and allogeneic GEAR hematopoietic stem cells (CD117-GEAR-HSC)

[0464] Following the methods of Examples 1-4 and 7-9, HSCs can be engineered to be resistant to anti-CD117 (cKIT) antibodies. LOP628 is a therapeutic antibody currently under investigation for gastrointestinal stromal tumors (GIST), small cell lung cancer (SCLC), non-small cell lung cancer (NSCLC), melanoma, and acute myeloid leukemia (AML). HSC grafts can be engineered to differentiate into hematopoietic cells resistant to recognition by anti-CD117 mAbs such as LOP628, KITMAB, and the like. The generation of this CD117-GEAR HSC product is similar to the CD19-GEAR HSC product of Examples 7-9.

[0465] Apart from LOP628, KITMAB, many other CD117-specific antibodies are currently being tested for treatment. The biggest obstacle to gain approval is that these antibodies not only bind to malignant cells, but also to all developing hematopoietic cells that express the antigen at several cellular stages. The present invention may greatly improve the development of clinical products.

[0466] Modifications of the CD117 antigen include any change in one or more amino acids that alters the recognition and binding of anti-CD117 mAbs. This substitution, if present, would be from a natural amino acid to one with different physicochemical properties, e.g., different charge or structure, both of which could abolish / impair binding to the mAb.

[0467] Following the teachings of Example 1, identify the CD117 antibody epitope in the CD117 gene and appropriate substitutions to eliminate or reduce antibody binding. Once it is determined what needs to be modified in the CD117 gene, develop a strategy to replace or edit the CD117 gene, either by knock-out-knock-in or targeted editing strategies.

[0468] In the knockout-knockin approach, the CD117 gene is disrupted using CRISPR, ZFN, or TALEN. The sequence encoding the modified CD117 can then be introduced by electroporation, viral vector gene transfer, piggyback or sleeping beauty delivery systems, engineered or biological nanoparticles, extracellular vesicles, and many more techniques.

[0469] In the CRISPR editing strategy, gRNAs are designed to target Cas9 towards the DNA sequence of the CD117 gene that encodes the CD117 binding epitope. These gRNAs are tested for B cell targeting efficiency (used to create CD117-ko). Homologous recombination repair (HDR) templates are designed for gRNAs that display Cas9 cleavage activity to perform editing of several amino acids adjacent to the induced double strand break in HSCs. The resulting cells are tested using functional assays, i.e. binding of CD117 antibodies, CD117-ADC, CD117-bispecific antibodies, and KITMAB is currently being tested against imatinib-resistant GIST. CD117-CAR T / NK cells, proliferation, potential to create all hematopoietic lineages with functional capacity, mainly B cell growth.

[0470] We will evaluate the use of base editors (mutated Cas9 variants) that, in theory, can induce editing without creating double-strand breaks.

[0471] The engineered cells are expanded as required for therapy, with appropriate quality controls ensuring sterility, phenotype and overall safety of the cells in situ.

[0472] The patient is diagnosed with AML. The patient undergoes standard treatment, allogeneic stem cell transplantation (SCT), in which hematopoietic stem cells are harvested from the blood, either by apheresis or by removing bone marrow from the pelvis (iliac crest) with a special needle. After harvesting the hematopoietic stem cells, these cells are genetically modified with one of the constructs identified and described in this invention. Successfully modified HSCs contain a CD117 gene with a variant that has a small change in the amino acid sequence, so that they are no longer recognized by therapeutic antibodies. The quality of the modified HSCs is tested and then reinfused into the patient after the patient has received high-dose chemotherapy. These stem cells are capable of repopulating all blood cell lineages.

[0473] In case of relapse, the patient may be eligible for treatment with a therapeutic antibody that targets CD117+ cells. Physicians have determined that the optimal treatment is an anti-CD117 antibody. This antibody treatment eradicates the malignant cells, but also depletes all cells expressing the endogenous CD117 antigen. However, normal cells derived from the patient's modified GEAR-HSCs are resistant because they contain a CD117 variant that is not recognized by the antibody. This results in a situation where the malignant CD117+ cells are efficiently eradicated while normal cells remain. The patient may be less susceptible to the long-term side effects of CD117 antibody therapy, such as recurrent infections due to the loss of hematopoietic cells.

[0474] Example 12: Anti-CD34 BiTE and allogeneic GEAR hematopoietic stem cells (CD34-GEAR -HSC) in patients with acute myeloid lymphoma

[0475] HSCs resistant to anti-CD34 antibodies or anti-CD34 bispecific T cell engagers (BiTEs) can be engineered according to the methods of Examples 1-4 and 7-9. Recently, a novel anti-CD34 BiTE for depletion of AML and leukemia stem cells was described (40).

[0476] This BiTE can be administered in addition to a non-myeloablative conditioning regimen to kill / deplete remaining leukemic stem cells. The patient is then infused with a stem cell graft, which also expresses CD34, meaning that the BiTE can no longer be used, otherwise new HSCs would also be depleted. If CD34-GEAR-HSCs are instead infused as the graft, the new GEAR-HSCs will be resistant to the CD34 targeting of the BiTE, allowing for longer and multiple uses of the BiTE.

[0477] Modifications of the CD34 antigen include all changes of one or more amino acids that alter the recognition and binding of an anti-CD34 mAb, which are predicted to be present in the epitope of the anti-CD34 antibody used to generate the CD34-BiTE. The substitutions, if any, are from the natural amino acid to one with different physicochemical properties, e.g., different charge or structure, both of which may abolish / impair binding to the mAb.

[0478] Identify appropriate substitutions to eliminate or reduce CD34 antibody epitopes and BiTE binding within the CD34 gene following the teachings of Example 1. Once it is determined what needs to be altered in the CD34 gene, develop a strategy to replace or edit the CD34 gene, either by knock-out-knock-in or targeted editing strategies.

[0479] In the knockout-knockin approach, the CD34 gene is disrupted using CRISPR, ZFN, or TALEN. The modified CD34 coding sequence can then be introduced by electroporation, viral vector gene transfer, piggyback or sleeping beauty delivery systems, engineered or biological nanoparticles, extracellular vesicles, and many more techniques.

[0480] In the CRISPR editing strategy, gRNAs are designed to target Cas9 towards the DNA sequence of the CD34 gene that encodes the CD34 binding epitope. These gRNAs are tested for B cell targeting efficiency (used to generate CD34-ko). Homologous directed repair (HDR) templates are designed for gRNAs that display Cas9 cleavage activity to perform editing of a few amino acids adjacent to the induced double strand break in HSCs. The resulting cells are tested using functional assays, i.e. binding of CD34 antibodies, CD34-ADC, CD34-bispecific antibodies. CD34-CAR T / NK cells, proliferation, potential to generate all hematopoietic lineages with functional capacity.

[0481] We will evaluate the use of base editors (mutated Cas9 variants) that, in theory, can induce editing without creating double-strand breaks.

[0482] The engineered cells are expanded as required for therapy, with appropriate quality controls ensuring sterility, phenotype and overall safety of the cells in situ.

[0483] The patient is diagnosed with AML. The patient undergoes standard treatment, allogeneic stem cell transplantation (SCT), in which hematopoietic stem cells are harvested from the blood, either by apheresis or by removing bone marrow from the pelvis (iliac crest) with a special needle. After harvesting the hematopoietic stem cells, these cells are genetically modified with one of the constructs identified and described in this invention. Successfully modified HSCs contain a variant of the CD34 gene with a small change in the amino acid sequence. The modified HSCs are then tested for quality and subsequently reinfused into the patient after the patient has undergone high-dose chemotherapy. These stem cells are capable of repopulating all blood cell lineages.

[0484] In the event of relapse, the patient may be eligible for treatment with a therapeutic antibody that targets CD34+ cells. Physicians have determined that the treatment of choice is an anti-CD34 antibody. This antibody treatment eradicates the malignant cells, but also depletes all cells expressing the endogenous CD34 antigen. However, normal cells derived from the patient's modified GEAR-HSCs are resistant because they contain a CD34 variant that is not recognized by the antibody. This results in a situation where the malignant CD34+ cells are efficiently eradicated while normal cells remain. The patient may be less susceptible to the long-term side effects of CD34 antibody therapy, such as recurrent infections due to the loss of hematopoietic cells.

[0485] Example 13: T1D patients receiving islet transplants of autologous or allogeneic GEAR islet cells (GEAR-autoislets / alloislets)

[0486] Following the teachings of Example 1, epitope binding regions of islet cell antibodies (ICA, directed against a cytoplasmic protein of beta cells), antibodies against glutamic acid decarboxylase (GAD-65), insulin autoantibodies (IAA), and IA-2A against protein tyrosine phosphatase are identified [2].

[0487] Identify the binding epitope(s) involved in the corresponding antibody and appropriate substitutions to eliminate or reduce antibody binding.

[0488] Once it has been determined what needs to be modified in the relevant gene, the teachings of Example 1 are used to develop a strategy to either replace or edit that gene.

[0489] The expanded cells, after appropriate quality control, are administered to a patient in need thereof. The cells may be administered once or multiple times.

[0490] During treatment, the patient may be tested to determine the presence or absence of engineered cells, and dosage may be adjusted based on the test results.

[0491] Example 14: Treatment of colorectal cancer with celalizumab (anti-CD28 agonist antibody, CD28-SuperMAB) and autologous GEAR hematopoietic stem cells (CD28-GEAR-HSC)

[0492] Following the methods of Example 1, antibody-resistant cell types can be engineered where previous trials have failed due to severe side effects caused by on-target off-tumor activity.

[0493] One such failed antibody is the anti-CD28 antibody ceralizumab (TGN1412). TGN1412 is a humanized IgG4 agonist anti-CD28 monoclonal antibody designed to stimulate T cells by activating CD28 signaling without the need for prior activation of the T cell antigen receptor. It was originally intended for the treatment of B-cell chronic lymphocytic leukemia (B-CLL) and rheumatoid arthritis. It caused severe inflammatory responses and chronic organ failure in the first and only human trial in 2006. Phase I and II clinical trials have been completed in arthritis, and clinical trials are ongoing in cancer. The antibody binds to and agonizes CD28, a costimulatory molecule expressed by T cells, NK cells, and eosinophil granulocytes. These cells can release many proinflammatory cytokines when activated by TGN1412, which is responsible for the adverse events observed. It is thought that.

[0494] According to the method of Example 1, HSCs resistant to anti-CD28 antibodies can be engineered.

[0495] The preparation of this CD28GEAR HSC product is similar to that of the CD19GEAR HSC product in Examples 7-9.

[0496] Modifications of the CD28 antigen include any change in one or more amino acids that alter the recognition and binding of an anti-CD28 mAb, such as celalizumab, that are predicted to be in the epitope of the anti-CD28 antibody. If present, the substitutions are from the natural amino acid to one with different physicochemical properties, e.g., different charge or structure, both of which may abolish / impair binding to the mAb.

[0497] Following the teachings of Example 1, identification of the CD28-scFv epitope within the CD28 gene and appropriate substitutions to eliminate or reduce antibody binding is required.

[0498] Once it is determined what needs to be modified in the CD28 gene, a strategy is developed to either replace or edit the CD28 gene.

[0499] The resulting cells are tested in functional assays relevant to the particular clinical application, ie, cytotoxicity and cytokine production, proliferation, consumption, coping with metabolic stress, etc.

[0500] The engineered cells are expanded as required for therapy, with appropriate quality controls ensuring sterility, phenotype and overall safety of the cells in situ.

[0501] The expanded cells, after appropriate quality control, are administered to a patient in need thereof, and any therapeutic antibody administered at any time thereafter does not affect the hematopoietic cells generated from the modified HSCs.

[0502] During treatment, the patient may be tested to determine the presence or absence of engineered cells, and dosage may be adjusted based on the test results.

[0503] The patient receives a transplant of the edited HSCs. In the event of relapse, the patient can be treated with selalizumab, since all hematopoietic cells, including memory T cells, will express an edited version of CD28 that is not recognized by the mAb. At the same time, the patient receives the other half of the frozen HSCs that were left unedited and can be activated by the agonist mAb selalizumab.

[0504] Example 15: IL-2 and CD25 and Treg

[0505] According to the methods of Examples 1, 2 and 3, cells can be engineered to be resistant to IL-2, Tregs, SLAMF7, CD19, CD20, CD22, CD25, CD28, CD30, CD33, CD47, CD52, CD117 and / or PDGFRA.

[0506] Example 16: Cell replacement

[0507] Using the methods of the present invention, any unwanted cell population can be removed and replaced with engineered cells that are resistant to antibodies.

[0508] Example 17: Tissue replacement

[0509] Using the methods of the present invention, one can remove any unwanted tissue and treat to engineer engineered cells that are resistant to antibodies.

[0510] One of skill in the art will appreciate that the invention described herein can be used to engineer cells that are resistant to any therapeutic antibody, and such cells can be used therapeutically to aid in the treatment of patients undergoing treatment with that therapeutic antibody.

[0511] References 1. H. Nahi et al., Incidence, characteristics, and outcome of solitary plasmacytoma and plasma cell leukemia. Population-based data from the Swedish Myeloma Register. Eur J Haematol 99, 216-222 (2017). 2. M. V. Mateos, J. F. San Miguel, Management of multiple myeloma in the newly diagnosed patient. Hematology Am Soc Hematol Educ Program 2017, 498-507 (2017). 3. S. K. Kumar et al., Continued improvement in survival in multiple myeloma: changes in early mortality and outcomes in older patients. Leukemia 28, 1122-1128 (2014). 4. H. M. Lokhorst et al., Targeting CD38 with Daratumumab Monotherapy in Multiple Myeloma. N Engl J Med 373, 1207-1219 (2015). 5. T. Plesner, J. Krejcik, Daratumumab for the Treatment of Multiple Myeloma. Front Immunol 9, 1228 (2018). 6. M. Attal et al., Isatuximab plus pomalidomide and low-dose dexamethasone versus pomalidomide and low-dose dexamethasone in patients with relapsed and refractory multiple myeloma (ICARIA-MM): a randomised, multicentre, open-label, phase 3 study. Lancet 394, 2096-2107 (2019). 7. J. Mikhael et al., A dose-finding Phase 2 study of single agent isatuximab (anti-CD38 mAb) in relapsed / refractory multiple myeloma. Leukemia 34, 3298-3309 (2020). 8. S. Ibrahim et al., CD38 expression as an important prognostic factor in B-cell chronic lymphocytic leukemia. Blood 98, 181-186 (2001). 9. A. Funaro et al., Involvement of the multilineage CD38 molecule in a unique pathway of cell activation and proliferation. J Immunol 145, 2390-2396 (1990). 10. F. Bonello et al., CD38 as an immunotherapeutic target in multiple myeloma. Expert Opin Biol Ther 18, 1209-1221 (2018). 11. M. Naeimi Kararoudi et al., CD38 deletion of human primary NK cells eliminates daratumumab-induced fratricide and boosts their effector activity. Blood 136, 2416-2427 (2020). 12. K. V. Woan et al., Harnessing features of adaptive NK cells to generate iPSC-derived NK cells for enhanced immunotherapy. Cell Stem Cell, (2021). 13. D. Viola et al., Daratumumab induces mechanisms of immune activation through CD38+ NK cell targeting. Leukemia, (2020). 14. S. Y. Rah, J. Y. Kwak, Y. J. Chung, U. H. Kim, ADP-ribose / TRPM2-mediated Ca2+ signaling is essential for cytolytic degranulation and antitumor activity of natural killer cells. Sci Rep 5, 9482 (2015). 15. G. Sconocchia et al., CD38 triggers cytotoxic responses in activated human natural killer cells. Blood 94, 3864-3871 (1999). 16. T. Lischke et al., CD38 controls the innate immune response against Listeria monocytogenes. Infect Immun 81, 4091-4099 (2013). 17. R. Mallone et al., Signaling through CD38 induces NK cell activation. Int Immunol 13, 397-409 (2001). 18. S. Deaglio et al., Human CD38 and CD16 are functionally dependent and physically associated in natural killer cells. Blood 99, 2490-2498 (2002). 19. E. Glaria, A. F. Valledor, Roles of CD38 in the Immune Response to Infection. Cells 9, (2020). 20. Q. Liu et al., Crystal structure of human CD38 extracellular domain. Structure 13, 1331-1339 (2005). 21. H. Nahi et al., Infectious complications and NK cell depletion following daratumumab treatment of Multiple Myeloma. PloS one 14, e0211927 (2019). 22. T. Casneuf et al., Effects of daratumumab on natural killer cells and impact on clinical outcomes in relapsed or refractory multiple myeloma. Blood Adv 1, 2105-2114 (2017). 23. J. S. Miller et al., Successful adoptive transfer and in vivo expansion of human haploidentical NK cells in patients with cancer. Blood 105, 3051-3057 (2005). 24. M. C. Hareth Nahi, Stephan Meinke, Charlotte Gran, Nicole Marquardt, Garniel Afram, Tolga Sutlu, Mari Gilljam, Birgitta Stellan, Arnika K. Wagner, Pontus Blomberg, Per-Henrik Holmqvist, Lillian Walther-Jallow, Karin Mellstrom, Johan Liwing, Charlotte Gustafsson, Robert Mansson, Emma Watz, Monika Klimkowska, Gosta Gahrton, Johan Lund, Per Ljungman, Hans-Gustaf Ljunggren, Evren Alici, Autologous Activated and Expanded NK Cells as Consolidation Therapy Following Autologous Stem Cell Transplantation in Multiple Myeloma. Cell Reports Medicine accepted january 2022, (2022). 25. A. T. Bjorklund et al., Complete Remission with Reduction of High-Risk Clones following Haploidentical NK-Cell Therapy against MDS and AML. Clin Cancer Res 24, 1834-1844 (2018). 26. C. J. Denman et al., Membrane-bound IL-21 promotes sustained ex vivo proliferation of human natural killer cells. PloS one 7, e30264 (2012). 27. E. Liu et al., Use of CAR-Transduced Natural Killer Cells in CD19-Positive Lymphoid Tumors. N Engl J Med 382, 545-553 (2020). 28. R. Romee et al., Cytokine-induced memory-like natural killer cells exhibit enhanced responses against myeloid leukemia. Sci Transl Med 8, 357ra123 (2016). 29. F. Cichocki et al., iPSC-derived NK cells maintain high cytotoxicity and enhance in vivo tumor control in concert with T cells and anti-PD-1 therapy. Sci Transl Med 12, (2020). 30. H. Nahi et al., Autologous NK cells as consolidation therapy following stem cell transplantation in multiple myeloma. Cell Rep Med 3, 100508 (2022). 31. G. Alter, J. M. Malenfant, M. Altfel d, CD107a as a functional marker for the identification of natural killer cell activity. J Immunol Methods 294, 15-22 (2004). 32. Y. T. Bryceson et al., Functional analysis of human NK cells by flow cytometry. Methods Mol Biol 612, 335-352 (2010). 33. S. Sarkar et al., The CD38(low) natural killer cell line KHYG1 transiently expressing CD16(F158V) in combination with daratumumab targets multiple myeloma cells with minimal effector NK cell fratricide. Cancer immunology, immunotherapy : CII 69, 421-434 (2020). 34. S. K. Kumar et al., Natural history of relapsed myeloma, refractory to immunomodulatory drugs and proteasome inhibitors: a multicenter IMWG study. Leukemia 31, 2443-2448 (2017). 35. J. Laubach et al., Management of relapsed multiple myeloma: recommendations of the International Myeloma Working Group. Leukemia 30, 1005-1017 (2016). 36. N. van de Donk, S. Z. Usmani, CD38 Antibodies in Multiple Myeloma: Mechanisms of Action and Modes of Resistance. Front Immunol 9, 2134 (2018). 37. E. Alici et al., Autologous antitumor activity by NK cells expanded from myeloma patients using GMP-compliant components. Blood 111, 3155-3162 (2008). 38. H. Zhu et al., Pluripotent stem cell-derived NK cells with high-affinity noncleavable CD16a mediate improved antitumor activity. Blood 135, 399-410 (2020). 39. S. L. Maude et al., Chimeric antigen receptor T cells for sustained remissions in leukemia. N Engl J Med 371, 1507-1517 (2014). 40. L. C. M. Arruda et al., A novel CD34-specific T-cell engager efficiently depletes acute myeloid leukemia and leukemic stem cells in vitro and in vivo. Haematologica, (2022).

Claims

1. A cell containing a wild-type protein that is wild-type except for having at least one mutation in the binding site of a therapeutic agent, wherein the at least one mutation is configured to inhibit the specific binding of the therapeutic agent to the protein while maintaining the physiological function of the wild-type protein.

2. The cell according to claim 1, wherein the therapeutic agent is a therapeutic antibody.

3. The cell according to claim 1, wherein the at least one mutation is at least one amino acid substitution for a naturally occurring amino acid at the binding site.

4. The cell according to claim 1, wherein the cell is a primate cell, preferably a human cell, and more preferably a primary human cell.

5. The cell according to claim 1, wherein the cell is selected from immune cells (e.g., plasma cells, B cells, macrophages, NK cells, dendritic cells, neutrophils, monocytes, T cells), stem cells (e.g., hematopoietic stem cells, induced pluripotent stem cells), or somatic cells.

6. The cells according to any one of claims 1 to 5, wherein the cells are homogeneous and / or otherwise configured for adoption therapy in a subject, preferably a human subject.

7. The cell according to any one of claims 1 to 5, wherein the therapeutic agent binding site is located on a protein expressed on the surface of the cell, and the protein is selected from CD38, SLAMF7, CD19, CD20, CD22, CD25, CD28, CD30, CD33, CD47, CD52, or PDGFRA.

8. The following (a) to (d): (a) The therapeutic agent binding site is located on CD38, the therapeutic agent is an antibody, and the antibody is daratumumab, isatuximab, or TAK-079; (b) The therapeutic agent binding site is located in SLAMF7, the therapeutic agent is an antibody, and the antibody is elotuzumab; (c) The therapeutic agent binding site is located on CD19, and the therapeutic agent is Abecma, Bleucothoe. These are CD19-CAR-T cells or NK cells such as Yangzi, Kymriah, Tecartus, or Yescarta; (d) The therapeutic agent binding site is located on CD52, the therapeutic agent is an antibody, and the antibody is alemtuzumab or ANT1034. A cell according to claim 7, selected from any of the following.

9. (i) A cell comprising a wild-type protein which is wild-type except having at least one mutation in the binding site of a therapeutic agent, wherein the at least one mutation is configured to maintain the physiological function of the wild-type protein while inhibiting the specific binding of the therapeutic agent to the protein, and (ii) The aforementioned therapeutic agent, A pharmaceutical composition containing the following:

10. The pharmaceutical composition according to claim 9, wherein the at least one mutation comprises at least one amino acid substitution at the binding site.

11. The pharmaceutical composition according to claim 9, wherein the cells are selected from immune cells (e.g., plasma cells, B cells, macrophages, NK cells, dendritic cells, neutrophils, monocytes, T cells), stem cells (e.g., hematopoietic stem cells, induced pluripotent stem cells), or somatic cells.

12. The pharmaceutical composition according to claim 10, wherein the binding site is present on a protein expressed on the surface of a cell selected from CD38, SLAMF7, CD19, CD20, CD22, CD25, CD28, CD30, CD33, CD47, CD52, or PDGFRA.

13. The following (a) to (c): (a) The therapeutic agent binding site is located on CD38, the therapeutic agent is an antibody, and the antibody is daratumumab, isatuximab, or TAK-079; (b) The therapeutic agent binding site is located in SLAMF7, the therapeutic agent is an antibody, and the antibody is elotuzumab; (c) The therapeutic agent binding site is located on CD52, the therapeutic agent is an antibody, and the antibody is alemtuzumab or ANT1034. A pharmaceutical composition according to claim 12, selected from any one of the following.

14. The pharmaceutical composition according to claim 12, wherein the protein expressed on the surface of the cell is functional for all purposes other than drug binding, and / or the CD38 on the surface of the cell is functional for all purposes other than daratumumab binding.

15. The pharmaceutical composition according to claim 12, wherein the at least one amino acid substitution is made at positions 233-246 or 267-286 of the amino acid sequence of SEQ ID NO:

5.

16. The pharmaceutical composition according to claim 12, wherein the at least one amino acid substitution is selected from: T237A, E239F, Q272R, S274F, and / or K276F.

17. The pharmaceutical composition according to claim 12, wherein the CD38 on the surface of the cell comprises an amino acid sequence represented by SEQ ID NOs: 6, 7, 8, 9, or 10.

18. The pharmaceutical composition according to claim 12, wherein the CD38 on the surface of the cell is functional for all purposes other than isatuximab binding.

19. The pharmaceutical composition according to claim 12, wherein the amino acid substitution is made for one or more amino acids at positions 77-80, 111-118, or 232-234 of the amino acid sequence of SEQ ID NO:

5.

20. The pharmaceutical composition according to claim 17, wherein the amino acid substitution is selected from the following: M77F, R78F, H79F, V80F, K111F, L112F, G113F, T114F, Q115F, T116F, V117F, P118F, P232F, E233F and / or K234F.

21. The pharmaceutical composition according to claim 17, wherein the CD38 on the surface of the cell comprises an amino acid sequence represented by SEQ ID NOs: 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25.

22. The pharmaceutical composition according to claim 13, wherein the amino acid substitution is made in the CD52 region, including positions 31 to 36 of the amino acid sequence of SEQ ID NO:

43.

23. The pharmaceutical composition according to claim 13, wherein the amino acid substitution is selected from the following: Q31F, T32F, S33F, S34F, P35F and / or S36F.

24. The pharmaceutical composition according to claim 13, wherein the CD52 on the surface of the cell comprises an amino acid sequence represented by sequence numbers 45, 46, 47, 48, 49 and / or 50.

25. A pharmaceutical composition for malignant hematological disease, wherein the malignant hematological disease is selected from multiple myeloma, leukemia and lymphoma, T-cell and B-cell acute lymphoblastic leukemia, B-cell chronic lymphocytic leukemia, primary systemic amyloidosis, Waldenström hypergammaglobulinemia, mantle cell lymphoma, prolymphocytic / myeloid leukemia, acute myeloid leukemia, chronic myeloid leukemia, follicular lymphoma, Burkitt lymphoma, large granular lymphocytic (LGL) leukemia, NK-cell leukemia, or plasma cell leukemia, according to claim 9.

26. A pharmaceutical composition according to any one of claims 9 to 25, to be used in combination with adoptive cell therapy.

27. Cells configured for adoptive therapy, comprising a cell surface and / or transmembrane protein having at least one mutation at the binding site of a therapeutic antibody, wherein the at least one mutation is configured to inhibit the specific binding of the therapeutic antibody to the cell surface and / or transmembrane protein.

28. The following (a) to (c): (a) Sequence IDs 6, 7, 8, 9, and / or 10; (b) Sequence IDs 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, and / or 25; (c) Sequence IDs 45, 46, 47, 48, 49, and / or 50 The cell according to claim 27, comprising any of the amino acid sequences.

29. The cell according to claim 27, configured to retain a binding site for a second therapeutic antibody.

30. Cells containing an exogenous nucleotide sequence encoding a variant of a human cell surface or transmembrane protein, wherein the variant lacks an epitope that enables specific binding to a therapeutic antibody, but possesses the same functional capabilities as the corresponding wild-type cell surface or transmembrane protein. Cells that have been manipulated to possess everything.

31. The cell according to claim 30, wherein the exogenous nucleotide sequence encodes a variant of human CD38, SLAMF7, CD19, CD20, CD22, CD25, CD28, CD30, CD33, CD47, CD52, or PDGFRA, or a variant thereof having at least 80% sequence identity.

32. (a) Obtaining homogeneous and / or stem cells comprising a nucleic acid sequence encoding a protein expressed on the surface of the homogeneous and / or stem cells, wherein the protein comprises a therapeutic antibody binding site. (b) Identifying the amino acid residues of the therapeutic antibody binding site, and (c) Introducing one or more mutations into the nucleic acid sequence encoding the protein so as to maintain all other functions of the expressed protein while inhibiting the specific binding of the therapeutic antibody to the binding site, A method for producing cells for adoption therapy.

33. The method according to claim 32, wherein the therapeutic antibody binding site is selected from sites present in CD38, SLAMF7, CD19, CD20, CD22, CD25, CD28, CD30, CD33, CD47, CD52, or PDGFRA.

34. The method according to claim 33, wherein the therapeutic antibody is daratumumab, and the amino acid substitution is made at positions 233-246 or 267-286 of the amino acid sequence of CD38 represented by SEQ ID NO:

5.

35. The method according to claim 34, wherein the amino acid substitution is selected from the following: T237A, E239F, Q272R, S274F, and / or K276F.

36. The method according to claim 33, wherein the therapeutic antibody is isatuximab, and the amino acid substitution is made in the CD38 region, including positions 77-80, 111-118, or 232-234 of the amino acid sequence of SEQ ID NO:

5.

37. The method according to claim 36, wherein the amino acid substitution is selected from the following: M77F, R78F, H79F, V80F, K111F, L112F, G113F, T114F, Q115F, T116F, V117F, P118F, P232F, E233F and / or K234F.

Images