Antibody-oligonucleotide conjugate compositions and methods for inducing DMD exon 44 skipping

Abstract

Disclosed herein are antibody-oligonucleotide conjugates and pharmaceutical compositions that induce changes in incorrectly spliced ​​dystrophin mRNA transcripts to induce exon 44 skipping. Also described herein are methods for treating muscular dystrophies, including Duchenne muscular dystrophy, comprising administering an antibody-oligonucleotide conjugate or pharmaceutical composition that induces changes in incorrectly spliced ​​dystrophin mRNA transcripts to induce exon 44 skipping.

Description

[Technical field]

[0001] cross reference This application claims the benefit of U.S. Provisional Patent Application No. 63 / 327,725, filed April 5, 2022, which is incorporated by reference in its entirety. [Background technology]

[0002] Duchenne muscular dystrophy (DMD) is a rare X-linked neuromuscular disorder that affects approximately 1:5000–10,000 male births worldwide. There are approximately 300,000 people with DMD worldwide. DMD is a monogenic disease that is progressive, severe, and irreversible. The disease is caused by mutations in the DMD gene, the longest gene in the human genome (79 exons), which encodes the dystrophin protein (430 kDa). The central domain of dystrophin, called the rod domain, is formed by 24 spectrin repeats that act as a shock absorber and protect muscle cells from injury during movement.

[0003] DMD is caused by mutations (changes) in the dystrophin gene. Deletions of one or more exons are the most common type of mutation. Since the dystrophin gene has a total of 79 exons, there are many different deletions that can occur. However, there are certain regions of the gene that are more likely to have deletions, and these regions are called "hot spots." Deletions in the DMD gene that are non-randomly distributed with many of the larger gene deletions occurring in the DMD gene can be found in certain hot spot regions of the gene. These hot spots are clustered in two main regions, with approximately 20% of the deletions occurring in the 5' proximal part of the gene (exons 1, 3, 4, 5, 8, 13, 19) and approximately 80% of the deletions occurring in the middle distal region, i.e., 42-45, 47, 48, 50-53 (Den Dunnen et al., Am J Hum Genet. 1989;45(6):835-847). The mutated DMD gene is unable to produce any functional dystrophin, and the lack of functional dystrophin leads to muscle damage, repair, inflammatory changes, and progressive muscle weakness due to paralysis.

[0004] Current research into DMD treatments includes stem cell replacement therapy, analog up-regulation, gene replacement, and exon skipping techniques. Exon skipping techniques use structural analogs of DNA called antisense oligonucleotides that help cells skip specific exons during RNA splicing. These antisense oligonucleotides allow the defective portion of the dystrophin gene to be skipped when the gene is transcribed into RNA for protein production, allowing a truncated but more functional version of the dystrophin protein to be produced by muscle cells.

[0005] There are several antisense oligonucleotides already approved for DMD patients amenable to exon 45, 51, or 53 skipping. An antisense oligonucleotide named eteplirsen is approved in the United States for the treatment of mutations amenable to dystrophin exon 51 skipping. An antisense oligonucleotide named golodirsen was approved for medical use in the United States in 2019 for the treatment of cases that may benefit from skipping exon 53 of the dystrophin transcript. An antisense oligonucleotide named casimersen was approved in the United States in February 2021 for the treatment of patients with confirmed DMD gene mutations amenable to exon 45 skipping.

[0006] Although there has been extensive research using exon skipping for exon 44 (U.S. Patent Nos. 9,447,417, 8,461,325, and 8,361,979), there is currently no FDA-approved exon skipping therapy for DMD patients suitable for exon 44 skipping. Approximately 6% of the DMD patient population is suitable for exon 44 skipping, and the majority of these DMD patients also have a deletion of exon 45 in the DMD transcript.

[0007] A new class of therapeutics called antibody-oligonucleotide conjugates (AOCs) improves the delivery of antisense oligonucleotides. These AOCs target and deliver antisense oligonucleotides to specific tissues and cell types, including muscle cells. These AOCs are being developed for potential breakthrough treatments for DMD patients, including those suitable for exon 44 skipping. There is a need to provide treatments for DMD patients suitable for exon 44 skipping. [Prior art documents] [Patent documents]

[0008] [Patent Document 1] U.S. Pat. No. 9,447,417 [Patent Document 2] U.S. Patent No. 8,461,325 [Patent Document 3] U.S. Pat. No. 8,361,979 [Non-patent literature]

[0009] [Non-Patent Document 1] Den Dunnen et al. Am J Hum Genet. 1989;45(6):835-847 Summary of the Invention

[0010] In certain embodiments herein, disclosed is a phosphorodiamidate morpholino oligonucleotide (PMO) conjugate comprising an anti-transferrin receptor antibody or antigen-binding fragment thereof conjugated to a PMO molecule, wherein the PMO molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 100-133. In some embodiments, the PMO molecule hybridizes to an acceptor splice site, donor splice site, or exon splice enhancer element of a pre-mRNA transcript of the DMD gene and induces exon 44 skipping in the pre-mRNA transcript to generate an mRNA transcript encoding a truncated DMD protein. In some embodiments, the PMO molecule comprises at least about 10 to about 30 nucleotides in length. In some embodiments, the PMO molecule is delivered into a muscle cell. In some embodiments, the PMO molecule hybridizes to an exon 44 acceptor splice site of a pre-mRNA transcript of the DMD gene in the pre-mRNA transcript to generate an mRNA transcript encoding a truncated dystrophin protein. In some embodiments, the anti-transferrin receptor antibody or antigen-binding fragment thereof comprises a humanized antibody or antigen-binding fragment thereof, a chimeric antibody or antigen-binding fragment thereof, a monoclonal antibody or antigen-binding fragment thereof, a monovalent Fab', a bivalent Fab2, a single chain variable fragment (scFv), a diabody, a minibody, a nanobody, a single domain antibody (sdAb), or a camelid antibody or antigen-binding fragment thereof. In some embodiments, the PMO molecule is conjugated to the anti-transferrin receptor antibody or antigen-binding fragment thereof via a linker. In some embodiments, the linker is a cleavable linker. In some embodiments, the linker is a non-cleavable linker. In some embodiments, the linker is selected from the group consisting of a heterobifunctional linker, a homobifunctional linker, a maleimide group, a dipeptide moiety, a benzoic acid group or derivative thereof, a C1-C6 alkyl group, and combinations thereof. In some embodiments, the PMO conjugates have a PMO molecule to antibody ratio (DAR) of about 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, or more. In some embodiments, the PMO conjugates have an average DAR of about 1, 2, 3, 4, 5, 6, 7, 8, or more.In some embodiments, the PMO conjugate has an average DAR in the range of 3.5 to 4.5. In some embodiments, the PMO conjugate has an average DAR in the range of 7.5 to 8.5. In some embodiments, the PMO conjugate has an average DAR of about 4. In some embodiments, the PMO conjugate has an average DAR of about 8. In some embodiments, the PMO conjugate has a DAR of about 4. In some embodiments, the PMO conjugate has a DAR of about 8. In some embodiments, the PMO conjugate is formulated for parenteral administration. In some embodiments, the truncated dystrophin protein modulates muscular dystrophy. In some embodiments, the muscular dystrophy is Duchenne muscular dystrophy or Becker muscular dystrophy.

[0011] Also disclosed in certain embodiments herein is a method of treating muscular dystrophy in a subject in need thereof, comprising administering to the subject a PMO conjugate comprising an anti-transferrin receptor antibody or antigen-binding fragment thereof conjugated to a phosphorodiamidate morpholino oligonucleotide (PMO) molecule comprising a sequence selected from the group consisting of SEQ ID NOs: 100-133, wherein the PMO molecule hybridizes to an acceptor splice site, donor splice site, or exon splice enhancer element of a pre-mRNA transcript of the DMD gene and induces exon 44 skipping in the pre-mRNA transcript to generate an mRNA transcript encoding a truncated dystrophin protein. In some embodiments, the PMO molecule is delivered into a muscle cell. In some embodiments, the anti-transferrin receptor antibody or antigen-binding fragment thereof comprises a humanized antibody or antigen-binding fragment thereof, a chimeric antibody or antigen-binding fragment thereof, a monoclonal antibody or antigen-binding fragment thereof, a monovalent Fab', a bivalent Fab2, a single chain variable fragment (scFv), a diabody, a minibody, a nanobody, a single domain antibody (sdAb), or a camelid antibody or antigen-binding fragment thereof. In some embodiments, the PMO molecule comprises at least about 10 to about 30 nucleotides in length. In some embodiments, the PMO molecule is conjugated to the anti-transferrin receptor antibody or antigen-binding fragment thereof via a linker. In some embodiments, the linker is a cleavable linker. In some examples, the linker is a non-cleavable linker. In some embodiments, the linker is selected from the group consisting of a heterobifunctional linker, a homobifunctional linker, a maleimide group, a dipeptide moiety, a benzoic acid group or derivative thereof, a C1-C6 alkyl group, and combinations thereof. In some embodiments, the PMO conjugates have an average PMO molecule to antibody ratio (DAR) of about 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, or 8:1. In some embodiments, the PMO conjugates have an average DAR in the range of 3.5 to 4.5. In some embodiments, the PMO conjugates have an average DAR in the range of 7.5 to 8.5. In some embodiments, the PMO conjugates have an average DAR of about 4.In some embodiments, the PMO conjugate has an average DAR of about 8. In some embodiments, the PMO conjugate is administered parenterally. In some embodiments, the truncated dystrophin protein regulates muscular dystrophy. In some embodiments, the muscular dystrophy is Duchenne muscular dystrophy or Becker muscular dystrophy.

[0012] Also provided herein is a method of inducing exon 44 skipping in a targeted pre-mRNA transcript of a DMD gene, comprising the steps of: (a) contacting a muscle cell with a phosphorodiamidate morpholino oligonucleotide (PMO)-antibody conjugate, wherein the PMO-antibody conjugate is an anti-transferrin receptor antibody, or an antigen-binding fragment thereof, and targets an acceptor splice site, a donor splice site, or an exon splice enhancer element of the targeted pre-mRNA transcript of the DMD gene; Also disclosed are methods comprising the steps of: (a) hybridizing the PMO molecule to the targeted pre-mRNA transcript to induce exon 44 skipping in the targeted pre-mRNA transcript, and (b) translating the mRNA transcript produced from the targeted pre-mRNA transcript treated in step (b) in the muscle cell to produce a truncated dystrophin protein. In some embodiments, the anti-transferrin receptor antibody or antigen-binding fragment thereof comprises a humanized antibody or antigen-binding fragment thereof, a chimeric antibody or antigen-binding fragment thereof, a monoclonal antibody or antigen-binding fragment thereof, a monovalent Fab', a bivalent Fab2, a single chain variable fragment (scFv), a diabody, a minibody, a nanobody, a single domain antibody (sdAb), or a camelid antibody or antigen-binding fragment thereof. In some embodiments, the PMO molecule comprises at least about 10 to about 30 nucleotides in length. In some embodiments, the PMO molecule comprises at least 90%, 95%, 99%, or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 100-133. In some embodiments, the PMO molecule targets the acceptor site of exon 44. In some embodiments, the PMO molecule is conjugated to an anti-transferrin receptor antibody or antigen-binding fragment thereof via a linker. In some embodiments, the linker is a cleavable linker. In some embodiments, the linker is a non-cleavable linker.In some embodiments, the linker is selected from the group consisting of a heterobifunctional linker, a homobifunctional linker, a maleimide group, a dipeptide moiety, a benzoic acid group or derivatives thereof, a C1-C6 alkyl group, and combinations thereof. In some embodiments, the PMO conjugate has an average PMO to antibody ratio (DAR) of about 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, or more. In some embodiments, the PMO conjugate has a DAR of about 1, 2, 3, 4, 5, 6, 7, 8, or more. In some embodiments, the PMO conjugate has an average DAR in the range of 3.5-4.5. In some embodiments, the PMO conjugate has an average DAR in the range of 7.5-8.5. In some embodiments, the PMO conjugate has an average DAR of about 4. In some embodiments, the PMO conjugate has an average DAR of about 8. In some embodiments, the method is an in vivo method.

[0013] Also disclosed in certain embodiments herein is a method of inducing exon 44 skipping in a DMD subject in need thereof, the method comprising administering to the DMD subject a PMO conjugate comprising an anti-transferrin receptor antibody, or an antigen-binding fragment thereof, conjugated to a phosphorodiamidate morpholino oligonucleotide (PMO) molecule comprising a sequence selected from the group consisting of SEQ ID NOs: 100-133, wherein the PMO molecule hybridizes to the exon 44 acceptor splice site of a pre-mRNA transcript of the DMD gene and induces exon 44 skipping in the pre-mRNA transcript to generate an mRNA transcript encoding a truncated dystrophin protein.

[0014] Also disclosed in certain aspects herein is a method of restoring dystrophin in a DMD subject in need of dystrophin restoration, comprising administering to the DMD subject a PMO conjugate comprising an anti-transferrin receptor antibody, or an antigen-binding fragment thereof, conjugated to a phosphorodiamidate morpholino oligonucleotide (PMO) molecule comprising a sequence selected from the group consisting of SEQ ID NOs: 100-133, wherein the PMO molecule hybridizes to the exon 44 acceptor splice site of a pre-mRNA transcript of the DMD gene and induces exon 44 skipping in the pre-mRNA transcript to generate an mRNA transcript encoding a truncated dystrophin protein.

[0015] Also disclosed in certain embodiments herein is a method of producing a truncated dystrophin protein in a DMD subject in need thereof, the method comprising administering to the DMD subject a PMO conjugate comprising an anti-transferrin receptor antibody, or an antigen-binding fragment thereof, conjugated to a phosphorodiamidate morpholino oligonucleotide (PMO) molecule comprising a sequence selected from the group consisting of SEQ ID NOs: 100-133, wherein the PMO molecule hybridizes to the exon 44 acceptor splice site of a pre-mRNA transcript of the DMD gene and induces exon 44 skipping in the pre-mRNA transcript to produce an mRNA transcript encoding the truncated dystrophin protein. [Brief description of the drawings]

[0016] [Figure 1] 1 is a plot comparing predicted exon 44 skipping activity in response to 25-mer and 30-mer phosphorodiamidate morpholino oligomers (PMOs) with experimental exon 44 skipping. [Diagram 2] FIG. 13 is a plot of dose-response curves for the relative levels of exon 44 skipping in response to increasing concentrations of 12 different 30mer PMOs in human immortalized myoblasts. [Diagram 3]FIG. 13 is a plot of dose response curves for the relative levels of exon 44 skipping in response to increasing concentrations of three different PMOs: hEx44_Ac7_26, hEx44_Ac5_27, and hEx44_Ac4_28. [Figure 4A] 4A illustrates a plot of a dose-response curve for the relative levels of exon 44 skipping in response to increasing concentrations of hEx44_Ac7_26 in myotubes. FIG. 4B is a plot of a dose-response curve for the relative levels of exon 44 skipping in response to increasing concentrations of hEx44_Ac7_26 in healthy primary cells and immortalized cells. [Figure 4B] 4A illustrates a plot of the dose-response curve for the relative level of exon 44 skipping in response to increasing concentrations of hEx44_Ac7_26 in myotubes. FIG. 4B illustrates a plot of the dose-response curve for the relative level of exon 44 skipping in response to increasing concentrations of hEx44_Ac7_26 in DMD primary cells derived from a DMD patient. [Figure 4C] 4A illustrates a plot of the dose response curve for the relative levels of exon 44 skipping in response to increasing concentrations of hEx44_Ac7_26 in myotubes. FIG. 4C illustrates a plot of the dose response curve for the relative levels of exon 44 skipping in response to increasing concentrations of hEx44_Ac7_26 in DMD immortalized cells. [Figure 5A] Figure 5 shows the levels of dystrophin protein in response to increasing concentrations of hEx44_Ac7_26 in cultured myotubes from DMD patients. Figure 5A depicts photographs of immunofluorescence staining of dystrophin-positive fibers in healthy human cells and in cultured myotubes from DMD patients transfected with hEx44_Ac7_26. [Figure 5B] Figure 5B shows the levels of dystrophin protein in response to increasing concentrations of hEx44_Ac7_26 in cultured myotubes from DMD patients. Figure 5B shows a dose-response curve plot of the relative levels of dystrophin, as quantified by immunofluorescence staining, in response to increasing concentrations of hEx44_Ac7_26 in cultured myotubes from DMD patients. [Figure 5C]Figure 5C shows the levels of dystrophin protein in myotube cultures from DMD patients in response to increasing concentrations of hEx44_Ac7_26. Figure 5C is a bar graph quantifying the levels of dystrophin protein in myotube cultures from healthy and DMD patients in response to increasing concentrations of hEx44_Ac7_26 by Jess capillary assay. [Figure 6A] 6A is a plot of the dose response curve for the relative levels of exon 44 skipping in response to increasing concentrations of hEx44_Ac7_26 in non-human primate myotubes. FIG. 6B is a plot of the dose response curve for the relative levels of exon 44 skipping in response to increasing concentrations of hEx44_Ac7_26 in non-human primate myotubes. [Figure 6B] Figure 6B is a dose response plot of the relative levels of exon 44 skipping in response to increasing concentrations of hEx44_Ac7_26 in non-human primate myotubes.Figure 6B is a bar graph quantifying the number of exon 44 skip copies in response to increasing concentrations of hEx44_Ac7_26 in non-human primate myotubes. [Figure 6C] Figure 6C is a dose response plot of the relative levels of exon 44 skipping in response to increasing concentrations of hEx44_Ac7_26 in non-human primate myotubes.Figure 6C is a bar graph quantifying the total number of dystrophin copies in the presence of increasing concentrations of hEx44_Ac7_26 in non-human primate myotubes. [Figure 7] 1 is a graph illustrating the binding assay of DAR8 hEx44_Ac7_26 AOC or unmodified anti-transferrin receptor monoclonal antibody to transferrin receptor by ELISA. [Figure 8] 1 is a bar graph illustrating the number of exon 44 skipped copies in muscle and non-muscle tissues obtained on days 43 / 44 from cynomolgus monkeys that received a single injection of hEx44_Ac7_26-AOC at a dose of 159.9 mg / kg on day 0. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0017] In some embodiments herein, an antibody-polynucleic acid conjugate composition for treating muscular dystrophy is disclosed.In some embodiments herein, a method for treating muscular dystrophy caused by incorrectly spliced ​​DMD mRNA transcript in a subject who needs to treat muscular dystrophy is disclosed, comprising administering an antibody-polynucleic acid conjugate to the subject, wherein the antibody-polynucleic acid conjugate induces a change in the incorrectly spliced ​​pre-mRNA dystrophic transcript, thereby inducing exon 44 skipping of DMD mRNA transcript to generate a fully processed DMD mRNA transcript, and the fully processed DMD mRNA transcript encodes a functional and truncated dystrophin protein, thereby treating the disease or disorder of the subject.As used herein, the term "polynucleic acid" is used interchangeably with the term "oligonucleotide".

[0018] In some embodiments herein, antibody-antisense oligonucleotide (ASO) conjugate composition or antibody-phosphorodiamidate morpholino oligomer (PMO) conjugate composition for treating muscular dystrophy is disclosed.Also disclosed herein is a method for treating muscular dystrophy caused by incorrectly spliced ​​DMD mRNA transcript in a subject who needs to treat muscular dystrophy, comprising administering antibody-ASO conjugate or antibody-PMO conjugate to the subject, ASO or PMO induces changes in incorrectly spliced ​​pre-mRNA dystrophic transcript, thereby inducing exon 44 skipping of DMD mRNA transcript to generate fully processed DMD mRNA transcript, and fully processed DMD mRNA transcript encodes functional truncated dystrophin protein, thereby treating the disease or disorder of the subject.

[0019] In some cases, one field in which antibody-polynucleic acid conjugate is used is for treating muscular dystrophy.Muscular dystrophy encompasses several diseases that affect muscle.Duchenne muscular dystrophy is a severe form of muscular dystrophy, and is caused by mutation of DMD gene.In some cases, mutation of DMD gene destroys translation reading frame, resulting in non-functional dystrophin protein.

[0020] In certain embodiments herein, methods and compositions related to nucleic acid therapy are described, which induce insertion, deletion, duplication or change in incorrectly spliced ​​mRNA transcripts to induce exon skipping or exon inclusion, and are used to repair translation reading frame.In some embodiments herein, methods and compositions are also described for treating diseases or disorders characterized by incorrectly processed mRNA transcripts, and after exon removal, the mRNA can code functional protein, thereby treating the disease or disorder.In further embodiments herein, pharmaceutical compositions and kits for treating muscular dystrophy are also included.

[0021] RNA processing RNA plays a central role in regulating gene expression and cell physiology. Proper processing of RNA is important for the translation of functional proteins. Altered RNA processing, such as as a result of incorrect splicing of RNA, can result in disease. For example, mutations at splice sites can cause exposure of premature stop codons, loss of exons, or inclusion of introns. In some cases, altered RNA processing results in insertions, deletions, or duplications. In some cases, altered RNA processing results in insertions, deletions, or duplications of exons. Altered RNA processing can sometimes result in insertions, deletions, or duplications of introns.

[0022] Exon skipping As used herein, the term "pre-mRNA" refers to a transcript that is composed of both exons (coding sequences) and introns (non-coding sequences). Exon skipping is a form of RNA splicing. In some cases, exon skipping occurs when an exon is skipped on a pre-mRNA transcript or spliced ​​out of a processed mRNA. As a result of exon skipping, the processed mRNA does not contain the skipped exon. In some cases, exon skipping results in the expression of an altered transcript and / or mRNA product. For example, exon 44 skipping occurs when exon 44 is skipped in a pre-mRNA transcript or spliced ​​out of a processed DMD mRNA. As a result of exon 44 skipping, the processed DMD mRNA does not contain the skipped exon 44. In some cases, exon 44 skipping results in the expression of a truncated dystrophin protein. In some cases, exon 44 skipping results in the expression of a functional dystrophin protein. In some cases, exon 44 skipping leads to expression of a truncated and functional dystrophin protein.

[0023] In some examples, morpholino or phosphorodiamidate morpholino oligonucleotide (PMO)-antibody conjugate (PMO-AOC) is used to induce exon skipping. In some examples, morpholino or phosphorodiamidate morpholino oligonucleotide (PMO)-antibody conjugate is used to deliver PMO to induce exon skipping (e.g., to cells, preferably muscle cells, etc.). In some examples, the delivered PMO is used to induce exon skipping. For example, PMO binds to splice sites or exon enhancers. In some examples, binding of PMO to a specific mRNA or pre-mRNA sequence generates a double-stranded region. In some examples, PMO binds to acceptor or donor splice sites at the beginning and / or end of an exon. In some examples, morpholino or phosphorodiamidate morpholino oligonucleotide (PMO)-antibody conjugate is used to induce exon 44 skipping. In some examples, morpholino or phosphorodiamidate morpholino oligonucleotide (PMO)-antibody conjugates are used to deliver PMOs for inducing exon 44 skipping. The delivered PMOs are used to induce exon 44 skipping. For example, the delivered PMOs bind to at least one of the splice sites or exon enhancers of exon 44. In some examples, the binding of PMOs to a specific mRNA or pre-mRNA sequence generates a double-stranded region. In some examples, the PMOs bind to the acceptor or donor splice sites at the beginning and / or end of exon 44. In some examples, the PMOs bind to the acceptor splice site at the beginning of exon 44. In some examples, the PMOs bind to the donor splice site at the beginning of exon 44. In some examples, antisense oligonucleotides (AONs, ASOs) are used to induce exon skipping. As used herein, the term "AONs" is used interchangeably with the term "ASOs", both of which refer to antisense oligonucleotides.In some cases, AON is a short nucleic acid sequence that binds to a specific mRNA or pre-mRNA sequence. For example, AON binds to a splice site or exon enhancer. In some cases, AON binds to a specific mRNA or pre-mRNA sequence, generating a double-stranded region. In some cases, the formation of the double-stranded region occurs at a site where spliceosome or spliceosome-related proteins properly bind to an exon and cause the exon to skip. In some cases, exon skipping results in the restoration of the transcription reading frame, allowing the production of at least partially functional dystrophin protein.

[0024] Indications In some embodiments, the polynucleic acid molecules (oligonucleotides, e.g., PMOs, ASOs, etc.) or pharmaceutical compositions comprising the polynucleic acid molecules described herein are used to treat diseases or disorders characterized by defective mRNA. In some embodiments, the polynucleic acid molecules (oligonucleotides, e.g., PMOs, ASOs, etc.) or pharmaceutical compositions comprising the polynucleic acid molecules described herein are used to treat diseases or disorders by inducing insertions, deletions, duplications, or changes in incorrectly spliced ​​mRNA transcripts to induce exon skipping or exon inclusion.

[0025] Most human protein-coding genes are alternatively spliced. In some cases, mutations lead to improperly spliced ​​or partially spliced ​​mRNA. For example, mutations can be present in at least one of splice sites, silencer or enhancer sequences, exon sequences, or intron sequences in protein-coding genes. In some cases, mutations lead to gene dysfunction. In some cases, mutations lead to disease or disorder.

[0026] In some cases, improperly spliced ​​or partially spliced ​​mRNA causes neuromuscular disease or disorder.Exemplary neuromuscular diseases include muscular dystrophies, such as Duchenne muscular dystrophy, Becker muscular dystrophy, facioscapular-humeral muscular dystrophy, congenital muscular dystrophy, or myotonic dystrophy.In some cases, muscular dystrophy is hereditary.In some cases, muscular dystrophy is caused by spontaneous mutation.Becker muscular dystrophy and Duchenne muscular dystrophy have been shown to involve mutations in the DMD gene, which codes for protein dystrophin.

[0027] In some cases, improperly spliced ​​or partially spliced ​​mRNA causes Duchenne muscular dystrophy. Duchenne muscular dystrophy is caused by a mutation in the DMD gene, which causes severe muscle weakness and eliminates the production of functional dystrophin. In some cases, Duchenne muscular dystrophy is the result of a mutation in exon 44 of the DMD gene. In some cases, multiple exons are mutated / deleted. For example, mutations in exons 44 and 45 are common in Duchenne muscular dystrophy patients. In some cases, Duchenne muscular dystrophy is the result of a mutation in exon 44. In some cases, Duchenne muscular dystrophy is the result of a mutation in exon 44 and a deletion in exon 45.

[0028] In some examples, the polynucleic acid-antibody conjugate described herein or the pharmaceutical composition comprising the polynucleic acid-antibody conjugate is used to treat muscular dystrophy. In some examples, the polynucleic acid-antibody conjugate described herein or the pharmaceutical composition comprising the polynucleic acid-antibody conjugate is used to treat Duchenne muscular dystrophy, Becker muscular dystrophy, facioscapulohumeral muscular dystrophy, congenital muscular dystrophy, or myotonic dystrophy. In some examples, the polynucleic acid-antibody conjugate described herein or the pharmaceutical composition comprising the polynucleic acid-antibody conjugate is used to treat Duchenne muscular dystrophy. In some examples, the PMO-antibody conjugate described herein or the pharmaceutical composition comprising the PMO-antibody conjugate is used to induce exon 44 skipping in the treatment of muscular dystrophy. In some examples, the PMO-antibody conjugates described herein or pharmaceutical compositions comprising the PMO-antibody conjugates are used to induce exon 44 skipping in the treatment of Duchenne muscular dystrophy or Becker muscular dystrophy. In some examples, the PMO-antibody conjugates described herein or pharmaceutical compositions comprising the PMO-antibody conjugates are used to induce exon 44 skipping in the treatment of Duchenne muscular dystrophy.

[0029] Antibody-Polynucleic Acid Conjugates In some embodiments, the antibody is conjugated to the polynucleic acid molecule. The polynucleic acid molecule can be an ASO or a PMO. In some examples, the one or more polynucleic acid molecules are PMOs. The antibody can be an anti-transferrin receptor (anti-CD71) antibody or an antigen-binding fragment thereof. In some embodiments, the antibody is non-specifically conjugated to the polynucleic acid molecule. In some examples, the antibody is conjugated to the polynucleic acid molecule via a lysine residue. In some examples, the antibody is conjugated to the polynucleic acid molecule via a cysteine ​​residue. In some examples, the antibody is non-site-specifically conjugated to the polynucleic acid molecule via a lysine residue or a cysteine ​​residue. In some examples, the antibody is non-site-specifically conjugated to the polynucleic acid molecule via a lysine residue, e.g., a lysine residue present in the antibody. Optionally, the antibody is non-site-specifically conjugated to the polynucleic acid molecule via a cysteine ​​residue, e.g., a cysteine ​​residue present in the antibody.

[0030] In some aspects, the antibody is site-specifically conjugated to the polynucleic acid molecule. In some examples, the antibody is site-specifically conjugated to the polynucleic acid molecule through a lysine residue, through a cysteine ​​residue, at the 5' end, at the 3' end, through an unnatural amino acid, or through an enzyme-modified or enzyme-catalyzed residue. In some examples, the antibody is site-specifically conjugated to the polynucleic acid molecule through a lysine residue (e.g., a lysine residue present in the antibody). In some examples, the antibody is site-specifically conjugated to the polynucleic acid molecule through a cysteine ​​residue (e.g., a cysteine ​​residue present in the antibody). In some examples, the antibody is site-specifically conjugated to the polynucleic acid molecule at the 5' end. In some examples, the antibody is site-specifically conjugated to the polynucleic acid molecule at the 3' end. In some examples, the antibody is site-specifically conjugated to the polynucleic acid molecule through an unnatural amino acid. In some examples, the antibody is site-specifically conjugated to the polynucleic acid molecule through an enzyme-modified or enzyme-catalyzed residue. In some examples, the antibody is conjugated to the polynucleic acid molecule via a linker or one or more linkers.

[0031] In some embodiments, one or more polynucleic acid molecules are conjugated to an antibody. The one or more polynucleic acid molecules can be ASO or PMO. In some examples, the one or more polynucleic acid molecules are PMOs. The antibody can be an anti-transferrin receptor (anti-CD71) antibody or an antigen-binding fragment thereof. In some examples, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more polynucleic acid molecules are conjugated to an antibody. In some examples, about 1 polynucleic acid molecule is conjugated to an antibody. In some examples, about 2 polynucleic acid molecules are conjugated to an antibody. In some examples, about 3 polynucleic acid molecules are conjugated to an antibody. In some examples, about 4 polynucleic acid molecules are conjugated to an antibody. In some examples, about 5 polynucleic acid molecules are conjugated to an antibody. In some examples, about 6 polynucleic acid molecules are conjugated to one antibody. In some examples, about 7 polynucleic acid molecules are conjugated to one antibody. In some examples, about 8 polynucleic acid molecules are conjugated to one antibody. In some examples, about 9 polynucleic acid molecules are conjugated to one antibody. In some examples, about 10 polynucleic acid molecules are conjugated to one antibody. In some examples, about 11 polynucleic acid molecules are conjugated to one antibody. In some examples, about 12 polynucleic acid molecules are conjugated to one antibody. In some examples, about 13 polynucleic acid molecules are conjugated to one antibody. In some examples, about 14 polynucleic acid molecules are conjugated to one antibody. In some examples, about 15 polynucleic acid molecules are conjugated to one antibody. In some examples, about 16 polynucleic acid molecules are conjugated to one antibody. Optionally, one or more polynucleic acid molecules are the same. In other cases, one or more of the polynucleic acid molecules are different.

[0032] In some embodiments, the number of polynucleic acid molecules conjugated to antibody forms a certain ratio. In some cases, this ratio is referred to as DAR (drug to antibody) ratio, and the drug referred to herein is a polynucleic acid molecule. In some cases, the DAR ratio of polynucleic acid molecule to antibody is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more. In some cases, the DAR ratio of polynucleic acid molecule to antibody A is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more. In some cases, the DAR ratio includes the integer as well as the fraction or decimal of DAR ratio. For example, fractions or decimals of the DAR ratio include X.1, X.2, X.3, X.4, X.5, X.6, X.7, X.8, X.9 (e.g., 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, etc.). In some examples, the DAR ratio of the polynucleic acid molecule to the antibody is about 1 or more. In some examples, the DAR ratio of the polynucleic acid molecule to the antibody is about 2 or more. In some examples, the DAR ratio of the polynucleic acid molecule to the antibody is about 3 or more. In some examples, the DAR ratio of the polynucleic acid molecule to the antibody is about 4 or more. In some examples, the DAR ratio of the polynucleic acid molecule to the antibody is about 5 or more. In some examples, the DAR ratio of the polynucleic acid molecule to the antibody is about 6 or more. In some examples, the DAR ratio of the polynucleic acid molecule to the antibody is about 7 or more. In some examples, the DAR ratio of the polynucleic acid molecule to the antibody is about 8 or more. In some examples, the DAR ratio of polynucleic acid molecules to antibodies is about 9 or greater. In some examples, the DAR ratio of polynucleic acid molecules to antibodies is about 10 or greater. In some examples, the DAR ratio of polynucleic acid molecules to antibodies is about 11 or greater. In some examples, the DAR ratio of polynucleic acid molecules to antibodies is about 12 or greater.

[0033] In some examples, the DAR ratio of polynucleic acid molecules to antibodies is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16. In some examples, the DAR ratio of polynucleic acid molecules to antibodies is about 1. In some examples, the DAR ratio of polynucleic acid molecules to antibodies is about 2. In some examples, the DAR ratio of polynucleic acid molecules to antibodies is about 3. In some examples, the DAR ratio of polynucleic acid molecules to antibodies is about 4. In some examples, the DAR ratio of polynucleic acid molecules to antibodies is about 5. In some examples, the DAR ratio of polynucleic acid molecules to antibodies is about 6. In some examples, the DAR ratio of polynucleic acid molecules to antibodies is about 7. In some examples, the DAR ratio of polynucleic acid molecules to antibodies is about 8. In some examples, the DAR ratio of polynucleic acid molecules to antibodies is about 9. In some examples, the DAR ratio of polynucleic acid molecules to antibodies is about 10. In some examples, the DAR ratio of polynucleic acid molecules to antibodies is about 11. In some examples, the DAR ratio of polynucleic acid molecules to antibodies is about 12. In some examples, the DAR ratio of polynucleic acid molecules to antibodies is about 13. In some examples, the DAR ratio of polynucleic acid molecules to antibodies is about 14. In some examples, the DAR ratio of polynucleic acid molecules to antibodies is about 15. In some examples, the DAR ratio of polynucleic acid molecules to antibodies is about 16.

[0034] In some examples, the DAR ratio of polynucleic acid molecules to antibodies is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16. In some examples, the DAR ratio of polynucleic acid molecules to antibodies is 1. In some examples, the DAR ratio of polynucleic acid molecules to antibodies is 2. In some examples, the DAR ratio of polynucleic acid molecules to antibodies is 4. In some examples, the DAR ratio of polynucleic acid molecules to antibodies is 6. In some examples, the DAR ratio of polynucleic acid molecules to antibodies is 8. In some examples, the DAR ratio of polynucleic acid molecules to antibodies is 12. In some examples, the DAR ratio of polynucleic acid molecules to antibodies is 16.

[0035] In some embodiments, the composition comprises a plurality of antibody-polynucleic acid conjugates. In some examples, the number of polynucleic acid molecules conjugated to the antibody forms a certain ratio. In some examples, this ratio is referred to as DAR (drug to antibody) ratio, where the drug referred to is a polynucleic acid molecule. In some examples, the plurality of antibody-polynucleic acid conjugates in the composition have the same DAR ratio. In some examples, the plurality of antibody-polynucleic acid conjugates in the composition have different DAR ratios. In some examples, at least two of the antibody-polynucleic acid conjugates in the composition have different DAR ratios from each other. In some examples, the DAR ratio is the average DAR (drug to antibody) ratio, which is the average number of DAR ratios of the plurality of antibody-polynucleic acid conjugates in the composition. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more. In some examples, the average DAR ratio includes the integer as well as the fractional or decimal DAR ratio. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is about 1 or more. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is about 2 or more. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is about 3 or more. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is about 4 or more. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is about 5 or more. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is about 6 or more. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is about 7 or more. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is about 8 or more. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is about 9 or greater. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is about 10 or greater. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is about 11 or greater. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is about 12 or greater.

[0036] In some examples, the average DAR ratio of polynucleic acid molecules to antibody A is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16. In some examples, the average DAR ratio of polynucleic acid molecules to antibody is about 1. In some examples, the average DAR ratio of polynucleic acid molecules to antibody is about 2. In some examples, the average DAR ratio of polynucleic acid molecules to antibody is about 3. In some examples, the average DAR ratio of polynucleic acid molecules to antibody is about 4. In some examples, the average DAR ratio of polynucleic acid molecules to antibody is about 5. In some examples, the average DAR ratio of polynucleic acid molecules to antibody is about 6. In some examples, the average DAR ratio of polynucleic acid molecules to antibody is about 7. In some examples, the average DAR ratio of polynucleic acid molecules to antibody is about 8. In some examples, the average DAR ratio of polynucleic acid molecules to antibody is about 9. In some examples, the average DAR ratio of polynucleic acid molecules to antibody is about 10. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is about 11. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is about 12. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is about 13. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is about 14. In some examples, the DAR ratio of polynucleic acid molecules to antibodies is about 15. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is about 16.

[0037] In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is 1. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is 2. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is 4. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is 6. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is 8. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is 12. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is 16.

[0038] In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is in the range of 1.5-2.5, 2.5-3.5, 3.5-4.5, 4.5-5.5, 5.5-6.5, 6.5-7.5, 7.5-8.5, 8.5-9.5, 9.5-10.5, 10.5-11.5, 11.5-12.5, 12.5-13.5, 13.5-14.5, 14.5-15.5, 15.5-16.5, or 16.5-17.5. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is in the range of 1.5-2.5. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is in the range of 2.5-3.5. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is in the range of 3.5-4.5. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is in the range of 4.5 to 5.5. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is in the range of 5.5 to 6.5. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is in the range of 6.5 to 7.5. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is in the range of 7.5 to 8.5. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is in the range of 8.5 to 9.5. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is in the range of 9.5 to 10.5. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is in the range of 10.5 to 11.5. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies A is in the range of 11.5 to 12.5. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is in the range of 12.5 to 13.5. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is in the range of 13.5 to 14.5. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is in the range of 14.5 to 15.5. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is in the range of 15.5 to 16.5. In some examples, the average DAR ratio of polynucleic acid molecules to antibodies is in the range of 16.5 to 17.5.

[0039] In some cases, the conjugate comprising a polynucleic acid molecule and an antibody has improved activity compared to a conjugate comprising a polynucleic acid molecule but not an antibody. In some cases, improved activity results in improved biologically relevant function, such as improved stability, affinity, binding, functional activity, and efficacy in treating or preventing a disease state. In some cases, the disease state is the result of one or more exons of a gene being mutated. In some cases, the conjugate comprising a polynucleic acid molecule and an antibody increases exon skipping of one or more mutated exons compared to a conjugate comprising a polynucleic acid molecule but not an antibody. In some cases, exon skipping is increased by at least or about 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 95% or more in a conjugate comprising a polynucleic acid molecule and an antibody A compared to a conjugate comprising a polynucleic acid molecule but not an antibody.

[0040] PMO molecule in PMO-antibody conjugates In some embodiments, the polynucleic acid is an antisense oligonucleotide (ASO) molecule or a PMO molecule. In some embodiments, the antibody-polynucleic acid conjugate is an ASO-antibody conjugate. In some embodiments, the antibody-polynucleic acid conjugate is a PMO-antibody conjugate. In some embodiments, the PMO molecule of the PMO-antibody conjugate described herein induces exon 44 skipping to induce changes in incorrectly spliced ​​mRNA transcripts. In some examples, the PMO molecule restores the translation reading frame of the dystrophin protein by changing the incorrectly spliced ​​mRNA transcript. In some examples, the PMO molecule restores the translation reading frame of the dystrophin protein, resulting in a functional truncated dystrophin protein.

[0041] In some embodiments, the polynucleic acid molecule is conjugated to an antibody for delivery to a site of interest. Optionally, a PMO molecule is conjugated to an antibody. Optionally, a PMO molecule is conjugated to an antibody for delivery to a site of interest.

[0042] In some embodiments, the PMO molecule is conjugated to an antibody for delivery to a muscle cell. Optionally, the PMO molecule for skipping exon 44 is conjugated to an antibody. Optionally, the PMO molecule for skipping exon 44 is conjugated to an antibody for delivery to a muscle cell.

[0043] In some examples, the antibody is conjugated to at least one PMO molecule. In some examples, the antibody is conjugated to at least one PMO molecule to form a PMO-antibody conjugate. In some embodiments, the antibody is conjugated to the 5' end of the PMO molecule, the 3' end of the PMO molecule, an internal site on the PMO molecule, or any combination thereof. In some examples, the antibody is conjugated to at least two PMO molecules. In some examples, the antibody is conjugated to at least 2, 3, 4, 5, 6, 7, 8, or more PMO molecules.

[0044] In some examples, the PMO molecule of the PMO-antibody conjugate targets and hybridizes to the pre-mRNA sequence of the DMD gene. In some examples, the PMO molecule targets and hybridizes to the splice site of exon 44 of the pre-mRNA sequence of the DMD gene. In some examples, the PMO molecule targets and hybridizes to the cis-regulatory element of exon 44 of the pre-mRNA sequence of the DMD gene. In some examples, the PMO molecule targets and hybridizes to the trans-regulatory element of the exon of the pre-mRNA sequence of the DMD gene. In some examples, the PMO molecule targets and hybridizes to the exon splice enhancer or intron splice enhancer of exon 44 of the pre-mRNA sequence of the DMD gene. In some examples, the PMO molecule targets and hybridizes to the exon splice silencer or intron splice silencer of exon 44 of the pre-mRNA sequence of the DMD gene. In some instances, the PMO molecule targets and hybridizes to an acceptor site in exon 44 of the pre-mRNA sequence of the DMD gene.

[0045] In some examples, the PMO molecule of the PMO-antibody conjugate targets and hybridizes to a sequence found in an intron or exon of the pre-mRNA sequence of the DMD gene. For example, the PMO molecule targets and hybridizes to a sequence found in exon 44 of the pre-mRNA sequence of the DMD gene that mediates exon splicing. In some examples, the PMO molecule targets an exon recognition sequence of the pre-mRNA sequence of the DMD gene. In some examples, the PMO molecule targets a sequence upstream of an exon of the pre-mRNA sequence of the DMD gene. In some examples, the PMO molecule targets a sequence downstream of an exon of the pre-mRNA sequence of the DMD gene.

[0046] As described above, the PMO molecule targets incorrectly processed mRNA transcripts that result in a neuromuscular disease or disorder. In some cases, the neuromuscular disease or disorder is Duchenne muscular dystrophy or Becker muscular dystrophy.

[0047] In some examples, the polynucleic acid molecule (e.g., PMO molecule, antisense oligonucleotide, etc.) targets the region (sequence) adjacent to the mutated exon. In another example, if there is a mutation in exon 44, the polynucleic acid molecule targets a sequence in exon 44 (e.g., a region within exon 44) of the pre-mRNA sequence of the DMD gene so that exon 44 is skipped.

[0048] Optionally, the polynucleic acid molecules described herein target a region at the exon-intron junction of exon 44 of the pre-mRNA sequence of the DMD gene. Optionally, the polynucleic acid molecules described herein target a region at the exon-intron junction of exon 44 of the pre-mRNA sequence of the DMD gene.

[0049] In some examples, the PMO molecule of the PMO-antibody conjugate hybridizes to a target region at either the 5' intron-exon junction or the 3' exon-intron junction of exon 44 of the pre-mRNA of the DMD gene.

[0050] Optionally, the polynucleic acid molecule hybridizes to a target region at the 5' intron-exon junction of exon 44 of the pre-mRNA of the DMD gene.

[0051] Optionally, the PMO molecule hybridizes to a target region at the 3' exon-intron junction of exon 44 of the pre-mRNA of the DMD gene.

[0052] In some examples, the PMO molecule of the PMO-antibody conjugates described herein targets the splice site of exon 44 of the pre-mRNA of the DMD gene. Optionally, the PMO molecule of the PMO-antibody conjugates described herein targets the splice site of exon 44 of the pre-mRNA of the DMD gene. As used herein, splice site includes canonical splice sites, cryptic splice sites, or alternative splice sites that can induce insertions, deletions, duplications, or changes in an incorrectly spliced ​​mRNA transcript to induce exon 44 skipping.

[0053] In some examples, the PMO molecule of the PMO-antibody conjugate hybridizes to a target region proximal to an exon-intron junction. In some examples, the PMO molecule described herein targets a region at least 1000 nucleotides (nt), 500nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, or 5 nt upstream (or 5') of exon 44 of the pre-mRNA of the DMD gene. In some examples, the PMO molecule described herein targets a region at least 1000nt, 500nt, 400nt, 300nt, 200nt, 100nt, 80nt, 60nt, 50nt, 40nt, 30nt, 20nt, 10nt, or 5 nt upstream (or 5') of exon 44 of the pre-mRNA of the DMD gene.

[0054] In some examples, the PMO molecule of the PMO-antibody conjugate hybridizes to a target region downstream (or 3') of exon 44 of the pre-mRNA of the DMD gene. In some examples, the polynucleic acid molecule hybridizes to a target region about 5, 10, 15, 20, 50, 100, 200, 300, 400, or 500 nt downstream (or 3') of exon 44 of the pre-mRNA of the DMD gene.

[0055] In some examples, the PMO molecule of the PMO-antibody conjugates described herein targets an internal region within exon 44 of the pre-mRNA of the DMD gene.

[0056] In some embodiments, the PMO molecule of the PMO-antibody conjugate described herein targets a partially spliced ​​mRNA sequence that includes exon 44 of the pre-mRNA of the DMD gene. In some examples, the PMO molecule hybridizes to a target region that is upstream (or 5') of exon 44 of the pre-mRNA of the DMD gene. In some examples, the PMO molecule hybridizes to a target region that is about 5, 10, 15, 20, 50, 100, 200, 300, 400, or 500 bp upstream (or 5') of exon 44 of the pre-mRNA of the DMD gene. In some examples, the PMO molecule hybridizes to a target region that is downstream (or 3') of exon 44 of the pre-mRNA of the DMD gene. In some examples, the PMO molecule hybridizes to a target region that is approximately 5, 10, 15, 20, 50, 100, 200, 300, 400, or 500 bp downstream (or 3') of exon 44 of the pre-mRNA of the DMD gene.

[0057] In some examples, the PMO molecule hybridizes to a target region within exon 44 of the pre-mRNA of the DMD gene. In some examples, the PMO molecule hybridizes to a target region at either the 5' intron-exon 44 junction or the 3' exon 44-intron junction of the pre-mRNA of the DMD gene.

[0058] In some embodiments, the PMO molecule comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs: 100-133.

[0059] In some embodiments, the PMO molecule comprises a core sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs: 100-133.

[0060] In some embodiments, the PMO molecule of the PMO-antibody conjugate comprises at least 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more contiguous bases of a sequence selected from SEQ ID NOs: 100-133. Optionally, the PMO molecule further comprises 1, 2, 3, or 4 mismatches, or no more than 1, 2, 3, or 4 mismatches, from a sequence selected from SEQ ID NOs: 100-133.

[0061] Tables 1 and 10 list the PMO molecules of SEQ ID NOs: 100-133.

[0062] [Table 1]

[0063] [Table 2]

[0064] In some embodiments, the polynucleic acid molecule is an antisense oligonucleotide (ASO) molecule or a phosphorodiamidate morpholino oligonucleotide (PMO) molecule.

[0065] In some embodiments, the PMO molecule is at least about 10 to about 50 nucleotides in length. In some examples, the PMO molecule is about 10 to about 30, about 15 to about 30, about 18 to about 30, about 18 to about 25, about 18 to about 24, about 19 to about 23, about 19 to about 30, about 19 to about 25, about 19 to about 24, about 19 to about 23, about 20 to about 30, about 20 to about 25, about 20 to about 24, about 20 to about 23, or about 20 to about 22 nucleotides in length.

[0066] In some embodiments, the polynucleic acid molecule comprises natural, synthetic or artificial nucleotide analogs or bases. In some cases, the ASO or PMO molecule of the polynucleic acid molecule-antibody conjugate (e.g., PMO-antibody conjugate or ASO-antibody conjugate) comprises a combination of DNA, RNA and / or nucleotide analogs. In some examples, the synthetic or artificial nucleotide analogs or bases comprise modifications in one or more of ribose moieties, phosphate moieties, nucleoside moieties, or combinations thereof.

[0067] In some embodiments, the nucleotide analog or artificial nucleotide base comprises a nucleic acid having a modification at the 2' hydroxyl group of the ribose moiety. In some examples, the modification comprises H, OR, R, halo, SH, SR, NH2, NHR, NR2, or CN, where R is an alkyl moiety. Exemplary alkyl moieties include, but are not limited to, halogen, sulfur, thiol, thioether, thioester, amine (primary, secondary, or tertiary), amide, ether, ester, alcohol, and oxygen. In some examples, the alkyl moiety further comprises a modification. In some examples, the modification comprises an azo group, a keto group, an aldehyde group, a carboxyl group, a nitro group, a nitroso group, a nitrile group, a heterocyclic (e.g., imidazole, hydrazino, or hydroxylamino) group, an isocyanate or cyanate group, or a sulfur-containing group (e.g., sulfoxide, sulfone, sulfide, or disulfide). In some examples, the alkyl moiety further comprises a heterosubstitution. In some examples, a carbon of a heterocyclic group is replaced by nitrogen, oxygen, or sulfur. In some examples, heterocyclic substitutions include, but are not limited to, morpholino, imidazole, and pyrrolidino.

[0068] In some examples, the modification at the 2' hydroxyl group is a 2'-O-methyl modification or a 2'-O-methoxyethyl (2'-O-MOE) modification. In some cases, the 2'-O-methyl modification adds a methyl group to the 2' hydroxyl group of the ribose moiety, whereas the 2'O-methoxyethyl modification adds a methoxyethyl group to the 2' hydroxyl group of the ribose moiety. Exemplary chemical structures of the 2'-O-methyl modification of an adenosine molecule and the 2'O-methoxyethyl modification of a uridine are shown below.

[0069] [ka]

[0070] In some cases, the modification at the 2' hydroxyl group is a 2'-O-aminopropyl modification, in which an extended amine group containing a propyl linker attaches the amine group to the 2' oxygen. In some cases, this modification neutralizes the overall negative charge from the phosphate of the oligonucleotide molecule by introducing one positive charge from the amine group per sugar, thereby improving the cell uptake properties due to zwitterionic properties. An exemplary chemical structure of 2'-O-aminopropyl nucleoside phosphoramidite is shown below.

[0071] [ka]

[0072] In some instances, the modification at the 2' hydroxyl group is a locked or bridged ribose modification (e.g., locked nucleic acid or LNA), in which the oxygen molecule attached at the 2' carbon is linked to the 4' carbon by a methylene group, thus forming a 2'-C,4'-C-oxy-methylene linked bicyclic ribonucleotide monomer. An exemplary representation of the chemical structure of LNA is shown below. The representation shown on the left highlights the chemical bondability of the LNA monomer. The representation shown on the right highlights the locked 3'-endo (3E) conformation of the furanose ring of the LNA monomer.

[0073] [ka]

[0074] In some cases, the modification at the 2' hydroxyl group includes ethylene nucleic acid (ENA), such as 2'-4'-ethylene bridged nucleic acid, which locks the sugar conformation into a C3'-endo sugar pucker conformation. ENA is part of the bridged nucleic acid class of modified nucleic acid, which further includes LNA. Exemplary chemical structures of ENA and bridged nucleic acid are shown below.

[0075] [ka]

[0076] In some embodiments, further modifications at the 2' hydroxyl group include 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamide (2'-O-NMA).

[0077] In some embodiments, the nucleotide analogs include modified bases, such as, but not limited to, 5-propynyluridine, 5-propynylcytidine, 6-methyladenine, 6-methylguanine, N,N-dimethyladenine, 2-propyladenine, 2 propylguanine, 2-aminoadenine, 1-methylinosine, 3-methyluridine, 5-methylcytidine, 5-methyluridine and other nucleotides with modifications at the 5-position, 5-(2-amino)propyluridine, 5-halocytidine, 5-halouridine, 4-acetylcytidine, 1-methyladenosine, 2-methyladenosine, 3-methylcytidine, 6-methyluridine, 2-methylguanosine, 7-methylguanosine, 2,2-dimethylguanosine, 5-methylaminoethyluridine, 5-methyloxyuridine, diazanucleotides, such as 7-deaza-adenosine, 6-azouridine, 6-azocyt ... Included are zothymidine, 5-methyl-2-thiouridine, other thio bases such as 2-thiouridine and 4-thiouridine and 2-thiocytidine, dihydrouridine, pseudouridine, queiosine, archaeosine, naphthyl and substituted naphthyl groups, all O- and N-alkylated purines and pyrimidines such as N6-methyladenosine, 5-methylcarbonylmethyluridine, uridine 5-oxyacetic acid, pyridin-4-one, pyridin-2-one, phenyl and modified phenyl groups such as aminophenol or 2,4,6-trimethoxybenzene, modified cytosines that act as G-clamp nucleotides, 8-substituted adenines and guanines, 5-substituted uracil and thymine, azapyrimidines, carboxyhydroxyalkyl nucleotides, carboxyalkylaminoalkyl nucleotides, and alkylcarbonyl alkylated nucleotides. Modified nucleotides also include nucleotides modified on the sugar moiety as well as nucleotides having non-ribosyl sugars or analogs thereof. For example, the sugar moiety is optionally based on or is mannose, arabinose, glucopyranose, galactopyranose, 4'-thioribose, and other sugars, heterocycles, or carbocycles. The term nucleotide also includes what are known in the art as universal bases.By way of example, universal bases include, but are not limited to, 3-nitropyrrole, 5-nitroindole, or nebularine.

[0078] In some embodiments, the nucleotide analogue further comprises morpholino, peptide nucleic acid (PNA), methyl phosphonate nucleotide, thiol phosphonate nucleotide, 2'-fluoro N3-P5'-phosphoramidite, 1',5'-anhydrohexitol nucleic acid (HNA), or a combination thereof. Morpholino or phosphorodiamidate morpholino oligomers (PMO) comprise synthetic molecules whose structure mimics natural nucleic acid structure by deviating from the normal sugar and phosphate structure. In some cases, the five-membered ribose ring is replaced with a six-membered morpholino ring containing four carbons, one nitrogen, and one oxygen. In some cases, the ribose monomers are linked by phosphorodiamidate groups instead of phosphate groups. In such cases, the backbone changes remove all positive and negative charges, allowing the morpholino neutral molecule to cross cell membranes without the assistance of a cell delivery agent, such as those used by charged oligonucleotides.

[0079] [ka]

[0080] In some embodiments, peptide nucleic acids (PNAs) do not contain sugar rings or phosphate linkages; the bases are attached and appropriately spaced by oligoglycine-like molecules, thus eliminating backbone charge.

[0081] [ka]

[0082] In some embodiments, one or more modifications are optionally made to the internucleotide bond. In some examples, the modified internucleotide bond includes phosphorothioate, phosphorodithioate, methyl phosphonate, 5'-alkylene phosphonate, 5'-methyl phosphonate, 3'-alkylene phosphonate, boron trifluoridate, boranophosphate ester and selenophosphate with 3'-5' or 2'-5' bond, phosphotriester, thionoalkyl phosphotriester, phosphonic acid hydrogen bond, alkyl phosphonate, alkyl phosphonothioate, aryl phosphonothioate, phosphoroselenoate, phosphorodiselenoate, phosphinate, phosphoramidate, 3'-alkyl phosphoramidate, aminoalkyl phosphoramidate, thionophosphoramidate, phosphoropiperazidate. , phosphoroanilothioate, phosphoroanilidate, ketone, sulfone, sulfonamide, carbonate, carbamate, methylenehydrazo, methylenedimethylhydrazo, formacetal, thioformacetal, oxime, methyleneimino, methylenemethylimino, thioamidate, bond with riboacetyl group, aminoethylglycine, silyl or siloxane bond, alkyl or cycloalkyl bond with or without heteroatom, such as saturated or unsaturated and / or substituted and / or containing heteroatom, bond with morpholino structure, amide, polyamide with base attached directly or indirectly to aza nitrogen of backbone, and combinations thereof. Phosphorothioate antisense oligonucleotide (PS ASO) is an antisense oligonucleotide containing phosphorothioate bond. Exemplary PS ASO is shown below.

[0083] [ka]

[0084] In some examples, the modification is a methyl or thiol modification, such as a methyl phosphonate modification or a thiol phosphonate modification. Exemplary thiol phosphonate nucleotides (left) and methyl phosphonate nucleotides (right) are shown below.

[0085] [ka]

[0086] In some examples, modified nucleotides include, but are not limited to, 2'-fluoro N3-P5'-phosphoramidites, shown as follows:

[0087] [ka]

[0088] In some examples, modified nucleotides include, but are not limited to, hexitol nucleic acids (ie, 1',5'-anhydrohexitol nucleic acid (HNA)), depicted as follows:

[0089] [ka]

[0090] In some embodiments, the nucleotide analog or artificial nucleotide base described above comprises a 5'-vinylphosphonate modified nucleotide having a modification at the 5' hydroxyl group of the ribose moiety. In some embodiments, the 5'-vinylphosphonate modified nucleotide is selected from the nucleotides provided below, where X is O or S, and B is a heterocyclic base moiety.

[0091] [ka]

[0092] In some cases, the modification at the 2' hydroxyl group is a 2'-O-aminopropyl modification in which an extended amine group containing a propyl linker attaches the amine group to the 2' oxygen. In some cases, this modification neutralizes the overall negative charge from the phosphate of the oligonucleotide molecule by introducing one positive charge from the amine group per sugar, thereby improving the cellular uptake properties due to the zwitterionic character.

[0093] In some examples, 5'-vinylphosphonate modified nucleotides are further modified with a locked or bridged ribose modification at the 2' hydroxyl group (e.g., locked nucleic acid or LNA), in which the oxygen molecule attached at the 2' carbon is linked to the 4' carbon by a methylene group, thus forming a 2'-C,4'-C-oxy-methylene linked bicyclic ribonucleotide monomer. An exemplary representation of the chemical structure of 5'-vinylphosphonate modified LNA is shown below, where X is O or S, B is a heterocyclic base moiety, and J is an internucleotide linking group that links adjacent nucleotides of a polynucleotide.

[0094] [ka]

[0095] In some embodiments, further modifications at the 2' hydroxyl group include 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamide (2'-O-NMA).

[0096] In some embodiments, the nucleotide analogs include modified bases, such as, but not limited to, 5-propynyluridine, 5-propynylcytidine, 6-methyladenine, 6-methylguanine, N,N-dimethyladenine, 2-propyladenine, 2-propylguanine, 2-aminoadenine, 1-methylinosine, 3-methyluridine, 5-methylcytidine, 5-methyluridine and other nucleotides with modifications at the 5 position, 5-(2-amino )propyluridine, 5-halocytidine, 5-halouridine, 4-acetylcytidine, 1-methyladenosine, 2-methyladenosine, 3-methylcytidine, 6-methyluridine, 2-methylguanosine, 7-methylguanosine, 2,2-dimethylguanosine, 5-methylaminoethyluridine, 5-methyloxyuridine, diazanucleotides (7-deaza-adenosine, 6-azouridine, 6-azocytidine, or 6-azocitidine) uridine), 5-methyl-2-thiouridine, other thio bases (such as 2-thiouridine, 4-thiouridine, and 2-thiocytidine), dihydrouridine, pseudouridine, queiosine, archaeosine, naphthyl and substituted naphthyl groups, any O- and N-alkylated purines and pyrimidines (such as N6-methyladenosine, 5-methylcarbonylmethyluridine, uridine 5-oxyacetic acid, pyridin-4-one, or pyridin-2-one), phenyl and modified phenyl groups, such as aminophenol or 2,4,6-trimethoxybenzene, modified cytosines that act as G-clamp nucleotides, 8-substituted adenines and guanines, 5-substituted uracils and thymines, azapyrimidines, carboxyhydroxyalkyl nucleotides, carboxyalkylaminoalkyl nucleotides, and alkylcarbonyl alkylated nucleotides. 5'-vinylphosphonate modified nucleotides can also include nucleotides modified on the sugar moiety, as well as 5'-vinylphosphonate modified nucleotides having non-ribosyl sugars or analogs thereof, for example, the sugar moiety optionally is or is based on mannose, arabinose, glucopyranose, galactopyranose, 4'-thioribose, and other sugars, heterocycles, or carbocycles.The term nucleotide also includes what are known in the art as universal bases. Exemplary universal bases include, but are not limited to, 3-nitropyrrole, 5-nitroindole, or nebularine.

[0097] In some embodiments, the 5'-vinyl phosphonate modified nucleotide analogue further comprises morpholino, peptide nucleic acid (PNA), methyl phosphonate nucleotide, thiol phosphonate nucleotide, 2'-fluoro N3-P5'-phosphoramidite, or 1',5'-anhydrohexitol nucleic acid (HNA). Morpholino or phosphorodiamidate morpholino oligomers (PMO) comprise synthetic molecules whose structure mimics natural nucleic acid structure but deviates from the normal sugar and phosphate structure. In some cases, the five-membered ribose ring is replaced with a six-membered morpholino ring containing four carbons, one nitrogen, and one oxygen. In some cases, the ribose monomers are linked by phosphorodiamidate groups instead of phosphate groups. In such cases, the backbone changes remove all positive and negative charges, allowing the morpholino neutral molecule to pass through cell membranes without the aid of a cell delivery agent, such as those used by charged oligonucleotides. Non-limiting examples of 5'-vinylphosphonate modified morpholino oligonucleotides are shown below, where B is a heterocyclic base moiety.

[0098] [ka]

[0099] In some embodiments, the 5'-vinylphosphonate modified morpholino or PMO is a PMO that comprises positive or cationic charge.In some examples, the PMO is PMOplus (Sarepta).PMOplus refers to phosphorodiamidate morpholino oligomers that comprise any number of (1-piperazino)phosphinylideneoxy, (1-(4-(omega-guanidino-alkanoyl))-piperazino)phosphinylideneoxy bonds (such as those described in WO2008 / 036127).Optionally, the PMO is the PMO described in U.S. Patent No. 7,943,762.

[0100] In some embodiments, the morpholino or PMO is PMO-X (Sarepta).In some cases, PMO-X refers to a phosphorodiamidate morpholino oligomer that includes at least one bond or terminal modification as disclosed, such as at least one of those disclosed in WO2011 / 150408 and US2012 / 0065169.

[0101] In some embodiments, the morpholino or PMO is a PMO described in Table 5 of U.S. Patent Application Publication No. 2014 / 0296321.

[0102] An exemplary representation of the chemical structure of a 5'-vinylphosphonate modified nucleic acid is shown below, where X is O or S, B is a heterocyclic base moiety, and J is an internucleotide linkage.

[0103] [ka]

[0104] In some embodiments, one or more modifications of the 5'-vinyl phosphonate modified oligonucleotides are optionally made to the internucleotide bond. In some examples, the modified internucleotide bond includes phosphorothioate, phosphorodithioate, methyl phosphonate, 5'-alkylene phosphonate, 5'-methyl phosphonate, 3'-alkylene phosphonate, boron trifluoridate, boranophosphate ester and selenophosphate with 3'-5' or 2'-5' bond, phosphotriester, thionoalkyl phosphotriester, phosphonic acid hydrogen bond, alkyl phosphonate, alkyl phosphonothioate, aryl phosphonothioate, phosphoroselenoate, phosphorodiselenoate, phosphinate, phosphoramidate, 3'-alkyl phosphoramidate, aminoalkyl phosphoramidate, thionophosphoramidate, phosphoropiperazidate, phosphinate, phosphoramidate ... These include, but are not limited to, phosphoroanilothioates, phosphoroanilidates, ketones, sulfones, sulfonamides, carbonates, carbamates, methylenehydrazo, methylenedimethylhydrazo, formacetals, thioformacetals, oximes, methyleneimino, methylenemethylimino, thioamidates, bonds with riboacetyl groups, aminoethylglycines, silyl or siloxane bonds, alkyl or cycloalkyl bonds, such as saturated or unsaturated and / or substituted and / or containing heteroatoms, with or without heteroatoms, bonds with morpholino structures, amides, or polyamides in which the bases are attached directly or indirectly to the aza nitrogens of the backbone, and combinations thereof.

[0105] In some examples, the modification is a methyl or thiol modification, such as a methylphosphonate or thiolphosphonate modification. Exemplary thiolphosphonate nucleotides (left), phosphorodithioate (center), and methylphosphonate nucleotides (right) are shown below.

[0106] [ka]

[0107] In some examples, 5'-vinylphosphonate modified nucleotides include, but are not limited to, phosphoramidites shown as follows:

[0108] [ka]

[0109] In some examples, the modified internucleotide linkage is a phosphorodiamidate linkage. Non-limiting examples of phosphorodiamidate linkages with morpholino systems are shown below.

[0110] [ka]

[0111] In some examples, the modified internucleotide linkage is a methylphosphonate linkage. Non-limiting examples of methylphosphonate linkages are shown below:

[0112] [ka]

[0113] In some examples, the modified internucleotide linkage is an amide bond. Non-limiting examples of amide bonds are shown below:

[0114] [ka]

[0115] In some examples, 5'-vinylphosphonate modified nucleotides include, but are not limited to, modified nucleic acids shown as follows:

[0116] [ka]

[0117] wherein B is a heterocyclic base moiety.

[0118] [ka]

[0119] where B is a heterocyclic base moiety;

[0120] R4 and R5 are independently selected from hydrogen, halogen, alkyl, or alkoxy;

[0121] J is an internucleotide linking group that links adjacent nucleotides of a polynucleotide.

[0122] [ka]

[0123] where B is a heterocyclic base moiety;

[0124] R6 is selected from hydrogen, halogen, alkyl, or alkoxy;

[0125] J is an internucleotide linking group that links adjacent nucleotides of a polynucleotide.

[0126] [ka]

[0127] where B is a heterocyclic base moiety;

[0128] J is an internucleotide linking group that links adjacent nucleotides of a polynucleotide.

[0129] [ka]

[0130] where B is a heterocyclic base moiety;

[0131] J is an internucleotide linking group that links adjacent nucleotides of a polynucleotide.

[0132] [ka]

[0133] where B is a heterocyclic base moiety;

[0134] R6 is selected from hydrogen, halogen, alkyl, or alkoxy;

[0135] J is an internucleotide linking group that links adjacent nucleotides of a polynucleotide.

[0136] In some embodiments, the PMO molecule of the PMO-antibody conjugate comprises a plurality of phosphorodiamidate morpholino oligomers or a plurality of peptide nucleic acid modified non-natural nucleotides, and optionally comprises at least one inverted abasic portion. In some examples, the PMO molecule comprises at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more phosphorodiamidate morpholino oligomer modified non-natural nucleotides. In some examples, the PMO molecule comprises 100% phosphorodiamidate morpholino oligomer modified non-natural nucleotides.

[0137] In some examples, the PMO molecule of the PMO-antibody conjugate comprises at least one of about 5% to about 100% modification, about 10% to about 100% modification, about 20% to about 100% modification, about 30% to about 100% modification, about 40% to about 100% modification, about 50% to about 100% modification, about 60% to about 100% modification, about 70% to about 100% modification, about 80% to about 100% modification, and about 90% to about 100% modification.

[0138] In some cases, one or more of the artificial nucleotide analogs described herein exhibits resistance to nucleases, such as ribonucleases, such as RNase H, deoxyribonucleases, such as DNases, or exonucleases, such as 5'-3' exonuclease and 3'-5' exonuclease, as compared to naturally occurring polynucleic acid molecules. In some examples, the artificial nucleotide analogs include RNase A inhibitors, including 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamide (2'-O-NMA) modifications, LNA, ENA, PNA, HNA, morpholino, methylphosphonate nucleotides, thiolphosphonate nucleotides, 2'-fluoro N3-P5'-phosphoramidites, or combinations thereof. Resistant to nucleases, such as ribonucleases, such as RNase H, deoxyribonucleases, such as DNase, or exonucleases, such as 5'-3' exonucleases and 3'-5' exonucleases. In some examples, 2'-O-methyl modified polynucleic acid molecules are nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some examples, 2'O-methoxyethyl (2'-O-MOE) modified polynucleic acid molecules are nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some examples, 2'-O-aminopropyl modified polynucleic acid molecules are nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some instances, the 2'-deoxy modified polynucleic acid molecule is nuclease resistant (eg, RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant).In some examples, 2'-deoxy-2'-fluoro modified polynucleic acid molecules are nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some examples, 2'-O-aminopropyl (2'-O-AP) modified polynucleic acid molecules are nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some examples, 2'-O-dimethylaminoethyl (2'-O-DMAOE) modified polynucleic acid molecules are nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some examples, 2'-O-dimethylaminopropyl (2'-O-DMAP) modified polynucleic acid molecules are nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some examples, 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE) modified polynucleic acid molecules are nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some examples, 2'-O-methylacetamide (2'-O-NMA) modified polynucleic acid molecules are nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some examples, LNA modified polynucleic acid molecules are nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some examples, ENA modified polynucleic acid molecules are nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some examples, HNA modified polynucleic acid molecules are nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some examples, morpholinos are nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant).In some examples, PNA modified polynucleic acid molecules are resistant to nucleases (e.g., RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some examples, methylphosphonate nucleotide modified polynucleic acid molecules are resistant to nucleases (e.g., RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some examples, thiol phosphonate nucleotide modified polynucleic acid molecules are resistant to nucleases (e.g., RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some examples, polynucleic acid molecules comprising 2'-fluoro N3-P5'-phosphoramidites are resistant to nucleases (e.g., RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistant). In some examples, the 5' conjugates described herein inhibit 5'-3' exonucleolytic cleavage. In some examples, the 3' conjugates described herein inhibit 3'-5' exonucleolytic cleavage.

[0139] Polynucleic acid molecule synthesis In some embodiments, the polynucleic acid molecules described herein are constructed using chemical synthesis and / or enzymatic ligation reactions using procedures known in the art.For example, polynucleic acid molecules are chemically synthesized using naturally occurring nucleotides or various modified nucleotides designed to increase the biological stability of the molecule or increase the physical stability of the duplex formed between the polynucleic acid molecule and target nucleic acid.Exemplary methods include those described in US Patent Nos. 5,142,047, 5,185,444, 5,889,136, 6,008,400 and 6,111,086, WO2009099942, or EP1579015.Further exemplary methods include those described by Griffey et al., "2'-O-aminopropyl ribonucleotides: a zwitterionic modification that enhances the exonuclease resistance and biological activity of antisense oligonucleotides," J. Med. Chem. 39(26):5100-5109 (1997); Obika et al., "Synthesis of 2'-O,4'-C-methyleneuridine and -cytidine. Novel bicyclic nucleosides having a fixed C3,-endo sugar puckering," Tetrahedron Letters 38(50):8735 (1997); Koizumi, M., "ENA oligonucleotides as therapeutics," Current opinion in molecular therapeutics 8(2):144-149 (2006); and Abramova et al., "Novel oligonucleotide analogues based on morpholino nucleoside subunits-antisense technologies: new chemical Alternatively, the polynucleic acid molecule is produced biologically using an expression vector into which the polynucleic acid molecule has been subcloned in an antisense orientation (i.e., the RNA transcribed from the inserted polynucleic acid molecule is in an antisense orientation relative to the desired target polynucleic acid molecule).

[0140] In some aspects, the polynucleic acid molecule is synthesized by tandem synthesis, where both strands are synthesized as a single contiguous oligonucleotide fragment or strand separated by a cleavable linker, which is then cleaved to provide separate fragments or strands that hybridize and allow for purification of the two strands.

[0141] For example, further modification methods for incorporating sugar, base, and phosphate modifications are described in Eckstein et al., International Publication No. WO 92 / 07065; Perrault et al., Nature, 1990, 344, 565-568; Pieken et al., Science, 1991, 253, 314-317; Usman and Cedergren, Trends in Biochem. Sci., 1992, 17, pp. 334-339; Usman, WO 93 / 15187; Sproat, U.S. Pat. No. 5,334,711; Beigelman et al., 1995, J. Biol. Chem., 270, 25702; Beigelman et al., WO 97 / 26270; Beigelman et al., U.S. Pat. No. 5,716,824; Usman et al., U.S. Pat. No. 5,627,053; Woolf et al., WO 98 / 13526; Thompson et al., U.S. Provisional Patent Application No. 60 / 082,404, filed Apr. 20, 1998; Karpeisky et al., 1998, Tetrahedron Lett., 39, 1131; Earnshaw and Gait, 1998, Biopolymers (Nucleic Acid Sciences), 48, 39-55; Verma and Eckstein, 1998, Annu. Rev. Biochem., 67, 99-134; and Burlina et al., 1997, Bioorg. Med. Chem., 5, 1999-2010. Such publications describe general methods and strategies for determining the location of incorporation of sugar, base, and / or phosphate modifications into nucleic acid molecules without modulating catalysis.

[0142] In some cases, chemical modification of the internucleotide bond of polynucleic acid molecules using phosphorothioate, phosphorodithioate, and / or 5'-methylphosphonate bond improves stability, but excessive modification may cause toxicity or reduced activity.Therefore, when designing nucleic acid molecules, the amount of these internucleotide bonds is sometimes minimized.In such cases, reducing the concentration of these bonds reduces the toxicity, increases the efficacy, and enhances the specificity of these molecules.

[0143] antibody In some aspects, the antibody or antigen-binding fragment thereof comprises a humanized antibody or antigen-binding fragment thereof, a murine antibody or antigen-binding fragment thereof, a chimeric antibody or antigen-binding fragment thereof, a monoclonal antibody or antigen-binding fragment thereof, a monovalent Fab', a bivalent Fab2, a F(ab)'3 fragment, a single chain variable fragment (scFv), a bis-scFv, an (scFv)2, a diabody, a minibody, a nanobody, a triabody, a tetrabody, a disulfide-stabilized Fv protein (dsFv), a single domain antibody (sdAb), an Ig NAR, a camelid antibody or antigen-binding fragment thereof, a bispecific antibody or antigen-binding fragment thereof, or a chemically modified derivative thereof.

[0144] In some examples, the antibody is an anti-transferrin receptor (anti-CD71) antibody or an antigen-binding fragment thereof. In some cases, the anti-transferrin receptor antibody is a humanized antibody or an antigen-binding fragment thereof. In other cases, the anti-transferrin receptor antibody is a chimeric antibody or an antigen-binding fragment thereof. In further cases, the anti-transferrin receptor antibody is a monovalent, bivalent, or multivalent antibody or an antigen-binding fragment thereof. In some embodiments, exemplary anti-transferrin receptor antibodies or antigen-binding fragments thereof include MAB5746 from R&D Systems, AHP858 from Bio-Rad Laboratories, A80-128A from Bethyl Laboratories, Inc., and T2027 from MilliporeSigma. In some embodiments, the anti-transferrin receptor antibody or antigen-binding fragment thereof includes the antibodies disclosed in U.S. Pat. No. 10,913,800 or U.S. Pat. No. 11,028,179.

[0145] In some examples, the anti-transferrin receptor antibody comprises a variable heavy chain (VH) region and a variable light chain (VL) region, wherein the VH region comprises an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of EINPIX1GRSNYAX2KFQG (SEQ ID NO: 12), where X1 is selected from N or Q and X2 is selected from Q or E, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19.

[0146] In some embodiments, the VH region of the anti-transferring antibody comprises an HCDR1 sequence, an HCDR2 sequence, and an HCDR3 sequence selected from Table 2.

[0147] [Table 3]

[0148] In some embodiments, the VH region comprises an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 18, 20, or 21, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19. In some examples, the VH region comprises an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 18, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19. In some examples, the VH region comprises an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 20, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19. In some examples, the VH region comprises an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 21, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19.

[0149] In some embodiments, the VL region of the anti-transferrin receptor antibody comprises an LCDR1 sequence that comprises or consists of the sequence of RTSENIYX3NLA (SEQ ID NO: 13), an LCDR2 sequence that comprises or consists of the sequence of AX4TNLAX5 (SEQ ID NO: 14), and an LCDR3 sequence that comprises or consists of the sequence of QHFWGTPLTX6 (SEQ ID NO: 15), wherein X3 is selected from N or S, X4 is selected from A or G, X5 is selected from D or E, and X6 is present or absent, and if present is F.

[0150] In some embodiments, the VL region of the anti-transferrin receptor antibody comprises an LCDR1, LCDR2, and LCDR3 sequence selected from Table 3.

[0151] [Table 4]

[0152] In some examples, the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 13, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 23, 25, or 28, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 24 or 26, wherein X3 is selected from N or S.

[0153] In some examples, the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 22 or 27, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 14, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 24 or 26, wherein X4 is selected from A or G, and X5 is selected from D or E.

[0154] In some examples, the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 22 or 27, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 23, 25, or 28, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 15, wherein X6 is present or absent and, if present, is F.

[0155] In some examples, the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 22, an LCDR2 sequence comprising or consisting of the sequence of AATNLAX5 (SEQ ID NO: 16), and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 15, wherein X5 is selected from D or E, and X6 is present or absent, and if present is F.

[0156] In some examples, the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO:22, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO:23, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO:24.

[0157] In some examples, the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO:22, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO:25, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO:26.

[0158] In some examples, the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO:27, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO:28, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO:26.

[0159] In some embodiments, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 12, wherein X1 is selected from N or Q and X2 is selected from Q or E, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19; and the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 13, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 14, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 15, wherein X3 is selected from N or S, X4 is selected from A or G, X5 is selected from D or E, and X6 is present or absent, and if present is F.

[0160] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, the VH region comprising an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 12, wherein X1 is selected from N or Q and X2 is selected from Q or E, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19, and the VL region comprising an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 13, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 23, 25, or 28, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 24 or 26, wherein X3 is selected from N or S.

[0161] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 12, wherein X1 is selected from N or Q and X2 is selected from Q or E, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19; and the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 22 or 27, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 14, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 24 or 26, wherein X4 is selected from A or G and X5 is selected from D or E.

[0162] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 12, wherein X1 is selected from N or Q and X2 is selected from Q or E, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19, and the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 22 or 27, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 23, 25, or 28, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 15, wherein X6 is present or absent, and if present is F.

[0163] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 12, wherein X1 is selected from N or Q and X2 is selected from Q or E, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19; and the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 22, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 16, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 15, wherein X5 is selected from D or E, and X6 is present or absent, and if present is F.

[0164] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, the VH region comprising an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 12, wherein X1 is selected from N or Q and X2 is selected from Q or E, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19, and the VL region comprising an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 22, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 23, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 24.

[0165] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, the VH region comprising an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 12, wherein X1 is selected from N or Q and X2 is selected from Q or E, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19, and the VL region comprising an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 22, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 25, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 26.

[0166] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, the VH region comprising an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 12, wherein X1 is selected from N or Q and X2 is selected from Q or E, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19, and the VL region comprising an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 27, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 28, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 26.

[0167] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 18, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19; and the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 13, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 23, 25, or 28, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 24 or 26, wherein X3 is selected from N or S.

[0168] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 18, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19; the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 22 or 27, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 14, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 24 or 26, wherein X4 is selected from A or G and X5 is selected from D or E.

[0169] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 18, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19; the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 22 or 27, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 23, 25, or 28, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 15, wherein X6 is present or absent and, if present, is F.

[0170] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 18, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19; the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 22, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 16, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 15; X5 is selected from D or E, and X6 is present or absent, and if present is F.

[0171] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 18, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19, and the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 22, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 23, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 24.

[0172] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 18, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19, and the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 22, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 21, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 26.

[0173] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 18, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19, and the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 27, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 28, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 26.

[0174] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 20, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19; and the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 13, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 23, 25, or 28, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 24 or 26, wherein X3 is selected from N or S.

[0175] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 20, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19; the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 22 or 27, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 14, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 24 or 26, wherein X4 is selected from A or G and X5 is selected from D or E.

[0176] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 20, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19; the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 22 or 27, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 23, 25, or 28, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 15, wherein X6 is present or absent and, if present, is F.

[0177] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 20, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19; the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 22, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 16, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 15; X5 is selected from D or E, and X6 is present or absent, and if present is F.

[0178] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 20, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19, and the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 22, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 23, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 24.

[0179] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 20, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19, and the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 22, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 25, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 26.

[0180] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 20, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19, and the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 27, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 28, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 26.

[0181] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 21, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19; and the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 13, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 23, 25, or 28, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 24 or 26, wherein X3 is selected from N or S.

[0182] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 21, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19; the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 22 or 27, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 14, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 24 or 26, wherein X4 is selected from A or G and X5 is selected from D or E.

[0183] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 21, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19; the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 22 or 27, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 23, 25, or 28, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 15, wherein X6 is present or absent and, if present, is F.

[0184] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 21, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19; the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 22, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 16, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 15; X5 is selected from D or E, and X6 is present or absent, and if present is F.

[0185] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 21, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19, and the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 22, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 23, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 24.

[0186] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 21, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19, and the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 22, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 25, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 26.

[0187] In some examples, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the VH region comprises an HCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 21, and an HCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 19, and the VL region comprises an LCDR1 sequence comprising or consisting of the sequence of SEQ ID NO: 27, an LCDR2 sequence comprising or consisting of the sequence of SEQ ID NO: 28, and an LCDR3 sequence comprising or consisting of the sequence of SEQ ID NO: 26.

[0188] In some embodiments, the anti-transferrin receptor antibody comprises a VH region and a VL region, wherein the sequence of the VH region comprises or consists of a sequence having about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% sequence identity to a sequence selected from SEQ ID NOs:29-33, and the sequence of the VL region comprises or consists of a sequence having about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% sequence identity to a sequence selected from SEQ ID NOs:34-38. In some embodiments, the anti-transferrin receptor antibody comprises a VH region and a VL region, the sequence of the VH region comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a sequence selected from the sequences of SEQ ID NOs: 29-33, and the sequence of the VL region comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a sequence selected from the sequences of SEQ ID NOs: 34-38. In some embodiments, the anti-transferrin receptor antibody comprises a VH region and a VL region, the sequence of the VH region comprises or consists of a sequence selected from the sequences of SEQ ID NOs: 29-33, and the sequence of the VL region comprises or consists of a sequence selected from the sequences of SEQ ID NOs: 34-38.

[0189] In some embodiments, the VH region comprises or consists of a sequence selected from SEQ ID NOs: 29-33 (Table 4), and the VL region comprises or consists of a sequence selected from SEQ ID NOs: 34-38 (Table 5). The underlined regions in Tables 4 and 5 indicate the respective CDR1, CDR2, or CDR3 sequences.

[0190] [Table 5]

[0191] [Table 6]

[0192] In some embodiments, the anti-transferrin receptor antibody comprises the VH and VL regions illustrated in Table 6.

[0193] [Table 7]

[0194] In some embodiments, the anti-transferrin receptor antibodies described herein comprise an IgG framework, an IgA framework, an IgE framework, or an IgM framework. In some examples, the anti-transferrin receptor antibody comprises an IgG framework (e.g., IgG1, IgG2, IgG3, or IgG4). Optionally, the anti-transferrin receptor antibody comprises an IgG1 framework. Optionally, the anti-transferrin receptor antibody comprises an IgG2 (e.g., IgG2a or IgG2b) framework. Optionally, the anti-transferrin receptor antibody comprises an IgG2a framework. Optionally, the anti-transferrin receptor antibody comprises an IgG2b framework. Optionally, the anti-transferrin receptor antibody comprises an IgG3 framework. Optionally, the anti-transferrin receptor antibody comprises an IgG4 framework.

[0195] In some cases, the anti-transferrin receptor antibody comprises one or more mutations in the framework region, such as the CH1 domain, the CH2 domain, the CH3 domain, the hinge region, or a combination thereof. In some examples, the one or more mutations are for stabilizing the antibody and / or extending half-life. In some examples, the one or more mutations are for modulating Fc receptor interaction and reducing or eliminating Fc effector functions such as FcyR, antibody-dependent cell-mediated cytotoxicity (ADCC), or complement-dependent cytotoxicity (CDC). In further examples, the one or more mutations are for modulating glycosylation.

[0196] In some embodiments, the one or more mutations are located in the Fc region. In some examples, the Fc region comprises a mutation at residue position L234, L235, or a combination thereof. In some examples, the mutation comprises L234 and L235. In some examples, the mutation comprises L234A and L235A. Optionally, the residue position is relative to IgG1.

[0197] In some examples, the Fc region comprises a mutation at residue position L234, L235, D265, N21, K46, L52, or P53, or a combination thereof. In some examples, the mutation comprises L234 and L235 in combination with a mutation at residue position K46, L52, or P53. Optionally, the Fc region comprises a mutation at L234, L235, and K46. Optionally, the Fc region comprises a mutation at L234, L235, and L52. Optionally, the Fc region comprises a mutation at L234, L235, and P53. Optionally, the Fc region comprises a mutation at D265 and N21. Optionally, the residue position is relative to IgG1.

[0198] In some examples, the Fc region comprises L234A, L235A, D265A, N21G, K46G, L52R, or P53G, or a combination thereof. In some examples, the Fc region comprises L234A and L235A in combination with K46G, L52R, or P53G. Optionally, the Fc region comprises L234A, L235A, and K46G. Optionally, the Fc region comprises L234A, L235A, and L52R. Optionally, the Fc region comprises L234A, L235A, and P53G. Optionally, the Fc region comprises D265A and N21G. Optionally, the residue position is relative to IgG1.

[0199] In some examples, the Fc region comprises a mutation or a combination of mutations at residue positions L235, L236, D265, N21, K46, L52, or P53. In some examples, the Fc region comprises a mutation at L235 and L236. In some examples, the Fc region comprises a mutation at L235 and L236 in combination with a mutation at residue position K46, L52, or P53. Optionally, the Fc region comprises a mutation at L235, L236, and K46. Optionally, the Fc region comprises a mutation at L235, L236, and L52. Optionally, the Fc region comprises a mutation at L235, L236, and P53. Optionally, the Fc region comprises a mutation at D265 and N21. Optionally, the residue positions are related to IgG2b.

[0200] In some embodiments, the Fc region comprises L235A, L236A, D265A, N21G, K46G, L52R, or P53G, or a combination thereof. In some examples, the Fc region comprises L235A and L236A. In some examples, the Fc region comprises L235A and L236A in combination with K46G, L52R, or P53G. Optionally, the Fc region comprises L235A, L236A, and K46G. Optionally, the Fc region comprises L235A, L236A, and L52R. Optionally, the Fc region comprises L235A, L236A, and P53G. Optionally, the Fc region comprises D265A and N21G. Optionally, the residue position is relative to IgG2b.

[0201] In some embodiments, the Fc region comprises a mutation at residue position L233, L234, D264, N20, K45, L51, or P52, the residues corresponding to positions 233, 234, 264, 20, 45, 51, and 52 of SEQ ID NO: 39. In some examples, the Fc region comprises a mutation at L233 and L234. In some examples, the Fc region comprises a mutation at L233 and L234 in combination with a mutation at residue position K45, L51, or P52. Optionally, the Fc region comprises a mutation at L233, L234, and K45. Optionally, the Fc region comprises a mutation at L233, L234, and L51. Optionally, the Fc region comprises a mutation at L233, L234, and K45. Optionally, the Fc region comprises mutations at L233, L234, and P52. In some examples, the Fc region comprises mutations at D264 and N20. Optionally, equivalent positions to residues L233, L234, D264, N20, K45, L51, or P52 in IgG1, IgG2, IgG3, or IgG4 frameworks are contemplated. Optionally, mutations to residues corresponding to residues L233, L234, D264, N20, K45, L51, or P52 of SEQ ID NO: 39 in IgG1, IgG2, or IgG4 frameworks are also contemplated.

[0202] In some embodiments, the Fc region comprises L233A, L234A, D264A, N20G, K45G, L51R, or P52G, where the residues correspond to positions 233, 234, 264, 20, 45, 51, and 52 of SEQ ID NO: 39. In some examples, the Fc region comprises L233A and L234A. In some examples, the Fc region comprises L233A and L234A in combination with K45G, L51R, or P52G. Optionally, the Fc region comprises L233A, L234A, and K45G. Optionally, the Fc region comprises L233A, L234A, and L51R. Optionally, the Fc region comprises L233A, L234A, and K45G. Optionally, the Fc region comprises L233A, L234A, and P52G. Optionally, the Fc region comprises D264A and N20G.

[0203] In some embodiments, the human IgG constant region can be any of the antibodies described in, e.g., Natsume et al., 2008 Cancer Res, 68(10):3863-72; Idusogie et al., 2001 J Immunol, 166(4):2571-5; Moore et al., 2010 mAbs, 2(2):181-189; Lazar et al., 2006 PNAS, 103(11):4005-4010; Shields et al., 2001 JBC, 276(9):6591-6604; Stavenhagen et al., 2007 Cancer Res, 67(18):8882-8890; Stavenhagen et al., 2008 Advan. Enzyme Regul., 48:152-164; Alegre et al., 1992 J Immunol, 2009, 2010, 2011, 2012, 2013, 2014, 2015, 2016, 2017, 2018, 2019, 2020, 2030, 2040, 2050, 2060, 2070, 2082, 2090 ... Immunol, 148:3461-3468; Reviewed in Kaneko and Niwa, 2011 Biodrugs, 25(1):1-11, are used to modify antibody-dependent cellular cytotoxicity (ADCC) and / or complement-dependent cytotoxicity (CDC).

[0204] In some embodiments, the anti-transferrin receptor antibodies described herein are full-length antibodies comprising a heavy chain (HC) and a light chain (LC). Optionally, the heavy chain (HC) comprises a sequence selected from Table 7. Optionally, the light chain (LC) comprises a sequence selected from Table 8. The underlined regions represent the respective CDRs.

[0205] [Table 8-1]

[0206] [Table 8-2]

[0207] [Table 8-3]

[0208] [Table 8-4]

[0209] [Table 8-5]

[0210] [Table 9]

[0211] In some embodiments, the anti-transferrin receptor antibodies described herein have improved serum half-life compared to a reference anti-transferrin receptor antibody. In some examples, the improved serum half-life is at least 30 minutes, 1 hour, 1.5 hours, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 12 hours, 18 hours, 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 14 days, 30 days, or more, longer than the reference anti-transferrin receptor antibody.

[0212] In some embodiments, the antibody or antigen-binding fragment thereof is further modified using conventional techniques known in the art, for example, by using amino acid deletion, insertion, substitution, addition, and / or by using recombination and / or any other modification known in the art (e.g., post-translational modifications such as glycosylation and phosphorylation and chemical modifications), alone or in combination. In some examples, the modification further comprises a modification for regulating interaction with Fc receptor. In some examples, the one or more modifications comprise, for example, the modifications described in WO 97 / 34631, which discloses amino acid residues involved in the interaction of the Fc domain with the FcRn receptor. Methods for introducing such modifications into the nucleic acid sequence underlying the amino acid sequence of the antibody or binding fragment thereof are well known to those skilled in the art.

[0213] In some examples, the antibody or antigen-binding fragment thereof further includes derivatives thereof and comprises a polypeptide sequence containing at least one CDR.

[0214] In some instances, the term "single-chain" as used herein means that the first and second domains of the bispecific single-chain construct are covalently linked, preferably in the form of a colinear amino acid sequence that can be encoded by a single nucleic acid molecule.

[0215] In some examples, the bispecific single chain antibody construct relates to a construct comprising two antibody-derived binding domains. In such an embodiment, the bispecific single chain antibody construct is a tandem to bi-scFv or diabody. In some examples, the scFv comprises a VH and a VL domain connected by a linker peptide. In some examples, the linker has a length and sequence sufficient to ensure that each of the first and second domains can retain their different binding specificities independently of each other.

[0216] In some embodiments, binding or interaction, as used herein, defines that at least two antigen interaction sites bind / interact with each other. In some examples, the antigen interaction site defines a motif of a polypeptide that exhibits the ability of specific interaction with a specific antigen or a specific group of antigens. In some cases, binding / interaction is also understood to define specific recognition. In such cases, specific recognition refers to whether an antibody or a binding fragment thereof can specifically interact and / or bind with at least two amino acids of each of a target molecule. For example, specific recognition relates to the specificity of an antibody molecule or the ability of an antibody molecule to discriminate a specific region of a target molecule. In further examples, the specific interaction of an antigen interaction site with its specific antigen results in the initiation of a signal, for example, due to induction of a conformational change of the antigen, oligomerization of the antigen, etc. In further embodiments, the binding is exemplified by the specificity of the "key-lock-principle". Thus, in some instances, specific motifs in the amino acid sequence of the antigen interaction site and the antigen bind to each other as a result of their primary, secondary, or tertiary structures, as well as secondary modifications of these structures. In such cases, the specific interaction of the antigen interaction site with its specific antigen similarly results in simple binding of the site to the antigen.

[0217] In some cases, specific interaction further refers to the reduction of cross-reactivity of the antibody or its binding fragment, or the reduction of off-target effects.For example, an antibody or its antigen-binding fragment that binds to a polypeptide / protein of interest but does not bind or essentially does not bind to any other polypeptide is considered to be specific for the polypeptide / protein of interest.Examples of the specific interaction between an antigen interaction site and a specific antigen include the specificity of a ligand to its receptor, for example, the interaction between an antigenic determinant (epitope) and an antigen-binding site of an antibody.

[0218] Thus, in some examples, the polynucleic acid molecule conjugate comprises a polynucleic acid molecule (e.g., a PMO molecule) that comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs: 100-133, and an anti-transferrin receptor antibody or antigen-binding fragment thereof conjugated to the polynucleic acid such that the polynucleic acid molecule conjugate induces exon skipping of the pre-mRNA of the DMD gene.

[0219] In certain embodiments, the polynucleic acid molecule conjugate comprises an anti-transferrin receptor antibody or antigen-binding fragment thereof conjugated to a polynucleic acid molecule (e.g., a PMO molecule) that hybridizes to a sequence of a target region of a pre-mRNA transcript of a DMD gene, the polynucleic acid molecule having a sense strand that comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs: 100-133, and the anti-transferrin receptor antibody or antigen-binding fragment thereof comprises a variable heavy chain (VH) region and a variable light chain (VL) region. the VH region comprises an HCDR1 sequence comprising or consisting of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of SEQ ID NO: 20, and an HCDR3 sequence comprising or consisting of SEQ ID NO: 19; the VL region comprises an LCDR1 sequence comprising or consisting of SEQ ID NO: 22, an LCDR2 sequence comprising or consisting of SEQ ID NO: 23, and an LCDR3 sequence comprising or consisting of SEQ ID NO: 24; and the anti-transferrin receptor antibody or antigen-binding fragment thereof and the polynucleic acid molecule are conjugated via a linker comprising 4-(N-maleimidomethyl)cyclohexane-1-amidate (SMCC).

[0220] In certain embodiments, the polynucleic acid molecule conjugate comprises an anti-transferrin receptor antibody or antigen-binding fragment thereof conjugated to a polynucleic acid molecule (e.g., a PMO molecule) that hybridizes to a sequence of a target region of a pre-mRNA transcript of the DMD gene, the polynucleic acid molecule comprising or consisting of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs: 100-133, and the polynucleic acid molecule conjugate comprises an anti-transferrin receptor antibody or antigen-binding fragment thereof conjugated to a polynucleic acid molecule (e.g., a PMO molecule) that hybridizes to a sequence of a target region of a pre-mRNA transcript of the DMD gene, the polynucleic acid molecule comprising or consisting of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs: 100-133, the anti-transferrin receptor antibody or The antigen-binding fragment comprises a variable heavy chain (VH) region and a variable light chain (VL) region, wherein the VH region comprises or consists of a sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 30, and the VL region comprises or consists of a sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 34, and the anti-transferrin receptor antibody or antigen-binding fragment thereof and the polynucleic acid molecule are conjugated via a maleimide linker.

[0221] In certain embodiments, the polynucleic acid molecule conjugate comprises an anti-transferrin receptor antibody or antigen-binding fragment thereof conjugated to a polynucleic acid molecule (e.g., a PMO molecule) that hybridizes to a sequence of a target region of a pre-mRNA transcript of the DMD gene, the polynucleic acid molecule comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs: 100-133, the polynucleic acid molecule comprises at least 3, 4, 5, or 6 contiguous 2'-O-methyl modified nucleotides at the 5' end and at least 2'-O-methyl modified nucleotides at the 6' end. and at least three 2'-F modified nucleotides; the anti-transferrin receptor antibody or antigen-binding fragment thereof comprises a variable heavy chain (VH) region and a variable light chain (VL) region, wherein the VH region comprises or consists of a sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO:30 and the VL region comprises or consists of a sequence having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO:34; and the anti-transferrin receptor antibody or antigen-binding fragment thereof and the polynucleic acid molecule are conjugated via a maleimide linker.

[0222] In certain embodiments, the polynucleic acid molecule conjugate comprises an anti-transferrin receptor antibody or antigen-binding fragment thereof conjugated to a polynucleic acid molecule (e.g., a PMO molecule) that hybridizes to a sequence of a target region of a pre-mRNA transcript of the DMD gene, wherein the polynucleic acid molecule comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs: 100-133, and wherein the polynucleic acid molecule comprises at least two, at least three, at least four, or at least five contiguous 2'-O-methyl modified nucleotides at the 3' end of the polynucleic acid molecule and at least one, at least two, at least three, at least four, or at least five contiguous 2'-O-methyl modified nucleotides at the 3' end of the polynucleic acid molecule. and at least three and at least four 2'-F modified nucleotides, the anti-transferrin receptor antibody or antigen-binding fragment thereof comprising a variable heavy chain (VH) region and a variable light chain (VL) region, the VH region comprising an HCDR1 sequence comprising or consisting of SEQ ID NO:17, an HCDR2 sequence comprising or consisting of SEQ ID NO:20, and an HCDR3 sequence comprising or consisting of SEQ ID NO:19, the VL region comprising an LCDR1 sequence comprising or consisting of SEQ ID NO:22, an LCDR2 sequence comprising or consisting of SEQ ID NO:23, and an LCDR3 sequence comprising or consisting of SEQ ID NO:24, and the anti-transferrin receptor antibody or antigen-binding fragment thereof and the polynucleic acid molecule are conjugated via a maleimide linker.

[0223] In certain embodiments, the polynucleic acid molecule conjugate comprises an anti-transferrin receptor antibody or antigen-binding fragment thereof conjugated to a polynucleic acid molecule (e.g., a PMO molecule) that hybridizes to a sequence of a target region of a pre-mRNA transcript of the DMD gene, the polynucleic acid molecule comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs: 100-133, the polynucleic acid molecule comprises one or more 2'-O-methyl modified nucleotides at the 5' end and / or the 3' end of the polynucleic acid molecule, and is an anti-transferrin receptor antibody or antigen-binding fragment thereof conjugated to a polynucleic acid molecule (e.g., a PMO molecule) that hybridizes to a sequence of a target region of a pre-mRNA transcript of the DMD gene, the polynucleic acid molecule comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs: 100-133, the polynucleic acid molecule comprises one or more 2'-O-methyl modified nucleotides at the 5' end and / or the 3' end of the polynucleic acid molecule, and The anti-transferrin receptor antibody or antigen-binding fragment thereof comprises a variable heavy chain (VH) region and a variable light chain (VL) region, wherein the VH region comprises an HCDR1 sequence comprising or consisting of SEQ ID NO: 17, an HCDR2 sequence comprising or consisting of SEQ ID NO: 18, and an HCDR3 sequence comprising or consisting of SEQ ID NO: 19, and the VL region comprises an LCDR1 sequence comprising or consisting of SEQ ID NO: 22, an LCDR2 sequence comprising or consisting of SEQ ID NO: 3, and an LCDR3 sequence comprising or consisting of SEQ ID NO: 24, and the anti-transferrin receptor antibody or antigen-binding fragment thereof and the polynucleic acid molecule are conjugated via a maleimide linker.

[0224] In certain embodiments, the polynucleic acid molecule conjugate comprises an anti-transferrin receptor antibody or antigen-binding fragment thereof conjugated to a polynucleic acid molecule (e.g., a PMO molecule) that hybridizes to a target sequence of a pre-mRNA transcript of the DMD gene, wherein the polynucleic acid molecule comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs: 100-133, and the anti-transferrin receptor antibody or antigen-binding fragment thereof comprises a variable heavy (VH) region and a variable light (VL) region. The anti-transferrin receptor antibody or antigen-binding fragment thereof and the polynucleic acid molecule are conjugated via a 6-amino-1-hexanol linker. In some examples, the polynucleic acid molecule comprises at least one or more 2'-modified nucleotides. In some examples, the polynucleic acid molecule comprises at least five consecutive 2'-O-methyl modified nucleotides at the 3' end. In some examples, the polynucleic acid molecule comprises at least three or at least four 2'-F modified nucleotides, and any two of the at least three or at least four 2'-F modified nucleotides are not consecutive.

[0225] In some embodiments, the antibody or antigen-binding fragment thereof is non-specifically conjugated to any of the PMO molecules disclosed herein. In some examples, the antibody or antigen-binding fragment thereof is non-site-specifically conjugated to any of the PMO molecules disclosed herein via a lysine residue or a cysteine ​​residue. In some examples, the antibody or antigen-binding fragment thereof is non-site-specifically conjugated to any of the PMO molecules disclosed herein via a lysine residue. In some cases, the antibody or antigen-binding fragment thereof is non-site-specifically conjugated to any of the PMO molecules disclosed herein via a cysteine ​​residue.

[0226] In some embodiments, the antibody or antigen-binding fragment thereof is site-specifically conjugated to any of the PMO molecules disclosed herein. In some examples, the antibody or antigen-binding fragment thereof is site-specifically conjugated to any of the PMO molecules disclosed herein via a lysine residue, via a cysteine ​​residue, at the 5' end, at the 3' end, via a non-natural amino acid, or via an enzyme-modified or enzyme-catalyzed residue. In some examples, the antibody or antigen-binding fragment thereof is site-specifically conjugated to any of the PMO molecules disclosed herein via a lysine residue. In some examples, the antibody or antigen-binding fragment thereof is site-specifically conjugated to any of the PMO molecules disclosed herein via a cysteine ​​residue. In some examples, the antibody or antigen-binding fragment thereof is site-specifically conjugated to any of the PMO molecules disclosed herein via the 5' end. In some examples, the antibody or antigen-binding fragment thereof is site-specifically conjugated to any of the PMO molecules disclosed herein via the 3' end. In some examples, an antibody or antigen-binding fragment thereof is site-specifically conjugated to any of the PMO molecules disclosed herein via a non-natural amino acid. In some examples, an antibody or antigen-binding fragment thereof is site-specifically conjugated to any of the PMO molecules disclosed herein via an enzyme-modifying or enzyme-catalyzed residue.

[0227] In some embodiments, one or more PMO molecules are conjugated to any of the antibodies or antigen-binding fragments thereof disclosed herein. In some examples, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more PMO molecules are conjugated to an antibody or antigen-binding fragment thereof. In some examples, about 1 PMO molecule is conjugated to one antibody or antigen-binding fragment thereof. In some examples, about 2 PMO molecules are conjugated to one antibody or antigen-binding fragment thereof. In some examples, about 3 PMO molecules are conjugated to one antibody or antigen-binding fragment thereof. In some examples, about 4 PMO molecules are conjugated to one. In some examples, about 5 PMO molecules are conjugated to one antibody or antigen-binding fragment thereof. In some examples, about 6 PMO molecules are conjugated to one antibody or antigen-binding fragment thereof. In some examples, about 7 PMO molecules are conjugated to one antibody or antigen-binding fragment thereof. In some examples, about 8 PMO molecules are conjugated to one antibody or antigen-binding fragment thereof.

[0228] In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 PMO molecules are conjugated to an antibody or antigen-binding fragment thereof. In some examples, at least one PMO molecule is conjugated to an antibody or antigen-binding fragment thereof. In some examples, at least two PMO molecules are conjugated to an antibody or antigen-binding fragment thereof. In some examples, at least three PMO molecules are conjugated to an antibody or antigen-binding fragment thereof. In some examples, at least four PMO molecules are conjugated to one. In some examples, at least five PMO molecules are conjugated to an antibody or antigen-binding fragment thereof. In some examples, at least six PMO molecules are conjugated to an antibody or antigen-binding fragment thereof. In some examples, at least seven PMO molecules are conjugated to an antibody or antigen-binding fragment thereof. In some examples, at least eight PMO molecules are conjugated to one antibody or antigen-binding fragment thereof.

[0229] In some examples, about 1 to about 16 PMO molecules are conjugated to the antibody or antigen-binding fragment thereof. In some examples, about 2 to about 15 PMO molecules are conjugated to the antibody or antigen-binding fragment thereof. In some examples, about 3 to about 14 PMO molecules are conjugated to the antibody or antigen-binding fragment thereof. In some examples, about 4 to about 13 PMO molecules are conjugated to the antibody or antigen-binding fragment thereof. In some examples, about 5 to about 12 PMO molecules are conjugated to the antibody or antigen-binding fragment thereof. In some examples, about 6 to about 11 PMO molecules are conjugated to the antibody or antigen-binding fragment thereof. In some examples, about 7 to about 10 PMO molecules are conjugated to the antibody or antigen-binding fragment thereof. In some examples, about 8 to about 9 PMO molecules are conjugated to the antibody or antigen-binding fragment thereof.

[0230] In some embodiments, an average of one or more PMO molecules are conjugated to an antibody or antigen-binding fragment thereof. In some examples, an average of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more PMO molecules are conjugated to an antibody or antigen-binding fragment thereof. In some examples, an average of about 1 PMO molecule is conjugated to an antibody or antigen-binding fragment thereof. In some examples, an average of about 2 PMO molecules are conjugated to an antibody or antigen-binding fragment thereof. In some examples, an average of about 3 PMO molecules are conjugated to an antibody or antigen-binding fragment thereof. In some examples, an average of about 4 PMO molecules are conjugated to an antibody or antigen-binding fragment thereof. In some examples, an average of about 5 PMO molecules are conjugated to an antibody or antigen-binding fragment thereof. In some examples, an average of about 6 PMO molecules are conjugated to an antibody or antigen-binding fragment thereof. In some examples, an average of about 7 PMO molecules are conjugated to one antibody or antigen-binding fragment thereof. In some examples, an average of about 8 PMO molecules are conjugated to one antibody or antigen-binding fragment thereof.

[0231] In some examples, an average of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 PMO molecules are conjugated to an antibody or antigen-binding fragment thereof. In some examples, an average of at least 1 PMO molecule is conjugated to an antibody or antigen-binding fragment thereof. In some examples, an average of at least 2 PMO molecules are conjugated to an antibody or antigen-binding fragment thereof. In some examples, an average of at least 3 PMO molecules are conjugated to an antibody or antigen-binding fragment thereof. In some examples, an average of at least 4 PMO molecules are conjugated to an antibody or antigen-binding fragment thereof. In some examples, an average of at least 5 PMO molecules are conjugated to an antibody or antigen-binding fragment thereof. In some examples, an average of at least 6 PMO molecules are conjugated to an antibody or antigen-binding fragment thereof. In some examples, an average of at least 7 PMO molecules are conjugated to an antibody or antigen-binding fragment thereof. In some examples, an average of at least eight PMO molecules are conjugated to one antibody or antigen-binding fragment thereof.

[0232] In some embodiments, the number of PMO molecules conjugated to an antibody forms a certain ratio. In some examples, this ratio is referred to as the DAR (drug to antibody) ratio, and the drug referred to herein is the PMO molecule. In some examples, the DAR ratio of the PMO molecule to the antibody is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more. In some examples, the DAR ratio of the PMO molecule to the antibody is about 1 or more. In some examples, the DAR ratio of the PMO molecule to the antibody is about 2 or more. In some examples, the DAR ratio of the PMO molecule to the antibody is about 3 or more. In some examples, the DAR ratio of the PMO molecule to the antibody is about 4 or more. In some examples, the DAR ratio of the PMO molecule to the antibody is about 5 or more. In some examples, the DAR ratio of the PMO molecule to the antibody is about 6 or more. In some examples, the DAR ratio of the PMO molecule to the antibody is about 7 or more. In some instances, the DAR ratio of the PMO molecule to antibody is about 8 or greater.

[0233] In some embodiments, the average number of PMO molecules conjugated to the antibody forms a certain average ratio. In some examples, the average ratio is referred to as the average DAR (drug to antibody) ratio, where the drug referred to is a PMO molecule. In some examples, the average DAR ratio of PMO molecules to antibodies is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more. In some examples, the average DAR ratio of PMO molecules to antibodies is about 1 or more. In some examples, the average DAR ratio of PMO molecules to antibodies is about 2 or more. In some examples, the average DAR ratio of PMO molecules to antibodies is about 3 or more. In some examples, the average DAR ratio of PMO molecules to antibodies is about 4 or more. In some examples, the average DAR ratio of PMO molecules to antibodies is about 5 or more. In some examples, the average DAR ratio of PMO molecules to antibodies is about 6 or more. In some examples, the average DAR ratio of PMO molecules to antibodies is about 7 or more. In some instances, the average DAR ratio of PMO molecules to antibodies is about 8 or greater.

[0234] In some embodiments, the average number of PMO molecules conjugated to the antibody forms a certain average ratio. In some examples, the average ratio is referred to as the average DAR (drug to antibody) ratio, where the drug referred to is the PMO molecule. In some examples, the average DAR ratio of PMO molecules to antibody is in the range of 1.5-2.5, 2.5-3.5, 3.5-4.5, 4.5-5.5, 5.5-6.5, 6.5-7.5, 7.5-8.5, 8.5-9.5, 9.5-10.5, 10.5-11.5, 11.5-12.5, 12.5-13.5, 13.5-14.5, 14.5-15.5, 15.5-16.5, or 16.5-17.5. In some examples, the average DAR ratio of PMO molecules to antibody is in the range of 1.5-2.5. In some examples, the average DAR ratio of PMO molecules to antibody ranges from 2.5 to 3.5. In some examples, the average DAR ratio of PMO molecules to antibody ranges from 3.5 to 4.5. In some examples, the average DAR ratio of PMO molecules to antibody ranges from 4.5 to 5.5. In some examples, the average DAR ratio of PMO molecules to antibody ranges from 5.5 to 6.5. In some examples, the average DAR ratio of PMO molecules to antibody ranges from 6.5 to 7.5. In some examples, the average DAR ratio of PMO molecules to antibody ranges from 7.5 to 8.5.

[0235] Conjugation Chemistry

[0236] In some aspects, the polynucleic acid molecules (e.g., PMOs) disclosed herein are conjugated to antibodies (e.g., antibodies disclosed herein). In some examples, antibodies include amino acids, peptides, polypeptides, proteins, antibodies, antigens, toxins, hormones, lipids, nucleotides, nucleosides, sugars, carbohydrates, polymers such as polyethylene glycol and polypropylene glycol, as well as all analogs or derivatives of these classes of substances. Further examples of antibodies also include cholesterol, phospholipids, diacylglycerol and triacylglycerol, fatty acids, carbohydrates (e.g., saturated, unsaturated, or containing substitutions), enzyme substrates, steroids such as biotin, digoxigenin, and polysaccharides. In some examples, the polynucleic acid molecules are further conjugated to polymers and, optionally, endosomolytic moieties.

[0237] In some aspects, the polynucleic acid molecule is conjugated to the antibody by a chemical ligation process. In some examples, the polynucleic acid molecule is conjugated to the antibody by native ligation. In some examples, the conjugation is as described in "Synthesis of proteins by native chemical ligation" by Dawson et al., Science 1994, 266, 776-779; "Modulation of Reactivity in Native Chemical Ligation through the Use of Thiol Additives" by Dawson et al., J. Am. Chem. Soc. 1997, 119, 4325-4329; "Protein synthesis by native chemical ligation: Expanded scope by using straightforward methodology." by Hackeng et al., Proc. Natl. Acad. Sci. USA 1999, 96, 10068-10073; or "Building complex glycopeptides: Development of a cysteine-free native chemical ligation protocol" by Wu et al., Angew. Chem. Int. Ed. 2006, 45, 4116-4125. In some examples, the conjugation is as described in U.S. Patent No. 8,936,910. In some embodiments, the polynucleic acid molecule is conjugated to the antibody via native ligation chemistry, either site-specifically or non-specifically.

[0238] In some cases, polynucleic acid molecules are conjugated to antibodies by a site-specific method using "traceless" coupling technology (Philochem). In some cases, the "traceless" coupling technology utilizes N-terminal 1,2-aminothiol groups on antibodies that are then conjugated with polynucleic acid molecules containing aldehyde groups (see Casi et al., "Site-specific traceless coupling of potent cytotoxic drugs to recombinant antibodies for pharmacodelivery," JACS 134(13):5887-5892 (2012)).

[0239] In some examples, the polynucleic acid molecule is conjugated to the antibody by a site-specific method that utilizes an unnatural amino acid that has been incorporated into the antibody. In some examples, the unnatural amino acid comprises p-acetylphenylalanine (pAcPhe). In some examples, the keto group of pAcPhe is selectively coupled to an alkoxy-amine derivative conjugate moiety to form an oxime bond (see Axup et al., "Synthesis of site-specific antibody-drug conjugates using unnatural amino acids," PNAS 109(40):16101-16106 (2012)).

[0240] In some instances, the polynucleic acid molecule is conjugated to the antibody by a site-specific method that utilizes an enzyme-catalyzed process. In some instances, the site-specific method utilizes SMARTag™ technology (Redwood). In some examples, SMARTag™ technology involves the generation of formylglycine (FGly) residues from cysteines by formylglycine generating enzyme (FGE) through an oxidation process in the presence of an aldehyde tag, followed by conjugation of FGly to alkylhydraine-functionalized polynucleic acid molecules by hydrazino-Pictet-Spengler (HIPS) ligation (see Wu et al., "Site-specific chemical modification of recombinant proteins produced in mammalian cells by using the genetically encoded aldehyde tag," PNAS 106(9):3000-3005 (2009); Agarwal et al., "A Pictet-Spengler ligation for protein chemical modification," PNAS 110(1):46-51 (2013)).

[0241] In some examples, the enzyme-catalyzed process includes microbial transglutaminase (mTG). In some cases, polynucleic acid molecules are conjugated to antibodies using a microbial transglutaminase-catalyzed process. In some examples, mTG catalyzes the formation of a covalent bond between the amide side chain of glutamine in the recognition sequence and a primary amine of the functionalized polynucleic acid molecule. In some examples, mTG is produced by Streptomyces mobarensis (see Strop et al., "Location matters: site of conjugation modulates stability and pharmacokinetics of antibody drug conjugates," Chemistry and Biology 20(2) 161-167 (2013)).

[0242] In some examples, the polynucleic acid molecule is conjugated to the antibody by the methods described in WO 2014 / 140317, which utilize a sequence-specific transpeptidase.

[0243] In some examples, the polynucleic acid molecule is conjugated to the antibody by the methods described in U.S. Patent Application Nos. 2015 / 0105539 and 2015 / 0105540.

[0244] Production of antibodies or antigen-binding fragments thereof In some aspects, the polypeptides (e.g., antibodies and antigen-binding fragments) described herein are produced using any method known in the art to be useful for the synthesis of polypeptides (e.g., antibodies), in particular by chemical synthesis or recombinant expression, preferably by recombinant expression techniques.

[0245] In some examples, antibodies or antigen-binding fragments thereof are recombinantly expressed and nucleic acids encoding the antibodies or antigen-binding fragments are constructed from chemically synthesized oligonucleotides (e.g., as described in Kutmeier et al., 1994, BioTechniques 17:242), which involves synthesis of overlapping oligonucleotides containing the antibody-encoding portions of the sequence, annealing and ligation of those oligonucleotides, followed by amplification of the ligated oligonucleotides by PCR.

[0246] Alternatively, nucleic acid molecules encoding antibodies are optionally produced from a suitable source (e.g., an antibody cDNA library, or a cDNA library generated from any tissue or cell expressing immunoglobulins) by PCR amplification using synthetic primers hybridizable to the 3' and 5' ends of the sequence, or by cloning using oligonucleotide probes specific for a particular gene sequence.

[0247] In some examples, the antibodies or antigen-binding fragments thereof are optionally produced by immunizing an animal such as a rabbit to produce polyclonal antibodies, or more preferably, by producing monoclonal antibodies as described, for example, by Kohler and Milstein (1975, Nature 256:495-497), or Kozbor et al. (1983, Immunology Today 4:72), or Cole et al. (1985 in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). Alternatively, clones encoding at least the Fab portion of the antibody are optionally obtained by screening Fab expression libraries (e.g., as described in Huse et al., 1989, Science 246:1275-1281) for clones of Fab fragments that bind to a specific antigen, or by screening antibody libraries (see, e.g., Clackson et al., 1991, Nature 352:624; Hane et al., 1997 Proc. Natl. Acad. Sci. USA 94:4937).

[0248] In some embodiments, techniques developed for the production of "chimeric antibodies" (Morrison et al., 1984, Proc. Natl. Acad. Sci. 81:851-855; Neuberger et al., 1984, Nature 312:604-608; Takeda et al., 1985, Nature 314:452-454) by splicing genes from a mouse antibody molecule of appropriate antigen specificity together with genes from a human antibody molecule of appropriate biological activity are used. Chimeric antibodies are molecules in which different portions are derived from different animal species, such as those having a variable region derived from a mouse monoclonal antibody and a human immunoglobulin constant region, e.g., a humanized antibody.

[0249] In some embodiments, techniques described for the production of single chain antibodies (U.S. Pat. No. 4,694,778; Bird, 1988, Science 242:423-42; Huston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Ward et al., 1989, Nature 334:544-54) are suitable for producing single chain antibodies. Single chain antibodies are formed by linking the heavy and light chain fragments of the Fv region via an amino acid bridge, resulting in a single chain polypeptide. Techniques for constructing functional Fv fragments in E. coli are also optionally used (Skerra et al., 1988, Science 242:1038-1041).

[0250] In some aspects, an expression vector containing the antibody nucleotide sequence, or the antibody nucleotide sequence, is transfected into a host cell by conventional techniques (e.g., electroporation, liposomal transfection, and calcium phosphate precipitation) and the transfected cells are then cultured by conventional techniques to produce the antibody. In certain aspects, expression of the antibody is regulated by a constitutive, inducible, or tissue-specific promoter.

[0251] In some aspects, a variety of host-expression vector systems are utilized to express the antibodies or antigen-binding fragments thereof described herein. Such host-expression systems represent vehicles in which antibody coding sequences are produced and subsequently purified, but also cells which, when transformed or transfected with the appropriate nucleotide coding sequences, express the antibody or binding fragment thereof in situ. These include bacteria (e.g., E. coli and B. subtilis) transformed with recombinant bacteriophage DNA, plasmid DNA, or cosmid DNA expression vectors containing the antibody or binding fragment thereof coding sequences; yeast (e.g., Saccharomyces pichia) transformed with recombinant yeast expression vectors containing the antibody or binding fragment thereof coding sequences; Pichia); insect cell systems infected with recombinant viral expression vectors (e.g., baculovirus) containing the antibody or binding fragment thereof coding sequence; plant cell systems infected with recombinant viral expression vectors (e.g., cauliflower mosaic virus (CaMV) and tobacco mosaic virus (TMV)) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing the antibody or binding fragment thereof coding sequence; or mammalian cell systems (e.g., COS cells, CHO cells, BH cells, 293 cells, 293T cells, 3T3 cells) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter).

[0252] For long-term, high-yield production of recombinant proteins, stable expression is preferred. In some cases, cell lines that stably express the antibody are optionally engineered. Rather than using expression vectors that contain viral origins of replication, host cells are transformed with DNA controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.) and a selectable marker. After introduction of the foreign DNA, engineered cells are grown in enriched medium for 1-2 days and then switched to selective medium. The selectable marker in the recombinant plasmid confers resistance to the selection, allowing cells to stably integrate the plasmid into their chromosomes and grow to form foci that are later cloned and expanded into cell lines. This method can be advantageously used to engineer cell lines that express an antibody or a binding fragment thereof.

[0253] In some examples, several selection systems are used for tk cells, hgprt cells, or aprt cells, respectively, including, but not limited to, the genes for herpes simplex virus thymidine kinase (Wigler et al., 1977, Cell 11:223), hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, 192, Proc. Natl. Acad. Sci. USA 48:202), and adenine phosphoribosyltransferase (Lowy et al., 1980, Cell 22:817). Antimetabolite resistance has also been used as the basis of selection for the following genes: dhfir, which confers resistance to methotrexate (Wigler et al., 1980, Proc. Natl. Acad. Sci. USA 77:357; O'Hare et al., 1981, Proc. Natl. Acad. Sci. USA 78:1527), gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, 1981, Proc. Natl. Acad. Sci. USA 78:2072), and neo, which confers resistance to the aminoglycoside G-418 (Clinical Pharmacy 12:488-505; Wu and Wu, 1991, Biotherapy for Cancer Research 12:131-135). 3:87-95; Tolstoshev, 1993, Ann. Rev. Pharmacol. Toxicol. 32:573-596; Mulligan, 1993, Science 260:926-932; and Morgan and Anderson, 1993, Ann. Rev. Biochem. 62:191-217; May, 1993, TIB TECH 11(5):155-215), and hygro, which confers resistance to hygromycin (Santerre et al., 1984, Gene 30:147).Methods well known in the art of recombinant DNA technology that can be used are described in Ausubel et al. (eds.), 1993, Current Protocols in Molecular Biology, John Wiley & Sons, NY; Kriegler, 1990, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY; and Dracopoli et al. (eds.), 1994, Current Protocols in Human Genetics, John Wiley & Sons, NY., chapters 12 and 13; Colberre-Garapin et al., 1981, J. Mol. Biol. 150:1).

[0254] In some cases, antibody expression levels are increased by vector amplification (for a review, see Bebbington and Hentschel, The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells in DNA cloning, Vol. 3. (Academic Press, New York, 1987)). If the marker in the antibody expression vector system is amplifiable, increasing the level of inhibitor present in the host cell culture will increase the copy number of the marker gene. Since the amplified region is associated with the antibody nucleotide sequence, production of the antibody will also increase (Crouse et al., 1983, Mol. Cell Biol. 3:257).

[0255] In some examples, any method known in the art for purification or analysis of antibodies or antibody conjugates is used, for example, by chromatography (e.g., ion exchange chromatography, affinity chromatography, particularly by affinity for specific antigens following Protein A, and sizing column chromatography), centrifugation, differential solubility, or any other standard technique in the purification of proteins. Exemplary chromatographic methods include, but are not limited to, strong anion exchange chromatography, hydrophobic interaction chromatography, size exclusion chromatography, and fast protein liquid chromatography.

[0256] Linker In some aspects, the linkers described herein are cleavable linkers or non-cleavable linkers. In some examples, the linker is a cleavable linker. In other examples, the linker is a non-cleavable linker.

[0257] In some cases, the linker is a non-polymeric linker. A non-polymeric linker refers to a linker that does not contain repeating units of a monomer produced by a polymerization process. Exemplary non-polymeric linkers include, but are not limited to, C1-C6 alkyl groups (e.g., C5, C4, C3, C2, or C1 alkyl groups), homobifunctional crosslinkers, heterobifunctional crosslinkers, peptide linkers, traceless linkers, self-immolative linkers, maleimide-based linkers, or combinations thereof. In some cases, the non-polymeric linker comprises a C1-C6 alkyl group (e.g., C5, C4, C3, C2, or C1 alkyl group), homobifunctional crosslinkers, heterobifunctional crosslinkers, peptide linkers, traceless linkers, self-immolative linkers, maleimide-based linkers, or combinations thereof. In further cases, the non-polymeric linker does not comprise more than two of the same type of linker, for example, more than two homobifunctional crosslinkers, or more than two peptide linkers. In further cases, the non-polymeric linker optionally includes one or more reactive functional groups.

[0258] In some cases, the non-polymeric linker does not include the above-mentioned polymer. In some cases, the non-polymeric linker does not include the polymer that is included by the polymer moiety C. In some cases, the non-polymeric linker does not include a polyalkylene oxide (e.g., PEG). In some cases, the non-polymeric linker does not include PEG.

[0259] In some examples, the linker comprises a homobifunctional linker. Exemplary homobifunctional linkers include Lomant's reagent dithiobis(succinimidyl propionate) DSP, 3'3'-dithiobis(sulfosuccinimidyl propionate (DTSSP), disuccinimidyl suberate (DSS), bis(sulfosuccinimidyl) suberate (BS), disuccinimidyl tartrate (DST), disulfosuccinimidyl tartrate (sulfoDST), ethyl ester, and the like. Glycobis(succinimidyl succinate) (EGS), disuccinimidyl glutarate (DSG), N,N'-disuccinimidyl carbonate (DSC), dimethyl adipimidate (DMA), dimethyl pimelimidate (DMP), dimethyl suberimidate (DMS), dimethyl-3,3'-dithiobispropionimidate (DTBP), 1,4-di-3'-(2'-pyridyldithio)propionamide ) butane (DPDPB), bismaleimidohexane (BMH), halogenated aryl-containing compounds (DFDNB) such as 1,5-difluoro-2,4-dinitrobenzene or 1,3-difluoro-4,6-dinitrobenzene, 4,4'-difluoro-3,3'-dinitrophenyl sulfone (DFDNPS), bis-[β-(4-azidosalicylamido)ethyl] disulfide (BASED), formaldehyde, glutaraldehyde, 1,4-butanediol diglycidyl ether, adipic acid dihydrazide, carbohydrazide, o-toluidine, 3,3'-dimethylbenzidine, benzidine, α,α'-p-diaminodiphenyl, diiodo-p-xylene sulfonic acid, N,N'-ethylene-bis(iodoacetamide), or N,N'-hexamethylene-bis(iodoacetamide).

[0260] In some embodiments, the linker comprises a heterobifunctional linker. Exemplary heterobifunctional linkers include amine-reactive and sulfhydryl crosslinkers, such as N-succinimidyl 3-(2-pyridyldithio)propionate (sPDP), long-chain N-succinimidyl 3-(2-pyridyldithio)propionate (LC-sPDP), water-soluble long-chain N-succinimidyl 3-(2-pyridyldithio)propionate (sulfo-LC-sPDP), succinimidyloxycarbonyl-α-methyl-α-(2-pyridyldithio)toluene (sMPT), sulfosuccinimidyl-6-[α -Methyl-α-(2-pyridyldithio)toluamide]hexanoate (sulfo-LC-sMPT), succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sMCC), sulfosuccinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sulfo-sMCC), m-maleimidobenzoyl-N-hydroxysuccinimide ester (MBs), m-maleimidobenzoyl-N-hydroxysulfosuccinimide ester (sulfo-MBs), N-succinimidyl (4-iodoacteyl)aminobenzoate (sIAB), sulfosuccinimidyl (4-iodoacteyl)aminobenzoate (sulfo-sIAB), succinimidyl-4-(p-maleimidophenyl)butyrate (sMPB), sulfosuccinimidyl-4-(p-maleimidophenyl)butyrate (sulfo-sMPB), N-(γ-maleimidobutyryloxy)succinimide esters (GMBs), N-(γ-maleimidobutyryloxy)sulfosuccinimide esters (sulfo-GMBs) ), succinimidyl 6-((iodoacetyl)amino)hexanoate (sIAX), succinimidyl 6-[6-(((iodoacetyl)amino)hexanoyl)amino]hexanoate (sIAXX), succinimidyl 4-(((iodoacetyl)amino)methyl)cyclohexane-1-carboxylate (sIAC), succinimidyl 6-((((4-iodoacetyl)amino)methyl)cyclohexane-1-carbonyl)amino)hexanoate (sIACX), p-nitrophenyl iodoacetate (NPIA),Carbonyl-reactive and sulfhydryl-reactive crosslinkers, such as 4-(4-N-maleimidophenyl)butyric acid hydrazide (MPBH), 4-(N-maleimidomethyl)cyclohexane-1-carboxyl-hydrazide-8 (M2C2H), 3-(2-pyridyldithio)propionyl hydrazide (PDPH), amine-reactive and photoreactive crosslinkers, such as N-hydroxysuccinimidyl-4-azidosalicylate (NHs-AsA), N-hydroxysulfosuccinimidyl-4-azidosalicylate (sulfo-NHs-AsA), sulfo-NHs-AsA, ... Phosuccinimidyl-(4-azido-salicylamido)hexanoate (sulfo-NHs-LC-AsA), sulfosuccinimidyl-2-(p-azido-salicylamido)ethyl-1,3'-dithiopropionate (sAsD), N-hydroxysuccinimidyl-4-azidobenzoate (HsAB), N-hydroxysulfosuccinimidyl-4-azidobenzoate (sulfo-HsAB), N-succinimidyl-6-(4'-azido-2'-nitrophenylamino)hexanoate (sANPAH), sulfosuccinimidyl-6-(4'-azido-2'-nitrophenylamino)hexanoate (sANPAH), N-succinimidyl-4-(4-azidophenyl)-1,3'-dithiopropionate (sADP), N-sulfosuccinimidyl-4-(ρ-azidophenyl)-1,3'-dithiopropionate (sulfo- ... azidophenyl)butyrate (sulfo-sAPB, sulfosuccinimidyl 2-(7-azido-4-methylcoumarin-3-acetamido)ethyl-1,3'-dithiopropionate (sAED), sulfosuccinimidyl 7-azido-4-methylcoumain-3-acetate (sulfo-sAMCA), ρ-nitrophenyl diazopyruvate (ρNPDP), ρ-nitrophenyl-2-diazo-3,3,3-trifluoropropionate (PNP-DTP), sulfhydryl-reactive and photoreactive crosslinkers, e.g.These include, but are not limited to, 1-(ρ-azidosalicylamido)-4-(iodoacetamido)butane (AsIB), N-[4-(ρ-azidosalicylamido)butyl]-3'-(2'-pyridyldithio)propionamide (APDP), benzophenone-4-iodoacetamide, benzophenone-4-maleimidocarbonyl-reactive and photoreactive crosslinkers, such as ρ-azidobenzoylhydrazide (ABH), carboxylate-reactive and photoreactive crosslinkers, such as 4-(ρ-azidosalicylamido)butylamine (AsBA), and arginine-reactive and photoreactive crosslinkers, such as ρ-azidophenylglyoxal (APG).

[0261] In some examples, the linker comprises a reactive functional group. In some cases, the reactive functional group comprises a nucleophilic group that is reactive to an electrophilic group present on the antibody. Exemplary electrophilic groups include carbonyl groups, such as aldehydes, ketones, carboxylic acids, esters, amides, enones, acyl halides, or acid anhydrides. In some aspects, the reactive functional group is an aldehyde. Exemplary nucleophilic groups include hydrazides, oximes, aminos, hydrazines, thiosemicarbazones, hydrazine carboxylates, and aryl hydrazides.

[0262] In some embodiments, the linker comprises a maleimide group. In some examples, the maleimide group is also referred to as a maleimide spacer. In some examples, the maleimide group further comprises caproic acid to form maleimidocaproyl (me). Optionally, the linker comprises maleimidocaproyl (me). Optionally, the linker is maleimidocaproyl (me). In other examples, the maleimide group comprises a maleimidomethyl group, such as succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sMCC) or sulfosuccinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sulfo-sMCC) as described above.

[0263] In some embodiments, the maleimide group is a self-stabilizing maleimide. In some examples, the self-stabilizing maleimide utilizes diaminopropionic acid (DPR) to incorporate a basic amino group adjacent to the maleimide and provide intramolecular catalysis of thiosuccinimide ring hydrolysis, thereby rendering the maleimide non-reactive through a retro-Michael elimination reaction. In some examples, the self-stabilizing maleimide is a maleimide group as described in Lyon et al., "Self-hydrolyzing mal eimides improves the stability and pharmacological properties of antibody-drug conjugates," Nat. Biotechnol. 32(10):1059-1062 (2014). In some examples, the linker comprises a self-stabilizing maleimide. In some examples, the linker is a self-stabilizing maleimide.

[0264] In some embodiments, the linker comprises a peptide moiety. In some examples, the peptide moiety comprises at least 2, 3, 4, 5, or 6 or more amino acid residues. In some examples, the peptide moiety comprises at most 2, 3, 4, 5, 6, 7, or 8 amino acid residues. In some examples, the peptide moiety comprises about 2, about 3, about 4, about 5, or about 6 amino acid residues. In some examples, the peptide moiety is a cleavable peptide moiety (e.g., either enzymatically or chemically). In some examples, the peptide moiety is a non-cleavable peptide moiety. In some examples, the peptide moiety comprises Val-Cit (valine-citrulline), Gly-Gly-Phe-Gly (SEQ ID NO: 96), Phe-Lys, Val-Lys, Gly-Phe-Lys, Phe-Phe-Lys, Ala-Lys, Val-Arg, Phe-Cit, Phe-Arg, Leu-Cit, Ile-Cit, Trp-Cit, Phe-Ala, Ala-Leu-Ala-Leu (SEQ ID NO: 97), or Gly-Phe-Leu-Gly (SEQ ID NO: 98). In some examples, the linker comprises a peptide moiety such as Val-Cit (valine-citrulline), Gly-Gly-Phe-Gly, Phe-Lys, Val-Lys, Gly-Phe-Lys, Phe-Phe-Lys, Ala-Lys, Val-Arg, Phe-Cit, Phe-Arg, Leu-Cit, Ile-Cit, Trp-Cit, Phe-Ala, Ala-Leu-Ala-Leu, or Gly-Phe-Leu-Gly. Optionally, the linker comprises Val-Cit. Optionally, the linker is Val-Cit.

[0265] In some embodiments, the linker comprises a benzoic acid group or a derivative thereof. In some examples, the benzoic acid group or a derivative thereof comprises para-aminobenzoic acid (PABA). In some examples, the benzoic acid group or a derivative thereof comprises gamma-aminobutyric acid (GABA).

[0266] In some embodiments, the linker comprises one or more of a maleimide group, a peptide moiety, and / or a benzoic acid group, in any combination. In some embodiments, the linker comprises a combination of a maleimide group, a peptide moiety, and / or a benzoic acid group. In some examples, the maleimide group is maleimidocaproyl (mc). In some examples, the peptide group is val-cit. In some examples, the benzoic acid group is PABA. In some examples, the linker comprises a mc-val-cit group. In some cases, the linker comprises a val-cit-PABA group. In further cases, the linker comprises a mc-val-cit-PABA group.

[0267] In some embodiments, the linker is a self-immolative linker or a self-elimination linker. In some cases, the linker is a self-immolative linker. In other cases, the linker is a self-elimination linker (e.g., a cyclized self-elimination linker). In some examples, the linker comprises the linker described in U.S. Pat. No. 9,089,614 or WO2015038426.

[0268] In some embodiments, the linker is a dendritic linker. In some cases, the dendritic linker comprises a branched multifunctional linker moiety. In some cases, the dendritic linker is used to increase the molar ratio of polynucleotide to antibody. In some cases, the dendritic linker comprises a PAMAM dendrimer.

[0269] In some embodiments, the linker is a traceless linker, i.e., a linker that does not leave a linker moiety (e.g., an atom or a linker group) on the binding moiety (e.g., an antibody), polynucleotide, polymer, or endosomolytic moiety after cleavage. Exemplary traceless linkers include, but are not limited to, germanium linkers, silicon linkers, sulfur linkers, selenium linkers, nitrogen linkers, phosphorus linkers, boron linkers, chromium linkers, or phenylhydrazide linkers. In some cases, the linker is a traceless aryl-triazene linker as described in Hejesen et al., "A traceless aryl-triazene linker for DNA-directed chemistry," Org Biomol Chem 11(15):2493-2497 (2013). In some examples, the linker is a traceless linker as described in Blaney et al., "Traceless solid-phase organic synthesis," Chem.Rev.102:2607-2024 (2002). In some examples, the linker is a traceless linker as described in US Pat. No. 6,821,783.

[0270] In some examples, the linker may be any of the compounds described in U.S. Pat. Nos. 6,884,869, 7,498,298, 8,288,352, 8,609,105, or 8,697,688; U.S. Patent Application Nos. 2014 / 0127239, 2013 / 028919, 2014 / 286970, A linker as described in WO 2013 / 0309256, WO 2015 / 037360, or WO 2014 / 0294851, or in WO 2015057699, WO 2014080251, WO 2014197854, WO 2014145090, or WO 2014177042.

[0271] In some examples, the linker is a C1-C6 alkyl group. Optionally, the linker is a C1-C6 alkyl group, such as a C5, C4, C3, C2, or C1 alkyl group. Optionally, the C1-C6 alkyl group is an unsubstituted C1-C6 alkyl group. When used in the context of linkers, particularly in the context of linkers, alkyl means a saturated straight or branched chain hydrocarbon radical containing up to 6 carbon atoms. In some examples, the linker is a non-polymeric linker. In some examples, the linker includes a homobifunctional linker or a heterobifunctional linker as described above. Optionally, the linker includes a heterobifunctional linker. Optionally, the linker includes or comprises sMCC. In other examples, the linker includes a heterobifunctional linker optionally conjugated to a C1-C6 alkyl group. In other examples, the linker includes sMCC optionally conjugated to a C1-C6 alkyl group. In further cases, the linker does not include a homobifunctional or heterobifunctional linker as described above.

[0272] Pharmaceutical preparations In some aspects, the pharmaceutical formulations described herein are administered to a subject by multiple routes of administration, including but not limited to parenteral (e.g., intravenous, subcutaneous, intramuscular), oral, intranasal, buccal, rectal, or transdermal routes of administration. In some examples, the pharmaceutical compositions described herein are formulated for parenteral (e.g., intravenous, subcutaneous, intramuscular, intraarterial, intraperitoneal, intrathecal, intracerebral, intraventricular, or intracranial) administration. In other examples, the pharmaceutical compositions described herein are formulated for oral administration. In yet other examples, the pharmaceutical compositions described herein are formulated for intranasal administration.

[0273] In some embodiments, pharmaceutical formulations include, but are not limited to, aqueous liquid dispersions, self-emulsifying dispersions, solid solutions, liposomal dispersions, aerosols, solid dosage forms, powders, immediate release formulations, controlled release formulations, fast dissolve formulations, tablets, capsules, pills, delayed release formulations, sustained release formulations, pulsatile release formulations, multiparticulate formulations (e.g., nanoparticle formulations), and combined immediate and controlled release formulations.

[0274] In some cases, the pharmaceutical formulation comprises a multiparticulate formulation. In some cases, the pharmaceutical formulation comprises a nanoparticle formulation. In some cases, the nanoparticle comprises cMAP, cyclodextrin, or lipid. In some cases, the nanoparticle comprises a solid lipid nanoparticle, a polymeric nanoparticle, a self-emulsifying nanoparticle, a liposome, a microemulsion, or a micelle solution. Further exemplary nanoparticles include, but are not limited to, paramagnetic nanoparticles, superparamagnetic nanoparticles, metal nanoparticles, fullerene-like materials, inorganic nanotubes, dendrimers (such as those with covalently bound metal chelates), nanofibers, nanohorns, nanoonions, nanorods, nanoropes, and quantum dots. In some examples, the nanoparticles are metal nanoparticles, such as nanoparticles of scandium, titanium, vanadium, chromium, manganese, iron, cobalt, nickel, copper, zinc, yttrium, zirconium, niobium, molybdenum, ruthenium, rhodium, palladium, silver, cadmium, hafnium, tantalum, tungsten, rhenium, osmium, iridium, platinum, gold, gadolinium, aluminum, gallium, indium, tin, thallium, lead, bismuth, magnesium, calcium, strontium, barium, lithium, sodium, potassium, boron, silicon, phosphorus, germanium, arsenic, antimony, and combinations, alloys, or oxides thereof.

[0275] In some cases, the nanoparticles include a core, or a core and a shell, such as in a core-shell nanoparticle.

[0276] In some examples, the nanoparticles are further coated with molecules for attachment of functional elements (e.g., one or more of a polynucleic acid molecule or a binding moiety (e.g., an antibody as described herein). In some examples, the coating comprises chondroitin sulfate, dextran sulfate, carboxymethyldextran, alginic acid, pectin, carrageenan, fucoidan, agaropectin, porphyran, karaya gum, gellan gum, xanthan gum, hyaluronic acid, glucosamine, galactosamine, chitin (or chitosan), polyglutamic acid, polyaspartic acid, lysozyme, cytochrome C, ribonuclease, trypsinogen, chymotrypsinogen, α-chymotrypsin, polylysine, polyarginine, histones, protamine, ovalbumin, or dextrin or cyclodextrin. In some examples, the nanoparticles comprise graphene-coated nanoparticles.

[0277] In some cases, the nanoparticles have at least one dimension less than about 500 nm, 400 nm, 300 nm, 200 nm, or 100 nm.

[0278] In some examples, the nanoparticle formulation comprises paramagnetic nanoparticles, superparamagnetic nanoparticles, metal nanoparticles, fullerene-like materials, inorganic nanotubes, dendrimers (such as those with covalently bound metal chelates), nanofibers, nanohorns, nanoonions, nanorods, nanoropes, or quantum dots.In some examples, the polynucleic acid molecules or binding moieties (e.g., antibodies) described herein are directly or indirectly conjugated to the nanoparticles.In some examples, at least 1, 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more polynucleic acid molecules or binding moieties described herein are directly or indirectly conjugated to the nanoparticles.

[0279] In some embodiments, the pharmaceutical preparation comprises a delivery vector, such as a recombinant vector, that delivers polynucleic acid molecules to cells.In some examples, the recombinant vector is a DNA plasmid.In other examples, the recombinant vector is a viral vector.Exemplary viral vectors include vectors derived from adeno-associated virus, retrovirus, adenovirus, or alphavirus.In some examples, the recombinant vector capable of expressing polynucleic acid molecules provides stable expression in target cells.In further examples, viral vectors are used that provide transient expression of polynucleic acid molecules.

[0280] In some aspects, pharmaceutical formulations include carriers or carrier materials that are selected based on their compatibility with the compositions disclosed herein and the release profile characteristics of the desired dosage form.Exemplary carrier materials include, for example, binders, suspending agents, disintegrants, fillers, surfactants, solubilizers, stabilizers, lubricants, wetting agents, diluents, etc.Pharmaceutical compatible carrier materials include, but are not limited to, acacia, gelatin, colloidal silicon dioxide, calcium glycerophosphate, calcium lactate, maltodextrin, glycerin, magnesium silicate, polyvinylpyrrolidone (PVP), cholesterol, cholesterol esters, sodium caseinate, soy lecithin, taurocholic acid, phosphotidylcholine, sodium chloride, tricalcium phosphate, dipotassium phosphate, cellulose and cellulose conjugates, sugars of sodium stearoyl lactylate, carrageenan, monoglycerides, diglycerides, pregelatinized starch, etc. See, e.g., Remington: The Science and Practice of Pharmacy, Nineteenth Ed (Easton, Pa.: Mack Publishing Company, 1995); Hoover, John E., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania 1975; Liberman, H.A. and Lachman, L., Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, NY, 1980; and Pharmaceutical Dosage Forms and Drug Delivery Systems, Seventh Ed. (Lippincott Williams & Wilkins 1999).

[0281] Treatment regimen In some embodiments, the pharmaceutical compositions described herein are administered for therapeutic use. In some embodiments, the pharmaceutical compositions are administered once a day, twice a day, three times a day, or more. The pharmaceutical compositions are administered daily, every other day, five days a week, once a week, every other week, two weeks a month, three weeks a month, once a month, twice a month, three times a month, or more. The pharmaceutical compositions are administered for at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 18 months, 2 years, 3 years, or more.

[0282] In some embodiments, one or more pharmaceutical compositions are administered simultaneously, sequentially, or at regular intervals. In some embodiments, one or more pharmaceutical compositions are administered simultaneously. In some cases, one or more pharmaceutical compositions are administered sequentially. In further cases, one or more pharmaceutical compositions are administered at regular intervals (e.g., a first administration of a first pharmaceutical composition is performed on day 1, followed by at least 1, 2, 3, 4, 5, or more days before administration of at least a second pharmaceutical composition).

[0283] In some embodiments, two or more different pharmaceutical compositions are co-administered.In some cases, two or more different pharmaceutical compositions are co-administered simultaneously.In some cases, two or more different pharmaceutical compositions are co-administered consecutively without a time gap between administrations.In other cases, two or more different pharmaceutical compositions are co-administered consecutively with an interval of about 0.5 hours, 1 hour, 2 hours, 3 hours, 12 hours, 1 day, 2 days or more between administrations.

[0284] If the patient's condition improves, at the physician's discretion, administration of the composition may be continuous; alternatively, the administered dose of the composition may be temporarily reduced or temporarily suspended for a certain period of time (i.e., a "drug holiday"). In some cases, the length of the drug holiday may vary between 2 days and 1 year, including, by way of example only, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, 35 days, 50 days, 70 days, 100 days, 120 days, 150 days, 180 days, 200 days, 250 days, 280 days, 300 days, 320 days, 350 days, or 365 days. Dose reductions during drug holidays range from 10% to 100%, including, by way of example only, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.

[0285] Once improvement of the patient's condition has occurred, a maintenance dose is administered if necessary, after which the dosage or frequency of administration, or both, can be reduced, depending on the symptoms, to a level at which improvement of the disease, disorder, or condition is maintained.

[0286] In some embodiments, the amount of a given agent that corresponds to such an amount will vary depending on factors such as the particular compound, the severity of the disease, the identity (e.g., body weight) of the subject or host requiring treatment, but will nevertheless be routinely determined in a manner known in the art according to the particular circumstances surrounding the case, including, for example, the particular agent being administered, the route of administration, and the subject or host being treated. In some instances, the desired dose is conveniently provided in a single dose or as divided doses administered simultaneously (or over a short period of time) or at appropriate intervals, for example, two, three, four or more subdoses per day.

[0287] The foregoing ranges are merely suggestive, since there are many variables for each individual treatment regimen, and substantial deviations from these recommendations are not uncommon. Such dosages will vary depending on a number of variables, including, but not limited to, the activity of the compound being used, the disease or condition being treated, the mode of administration, the requirements of the individual subject, the severity of the disease or condition being treated, and the judgment of the health care practitioner.

[0288] In some embodiments, the toxicity and therapeutic efficacy of such treatment regimens are determined by standard pharmaceutical procedures in cell cultures or experimental animals, including but not limited to determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index, which is expressed as the ratio between LD50 and ED50. Compounds that exhibit high therapeutic indices are preferred. Data obtained from cell culture assays and animal studies are used in formulating a range of dosages for human use. The dosage of such compounds is preferably within a range of circulating concentrations that includes the ED50 with minimal toxicity. Dosages vary within this range depending on the dosage form employed and the route of administration utilized.

[0289] Kit / manufactured product In certain aspects herein, kits and articles of manufacture are disclosed for use with one or more of the compositions and methods described herein.Such kits include carriers, packages, or containers that are compartmentalized to accommodate one or more containers, such as vials or tubes, each of which contains one of the separate elements used in the methods described herein.Suitable containers include, for example, bottles, vials, syringes, and test tubes.In one embodiment, the containers are formed from various materials, such as glass and plastic.

[0290] The articles of manufacture provided herein are accompanied by packaging materials. Examples of pharmaceutical packaging materials include, but are not limited to, blister packs, bottles, tubes, bags, containers, bottles, and any packaging material suitable for the selected formulation, intended mode of administration, and mode of treatment.

[0291] For example, the container comprises a target nucleic acid molecule as described herein.Such kits optionally include an identifying description, label, or instructions for use in the methods described herein.

[0292] The kit typically includes a label listing the contents and / or instructions for use, as well as a package insert with the instructions. A set of instructions is also typically included.

[0293] In one embodiment, the label is on or associated with the container. In one embodiment, the label is on the container when letters, numbers, or other characters forming the label are attached, printed, or etched on the container itself. The label is associated with the container when present in a receptacle or carrier that also holds the container, for example, as a package insert. In one embodiment, the label is used to indicate that the contents are to be used for a particular therapeutic application. The label also indicates instructions for using the contents, such as in the methods described herein.

[0294] In certain aspects, the pharmaceutical compositions are provided in a pack or dispenser device containing one or more unit dosage forms containing the compound provided herein. The pack contains, for example, metal or plastic foil, such as a blister pack. In one embodiment, the pack or dispenser device is accompanied by instructions for administration. In one embodiment, the pack or dispenser is also accompanied by a notice affixed to the container in a manner prescribed by a government agency regulating the manufacture, use, or sale of pharmaceuticals, which notice reflects the approval by the government agency of the drug form for administration to humans or animals. Such notice is, for example, a label approved by the U.S. Food and Drug Administration for prescription drugs, or an approved product insert. In one embodiment, compositions containing the compound provided herein formulated in a compatible pharmaceutical carrier are also prepared, placed in a suitable container, and labeled for the treatment of a specified disease.

[0295] Specific Terms Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the claimed subject matter belongs. It is to be understood that the foregoing summary and the following detailed description are exemplary and explanatory only and are not intended to limit any claimed subject matter. In this application, the use of the singular includes the plural unless specifically stated otherwise. It should be noted that as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly indicates otherwise. In this application, the use of "or" means "and / or" unless specifically stated otherwise. Furthermore, the use of the term "including," as well as other forms such as "include," "includes," and "included," is not limiting.

[0296] As used herein, ranges and amounts can be expressed as a particular value or range with "about." About includes the exact amount. Thus, "about 5 μL" means "about 5 μL" and even "5 μL." In general, the term "about" includes amounts that are expected to be within experimental error.

[0297] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

[0298] As used herein, the terms "individual," "subject," and "patient" refer to any mammal. In some aspects, the mammal is a human. In some aspects, the mammal is not a human. None of these terms require or are limited to a situation characterized by supervision (e.g., continuous or intermittent) by a medical professional (e.g., a physician, registered nurse, clinical nurse, physician assistant, skilled worker, or hospice worker).

[0299] As used herein, the term "DMD subject" refers to any mammal that is afflicted with or suspected to be afflicted with DMD and / or has a genetic predisposition associated with DMD (e.g., a mutation in the DMD gene). In some embodiments, the mammal is a human. In some embodiments, the mammal is not a human. EXAMPLES

[0300] These examples are provided for illustrative purposes only and are not intended to limit the scope of the claims provided herein.

[0301] Example 1: In silico identification of phosphorodiamidate morpholino oligomers (PMOs) predicted to have high hDMD exon 44 skipping activity

[0302] Several algorithms have been reported to identify regions on the hDMD pre-mRNA that are modifiable for exon 44 skipping activity. In the PMO screen, we focused on specific regions closest to the exon 44 acceptor site based on the predictions reported for exon 44 skipping (Echigoya et al. 2015, PLoS ONE 10(3):e0120058).

[0303] PMOs with hDMD exon 44 skipping activity were identified in silico. Figure 1 shows the exon 44 skipping activity of PMO 30-mer and 25-mer. PMOs that bind to the exon 44 acceptor site position are labeled based on the distance (in bases) from the acceptor site to their 3' end. Large squares represent the exon 44 skipping activity of PMOs, and dots represent PMOs with predicted exon 44 skipping activity. The acceptor site of exon 44 has a length of 148 base pairs (Source: NCBI a Homo sapiens dystrophin (DMD), transcript variant Dp427m, mRNA. ACCESSION NM_004006) 5'-GCGATTTGACAGATCTGTTGAGAAATGGCGGCGTTTTCATTATGATATAAAGATATTTAATCAGTGGCTAACAGAAGCTGAACAGTTTCTCAGAAAGACACAAATTCCTGAGAATTGGGAACATGCTAAATACAAATGGTATCTTAAG-3' (SEQ ID NO: 134), and the majority of active exon 44 skipping PMOs were observed to interact between the acceptor site at position 0 (Ac0) and the acceptor site at position 20 (Ac20). We further identified 12 PMOs (30mers) (see box in Figure 1) with predicted hDMD exon 44 skipping activity of more than 70%. The sequences of these 12 PMOs targeting the hDMD exon 44 acceptor site are shown in Table 1.

[0304] result

[0305] Overall, 12 phosphorodiamidate morpholino oligomers (PMOs) with the highest predicted exon 44 skipping activity were selected based on an algorithm that helped identify regions on the hDMD pre-mRNA that may be modifiable for exon 44 skipping activity.

[0306] Example 2: Identification and selection of PMOs with high exon 44 skipping activity in healthy primary human skeletal muscle cells (hSkMCs)

[0307] For further in vitro assays on healthy primary human skeletal muscle cells, the selected 12 PMOs with high predicted exon 44 skipping activity from Example 1 were synthesized. Primary human skeletal muscle cells (SkMCs) were obtained commercially (Gibco, #A11440). These cells were pre-differentiated and induced to form myotubes by seeding on type 1 collagen-coated 24-well plates (Gibco, #1970788) (50000 cells / well) in DMEM supplemented with 2% horse serum and 1x ITS (Gibco, #1933286) for 2 days according to the manufacturer's instructions. Cells were incubated without antibiotics for 24 hours before transfection. PMOs were synthesized by GeneTool. PMOs were formulated in water, heated at 65-70°C for 5 minutes, and diluted in warm medium with 2μM Endo-Porter (Gene Tools, #EP6P1-1) to facilitate PMO uptake into cells. 48 hours after transfection, cells were harvested. Cells were harvested in Trizol and stored at -80°C until processed for RNA isolation using the Direct-zol-96 RNA isolation kit (Zymo) according to the manufacturer's instructions. Total RNA concentration was quantified spectrophotometrically. 100–200 ng of purified RNA was converted to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and a SimpliAmp thermal cycler (Applied Biosystems).DNA fragments representing total DMD mRNA or exon 44 skipped mRNA were amplified by PCR using TaqMan Fast Advanced Master mix (Applied Biosystems) and either the hDMD TaqMan assay Hs01049401_ml (VIC-MGB, Thermo Fisher Scientific) or a custom made TaqMan assay specific for the hDMD exon 43 / 45 junction (FAM-MGB, forward: 5'-CTGTGGAAAGGGTGAAGCTA-3' (SEQ ID NO: 90), reverse: 5'-GACAAGGGAACTCCAGGATG-3' (SEQ ID NO: 91), probe: 5'-AGCTCTCTCCCAGCTTGATTTCCA-3' (SEQ ID NO: 92)). For quantification of exon 44 skipping levels by gel electrophoresis, PCR reactions were incubated at 95°C for 20 s followed by 32 cycles of 95°C for 1 s and 60°C for 20 s using a QuantStudio 7 Flex (Applied Biosystems). PCR products were diluted 4:1 in TAE loading buffer and loaded onto a 24-well 4% TAE gel containing GelGreen (Embi Tec, #GG3807). PCR products were separated by electrophoresis (50V for 2 h). The intensity of the bands corresponding to total and skipped DMD products was quantified by densitometry using a ChemiDoc TM XRS+ (Bio-Rad).

[0308] result

[0309] The selected 12 PMOs were transfected into healthy primary HSkMCs previously differentiated into myotubes using Endoporter as described above and harvested 48 hours after transfection. Total DMD mRNA and exon 44 skipped DMD mRNA were amplified by RT-qPCR. PCR products were separated by gel electrophoresis and quantified by densitometry. The presented data were fitted to a specific binding algorithm (single site). The best fit values ​​for binding affinity (Kd=EC50) and (Bmax=maximal skipping%) are reported in Table 9. These results are from two independent experiments performed in duplicate with either 1, 3, and 10 μM or 0.1, 1, and 10 μM PMOs.

[0310] [Table 10]

[0311] result

[0312] FIG. 2 shows the dose-dependent response of exon 44 skipping activity of 12 selected PMOs (30mers) targeting the acceptor site of human DMD exon 44 in healthy primary human skeletal muscle cells (hSkMCs).

[0313] The results of the assay in HSkMCs show that the maximum hDMD exon 44 skipping activity of the tested PMOs is more than 75%, and their predicted activity is confirmed as shown in Table 9 and Figure 2. Furthermore, the dose response of exon 44 skipping active cells for the selected 12 PMOs (30mer) all showed similar binding affinity (Kd) as shown in Table 9 (0.3-1.0 mM, single site, specific binding algorithm).

[0314] Overall, in vitro assays for the activity of the selected 12 PMOs confirm their predicted exon 44 skipping activity.

[0315] Example 3: Selection of length-optimized exon 44 skipping PMOs in healthy immortalized human myoblasts

[0316] To select the PMO exhibiting the optimal length / activity ratio, the predicted free binding energies (ΔG) of short PMO oligonucleotides targeting the Ac0-Ac10 site were analyzed to target the exon 44 acceptor site. Table 11 shows the predicted free binding energies (ΔG (kcal / mol)) of PMOs of various lengths targeting the exon 44 acceptor site of hDMD. ΔG was calculated using DNA-DNA oligonucleotide hybridization (IDT OligoAnalyzer) as a first approximation.

[0317] [Table 11]

[0318] result

[0319] By characterizing the relationship between PMO molecule length and predicted free binding energy (ΔG) to the DMD target mRNA, PMO oligonucleotides that retained maximum activity at sequence lengths less than 30 mer were identified. Shorter sequences were predicted to have lower binding energy compared to the 30 mer parent sequence (Table 11). From the predicted free binding energies (ΔG (kcal / mol)) of the PMOs in Table 11, 13 different PMOs targeting acceptor sites between +2 and +10 with oligonucleotide lengths between 26 and 28 and apparent ΔG less than -50 kcal / mol were selected and synthesized (see box in Table 11). These include PMOs (hEx_44_Ac24_28, hEx_44_Ac25_28, and hEx_44_Ac28) with predicted hDMD exon 44 skipping activity greater than 50% (data not shown). The sequences of each of the 13 PMOs are shown in Table 10. Additionally, a short 25-mer PMO hEx_44_Ac2_25 with a predicted binding energy (ΔG) of −40.8 kcal / mol was included as an internal control (see Table 11). For further in vitro screening for exon 44 skipping activity in human primary and immortalized skeletal muscle cells (hSkMCs), 13 selected PMOs ranging from 26- to 28-mer with free binding energies (ΔG) below −50 kcal / mol, as well as a 25-mer as a control, were synthesized.

[0320] In vitro screening assay for exon 44 skipping

[0321] Human myoblast cell lines were obtained from the Association Institut de Myologie-Centre de Recherche en Myologie (UMRS 787 INSERM and Sorbonne Universite, France) through MyoBank (certification reference number AC-2019-3502) in partnership with EuroBioBank. Myoblast cell lines were derived from the fascia lata (AB1167C20FL) of a 20-year-old healthy male donor. Cells were grown at a cell density of less than 80% in Promocell growth medium (C-23160) supplemented with 5% FBS. Immortalized myoblasts were seeded in 24-well plates at 50,000 cells / well in growth medium and grown to confluence before differentiation. To induce differentiation into myotubes, cells were rinsed with DMEM and then incubated for 3–4 days in differentiation medium (DMEM, 50ug / mL gentamicin, 10pg / mL insulin). Cells were incubated without antibiotics for 24 h before transfection. PMOs were synthesized by GeneTool, formulated in water, heated to 65–70 °C for 5 min, and diluted in warm medium with 2 μM Endo-Porter (Gene Tools, #EP6P1-1) to promote PMO uptake into cells. Experiments were performed with 0.3, 1, 3.3, and 10 μM PMOs. After 48 h, cells were harvested and RNA isolation and cDNA synthesis were performed as described above. For quantification by qPCR, PCR reactions were repeated 40 times and amplification of total and exon 44 skipping PCR products was monitored using a QuantStudio 6 or 7 Flex Real-Time PCR instrument (Applied Biosystems). Data were analyzed by QuantStudioTM Real-Time PCR software v1.3 (Applied Biosystems). The % of exon 44 skipping mRNA was calculated as a function of 100. *The CT was calculated as 2 (CT(total)-CT(skip)). Primers used: hDMD TaqMan assay Hs01049401_ml (VIC-MGB, Thermo Fisher Scientific) or a custom-made TaqMan assay specific for the hDMD exon 43 / 45 junction (FAM-MGB, forward: 5'-CTGTGGAAAGGGTGAAGCTA-3' (SEQ ID NO: 90), reverse: 5'-GACAAGGGAACTCCAGGATG-3' (SEQ ID NO: 91), probe: 5'-AGCTCTCTCCCAGCTTGATTTCCA-3' (SEQ ID NO: 92). The dose response of the selected PMOs was fitted to a specific binding algorithm (single site). Total DMD mRNA and exon 44 skipped DMD mRNA were monitored by RT-qPCR. The dose response of the selected main PMOs was fitted to a specific binding algorithm (single site).

[0322] By transfecting the selected PMOs into myotubes derived from healthy immortalized hSkMCs, three different PMOs of various sizes were found to exhibit better exon 44 skipping activity than the other PMOs. The 26mer hEx44_Ac7_26 targeting acceptor site 7, the 27mer hEx44_Ac5_27 targeting acceptor site 5, and the 28mer hEx44_Ac4_28 targeting acceptor site 4 exhibited at least 75% exon 44 skipping activity at a concentration of 10 μM (Figure 3). Among the three PMOs, the PMO hEx44_Ac7-26-mer had the highest length / activity ratio and was selected as the PMO molecule for further evaluation in in vitro and in vivo assays.

[0323] Based on the exon 44 skipping activity derived from healthy immortalized hSkMCs, the 26mer PMO hEx44_Ac7-26 (5'-CGCCGCCATTTCTCAACAGATCTGTC-3' (SEQ ID NO: 118) exhibited the best exon 44 skipping activity among the three PMOs.

[0324] Example 4: hEx44_Ac7_26 induces exon 44 skipping activity in healthy human cells and DMD patient-derived cells

[0325] Human immortalized and primary skeletal muscle cells (HSkMCs) (DMD cells: AB1323-immortalized, 47811-primary, 47898-primary; healthy cells: AB1167-immortalized, MB07-primary, MB09-primary) were obtained from the Institut de M yologie (loM), Paris, France (immortalized) and Besta Institute, Italy (primary). Two primary and one immortalized cell line each originated from a DMD patient with an exon 45 deletion. The immortalized cells were grown in skeletal muscle growth medium (Promocell, C-23160). Primary cells were grown in GM consisting of DMEM+Glutamax (Gibco, Cat. No. 10566-016) supplemented with 20% FBS (Corning), 1% Pen / Strep (ThermoFisher), 10ug / ml insulin (Sigma), 25ng / ml hFGF (Stemcell Technologies), 10ng / ml EGF (Stemcell Technologies) and seeded (20000 cells / well) onto 24-well plates coated with 1% Matrigel. Myoblasts were induced to form myotubes in DMEM Glutamax (Gibco) supplemented with skeletal muscle cell differentiation medium (Promocell, Cat. No. C-39366) and 1% Pen / Strep for 2 days according to the manufacturer's instructions. PMOs were synthesized by GeneTool. PMOs were formulated in water, heated at 65-70°C for 5-10 min, and diluted into warm medium. 48 hours after transfection, cells were harvested. Cells were harvested in Trizol and stored at -80°C until processed for RNA isolation using the Direct-zol-96 RNA isolation kit (Zymo) according to the manufacturer's instructions. Total RNA concentrations were quantified spectrophotometrically. cDNA was prepared from 100–500 ng of purified RNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosciences) in a SimpliAmp thermal cycler (Applied Biosystems).40 ng of cDNA was distributed into droplets in triplicate in a QX200 Automated Droplet Generator (BioRad) in combination with Taqman probes (ThermoFischer), 2X ddPCR Supermix (no dUTP) (BioRad), and BamHI restriction enzyme (BioRad). After droplet generation, the mixture was loaded into a deep-well C1000 Touch thermal cycler (BioRad) for PCR amplification. Absolute quantification of target RNA molecules was measured with a QX200 Droplet Digital PCR System (BioRad) using QX Manager software (BioRad). The percentage of exon skipping was calculated by normalizing the number of targeted exons to total gene expression. Primers used: hDMD TaqMan assay Hs01049401_ml (VIC-MGB, Thermo Fisher Scientific) or a custom TaqMan assay specific for the hDMD exon 43 / 45 junction (FAM-MGB, forward: 5'-CTGTGGAAAGGGTGAAGCTA-3' (SEQ ID NO: 90), reverse: 5'-GACAAGGGAACTCCAGGATG-3' (SEQ ID NO: 91), probe: 5'-AGCTCTCTCCCAGCTTGATTTCCA-3' (SEQ ID NO: 92)).

[0326] result

[0327] Exon 45 deletion-derived myotubes transfected with hEx44_Ac7_26 were used to evaluate exon 44 skipping activity in primary and immortalized healthy or DMD patients by using ddPCR, a sensitive and highly accurate method for exon skipping quantification. These in vitro assays with hEx44_Ac7_26 were performed on healthy and DMD patient-derived myotubes with exon 45 deletion, which are suitable for exon 44 skipping therapy. As shown in Figure 4C, hEx44_Ac7_26 was able to induce exon 44 skipping in healthy and DMD patient-derived myotubes, and the exon 44 skipping activity in these cells was dose-dependent. Interestingly, the results show that hEx44_Ac7_26 exhibits higher exon 44 skipping activity in DMD cells than in healthy cells. Exon 44 skipping activity in DMD-derived patient cells transfected with hEx44_Ac7_26 is up to 60% (Figure 4C), whereas exon 44 skipping activity in healthy primary or immortalized cells is only up to 10% (Figure 4A-Figure 4B). Without being bound to any particular theory, skipping of specific exons in dystrophin pre-mRNA in healthy cells may result in destabilization of skipped mRNA and reduction of total dystrophin mRNA, whereas hEx44_Ac7_26 induces frameshift repair in DMD-derived patient cells and significantly increases the level of skipped DMD transcripts, which may be highly correlated with an increase in total dystrophin mRNA expression levels to WT levels.

[0328] Overall, hEx44_Ac7_26 can induce exon 44 skipping in healthy human cells and in DMD patient-derived cells, with the exon 44 skipping activity in DMD patient-derived cells being greater than that in healthy human cells.

[0329] Example 5: hEx44_Ac7_26 induces dystrophin restoration in myotubes derived from DMD patients

[0330] Human primary myoblasts derived from healthy and DMD patients were expanded in skeletal muscle growth medium (GM, Zenbio). On day 0, 15000 human primary myoblasts per well were plated in GM in 96-well MyoScreen CYTOO plates (CYTOO) coated with 10 μg / ml fibronectin (Invitrogen). The day after seeding (day 1), the growth medium was replaced with differentiation medium (DM) composed of Dulbecco's modified Eagle's medium: nutrient mixture F12 (DMEM / F12, Invitrogen), 2% horse serum (HS, GE Healthcare), 100 U / ml penicillin, and 100 μg / ml streptomycin (Invitrogen). On days 3 or 6, compounds (PMO and AOC) were added to DMD cells for 6 or 3 days, respectively, without medium change. For PMO treatment, PMO was synthesized by GeneTool. PMOs were heated at 70°C for 5 min and then slowly cooled before being added to the medium. In this particular condition, Endo-Porter (GeneTool) was simultaneously added to the wells at 1 μM as a delivery reagent. In each experiment, we included a mock condition corresponding to vehicle + / - Endo-Porter, used as a negative control. On day 9, after fixation with 10% formalin (Sigma-Aldrich) for 30 min, myotubes were washed three times with Dulbecco's phosphate-buffered saline (DPBS) and permeabilized with 0.5% Triton X-100 (Sigma-Aldrich). After blocking in 1% bovine serum albumin (BSA, Sigma-Aldrich), cells were incubated with primary antibodies prepared in blocking solution, and myotubes were stained with troponin T-specific antibodies (ab45932 Abcam) or myosin heavy chain-specific antibodies (14-6503-82 Thermo Fisher). C-terminal and N-terminal dystrophin were stained with NCL-Dys2 and NCL-DysB antibodies (Leica), respectively. Then, after washing three times with DPBS, secondary antibodies prepared in BSA 1% were added to the wells together with Hoechst 33342. Finally, cells were washed three times with DPBS before acquisition.Quantitative microscopy was performed using an Operetta HCS imaging system with a 10x / 0.3NA objective (PerkinElmer). Images were analyzed using scripts developed in Acapella software (PerkinElmer), including customized segmentation of myotubes and nuclei. Myotubes were defined as areas positive for skeletal muscle differentiation markers Troponin-T or Myosin Heavy Chain (MHC) and fitting specific optimized filters, such as minimum / maximum area, maximum orientation, minimum elongation, and minimum / maximum length of myotubes. Nuclei counts were performed to determine the total number of nuclei. Fusion index (FI) was calculated as the number of nuclei within the myotube stained area divided by the total number of nuclei and expressed as a percentage. After excluding myotubes touching the image border, the entire myotube was finally used to extract myotube area and dystrophin mean intensity. Three healthy donors were included in each experiment. The average intensity of dystrophin expression in these healthy myotubes was calculated and used as a criterion to assess the percentage of dystrophin restoration in the DMD-treated conditions, calculated with the following formula: % Dystrophin Restoration = (IDMD-Treated - IDMD-Sham) / (IAverage Healthy - IDMD-Sham). The percentage of positive myotubes was determined for each condition as the percentage of myotubes expressing a dystrophin intensity superior to the threshold determined with the corresponding sham condition.

[0331] Jess Capillary Western Blot

[0332] Immortalized human skeletal myoblasts from patients with exon 45 deletion and healthy human immortalized skeletal myoblasts were plated in 24-well plates coated with 1% Matrigel at a starting density of 20,000 cells / well in General Media (Skeletal Muscle Growth Medium, Promocell c-23160, Gentamicin 5%, Gibco 15710064). Differentiation of myoblasts into myotubes was initiated 3 days after seeding by adding differentiation medium (DMEM+Glutmax Gibco 10566-016, Insulin Promocell C-39366). Myoblasts were harvested after 4 days of differentiation and 2 days after PMO treatment. On ice, myoblasts underwent two washing cycles with cold DPBS (Gibco 14190144) followed by incubation with M-PER lysis buffer (Thermo Fisher, 78501) and Halt protease inhibitor (Thermo Fisher, 78429) for 5 min. Each well was then rubbed individually for 20 s. The suspension was then collected and centrifuged at 14000g for 15 min at 4°C. The supernatant was collected and total protein concentration was measured using the Pierce BCA Protein Assay Kit (Thermo Scientific, 23227) according to the manufacturer's instructions. Samples were normalized to 300 μg / mL. Samples were then flash frozen in liquid nitrogen before quantification by Jess Capillary Western blot. Quantification of dystrophin protein was measured by capillary western blot analysis using a protein simple Jess system equipped with a 66-440 kDA separation module (Protein Simple, SM-W008), an anti-rabbit detection module (ProteinSimple, DM-001), and a Replex module (Protein Simple, RP-001). Anti-dystrophin rabbit monoclonal antibody (Abcam, AB154168) specific for dystrophin was diluted 1:5000 in antibody dilution buffer 2 (Protein Simple). The anti-rabbit detection module contained blocking reagent (antibody diluent), HRP-conjugated anti-rabbit secondary antibody, and chemiluminescent substrate.The Replex module contained a total protein normalization agent and a biotinylation agent. These reagents were seeded according to the manufacturer's protocol. Sample proteins diluted to appropriate concentrations in sample buffer (100-fold diluted "10x sample buffer" from the separation module) were separated in the capillary and analyzed by chemiluminescence signal. Dystrophin signals were determined by Compass software (Protein Simple). The following criteria were used to discriminate low dystrophin signals from background: the peak signal-to-noise (S / N) ratio given by the software must be ≥10, and the peak height / baseline ratio (calculated manually from the peak height and baseline values ​​given by the software) must be ≥3 (adopted from Beekman et al. 2018). Signals were normalized to the total protein of each sample in the final quantification.

[0333] result

[0334] Dystrophin repair assays were performed using the MyoScreen platform. This platform uses culture conditions optimized for differentiation, maturation, and longevity of cultured myotubes and allows quantification of dystrophin repair by immunofluorescence. Figure 5A shows pictures of healthy cells and DMD patient-derived cells on the MyoScreen platform immunofluorescently stained for dystrophin-positive fibers. Healthy cells (left panel) and DMD patient-derived cells transfected with hEx44_Ac7_26 (right panel) showed the presence of dystrophin as shown by positive cell immunofluorescence staining, whereas DMD patient-derived cells did not express any dystrophin as evidenced by the lack of immunofluorescence staining (middle panel).

[0335] Quantitative analysis of immunofluorescence staining for dystrophin restoration in patient-derived cells transfected with PMO44 showed that hEx44_Ac7_26 efficiently restored dystrophin in primary myotubes (two primary cells with exon 45 deletion and one immortalized cell line) derived from three patients in a dose-dependent manner (Figure 5B). hEx44_Ac7_26 could restore up to 100% dystrophin in the immortalized DMD patient-derived cell line compared to wild-type cells (healthy primary cells), while it could induce up to 70% restoration of dystrophin in two primary DMD patient-derived cells compared to wild-type cells. The variation in dystrophin restoration level may depend on the DMD donor cells.

[0336] Furthermore, dystrophin restoration levels were also quantified in healthy cells and immortalized DMD patient-derived cells using Jess capillary Western blotting (Figure 5C). The results show that hEx44_Ac7_26 can restore dystrophin expression levels in DMD patient-derived cells by up to 50%, compared with the levels of dystrophin in healthy primary cells.

[0337] Overall, hEx44_Ac7_26 was able to restore dystrophin and DAPCs in primary and immortalized DMD patient-derived cells, with the extent of dystrophin restoration dependent on the DMD donor cell.

[0338] Example 6: Dose-dependent in vitro exon 44 skipping activity in wild-type monkey myotubes treated with hEx44_Ac7_26

[0339] Wild-type cynomolgus monkey primary skeletal muscle cells (Lot no. SKM110414) were obtained from Worldwide Primate (WWP). Cells were grown in Zenbio GM medium (SKM-M) and seeded (20,000 cells / well) on 24-well plates coated with 1% Matrigel (Corning). Myoblasts were induced to form myotubes for 2 days in Zenbio DM medium (SKM-D) according to the manufacturer's instructions. PMOs were synthesized by GeneTool. PMOs were formulated in water, heated at 65-70°C for 5-10 min, and diluted into warm medium with 1 μM Endo-Porter (Gene Tools, #EP6P1-1) to promote PMO uptake into cells. Cells were harvested 48 h after transfection. Cells were harvested in Trizol and stored at -80°C until processed for RNA isolation using the Direct-zol-96 RNA isolation kit (Zymo) according to the manufacturer's instructions. Total RNA concentrations were quantified spectrophotometrically. cDNA was prepared from 100–500 ng of purified RNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosciences) in a SimpliAmp thermal cycler (Applied Biosystems). 40 ng of cDNA was dispensed into droplets in triplicate in a QX200 Automated Droplet Generator (BioRad) combined with 60X Taqman probes (ThermoFischer) targeting the skipped DMD spanning exon 43–45 junction (ID number AP7DUYJ) and the whole DMD spanning exon 39–40 junction (ID number Mf01049436_m1), Taqman probes (ThermoFischer), 2X ddPCR Supermix (without dUTP) (BioRad), and BamHI restriction enzyme (BioRad). After droplet generation, the mixture was loaded into a deep-well C1000 Touch thermal cycler (BioRad) for PCR amplification. Absolute quantification of target RNA molecules was measured with a QX200 Droplet Digital PCR system (BioRad) using QX Manager software (BioRad).The percentage of dystrophin exon skipping was calculated by normalizing the number of targeted exons to total gene expression.

[0340] result

[0341] Since the acceptor sequence of exon 44 in the monkey DMD gene is identical to that of humans, we used ddPCR to evaluate exon 44 skipping activity in primary healthy monkey myotubes treated with increasing concentrations of hEx44_Ac7_26. As shown in Figures 6A-6B, hEx44_Ac7_26 induces a strong dose-dependent response of exon 44 skipping in primary healthy monkey myotubes in vitro. hEx44_Ac7_26 induces more than 25% exon 44 skipping (Figure 6A) and up to 100 exon 44 skip copies per μl (Figure 6B) in healthy monkey myotubes. Interestingly, hEx44_Ac7_26 reduced the total number of DMD copies per μl to less than 400, compared to the dystrophin mRNA copies in the control group. Similar to healthy human myotubes (see Example 4), the reduction in total dystrophin mRNA copy number in healthy monkey cells transfected with hEx44_Ac7_26 was up to 25% compared to DMD cells, which may be due to out-of-frame mutations in the dystrophin mRNA leading to destabilization of the skipped exon mRNA.

[0342] Overall, these results demonstrate that hEx44_Ac7_26 can reduce DMD mRNA levels in primary healthy monkey cells and that exon 44 skipping induced by PMO in healthy cells reduces DMD gene expression that can result from out-of-frame mutations in DMD mRNA.

[0343] Example 7: Biodistribution of exon 44 skipping copies in muscle and non-muscle tissues of cynomolgus monkeys administered a single dose of hEx44_Ac7_26-AOC on day 0 at a dose of 159.9 mg / kg, corresponding to a PMO(hEx44-Ac7-26) dose level of 30 mg / kg.

[0344] Scheme 1: Synthesis and purification of hEx44_Ac7_26-AOC

[0345] Anti-human transferrin receptor antibody was produced. hEx44_Ac7_26PMO was synthesized by GeneTool. Antibody (10 mg / ml) in borate buffer (25 mM sodium tetraborate, 25 mM NaCl, 1 mM diethylenetriaminepentaacetic acid, pH 8.0) was reduced by adding 4 equivalents of tris(2-carboxyethyl)phosphine (TCEP) in water and incubating at 37°C for 4 hours. 4(N-maleimidomethyl)cyclohexane carboxylic acid N-hydroxysuccinimide ester (SMCC) was coupled to the primary amine on the 3' end of hEx44_Ac7_26PMO by incubating hEx44_Ac7_26PMO (50 mg / ml) in DMSO with 10 equivalents of SMCC (10 mg / ml) in DMSO for 1 hour. Unconjugated SMCC was removed by ultrafiltration using an Amicon Ultra-15 centrifugal filter unit with a MWCO of 3 kDa. hEx44_Ac7_26PMO-SMCC was washed three times with acetate buffer (10 mM sodium acetate, pH 6.0) and used immediately. The reduced antibody was mixed with 2.25 equivalents of hEx44_Ac7_26PMO-SMCC and incubated overnight at 4°C. The pH of the reaction mixture was then lowered to 7.5 and 8 equivalents of N-ethylmaleimide were added to the mixture at room temperature for 30 minutes to quench unreacted cysteines.

[0346] The reaction mixture was purified by AKTA Explorer FPLC using HIC method-1. Depending on the conjugate, fractions containing either conjugates with a drug-to-antibody ratio of 1 (DAR1), 2 (DAR2), 3 (DAR3), 4 (DAR4), 5 (DAR5), 6 (DAR6), 7 (DAR7), 8 (DAR8), or fractions containing conjugates with a drug-to-antibody ratio of 3+ (DAR3+), 4+ (DAR4+), 5+ (DAR5+), 6+ (DAR6+), 7+ (DAR7+), (DAR8+), or fractions containing conjugates with an average drug-to-antibody ratio of 1 (DAR1), 2 (DAR2), 3 (DAR3), 4 (DAR4), 5 (DAR5), 6 (DAR6), 7 (DAR7), or 8 (DAR8) were combined and concentrated using Amicon Ultra-15 centrifugal filter units with a MWCO of 50 kDa. The concentrated conjugate was buffer exchanged into PBS (pH 7.4) using Amicon Ultra-15 centrifugal filter units prior to analysis.

[0347] Hydrophobic Interaction Chromatography (HIC) Method-1 Column: GE, HiScreen Butyl HP, 4.7ml Solvent A: 50 mM phosphate buffer, 0.7 M ammonium sulfate, pH 7.0; Solvent B: 80% 50 mM phosphate buffer, 20% IPA, pH 7.0; Flow rate: 1.0 ml / min gradient: % of A % of B Column volume 100 0 1 70 30 25 0 100 1 0 100 2 hEx44_Ac7_26-AOC was quantified by BCA and analyzed by HIC (Avg DAR ≈ 3.8-4.0), SEC (3.3% HMW), and LAL (<0.025 EU per mg of anti-transferrin receptor antibody). The product was stored at 4 °C.

[0348] Scheme 2: Synthesis and purification of hEx44_Ac7_26-AOC

[0349] Anti-human transferrin receptor antibody was produced. hEx44_Ac7_26PMO was synthesized. The antibody (20.4 mg / ml) in citrate buffer (50 mM sodium citrate, 300 mM sucrose, pH 6.5) was combined with ethylenediaminetetraacetic acid (EDTA, 0.5 M, 0.591 mL) and reduced by adding 2 equivalents of tris(2-carboxyethyl)phosphine (TCEP) in water and incubating at 37 °C for 2 hours. 4(N-maleimidomethyl)cyclohexane carboxylic acid N-hydroxysuccinimide ester (SMCC) was coupled to the primary amine on the 3' end of hEx44_Ac7_26PMO by incubating hEx44_Ac7_26PMO (50 mg / ml) in 50 mM phosphate buffer at pH 7.2 with 3 equivalents of SMCC (50 mg / ml) in DMSO for 1 hour. Unconjugated SMCC was removed by tangential flow filtration (TFF) through a 3 kDa membrane MWCO with acetate buffer (10 mM sodium acetate, pH 6.0). The reduced antibody was mixed with 4.75 equivalents of hEx44_Ac7_26PMO-SMCC and incubated at room temperature for 1 hour. N-ethylmaleimide (10 equivalents, 15 mg / ml in DMSO, 25 mg) was added to the mixture at room temperature for 30 minutes to quench unreacted cysteines. The reaction was diluted to 1 L with endotoxin-free water. Excess PMO and NEM were removed by SCX purification (GE SP / HP 16 10 resin) using SCX method-1. The combined fractions were buffer exchanged by TFF into citrate buffer (50 mM sodium citrate, 60 mM NaCl, pH 5.5) and concentrated to approximately 25 mg Ab / mL. The solution was sterile filtered through a 0.22 um membrane.

[0350] Strong Cation Chromatography (SCX) Method-1 Column: GE HiScale 50, HiPrep SP HP, 200ml Solvent A: 25 mM acetate, 25 mM PB, pH 6; Solvent B: 25 mM acetate, 25 mM PB, pH 6, 0.5 mM NaCl; Flow rate: 30 ml / min gradient: % of A % of B Column volume 100 0 3 40 60 1.5 0 100 0.2 0 100 1 hEx44_Ac7_26-AOC was quantified by BCA and analyzed by HIC (Avg DAR ≈ 3.8-4.0), SEC (3.3% HMW), and LAL (<0.025 EU per mg of anti-transferrin receptor antibody). The product was stored at 4 °C.

[0351] Scheme 3: Synthesis and purification of hEx44_Ac7_26-AOC

[0352] Anti-human transferrin receptor antibody was produced in citrate buffer (50 mM sodium citrate, 300 mM sucrose, pH 6.5). hEx44_Ac7_26PMO-SMCC was synthesized by coupling 4(N-maleimidomethyl)cyclohexane carboxylic acid N-hydroxysuccinimide ester (SMCC) to the primary amine at the 3' end of hEx44_Ac7_26PMO. Ethylenediaminetetraacetic acid (EDTA, 0.5 M, 0.05 mL) was added to the antibody and the solution was mixed thoroughly. The antibody was reduced by the addition of tris(2-carboxyethyl)phosphine (TCEP, 20 mg / mL in HO, 10 equiv, 19.5 mg, 0.973 mL) and the solution was incubated at 37 °C for 2 h. The reduced antibody solution was removed from the incubator and cooled to room temperature. hEx44_Ac7_26PMO-SMCC solution (12 equiv., 27.4 mg / mL in 10 mM acetate, pH 6, 26.1 mL) was added to the reduced antibody solution and mixed thoroughly. The reaction was allowed to proceed for 1 h at room temperature. n-Ethylmaleimide (NEM) solution (10 equiv., 25 mg / mL in DMSO, 8.5 mg, 0.34 mL) was added to the reaction mixture and the reaction was allowed to proceed for 30 min at room temperature to quench unreacted cysteines. The reaction mixture was diluted to 0.2 L using endotoxin-free water. Excess PMO and NEM were removed by strong cation chromatography purification SCX method-1. The combined fractions were buffer exchanged into histidine buffer (20 mM histidine, 10 mM methionine, 120 mM sucrose, pH 6.0) using spin filtration and quantified by BCA assay (0.79 g, 79% yield). The solution was sterile filtered through a 0.22 μm membrane. PMO44-AOC was quantified by BCA and analyzed by hydrophobic interaction chromatography (average DAR ≈ 8), size exclusion chromatography (3.3% HMW), reduced capillary gel electrophoresis (average DAR ≈ 7.8-8.0), and ELISA binding affinity to human transferrin receptor (Kd of 74.5 pM). The affinity of hEx44_Ac7_26-AOC DAR8 AOC was equivalent to unconjugated anti-transferrin receptor antibody as shown in Figure 7.

[0353] Exon 44 skipping assay

[0354] Cynomolgus monkeys were given a single intravenous (IV) injection of 159.9 mg / kg hEx44_Ac7_26-AOC, corresponding to a PMO dose level of 30 mg / kg. Muscle tissue and non-muscle biopsy samples were obtained from cynomolgus monkeys on day 43 / 44 (before necropsy). In the vehicle control group, animals did not receive any hEx44_Ac7_26-AOC. Four male animals per group were analyzed.

[0355] Cynomolgus monkey muscle tissue and nonmuscle samples ranging from 20 to 50 mg were homogenized on an OMNI Bead Ruptor Elite system (OMNI International) in 1 mL of TRIzol (Thermo Fisher). RNA was isolated from tissue homogenate supernatants using the Direct-zol-96 RNA kit (Zymo Research) according to the manufacturer's instructions. 250 ng of purified RNA was converted to cDNA using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and a SimpliAmp thermal cycler (Applied Biosystems). ddPCR was performed on 50 ng of cDNA in a reaction with a commercial Total DMD Taqman assay (Mf01049436_m1 VIC-MGB, Thermo Fisher), a custom Skipped DMD Taqman assay (forward primer: AAGGACCGACAAGGGAACT (SEQ ID NO: 93), probe (FAM-MGB): TTCTGACAACAGTTTGCCGCTGC (SEQ ID NO: 94), reverse primer: GCTGAATTATTCTTCCGCAGTTG (SEQ ID NO: 95), Thermo Fisher), ddPCR Supermix for the probe (no dUTP, Bio-Rad), BamHI-HF restriction enzyme (New England BioLabs), and Ambion nuclease free water (Thermo Fisher). Each sample, performed in triplicate, was dispensed into droplets in a QX200 Automated Droplet Generator (Bio-Rad). After droplet generation, samples were transferred to a C1000 Touch thermal cycler equipped with a 96-Deep Well Reaction Module (Bio-Rad). After PCR amplification, samples were loaded into a QX200 Droplet Reader (Bio-Rad). Data were analyzed using QX Manager software, standard edition, version 1.2 (Bio-Rad). Discrimination between positive and negative droplets was achieved by manually applying a fluorescence amplitude threshold. The percentage of exon skipping was calculated using a 100% confidence interval (CI) of 100–1500. *Calculated as (number of skipped exon 44 copies per μL / total DMD copies per μL).

[0356] result

[0357] Cynomolgus monkeys received a single IV injection of hEx44-Ac7-26-AOC at a dose of 159.9 mg / kg, corresponding to a PMO(hEx44-Ac7-26) dose level of 30 mg / kg, on day 0. Muscle and non-muscle tissues from the animals were collected 43 / 44 days after dosing, and the number of exon 44 skipping copies in these tissues was measured by ddPCR. No exon 44 skipping activity was detected in PBS-injected samples. Forty-four days after a single IV dose of 159.9 mg / kg hEx44_Ac7_26-AOC was detected in all muscle tissues, but not in non-muscle tissues, including liver and kidney (see Figure 8). Exon 44 skipping activity in muscle was detected in cardiac as well as skeletal muscle. The highest level of exon 44 skipping activity in muscle tissue was detected in rectus femoris with more than 25 exon 44 skipping copies per ng of cDNA, and the lowest level was detected in biceps brachii with less than 5 copies per ng of cDNA. In addition, exon 44 skipping activity was measured in the atria and ventricles of the heart with an average of about 7 exon 44 skipping copies per ng of cDNA. These results indicate that hEx44_Ac7_26-AOC specifically targets muscle tissues, both skeletal and cardiac, and induces exon 44 skipping in these specific tissues. Exon 44 skipping activity was detected 43 days after a single IV injection of hEx44_Ac7_26-AOC, demonstrating its long-acting activity in the target tissues. Overall, the exon 44 skipping activity induced by hEx44_Ac7_26-AOC is specific to muscle tissue, and hEx44_Ac7_26-AOC has challenge-type exon 44 skipping activity in muscle tissue.

[0358] While preferred embodiments of the present disclosure have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will occur to those skilled in the art without departing from the present disclosure. It is understood that various alternatives to the embodiments of the present disclosure described herein may be employed in the practice of the present disclosure. It is intended that the following claims define the scope of the disclosure, and that methods and structures within the scope of these claims, and their equivalents, be covered thereby.

Claims

1. 1. A phosphorodiamidate morpholino oligonucleotide (PMO) conjugate comprising an anti-transferrin receptor antibody, or antigen-binding fragment thereof, conjugated to a PMO molecule, wherein the PMO molecule comprises a sequence selected from the group consisting of SEQ ID NOs: 100-133.

2. 2. The PMO conjugate of claim 1, wherein the PMO molecule hybridizes to an acceptor splice site, a donor splice site, or an exon splice enhancer element of a pre-mRNA transcript of the DMD gene and induces exon 44 skipping in the pre-mRNA transcript to generate an mRNA transcript encoding a truncated DMD protein.

3. 3. The PMO conjugate of claim 1 or 2, wherein the PMO molecule comprises at least about 10 to about 30 nucleotides in length.

4. The PMO conjugate of any one of claims 1 to 3, wherein the PMO molecule is delivered into a muscle cell.

5. 5. The PMO conjugate of any one of claims 1 to 4, wherein the PMO molecule hybridizes to an exon 44 acceptor splice site of a pre-mRNA transcript of the DMD gene in a pre-mRNA transcript to generate an mRNA transcript encoding a truncated dystrophin protein.

6. 6. The PMO conjugate of any one of claims 1 to 5, wherein the anti-transferrin receptor antibody or antigen-binding fragment thereof comprises a humanized antibody or antigen-binding fragment thereof, a chimeric antibody or antigen-binding fragment thereof, a monoclonal antibody or antigen-binding fragment thereof, a monovalent Fab', a bivalent Fab2, a single chain variable fragment (scFv), a diabody, a minibody, a nanobody, a single domain antibody (sdAb), or a camelid antibody or antigen-binding fragment thereof.

7. The PMO conjugate of any one of claims 1 to 6, wherein the PMO molecule is conjugated to the anti-transferrin receptor antibody or antigen-binding fragment thereof via a linker.

8. The PMO conjugate of claim 7 , wherein the linker is a cleavable linker.

9. The PMO conjugate of claim 7 , wherein the linker is a non-cleavable linker.

10. The linker is a heterobifunctional linker, a homobifunctional linker, a maleimide group, a dipeptide moiety, a benzoic acid group or a derivative thereof, １ -C ６ 8. The PMO conjugate of claim 7, wherein the PMO conjugate is selected from the group consisting of alkyl groups, alkyl radicals, and combinations thereof.

11. 11. The PMO conjugate of any one of claims 1 to 10, having a PMO molecule to antibody ratio (DAR) of about 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, or more.

12. 11. The PMO conjugate of any one of claims 1 to 10, having an average DAR of about 1, 2, 3, 4, 5, 6, 7, 8, or more.

13. 11. The PMO conjugate of any one of claims 1 to 10, having an average DAR in the range of 3.5 to 4.

5.

14. 11. The PMO conjugate of any one of claims 1 to 10, having an average DAR in the range of 7.5 to 8.

5.

15. 11. The PMO conjugate of any one of claims 1 to 10, having an average DAR of about 4.

16. 11. The PMO conjugate of any one of claims 1 to 10, having an average DAR of about 8.

17. 11. The PMO conjugate of any one of claims 1 to 10, having a DAR of about 4.

18. 11. The PMO conjugate of any one of claims 1 to 10, having a DAR of about 8.

19. 18. The PMO conjugate of any one of claims 1 to 17, formulated for parenteral administration.

20. The PMO conjugate of any one of claims 1 to 19, wherein the truncated dystrophin protein modulates muscular dystrophy.

21. 20. The PMO of claim 19, wherein the muscular dystrophy is Duchenne muscular dystrophy or Becker muscular dystrophy.

22. 1. A method of treating muscular dystrophy in a subject in need thereof, comprising administering to the subject a phosphorodiamidate morpholino oligonucleotide (PMO) conjugate comprising an anti-transferrin receptor antibody, or an antigen-binding fragment thereof, conjugated to a PMO molecule comprising a sequence selected from the group consisting of SEQ ID NOs: 100-133, wherein the PMO molecule hybridizes to an acceptor splice site, donor splice site, or exon splice enhancer element of a pre-mRNA transcript of a DMD gene and induces exon 44 skipping in the pre-mRNA transcript to generate an mRNA transcript encoding a truncated dystrophin protein.

23. 23. The method of claim 22, wherein the PMO molecule is delivered into a muscle cell.

24. 24. The method of any one of claims 22-23, wherein the anti-transferrin receptor antibody or antigen-binding fragment thereof comprises a humanized antibody or antigen-binding fragment thereof, a chimeric antibody or antigen-binding fragment thereof, a monoclonal antibody or antigen-binding fragment thereof, a monovalent Fab', a bivalent Fab2, a single chain variable fragment (scFv), a diabody, a minibody, a nanobody, a single domain antibody (sdAb), or a camelid antibody or antigen-binding fragment thereof.

25. 24. The method of any one of claims 22-23, wherein the PMO molecule comprises at least about 10 to about 30 nucleotides in length.

26. The method of any one of claims 22 to 24, wherein the PMO molecule is conjugated to the anti-transferrin receptor antibody or antigen-binding fragment thereof via a linker.

27. 27. The method of claim 26, wherein the linker is a cleavable linker.

28. 27. The method of claim 26, wherein the linker is a non-cleavable linker.

29. The linker is a heterobifunctional linker, a homobifunctional linker, a maleimide group, a dipeptide moiety, a benzoic acid group or a derivative thereof, １ -C ６ 27. The method of claim 26, wherein the alkyl group is selected from the group consisting of alkyl groups, alkyl radicals, and combinations thereof.

30. 30. The method of any one of claims 22-29, wherein the PMO conjugate has an average PMO molecule to antibody ratio (DAR) of about 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, or 8:

1.

31. 30. The method of any one of claims 22 to 29, wherein the PMO conjugate has an average DAR in the range of 3.5 to 4.

5.

32. 30. The method of any one of claims 22 to 29, wherein the PMO conjugate has an average DAR in the range of 7.5 to 8.

5.

33. 30. The method of any one of claims 22 to 29, wherein the PMO conjugate has an average DAR of about 4.

34. 30. The method of any one of claims 22 to 29, wherein the PMO conjugate has an average DAR of about 8.

35. The method of any one of claims 22 to 34, wherein the PMO conjugate is administered parenterally.

36. The method of any one of claims 22 to 35, wherein the truncated dystrophin protein modulates muscular dystrophy.

37. 37. The method of claim 36, wherein the muscular dystrophy is Duchenne muscular dystrophy or Becker muscular dystrophy.

38. 1. A method for inducing exon 44 skipping in a targeted pre-mRNA transcript of a DMD gene, comprising: a) contacting a muscle cell with a phosphorodiamidate morpholino oligonucleotide (PMO)-antibody conjugate, the PMO-antibody conjugate comprising an anti-transferrin receptor antibody or antigen-binding fragment thereof, and a PMO molecule that targets an acceptor splice site, a donor splice site, or an exon splice enhancer element of the targeted pre-mRNA transcript of the DMD gene, wherein the PMO molecule induces exon 44 skipping in the targeted pre-mRNA transcript, and the PMO-antibody conjugate is preferentially delivered into the muscle cell; b) hybridizing said PMO molecule to said targeted pre-mRNA transcript to induce exon 44 skipping in said targeted pre-mRNA transcript; and c) translating in said muscle cells mRNA transcripts produced from said targeted pre-mRNA transcripts processed in step b) to produce a truncated dystrophin protein.

39. 39. The method of claim 38, wherein the anti-transferrin receptor antibody or antigen-binding fragment thereof comprises a humanized antibody or antigen-binding fragment thereof, a chimeric antibody or antigen-binding fragment thereof, a monoclonal antibody or antigen-binding fragment thereof, a monovalent Fab', a bivalent Fab2, a single chain variable fragment (scFv), a diabody, a minibody, a nanobody, a single domain antibody (sdAb), or a camelid antibody or antigen-binding fragment thereof.

40. 40. The method of claim 38 or 39, wherein the PMO molecule comprises at least about 10 to about 30 nucleotides in length.

41. 41. The method of any one of claims 38-40, wherein the PMO molecule comprises at least 90%, 95%, 99%, or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 100-133.

42. 42. The method of any one of claims 38 to 41, wherein the PMO molecule targets an acceptor site in exon 44.

43. The method of any one of claims 38 to 42, wherein the PMO molecule is conjugated to the anti-transferrin receptor antibody or antigen-binding fragment thereof via a linker.

44. 44. The method of claim 43, wherein the linker is a cleavable linker.

45. 44. The method of claim 43, wherein the linker is a non-cleavable linker.

46. The linker is a heterobifunctional linker, a homobifunctional linker, a maleimide group, a dipeptide moiety, a benzoic acid group or a derivative thereof, １ -C ６ 44. The method of claim 43, wherein the alkyl group is selected from the group consisting of alkyl groups, alkyl radicals, and combinations thereof.

47. 47. The method of any one of claims 38-46, wherein the PMO conjugate has an average PMO-to-antibody ratio (DAR) of about 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, or more.

48. 47. The method of any one of claims 38-46, wherein the PMO conjugate has a DAR of about 1, 2, 3, 4, 5, 6, 7, 8, or more.

49. 48. The method of any one of claims 38 to 47, wherein the PMO conjugate has an average DAR in the range of 3.5 to 4.

5.

50. 48. The method of any one of claims 38 to 47, wherein the PMO conjugate has an average DAR in the range of 7.5 to 8.

5.

51. 48. The method of any one of claims 38 to 47, wherein the PMO conjugate has an average DAR of about 4.

52. 48. The method of any one of claims 38 to 47, wherein the PMO conjugate has an average DAR of about 8.

53. The method according to any one of claims 38 to 52, which is an in vivo method.

54. 1. A method of inducing exon 44 skipping in a DMD subject in need thereof, comprising administering to the DMD subject a phosphorodiamidate morpholino oligonucleotide (PMO) conjugate comprising an anti-transferrin receptor antibody, or an antigen-binding fragment thereof, conjugated to a PMO molecule comprising a sequence selected from the group consisting of SEQ ID NOs: 100-133, wherein the PMO molecule hybridizes to an exon 44 acceptor splice site of a pre-mRNA transcript of a DMD gene and induces exon 44 skipping in the pre-mRNA transcript to produce an mRNA transcript encoding a truncated dystrophin protein.

55. 1. A method of restoring dystrophin in a DMD subject in need thereof, comprising administering to the DMD subject a phosphorodiamidate morpholino oligonucleotide (PMO) conjugate comprising an anti-transferrin receptor antibody, or an antigen-binding fragment thereof, conjugated to a PMO molecule comprising a sequence selected from the group consisting of SEQ ID NOs: 100-133, wherein the PMO molecule hybridizes to an exon 44 acceptor splice site of a pre-mRNA transcript of the DMD gene and induces exon 44 skipping in the pre-mRNA transcript to generate an mRNA transcript encoding a truncated dystrophin protein.

56. 1. A method of producing a truncated dystrophin protein in a DMD subject in need thereof, comprising administering to the DMD subject a PMO conjugate comprising an anti-transferrin receptor antibody, or an antigen-binding fragment thereof, conjugated to a phosphorodiamidate morpholino oligonucleotide (PMO) molecule comprising a sequence selected from the group consisting of SEQ ID NOs: 100-133, wherein the PMO molecule hybridizes to an exon 44 acceptor splice site of a pre-mRNA transcript of the DMD gene and induces exon 44 skipping in the pre-mRNA transcript to produce an mRNA transcript encoding a truncated dystrophin protein.

Images