Compositions and methods for the treatment of muscular dystrophies

Abstract

The present invention relates to recombinant adeno-associated virus (rAAV) delivery of polynucleotides for treating muscular dystrophies resulting from duplication of DMD exon 2. The present invention provides rAAV products and methods of using rAAV in the treatment of muscular dystrophies.

Description

[Technical field]

[0001] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in XML format and is incorporated herein by reference in its entirety. A copy of this XML was created on April 3, 2023, is entitled "51037-062WO2_Sequence_Listing_4_3_23", and is 20,956 bytes in size.

[0002] The present invention relates to the field of therapeutic treatment of muscular dystrophies in patients, such as Duchenne muscular dystrophy in human patients.

[0003] CROSS-REFERENCE TO ONE OR MORE RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Application No. 63 / 327,532, filed April 5, 2022, the entire disclosure of which is incorporated by reference herein as if set forth in its entirety. [Background technology]

[0004] Duchenne muscular dystrophy (DMD) is a severe X-linked muscular degenerative disease caused by the absence of the cytoskeletal protein dystrophin. In contrast, mutations that preserve the reading frame of the gene encoding dystrophin and result in a partially functional protein induce milder Becker muscular dystrophy (BMD). The dystrophin protein provides stability to the sarcolemma (i.e., the cell membrane of muscle cells) by linking the intracellular cytoskeletal network to the extracellular matrix. In the absence of dystrophin, muscle contraction mechanically stresses the cell membrane and induces progressive damage to muscle fibers. Initially, primarily skeletal muscles are affected. However, as the disease progresses, damage spreads to the myocardium, causing death by respiratory or cardiac failure. DMD is one of the most common genetic disorders, affecting an estimated 1 in 3,600 male births each year. DMD is a debilitating disease that gradually worsens over the short (approximately 25-year) lifespan of affected individuals. Recently, gene therapy approaches have been developed that involve delivery of interfering ribonucleic acids for targeted skipping of exon 2 of the dystrophin gene. However, there is a need in the art to improve the efficacy of gene therapy approaches that skip DMD exon 2 for patients with DMD or BMD. Summary of the Invention

[0005] The present disclosure provides compositions and methods for preventing disease, slowing disease progression, and / or treating patients with one or more 5' mutations of the dystrophin (DMD) gene. The compositions and methods are based on the identification of an effective approach to DMD exon 2 skipping translation, which comprises administering a U7 small nuclear ribonucleic acid (snRNA)-specific antisense polynucleotide against an exonic splicing enhancer (ESE) of exon 2, the skipping of which can generate a functional N-terminally truncated dystrophin isoform.

[0006] The present disclosure contemplates a method of ameliorating Duchenne muscular dystrophy (DMD) or Becker muscular dystrophy (BMD) in a patient having a 5' mutation in the DMD gene, the method comprising administering an antisense polynucleotide (e.g., an interfering ribonucleic acid (RNA)) to the patient, the patient having a DMD exon 2 duplication, and / or the patient having a frameshift mutation in any one of exons 1-4 of the endogenous DMD gene.

[0007] In one aspect, the disclosure provides a transgene encoding an RNA molecule, the RNA molecule comprising: (i) a BoxB RNA element; and (ii) an antisense polynucleotide of 10 to 100 (e.g., 11 to 99, 12 to 98, 13 to 97, 14 to 96, 15 to 95, 20 to 90, 30 to 80, 40 to 70, or 50 to 60) nucleotides in length having sufficient complementarity to hybridize to a region within an mRNA transcript encoding a protein (such as, for example, exon 2 of a human dystrophin RNA transcript).

[0008] In some embodiments, the BoxB RNA element has a nucleic acid sequence that is at least 85% (e.g., at least 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the BoxB RNA element has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the BoxB RNA element has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the BoxB RNA element has a nucleic acid sequence that is at least 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the BoxB RNA element has a nucleic acid sequence of SEQ ID NO:3.

[0009] In some embodiments, a BoxB RNA element is located 5' to the antisense polynucleotide, or a BoxB RNA element is located 3' to the antisense polynucleotide, In some embodiments, a BoxB RNA element is located 5' to the antisense polynucleotide.

[0010] In some embodiments, the mRNA transcript is a human dystrophin mRNA transcript, a human fukutin mRNA transcript, a human gamma-sarcoglycan mRNA transcript, a human dysferlin mRNA transcript, a human myotonic dystrophy protein kinase mRNA transcript, a human laminin subunit alpha 2 mRNA transcript, a human usherin mRNA transcript, a human collagen alpha-1 (VII) chain mRNA transcript, or a human activin A receptor type 1 mRNA transcript. In some embodiments, the mRNA transcript is a human dystrophin mRNA transcript.

[0011] In some embodiments, the antisense polynucleotide comprises a portion of 25 to 40 (e.g., 25 to 40, 26 to 40, 27 to 40, 28 to 40, 29 to 40, 30 to 40, 31 to 40, 32 to 40, 33 to 40, 34 to 40, 35 to 40, 36 to 40, 37 to 40, 38 to 40, or 39 to 40) nucleotides in length having sufficient complementarity to hybridize across or within the length of a region of exon 2 of the human dystrophin RNA transcript, the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the portion of the antisense polynucleotide is 25 to 35 nucleotides in length. In some embodiments, the portion of the antisense polynucleotide is 26 to 34 nucleotides in length. In some embodiments, the portion of the antisense polynucleotide is 27 to 33 nucleotides in length. In some embodiments, the portion of the antisense polynucleotide is 28 to 32 nucleotides in length. In some embodiments, the portion of the antisense polynucleotide is 29 to 31 nucleotides in length. In some embodiments, the portion of the antisense polynucleotide is 30 nucleotides in length. In another example, in some embodiments, the portion of the antisense polynucleotide is 31 to 39 nucleotides in length. In some embodiments, the portion of the antisense polynucleotide is 32 to 38 nucleotides in length. In some embodiments, the portion of the antisense polynucleotide is 33 to 37 nucleotides in length. In some embodiments, the portion of the antisense polynucleotide is 34 to 36 nucleotides in length. In some embodiments, the portion of the antisense polynucleotide is 30 nucleotides in length.

[0012] In some embodiments, the antisense polynucleotide does not have complementarity to exon 2 of the human dystrophin RNA transcript at a site located 5' to residue 17 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide does not have complementarity to exon 2 of the human dystrophin RNA transcript at a site located 3' to residue 46 of SEQ ID NO:1.

[0013] In some embodiments, the antisense polynucleotide has a nucleic acid sequence that is at least 70% (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide has a nucleic acid sequence that is at least 75% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide has a nucleic acid sequence that is at least 80% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide has a nucleic acid sequence that is at least 85% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide has a nucleic acid sequence that is at least 90% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide has a nucleic acid sequence that is at least 95% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide has a nucleic acid sequence that is at least 96%, 97%, 98%, or 99% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide has a nucleic acid sequence that is completely complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1.

[0014] In some embodiments, the antisense polynucleotide comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or at least 30 contiguous nucleotides, which contiguous nucleotides are perfectly complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises 10 to 30 (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) contiguous nucleotides, which are fully complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises 12 to 30 contiguous nucleotides, which are fully complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises 15 to 30 contiguous nucleotides, which are fully complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises 18 to 30 contiguous nucleotides that are perfectly complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1.In some embodiments, the antisense polynucleotide comprises 21 to 30 contiguous nucleotides, which are fully complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises 24 to 30 contiguous nucleotides, which are fully complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises 30 contiguous nucleotides, which are fully complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1.

[0015] In some embodiments, the antisense polynucleotide contains 9 or fewer (e.g., 9, 8, 7, 6, 5, 4, 3, 2, or 1) nucleotide mismatches to the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide contains 6 or fewer nucleotide mismatches to the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide contains 3 or fewer nucleotide mismatches to the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1.

[0016] In some embodiments, the antisense polynucleotide has a nucleic acid sequence that is at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the antisense polynucleotide has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the antisense polynucleotide has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the antisense polynucleotide has a nucleic acid sequence that is at least 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the antisense polynucleotide has a nucleic acid sequence of SEQ ID NO:2.

[0017] In some embodiments, the RNA molecule comprises U7snRNA. In some embodiments, the U7snRNA is located 3' to the antisense polynucleotide.

[0018] In some embodiments, the U7snRNA comprises an optimized spliceosome binding (Sm OPT) motif. In some embodiments, the Sm OPT motif has a nucleic acid sequence that is at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical to the nucleic acid sequence of SEQ ID NO:5. In some embodiments, the Sm OPT motif has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:5. In some embodiments, the Sm OPT motif has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:5. In some embodiments, the Sm OPT motif has a nucleic acid sequence that is at least 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO:5. In some embodiments, the Sm OPT motif has a nucleic acid sequence of SEQ ID NO:5.

[0019] In some embodiments, the U7 snRNA comprises a U7 stem loop. In some embodiments, the U7 stem loop has a nucleic acid sequence that is at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical to the nucleic acid sequence of SEQ ID NO:6. In some embodiments, the U7 stem loop has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:6. In some embodiments, the U7 stem loop has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:6. In some embodiments, the U7 stem loop has a nucleic acid sequence that is at least 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO:6.

[0020] In some embodiments, the U7 snRNA comprises a U7 downstream region. In some embodiments, the U7 downstream region has a nucleic acid sequence that is at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the U7 downstream region has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the U7 downstream region has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the U7 downstream region has a nucleic acid sequence that is at least 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO:7.

[0021] In some embodiments, the U7snRNA has a nucleic acid sequence that is at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the U7snRNA has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the U7snRNA has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the U7snRNA has a nucleic acid sequence that is at least 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the U7snRNA has a nucleic acid sequence of SEQ ID NO:8.

[0022] In some embodiments, the antisense polynucleotide is an antisense RNA (asRNA), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a microRNA (miRNA), or an antisense oligonucleotide (ASO).

[0023] In another aspect, the present disclosure provides a composition comprising a transgene or RNA molecule of any of the above aspects, wherein the composition is a liposome, a vesicle, a synthetic vesicle, an exosome, a synthetic exosome, a dendrimer, or a nanoparticle.

[0024] In another aspect, the disclosure provides a plasmid comprising or encoding a transgene or RNA molecule of any of the above aspects. In another aspect, the disclosure provides a non-viral vector comprising or encoding a transgene or RNA molecule of any of the above aspects. In another aspect, the disclosure provides a viral vector comprising or encoding a transgene or RNA molecule of any of the above aspects.

[0025] In some embodiments of the above aspects, the plasmid, non-viral vector, or viral vector comprises one or more RNA molecules. In some embodiments, the plasmid, non-viral vector, or viral vector comprises two RNA molecules.

[0026] In some embodiments, the two RNA molecules are bidirectionally oriented.

[0027] In some embodiments, the viral vector is selected from the group including adeno-associated virus (AAV), adenovirus, lentivirus, retrovirus, poxvirus, baculovirus, herpes simplex virus, vaccinia virus, and synthetic viruses.

[0028] In some embodiments, the viral vector is AAV. In some embodiments, the AAV is recombinant AAV (rAAV), single-stranded rAAV, or self-complementary recombinant AAV (scAAV). In some embodiments, the AAV is single-stranded rAAV. In some embodiments, the AAV is scAAV.

[0029] In some embodiments, the AAV comprises a capsid protein from an AAV having a serotype selected from the group including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrhlO, and AAVrh74.

[0030] In some embodiments, the viral vector is pseudotyped AAV. In some embodiments, the pseudotyped AAV is AAV2 / 8 or AAV2 / 9. In some embodiments, the pseudotyped AAV is AAV2 / 8.

[0031] In some embodiments, expression of the transgene is regulated by an enhancer that promotes expression of the transgene in muscle cells or neurons. In some embodiments, the enhancer is a muscle creatine kinase (MCK) enhancer, a desmin enhancer, a myosin light chain enhancer, a myosin heavy chain enhancer, a cardiac troponin C enhancer, a troponin I enhancer, a myoD gene family enhancer, an actin alpha enhancer, an actin beta enhancer, an actin gamma enhancer, or an enhancer within intron 1 of the paired-like homeodomain 3 of the eye. In some embodiments, the enhancer is an MCK enhancer.

[0032] In some embodiments, the MCK enhancer has a nucleic acid sequence that is at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical to the nucleic acid sequence of SEQ ID NO:11. In some embodiments, the MCK enhancer has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:11. In some embodiments, the MCK enhancer has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:11. In some embodiments, the MCK enhancer has a nucleic acid sequence that is at least 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO:11. In some embodiments, the MCK enhancer has a nucleic acid sequence of SEQ ID NO:11.

[0033] In some embodiments, the transgene is operably linked to a U7 promoter. In some embodiments, the 5' end of the antisense polynucleotide is linked to the 3' end of the U7 promoter.

[0034] In some embodiments, the U7 promoter has a nucleic acid sequence that is at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the U7 promoter has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the U7 promoter has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the U7 promoter has a nucleic acid sequence that is at least 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the U7 promoter has a nucleic acid sequence of SEQ ID NO:4.

[0035] In some embodiments, the transgene has a nucleic acid sequence that is at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the transgene has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the transgene has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the transgene has a nucleic acid sequence that is at least 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the transgene has a nucleic acid sequence of SEQ ID NO:9.

[0036] In some embodiments, the viral vector has a nucleic acid sequence that is at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical to the nucleic acid sequence of SEQ ID NO:10. In some embodiments, the viral vector has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:10. In some embodiments, the viral vector has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:10. In some embodiments, the viral vector has a nucleic acid sequence that is at least 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO:10. In some embodiments, the viral vector has a nucleic acid sequence of SEQ ID NO:10.

[0037] In another aspect, the disclosure provides a pharmaceutical composition comprising the composition or viral vector of any of the above aspects and a pharma- ceutically acceptable carrier, diluent, or excipient.

[0038] In another aspect, the disclosure provides a method of treating a muscular dystrophy (such as DMD) in a human patient diagnosed with a duplication in exon 2 of the endogenous DMD gene, the method comprising administering to the patient a therapeutically effective amount of a composition, viral vector, or pharmaceutical composition of any of the above aspects.

[0039] In another aspect, the disclosure provides a method of treating a disorder (such as DMD) in a human patient diagnosed with a frameshift mutation, the method comprising administering to the patient a therapeutically effective amount of a composition, viral vector, or pharmaceutical composition of any of the above aspects.

[0040] In another aspect, the disclosure provides a method of treating a disorder mediated by a frameshift mutation (such as DMD) in a human patient, the method comprising administering to the patient a therapeutically effective amount of a composition, viral vector, or pharmaceutical composition of any of the above aspects.

[0041] In another aspect, the disclosure provides a method of treating a disorder mediated by a frameshift mutation (such as DMD) in a human patient, the method comprising administering to the patient a therapeutically effective amount of a composition, viral vector, or pharmaceutical composition of any of the above aspects.

[0042] In another aspect, the disclosure provides a method of treating a disorder (e.g., DMD) in a human patient diagnosed as overexpressing a protein of interest (e.g., dystrophin), the method comprising administering to the patient a therapeutically effective amount of a composition, viral vector, or pharmaceutical composition of any of the above aspects.

[0043] In another aspect, the disclosure provides a method of treating a disorder mediated by overexpression of a protein of interest (e.g., dystrophin, etc.) in a human patient, the method comprising administering to the patient a therapeutically effective amount of a composition, viral vector, or pharmaceutical composition of any of the above aspects.

[0044] In another aspect, the disclosure provides a method of treating DMD in a human patient diagnosed with a duplication in exon 2 of the endogenous DMD gene, the method comprising administering to the patient a therapeutically effective amount of a composition, viral vector, or pharmaceutical composition of any of the above aspects.

[0045] In another aspect, the disclosure provides a method of increasing expression of a functional dystrophin protein in a human patient diagnosed with a muscular dystrophy (such as DMD) and with a duplication in exon 2 of the endogenous DMD gene, the method comprising administering to the patient a therapeutically effective amount of a composition, viral vector, or pharmaceutical composition of any of the above aspects.

[0046] In another aspect, the disclosure provides a method of inducing exon 2 skipping in a human patient diagnosed with a muscular dystrophy (such as DMD) and with a duplication in exon 2 of the endogenous DMD gene, the method comprising administering to the patient a therapeutically effective amount of a composition, viral vector, or pharmaceutical composition of any of the above aspects.

[0047] In another aspect, the disclosure provides a method of treating a muscular dystrophy (e.g., DMD) in a human patient diagnosed with a frameshift mutation in any one of exons 1-4 of an endogenous DMD gene, the method comprising administering to the patient a therapeutically effective amount of a composition, viral vector, or pharmaceutical composition of any of the above aspects.

[0048] In another aspect, the disclosure provides a method of increasing expression of a functional dystrophin protein in a human patient diagnosed with a muscular dystrophy (e.g., DMD) and with a frameshift mutation in any one of exons 1-4 of the endogenous DMD gene, the method comprising administering to the patient a therapeutically effective amount of a composition, viral vector, or pharmaceutical composition of any of the above aspects.

[0049] In another aspect, the disclosure provides a method of inducing activation of an internal ribosome entry site in exon 5 of an endogenous DMD gene in a human patient, the patient having a muscular dystrophy (e.g., DMD) and having a frameshift mutation in any one of exons 1-4 of the endogenous DMD gene, the method comprising administering to the patient a therapeutically effective amount of a composition, viral vector, or pharmaceutical composition of any of the above aspects.

[0050] In some embodiments of any of the above aspects, the composition or viral vector is administered to the patient intravenously, intrathecally, intraventricularly, intraparenchymal, intravesical, intradermal, transdermal, parenterally, intramuscularly, intranasally, subcutaneously, transdermally, intratracheally, intraperitoneally, intraarterially, intravascularly, by inhalation, perfusion, lavage, or by oral administration. In some embodiments, the composition or viral vector is administered to the patient intravenously.

[0051] In some embodiments of any of the above aspects, the patient is a pediatric patient. In some embodiments, the patient is about 6 months to about 14 years old (e.g., about 6 months to about 13 years old, about 6 months to about 12 years old, about 6 months to about 11 years old, about 6 months to about 10 years old, about 6 months to about 9 years old, about 6 months to about 8 years old, about 6 months to about 7 years old, about 6 months to about 6 years old, about 6 months to about 5 years old, about 6 months to about 4 years old, about 6 months to about 3 years old, about 6 months to about 2 years old, or about 6 months to about 1 year old).

[0052] In some embodiments of any of the above aspects, the patient is pre-ambulatory. In some embodiments, the patient is ambulatory.

[0053] In another aspect, the disclosure provides a kit comprising: (i) the composition, viral vector, or pharmaceutical composition of any of the above aspects; and (ii) a package insert, the package insert instructing a user of the kit to administer the composition, viral vector, or pharmaceutical composition to a human patient diagnosed with a frameshift mutation.

[0054] In another aspect, the disclosure provides a kit comprising (i) the composition, viral vector, or pharmaceutical composition of any of the above aspects, and (ii) a package insert, the package insert instructing a user of the kit to administer the composition, viral vector, or pharmaceutical composition to a human patient diagnosed with overexpression of a protein of interest, such as dystrophin.

[0055] In another aspect, the disclosure provides a kit comprising: (i) the composition, viral vector, or pharmaceutical composition of any of the above aspects; and (ii) a package insert, the package insert instructing a user of the kit to administer the composition, viral vector, or pharmaceutical composition to a human patient diagnosed with a muscular dystrophy (such as DMD).

[0056] In some embodiments of any of the above aspects, the protein of interest is dystrophin.

[0057] In some embodiments of any of the above aspects, the disorder is DMD or BMD. In some embodiments, the disorder is DMD. In some embodiments of any of the above aspects, the muscular dystrophy is DMD or BMD. In some embodiments, the muscular dystrophy is DMD.

[0058] In some embodiments of any of the above aspects, the patient has been diagnosed with a duplication in exon 2 of the endogenous DMD gene.

[0059] In some embodiments of any of the above aspects, the patient has been diagnosed with a frameshift mutation in any one of exons 1-4 of the endogenous DMD gene. In some embodiments, the frameshift mutation is a frameshift mutation in exon 2 of the endogenous DMD gene. [Brief description of the drawings]

[0060] [Figure 1]FIG. 1 is a schematic diagram of an illustrative recombinant adeno-associated virus (rAAV) 8 (rAAV8) vector for expression of a transgene containing a BoxB RNA element and an antisense polynucleotide (e.g., an antisense ribonucleic acid (asRNA) complementary to the region between residues 17 and 46 of exon 2 of the human dystrophin (DMD) RNA transcript). From left to right, the shaded arrows and rectangles represent rAAV8 encoding two bidirectionally oriented U7 small nuclear RNA expression cassettes operably linked to the muscle creatine kinase (MCK) enhancer, a stuffer ("synthetic2"), and adjacent rAAV2 inverted terminal repeat (ITR) sequences. The double-headed arrows indicate two U7snRNA expression cassettes, each containing from 5' to 3' a BoxB RNA element, an antisense polynucleotide (e.g., a modified asRNA sequence targeting DMD exon 2), a U7snRNA sequence, a U7Sm binding protein (U7Sm OPT) sequence, a U7 stem-loop, and a U7 downstream element. Abbreviations: ESE, exonic splicing enhancer. [Diagram 2] FIG. 1 is a schematic diagram of an exemplary U7 expression cassette with an asRNA ("as") complementary to the region between residues 17 and 46 of DMD exon 2, including a portion of exon 2 and the ESE region. From left to right, the shaded rectangles represent nucleic acid sequences encoding a U7 promoter (U7-P) operably linked to an asRNA targeting DMD exon 2, a U7 snRNA, an Sm binding protein sequence (Sm), and a U7 small nuclear RNA (snRNA) construct with a U7 hairpin (hairpin; e.g., U7 stem loop and U7 downstream element). [Diagram 3]Reverse transcription polymerase chain reaction (RT-PCR) diagram illustrating the U7snRNA vector approach to exon skipping in transduced Dup2-immortalized human fibromyoblasts using rAAV8 as described in FIG. 1 with or without BoxB RNA element, respectively, encoding U7snRNA targeting exon 2 as described in FIG. 2. A U7snRNA expression cassette cloned into an AAV plasmid was used as a carrier to target DMD exon 2 pre-messenger RNA. This U7snRNA was composed of a U7 stem loop used for nucleocytoplasmic transport, a U7Sm OPT recognition sequence that binds Sm protein for efficient assembly between U7snRNA and target pre-mRNA, an asRNA targeting DMD exon 2 pre-mRNA, and a BoxB RNA element that enhances expression of the asRNA. The vector in lane 3 shows the vector genome encoding U7snRNA with BoxB RNA element. Lanes "AAV-DMD-Ex2", 1, 5, and 6 vectors each show a vector genome encoding U7 snRNA without the BoxB RNA element. [Figure 4] FIG. 3 shows a graph depicting the relative amounts of guide RNA (e.g., asRNA) expression levels in host cells transduced with rAAV8 as depicted in FIG. 1, with or without a BoxB RNA element, each encoding a U7 snRNA targeting exon 2 as depicted in FIG. 2. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0061] definition As used herein, the term "about" refers to a value within 10% above or below the stated value.

[0062] As used herein, "activity" refers to one or more forms of a nucleic acid or polypeptide that retain a biological activity of the native or naturally occurring nucleic acid or polypeptide, respectively, and "biological" activity refers to a biological function (e.g., splicing, etc.) caused by the native or naturally occurring nucleic acid or polypeptide, respectively.

[0063] As used herein, "administration" refers to providing or giving a therapeutic agent (such as an inhibitor) to a subject by any effective route. Illustrative administration routes are described herein and below (e.g., intracerebroventricular (ICV) injection, intrathecal (IT) injection, intraparenchymal (IP) injection, intravenous (IV) injection, and stereotactic injection, etc.). Administration may be systemic or local.

[0064] As used herein, the term "annealing" refers to the formation of a stable duplex of nucleic acid by hybridization mediated by interstrand hydrogen bonds, for example according to Watson-Crick base pairing. Double-stranded nucleic acids can be, for example, at least 50% complementary to each other (e.g., about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% complementary to each other). A "stable duplex" formed upon annealing of one nucleic acid to another is a double-stranded structure that is not denatured by stringent washing. Exemplary stringent washing conditions are known in the art and include temperatures about 5°C below the melting temperatures of the individual strands of the duplex and low concentrations of monovalent salt, such as monovalent salt concentrations (e.g., NaCl concentrations) of less than 0.2M (e.g., 0.2M, 0.19M, 0.18M, ​​0.17M, 0.16M, 0.15M, 0.14M, 0.13M, 0.12M, 0.11M, 0.1M, 0.09M, 0.08M, 0.07M, 0.06M, 0.05M, 0.04M, 0.03M, 0.02M, 0.01M or less).

[0065] As used herein, the terms "antisense oligonucleotide" and "ASO" refer to a single-stranded oligonucleotide sequence that contains one or more modified nucleosides or nucleotides and has the ability to (i) anneal to a target RNA transcript, particularly a contiguous sequence on a target nucleic acid, thereby forming a nucleic acid duplex, and (ii) mask a splicing reaction by said annealing. In some embodiments, the ASO comprises a locked nucleic acid antisense oligonucleotide or alternative modification.

[0066] As used herein, the terms "antisense RNA" and "asRNA" refer to a single-stranded cis-naturally occurring antisense transcript having a complementary transcript to another endogenous RNA transcript and having the ability to (i) anneal to a target RNA transcript, in particular a contiguous sequence on a target nucleic acid, thereby forming a nucleic acid duplex, and (ii) mask a splicing reaction by said annealing.

[0067] As used herein, "combination therapy" means that two (or more) different agents or treatments are administered to a subject as part of a defined treatment regimen for a particular disease or condition (such as DMD). The treatment regimen defines the dosage and periodicity of administration of each agent such that the effects of the separate agents on the subject overlap. In some embodiments, the delivery of the two or more agents is simultaneous or coincident, and the agents may be formulated simultaneously. In other embodiments, the two or more agents are not formulated simultaneously, but are administered sequentially as part of a defined regimen. In some embodiments, the administration of the two or more agents or treatments in combination is such that the reduction in symptoms or other parameters associated with the disorder is greater than that observed with one agent or treatment delivered alone or in the absence of the other agent. The effect of the two treatments may be partially additive, fully additive, or greater than additive (e.g., synergistic). The sequential or substantially simultaneous administration of each therapeutic agent may be effected by any suitable route, including, but not limited to, oral, intravenous, intramuscular, and direct absorption through mucosal tissue. The therapeutic agents may be administered by the same route or by different routes, for example, a first therapeutic agent in the combination may be administered by intravenous injection and a second therapeutic agent in the combination may be administered orally.

[0068] As used herein, the term "BoxB RNA element" refers to a bacteriophage lambda (e.g., phage p22 and phi21) N protein NutboxB ("BoxB") ribonucleic acid (RNA) stem loop (e.g., an RNA hairpin, etc.). Such BoxB RNA elements have intramolecular base pairing, also known as a hairpin or hairpin loop, which occurs when two regions of the same RNA strand base pair to form a double helix that terminates in an unpaired loop. The resulting hairpin loop is an RNA secondary structure that can, among other functions, direct RNA folding, protect structural stability for messenger RNA (mRNA), provide a recognition site for an RNA binding protein, or serve as a substrate for an enzymatic reaction. As described herein, a BoxB RNA element may refer to an RNA sequence whose nucleic acid sequence comprises or consists of a naturally occurring wild-type bacteriophage lambda N-protein NutboxB RNA stem loop as well as variants thereof. Bacteriophage λ BoxB has NCBI Macromolecular Structures Resource Group (MMBD) ID NO:49478. An exemplary BoxB nucleic acid sequence is provided in SEQ ID NO:3. As used herein, a BoxB RNA element may refer to an RNA sequence whose nucleic acid sequence is at least 75% (e.g., at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical to the nucleic acid sequence of SEQ ID NO:3.

[0069] As used herein, the term "DMD" refers to the gene for dystrophin. As used herein, the term DMD encompasses full-length unprocessed DMD, as well as any form of DMD resulting from processing in cells, as well as any naturally occurring variant of DMD (e.g., splice variants or allelic variants, etc.). Human DMD has NCBI Gene ID: 1756. An exemplary wild-type human DMD isoform DP427p1 nucleic acid sequence is provided in NCBI RefSeq Acc.No.NM_004009.3, and an exemplary wild-type human DMD isoform DP427p1 amino acid sequence is provided in NCBI RefSeq Acc.No.NP_004000.1. An exemplary wild-type human DMD isoform Dp427p2 nucleic acid sequence is provided in NCBI RefSeq Acc. No. NM_004010.3, and an exemplary wild-type human DMD isoform Dp427p2 amino acid sequence is provided in NCBI RefSeq Acc. NP_004001.1. An exemplary wild-type human DMD isoform Dp71 nucleic acid sequence is provided in NCBI RefSeq Acc. No. NM_004015.3, and an exemplary wild-type human DMD isoform Dp71 amino acid sequence is provided in NCBI RefSeq Acc. NP_004006.1. An exemplary wild-type human DMD isoform Dp71b nucleic acid sequence is provided in NCBI RefSeq Acc. No. NM_004016.3, and an exemplary wild-type human DMD isoform Dp71b amino acid sequence is provided in NCBI RefSeq Acc. NP_004007.1. An exemplary wild-type human DMD isoform Dp71a nucleic acid sequence is provided in NCBI RefSeq Acc. No. NM_004017.3, and an exemplary wild-type human DMD isoform Dp71a amino acid sequence is provided in NCBI RefSeq Acc. NP_004008.1.An exemplary wild-type human DMD isoform Dp71ab nucleic acid sequence is provided in NCBI RefSeq Acc. No. NM_004018.3, and an exemplary wild-type human DMD isoform Dp71ab amino acid sequence is provided in NCBI RefSeq Acc. NP_004009.1. An exemplary wild-type human DMD isoform Dp40 nucleic acid sequence is provided in NCBI RefSeq Acc. No. NM_004019.3, and an exemplary wild-type human DMD isoform Dp40 amino acid sequence is provided in NCBI RefSeq Acc. NP_004010.1.

[0070] In practicing the methods of this invention, an "effective amount" of any one of the compounds or any combination of compounds or pharma- ceutically acceptable salts thereof is administered, either alone or in combination, via any of the conventional and acceptable methods known in the art.

[0071] As used herein, the term "endogenous" refers to a molecule (e.g., a metabolite, a polypeptide, a nucleic acid, or a cofactor, etc.) that is naturally present in a particular organism (e.g., a human) or in a particular location within an organism (e.g., an organ, tissue, or cell, such as a human cell).

[0072] As used herein, the term "exon" refers to a region in the coding region of a gene, the nucleotide sequence of which determines the amino acid sequence of the corresponding protein. The term exon also refers to the corresponding region of the RNA transcribed from the gene. The gene may, for example, contain at least three exons separated by intervening introns. The exons may be transcribed into pre-mRNA and included in the mature mRNA depending on alternative splicing of the gene. The exons included in the processed mature mRNA are translated into proteins, and the sequence of the exons determines the amino acid composition of the protein.

[0073] As used herein, the term "exon skipping" refers to a form of alternative splicing in which one or more exons are excluded from the resulting mature mRNA. Exon skipping can occur as a result of endogenous regulation or can be induced in a predetermined manner by the presence of a polynucleotide (e.g., an antisense polynucleotide).

[0074] As used herein, the term "frameshift" refers to a change in the way ribosomes define codons in a gene and thus define the translational reading frame. The identity of each amino acid in a protein is determined by a three-nucleotide codon defined by the ribosome through the binding of the anticodon of the tRNA to its complementary sequence on the mRNA. Thus, any occurrence of a frameshift can change the amino acid sequence of the translated protein both at the position of the frameshift and downstream of it. As used herein, the term "genetic frameshift" refers to any mutation that results in a frameshift. A deletion or insertion within an exon can result in a frameshift, where the deletion or insertion is not a multiple of three nucleotides. In addition, a duplication or deletion of an entire exon can result in a frameshift, where the number of nucleotides in the exon is not a multiple of three. In some embodiments, a frameshift mutation refers to a frameshift mutation in any one of exons 1-4 of the endogenous DMD gene.

[0075] As used herein, the term "gene" refers to a region of DNA that codes for a protein. A gene may include a regulatory region and a protein coding region. In some embodiments, a gene includes two or more introns and three or more exons, with each intron forming an intervening sequence between two exons.

[0076] As used herein, the term "antisense polynucleotide" refers to an RNA, such as an antisense RNA (asRNA), small interfering RNA (siRNA), microRNA (miRNA), small hairpin RNA (shRNA), or antisense oligonucleotide (ASO), which, for example, (i) anneals to a target RNA transcript, thereby forming a nucleic acid duplex; and (ii) suppresses the endogenous function of a target RNA transcript by masking the binding of a specific splice-associated region (e.g., a splicing enhancer, splice acceptor, or splice donor of an exon) during a splicing reaction. The antisense polynucleotides described herein may be provided to a patient, such as a human patient having a muscular dystrophy (e.g., DMD) described herein, for example, in the form of a single-stranded or double-stranded oligonucleotide, or in the form of a vector (e.g., a viral vector) that includes a transgene encoding the antisense polynucleotide (e.g., asRNA). Exemplary antisense polynucleotide platforms are described, for example, in Lam et al., Mol. Ther. Nucleic Acids 4:e252 (2015); Rao et al., Adv. Drug Deliv. Rev. 61:746-769 (2009); and Borel et al., Mol. Ther. 22:692-701 (2014); the entire disclosures of each of which are incorporated herein by reference. In some embodiments, the antisense polynucleotide is asRNA.

[0077] As used herein, the term "IRES" refers to an internal ribosome entry site. In general, an IRES sequence is a feature that allows eukaryotic ribosomes to bind to an mRNA transcript and begin translation without binding to the 5' cap end. An mRNA that contains an IRES sequence produces two translation products, one that starts from the 5' end of the mRNA and the other that starts from the internal translation mechanism mediated by the IRES.

[0078] As used herein, the "length" of a nucleic acid refers to the size of the length of the nucleic acid as assessed by measuring the amount of nucleotides from the 5' end to the 3' end of the nucleic acid. Illustrative molecular biology techniques that can be used to determine the length of a nucleic acid of interest are known in the art.

[0079] "Muscular dystrophies" refers to a group of muscle diseases that weaken the musculoskeletal system and interfere with locomotor activity. Muscular dystrophies are characterized by a progressive deterioration of muscle function (e.g., weakness), loss of muscle proteins, and death of muscle cells and tissues.

[0080] Some types of muscular dystrophies are characterized as dystrophinopathy, which includes a range of muscle diseases in which insufficient dystrophin protein is produced in muscle cells, resulting in instability of the structure of muscle cell membranes.Non-limiting examples of dystrophinopathy include Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (also known as benign pseudohypertrophic muscular dystrophy, BMD).DMD and BMD are X-linked recessive genetic diseases caused by mutations in the dystrophin gene (DMD), which codes for the protein dystrophin.DMD is typically a more severe form than BMD, because in DMD, no dystrophin protein is produced in affected muscle cells, whereas in BMD, defective dystrophin is produced.Other examples of muscular dystrophies include, but are not limited to, congenital muscular dystrophy, facioscapulohumeral muscular dystrophy, limb-girdle muscular dystrophy, myotonic muscular dystrophy, and oculopharyngeal muscular dystrophy.

[0081] As used herein, the term "mutation" refers to any change in the sequence of a gene such that the sequence is not identical to that of a wild-type gene. The mutation may be selected from the group including a single base point mutation resulting in a premature stop codon, a single base insertion, a single base deletion, an insertion of two or more consecutive nucleotides, a deletion of two or more consecutive nucleotides, a duplication of a consecutive region within a gene (e.g., an exon, such as DMD exon 2), or a deletion of a consecutive region within a gene. A mutant gene may contain a single mutation or multiple mutations. Mutations may occur in any region of a gene.

[0082] As used herein, the terms "nucleic acid molecule," "nucleic acid," and "polynucleotide" are used interchangeably and refer to a polymer of nucleotides of any length. Examples of polynucleotides are DNA polynucleotides and RNA polynucleotides. All nucleic acid sequences herein are written in the 5' to 3' direction and will be interpreted accordingly.

[0083] As used herein, the term "operably linked" with respect to a nucleic acid refers to a nucleic acid placed in a structural or functional relationship with another nucleic acid. For example, one segment of DNA can be operably linked to another segment of DNA if the two segments are located relative to each other on the same contiguous DNA molecule and have a structural or functional relationship, such as a promoter or enhancer located relative to the coding region to promote transcription of the coding region. In other examples, operably linked nucleic acids are not contiguous, but are located in such a way that they have a functional relationship to each other, either as nucleic acids or as proteins expressed by them. For example, enhancers need not be contiguous. Linking can be accomplished by ligation at convenient restriction sites or by using synthetic oligonucleotide adaptors or linkers. In some embodiments, the transgenes described herein are operably linked to a muscle creatine kinase (MCK) enhancer. In some embodiments, the transgenes described herein are operably linked to a U7 promoter.

[0084] "Percent sequence complementarity" with respect to a reference polynucleotide sequence is defined as the percentage of nucleic acids in a candidate sequence that are complementary to the nucleic acids in the reference polynucleotide sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence complementarity. A given nucleotide is considered to be "complementary" to a reference nucleotide as described herein if the two nucleotides form a standard Watson-Crick base pair. For the avoidance of doubt, Watson-Crick base pairs in the context of this disclosure include adenine-thymine, adenine-uracil, and cytosine-guanine base pairs. A proper Watson-Crick base pair is referred to in this context as a "match," and each unpaired nucleotide and each incorrectly paired nucleotide is referred to as a "mismatch." Alignment for purposes of determining percent nucleic acid sequence complementarity can be accomplished in a variety of ways that are within the capabilities of one of skill in the art, such as using publicly available computer software, such as BLAST, BLAST-2, or Megalign software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms necessary to achieve maximum complementarity over the entire length of the sequences being compared. By way of illustration, the percent sequence complementarity of a given nucleic acid sequence A to a given nucleic acid sequence B (which can alternatively be expressed as given nucleic acid sequence A having a particular percent complementarity to a given nucleic acid sequence B) is calculated as follows: 100×(fraction X / Y) where X is the number of complementary base pairs in the alignment of A and B in that program alignment (e.g., as performed by computer software such as BLAST), and Y is the total number of nucleic acids in B. It will be appreciated that if the length of nucleic acid sequence A is not equal to the length of nucleic acid sequence B, then the percent sequence complementarity of A to B will not be equal to the percent sequence complementarity of B to A. As used herein, a query nucleic acid sequence is considered to be "fully complementary" to a reference nucleic acid sequence if the query nucleic acid sequence has 100% sequence complementarity to the reference nucleic acid sequence.

[0085] As used herein, the term "sufficiently complementary to hybridize" refers to a nucleic acid sequence or a portion thereof that does not necessarily have to be fully complementary (e.g., 100% complementary) to a target region, or a nucleic acid sequence or a portion thereof that has one or more nucleotide mismatches to a target region, but still has the ability to hybridize to the target region under certain conditions. For example, a nucleic acid can be, for example, 95% complementary, 90% complementary, 85% complementary, 80% complementary, 75% complementary, 70% complementary, 65% complementary, 60% complementary, 55% complementary, 50% complementary, or less, but still forms sufficient base pairs with the target to hybridize over its length.

[0086] As used herein, the term "hybridize" refers to the formation of a stable duplex of nucleic acid by annealing mediated by interstrand hydrogen bonds, e.g., according to Watson-Crick base pairing. Double-stranded nucleic acids can be, for example, at least 50% (e.g., about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100%) complementary to each other. A "stable duplex" formed by hybridization of one nucleic acid to another is a double-stranded structure that is not denatured by stringent washing. Exemplary stringent washing conditions are known in the art and include temperatures about 5°C below the melting temperatures of the individual strands of the duplex and low concentrations of monovalent salt, such as monovalent salt concentrations (e.g., NaCl concentrations) of less than 0.2M (e.g., 0.2M, 0.19M, 0.18M, ​​0.17M, 0.16M, 0.15M, 0.14M, 0.13M, 0.12M, 0.11M, 0.1M, 0.09M, 0.08M, 0.07M, 0.06M, 0.05M, 0.04M, 0.03M, 0.02M, 0.01M, or less).The complementarity of a double-stranded nucleic acid may be low overall (e.g., less than 95%, less than 90%, less than 85%, less than 80%, less than 70%, less than 60%, less than 50%, etc.), but there may be segments of nucleic acid that are contiguous and fully complementary to equal length segments of the target, which in double-stranded form allow hybridization over the length of the target (e.g., although the overall complementarity may be low, there may be segments of at least 10 contiguous nucleotides, at least 11 contiguous nucleotides, at least 12 contiguous nucleotides, at least 13 contiguous nucleotides, at least 14 contiguous nucleotides, at least 15 contiguous nucleotides, at least 20 contiguous nucleotides, at least 25 contiguous nucleotides, at least 30 contiguous nucleotides that are fully complementary to equal length segments of the target and thus facilitate hybridization over the length of the target).

[0087] "Percent sequence identity" with respect to a reference polynucleotide or polypeptide sequence is defined as the percentage of nucleic acids or amino acids in a candidate sequence that are identical to those in the reference polynucleotide or polypeptide sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent nucleic acid or amino acid sequence identity can be accomplished in a variety of ways that are within the capabilities of those skilled in the art, such as using publicly available computer software, such as BLAST, BLAST-2, or Megalign software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms necessary to achieve maximum alignment over the entire length of the sequences being compared. For example, percent sequence identity values ​​may be generated using the sequence comparison computer program BLAST. By way of illustration, the percent sequence homology of a given nucleic acid or amino acid sequence A to, with, or relative to a given nucleic acid or amino acid sequence B (which can alternatively be expressed as a given nucleic acid or amino acid sequence A having a particular percent sequence homology to, with, or relative to a given nucleic acid or amino acid sequence B) is calculated as follows: 100×(fraction X / Y) where X is the number of nucleotides or amino acids scored as identical matches by a sequence alignment program (such as, for example, BLAST) in that program's alignment of A and B, and Y is the total number of nucleic acids in B. It will be appreciated that if the length of nucleic acid or amino acid sequence A is not equal to the length of nucleic acid or amino acid sequence B, then the percent sequence homology of A to B will not be equal to the percent sequence homology of B to A.

[0088] As used herein, the term "pharmaceutical composition" refers to a composition containing a nucleic acid described herein, formulated with a pharma- ceutical acceptable excipient, and manufactured or sold with the approval of a government regulatory agency as part of a therapeutic regimen for the treatment of a disease in a subject.

[0089] As used herein, the term "pharmacologically acceptable" refers to compounds, materials, compositions, and / or dosage forms that are suitable for contact with the tissues of a subject, such as a mammal (e.g., a human), without excessive toxicity, irritation, allergic response, and other problematic complications, commensurate with a reasonable benefit / risk ratio.

[0090] As used herein, the term "plasmid" refers to an extrachromosomal circular double-stranded DNA molecule to which additional DNA segments can be ligated. A plasmid is a type of vector, a nucleic acid molecule that has the ability to transport another nucleic acid to which it is ligated. Certain plasmids have the ability to replicate autonomously in a host cell into which they are introduced (e.g., bacterial plasmids with bacterial replication and episomal mammalian plasmids, etc.). Other vectors (e.g., non-episomal mammalian vectors, etc.) can be integrated into the genome of the host cell upon introduction into the host cell, and are thereby replicated along with the host genome. Certain plasmids have the ability to direct the expression of genes to which they are operatively linked.

[0091] As used herein, the term "promoter" refers to a region within a gene's regulatory region that allows the initiation of transcription of the gene into messenger RNA, where transcription is initiated by the binding of RNA polymerase on or near the promoter. In some embodiments, the promoter is a U7 promoter.

[0092] The term "reading frame" refers to how the ribosome defines the codons within a gene, as determined by the binding of tRNA to a three-nucleotide codon during translation of mRNA. When the reading frame is "restored," this indicates that the reading frame was first altered by a frameshift or nonsense mutation and then returned to the original reading frame by some means.

[0093] "Reference" refers to any useful reference used to compare protein or nucleic acid (e.g., mRNA) levels associated with muscular dystrophy (e.g., DMD, etc.). A reference can be any sample, standard, standard curve, or level used for comparison purposes. A reference can be a normal reference sample or reference standard or level. A "reference sample" can be, for example, a control, e.g., a predefined negative control value such as a "normal control", or a prior sample taken from the same subject; a sample from a normal healthy subject, such as a normal cell or normal tissue; a sample (e.g., cell or tissue, etc.) from a subject who does not have muscular dystrophy (e.g., DMD, etc.); a sample from a subject diagnosed with muscular dystrophy (e.g., DMD, etc.); a sample from a subject who has been treated for muscular dystrophy (e.g., DMD, etc.); or a sample of a purified protein (e.g., dystrophin) of known normal concentration; "Reference standard or level" refers to a value or number obtained from a reference sample. A "normal control value" is a predetermined value indicative of a non-disease state, e.g., a value expected in a healthy control subject. Typically, normal control values ​​are expressed as a range ("between X and Y"), a high threshold ("not higher than X"), or a low threshold ("not lower than X"). Subjects with measurements within the normal control value for a particular biomarker are typically referred to as "within the normal range" for that biomarker. A normal reference standard or level can be a value or number obtained from a normal subject without muscular dystrophy (such as DMD). In a preferred embodiment, the reference sample, standard, or level is matched to the subject sample by at least one of the following criteria: age, weight, sex, disease stage, and general health. A standard curve of levels of, for example, any of the purified proteins described herein within the normal reference range can also be used as a reference.

[0094] As used herein, the terms "subject" and "patient" are used interchangeably and refer to an organism receiving treatment for a particular disease or condition described herein. In a preferred embodiment, the subject is a human.

[0095] As used herein, the terms "transduction" and "transducing" refer to the method of introducing a viral vector construct, or a portion thereof, into a cell and subsequently expressing a transgene or RNA molecule encoded by the vector construct, or a portion thereof, within the cell.

[0096] As used herein, the term "transcriptional regulatory element" refers to a nucleic acid that at least partially controls the transcription of a gene of interest. Transcriptional regulatory elements may include promoters, enhancers, and other nucleic acids (e.g., polyadenylation signals, etc.) that control or contribute to the control of gene transcription. Examples of transcriptional regulatory elements are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology 185 (Academic Press, San Diego, CA, 1990). In some embodiments, the transcriptional regulatory element of the compositions herein is an MCK enhancer. In some embodiments, the transcriptional regulatory element of the compositions herein is a U7 promoter.

[0097] As used herein, the term "transfection" refers to any of a wide variety of techniques commonly used for the introduction of exogenous DNA into prokaryotic or eukaryotic host cells, including, for example, electroporation, lipofection, calcium-phosphate precipitation, diethylaminoethyl (DEAE)-dextran transfection, NUCLEOFECTION™, squeeze-poration, sonoporation, phototransfection, MAGNETOFECTION™, and impalefection.

[0098] As used herein, the terms "treat", "treated" and "treating" refer to both therapeutic treatment and prophylactic or preventative measures, the purpose of which is to prevent or delay (alleviate) an undesirable physiological condition, disorder or disease, or to obtain a beneficial or desired clinical outcome. Beneficial or desired clinical outcomes include, but are not limited to, alleviation of symptoms; reduction in the extent of the condition, disorder or disease; a stable (i.e., non-worsening) state of the condition, disorder or disease; a delay in the onset or slowing of the progression of the condition, disorder or disease; remission or amelioration (whether partial or complete) of the state of the condition, disorder or disease, whether detectable or undetectable; amelioration of at least one measurable physical parameter, not necessarily discernible by the patient; or an improvement or amelioration of the condition, disorder or disease. Treatment includes eliciting a clinically meaningful response without excessive levels of side effects. Treatment also includes extending lifespan compared to the lifespan expected in the absence of treatment.

[0099] As used herein, the term "U7snRNA" refers to a polymerase II transcript involved in the 3'-end processing of non-polyadenylated histone mRNAs, which is required for S-phase specific gene expression. As used herein, U7snRNA may be used as a carrier to target messenger RNA precursors of target genes (such as DMD) or parts thereof (such as ESEs, splice acceptors (SAs), splice donors (SDs), exons (such as exon 2), or parts thereof): BoxB RNA elements or variants thereof (e.g., used to enhance expression of antisense polynucleotides), antisense polynucleotides or modified variants thereof (e.g., used to interfere with the function or expression of target sequences), U7 stem loops (e.g., used for nucleocytoplasmic transport), and / or Sm binding protein sequence recognition sequences (e.g., used to bind Sm proteins for efficient assembly of U7snRNA with target pre-mRNA).

[0100] As used herein, the term "vector" includes nucleic acid vectors, e.g., DNA vectors such as plasmids, RNA vectors, viruses, or other suitable replicons (e.g., viral vectors). A variety of vectors have been developed to deliver polynucleotides encoding exogenous proteins to prokaryotic or eukaryotic cells. Examples of such expression vectors are disclosed, for example, in WO1994 / 011026, which is incorporated herein by reference as it relates to vectors suitable for expressing genes of interest. Expression vectors suitable for use in the compositions and methods described herein contain polynucleotide sequences and additional sequence elements that are used, for example, for the expression of proteins and / or the integration of these polynucleotide sequences into the genome of mammalian cells. Particular vectors that can be used for the expression of transgenes described herein include plasmids that contain regulatory sequences such as promoter and enhancer regions that direct gene transcription. Other useful vectors for the expression of transgenes contain polynucleotide sequences that increase the rate of translation of these genes or improve the stability or nuclear export of mRNA resulting from gene transcription. These sequence elements include, for example, 5' and 3' untranslated regions, IRES, and polyadenylation signal sites to direct efficient transcription of genes carried on the expression vector. Expression vectors suitable for use in the compositions and methods described herein may also contain a polynucleotide encoding a marker for the selection of cells containing such a vector. Examples of suitable markers are genes encoding resistance to antibiotics such as ampicillin, chloramphenicol, kanamycin, nourseothricin, or zeocin.

[0101] As used herein, the terms "5' mutation of the DMD gene" and "Δ5'" refer to a mutation within or affecting exons 1, 2, 3, or 4 of the DMD gene. In some embodiments, the "5' mutation of the DMD gene" is a duplication in exon 2 of the endogenous DMD gene. In some embodiments, the "5' mutation of the DMD gene" is a frameshift mutation in any one of exons 1-4 of the endogenous DMD gene.

[0102] Detailed Description The compositions and methods described herein are useful for mediating targeted exon skipping and treating disorders associated with mutations in the dystrophin gene (DMD), such as muscular dystrophies (e.g., Duchenne muscular dystrophy (DMD)). The compositions described herein include a transgene that includes a BoxB RNA element and an antisense polynucleotide (e.g., a small antisense RNA) that masks the binding of specific exonic splicing enhancer (ESE) regions and / or splice sites during the splicing reaction. This masking provides important physiological benefits, including preventing the splicing and translation of operably linked mutated transcripts, mutated upstream transcripts, or mutated downstream transcripts. Without being limited by mechanism, the compositions described herein can ameliorate this condition by reducing the expression of RNA transcripts that have mutations (e.g., 5' mutations of the DMD gene). For example, the compositions and methods described herein may be used to treat disorders such as DMD that are associated with frameshift mutations or exon duplications in the endogenous DMD gene. Additionally, the targeted exon skipping described herein can be enhanced by the inclusion of BoxB RNA elements due to their ability to enhance expression of antisense polynucleotides.

[0103] The antisense polynucleotides described herein may be in any of a variety of forms, such as antisense RNA (asRNA), small interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), or antisense oligonucleotide (ASO). The antisense polynucleotides described herein may additionally be incorporated into a U7 small nuclear ribonucleic acid (snRNA) cassette and / or encoded by a vector, such as a viral vector. For example, described herein is an adeno-associated virus (AAV) vector, such as a pseudotyped AAV vector (e.g., AAV2 / 8 vector), that contains a transgene encoding an antisense polynucleotide construct that masks the binding of an ESE or one or more splice sites (e.g., SA, SD, or a combination thereof) during a splicing reaction.

[0104] To alter expression of DMD exon 2, the use of U7 snRNA for delivery of antisense polynucleotides targeted to DMD exon 2, including interfering RNA designed to anneal to splicing motifs at the ESE and / or intron:exon boundaries (e.g., splice acceptor (SA) or splice donor (SD) sites), has been tested. Previous attempts to induce DMD exon 2 skipping by targeting the center of the exon with asRNA have not met with sufficient success, if any, and the present invention is based, at least in part, on the discovery that the combination of a BoxB RNA element with an antisense polynucleotide (e.g., a small antisense RNA that induces RNA interference via targeting the region of DMD exon 2 from +17 to +46, including the ESE), results in a surprisingly good ability to induce exon 2 skipping.

[0105] Among other benefits, the compositions and methods described herein offer the advantageous feature of being able to mediate efficient skipping of DMD exon 2. This property is particularly beneficial in light of the prevalence of 5' mutations of the DMD gene in mammalian genomes, such as those of human patients with DMD. The compositions and methods described herein can be used to reduce expression of RNA transcripts containing mutations, while preserving expression of important healthy RNA transcripts and their encoded protein products.

[0106] The following sections provide a description of exemplary BoxB RNA elements, antisense polynucleotides (e.g., interfering RNA), and U7snRNA constructs that can be used in combination with the compositions and methods described herein, as well as vectors encoding such constructs and methods that can be used to treat disorders associated with muscular dystrophy, such as DMD.

[0107] How to Treat Muscular Dystrophy Muscular dystrophies are a group of genetic disorders characterized by progressive muscle weakness. Deletions and point mutations in the DMD gene cause either severe progressive myopathy DMD or mild Becker muscular dystrophy (BMD), depending on whether translation reading frame is lost or maintained. Specifically, phenotype generally depends on whether mutation causes complete lack of protein product dystrophin (such as DMD) or maintains the reading frame that allows translation of partially functional dystrophin protein (such as in BMD) (see, for example, Monaco et al. Trends Biochem Sci, 14: 412-415 (1989)).

[0108] Many clinical cases of DMD are associated with deletion mutations in the DMD gene. For example, DMD patients may have mutations within or affecting exons 1, 2, 3, or 4 of the DMD gene (e.g., 5' mutations of the DMD gene, etc.). In this clinical population, targeted skipping of exon 2 and putative activation of an inducible IRES in exon 5 of the DMD gene may be useful, as such activation generates functional N-terminal truncated dystrophin isoforms. In some embodiments, the present disclosure provides compositions and methods for treating DMD patients with one or more 5' mutations of the DMD gene (e.g., frameshift mutations in any one of exons 1-4 of the endogenous DMD gene).

[0109] In contrast to deletion mutations, duplications of the DMD exon account for approximately 5% of disease-causing mutations as assessed in unbiased samples of dystrophinopathy patients (see, e.g., Dent et al., Am. J. Med. Genet, 734(3): 295-298 (2005)). In this clinical population, targeted skipping of exon 2 offers therapeutic value, as one or both copies can be skipped. In some embodiments, the present disclosure provides compositions and methods for treating DMD patients with a duplication of exon 2 of the DMD gene.

[0110] As described herein, DMD exon 2 is represented by SEQ ID NO:1, as shown below: ATGAAAGAGAAGATGTTCAAAAGAAAACATTCACAAAATGGGTAAATGCACAATTTTCTAAG It refers to a nucleic acid sequence having the nucleic acid sequence of

[0111] By using the compositions and methods described herein, a patient experiencing a muscular dystrophy such as DMD can be administered a transgene or a vector encoding the same, comprising a BoxB RNA element and an antisense polynucleotide, to mask the binding of an ESE or splice site (e.g., SA, SD, or a combination thereof) during the splicing reaction. Without being limited by mechanism, this masking can provide a beneficial effect of mediating altered splicing of the DMD mRNA transcript, thereby skipping an exon that may itself have a mutation (e.g., exon duplication), or by skipping, can restore the translational reading frame so that a partially functional protein is generated. In some embodiments, the skipping of the exon can result in the activation of an inducible IRES in exon 5 of the DMD gene, thereby generating a functional N-terminal truncated dystrophin isoform.

[0112] In some embodiments, the disclosure provides a method of treating a disorder (e.g., DMD) in a human patient diagnosed with a frameshift mutation (e.g., a frameshift mutation in any one of exons 1-4 of an endogenous DMD gene, e.g., a frameshift mutation in exon 2 of an endogenous DMD gene).

[0113] In some embodiments, the disclosure provides a method of treating a disorder (e.g., DMD) mediated by a frameshift mutation (e.g., a frameshift mutation in any one of exons 1-4 of an endogenous DMD gene, e.g., a frameshift mutation in exon 2 of an endogenous DMD gene) in a human patient.

[0114] In some embodiments, the disclosure provides methods of treating a disorder in a human patient diagnosed as overexpressing a protein of interest, such as dystrophin.

[0115] In some embodiments, the disclosure provides methods of treating a disorder mediated by overexpression of a protein of interest (such as dystrophin) in a human patient.

[0116] In some embodiments, administration of the compositions described herein provides a method of treating DMD in a human patient diagnosed with a duplication in exon 2 of the endogenous DMD gene.

[0117] In some embodiments, administration of the compositions described herein provides a method of increasing expression of a functional dystrophin protein in a human patient diagnosed with DMD and having a duplication in exon 2 of the endogenous DMD gene.

[0118] In some embodiments, administration of the compositions described herein provides a method of inducing exon 2 skipping in a human patient diagnosed with DMD and having a duplication in exon 2 of the endogenous DMD gene.

[0119] In some embodiments, administration of the compositions described herein provides a method of treating DMD in a human patient diagnosed with a frameshift mutation in any one of exons 1-4 of the endogenous DMD gene.

[0120] In some embodiments, the patient is a pediatric patient.

[0121] In some embodiments, the patient is from about 6 months to about 14 years of age (e.g., from about 6 months to about 13 years, from about 6 months to about 12 years, from about 6 months to about 11 years, from about 6 months to about 10 years, from about 6 months to about 9 years, from about 6 months to about 8 years, from about 6 months to about 7 years, from about 6 months to about 6 years, from about 6 months to about 5 years, from about 6 months to about 4 years, from about 6 months to about 3 years, from about 6 months to about 2 years, or from about 6 months to about 1 year).

[0122] In some embodiments, the patient is pre-ambulatory or ambulatory.

[0123] BoxB RNA elements The transgenes described herein may include a BoxB RNA element or a variant thereof. The wild-type BoxB RNA element includes 15 nucleotides and folds into a hairpin structure that includes a pentaloop. As described herein, any suitable stem-loop and / or pentaloop can be used. Without being bound by mechanism, the advantage of including a BoxB RNA element in the transgenes or RNA molecules described herein is that the BoxB RNA element can also increase the expression of antisense polynucleotides encoded by the transgenes or RNA molecules.

[0124] In some embodiments, the BoxB RNA element has a nucleic acid sequence that is at least 85% (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the BoxB RNA element has a nucleic acid sequence that is 86% identical to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the BoxB RNA element has a nucleic acid sequence that is 87% identical to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the BoxB RNA element has a nucleic acid sequence that is 88% identical to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the BoxB RNA element has a nucleic acid sequence that is 89% identical to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the BoxB RNA element has a nucleic acid sequence that is 90% identical to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the BoxB RNA element has a nucleic acid sequence that is 91% identical to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the BoxB RNA element has a nucleic acid sequence that is 92% identical to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the BoxB RNA element has a nucleic acid sequence that is 93% identical to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the BoxB RNA element has a nucleic acid sequence that is 94% identical to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the BoxB RNA element has a nucleic acid sequence that is 95% identical to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the BoxB RNA element has a nucleic acid sequence that is 96% identical to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the BoxB RNA element has a nucleic acid sequence that is 97% identical to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the BoxB RNA element has a nucleic acid sequence that is 98% identical to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the BoxB RNA element has a nucleic acid sequence that is 99% identical to the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the BoxB RNA element has a nucleic acid sequence that is identical to the nucleic acid sequence of SEQ ID NO:3.

[0125] In some embodiments, the BoxB RNA element is located 5' to the antisense polynucleotide, or the BoxB RNA element is located 3' to the antisense polynucleotide. For example, in some embodiments, the BoxB RNA element is located 5' to the antisense polynucleotide. In some embodiments, the BoxB RNA element is located 3' to the antisense polynucleotide.

[0126] Induction of alternative RNA splicing The present invention provides compositions and methods for inducing alternative splicing in a gene, e.g., by exon skipping, by using interfering RNA (e.g., asRNA) to mask the binding of an ESE region and / or mask the availability of a splice site (e.g., an SA or SD site) during the splicing reaction.

[0127] The present invention uses targeted alternative splicing (e.g., by exon skipping) during the splicing of pre-mRNA to form mRNA.If the desired splice pattern omits one or more exons that are endogenous to a given host gene, when the host gene mRNA is translated by ribosome, the resulting protein can be truncated such that the truncated protein lacks one or more exteins of the wild-type protein (e.g., functional N-terminal truncated dystrophin isoform, etc.).

[0128] In some embodiments, the present invention provides compositions for inducing alternative splicing of a protein-encoding mRNA by providing a cell with an antisense polynucleotide (e.g., asRNA) that is complementary to a portion of an endogenous RNA transcript comprising residues +17 to +46 of human dystrophin exon 2, including the ESE region, relative to the nucleic acid sequence of SEQ ID NO:1.

[0129] Therapeutic applications of alternative splicing (i) Alternative splicing for frame restoration The ability to induce targeted alternative splicing resulting in the production of alternatively truncated proteins has well-documented therapeutic value. In some embodiments, alternative splicing is induced in the form of exon skipping. In some embodiments, alternative splicing (e.g., exon skipping) can be used to restore full or partial function to a protein, where the gene encoding the protein has a mutation (e.g., a 5' mutation in the DMD gene) relative to the wild-type gene.

[0130] In some embodiments, the host may have a deleterious genetic mutation in an exon (e.g., exon 1, 2, 3, or 4 of the DMD gene), and targeted skipping of an exon (e.g., DMD exon 2) may allow full or partial restoration of protein function. In some embodiments, the mutation is a point mutation, insertion, or deletion resulting in either a premature stop codon or a frameshift. In these embodiments, induced alternative splicing results in the exclusion of DMD exon 2 from the mature RNA, causing a frameshift in the DMD gene reading frame and inducing the utilization of the IRES in exon 5 for translation initiation, thereby generating a functional N-terminally truncated dystrophin isoform.

[0131] In another example, the host may have a deleterious genetic mutation in which a region containing one or more exons or a portion of one or more exons is duplicated (e.g., DMD exon 2 duplication), resulting in a frameshift. Targeted alternative splicing of one or more additional exons may allow full or partial restoration of protein function, such that removal of the duplicated exon (e.g., DMD exon 2) from the mRNA restores the downstream reading frame. In some embodiments, the mutation is a duplication of a region of the gene that includes an entire exon (e.g., DMD exon 2), resulting in a frameshift. In other related embodiments, the mutation is a duplication of a region of the gene that includes a portion of an exon, resulting in a frameshift. In these embodiments, induced alternative splicing of one or more exons, such that alternative splicing restores the downstream reading frame, may restore partial or complete function of the protein.

[0132] In some embodiments, alternative splicing (e.g., by exon skipping) can be used in the treatment of DMD.As discussed above, DMD results from frameshift or nonsense mutation in the DMD gene that encodes dystrophin protein.The alternative splicing induced by the compositions and methods described herein can restore the downstream reading frame in mutated DMD gene, and thus restore partial function of protein.

[0133] (ii) Alternative splicing to disrupt reading frames In some embodiments, for example, when a protein is overexpressed, when a protein has a dominant negative mutation, or when chromosomal abnormality results in a disease-related fusion protein, it may be therapeutically useful to produce a C-terminal truncated protein.In such cases, alternative splicing can be used to break the reading frame in order to include a premature stop codon in the mRNA transcript and produce an N-terminal truncated protein.

[0134] In some embodiments, alternative splicing can be used to break downstream reading frame and cause premature stop codon to activate downstream IRES.The alternative splicing to break reading frame requires skipping one or more exons, and the total number of nucleotides in the one or more exons that are skipped is not a multiple of 3.In addition, the design of alternative splicing construct should consider downstream sequence, so that alternative splicing will cause premature stop codon at desired position.

[0135] In some embodiments, alternative splicing (e.g., by exon skipping to break reading frame and include premature stop codon) can be used in the treatment of DMD.As discussed above, DMD arises from frameshift or nonsense mutation in the DMD gene that encodes dystrophin protein.The alternative splicing induced by the compositions and methods described herein can break the downstream reading frame in mutated DMD gene, thus activating downstream IRES and restoring partial function of protein.

[0136] Interfering RNA The RNA molecules described herein may be any small antisense RNA molecule (e.g., an interfering RNA molecule that acts to mask the binding or utilization of an ESE and / or one or more splice sites (e.g., SA, SD, or a combination thereof) or a combination thereof during a splicing reaction). For example, an interfering RNA molecule includes an asRNA, siRNA, shRNA, miRNA, or ASO that targets a DMD exon 2 ESE. An asRNA is a single-stranded cis-natural antisense transcript that has a complementary transcript to another endogenous RNA transcript and has the ability to anneal to a target RNA transcript (e.g., thereby forming a nucleic acid duplex specifically against a contiguous sequence on the target nucleic acid and masking the splicing reaction by this annealing).

[0137] siRNAs are double-stranded RNA molecules typically having a length of about 19-25 base pairs. shRNAs are RNA molecules with hairpin turns that reduce the function and / or expression of a target gene via RNA interference (RNAi). shRNAs can be delivered to cells in the form of plasmids (e.g., viral or bacterial vectors) by transfection, electroporation, or transduction. MicroRNAs are non-translated RNA molecules typically having a length of about 22 nucleotides. miRNAs bind to target sites on mRNA molecules and silence mRNAs, for example, by causing cleavage of the mRNA, destabilization of the mRNA, or inhibition of translation of the mRNA. ASOs are single-stranded oligonucleotide sequences that have one or more modified nucleosides or nucleotides and have the ability to anneal to a target RNA transcript (e.g., thereby forming a nucleic acid duplex specifically against a sequence in close proximity on the target nucleic acid, masking the splicing reaction by this annealing).

[0138] In some embodiments, the antisense polynucleotide molecule reduces the function and / or activity of DMD exon 2 ESE. In some embodiments, the antisense polynucleotide molecule reduces the function and / or activity of DMD exon 2 SA. In some embodiments, the antisense polynucleotide molecule reduces the function and / or activity of DMD exon 2 SD.

[0139] Antisense polynucleotides (e.g., interfering RNA molecules such as siRNA, shRNA, miRNA, or ASO) can be modified to contain, for example, modified nucleotides such as 2'-fluoro, 2'-o-methyl, 2'-deoxy, unlocked nucleic acid, 2'-hydroxy, phosphorothioate, 2'-thiouridine, 4'-thiouridine, or 2'-deoxyuridine. Without being bound by theory, it is believed that certain modifications may increase nuclease resistance and / or serum stability or reduce immunogenicity.

[0140] Antisense polynucleotide molecules can be chemically synthesized or transcribed in vitro. The creation and use of inhibitory therapeutics based on non-translated RNA, such as ribozymes, RNAase P, siRNA, and miRNA, are also known in the art, for example, as described in Sioud, RNA Therapeutics: Function, Design, and Delivery (Methods in Molecular Biology). Humana Press 2010.

[0141] Small RNAs of the disclosure may comprise antisense polynucleotides of 10 to 100 (e.g., 11 to 99, 12 to 98, 13 to 97, 14 to 96, 15 to 95, 20 to 90, 30 to 80, 40 to 70, or 50 to 60) nucleotides in length that have sufficient complementarity to hybridize to a region within an mRNA transcript that encodes a protein. For example, in some embodiments, the antisense polynucleotide may be 11 to 99 nucleotides in length. In some embodiments, the antisense polynucleotide may be 12 to 98 nucleotides in length. In some embodiments, the antisense polynucleotide may be 13 to 97 nucleotides in length. In some embodiments, the antisense polynucleotide may be 14 to 96 nucleotides in length. In some embodiments, the antisense polynucleotide may be 15 to 95 nucleotides in length. In some embodiments, the antisense polynucleotide may be 20 to 90 nucleotides in length. In some embodiments, the antisense polynucleotide may be 30 to 80 nucleotides in length. In some embodiments, the antisense polynucleotide may be 40 to 70 nucleotides in length. In some embodiments, the antisense polynucleotide may be 50 to 60 nucleotides in length.

[0142] In some embodiments, the antisense polynucleotide may be about 10 nucleotides in length. In some embodiments, the antisense polynucleotide may be about 11 nucleotides in length. In some embodiments, the antisense polynucleotide may be about 12 nucleotides in length. In some embodiments, the antisense polynucleotide may be about 13 nucleotides in length. In some embodiments, the antisense polynucleotide may be about 14 nucleotides in length. In some embodiments, the antisense polynucleotide may be about 15 nucleotides in length. In some embodiments, the antisense polynucleotide may be about 20 nucleotides in length. In some embodiments, the antisense polynucleotide may be about 30 nucleotides in length. In some embodiments, the antisense polynucleotide may be about 40 nucleotides in length. In some embodiments, the antisense polynucleotide may be about 50 nucleotides in length. In some embodiments, the antisense polynucleotide may be about 60 nucleotides in length. In some embodiments, the antisense polynucleotide may be about 70 nucleotides in length. In some embodiments, the antisense polynucleotide may be about 80 nucleotides in length. In some embodiments, the antisense polynucleotide may be about 90 nucleotides in length. In some embodiments, the antisense polynucleotide may be about 100 nucleotides in length.

[0143] Any suitable small RNA may be included.

[0144] In some embodiments, the antisense polynucleotide having a length of 10 to 100 (e.g., 11 to 99, 12 to 98, 13 to 97, 14 to 96, 15 to 95, 20 to 90, 30 to 80, 40 to 70, or 50 to 60) nucleotides has sufficient complementarity to hybridize to a region within an mRNA transcript encoding a protein (e.g., a human dystrophin mRNA transcript, a human fukutin mRNA transcript, a human gamma-sarcoglycan mRNA transcript, a human dysferlin mRNA transcript, a human myotonic dystrophy protein kinase mRNA transcript, a human laminin subunit alpha 2 mRNA transcript, a human usherin mRNA transcript, a human collagen alpha-1 (VII) chain mRNA transcript, or a human activin A receptor type 1 mRNA transcript).

[0145] In some embodiments, the mRNA transcript is a dystrophin mRNA transcript, a fukutin mRNA transcript, a gamma-sarcoglycan mRNA transcript, a dysferlin mRNA transcript, a myotonic dystrophy protein kinase mRNA transcript, a laminin subunit alpha 2 mRNA transcript, a usherin mRNA transcript, a collagen alpha-1 (VII) chain mRNA transcript, or an activin A receptor type 1 mRNA transcript.

[0146] In some embodiments, the mRNA transcript is a human dystrophin mRNA transcript, a human fukutin mRNA transcript, a human gamma-sarcoglycan mRNA transcript, a human dysferlin mRNA transcript, a human myotonic dystrophy protein kinase mRNA transcript, a human laminin subunit alpha 2 mRNA transcript, a human usherin mRNA transcript, a human collagen alpha-1 (VII) chain mRNA transcript, or a human activin A receptor type 1 mRNA transcript. For example, in some embodiments, the mRNA transcript is a human dystrophin mRNA transcript. In some embodiments, the mRNA transcript is a human fukutin mRNA transcript. In some embodiments, the mRNA transcript is a human gamma-sarcoglycan mRNA transcript. In some embodiments, the mRNA transcript is a human dysferlin mRNA transcript. In some embodiments, the mRNA transcript is a human myotonic dystrophy protein kinase mRNA transcript. In some embodiments, the mRNA transcript is a human laminin subunit alpha 2 mRNA transcript. In some embodiments, the mRNA transcript is a human usherin mRNA transcript. In some embodiments, the mRNA transcript is a human collagen alpha-1 (VII) chain mRNA transcript. In some embodiments, the mRNA transcript is a human activin A receptor type 1 mRNA transcript.

[0147] Any suitable mRNA transcript can be used in the compositions described herein.

[0148] Exemplary Antisense RNA In one approach, the present invention provides a single-stranded asRNA having a nucleobase sequence with at least 25 consecutive nucleobases, which are complementary to an equal length portion in the human dystrophin exon 2 target region. In some embodiments, the target region includes a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1 (e.g., the region includes an ESE). This approach is typically referred to as an antisense approach. Without wishing to be bound by theory, this approach involves hybridization of an oligonucleotide to a target nucleic acid (e.g., DMD exon 2 pre-mRNA, transcript 1, transcript 2, or a combination thereof), thereby sterically blocking the target nucleic acid from binding to the cellular post-transcriptional modification or translation machinery, thus preventing the function or translation of the target nucleic acid. Alternatively, without wishing to be bound by theory, this approach involves hybridization of an oligonucleotide to a target nucleic acid (e.g., DMD exon 2 pre-mRNA, transcript 1, transcript 2, or a combination thereof), followed by ribonuclease H (RNase H)-mediated cleavage of the target nucleic acid. In some embodiments, a single-stranded oligonucleotide can be delivered (e.g., to a patient) as a double-stranded oligonucleotide, where one oligonucleotide is hybridized to another.

[0149] In some embodiments, the antisense polynucleotide is a DMD exon 2 ESE antisense construct, such as an asRNA, and comprises a total of 25 to 40 (e.g., 25 to 40 (e.g., 25 to 40, 26 to 40, 27 to 40, 28 to 40, 29 to 40, 30 to 40, 31 to 40, 32 to 40, 33 to 40, 34 to 40, 35 to 40, 36 to 40, 37 to 40, 38 to 40, or 39 to 40) linked nucleotides and has a nucleobase sequence comprising at least 25 contiguous nucleobases. and at least 25 contiguous nucleobases are complementary to an equal length portion of a human DMD exon 2 target nucleic acid (e.g., residues +17 to +46 of human DMD exon 2 relative to the nucleic acid sequence of SEQ ID NO: 1). For example, a DMD exon 2 inhibitor may comprise a nucleic acid sequence that includes the nucleic acid sequence of SEQ ID NO: 2, or a sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO: 2 (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identical to the nucleic acid sequence of SEQ ID NO: 2).

[0150] In some embodiments, the antisense polynucleotide comprises a nucleobase sequence comprising at least 25 contiguous nucleobases complementary to a portion of residues +17 to +46 of SEQ ID NO:1 (e.g., including the human dystrophin exon 2 ESE). In some embodiments, the antisense polynucleotide comprises a nucleobase sequence comprising at least 26 contiguous nucleobases complementary to a portion of residues +17 to +46 of SEQ ID NO:1 (e.g., including the human dystrophin exon 2 ESE). In some embodiments, the antisense polynucleotide comprises a nucleobase sequence comprising at least 27 contiguous nucleobases complementary to a portion of residues +17 to +46 of SEQ ID NO:1 (e.g., including the human dystrophin exon 2 ESE). In some embodiments, the antisense polynucleotide comprises a nucleobase sequence comprising at least 28 contiguous nucleobases complementary to a portion of residues +17 to +46 of SEQ ID NO:1 (e.g., including the human dystrophin exon 2 ESE). In some embodiments, the antisense polynucleotide comprises a nucleobase sequence comprising at least 29 contiguous nucleobases complementary to a portion of residues +17 to +46 of SEQ ID NO:1 (e.g., including the human dystrophin exon 2 ESE). In some embodiments, the antisense polynucleotide comprises a nucleobase sequence comprising at least 30 contiguous nucleobases complementary to residues +17 to +46 of SEQ ID NO:1 (e.g., including the human dystrophin exon 2 ESE). In some embodiments, the antisense polynucleotide comprises a nucleobase sequence comprising at least 31 contiguous nucleobases complementary to residues +17 to +46 of SEQ ID NO:1 (e.g., including the human dystrophin exon 2 ESE). In some embodiments, the antisense polynucleotide comprises a nucleobase sequence comprising at least 32 contiguous nucleobases complementary to residues +17 to +46 of SEQ ID NO:1 (e.g., including the human dystrophin exon 2 ESE).In some embodiments, the antisense polynucleotide comprises a nucleobase sequence comprising at least 33 contiguous nucleobases complementary to residues +17 to +46 of SEQ ID NO:1 (e.g., including the human dystrophin exon 2 ESE). In some embodiments, the antisense polynucleotide comprises a nucleobase sequence comprising at least 34 contiguous nucleobases complementary to residues +17 to +46 of SEQ ID NO:1 (e.g., including the human dystrophin exon 2 ESE). In some embodiments, the antisense polynucleotide comprises a nucleobase sequence comprising at least 35 contiguous nucleobases complementary to residues +17 to +46 of SEQ ID NO:1 (e.g., including the human dystrophin exon 2 ESE). In some embodiments, the antisense polynucleotide comprises a nucleobase sequence comprising at least 36 contiguous nucleobases complementary to residues +17 to +46 of SEQ ID NO:1 (e.g., including the human dystrophin exon 2 ESE). In some embodiments, the antisense polynucleotide comprises a nucleobase sequence comprising at least 37 contiguous nucleobases complementary to residues +17 to +46 of SEQ ID NO:1 (e.g., including the human dystrophin exon 2 ESE). In some embodiments, the antisense polynucleotide comprises a nucleobase sequence comprising at least 38 contiguous nucleobases complementary to residues +17 to +46 of SEQ ID NO:1 (e.g., including the human dystrophin exon 2 ESE). In some embodiments, the antisense polynucleotide comprises a nucleobase sequence comprising at least 39 contiguous nucleobases complementary to residues +17 to +46 of SEQ ID NO:1 (e.g., including the human dystrophin exon 2 ESE). In some embodiments, the antisense polynucleotide comprises a nucleobase sequence comprising at least 40 contiguous nucleobases complementary to residues +17 to +46 of SEQ ID NO:1 (e.g., including the human dystrophin exon 2 ESE).

[0151] In some embodiments, the antisense polynucleotide comprises a nucleobase sequence that is at least 70% (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises a nucleobase sequence that is at least 71% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises a nucleobase sequence that is at least 72% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises a nucleobase sequence that is at least 73% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises a nucleobase sequence that is at least 74% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises a nucleobase sequence that is at least 75% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises a nucleobase sequence that is at least 76% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises a nucleobase sequence that is at least 77% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises a nucleobase sequence that is at least 78% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises a nucleobase sequence that is at least 79% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1.In some embodiments, the antisense polynucleotide comprises a nucleobase sequence that is at least 80% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises a nucleobase sequence that is at least 81% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises a nucleobase sequence that is at least 82% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises a nucleobase sequence that is at least 83% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises a nucleobase sequence that is at least 84% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises a nucleobase sequence that is at least 85% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises a nucleobase sequence that is at least 86% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises a nucleobase sequence that is at least 87% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises a nucleobase sequence that is at least 88% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises a nucleobase sequence that is at least 89% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises a nucleobase sequence that is at least 90% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises a nucleobase sequence that is at least 91% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1.In some embodiments, the antisense polynucleotide comprises a nucleobase sequence that is at least 92% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises a nucleobase sequence that is at least 93% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises a nucleobase sequence that is at least 94% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises a nucleobase sequence that is at least 95% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises a nucleobase sequence that is at least 96% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises a nucleobase sequence that is at least 97% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises a nucleobase sequence that is at least 98% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises a nucleobase sequence that is at least 99% complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1.

[0152] In some embodiments, the antisense polynucleotide comprises a nucleobase sequence that is fully complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the nucleobase sequence of the fully complementary antisense polynucleotide comprises at least 10 (e.g., at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or at least 30) contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises at least 11 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises at least 12 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises at least 13 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises at least 14 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1.In some embodiments, the antisense polynucleotide comprises at least 15 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises at least 16 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises at least 17 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises at least 18 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises at least 19 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises at least 20 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises at least 21 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1.In some embodiments, the antisense polynucleotide comprises at least 22 contiguous nucleotides, which are fully complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises at least 23 contiguous nucleotides, which are fully complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises at least 24 contiguous nucleotides, which are fully complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises at least 25 contiguous nucleotides, which are fully complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises at least 26 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises at least 27 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises at least 28 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1.In some embodiments, the antisense polynucleotide comprises at least 29 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the antisense polynucleotide comprises at least 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1.

[0153] In some embodiments, the antisense polynucleotide comprises 10 to 30 (e.g., 11 to 30, 12 to 30, 13 to 30, 14 to 30, 15 to 30, 16 to 30, 17 to 30, 18 to 30, 19 to 30, 20 to 30, 21 to 30, 22 to 30, 23 to 30, 24 to 30, 25 to 30, 26 to 30, 27 to 30, 28 to 30, or 29 to 30) contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. For example, the antisense polynucleotide comprises 10 contiguous nucleotides that are fully complementary. For example, the antisense polynucleotide comprises 11 contiguous nucleotides that are fully complementary. For example, the antisense polynucleotide comprises 12 contiguous nucleotides that are fully complementary. For example, the antisense polynucleotide comprises 13 contiguous nucleotides that are perfectly complementary. For example, the antisense polynucleotide comprises 14 contiguous nucleotides that are perfectly complementary. For example, the antisense polynucleotide comprises 15 contiguous nucleotides that are perfectly complementary. For example, the antisense polynucleotide comprises 16 contiguous nucleotides that are perfectly complementary. For example, the antisense polynucleotide comprises 17 contiguous nucleotides that are perfectly complementary. For example, the antisense polynucleotide comprises 18 contiguous nucleotides that are perfectly complementary. For example, the antisense polynucleotide comprises 19 contiguous nucleotides that are perfectly complementary. For example, the antisense polynucleotide comprises 20 contiguous nucleotides that are perfectly complementary. For example, the antisense polynucleotide comprises 21 contiguous nucleotides that are perfectly complementary. For example, the antisense polynucleotide comprises 22 contiguous nucleotides that are perfectly complementary. For example, the antisense polynucleotide comprises 23 contiguous nucleotides that are perfectly complementary. For example, the antisense polynucleotide comprises 24 contiguous nucleotides that are perfectly complementary. For example, the antisense polynucleotide comprises 25 contiguous nucleotides of perfect complementarity.For example, the antisense polynucleotide comprises 26 contiguous nucleotides that are perfectly complementary. For example, the antisense polynucleotide comprises 27 contiguous nucleotides that are perfectly complementary. For example, the antisense polynucleotide comprises 28 contiguous nucleotides that are perfectly complementary. For example, the antisense polynucleotide comprises 29 contiguous nucleotides that are perfectly complementary. For example, the antisense polynucleotide comprises 30 contiguous nucleotides that are perfectly complementary.

[0154] In some embodiments, the antisense polynucleotide comprises 9 or less (e.g., 8, 7, 6, 5, 4, 3, 2, or 1) nucleotide mismatches to the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. For example, the antisense polynucleotide comprises 8 nucleotide mismatches to the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. For example, the antisense polynucleotide comprises 7 nucleotide mismatches to the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. For example, the antisense polynucleotide comprises 6 nucleotide mismatches to the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. For example, the antisense polynucleotide comprises 5 nucleotide mismatches to the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. For example, the antisense polynucleotide comprises 4 nucleotide mismatches to the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. For example, the antisense polynucleotide contains a 3 nucleotide mismatch to the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. For example, the antisense polynucleotide contains a 2 nucleotide mismatch to the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. For example, the antisense polynucleotide contains a 1 nucleotide mismatch to the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1.

[0155] In some embodiments, the antisense polynucleotide has a nucleic acid sequence that is at least 85% (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical to the nucleic acid sequence of SEQ ID NO:2. As described herein, SEQ ID NO:2 refers to the nucleic acid sequence: UUUACCCAUUUUGUGAAUGUUUUCUUUUGA. In some embodiments, the antisense polynucleotide has a nucleic acid sequence that is 86% identical to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the antisense polynucleotide has a nucleic acid sequence that is 87% identical to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the antisense polynucleotide has a nucleic acid sequence that is 88% identical to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the antisense polynucleotide has a nucleic acid sequence that is 89% identical to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the antisense polynucleotide has a nucleic acid sequence that is 90% identical to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the antisense polynucleotide has a nucleic acid sequence that is 91% identical to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the antisense polynucleotide has a nucleic acid sequence that is 92% identical to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the antisense polynucleotide has a nucleic acid sequence that is 93% identical to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the antisense polynucleotide has a nucleic acid sequence that is 94% identical to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the antisense polynucleotide has a nucleic acid sequence that is 95% identical to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the antisense polynucleotide has a nucleic acid sequence that is 96% identical to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the antisense polynucleotide has a nucleic acid sequence that is 97% identical to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the antisense polynucleotide has a nucleic acid sequence that is 98% identical to the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the antisense polynucleotide has a nucleic acid sequence that is 99% identical to the nucleic acid sequence of SEQ ID NO:2.In some embodiments, the antisense polynucleotide has a nucleic acid sequence that is identical to the nucleic acid sequence of SEQ ID NO:2.

[0156] In some embodiments, the antisense polynucleotide does not have complementarity to exon 2 of the human dystrophin RNA transcript at a site located 5' to residue 17 of SEQ ID NO:1.

[0157] In some embodiments, the antisense polynucleotide does not have complementarity to exon 2 of the human dystrophin RNA transcript at a site located 3' to residue 46 of SEQ ID NO:1.

[0158] U7 small nuclear ribonucleic acid In some embodiments, the present disclosure includes U7 snRNA for delivery of antisense polynucleotides (e.g., asRNA, siRNA, shRNA, miRNA, or ASO). snRNAs are a class of small RNA molecules present in the splicing speckles and bodies of Cajal in the cell nucleus in eukaryotic cells. snRNAs are bound to a specific set of proteins, and the complexes are called small nuclear ribonucleoproteins (snRNPs). Each snRNP particle is composed of one snRNA component and several snRNP-specific proteins (e.g., Sm proteins). snRNAs, together with their binding proteins (e.g., Sm proteins), form ribonucleoprotein complexes (snRNPs), which bind to specific sequences on pre-mRNA substrates. They are transcribed by either RNA polymerase II or RNA polymerase III. snRNAs are often divided into two classes based on both common sequence features and binding protein factors such as RNA-binding LSm proteins. The first class, known as Sm class snRNAs, includes U1, U2, U4, U4atac, U5, U7, U11, and U12, which are transcribed by RNA polymerase II. The second class, known as Lsm class snRNAs, includes U6 and U6atac, which are transcribed by RNA polymerase III and, in contrast to the Sm class snRNAs, remain in the nucleus.

[0159] In some embodiments, the present disclosure uses U7snRNA molecules to deliver antisense polynucleotides that mask the binding or utilization of ESEs or one or more splice sites (e.g., SA, SD, or a combination thereof) during the splicing reaction. snRNAs are normally involved in the 3' end processing of histone mRNA precursors, but in some aspects are converted into versatile tools for splicing regulation or as asRNAs that are continuously expressed in cells (see, e.g., Goyenvalle et al., Science 306(5702): 1796-9 (2004)). By replacing the wild-type U7Sm binding site with a consensus sequence obtained from spliceosomal snRNAs, the resulting RNA associates with the seven Sm proteins present in the spliceosomal snRNAs. As a result, modified (e.g., optimized) U7Sm (U7Sm OPT) RNA accumulates more efficiently in nucleoplasm, and although it can still bind to histone pre-mRNA and act as a competitive inhibitor for wild-type U7snRNP, it no longer mediates the cleavage of histone pre-mRNA.By further replacing the sequence that binds to histone downstream element with a sequence that is complementary to a specific target in splicing substrate, it is possible to create U7snRNA that has the ability to regulate specific splicing events.The advantage of using U7 derivative is that antisense sequence is embedded in snRNP complex. Furthermore, when embedded in gene therapy vectors, these small RNAs can be persistently expressed in target cells after a single injection (see, e.g., Levy et al., Eur. J. Hum. Genet. 18(9): 969-70 (2010); Wein et al., Hum. Mutat. 31(2): 136-42, (2010); Wein et al., Nat. Med. 20(9): 992-1000 (2014);).

[0160] In some embodiments (eg, for delivery of an antisense polynucleotide), the U7 snRNA is located 3' to the antisense polynucleotide.

[0161] In some embodiments, the U7 snRNA comprises a Sm OPT motif. In some embodiments, the Sm OPT motif has a nucleic acid sequence that is at least 85% (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical to the nucleic acid sequence of SEQ ID NO:5. In some embodiments, the Sm OPT motif has a nucleic acid sequence that is 86% identical to the nucleic acid sequence of SEQ ID NO:5. In some embodiments, the Sm OPT motif has a nucleic acid sequence that is 87% identical to the nucleic acid sequence of SEQ ID NO:5. In some embodiments, the Sm OPT motif has a nucleic acid sequence that is 88% identical to the nucleic acid sequence of SEQ ID NO:5. In some embodiments, the Sm OPT motif has a nucleic acid sequence that is 89% identical to the nucleic acid sequence of SEQ ID NO:5. In some embodiments, the Sm OPT motif has a nucleic acid sequence that is 90% identical to the nucleic acid sequence of SEQ ID NO:5. In some embodiments, the Sm OPT motif has a nucleic acid sequence that is 91% identical to the nucleic acid sequence of SEQ ID NO:5. In some embodiments, the Sm OPT motif has a nucleic acid sequence that is 92% identical to the nucleic acid sequence of SEQ ID NO:5. In some embodiments, the Sm OPT motif has a nucleic acid sequence that is 93% identical to the nucleic acid sequence of SEQ ID NO:5. In some embodiments, the Sm OPT motif has a nucleic acid sequence that is 94% identical to the nucleic acid sequence of SEQ ID NO:5. In some embodiments, the Sm OPT motif has a nucleic acid sequence that is 95% identical to the nucleic acid sequence of SEQ ID NO:5. In some embodiments, the Sm OPT motif has a nucleic acid sequence that is 96% identical to the nucleic acid sequence of SEQ ID NO:5. In some embodiments, the Sm OPT motif has a nucleic acid sequence that is 97% identical to the nucleic acid sequence of SEQ ID NO:5. In some embodiments, the Sm OPT motif has a nucleic acid sequence that is 98% identical to the nucleic acid sequence of SEQ ID NO:5. In some embodiments, the Sm OPT motif has a nucleic acid sequence that is 99% identical to the nucleic acid sequence of SEQ ID NO:5. In some embodiments, the Sm OPT motif has a nucleic acid sequence that is identical to the nucleic acid sequence of SEQ ID NO:5.

[0162] In some embodiments, the U7 snRNA comprises a U7 stem loop. In some embodiments, the U7 stem loop has a nucleic acid sequence that is at least 85% (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical to the nucleic acid sequence of SEQ ID NO:6. In some embodiments, the U7 stem loop has a nucleic acid sequence that is 86% identical to the nucleic acid sequence of SEQ ID NO:6. In some embodiments, the U7 stem loop has a nucleic acid sequence that is 87% identical to the nucleic acid sequence of SEQ ID NO:6. In some embodiments, the U7 stem loop has a nucleic acid sequence that is 88% identical to the nucleic acid sequence of SEQ ID NO:6. In some embodiments, the U7 stem loop has a nucleic acid sequence that is 89% identical to the nucleic acid sequence of SEQ ID NO:6. In some embodiments, the U7 stem loop has a nucleic acid sequence that is 90% identical to the nucleic acid sequence of SEQ ID NO:6. In some embodiments, the U7 stem loop has a nucleic acid sequence that is 91% identical to the nucleic acid sequence of SEQ ID NO:6. In some embodiments, the U7 stem loop has a nucleic acid sequence that is 92% identical to the nucleic acid sequence of SEQ ID NO:6. In some embodiments, the U7 stem loop has a nucleic acid sequence that is 93% identical to the nucleic acid sequence of SEQ ID NO:6. In some embodiments, the U7 stem loop has a nucleic acid sequence that is 94% identical to the nucleic acid sequence of SEQ ID NO:6. In some embodiments, the U7 stem loop has a nucleic acid sequence that is 95% identical to the nucleic acid sequence of SEQ ID NO:6. In some embodiments, the U7 stem loop has a nucleic acid sequence that is 96% identical to the nucleic acid sequence of SEQ ID NO:6. In some embodiments, the U7 stem loop has a nucleic acid sequence that is 97% identical to the nucleic acid sequence of SEQ ID NO:6. In some embodiments, the U7 stem loop has a nucleic acid sequence that is 98% identical to the nucleic acid sequence of SEQ ID NO:6. In some embodiments, the U7 stem loop has a nucleic acid sequence that is 99% identical to the nucleic acid sequence of SEQ ID NO:6. In some embodiments, the U7 stem loop has a nucleic acid sequence identical to the nucleic acid sequence of SEQ ID NO:6.

[0163] In some embodiments, the U7 snRNA comprises a U7 downstream region. In some embodiments, the U7 downstream region has a nucleic acid sequence that is at least 85% (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the U7 downstream region has a nucleic acid sequence that is 86% identical to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the U7 downstream region has a nucleic acid sequence that is 87% identical to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the U7 downstream region has a nucleic acid sequence that is 88% identical to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the U7 downstream region has a nucleic acid sequence that is 89% identical to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the U7 downstream region has a nucleic acid sequence that is 90% identical to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the U7 downstream region has a nucleic acid sequence that is 91% identical to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the U7 downstream region has a nucleic acid sequence that is 92% identical to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the U7 downstream region has a nucleic acid sequence that is 93% identical to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the U7 downstream region has a nucleic acid sequence that is 94% identical to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the U7 downstream region has a nucleic acid sequence that is 95% identical to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the U7 downstream region has a nucleic acid sequence that is 96% identical to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the U7 downstream region has a nucleic acid sequence that is 97% identical to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the U7 downstream region has a nucleic acid sequence that is 98% identical to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the U7 downstream region has a nucleic acid sequence that is 99% identical to the nucleic acid sequence of SEQ ID NO:7. In some embodiments, the U7 downstream region has a nucleic acid sequence that is identical to the nucleic acid sequence of SEQ ID NO:7.

[0164] In some embodiments, the U7snRNA (e.g., comprising or encoding sequences of Sm OPT, U7 stem loop, and U7 downstream region) has a nucleic acid sequence that is at least 85% (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the U7snRNA has a nucleic acid sequence that is 86% identical to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the U7snRNA has a nucleic acid sequence that is 87% identical to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the U7snRNA has a nucleic acid sequence that is 88% identical to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the U7snRNA has a nucleic acid sequence that is 89% identical to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the U7snRNA has a nucleic acid sequence that is 90% identical to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the U7snRNA has a nucleic acid sequence that is 91% identical to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the U7snRNA has a nucleic acid sequence that is 92% identical to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the U7snRNA has a nucleic acid sequence that is 93% identical to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the U7snRNA has a nucleic acid sequence that is 94% identical to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the U7snRNA has a nucleic acid sequence that is 95% identical to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the U7snRNA has a nucleic acid sequence that is 96% identical to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the U7snRNA has a nucleic acid sequence that is 97% identical to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the U7snRNA has a nucleic acid sequence that is 98% identical to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the U7snRNA has a nucleic acid sequence that is 99% identical to the nucleic acid sequence of SEQ ID NO:8. In some embodiments, the U7snRNA has the nucleic acid sequence of SEQ ID NO:8 shown below: AAUUUUUGGAGCAGGUUUUCUGACUUCGGUCGGAAAACCCCUCCCAAUUUCACUGGUCUACAAUGAAAGCAAAACAGUUCUCUUCCCCGCUCCCCGGUGUGUGAGAGGGGCUUUGAUCCUUCUCUGGUUUCCUAGGAAACGCGUAUGUG has a nucleic acid sequence which is identical to

[0165] As described herein, exemplary U7snRNA elements, including BoxB RNA elements, asRNAs, asRNA tails, Sm OPT motifs, U7 stem loops, U7 downstream regions, and U7snRNAs, are exemplified by the nucleic acid sequences in Table 1 shown below.

[0166] [Table 1] In some embodiments, the U7 expression cassette described herein comprises the nucleic acid sequence of SEQ ID NO:9, as shown below: TAACAACATAGGAGCTGTGATTGGCTGTTTTCAGCCAATCAGCACTGACTCATTTGCATAGCCTTTACAAGCGGTCACAAACTCAAGAAACGAGCGGTTTTAATAGTCTTTTAGAATATTGTTTATCGAACCGAATAAGGAACTGTGCTTTGTGATTCACATATCAGTGGAGGGGTGTGGAAATGGCACCTTGATCTCACCCTCATCGAAAGTGGAGTTGATGTCCTTCCCTGGCTCGCTAC AGACGCACTTCGGCAAAGAGGGCCTGAAGAGGGCCTTTCTTATGATAGGGACTTAGGGTGTTTACCCATTTTGTGAATGTTTTCTTTTGAAATTTTTGGAGCAGGTTTTCTGACTTCGGTCGGAAAACCCCTCCCAATTTCACTGGTCTACAATGAAAGCAAAACAGTTCTCTTCCCCGCTCCCCGGTGTGTGAGAGGGGCTTTGATCCTTCTCTGGTTTCCTAGGAAACGCGTATGTG This is illustrated by:

[0167] delivery I. Viral Vectors for Expression of Therapeutic Transgenes Viral genomes provide a rich source of vectors that can be used to efficiently deliver exogenous genes into mammalian cells (such as muscle cells or neurons). Viral genomes are particularly useful vectors for gene delivery because polynucleotides contained within such genomes are typically integrated into the nuclear genome of mammalian cells by general or specific transduction. These processes occur as part of the natural viral replication cycle and do not require the addition of proteins or reagents to induce gene integration. Examples of viral vectors are retroviruses (such as those in the Retroviridae family), adenoviruses (such as Ad5, Ad26, Ad34, Ad35, and Ad48), parvoviruses (such as adeno-associated viruses), coronaviruses, orthomyxoviruses (such as influenza viruses), rhabdoviruses (such as rabies and vesicular stomatitis viruses), paramyxoviruses (such as measles and Sendai), negative-stranded RNA viruses such as picornaviruses and alphaviruses, as well as double-stranded DNA viruses including adenoviruses, herpesviruses (such as herpes simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxviruses (such as vaccinia, modified vaccinia Ankara (MVA), fowlpox, and canarypox). Other viruses include, for example, Norwalk virus, togavirus, flavivirus, reovirus, papovavirus, hepadnavirus, human papillomavirus, human foamy virus, and hepatitis virus. Examples of retroviruses are avian leukosis sarcoma virus, avian C virus, mammalian C virus, B virus, D virus, oncoretrovirus, HTLV-BLV group, lentivirus, alpharetrovirus, gammaretrovirus, spumavirus (Coffin, JM, Retroviridae: The viruses and their replication, Virology, Third Edition (Lippincott-Raven, Philadelphia, (1996)).Other examples are murine leukemia virus, murine sarcoma virus, mouse mammary tumor virus, bovine leukemia virus, feline leukemia virus, feline sarcoma virus, avian leukemia virus, human T-cell leukemia virus, baboon endogenous virus, gibbon leukemia virus, Mason-Pfizer monkey virus, simian immunodeficiency virus, simian sarcoma virus, Rous sarcoma virus, and lentivirus. Other examples of vectors are described, for example, in McVey et al., (US 5,801,030), the teachings of which are incorporated herein by reference.

[0168] IA. Retroviral Vectors The delivery vector used in the methods and compositions described herein may be a retroviral vector. One type of retroviral vector that can be used in the methods and compositions described herein is a lentiviral vector. Lentiviral vectors (LV), a subset of retroviruses, transduce a wide range of dividing and non-dividing cell types with high efficiency and provide stable, long-term expression of transgenes. A summary of optimization strategies for packaging and transducing LV is provided in Delenda, J. Gene Med. 6: S125 (2004), the disclosure of which is incorporated herein by reference.

[0169] The use of lentivirus-based gene transfer technology relies on the in vitro generation of recombinant lentiviral particles carrying a highly deleted viral genome that houses the transgene of interest. In particular, recombinant lentiviruses are recovered through in trans co-expression in permissive cell lines of (1) a packaging construct, i.e., a vector expressing (or expressing in trans) the Gag-Pol precursor together with Rev; (2) a vector expressing a heterologous envelope receptor, typically; and (3) a transfer vector into which the sequence to be expressed is inserted, which is a viral complementary DNA (cDNA) that has been stripped of all open reading frames but maintains sequences necessary for replication, encapsidation, and expression.

[0170] The LV used in the methods and compositions described herein may include one or more of a 5'-long terminal repeat (LTR), an HIV signal sequence, an HIV Psi signal 5'-splice site (SD), a delta-GAG element, a Rev response element (RRE), a 3'-splice site (SA), an elongation factor (EF) 1-alpha promoter, and a 3'-self-inactivating LTR (SIN-LTR). The lentiviral vector optionally includes a central polypurine tract (cPPT) and a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) as described in US 6,136,597, the disclosure of which is incorporated herein by reference with respect to the WPRE. The lentiviral vector may further include a pHR' backbone, which may include, for example, those provided below.

[0171] Lentigen LV, described in Lu et al., J. Gene Med. 6:963 (2004), can be used to express DNA molecules and / or transduce cells. The LV used in the methods and compositions described herein may include the 5'-long terminal repeat (LTR), HIV signal sequence, HIV Psi signal 5'-splice site (SD), delta-GAG element, Rev response element (RRE), 3'-splice site (SA), elongation factor (EF) 1-alpha promoter, and 3'-self-inactivating LTR (SIN-LTR). Optionally, one or more of these regions may be replaced with another region that performs a similar function, as will be readily apparent to one of skill in the art.

[0172] Enhancer elements can be used to increase expression of modified DNA molecules or to increase lentiviral integration efficiency. LVs used in the methods and compositions described herein may include a nef sequence. LVs used in the methods and compositions described herein may include a cPPT sequence that enhances vector integration. cPPT acts as a second origin of (+)strand DNA synthesis and introduces a partial strand overlap in the middle of the native HIV genome. Introduction of a cPPT sequence in the transfer vector backbone greatly increased nuclear transport and the total amount of genome integrated into the DNA of the target cell. LVs used in the methods and compositions described herein may include a WPRE. WPRE acts at the transcription level by promoting nuclear export of transcripts and / or by increasing the efficiency of polyadenylation of nascent transcripts, thus increasing the total amount of mRNA in the cell. Addition of WPRE to LVs results in substantial improvement of transgene expression levels from several different promoters both in vitro and in vivo. LVs used in the methods and compositions described herein may include both a cPPT sequence and a WPRE sequence. The vector may also contain an IRES sequence, which allows expression of multiple polypeptides from a single promoter.

[0173] In addition to IRES sequences, other elements that allow for the expression of multiple polypeptides are useful. The vectors used in the methods and compositions described herein may contain multiple promoters that allow for the expression of more than one polypeptide. The vectors used in the methods and compositions described herein may contain a protein cleavage site that allows for the expression of more than one polypeptide. Examples of protein cleavage sites that allow for the expression of more than one polypeptide are described in Klump et al., Gene Ther. 8:811 (2001); Osborn et al., Mol. Ther. 12:569 (2005); Szymczak and Vignali, Expert Opin Biol Ther. 5:627 (2005); and Szymczak et al., Nat Biotechnol. 22:589 (2004), the disclosures of which are incorporated herein by reference as they relate to protein cleavage sites that allow for the expression of more than one polypeptide. It will be readily apparent to one of skill in the art that other elements that allow for the expression of multiple polypeptides identified in the future will also be useful and can be utilized in vectors suitable for use in the compositions and methods described herein.

[0174] The vectors used in the methods and compositions described herein may be clinical grade vectors.

[0175] IB. Adeno-associated viral vectors The nucleic acids of the compositions and methods described herein can be incorporated into recombinant linear adeno-associated virus (rAAV) vectors, recombinant self-complementary AAV (scAAV) vectors, and / or virions to facilitate introduction into cells (e.g., muscle cells or neurons, etc.). Adeno-associated virus (AAV) vectors can be used in the central nervous system, and suitable promoters and serotypes are discussed in Pignataro et al., J Neural Transm., 125: 575 (2018), the disclosure of which is incorporated herein by reference as it relates to promoters and AAV serotypes useful in CNS gene therapy. In some embodiments, the AAV is a single-stranded rAAV. In some embodiments, the AAV is a scAAV.

[0176] The rAAV vector useful in the compositions and methods described herein is a recombinant nucleic acid construct (e.g., a nucleic acid capable of being expressed in muscle cells or neurons) that includes (1) a heterologous sequence to be expressed, and (2) a viral sequence that facilitates the integration and expression of the heterologous gene. The viral sequence may include AAV sequences required in cis for DNA replication and packaging into virions (e.g., functional inverted terminal repeats (ITRs)). Such rAAV vectors may also carry a marker or reporter gene. Useful rAAV vectors have one or more of the AAV WT genes deleted in whole or in part, but retain functional flanking ITR sequences. The AAV ITRs may be of any serotype suitable for a particular application. In some embodiments, the AAV ITRs are AAV2 ITRs. Methods for using rAAV vectors are described, for example, in Tai et al., J. Biomed. Sci. 7:279 (2000) and Monahan and Samulski, Gene Delivery 7:24 (2000), the disclosures of each of which are incorporated by reference herein as they relate to AAV vectors for gene delivery.

[0177] Enhancer elements can be used to increase the expression of modified DNA molecules. In some embodiments, enhancer elements that promote the expression of antisense polynucleotides in muscle cells or neurons are used in combination with the compositions and methods of the present disclosure. Exemplary enhancers that can be used in combination with the compositions and methods of the present disclosure are muscle creatine kinase (MCK) enhancer, desmin enhancer, myosin light chain enhancer, myosin heavy chain enhancer, cardiac troponin C enhancer, troponin I enhancer, myoD gene family enhancer, actin alpha enhancer, actin beta enhancer, actin gamma enhancer, or enhancer in intron 1 of eye paired-like homeodomain 3. In some embodiments, the enhancer is an MCK enhancer.

[0178] The nucleic acids and vectors described herein can be incorporated into rAAV virions to facilitate the introduction of the nucleic acid or vector into cells. The capsid protein of AAV constitutes the outer non-nucleic acid portion of the virion and is encoded by the AAV cap gene. The cap gene encodes three viral coat proteins, VP1, VP2, and VP3, which are required for virion assembly. Construction of rAAV virions has been described, for example, in US 5,173,414; US 5,139,941; US ​​5,863,541; US ​​5,869,305; US 6,057,152; and US 6,376,237; as well as in Rabinowitz et al., J. Virol. 76:791 (2002) and Bowles et al., J. Virol. 77:423 (2003); the disclosures of each of which are incorporated by reference herein as they relate to AAV vectors for gene delivery.

[0179] rAAV virions useful in combination with the compositions and methods described herein include those derived from a variety of AAV serotypes, including AAV1, 2, 3, 4, 5, 6, 7, 8, 9, rh10, and rh74. For targeting cells located in or delivered to the central nervous system, AAV2, AAV9, and AAV10 may be particularly useful. The construction and use of AAV vectors and AAV proteins of different serotypes are described, for example, in Chao et al., Mol. Ther. 2:619 (2000); Davidson et al., Proc. Natl. Acad. Sci. USA 97:3428 (2000); Xiao et al., J. Virol. 72:2224 (1998); Halbert et al., J. Virol. 74:1524 (2000); Halbert et al., J. Virol. 75:6615 (2001); and Auricchio et al., Hum. Molec. Genet. 10:3075 (2001); the disclosures of each of which are incorporated by reference herein as they relate to AAV vectors for gene delivery.

[0180] Also useful in combination with the compositions and methods described herein are pseudotyped rAAV vectors. Pseudotyped vectors include AAV vectors of a given serotype (e.g., AAV9, etc.) pseudotyped with a capsid gene from a serotype other than the given serotype (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, etc.). For example, a representative pseudotyped vector is an AAV8 vector encoding a therapeutic protein pseudotyped with a capsid gene from AAV serotype 2. Techniques involving the construction and use of pseudotyped rAAV virions are known in the art and are described, for example, in Duan et al., J. Virol. 75:7662-7671 (2001); Halbert et al., J. Virol. 74:1524-1532 (2000); Zolotukhin et al., Methods, 28:158-167 (2002); and Auricchio et al., Hum. Molec. Genet., 10:3075-3081 (2001); Zolotukhin et al., Methods, 28:158 (2002); and Auricchio et al., Hum. Molec. Genet. 10:3075 (2001);

[0181] AAV virions with mutations in the virion capsid may be used to infect specific cell types more effectively than non-mutated capsid virions. For example, suitable AAV mutants may have ligand insertion mutations to facilitate targeting of AAV to specific cell types. The construction and characterization of AAV capsid mutants, including insertion mutants, alanine screening mutants, and epitope tag mutants, are described in Wu et al., J. Virol. 74:8635 (2000). Other rAAV virions that can be used in the methods described herein include capsid hybrids generated by molecular breeding of viruses and by exon shuffling. See, for example, Soong et al., Nat. Genet., 25:436 (2000) and Kolman and Stemmer, Nat. Biotechnol. 19:423 (2001).

[0182] In some embodiments, the transgene (e.g., comprising or encoding a BoxB RNA element and an antisense polynucleotide) is operably linked to the U7 promoter. In some embodiments, the 5' end of the antisense polynucleotide (e.g., comprising or encoding an interfering RNA) is attached to the 3' end of the U7 promoter. In some embodiments, the U7 promoter has a nucleic acid sequence that is at least 85% (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the U7 promoter has a nucleic acid sequence that is 86% identical to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the U7 promoter has a nucleic acid sequence that is 87% identical to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the U7 promoter has a nucleic acid sequence that is 88% identical to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the U7 promoter has a nucleic acid sequence that is 89% identical to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the U7 promoter has a nucleic acid sequence that is 90% identical to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the U7 promoter has a nucleic acid sequence that is 91% identical to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the U7 promoter has a nucleic acid sequence that is 92% identical to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the U7 promoter has a nucleic acid sequence that is 93% identical to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the U7 promoter has a nucleic acid sequence that is 94% identical to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the U7 promoter has a nucleic acid sequence that is 95% identical to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the U7 promoter has a nucleic acid sequence that is 96% identical to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the U7 promoter has a nucleic acid sequence that is 97% identical to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the U7 promoter has a nucleic acid sequence that is 98% identical to the nucleic acid sequence of SEQ ID NO:4. In some embodiments, the U7 promoter has a nucleic acid sequence that is 99% identical to the nucleic acid sequence of SEQ ID NO:4.In some embodiments, the U7 promoter has a nucleic acid sequence identical to the nucleic acid sequence of SEQ ID NO:4.

[0183] In some embodiments, the MCK enhancer has a nucleic acid sequence that is at least 85% (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical to the nucleic acid sequence of SEQ ID NO:11. In some embodiments, the MCK enhancer has a nucleic acid sequence that is 86% identical to the nucleic acid sequence of SEQ ID NO:11. In some embodiments, the MCK enhancer has a nucleic acid sequence that is 87% identical to the nucleic acid sequence of SEQ ID NO:11. In some embodiments, the MCK enhancer has a nucleic acid sequence that is 88% identical to the nucleic acid sequence of SEQ ID NO:11. In some embodiments, the MCK enhancer has a nucleic acid sequence that is 89% identical to the nucleic acid sequence of SEQ ID NO:11. In some embodiments, the MCK enhancer has a nucleic acid sequence that is 90% identical to the nucleic acid sequence of SEQ ID NO:11. In some embodiments, the MCK enhancer has a nucleic acid sequence that is 91% identical to the nucleic acid sequence of SEQ ID NO:11. In some embodiments, the MCK enhancer has a nucleic acid sequence that is 92% identical to the nucleic acid sequence of SEQ ID NO:11. In some embodiments, the MCK enhancer has a nucleic acid sequence that is 93% identical to the nucleic acid sequence of SEQ ID NO:11. In some embodiments, the MCK enhancer has a nucleic acid sequence that is 94% identical to the nucleic acid sequence of SEQ ID NO:11. In some embodiments, the MCK enhancer has a nucleic acid sequence that is 95% identical to the nucleic acid sequence of SEQ ID NO:11. In some embodiments, the MCK enhancer has a nucleic acid sequence that is 96% identical to the nucleic acid sequence of SEQ ID NO:11. In some embodiments, the MCK enhancer has a nucleic acid sequence that is 97% identical to the nucleic acid sequence of SEQ ID NO:11. In some embodiments, the MCK enhancer has a nucleic acid sequence that is 98% identical to the nucleic acid sequence of SEQ ID NO:11. In some embodiments, the MCK enhancer has a nucleic acid sequence that is 99% identical to the nucleic acid sequence of SEQ ID NO:11. In some embodiments, the MCK enhancer has a nucleic acid sequence that is identical to the nucleic acid sequence of SEQ ID NO:11.

[0184] In some embodiments, the AAV encodes a transgene having a nucleic acid sequence that is at least 85% (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the AAV encodes a transgene having a nucleic acid sequence that is at least 86% identical to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the AAV encodes a transgene having a nucleic acid sequence that is at least 87% identical to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the AAV encodes a transgene having a nucleic acid sequence that is at least 88% identical to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the AAV encodes a transgene having a nucleic acid sequence that is at least 89% identical to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the AAV encodes a transgene having a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the AAV encodes a transgene having a nucleic acid sequence that is at least 91% identical to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the AAV encodes a transgene having a nucleic acid sequence that is at least 92% identical to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the AAV encodes a transgene having a nucleic acid sequence that is at least 93% identical to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the AAV encodes a transgene having a nucleic acid sequence that is at least 94% identical to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the AAV encodes a transgene having a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the AAV encodes a transgene having a nucleic acid sequence that is at least 96% identical to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the AAV encodes a transgene having a nucleic acid sequence that is at least 97% identical to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the AAV encodes a transgene having a nucleic acid sequence that is at least 98% identical to the nucleic acid sequence of SEQ ID NO:9. In some embodiments, the AAV encodes a transgene having a nucleic acid sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO:9.In some embodiments, the AAV encodes a transgene having a nucleic acid sequence identical to the nucleic acid sequence of SEQ ID NO:9.

[0185] In some embodiments, the AAV has a nucleic acid sequence that is at least 85% (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%) identical to the nucleic acid sequence of SEQ ID NO:10. In some embodiments, the AAV has a nucleic acid sequence that is 86% identical to the nucleic acid sequence of SEQ ID NO:10. In some embodiments, the AAV has a nucleic acid sequence that is 87% identical to the nucleic acid sequence of SEQ ID NO:10. In some embodiments, the AAV has a nucleic acid sequence that is 88% identical to the nucleic acid sequence of SEQ ID NO:10. In some embodiments, the AAV has a nucleic acid sequence that is 89% identical to the nucleic acid sequence of SEQ ID NO:10. In some embodiments, the AAV has a nucleic acid sequence that is 90% identical to the nucleic acid sequence of SEQ ID NO:10. In some embodiments, the AAV has a nucleic acid sequence that is 91% identical to the nucleic acid sequence of SEQ ID NO:10. In some embodiments, the AAV has a nucleic acid sequence that is 92% identical to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the AAV has a nucleic acid sequence that is 93% identical to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the AAV has a nucleic acid sequence that is 94% identical to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the AAV has a nucleic acid sequence that is 95% identical to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the AAV has a nucleic acid sequence that is 96% identical to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the AAV has a nucleic acid sequence that is 97% identical to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the AAV has a nucleic acid sequence that is 98% identical to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the AAV has a nucleic acid sequence that is 99% identical to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the AAV has a nucleic acid sequence that is identical to the nucleic acid sequence of SEQ ID NO: 10.

[0186] Exemplary AAV vector components, including the U7 promoter and MCK enhancer described herein, are exemplified by the nucleic acid sequences in Table 2, as described herein, shown below.

[0187] [Table 2] As described herein, an exemplary AAV2 / 8 vector comprises the nucleic acid sequence of SEQ ID NO:10, shown below: has.

[0188] II. Methods for delivering exogenous nucleic acids to target cells Techniques that can be used to introduce polynucleotides, such as DNA or RNA (e.g., mRNA, transfer RNA, asRNA, siRNA, shRNA, miRNA, ASO, or chemically modified RNA), including codon-optimized DNA or RNA, into mammalian cells (e.g., muscle cells or neurons, etc.) are well known in the art. For example, electroporation can be used to permeabilize mammalian cells (e.g., human target cells) by applying an electrostatic potential to the cells of interest. Mammalian cells, such as human cells, exposed to an external electric field in this manner are then susceptible to uptake of exogenous nucleic acids (e.g., nucleic acids capable of expression in muscle cells or neurons, etc.). Electroporation of mammalian cells is described in detail, for example, in Chu et al., Nucleic Acids Res 15:1311 (1987), the disclosure of which is incorporated herein by reference. A similar technique, NUCLEOFECTION™, utilizes an applied electric field to stimulate uptake of exogenous polynucleotides into the nucleus of eukaryotic cells. NUCLEOFECTION™ and protocols useful for carrying out this technique are described in detail, for example, in Distler et al., Exp. Dermatol. 14:315 (2005), as well as in US 2010 / 0317114, the disclosures of each of which are incorporated herein by reference.

[0189] Another technique useful for transfection of target cells is the squeeze poration method. This technique induces rapid mechanical deformation of cells to stimulate the uptake of foreign DNA through membrane pores that form in response to applied stress. This technique is advantageous in that it does not require a vector to deliver nucleic acid to cells, such as human target cells. Squeeze poration is described in detail, for example, in Sharei et al., JoVE 81:e50980 (2013), the disclosure of which is incorporated herein by reference.

[0190] Lipofection represents another technique useful for transfection of target cells. This method involves loading nucleic acid into liposomes, which often present cationic functional groups, such as quaternary amines or protonated amines, toward the exterior of the liposome. This promotes electrostatic interactions between the liposome and the cell due to the anionic nature of the cell membrane, ultimately resulting in the uptake of the exogenous nucleic acid, for example, by direct fusion of the liposome with the cell membrane or by endocytosis of the complex. Lipofection is described in detail, for example, in US 7,442,386, the disclosure of which is incorporated herein by reference. A similar technique that utilizes ionic interactions with the cell membrane to induce the uptake of exogenous nucleic acid is to contact the cell with a cationic polymer-nucleic acid complex. Illustrative cationic molecules that associate with polynucleotides to impart a positive charge that favors interaction with cell membranes are activated dendrimers (described, e.g., in Dennig, Top Curr Chem 228:227 (2003), the disclosure of which is incorporated herein by reference), polyethyleneimine, and DEAE-dextran, the use of which as transfection agents is described in detail, e.g., in Gulick et al., Curr Protoc Mol Biol 40:1:9.2:9.2.1 (1997), the disclosure of which is incorporated herein by reference.

[0191] Another useful tool for inducing the uptake of exogenous nucleic acids by target cells is laser transfection, also called phototransfection, which involves exposing cells to electromagnetic radiation of a specific wavelength to gently permeabilize the cells and allow polynucleotides to penetrate the cell membrane. The biological activity of this technique is similar to, and in some cases even superior to, electroporation.

[0192] Impalefection is another technique that can be used to deliver genetic material to target cells and relies on the use of nanomaterials such as carbon nanofibers, carbon nanotubes, and nanowires. Needle-like nanostructures are synthesized perpendicular to the surface of a substrate. DNA containing genes intended for intracellular delivery is attached to the nanostructure surface. A tip with an array of these needles is then pressed against a cell or tissue. Cells impaled by the nanostructures can express the delivered gene or genes. An example of this technique is described in Shalek et al., PNAS 107:25 1870 (2010), the disclosure of which is incorporated herein by reference.

[0193] MAGNETOFECTION™ can also be used to deliver nucleic acids to target cells. The principle of MAGNETOFECTION™ is to associate nucleic acids with cationic magnetic nanoparticles. The magnetic nanoparticles are made of iron oxide, which is fully biodegradable, and are coated with specific cationic proprietary molecules that vary depending on the application. Their association with gene vectors (DNA, asRNA, viral vectors, etc.) is achieved by salt-induced colloidal aggregation and electrostatic interactions. The magnetic particles are then concentrated on the target cells by the influence of an external magnetic field generated by a magnet. This technique is described in detail in Scherer et al., Gene Ther. 9:102 (2002), the disclosure of which is incorporated herein by reference. Magnetic beads are another tool that can be used to transfect target cells in a gentle and efficient manner, and this method utilizes an applied magnetic field to direct the uptake of nucleic acids. This technique is described in detail, for example, in US2010 / 0227406, the disclosure of which is incorporated herein by reference.

[0194] Another useful tool for inducing the uptake of exogenous nucleic acid by target cells is sonoporation, a technique that involves the use of sound (typically ultrasonic frequencies) to modify the permeability of cell plasma membrane, permeabilizing cells and allowing polynucleotides to penetrate the cell membrane.This technique is described in detail, for example, in Rhodes et al., Methods Cell Biol. 82:309 (2007), the disclosure of which is incorporated herein by reference.

[0195] Microvesicles represent another possible vehicle that can be used to modify the genome of target cells according to the methods described herein.For example, microvesicles induced by co-overexpression of a genome-modifying protein, such as a nuclease, and glycoprotein VSV-G can be used to efficiently deliver proteins into cells, which then catalyze the site-specific cleavage of endogenous polynucleotide sequences to prepare the genome of cells for covalent incorporation of a polynucleotide of interest, such as a gene or regulatory sequence.The use of such vesicles, also called Gesicle, for the genetic modification of eukaryotic cells is described in detail, for example, in Quinn et al., Genetic Modification of Target Cells by Direct Delivery of Active Protein [abstract];Methylation changes in early embryonic genes in cancer [abstract];Proceedings of the 18th Annual Meeting of the American Society of Gene and Cell Therapy;2015 May 13, Abstract No. 122;.

[0196] Pharmaceutical Compositions The RNA molecules described herein can be formulated in a biocompatible form suitable for administration in vivo into a pharmaceutical composition for administration to a patient, such as a human patient exhibiting or at risk of muscular dystrophy (e.g., DMD). For example, a pharmaceutical composition containing one or more transgenes each encoding a BoxB RNA element and an antisense polynucleotide described herein typically includes a pharmaceutically acceptable diluent or carrier. The pharmaceutical composition may, for example, comprise (e.g., consist of) sterile saline and nucleic acid. The sterile saline is typically pharmaceutical grade saline. The pharmaceutical composition may, for example, comprise (e.g., consist of) sterile water and nucleic acid. The sterile water is typically pharmaceutical grade water. The pharmaceutical composition may, for example, comprise (e.g., consist of) phosphate buffered saline (PBS) and nucleic acid. The sterile PBS is typically pharmaceutical grade PBS.

[0197] In certain embodiments, the pharmaceutical composition comprises one or more RNA molecules and one or more excipients, in certain embodiments, the excipients are selected from water, salt solutions, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.

[0198] In certain embodiments, the RNA molecule can be mixed with pharma- ceutically acceptable active and / or inactive substances for the preparation of pharmaceutical compositions or formulations.The composition and method for the formulation of pharmaceutical compositions depend on many criteria, including but not limited to the route of administration, the extent of the disease, or the dose to be administered.

[0199] In certain embodiments, the pharmaceutical composition comprising the RNA molecule includes any pharma- ceutically acceptable salt of the inhibitor, an ester of the inhibitor, or a salt of such an ester. In certain embodiments, the pharmaceutical composition comprising the RNA molecule is capable of providing (directly or indirectly) a biologically active metabolite or residue thereof upon administration to a subject (e.g., a human). Thus, for example, the present disclosure also applies to pharma- ceutically acceptable salts of the inhibitor, prodrugs, pharma- ceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharma- ceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, the prodrugs include one or more conjugate groups attached to the RNA molecule, where the conjugate groups are cleaved by endogenous nucleases in the body.

[0200] Lipid moieties have been used in nucleic acid therapy in a variety of ways. In certain such methods, nucleic acids are introduced into preformed liposomes or lipoplexes made with a mixture of cationic and neutral lipids. In certain methods, DNA complexes with monocationic or polycationic lipids are formed without the presence of neutral lipids. In certain embodiments, lipid moieties are selected to increase distribution of pharmaceutical agents to specific cells or tissues. In certain embodiments, lipid moieties are selected to increase distribution of pharmaceutical agents to adipose tissue. In certain embodiments, lipid moieties are selected to increase distribution of pharmaceutical agents to muscle tissue.

[0201] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions, including those that contain hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethylsulfoxide, are used.

[0202] In certain embodiments, a pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more pharmaceutical agents of the invention to a specific tissue or cell type, for example, in certain embodiments, a pharmaceutical composition comprises a liposome coated with a tissue-specific antibody.

[0203] In certain embodiments, the pharmaceutical composition includes a co-solvent system. Certain such co-solvent systems include, for example, benzyl alcohol, a non-polar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of 3% w / v benzyl alcohol, 8% w / v of the non-polar surfactant Polysorbate 80™, and 65% w / v polyethylene glycol 300 in absolute ethanol. The proportions of such a co-solvent system can be varied considerably without significantly altering its solubility and toxicity characteristics. Furthermore, the identity of the co-solvent components can be varied: for example, other surfactants can be used in place of Polysorbate 80™; the fraction size of the polyethylene glycol can be changed; other biocompatible polymers, such as polyvinylpyrrolidone, can be substituted for polyethylene glycol; and further, other sugars or polysaccharides can be substituted for dextrose.

[0204] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intraocular (e.g., intravitreal), intravenous, subcutaneous, intramuscular, intrathecal, intracerebroventricular, etc.). In certain such embodiments, the pharmaceutical composition includes a carrier and is formulated in an aqueous solution such as water or a physiologically compatible buffer such as Hank's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that contribute to solubility or serve as preservatives, etc.). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, and the like. Certain pharmaceutical compositions for injection are provided in unit dosage form, e.g., in ampoules or multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions, or emulsions in oily or aqueous vehicles and may contain formulatory agents such as suspending agents, stabilizing agents, and / or dispersing agents. Particular solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.

[0205] kit The compositions described herein can be provided in a kit for use in treating muscular dystrophy (such as DMD).The kit can include one or more RNA molecules described herein.In some embodiments, the kit can include a viral vector described herein.In some embodiments, the kit can include a pharmaceutical composition described herein.

[0206] The kit may include a package insert instructing a user of the kit, such as a physician, to perform any one of the methods described herein. In some embodiments, the kit may include a package insert instructing a user of the kit to administer the composition or vector to a human patient diagnosed with a frameshift mutation. In some embodiments, the kit may include a package insert instructing a user of the kit to administer the composition or vector to a human patient diagnosed with overexpression of a protein of interest (such as dystrophin). In some embodiments, the kit may include a package insert instructing a user of the kit to administer the composition or vector to a human patient diagnosed with DMD (e.g., the patient may be diagnosed with a duplication in exon 2 of the endogenous DMD gene, or the patient may be diagnosed with a frameshift mutation in any one of exons 1-4 of the endogenous DMD gene).

[0207] The kit may optionally include a syringe or other device for administering the composition. In some embodiments, the kit may include one or more additional therapeutic agents.

[0208] Combination therapy The transgene or RNA molecules described herein can be administered in combination with one or more additional therapeutic agents for the treatment of muscular dystrophy (such as DMD). The one or more additional therapeutic agents may include corticosteroids (such as betamethasone, prednisolone, triamcinolone, methylprednisolone, dexamethasone, hydrocortisone, cortisone, ethamethasoneb, prednisone, prednisolone, triamcinolone, dexamethasone, or fludrocortisone), or immunosuppressants (such as pomalidomide, methotrexate, azathioprine, lenalidomide, azathioprine, or thalidomide), or combinations thereof.

[0209] Working Example The following examples are presented to provide one of ordinary skill in the art with an illustration of how the compositions and methods described herein can be used and evaluated, and are intended to be purely illustrative of the invention and are not intended to limit the scope of what the inventors regard as their invention. EXAMPLES

[0210] Methods and Materials DMD Model As previously described, we developed an immortalized cell line expressing conditionally inducible myogenic (MyoD) fibroblast (fibroMyoD) under the control of a tetracycline-inducible promoter (see, for example, USPN9862945). This was achieved by stable transduction of a primary fibroblast cell line with a lentivirus encoding tetracycline-inducible MyoD and containing the human telomerase gene. The resulting stable line allows MyoD expression to be initiated by treatment with doxycycline. The cell line was generated from a DMD patient with a duplication of dystrophin (DMD) exon 2.

[0211] U7snRNA constructs We have developed a product and method for viral-mediated exon skipping of the duplicated DMD exon 2 (Figures 1 and 2), which has been modified compared to the U7snRNA system described in Goyenvalle et al., Science, 306(5702): 1796-1799 (2004) and Goyenvalle et al., Mol. Ther., 20(6): 179601799 (2004), with the further addition of a BoxB RNA element modified compared to U.S. Patent Application Serial No. 63 / 191,069. Specifically, a U7snRNA expression cassette (e.g., a cassette comprising, from 5' to 3', a BoxB RNA element, an antisense polynucleotide (e.g., an antisense RNA (asRNA) sequence), a U7snRNA sequence, a U7Sm binding protein (U7Sm OPT) sequence, a U7 stem loop, and a U7 downstream element) was modified to contain (i) a BoxB RNA element and (ii) an asRNA complementary to the region beginning at residue 17 and ending at residue 46 (SEQ ID NO:2) of a DMD exon 2 target gene (e.g., SEQ ID NO:1) to interfere with splicing of DMD exon 2 (Figure 2).

[0212] An exemplary U7 snRNA construct contains two BoxB RNA elements and two bidirectionally oriented asRNAs complementary to the exon 2 target sequence (including the ESE).

[0213] Each U7snRNA expression cassette was cloned into an AAV plasmid whose genome contained one or more of the U7snRNA constructs.

[0214] As described in Example 2, DMD exon 2 duplication skipping was demonstrated using a Dup2-immortalized human myofibroblast cell line and a U7 snRNA expression cassette encoding the BoxB RNA element and asRNA described herein. EXAMPLES

[0215] Efficacy of U7 snRNA-mediated skipping against exon 2 duplication mutations This example describes the efficacy of U7snRNA-mediated skipping of DMD exon 2 using U7snRNA containing a BoxB RNA element, for example, in the immortalized fibroMyoD cell line, for amelioration of DMD mutations associated with exon 2 duplication.

[0216] Materials and Methods Materials and methods are described in Example 1.

[0217] result Figure 3 shows a reverse transcription polymerase chain reaction (RT-PCR) alkaline gel demonstrating BoxB RNA element-dependent skipping of DMD exon 2 in an immortalized fibroMyoD cell line transfected with an AAV vector encoding a U7 snRNA construct containing an asRNA complementary to DMD exon 2 and containing a BoxB RNA element. Thus, a highly efficient AAV-mediated U7 snRNA containing a BoxB RNA element and an asRNA complementary to the DMD exon 2 ESE was designed to skip DMD exon 2.

[0218] Without being limited by mechanism, the BoxB RNA element-containing compositions described herein can mediate more effective exon skipping than constructs without the BoxB RNA element by enhancing expression of small antisense polynucleotides (Figure 4; e.g., asRNAs of 10 to 100 nucleotides in length with sufficient complementarity to hybridize to a region within an mRNA transcript encoding a protein such as dystrophin). Notably, the inventors observed 3-4 fold higher levels of expression of asRNA in host cells transduced with rAAVs with BoxB RNA elements compared to rAAVs without BoxB RNA elements. EXAMPLES

[0219] Induction of alternative splicing by asRNA in DMD exon 2 DMD is a severe progressive neuromuscular disorder caused by mutations in the DMD gene, resulting in a C-terminal truncated non-functional dystrophin protein. Mutations causing DMD are heterogeneous in nature and typically include at least one of the following: point mutations generating premature stop codons, duplications, or deletions. For example, alternative splicing by exon skipping is a promising therapeutic approach for treating DMD, since internally truncated dystrophin can be partially functional. This is exemplified by the less severe phenotype of Becker muscular dystrophy (BMD) patients who have mutations in the same gene, where the mutations do not change the reading frame of protein translation.

[0220] The wild-type DMD gene contains 79 exons, and nearly every patient has a unique mutation. Alternative splicing approaches are mutation-specific because, depending on the mutation, different exons need to be skipped to restore protein function. For example, DMD patients may have a duplication of exon 2 of the endogenous DMD gene. Therefore, skipping of DMD exon 2 is applicable to treat DMD patients.

[0221] This example describes the process of designing and administering a transgene that directs targeted exon skipping of exon 2, resulting in the translation of a functional truncated isoform of dystrophin.

[0222] In this example, exon skipping using asRNA can be achieved by introducing a transgene containing or encoding the asRNA into a cell. The efficiency of exon skipping can be further enhanced by including a BoxB RNA element in the transgene encoding the asRNA. In some embodiments, the asRNA comprises a portion of 25 to 40 (e.g., 25 to 40, 26 to 40, 27 to 40, 28 to 40, 29 to 40, 30 to 40, 31 to 40, 32 to 40, 33 to 40, 34 to 40, 35 to 40, 36 to 40, 37 to 40, 38 to 40, or 39 to 40) nucleotides in length that has sufficient complementarity to hybridize across or within the length of a region of exon 2 of a human dystrophin RNA transcript, where the region begins at residue 17 of SEQ ID NO:1 and ends at residue 46 of SEQ ID NO:1. In some embodiments, the asRNA has a nucleic acid sequence that is at least 70% (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, 100%) complementary to a region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the asRNA comprises 10 to 30 (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the asRNA comprises 9 or less (e.g., 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0) nucleotide mismatches to the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1.In some embodiments, the asRNA has a nucleic acid sequence that is at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100%) identical to the nucleic acid sequence of SEQ ID NO: 2. In some embodiments, the BoxB RNA element has a nucleic acid sequence that is at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100%) identical to the nucleic acid sequence of SEQ ID NO: 3.

[0223] The transgenes encoding the BoxB RNA element and the asRNA may be operably linked to a promoter and / or enhancer, such as the U7 promoter and muscle creatine kinase (MCK) enhancer, respectively, and may be incorporated into a viral vector, such as a recombinant single-stranded (ss) or self-complementary (sc) AAV vector. The vector containing the transgene may be delivered to cells (e.g., patient cells) that have a duplication in exon 2 (dup2) of the endogenous DMD gene. Following delivery of the vector, DMD dup2 myoblasts can be induced to differentiate, and samples of DMD mRNA and dystrophin protein can be collected after 7 days. Skipping of exon 2 can be assessed, for example, by RT-PCR analysis of DMD mRNA and / or Western blot of dystrophin protein. Production of a dystrophin protein containing an internal truncation is expected, thereby restoring partial function of the protein. EXAMPLES

[0224] Treatment of muscular dystrophy by inducing alternative splicing of DMD exon 2 by asRNA Using the compositions and methods of the disclosure, a patient (e.g., a pre-ambulatory or ambulatory pediatric patient between about 6 months and about 14 years of age) having DMD and a duplication in exon 2 of the endogenous DMD gene can be administered a pseudotyped AAV2 / 8 vector that contains or encodes a transgene comprising one or more U7snRNA expression cassettes (e.g., comprising a BoxB RNA element, an asRNA targeting DMD exon 2, a U7snRNA, an Sm binding protein (U7Sm OPT) sequence, a U7 stem loop, and a U7 downstream element) operably linked to a U7 promoter and an MCK enhancer, a stuffer, and adjacent rAAV2 inverted terminal repeat (ITR) sequences (e.g., SEQ ID NO: 10).

[0225] When a viral vector containing the above BoxB RNA element and asRNA is administered to a patient, the patient can exhibit increased expression of functional dystrophin protein and / or induction of exon 2 skipping. EXAMPLES

[0226] Induction of alternative splicing by DMD exon 2 asRNA to restore the downstream reading frame in the mutant DMD gene This example describes a process for designing and administering a transgene that directs targeted exon skipping of exon 2 for the treatment of DMD patients who may have, for example, a mutation within or affecting exons 1, 2, 3, or 4 of the DMD gene (such as a 5' mutation of the DMD gene). Skipping of exon 2 disrupts the reading frame and results in a premature stop codon, thereby activating a glucocorticoid-inducible IRES in exon 5 of the DMD gene, which can restore the 5' mutation of the DMD gene by translation of a functional truncated dystrophin isoform (see, e.g., US 20170218366 A1).

[0227] In this example, exon skipping using asRNA can be achieved by introducing an antisense polynucleotide into a cell. The efficiency of alternative splicing can be increased by further including a BoxB RNA element. In some embodiments, the asRNA comprises a portion of 25 to 40 (e.g., 25 to 40, 26 to 40, 27 to 40, 28 to 40, 29 to 40, 30 to 40, 31 to 40, 32 to 40, 33 to 40, 34 to 40, 35 to 40, 36 to 40, 37 to 40, 38 to 40, or 39 to 40) nucleotides in length that has sufficient complementarity to hybridize across or within the length of a region of exon 2 of a human dystrophin RNA transcript, where the region begins at residue 17 of SEQ ID NO:1 and ends at residue 46 of SEQ ID NO:1. In some embodiments, the asRNA has a nucleic acid sequence that is at least 70% (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100%) complementary to a region beginning with residue 17 of SEQ ID NO:1 and ending with residue 46 of SEQ ID NO:1. In some embodiments, the asRNA comprises 10 to 30 (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the asRNA comprises 9 or less (e.g., 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0) nucleotide mismatches to the region beginning at residue 17 of SEQ ID NO:1 and ending at residue 46 of SEQ ID NO:1. In some embodiments, the asRNA has a nucleic acid sequence that is at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100%) identical to the nucleic acid sequence of SEQ ID NO:2.In some embodiments, the BoxB RNA element has a nucleic acid sequence that is at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100%) identical to the nucleic acid sequence of SEQ ID NO:3.

[0228] The transgene encoding the asRNA may be operably linked to a promoter and / or enhancer, such as the U7 promoter or MCK enhancer, respectively, and may be incorporated into a viral vector, such as a recombinant ss or sc AAV vector. The vector containing the transgene may be delivered to cells (e.g., patient cells) that have a frameshift mutation in any one of exons 1-4 of the endogenous DMD gene (e.g., Δ5'). Following delivery of the vector, Δ5'DMD myoblasts can be induced to differentiate, and samples of DMD mRNA and dystrophin protein can be collected after 7 days. Skipping of exon 2 can be assessed, for example, by RT-PCR analysis of DMD mRNA and / or Western blot of dystrophin protein. Production of a dystrophin protein containing an internal truncation is expected, thereby restoring the downstream reading frame and partial function of the protein. EXAMPLES

[0229] Treatment of muscular dystrophy by inducing alternative splicing with DMD exon 2 asRNA to restore the downstream reading frame in the mutant DMD gene Using the compositions and methods of the disclosure, a patient (e.g., a pre-ambulatory or ambulatory pediatric patient between about 6 months and about 14 years of age) having DMD and having a frameshift mutation in any one of exons 1-4 of the endogenous DMD gene can be administered a pseudotyped AAV2 / 8 vector that includes or encodes one or more nucleic acid sequences of a U7snRNA expression cassette (e.g., including a BoxB RNA element, an asRNA targeting DMD exon 2, a U7snRNA, a U7Sm OPT sequence, a U7 stem loop, and a U7 downstream element) operably linked to a U7 promoter and an MCK enhancer, a stuffer, and a flanking rAAV2ITR sequence (e.g., SEQ ID NO: 10, etc.).

[0230] When a viral vector containing the above BoxB RNA element and asRNA is administered to a patient, the patient can exhibit increased expression of functional dystrophin protein and / or activation of an internal ribosome entry site within exon 5 of the endogenous DMD gene.

[0231] Other embodiments All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

[0232] While the invention has been described in relation to specific embodiments thereof, it will be understood that further modifications are possible, and this application is intended to cover any variations, uses, or adaptations of the invention which generally follow the principles of the invention and are within known or customary practice in the art to which the invention pertains and which can be applied to the essential features set forth hereinabove, including departures from the invention in accordance with the scope of the claims.

[0233] Other embodiments are within the scope of the claims.

Claims

1. An introduced gene encoding a ribonucleic acid (RNA) molecule, wherein the RNA molecule is (i) BoxB RNA element, and (ii) Antisense polynucleotides of 10 to 100 nucleotides in length that have sufficient complementarity to hybridize to a region within a protein-coding mRNA transcript. A transgene that includes this gene.

2. The transgene according to claim 1, wherein the BoxB RNA element has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of Sequence ID No.

3.

3. The transgene according to claim 1, wherein the mRNA transcript is a human dystrophin mRNA transcript, a human fukutin mRNA transcript, a human gamma-sarcoglycan mRNA transcript, a human dysferin mRNA transcript, a human myotonic dystrophy protein kinase mRNA transcript, a human laminin subunit alpha-2 mRNA transcript, a human usherin mRNA transcript, a human collagen alpha-1 (VII) chain mRNA transcript, or a human activin A receptor type 1 mRNA transcript.

4. The transgene according to claim 1, wherein the antisense polynucleotide comprises a portion of 30 to 40 nucleotides in length that is sufficiently complementary to hybridize over the length of the exon 2 region of the human dystrophin mRNA transcript, and optionally, the antisense polynucleotide is of length 30 to 40 nucleotides and is sufficiently complementary to hybridize over the length of the exon 2 region of the human dystrophin mRNA transcript, and optionally, the antisense polynucleotide is of length 30 to 39 nucleotides, 30 to 38 nucleotides, 30 to 37 nucleotides, 30 to 36 nucleotides, or 30 nucleotides.

5. The transgene according to claim 1, wherein the antisense polynucleotide has a nucleic acid sequence that is at least 70% complementary to the region beginning at residue 17 of SEQ ID NO: 1 and ending at residue 46 of SEQ ID NO:

1.

6. The introduced gene according to claim 1, wherein the antisense polynucleotide has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of Sequence ID No.

2.

7. The transgene according to claim 1, wherein the RNA molecule further comprises U7 nuclear small RNA (snRNA).

8. The transgene according to claim 7, wherein the U7snRNA has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of Sequence ID No.

8.

9. A composition comprising the transgene or RNA molecule described in claim 1, which is a liposome, vesicle, synthetic vesicle, exosome, synthetic exosome, dendrimer, or nanoparticle.

10. A viral vector comprising the introduced gene described in claim 1.

11. A pharmaceutical composition comprising the viral vector according to claim 10, and a pharmaceutically acceptable carrier, diluent, or excipient.

12. A method for treating Duchenne muscular dystrophy in a human patient diagnosed with having a duplication in exon 2 of the endogenous DMD gene or a frameshift mutation in any one of exons 1 to 4 of the endogenous DMD gene, comprising the step of administering a therapeutically effective amount of the pharmaceutical composition according to claim 11 to the patient.

13. (i) a pharmaceutical composition according to claim 11, and (ii) a kit comprising a package insert, wherein the package insert instructs the user of the kit to administer the composition to a human patient diagnosed with Duchenne muscular dystrophy.

Images