Plants with improved pathogen resistance

Abstract

The present invention relates to novel tomato plants having improved resistance to lesion-forming pathogens caused by reduced levels, activity, or expression of Pub17 protein. The levels, activity, or expression of Pub17 protein can be reduced by modification of Pub17 alleles to contain SNPs that have been identified to be associated with increased resistance to lesion-forming pathogens. The present invention further relates to plant parts and seeds derived from said tomato plants, and methods of making said tomato plants or increasing resistance to lesion-forming pathogens in tomato plants, as well as the use of SNPs as markers and kits related thereto.

Description

[Technical field]

[0001] The present invention relates to novel tomato plants having improved resistance to lesion-forming pathogens. The invention further relates to plant parts and seeds derived from said tomato plants, and to methods of producing said tomato plants or methods of increasing resistance to lesion-forming pathogens in tomato plants. Further aspects of the invention relate to modified Pub17 nucleic acid and Pub17 protein sequences associated with such improved resistance to lesion-forming pathogens. [Background technology]

[0002] Valuable cultivated plants such as tomato are hosts to more than 200 species of a wide variety of pests and pathogens. In plant breeding practice, one of the most prominent challenges since the 1950s has been breeding for resistance to the most destructive pests and pathogens by transferring disease resistance (R) genes from closely related wild species to cultivated plants. Today, about 20 pathogens can be genetically controlled by R genes derived from relatively few wild species. In most cases, single-gene resistances controlled by a single dominant gene are introgressed into cultivated varieties (Bai et al., 2018). Most of the dominant R genes cloned so far can be classified into two groups: (1) plasma membrane receptors, including receptor-like kinases (RLKs, encoded by I-3 genes) and receptor-like proteins (RLPs, encoded by Cf and Ve-1 genes); and (2) intracellular receptors, which in most cases represent proteins with nucleotide-binding sites and leucine-rich repeat domains (NBS-LRRs). These plant receptors can recognize pathogen molecules and effectors known as pathogen-associated molecular patterns to confer pathogen-induced resistance (Dangl et al., 2013).

[0003] Introgression of dominant R genes from wild species into cultivated varieties has been very successful for (semi)biotrophic pathogenic microorganisms. The mode of action of these R genes has been extensively tested over the last two decades and shown to depend in most cases on a mechanism called effector-induced immunity (ETI). Effector molecules of biotrophic pathogens are thought to be important in suppressing the so-called PAMP-induced immunity (PTI). Recognition of microbial effector molecules by plant receptor proteins (products of R genes) induces programmed cell death (the "hypersensitive response", HR), thereby preventing further invasion of the pathogen.

[0004] However, no dominant R genes have been identified that confer resistance to lesion-forming pathogens, especially necrotrophic pathogens, including the common tomato pathogens Botrytis cinerea and Alternaria solani (Adhikari et al., 2017; Bai et al., 2018). The immune responses described above are ineffective against such pathogenic microorganisms. Instead, necrotrophs are thought to usurp host cell death pathways in response to effector molecules (Mengiste, 2012; Vleeshouwers and Oliver 2014; Shi et al., 2016). It is therefore important to develop alternative breeding strategies that avoid the use of plant receptor genes that recognize effectors.

[0005] Currently available resistance to lesion-forming pathogens is mostly quantitative and conferred by many quantitative trait loci (QTLs, Poland et al., 2009; Bai et al., 2018). In contrast to R-gene-mediated qualitative resistance, the molecular mechanisms of quantitative resistance conferred by QTLs are not yet understood. It has been proposed that resistance QTLs can be conditioned by genes involved in defense signaling and genes regulating morphological traits, as well as genes encoding components of chemical warfare (Poland et al., 2009; Roux et al., 2014). In breeding, QTLs are difficult to use due to the small individual QTL effects on resistance. For example, resistance to B. cinerea and A. solani in certain wild tomato accessions is good relative to closely related species (ten Have et al., 2007; Smith et al., 2014), but when introgressed into a S. lycopersicum background, resistance levels decrease, indicating that the genetic background of resistance in wild species is very complex (Finkers et al., 2007; Smith et al., 2014).

[0006] In 2010, a novel method for breeding resistant crops was presented: the use of impaired plant susceptibility (S) genes (Pavan et al., 2010). S genes are plant genes that code for proteins exploited by pathogens for their own benefit during the infection process (Pavan et al., 2010). These S genes can be classified into three groups (Van Schie and Takken 2014): (i) genes that enable basic plant-pathogen compatibility, facilitating host recognition and invasion; (ii) genes that code for negative regulators of immune signaling; (iii) genes that meet metabolic or structural needs of the pathogen, allowing sustained fitness and pathogen growth. If such a gene becomes impaired due to mutation or expression defects, it prevents the pathogen from colonizing the plant. Thus, impaired S genes result in recessive resistance traits, in contrast to recognition-based resistance governed by dominant R genes. Methods using S genes offer fundamentally different opportunities for controlling diseases caused by lesion-forming microorganisms. However, many S genes remain undiscovered and the concept of using them to produce pathogen-resistant plants has not been tested or achieved in major cultivated plants such as tomato. Summary of the Invention [Problem to be solved by the invention]

[0007] The present invention aims to address one or more of the above problems in the art and to provide an alternative means of increasing plant resistance to lesion-forming pathogens, particularly in tomato plants. [Means for solving the problem]

[0008] Description of the invention According to a first aspect of the present invention there is provided a tomato plant or plant material having reduced level, activity or expression of Pub17 protein which confers increased resistance relative to a reference tomato plant or plant material to lesion-forming pathogens.

[0009] In one embodiment, a tomato plant or plant material has been modified to reduce the level, activity or expression of Pub17 protein. Thus, in one embodiment, there is a tomato plant or plant material that has been modified to reduce the level, activity or expression of Pub17 protein that confers increased resistance to lesion-forming pathogens relative to a reference tomato plant or plant material.

[0010] In one embodiment, the tomato plant or plant material comprises a modified Pub17 allele. In one embodiment, the plant or plant material comprises a Pub17 allele having at least 70% identity to SEQ ID NO:1 (wild type Pub17 allele) or an orthologue or homologue thereof, said Pub17 allele comprising a mutation. In one embodiment, the modified Pub17 allele confers increased resistance to a lesion-forming pathogen relative to a reference tomato plant or plant material. Thus, in one embodiment, there is a tomato plant or plant material comprising a Pub17 allele having at least 70% identity to SEQ ID NO:1 (wild type Pub17 allele) or an orthologue or homologue thereof, said Pub17 allele comprising a mutation resulting in a reduced level, activity or expression of Pub17 protein that confers increased resistance to a lesion-forming pathogen relative to a reference tomato plant or plant material.

[0011] According to a second aspect of the present invention there is provided a method of increasing resistance of a tomato plant or plant material to a pathogen forming a lesion comprising reducing the level, activity or expression of Pub17 protein in the tomato plant or plant material.

[0012] In one embodiment the method comprises modifying a tomato plant to reduce the level, activity or expression of Pub17 protein in the tomato plant or plant material.Thus, in one embodiment there is a method of increasing resistance of a tomato plant or plant material to a pathogen that forms a lesion comprising modifying a tomato plant to reduce the level, activity or expression of Pub17 protein in the tomato plant or plant material.

[0013] In one embodiment, the method comprises obtaining a mutant population of tomato plants and selecting tomato plants comprising a modified Pub17 allele. In one embodiment, the method comprises selecting tomato plants comprising a Pub17 allele having at least 70% identity to SEQ ID NO:1 (wild type Pub17 allele) or an orthologue or homologue thereof, comprising a mutation. Thus, in one embodiment, there is a method of increasing resistance of tomato plants or plant materials to pathogens forming lesions comprising obtaining a mutant population of tomato plants and selecting plants comprising a Pub17 allele having at least 70% identity to SEQ ID NO:1 (wild type Pub17 allele) or an orthologue or homologue thereof, comprising a mutation that results in a reduced level, activity or expression of Pub17 protein.

[0014] In one embodiment, the increased resistance may be relative to a reference tomato plant or plant material.

[0015] According to a third aspect of the present invention there is provided a method for producing a tomato plant with increased resistance to a lesion forming pathogen comprising reducing the level, activity or expression of Pub17 protein in a tomato plant or plant material.

[0016] In one embodiment the method comprises modifying a tomato plant to reduce the level, activity or expression of Pub17 protein in the tomato plant or plant material.Thus, in one embodiment there is a method of producing a tomato plant with increased resistance to a lesion forming pathogen comprising modifying the plant to reduce the level, activity or expression of Pub17 protein in the tomato plant or plant material.

[0017] In one embodiment, the method comprises obtaining a mutant population of tomato plants and selecting plants comprising a modified Pub17 allele. In one embodiment, the method comprises selecting tomato plants comprising a Pub17 allele having at least 70% identity to SEQ ID NO:1 (wild type Pub17 allele) or an orthologue or homologue thereof, comprising a mutation. Thus, in one embodiment, there is a method for producing tomato plants with increased resistance to a lesion forming pathogen comprising obtaining a mutant population of tomato plants and selecting modified tomato plants comprising a modified Pub17 allele having at least 70% identity to SEQ ID NO:1 (wild type Pub17 allele) or an orthologue or homologue thereof, comprising a mutation that results in a reduced level, activity or expression of Pub17 protein.

[0018] In one embodiment, the increased resistance may be relative to a reference tomato plant or plant material.

[0019] According to a fourth aspect of the present invention there is provided a method of enhancing the growth of a tomato plant by increasing the resistance of the tomato plant or plant material to a pathogen forming a lesion, the method comprising reducing the level, activity or expression of Pub17 protein in the tomato plant or plant material.

[0020] In one embodiment the method comprises modifying a tomato plant to reduce the level, activity or expression of Pub17 protein in the tomato plant or plant material.Thus, in one embodiment there is a method of enhancing tomato plant growth by increasing resistance to pathogens that form lesions in the tomato plant or plant material, the method comprising modifying a tomato plant to reduce the level, activity or expression of Pub17 protein in the tomato plant or plant material.

[0021] In one embodiment, the method comprises obtaining a mutant population of tomato plants and selecting plants comprising a modified Pub17 allele. In one embodiment, the method comprises selecting tomato plants comprising a Pub17 allele having at least 70% identity to SEQ ID NO:1 (wild type Pub17 allele) or an orthologue or homologue thereof, comprising a mutation. Thus, in one embodiment, there is a method of enhancing tomato plant growth by increasing resistance to pathogens that form lesions on tomato plants or plant materials, comprising obtaining a mutant population of tomato plants and selecting modified plants comprising a modified Pub17 allele having at least 70% identity to SEQ ID NO:1 (wild type Pub17 allele) or an orthologue or homologue thereof, comprising a mutation that results in a reduced level, activity or expression of Pub17 protein.

[0022] In one embodiment, the increased resistance may be relative to a reference tomato plant or plant material.

[0023] According to a fifth aspect of the present invention there is provided a method of identifying a tomato plant having increased resistance to a lesion-forming pathogen relative to a reference tomato plant or plant material comprising determining the level, activity or expression of Pub17 protein in one or more tomato plants and comparing this with the level, activity or expression of Pub17 protein in the reference tomato plant and selecting a tomato plant having a reduction in the level, activity or expression of Pub17 protein relative to the reference tomato plant, wherein a reduction in the level, activity or expression of Pub17 protein indicates increased resistance to a lesion-forming pathogen relative to the reference tomato plant.

[0024] In one embodiment, the method comprises obtaining a mutant population of tomato plants. In one embodiment, there is provided a method of identifying tomato plants having increased resistance to a lesion-forming pathogen relative to a reference tomato plant or plant material, comprising obtaining a mutant population of tomato plants, determining the level, activity or expression of Pub17 protein in one or more tomato plants of the population of tomato plants and comparing it to the level, activity or expression of Pub17 protein in the reference tomato plant, and selecting plants having a reduction in the level, activity or expression of Pub17 protein relative to the reference tomato plant, wherein a reduction in the level, activity or expression of Pub17 protein indicates increased resistance to a lesion-forming pathogen relative to the reference tomato plant.

[0025] In one embodiment, the method comprises obtaining a mutant population of tomato plants and screening for tomato plants comprising a modified Pub17 allele. In one embodiment, the method comprises screening for tomato plants comprising a Pub17 allele having at least 70% identity to SEQ ID NO:1 (wild type Pub17 allele) or an orthologue or homologue thereof, comprising a mutation. Thus, in one embodiment, there is a method for identifying tomato plants having increased resistance to a lesion forming pathogen relative to a reference tomato plant or plant material, comprising obtaining a mutant population of tomato plants, screening said population of tomato plants for the presence of a Pub17 allele having at least 70% identity to SEQ ID NO:1 (wild type Pub17 allele) or an orthologue or homologue thereof, comprising a mutation resulting in a reduced level, activity or expression of Pub17 protein, and selecting tomato plants having said Pub17 allele.

[0026] According to a sixth aspect of the present invention there is provided a plant part obtainable from a tomato plant of the first aspect.

[0027] In one embodiment, the plant part is a fruit. In one embodiment, the plant part comprises a modified Pub17 allele. In one embodiment, the plant part comprises a Pub17 allele having at least 70% identity to SEQ ID NO:1 (wild-type Pub17 allele) or an ortholog or homolog thereof, comprising a mutation.

[0028] According to a seventh aspect of the present invention there is provided a seed capable of producing a tomato plant of the first aspect.

[0029] In one embodiment, the seed comprises a modified Pub17 allele. In one embodiment, the seed comprises a Pub17 allele having at least 70% identity to SEQ ID NO:1 (wild-type Pub17 allele) or an ortholog or homolog thereof, comprising a mutation.

[0030] According to an eighth aspect of the present invention there is provided an isolated polynucleotide sequence having at least 70% identity to SEQ ID NO:1 (wild type) or an orthologue or homologue thereof, wherein the polynucleotide sequence comprises a mutation at or corresponding to position 1477 of SEQ ID NO:1.

[0031] In one embodiment, the isolated polynucleotide comprises or consists of a sequence according to SEQ ID NO:2.

[0032] In one embodiment, the isolated polynucleotide sequence is capable of conferring increased resistance to a pathogen that forms a lesion. Suitably, when expressed in a plant or plant material, it is capable of conferring increased resistance to a pathogen that forms a lesion.

[0033] According to a ninth aspect of the present invention there is provided an isolated polypeptide sequence encoded by a polynucleotide sequence of the eighth aspect.

[0034] In one embodiment the isolated polypeptide sequence consists of the amino acid sequence according to SEQ ID NO:4 (truncated protein sequence) or a portion thereof, or an amino acid sequence having at least 70% identity thereto.

[0035] In one embodiment, the isolated polypeptide sequence is capable of conferring increased resistance to a pathogen that forms a lesion. Suitably, it is capable of conferring increased resistance to a pathogen that forms a lesion when present in a plant or plant material.

[0036] According to a tenth aspect of the present invention there is provided a vector or expression construct comprising a polynucleotide sequence according to the eighth aspect.

[0037] According to an eleventh aspect of the present invention there is provided a host cell comprising a polynucleotide sequence according to the eighth aspect, a vector according to the tenth aspect, or a polypeptide according to the ninth aspect.

[0038] According to a twelfth aspect of the present invention there is provided a method of producing hybrid seed comprising crossing a first tomato plant of the first aspect with a second tomato plant and obtaining seed therefrom.

[0039] According to a thirteenth aspect of the present invention there is provided a kit for detecting Pub17 alleles conferring resistance to lesion-forming pathogens in tomato plants comprising a PCR oligonucleotide primer pair, wherein the primer pair comprises a forward primer of SEQ ID NO: 25 and a reverse primer of SEQ ID NO: 24; or a first forward primer of SEQ ID NO: 31, a second forward primer of SEQ ID NO: 30, and a reverse primer of SEQ ID NO: 32.

[0040] In one embodiment, the kit is for use in gene-specific PCR and comprises a forward primer of SEQ ID NO:25 and a reverse primer of SEQ ID NO:24.

[0041] In one embodiment, the kit is for use in allele-specific PCR and comprises a first forward primer of SEQ ID NO:31, a second forward primer of SEQ ID NO:30, and a reverse primer of SEQ ID NO:32.

[0042] In the present invention, instead of the use of classical R genes or the introgression of several (minor) effect QTLs, the principle of mutant S genes is used to achieve resistance to lesion-forming pathogens.

[0043] The inventors are the first to identify a novel S gene, Pub17, not previously known to be a susceptibility gene in Solanaceae species. The inventors further discover that Solanaceae plants carrying dysfunctional mutant alleles of this S gene have increased pathogen resistance, particularly to lesion-forming pathogens. These examples show that Solanaceae plants homozygous for this mutant Pub17 allele are significantly less susceptible to necrotrophic pathogens, including Botrytis and Alternaria, as well as hemibiotrophic pathogens such as Phytophthora infestans. The inventors show that this is the case in several different genetic backgrounds. Advantageously, the Pub17 allele can be used in crop breeding to obtain Solanaceae plant populations that are less prone to being severely affected by necrotrophic pathogens than existing varieties. Thus, the present invention provides an alternative to the problem of controlling pathogens that form lesions in Solanaceae crops that is much simpler than using QTL or R genes. Given that the Solanaceae family of plants is one of the largest families of cultivated plants, including not only tomato but also potato and pepper, such resistant plants of the present invention are economically important. The present invention can be used to limit the damage caused by these pathogens and increase crop yields in the Solanaceae family. [Brief description of the drawings]

[0044] [Figure 1] Pedigrees of identified M2042 mutants generated by EMS mutagenesis are shown. A. Self-pollinated generation of M2042 in Micro-Tom (MT) background. B. Hybrid generation after crossing resistant M4 plant M2042-1-2-12 with Moneymaker (MM). IR, moderately resistant; S, susceptible. [Diagram 2]The structure of the mutant M2042 candidate gene PUB17, which confers reduced susceptibility to Botrytis cinerea, is shown. Tomato PUB17 (Solyc02g072080) has three domains: a U-box N-terminal domain UND (amino acids 20-171), a U-box domain (amino acids 297-364) and an ARM armadillo repeat (amino acids 429-682) (predicted by comparison with potato StPUB17, Ni et al. 2010). A SNP at position 1477 was identified, resulting in a premature stop codon at amino acid R493. [Diagram 3] Relative gene expression levels of mutant PUB17 candidate genes in wild-type Micro-Tom (MT) and Botrytis-resistant mutant plants M2042-1-1-17 and M2042-1-2-12 upon infection with B. cinerea. hpi, hours post-infection. [Figure 4] The positions of selected RNAi fragments for silencing PUB17 expression are indicated. [Diagram 5] Relative expression levels of RNAi transformed tomato PUB17 compared to non-transformed Moneymaker (MM) as measured by qPCR using EF1α as a reference gene. T1 plants 3-5 and 3-29, indicated by arrows, were selected for further analysis. [Figure 6] Box plots of lesion diameter size on leaves from the PUB17 RNAi T3 family with two negative controls (MM and TV24) on the left of each panel. Left panel, results from 3 days post inoculation (dpi); right panel, results from 4 dpi. Different letters above the box plots indicate significant differences as calculated by Tukey HSD method. [Figure 7]Box plots of lesion diameter size on leaves from PUB17 RNAiT2 family TV181105 (TV05, NPTII-containing plant) with two negative controls (MM and TV181105 non-NPTII-containing plants) on the left of each panel are shown. Left panel, results from 3 days post-inoculation (dpi); right panel, results from 4 dpi. Different letters above the box plots indicate significant differences as calculated by Tukey HSD method. [Figure 8] The locations of the four sgRNAs for targeting the tomato PUB17 gene using CRISPR / Cas9 are shown. [Figure 9] Four CRISPR / Cas9 PUB17 transformants are shown, showing smaller bands than the expected wild-type Moneymaker (MM) control, indicating that cleavage has occurred. PUB17 was amplified using primers FWD_MR_GX_CRISPR+REV_MR_GX_CRISPR (A) or AWPUB17_F1+REV_MR_GX_CRISPR (B). PCR products were run on a 1% agarose gel with TAE. Marker band sizes are shown in bp. [Figure 10] Figure 1 shows CRISPR-induced mutations in the tomato PUB17 gene. Graphical representation of the tomato PUB17 genomic sequence. Single exons are shown as solid arrows and the locations of the four sgRNA target sites are shown as asterisks. The expected PCR products for the wild-type allele are shown below the exons. The sizes of the deletions in the CRISPR transformants are shown as lines above the exons. [Figure 11] 13 shows CRISPR-induced single nucleotide mutations at the target sites of sgRNA3 and sgRNA4 in the tomato PUB17 gene in CRISPR / Cas9 transformant 7. [Figure 12] Box plots of lesion diameter size on leaves from the PUB17 CRISPR mutant T3 family compared to the negative control Moneymaker (MM) and the non-mutant T2 family TV181133. A. Results from 3 days post-inoculation (dpi). B. Results from 4 dpi. [Figure 13] Graphs showing reduced lesion diameter size in F3, F4 and M5 EMS-induced mutant PUB17 plants after infection with Alternaria solani compared to controls Moneymaker (MM) and Micro-Tom (MT) at (A) 10 days post-inoculation and (B) 5 days post-inoculation. (C) Box plots of lesion diameter at 7 dpi (days post-inoculation) on leaves from PUB17 CRISPR mutant T3 family TV192007 (TV07) and TV192023 (TV23). MM was used as a susceptible control. Different letters above the box plots indicate significant differences (P<0.05) as calculated by Tukey HSD method. [Figure 14] Botrytis cinerea stem assay results. A. Disease scores of PUB17 RNAi T3 family 10 days post inoculation (dpi) with Moneymaker (MM) and wild type T3 family TV192024 as negative control (NC). B. Disease scores of PUB17 CRISPR T3 family TV192008, TV192012, TV192007, TV192009, TV192016, TV192019, TV192014, TV192023 6 days post Botrytis cinerea stem inoculation with Moneymaker (MM) and wild type T3 family TV181133 as negative control (NC). "abs, 0 to 3" is the Disease Severity Index (DSI) score: high numbers indicate heavy damage or "abs" indicates detachment of petiole stumps. Plants began to show disease symptoms 6 days after inoculation. [Figure 15]Figure 1 shows a photographic representation of disease index scoring in the Botrytis stem assay. Abs, abscission. Petiole segments have fallen off. 0, Petiole segments are unchanged. Response is equivalent to mock treated. 1, Petiole segments are responding. Petiole segments are brown and partially or completely thinned. 2, Initiation of external main stem infection. Small brown rings are visible on the main stem around the axils of the inoculated petiole segments. 3, Spread of external main stem infection. Brown rings are becoming irregular and spreading upwards and downwards on the main stem. 4, Full main stem infection and wilting of plant. Main stem is infiltrated followed by internal browning and collapse of stem tissue. Stem dies and eventually the plant top turns over. [Figure 16] Protein domains in mutant PUB17 alleles are shown. WT, wild-type tomato PUB17 protein; M2042, EMS PUB17 mutant allele; alleles 1-4, CRISPR PUB17 mutant alleles. Output was obtained from the Scan Prosite tool. [Figure 17] Pre-breeding results of the EMS mutant pub17. A. Scheme of introgression of the pub17 mutation into breeding lines H1 and H2. B. Scheme of introgression of the pub17 mutation into pre-breeding lines A and B of the F1 hybrid. C. Observation of autonecrosis in pre-breeding line B. No necrotic spots are shown on the leaves of the F1 hybrid and pre-breeding line A carrying the pub17 mutation (pub17pub17) (left panel). WT, control carrying normal PUB17 allele. Observation of necrotic spots on the leaves of pre-breeding line B 120 days after sowing (right panel). Pre-breeding line B-1 was selected as it showed the lowest necrosis to generate F1 hybrids by crossing with pre-breeding line A. D. No significant difference in fruit set between wild type (WT) hybrids and hybrids carrying pub17. Top panel, mean fruit weight for the first fruit cluster 40 days after pollination (±SD, n=6 plants). Lower panel, mean number of fruits for the mean of the first, second and third fruit clusters 20 days after pollination (±SD, n=6 plants). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0045] Further features and embodiments of the invention are now described under the heading sections. Any feature in any section may be combined with any of the above aspects or embodiments of the invention in any workable combination.

[0046] definition The technical terms and expressions used within the scope of this application should generally be given the meanings commonly applied to them in the relevant art of plant breeding and cultivation, unless otherwise indicated herein below.

[0047] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a plant" includes one or more plants, and reference to "a cell" includes mixtures of cells, tissues, and the like.

[0048] As used herein, the term "about" when referring to a value or amount of mass, weight, time, volume, concentration, or percentage is meant to include variations from the particular amount of, in some embodiments, ±20%, in some embodiments ±10%, in some embodiments ±5%, in some embodiments ±1%, in some embodiments ±0.5%, and in some embodiments ±0.1%, as such variations are appropriate within the context of the present invention.

[0049] A "cultivated" plant, within the scope of the present invention, is understood to refer to a plant that is no longer in its natural state but has been developed and domesticated by human care for agricultural use and / or human consumption, excluding wild relatives. By way of example, in an embodiment, a "cultivated plant" is a hybrid plant.

[0050] "Alleles" is understood within the scope of the present invention to refer to alternative forms or variants of various genetic units related to the same or different forms of genes, which are alternative in genetic traits because they are located at the same locus on homologous chromosomes. Such alternative forms or variants may be the result of single nucleotide polymorphisms, insertions, inversions, translocations or deletions, or may be the result of gene regulation caused, for example, by chemical or structural modifications, transcriptional or post-translational modifications / regulations. In diploid cells or organisms, the two alleles of a given gene or genetic element typically occupy corresponding loci on pairs of homologous chromosomes.

[0051] The term "trait" refers to a characteristic or phenotype. In the context of the present invention, a nematode resistance trait is an improved nematode resistance trait. A trait can be inherited in a dominant or recessive manner, or in a partially dominant or incompletely dominant manner. A trait can be monogenic or polygenic, or can result from the interaction of one or more genes with the environment. A plant can be homozygous or heterozygous for a trait.

[0052] The terms "hybrid," "hybrid plant," and "hybrid progeny" refer to individuals produced from genetically distinct parents (eg, genetically heterozygous or near-heterozygous individuals).

[0053] The term "inbred" refers to a genetically homozygous or nearly homozygous population. Inbred lines are obtained, for example, through several cycles of brother / sister breeding or selfing or in dihaploid production.

[0054] The term "dizomelic haploid line" refers to a stable inbred line derived from another culture. Some pollen grains (haploids) grown in a particular medium and environment can develop embryos containing n chromosomes. These embryos are then "doubled" and contain 2n chromosomes. The progeny of these embryos are called "dizomelic haploids" and essentially no longer segregate (are stable).

[0055] The term "cultivar" or "variety" refers to a horticulturally derived variety that is distinct from a natural variety. In certain embodiments of the invention, the cultivar or variety is commercially available.

[0056] The term "rootstock" refers to a plant used as a recipient for a cutting. Typically, the rootstock plant and the cutting are of different genotypes. In an embodiment, a plant according to the invention is used as a rootstock plant.

[0057] The term "genetically fixed" refers to a genetic element that has been stably integrated into the genome of a plant that does not normally contain the genetic element. If genetically fixed, the genetic element can be easily and predictably transmitted to other plants by sexual mating.

[0058] A "plant cell" is the structural and physiological unit of a plant, including the protoplast and the cell wall. A plant cell can be in the form of an isolated single cell or a cultured cell, or can be part of a more highly organized unit, such as a plant tissue, a plant organ, or a whole plant.

[0059] "Plant cell culture" refers to cultures of plant units such as, for example, protoplasts, cell culture cells, cells in plant tissue, pollen, pollen tubes, embryo stocks, embryo sacs, zygotes and embryos at various stages of development.

[0060] A "plant organ" is a distinct, visually structured differentiated part of a plant, such as a root, stem, leaf, flower bud or embryo.

[0061] As used herein, "plant tissue" refers to a group of plant cells organized into a structural and functional unit. Any plant tissue in a plant or in culture is included. The term includes, but is not limited to, whole plants, plant organs, plant seeds, tissue cultures, and any group of plant cells organized into a structural and / or functional unit. The use of this term with or without any particular type of plant tissue listed above or encompassed by this definition is not intended to exclude any other type of plant tissue.

[0062] As used herein, the term "breeding" and grammatical variations thereof refer to any process of producing offspring individuals. Breeding can be sexual or asexual or any combination thereof. Exemplary non-limiting types of breeding include crossing, selfing, derivative production of doubled haploids, and combinations thereof.

[0063] As used herein, the phrase "established breeding population" refers to a collection of potential breeding partners that are generated by and / or used as parents in a breeding program, e.g., a commercial breeding program. Members of an established breeding population are typically well characterized genetically and / or phenotypically. For example, some phenotypic traits of interest may be evaluated, for example, under different environmental conditions, in multiple locations and / or at different times. Alternatively or in addition, one or more loci associated with the expression of the phenotypic trait may be identified, and one or more members of the breeding population may be genotyped for one or more loci and for one or more genetic markers associated with the one or more loci.

[0064] As used herein, the phrase "diploid individual" refers to an individual having two sets of chromosomes, typically one from each of its two parents. However, it is understood that in some embodiments, a diploid individual may inherit its "maternal" and "paternal" sets of chromosomes from the same single organism, for example, when the plant self-pollinates to generate the next generation of the plant.

[0065] "Homozygous" is understood within the scope of the present invention to refer to similar alleles at one or more corresponding loci in homologous chromosomes.

[0066] "Heterozygosity" is understood within the scope of the present invention to refer to different alleles at one or more corresponding loci in homologous chromosomes.

[0067] A "dominant" allele is understood within the scope of the present invention to refer to an allele which determines the phenotype when present in the heterozygous or homozygous state.

[0068] A "recessive" allele refers to an allele that determines a phenotype only when present in the homozygous state.

[0069] A "locus" is understood within the scope of the present invention to refer to a region on a chromosome that contains a gene or any other genetic element or factor that contributes to a trait.

[0070] As used herein, a "marker locus" refers to a region on a chromosome that contains a nucleotide or polynucleotide sequence present in the genome of an individual and that is associated with one or more loci of interest, which may include genes or any other genetic determinants or factors that contribute to a trait. A "marker locus" also refers to a region on a chromosome that contains a polynucleotide sequence that is complementary to a genomic sequence, such as the sequence of a nucleic acid used as a probe.

[0071] As used herein, the phrases "sexual mating" and "sexual reproduction" in relation to the subject matter of this disclosure refer to the production of offspring by the fusion of gametes (e.g., by fertilization, such as the production of seeds by pollination in a plant). "Sexual mating" or "cross-fertilization" refers, in some embodiments, to the fertilization of one individual by another individual (e.g., cross-pollination in a plant). The term "selfing" refers, in some embodiments, to the production of seeds by self-fertilization or self-pollination, i.e., the pollen and ovules are from the same plant.

[0072] As used herein, the phrase "genetic marker" refers to a feature of an individual's genome (e.g., a nucleotide or polynucleotide sequence present in an individual's genome) that is associated with one or more loci of interest. In some embodiments, a genetic marker is a locus that is polymorphic or occupied by a polymorphism in a population of interest, depending on the context. Genetic markers include, for example, single nucleotide polymorphisms (SNPs), indels (i.e., insertions / deletions), simple sequence repeats (SSRs), restriction fragment length polymorphisms (RFLPs), random amplified polymorphic DNA (RAPDs), truncated amplified polymorphic sequence (CAPS) markers, diversity array technology (DArT) markers, and amplified fragment length polymorphisms (AFLPs), among many other examples. Genetic markers can be used, for example, to identify the location of loci containing alleles on chromosomes that contribute to the variability of phenotypic traits. The phrase "genetic marker" can also refer to polynucleotide sequences that are complementary to genomic sequences, such as sequences of nucleic acids used as probes.

[0073] A "genetic marker" may be physically located at a chromosomal location within or outside the locus to which it is associated (i.e., intragenic or extragenic, respectively). In other words, genetic markers are typically used when the location on the chromosome of a gene or functional mutation corresponding to the locus of interest, e.g., within a regulatory element external to the gene, has not been identified and there is a non-zero recombination rate between the genetic marker and the locus of interest, although the subject matter of the present disclosure may also use genetic markers that are physically within the boundaries of the locus (e.g., within the genomic sequence corresponding to the gene, such as, but not limited to, a polymorphism within an intron or exon of the gene). In certain embodiments of the subject matter of the present disclosure, the one or more genetic markers include 1-10 markers, and in certain embodiments, the one or more genetic markers include more than 10 genetic markers.

[0074] As used herein, the term "genotype" refers to the genetic makeup of a cell or organism. An individual's "genotype for a set of genetic markers" includes the specific alleles for one or more genetic marker loci present in the individual's haplotype. As is known in the art, a genotype can be associated with a single locus or multiple loci, regardless of whether the loci are related or unrelated and / or linked or unlinked. In an embodiment, an individual's genotype is associated with one or more genes that are related in that one or more of the genes are involved in the expression of a phenotype of interest (e.g., a quantitative trait as defined herein). Thus, in an embodiment, the genotype includes a profile of one or more alleles present in the individual at one or more loci of a quantitative trait. In an embodiment, the genotype is expressed in terms of a haplotype (as defined herein below).

[0075] As used herein, the term "germ genetic resources" refers to the totality of the genotype of a population or other population (e.g., a species). The term "germ genetic resources" can also refer to plant material, e.g., a group of plants that serve as a repository of various alleles. The phrase "adapted germplasm" refers to plant material that has proven genetic superiority for a given environmental or geographical region, while the phrases "non-adapted germplasm," "original germplasm," and "foreign germplasm" refer to plant material that has unknown or unproven genetic value for a given environmental or geographical region, and thus the phrase "non-adapted germplasm," in some embodiments, refers to plant material that is not part of an established breeding population and has no known relationship to members of an established breeding population.

[0076] As used herein, the phrase "nucleic acid" refers to any physical chain of monomeric units that may correspond to a chain of nucleotides, including polymers of nucleotides (e.g., typical DNA, cDNA, or RNA polymers), modified oligonucleotides (e.g., oligonucleotides containing bases that are not typical of biological RNA or DNA, such as 2'-O-methylated oligonucleotides), and the like. In certain embodiments, a nucleic acid may be single-stranded, double-stranded, multi-stranded, or combinations thereof. Unless otherwise indicated, a particular nucleic acid sequence of the subject matter of this disclosure optionally includes or encodes a complementary sequence in addition to any sequence explicitly indicated.

[0077] As used herein, the term "plurality" refers to two or more. Thus, a "plurality of individuals" refers to at least two individuals. In some embodiments, the term plurality refers to more than half of the total. For example, in some embodiments, a "plurality of a population" refers to more than half of the members of the population.

[0078] As used herein, the term "progeny" refers to the offspring of a particular cross. Typically, progeny result from the breeding of two individuals, although some species (particularly some plants and hermaphroditic animals) can self-fertilize (i.e., the same plant serves as both male and female gamete donors). Progeny can be, for example, F1, F2, or any subsequent generations.

[0079] The term "recipient plant" is used herein to denote a plant that will receive DNA from a donor plant that contains a modified allele for improved resistance to a disease-causing pathogen.

[0080] "Donor plant" is understood within the scope of the present invention to mean a plant that brings about a modified allele associated with improved resistance to a pathogen that produces a lesion. As used herein, the phrase "qualitative trait" refers to a phenotypic trait that is controlled by one or several genes that exhibit a major phenotypic effect. Thus, qualitative traits are typically simply inherited.

[0081] "Marker-assisted selection" is understood within the scope of the present invention to refer to the use of genetic markers to detect, for example, one or more nucleic acids from a plant, which nucleic acids are associated with a desired trait to identify plants that have the gene for the desired (or undesirable) trait so that those plants can be used (or avoided) in selective breeding programs.

[0082] A "single nucleotide polymorphism (SNP)" is a variation in DNA sequence that occurs when a single base (A, T, C, or G) in a genome (or other shared sequence) differs between members of a biological species or between paired chromosomes of an individual. For example, two sequenced DNA fragments, AAGCCTA and AAGCTTA, from different individuals contain a single base difference. In this case, there are two alleles: C and T. The basic principles of SNP arrays are the same as DNA microarrays. They are a confluence of DNA hybridization, fluorescence microscopy, and DNA capture. The three components of an SNP array are an array containing nucleic acid sequences (i.e., amplified sequences or targets), one or more labeled allele-specific oligonucleotide probes, and a detection system that records and interprets the hybridization signal.

[0083] "PCR (polymerase chain reaction)" is understood within the scope of the present invention to refer to a method for producing relatively large amounts of specific regions or subsets of genomic DNA, thereby allowing various analyses based on those regions.

[0084] "PCR primer" is understood within the scope of the present invention to refer to a relatively short piece of single-stranded DNA used in the PCR amplification of a specific region of DNA.

[0085] "Phenotype" is understood within the scope of the present invention to refer to the distinguishing characteristics of genetically controlled traits.

[0086] As used herein, the phrase "phenotypic trait" refers to the appearance or other detectable characteristics of an individual that result from the interaction of its genome, proteome and / or metabolome with the environment.

[0087] "Polymorphism" is understood within the scope of the present invention to refer to the occurrence of two or more different forms of a gene, genetic marker or inherited trait or a population of gene products which can be obtained, for example, by alternative splicing, DNA methylation, etc.

[0088] "Selective breeding" is understood within the scope of the present invention to refer to a breeding program that uses plants that have or exhibit desirable traits as parents.

[0089] A "test" plant is understood within the scope of the present invention to refer to a plant that is used to genetically characterize a trait in a test plant. Typically, the test plant is crossed with a "test" plant and the segregation ratio of the trait in the progeny of the cross is scored.

[0090] As used herein, "probe" refers to a group of atoms or molecules that can recognize and bind to a specific target molecule or cellular structure, thus allowing the detection of the target molecule or structure. In particular, "probe" refers to a labeled DNA or RNA sequence that can be used to detect the presence of and quantify a complementary sequence by molecular hybridization.

[0091] As used herein, the term "hybridizing" refers to conventional hybridization conditions, preferably those where 5xSSPE, 1% SDS, 1xDenhardt's solution are used as solutions and / or the hybridization temperature is 35°C to 70°C, preferably 65°C. After hybridization, washing is preferably carried out first with 2xSSC, 1% SDS, followed by 0.2xSSC, at a temperature of 35°C to 75°C, in particular 45°C to 65°C, but in particular 59°C (for the definitions of SSPE, SSC and Denhardt's solution, see the citations in Sambrook et al.). Particularly preferred are high stringency hybridization conditions, e.g. as described in Sambrook et al. (supra). Particularly preferred stringent hybridization conditions exist, for example, when hybridization and washing are carried out at 65°C as indicated above. For example, non-stringent hybridization conditions are less preferred, with hybridization and washing performed at 45°C, and even less preferred at 35°C.

[0092] According to the present invention, the term "position corresponding to" position X, where X is any number found in the respective context of this application, not only includes the respective positions in the SEQ ID NOs described below, but also any sequence corresponding to a Pub17 allele or encoding a Pub17 protein, where after alignment with a reference SEQ ID NO, the respective positions may have a different but corresponding number to that indicated for the reference SEQ ID NO. Alignment of Pub17 allele or Pub17 protein sequences can be performed in a practical manner by applying various alignment tools, for example by applying the tools described below.

[0093] "Sequence identity". The term "identical" or "identity" in reference to two or more nucleic acid or protein sequences refers to two or more sequences or subsequences that are the same or have a certain percentage of the same amino acid residues or nucleotides when compared and aligned for maximum correspondence as measured using one of the following sequence comparison algorithms or by visual inspection. When the two sequences compared to each other are of different lengths, the sequence identity preferably relates to the percentage of nucleotide residues of the shorter sequence that are identical to the nucleotide residues of the longer sequence. As used herein, the percent identity / homology between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps and the length of each gap that need to be introduced for optimal alignment of the two sequences (i.e., % identity = number of identical positions / total number of positions x 100). Comparison of sequences and determination of the percent identity between two sequences can be performed using a mathematical algorithm as described later in this specification. For example, sequence identity can be conventionally determined using a computer program such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive Madison, WI 53711). Bestfit utilizes the locus homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2 (1981), 482-489, to find the segment with the highest sequence identity between two sequences. When using Bestfit or another sequence alignment program to determine whether a particular sequence has, for example, 95% identity with the reference sequence of the present invention, the parameters are preferably adjusted so that the percentage of identity is calculated over the entire length of the reference sequence and so that homology gaps of up to 5% of the total number of nucleotides in the reference sequence are allowed. When using Bestfit, the so-called optional parameters are preferably left at their preset ("initial") values.Deviations found in the comparison between a given sequence and the above sequences of the invention may be caused, for example, by additions, deletions, substitutions, insertions or recombinations. Such sequence comparisons may also be preferably carried out using the program "fasta20u66" (Version 2.0u66 by William R. Pearson and the University of Virginia, September 1998; W.R. Pearson (1990), Methods in Enzymology 183, 63-98, see also the appended examples and http: / / workbench.sdsc.edu / ). For this purpose, the "default" parameter settings may be used.

[0094] Another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions. The phrase "specifically hybridize" refers to the fact that when a particular nucleotide sequence is present in a complex mixture (e.g., whole cell) DNA or RNA, the molecule binds, duplexes, or hybridizes to only that sequence under stringent conditions. "Substantially bind" refers to the complementary hybridization between the probe nucleic acid and the target nucleic acid, and includes minor mismatches that can be accommodated by lowering the stringency of the hybridization medium to achieve the desired detection of the target nucleic acid sequence.

[0095] "Stringent hybridization conditions" and "stringent hybridization wash conditions" for nucleic acid hybridization experiments such as Southern and Northern hybridization are sequence-dependent and vary under different environmental parameters. Longer sequences hybridize specifically at higher temperatures. An extensive guide to nucleic acid hybridization can be found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes part I chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays" Elsevier, New York. In general, highly stringent hybridization and wash conditions are selected to be about 5°C lower than the thermal melting point for a particular sequence at a defined ionic strength and pH. Typically, under "stringent conditions", a probe hybridizes to its target subsequence but not to other sequences.

[0096] The "thermal melting point" is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Very stringent conditions are those that exceed the melting temperature (T m) is selected to be equal to 10 ... For example, an example of a low stringency wash for duplexes of more than 100 nucleotides is 4-6x SSC at 40°C for 15 minutes. For short probes (e.g., about 10-50 nucleotides), stringent conditions typically include a salt concentration of less than about 1.0 M Na ion at pH 7.0-8.3, typically about 0.01-1.0 M Na ion concentration (or other salt), and a temperature typically at least about 30°C. Stringent conditions may also be achieved by the addition of destabilizing agents such as formamide. In general, a signal-to-noise ratio of 2x (or more) than that observed for an unrelated probe in a particular hybridization assay indicates detection of a specific hybridization. Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the proteins they encode are substantially identical. This occurs, for example, when copies of nucleic acids are formed using the maximum codon degeneracy permitted by the genetic code.

[0097] As used herein, "homolog" refers to a protein that is a functional equivalent, i.e., has the same activity as a Pub17 protein having an amino acid sequence as defined herein, but may have a limited number of amino acid substitutions, deletions, insertions or additions within the amino acid sequence. Homologs may have lower sequence identity, e.g., at least 20%, at least 25%, at least 30%, at least 35% or at least 40% or more, with the Pub17 proteins identified herein, but are capable of performing the same function.

[0098] As used herein, "ortholog" refers to a protein that is a homolog, and therefore a functional equivalent, but is found in a different species, i.e., has the same activity as the Pub17 protein as defined herein, but is present in a different species of plant.

[0099] Tomato plant A "plant," as used herein, is any plant at any stage of development. Preferably, in most embodiments of the present invention, the plant is a tomato plant. Preferably, in most embodiments of the invention, the plant is any of the following tomato species: Solanum lycopersicum, Solanum habrochaites, Solanum pimpinellifolium, Solanum pennellii, Solanum arcanum, Solanum cheesmaniae, Solanum chilense, Solanum chmielewskii, Solanum corneliomulleri, Solanum galapagense, Solanum neorickii, or Solanum pervianum. Preferably, in most embodiments of the present invention, the plant is a Solanum lycopersicum plant.

[0100] Preferably the plant is, for example, alicante, adoration, azoychka, beefsteak, better boy, black krim, brandywine, campari, celebrity, cherokee, early girl, fourth of July, garden peach, gardeners delight, germa johnson, guilette F1, granadero, great white, green zebra, hanover, hillbilly, japanese black trifele, jersey boy, or any other variety of plant. boy, jubilee, juliet, lillians yellow, matt's wild cherry, micro-tom, moneymaker, monterosa, montserrat, mortgage lifter, mr. stripey, pantano romanesco, plum, raf, rebellion, currant, roma, rutgers, san marzano, santorini, supersweet, tomaccio, yellow pear The plant may be any variety or cultivar of Solanum lycopersicum such as 'pear', 'zebra', etc.Suitably the plant may be a cultivated species of Solanum lycopersicum plant.

[0101] However, in some embodiments, the plant may be any Solanaceae plant. Preferably, the plant may be selected from any Solanaceae plant, such as tomato, tobacco, pepper, potato, or eggplant. Preferably, the plant may be selected from any Solanaceae genus of plants, such as Lycianthes, Cestrum, Nolana, Physalis, Lycium, Solanum, Brunfelsia, and Nicotiana. Suitably, the plant may be selected from any Solanaceae species of plant, such as potato (Solanum tuberosum), Solanum lycopersicum, Capsicum annuum, Capsicum sp., Capsicum frutescens, Solanum melongena, Physalis peruviana, Physalis pruinosa, Physalis philadelphica, Nicotiana rustica, and Nicotiana tabacum.

[0102] Suitably, any reference to a tomato plant, part or material thereof, as used herein can be substituted with another Solanaceae plant, part or material thereof.

[0103] In one embodiment, the plant is a crop plant or an economically and / or agriculturally valuable plant, hi one embodiment, the plant is a solanaceous crop plant.

[0104] In some embodiments, the plant is a selfed, dihaploid, or hybrid plant.

[0105] Plant parts or materials The terms "plant" or "plant part" or "plant material" hereinafter refer to any plant part, organ or tissue obtainable from a tomato plant according to the invention, including, but not limited to, leaves, stems, roots, flowers or inflorescences, fruits, shoots, gametophytes, sporophytes, pollen, anthers, microspores, egg cells, zygotes, embryos, meristematic tissue sections, callus tissue, seeds, cuttings, cell or tissue cultures. Suitably, any reference herein to a "plant" also encompasses plant parts or materials.

[0106] Suitably, the plant part or material may be any plant part, organ or tissue obtainable from a cultivated tomato plant, preferably a cultivated tomato plant, preferably a cultivated Solanum lycopersicum plant of the present invention.

[0107] Preferably, the tomato plant part or material further exhibits improved resistance to lesion-forming pathogens compared to a reference tomato plant part or material. In some embodiments, this resistance may only be present when the part or material is grown into a tomato plant. Thus, preferably, the tomato plant part or material exhibits a reduced level, activity or expression of Pub17 protein compared to a reference tomato plant part or material. Preferably, the tomato plant part comprises a modified Pub17 allele, and preferably is capable of expressing the modified Pub17 allele.

[0108] Preferably, the term plant material may include propagation material obtainable from a tomato plant according to the invention. Suitable propagation material may be cuttings, roots, fruits, tubers, bulbs, rhizomes, meristems, etc. Preferably, the propagation material further exhibits an improved resistance to lesion-forming pathogens compared to a reference propagation material. Thus, preferably, the propagation material exhibits a reduced level, activity or expression of Pub17 protein compared to a reference propagation material. Preferably, the propagation material comprises a modified Pub17 allele and is preferably capable of expressing the modified Pub17 allele. Preferably, the propagation material may be propagated to a tomato plant, preferably a tomato plant having an improved resistance to lesion-forming pathogens compared to a reference tomato plant. Preferably, to a tomato plant having a reduced level, activity or expression of Pub17 protein compared to a reference tomato plant. Preferably, to a tomato plant comprising a modified Pub17 allele and capable of expressing the modified Pub17 allele. "Propagation" refers to the process of growing a plant from a plant part or material (e.g., a plant protoplast or explant). Such regeneration techniques rely on the manipulation of specific plant hormones in tissue culture propagation media. The choice of methodology for the propagation step is not critical. See, e.g., Ammirato et al., Handbook of Plant Cell Culture-Crop Species. Macmillan Publ. Co. (1984).

[0109] The invention also extends to fruit. In a further aspect of the invention there is provided a fruit produced by a tomato plant according to the invention.

[0110] Preferably, the fruit is a tomato fruit. Preferably, the fruit may be obtainable from a cultivated tomato plant, more preferably from a cultivated Solanum lycopersicum plant of the invention. Preferably, the tomato fruit further exhibits improved resistance to lesion-forming pathogens compared to a reference tomato fruit. Preferably, the tomato fruit exhibits a reduced level, activity or expression of Pub17 protein compared to a reference tomato fruit. Preferably, the tomato fruit comprises a modified Pub17 allele, preferably is capable of expressing the modified Pub17 allele.

[0111] The invention also extends to one or more seeds. In a further aspect of the invention there is provided a tomato seed produced by a tomato plant according to the invention.

[0112] "Plant seed" as used herein is a seed that will grow into a plant, preferably a tomato plant of the present invention. The term "seed" encompasses all types of seeds and plant propagation material, including but not limited to true seeds, seed pieces, underground stolons, corms, bulbs, fruits, tubers, grains, cuttings, cuttings, and the like.

[0113] Preferably, the seed is capable of producing a tomato plant that exhibits improved resistance to lesion-forming pathogens compared to a reference tomato plant. Preferably, the seed exhibits a reduction in Pub17 protein level, activity or expression compared to a reference tomato seed. Preferably, the seed comprises a modified Pub17 allele, and preferably can be grown into a tomato plant that expresses the modified Pub17 allele.

[0114] In one embodiment, the seed is a tomato seed that will yield a tomato plant according to the invention. Suitably, the tomato seed may be obtained from a cultivated tomato plant, more preferably a cultivated Solanum lycopersicum plant of the invention. Suitably, the tomato seed comprises a modified Pub17 allele and may suitably be grown into a tomato plant that expresses the modified Pub17 allele.

[0115] The seeds may be treated or untreated. For example, the seeds may be treated to improve germination, for example, by priming the seeds or by sterilization to protect against seed-borne pathogens. In another example, the seeds may be coated with any available coating agent to improve, for example, plantability, seed emergency, and protection against seed-borne pathogens. The seed coating may be any form of seed coating, including, but not limited to, pelleting, film coating, and encrustment.

[0116] Methods for reducing Pub17 protein level, activity or expression Suitably, the level, activity or expression of Pub17 protein may be reduced in tomato plants of the present invention by any means, but suitably it is not reduced by an essentially biological process.

[0117] Suitably, the term "reducing the level, activity or expression of Pub17 protein" may refer to the down-expression, suppression or temporal or spatial mis-expression of Pub17 polypeptide in a plant or plant material and / or the reduction of the biological effect or activity of Pub17 protein in a plant or plant material. This can be achieved by various standard techniques well known in the art. Suitably, the reduction of Pub17 protein levels in a plant may be a reduction in the amount of Pub17 protein. Suitably, the reduction of the amount of Pub17 protein localized in a cell of a plant, for example in a cell of leaf tissue, compared to the amount of Pub17 protein in the same tissue in a natural plant of the same species at the same stage when grown under the same conditions, without deliberate alteration of the expression level (i.e. an unmodified reference plant).

[0118] Preferably, the level, activity or expression of Pub17 protein is reduced by modification of the tomato plant. Preferably, by genetic modification of the tomato plant. Preferably, the genetic modification of the tomato plant may be a transient or stable modification. In one embodiment, the resulting tomato plant is stably modified.

[0119] Preferably, stable transformation refers to a polynucleotide that can become integrated into a plant host chromosome, thereby permanently and genetically modifying the host genetic material, and the transformed cell can continue to express the trait imparted by this genetic material even after several generations of cell division. Preferably, transient transformation, with respect to a plant cell, refers to a cell that contains heterologous DNA or RNA and is capable of expressing the trait imparted by the heterologous genetic material, even if that genetic material has not been fully integrated into the cell's DNA.

[0120] Advantageously, the genetic modification of tomato plants can be achieved by any means known in the art, such as by random mutagenesis, transformation, homologous recombination, or gene editing.Suitable random mutagenesis techniques can be chemical, gamma-ray, UV, or X-ray mutagenesis.Suitable gene editing techniques can be, for example, by CRISPR-Cas system (particularly CRISPR-Cas9 or CRISPR-Cas13, hereafter any reference to Cas9 can also refer to other Cas proteins such as Cas13), Zn finger nuclease, or TALEN.

[0121] Alternatively, the level, activity or expression of Pub17 protein is reduced by inhibition, preferably by inhibiting expression of the Pub17 gene and thereby inhibiting expression of the Pub17 protein. Preferably, inhibition of Pub17 gene expression can be achieved by any means known in the art, for example by using RNAi, miRNA, siRNA, a nuclease-deficient CRISPR / Cas system, i.e. CRISPRi, modified TALEs, or Zn fingers.

[0122] Suitably, the tomato plant or plant material obtained may be transgenic or non-transgenic, hi one embodiment, the tomato plant or plant material is non-transgenic.

[0123] The plants, parts or plant material of the present invention may be transgenic in the sense that they have been produced by a process which includes some degree of gene transfer events; i.e., genetic material from one species has been isolated, introduced and incorporated into the genetic material of a recipient plant using methods of gene transfer well known to those skilled in the art. This approach may also include synthetic nucleic acid sequences which have been produced by design.

[0124] Alternatively, the plants, or plant material of the invention may be non-transgenic in the sense that the genetic material of the plant, parts or cells has been modified by a process including, for example, Crispr-Cas based gene editing, whereby modification of the identity of individual nucleotide bases or bases is achieved within the genome. Again, such methods of gene editing of plant genetic material and the regeneration of whole plants from a starting point of modified plant protoplasts, plant cells or plant tissues are well known to those skilled in the art.

[0125] In one embodiment, the modification is used to reduce the level, expression or activity of Pub17 protein in tomato plants. Preferably, the modification is performed by chemical mutagenesis or CRISPR / Cas9-mediated gene editing. Preferably, in such an embodiment, the Pub17 gene sequence is modified. Preferably, the Pub17 gene sequence comprises one or more modifications as a result of the method of modification.

[0126] Preferably, chemical mutagenesis may be performed by exposing tomato plants to a chemical mutagen such as ethyl methanesulfonate (EMS), ethyl nitrosourea (ENU), NMU (nitrosylmethylurea), methyl methanesulfonate (MMS), ethidium bromide, psoralen, acridine orange, or sodium azide. Preferably, the tomato plants are exposed to EMS. Preferably, seeds of the tomato plants are exposed to EMS and then tomato plants are grown from the seeds. Preferably, the seeds may be pre-soaked in distilled water. Preferably, the seeds may be pre-soaked for 2 to 15 hours, preferably about 8 hours. Preferably, the seeds are treated with a 0.5% to 10% EMS dilution, preferably a 1% to 5%, preferably a 1% EMS dilution. Preferably, the seeds are treated for 6 to 48 hours, preferably 12 to 245 hours, preferably about 12 hours.

[0127] Advantageously, CRISPR / Cas9 gene editing is carried out by introducing the components of CRISPR / Cas9 system into tomato plants. Advantageously, CRISPR-Cas system allows targeted cleavage of genomic DNA, which is induced by Cas9 endonuclease complexed with guide RNA (gRNA) that binds complementary to the target DNA sequence. Advantageously, the components of CRISPR / Cas9 system are Cas9 endonuclease protein and a suitable guide RNA that is complementary to the target sequence in the genome of the plant.

[0128] As used herein, the term "guide RNA" or "gRNA" generally refers to an RNA molecule (or collectively a group of RNA molecules) that can bind to a CRISPR system effector, such as a Cas or Cpfl protein, and contribute to targeting the Cas or Cpfl protein to a specific location within a target polynucleotide (e.g., DNA). A guide RNA can be a modified single RNA molecule (sgRNA), for example, where the sgRNA comprises a crRNA segment and optionally a tracrRNA segment. A guide RNA can also be a dual guide system, where the crRNA and tracrRNA molecules are physically distinct molecules that interact to form a duplex for the recruitment of a CRISPR system effector, such as Cas9, and for targeting the protein to a target polynucleotide.

[0129] As used herein, the term "crRNA" or "crRNA segment" refers to an RNA molecule or a portion of an RNA molecule, including a polynucleotide-targeting guide sequence, a stem sequence involved in protein binding, and, optionally, a 3'-overhang sequence. A polynucleotide-targeting guide sequence is a nucleic acid sequence that is complementary to a sequence in a target DNA (e.g., a Pub17 allele). This polynucleotide-targeting guide sequence is also referred to as a "protospacer." In other words, the polynucleotide-targeting guide sequence of a crRNA molecule interacts with the target DNA in a sequence-specific manner through hybridization (i.e., base pairing). As such, the nucleotide sequence of the polynucleotide-targeting guide sequence of a crRNA molecule can vary and determines the location within the target DNA where the guide RNA and the target DNA will interact.

[0130] The guide sequence targeting the polynucleotide of the crRNA molecule can be modified (e.g., by genetic engineering) to hybridize to any desired sequence within the target DNA. The guide sequence targeting the polynucleotide of the crRNA molecule of the present invention can have a length of about 12 nucleotides to about 100 nucleotides. For example, the guide sequence targeting the polynucleotide of the crRNA can have a length of about 12 nucleotides (nt) to about 80 nt, about 12 nt to about 50 nt, about 12 nt to about 40 nt, about 12 nt to about 30 nt, about 12 nt to about 25 nt, about 12 nt to about 20 nt, or about 12 nt to about 19 nt. For example, the guide sequence targeting the polynucleotide of the crRNA can have a length of about 17 nt to about 27 nt.

[0131] As used herein, the term "tracrRNA" or "tracrRNA segment" refers to an RNA molecule or a portion thereof that includes a protein-binding segment (e.g., the protein-binding segment can interact with a CRISPR-associated protein, such as Cas9).

[0132] Preferably, the CRISPR / Cas9 complex can be introduced into the tomato plant as one or more polynucleotides and / or proteins. Preferably, the CRISPR / Cas9 complex can be introduced into the tomato plant as one or more polynucleotides encoding the components of the complex. Preferably, the one or more polynucleotides can be included in one or more vectors. Preferably, the CRISPR / Cas9 complex can be introduced into the tomato plant by any known means of transformation. Those skilled in the art will understand that the technology of CRISPR / Cas9 gene editing in plants is well known, see, for example, Wada, N., et al., (2020) "Precision genome editing in plants: state-of-the-art in CRISPR / Cas9-based genome engineering" BMC Plant Biology volume 20, Article number: 234.

[0133] "Transformation" refers to the process of introducing an exogenous nucleic acid molecule (e.g., a recombinant polynucleotide) into a cell or protoplast, whereby the exogenous nucleic acid molecule is integrated into the host cell genome or an organelle genome (e.g., chloroplast or mitochondrion) or is capable of autonomous replication. "Transformed" or "transgenic" refers to a cell, tissue, organ, or organism into which a foreign nucleic acid, e.g., an expression vector or a recombinant nucleic acid molecule, has been introduced. Preferably, the means of transformation is gene transfer via a disarmed Ti plasmid vector carried by Agrobacterium tumefaciens, or for example, using Agrobacterium sp. mediated transformation, vacuum infiltration, floral dip, spraying, particle or microprojectile gun fire, protoplast transformation, electroporation, microinjection, electrophoresis, the pollen tube pathway, silicon carbide or liposome mediated transformation, root uptake, direct injection into the xylem or phloem, or other forms of direct DNA uptake.

[0134] Advantageously, the alteration of the sequence of the guide RNA allows the Cas9 endonuclease to be programmed to cleave DNA at the site complementary to the guide RNA. Guide RNAs suitable for use in the present invention can be selected from guide RNAs that are complementary to or target a sequence in the Pub17 gene. Advantageously, the guide RNA can be complementary to or target a sequence in the UND domain, U-box domain, or ARM repeat domain of the Pub17 gene, preferably of SEQ ID NO: 1 or its orthologue or homologue. Suitable guide RNAs can be designed to target a specific sequence in the Pub17 gene using widely available bioinformatics tools. Advantageously, the guide RNA is a single guide RNA. In one embodiment, the guide RNA is selected from one or more of the following sequences: sgRNA1 of SEQ ID NO: 17, sgRNA2 of SEQ ID NO: 18, sgRNA3 of SEQ ID NO: 19, and sgRNA4 of SEQ ID NO: 20. Advantageously, in some embodiments, two or more guide RNAs can be used in combination to guide the CRISPR / Cas9 complex to cleave the Pub17 gene at multiple locations. Advantageously, in one embodiment of the invention, all four guide RNAs of SEQ ID NOs: 17-20 are used.

[0135] Preferably, the method comprises modifying a tomato plant, preferably introducing one or more modifications into a Pub17 allele of the tomato plant. Thus, preferably, the tomato plant comprises a modified Pub17 allele having at least 70% identity to SEQ ID NO:1 (wild type allele), wherein the mutation results in a reduced level, activity or expression of Pub17 protein compared to a reference tomato plant. Preferably, the modified Pub17 allele comprises a specific mutation, preferably as defined hereinafter in connection with the modified Pub17 allele.

[0136] In another embodiment, suppression is used to reduce the level, expression or activity of Pub17 protein in tomato plants. Preferably, suppression is performed by RNA interference, in particular known as RNAi. Preferably, in such an embodiment, the Pub17 gene sequence is not modified. Preferably, in such an embodiment, expression of the Pub17 gene sequence is inhibited or suppressed. Preferably, in such an embodiment, expression of the Pub17 gene sequence is silenced.

[0137] Advantageously, RNAi suppression is carried out by introducing one or more polynucleotide sequences encoding RNAi agents that are complementary to the target DNA sequence into tomato plants. Two types of small RNA molecules are central to RNA interference: microRNA (miRNA) and small interfering RNA (siRNA). These small RNAs can induce enzyme complexes to degrade messenger RNA (mRNA) molecules, thus reducing their activity by blocking translation through post-transcriptional gene silencing. Furthermore, transcription can be inhibited through the pre-transcriptional silencing mechanism of RNA interference, through which enzyme complexes catalyze DNA methylation at genomic locations that are complementary to the complexed siRNA or miRNA.

[0138] Thus, in some embodiments of the invention, inhibitory RNAs, such as siRNAs, miRNAs or other RNAis, are used that serve to inhibit the expression of the Pub17 protein. The inhibitory RNAs can be synthesized and delivered to the plant or expressed in the plant from a suitable expression construct.

[0139] RNAi and its implementation methods are well known in the art. RNAi agents can be chemically or enzymatically synthesized outside the cell and then delivered to the cell (see, for example, Fire, et al., Nature, 391:806-11 (1998); Tuschl, et al., Genes and Dev., 13:3191-97 (1999); and Elbashir, et al., Nature, 411:494-498 (2001)); or can be expressed in vivo by a suitable vector in the cell (see, for example, U.S. Patent No. 6,573,099).

[0140] Preferably, the RNAi agent is a miRNA or siRNA. Preferably, the RNAi agent comprises a polynucleotide sequence that is complementary to a target sequence in the Pub17 gene. Suitable means for transforming tomato plants with such a polynucleotide sequence, or a vector comprising said polynucleotide sequence, are described above.

[0141] A suitable RNAi agent sequence can be selected from RNAi agent sequences that are complementary to or target a sequence in the UND domain or U-Box domain of the Pub17 gene, preferably of SEQ ID NO: 1 or its orthologue or homologue. In one embodiment, the RNAi agent sequence is selected from any of the following sequences: RNAi3 of SEQ ID NO: 11, and RNAi7 of SEQ ID NO: 12. Preferably, in some embodiments, two or more RNAi agents can be used in combination. Preferably, in one embodiment of the present invention, both RNAi agents of SEQ ID NO: 11 and SEQ ID NO: 12 are used.

[0142] Modified Pub17 alleles and Pub17 protein In some embodiments, the tomato plant comprises a modified Pub17 allele that reduces the level, expression or activity of a corresponding Pub17 protein. Preferably, the modified Pub17 allele is not the result of an essentially biological process. Preferably, the modified Pub17 allele is artificially created. In some embodiments, the tomato plant, or any plant part thereof, seed, or product therefrom, according to the present invention is not obtained exclusively by an essentially biological process. Preferably, the modified Pub17 allele causes increased resistance to lesion-forming pathogens.

[0143] In one embodiment, the tomato plant comprises two copies of the modified Pub17 allele and is therefore homozygous for the modified Pub17 allele.

[0144] Suitably, the modified Pub17 nucleic acid sequence comprises at least 70% identity to SEQ ID NO:1 (wild type allele), or an orthologue or homologue thereof, and said nucleic acid sequence comprises a mutation that results in a reduced level, activity or expression of Pub17 protein. Suitably, the modified Pub17 nucleic acid sequence is a modified Pub17 allele.

[0145] Suitably, the modified Pub17 nucleic acid sequence comprises at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO:1 (wild type allele), or an orthologue or homologue thereof. Suitably, at any level of identity, the sequence further comprises a mutation which results in a reduced level, activity or expression of Pub17 protein. Suitably, the modified Pub17 nucleic acid sequence is a modified Pub17 allele.

[0146] Suitably, the modified Pub17 nucleic acid sequence may comprise one, two or more mutations. Suitably, each mutation results in a reduction in the level, activity or expression of the Pub17 protein. Suitably, the modified Pub17 nucleic acid sequence is a modified Pub17 allele.

[0147] Preferably, the modified Pub17 nucleic acid sequence comprises a mutation in the second half of the nucleic acid sequence according to SEQ ID NO: 1 or in the second half of the nucleic acid sequence of its orthologue or homologue. Preferably, the modified Pub17 nucleic acid sequence comprises a mutation in the 3' region of the nucleic acid sequence according to SEQ ID NO: 1 or in the 3' region of the nucleic acid sequence of its orthologue or homologue. Preferably, the 3' region of the nucleic acid sequence is considered to be the half of the nucleic acid sequence closest to the 3' end. Preferably, the 3' region can be the second 50%, second 40%, second 30%, second 20%, second 10% or second 5% of the nucleic acid sequence when read in the 5' to 3' direction.

[0148] Suitably, the modified Pub17 nucleic acid sequence comprises a mutation in the ARM region of SEQ ID NO:1 (wild type allele), or a corresponding region thereof in its orthologue or homologue. Suitably, the ARM region is a region of the nucleic acid sequence encoding one or more ARM (armadillo) repeats. Suitably, in the context of a Pub17 nucleic acid sequence, such as in SEQ ID NO:1, the ARM region is a region encoding four ARM (armadillo) repeats. Suitably, the modified Pub17 nucleic acid sequence comprises a mutation in one or more of the regions encoding the first, second, third and / or fourth ARM repeats of SEQ ID NO:1 (wild type allele), or a corresponding region thereof in its orthologue or homologue.

[0149] Preferably, the mutation is a SNP. Preferably, the SNP is an A to T SNP. Preferably, the mutation is present at nucleotide position 1477 of SEQ ID NO:1 (wild type allele) or a corresponding position thereto, for example in an orthologue or homologue thereof. Thus, preferably, the modified Pub17 nucleic acid sequence comprises an A to T SNP at position 1477 of SEQ ID NO:1 (wild type allele) or a corresponding position thereto. Preferably, the modified Pub17 nucleic acid sequence comprises a mutation in the region encoding the second ARM repeat. Preferably, the modified Pub17 nucleic acid sequence comprises a SNP in the region encoding the second ARM repeat. Preferably, the modified Pub17 nucleic acid sequence comprises an A to T SNP in the region encoding the second ARM repeat. Preferably, the modified Pub17 nucleic acid sequence is a modified Pub17 allele.

[0150] Thus, preferably the modified Pub17 nucleic acid sequence comprises at least 70% identity to SEQ ID NO:1 (wild type allele), or an orthologue or homologue thereof, wherein the nucleic acid sequence comprises an A to T SNP at, or a position corresponding to, position 1477 of SEQ ID NO:1 (wild type allele), resulting in reduced levels, activity or expression of Pub17 protein. Preferably the modified Pub17 nucleic acid sequence is a modified Pub17 allele.

[0151] In one embodiment, the modified Pub17 allele comprises SEQ ID NO:2 (modified allele).In one embodiment, the modified Pub17 allele consists of SEQ ID NO:2 (modified allele).

[0152] A further aspect of the invention relates to an isolated nucleic acid sequence according to SEQ ID NO: 2 (modified allele), as well as vectors, expression cassettes and host cells comprising said sequence.

[0153] Alternatively, in some embodiments, the mutation is a deletion, preferably a deletion of a portion of the ARM region. Thus, preferably the modified Pub17 nucleic acid sequence comprises a deletion within the ARM region, preferably a deletion of one or more of the regions encoding the first, second, third and / or fourth ARM repeats of SEQ ID NO:1 (wild type allele), or corresponding regions in its orthologues or homologues. In one embodiment, the modified Pub17 nucleic acid sequence comprises a deletion of the regions encoding the first, second and third ARM repeats of SEQ ID NO:1 (wild type allele), or corresponding regions in its orthologues or homologues.

[0154] Preferably, the Pub17 protein is encoded by a Pub17 nucleic acid sequence. Therefore, preferably, the Pub17 protein is also modified. Preferably, the Pub17 protein modification is caused by a modification to the Pub17 nucleic acid sequence of a Pub17 allele as described above.

[0155] Preferably, the Pub17 protein is truncated. Preferably, the truncation is caused by a premature stop codon in the Pub17 nucleic acid sequence. Preferably, the premature stop codon is caused by a mutation in the Pub17 nucleic acid sequence, preferably by a SNP mutation in the Pub17 nucleic acid sequence. Preferably, the mutation causing the premature stop codon is present in the 3' region of the Pub17 nucleic acid sequence as described above. Preferably, the mutation causing the premature stop codon is present in the last 50%, last 40%, last 30%, last 20%, last 10% or last 5% of the 3' end of the Pub17 nucleic acid sequence. Preferably, the mutation causing the premature stop codon is present in the ARM region, specifically in the region encoding the second ARM repeat.

[0156] Therefore, preferably, the modified Pub17 protein is truncated at the C-terminus. Preferably, the Pub17 protein is not modified in the UND domain or in the U-box domain. Therefore, preferably, the modified Pub17 protein is truncated at the C-terminus, at most in the ARM region, preferably at most in the fourth, third, second or first ARM repeat. Preferably, the ARM region of the PUB17 protein is a region comprising one or more ARM (armadillo) repeats. Preferably, the ARM region of the PUB17 protein is a region comprising four ARM (armadillo) repeats. Preferably, in relation to the Pub17 protein sequence of SEQ ID NO: 3, the ARM region is present between amino acids 429 and 682, or in the corresponding amino acids in its orthologues or homologues. Preferably, the modified Pub17 protein is truncated at the C-terminus, at most in the second ARM repeat or at most in the first ARM repeat. Therefore, preferably the modified Pub17 protein does not comprise a complete fourth, third or second ARM repeat. Thus, preferably the modified Pub17 protein comprises only a complete first ARM repeat.

[0157] In one embodiment, the Pub17 protein is truncated at most at position R493 of SEQ ID NO: 3 (wild type protein) or a corresponding position thereto, for example in an orthologue or homologue thereof.

[0158] Alternatively, as described above, the Pub17 protein may comprise a deletion. Suitably, the Pub17 protein may comprise a deletion of one or more of the first, second, third or fourth ARM repeats. In one embodiment, the Pub17 protein may comprise a deletion of the first, second and third ARM repeats. Thus, in one embodiment, the Pub17 protein may only comprise the fourth ARM repeat.

[0159] Suitably, the Pub17 protein comprises an amino acid sequence according to a portion of SEQ ID NO: 3 (wild-type protein) or an orthologue or homologue thereof. Suitably, the Pub17 protein comprises an amino acid sequence according to at least 50%, 60%, 70%, 80%, or 90% of the full length of SEQ ID NO: 3 (wild-type protein) or an orthologue or homologue thereof. Suitably, the Pub17 protein does not consist of SEQ ID NO: 3 or an orthologue or homologue thereof. Suitably, the Pub17 protein comprises an amino acid sequence according to about 70%, more particularly 72%, of the full length of SEQ ID NO: 3 (wild-type) or an orthologue or homologue thereof.

[0160] Preferably, the modified Pub17 protein consists of the UND domain, the U-box domain and the first ARM repeat. Preferably, the modified Pub17 protein consists of amino acids 1 to 493 of SEQ ID NO: 3 (wild-type protein).

[0161] Preferably, the modified Pub17 protein consists of an amino acid sequence according to SEQ ID NO: 4 (modified protein) or a portion thereof, which has at least 70% identity thereto. Preferably, the modified Pub17 protein consists of an amino acid sequence according to SEQ ID NO: 4 (modified protein) or a portion thereof, which has at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity thereto.

[0162] Suitably, the modified Pub17 protein consists of an amino acid sequence according to SEQ ID NO: 4 (modified protein) or a portion thereof.

[0163] Suitably, the portion of SEQ ID NO:4 may be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the entire length of SEQ ID NO:4 (the modified protein).

[0164] Suitably, the modified Pub17 protein may comprise one, two or more further mutations, suitably each mutation resulting in a reduction in the level, activity or expression of the Pub17 protein.

[0165] Further aspects of the present invention relate to an isolated polypeptide sequence according to SEQ ID NO: 4 (modified protein), or a portion thereof, and to a host cell comprising said polypeptide.

[0166] In a further aspect of the present invention there is provided a plant or plant part or seed comprising a modified Pub17 protein as defined herein.

[0167] Lesion-forming pathogens Suitably, the lesion-forming pathogen may be any pathogen that forms one or more lesions on the tissue of the tomato plant, suitably on the stem, leaves and / or fruit of the tomato plant. Suitably, the lesions may be localized necrotic or chlorotic areas of the affected tissue.

[0168] Suitably the lesion forming pathogen may be a biotrophic, hemibiotrophic or necrotrophic pathogen, hi one embodiment the lesion forming pathogen is a necrotrophic pathogen.

[0169] Preferably, the pathogen that forms the lesion may be a bacterium, a fungus, a virus, a protozoan, or an archaea. Preferably, the pathogen that forms the lesion is a fungus or a virus or an oomycete, or any combination thereof.

[0170] Preferably, the lesion-forming pathogen is an oomycete. Preferably, the lesion-forming oomycete may be selected from Phytophthora infestans, Hyaloperonospora arabidopsidis, Phytophthora ramorum, Phytophthora sojae, Phytophthora capsici, Plasmopara viticola, Phytophthora cinnamomi, Pythium ultimum, Albugo Candida, and Phytophthora parasitica.

[0171] Preferably, the lesion forming pathogen is a virus. Suitable lesion forming viruses may be selected from one or more of the following: Tomato mosaic virus (ToMV), Tobacco mosaic virus (TMV), Tomato spotted wilt virus (TSWV), Pepino mosaic virus (PepMV), Cucumber mosaic virus (CMV), Potato Virus Y (PVY), double streak TMV+CMV, Tobacco Etch virus (TEV), Tomato ringspot virus (TRSV), Tomato Aspermy (TAV), Tomato yellow leaf curl virus (TYLCV), and Tomato brown rugose fruit virus (ToBRFV).

[0172] Preferably, the lesion forming pathogen is a fungus. Suitable lesion forming fungi may be selected from any of the following species: Cochliobolus heterostrophus, Cochliobolus carbonum, Cochliobolus victoriae, Alternaria alternata, Alternaria solani, Alternaria brassicola, Periconia circinata, Pyrenophora tritici-repentis, Bipolaris sacchari, Phyllosticta maydis, Stagonospora nodorum, Stemphylium vesicarium, and the like. vesicarium, Botrytis fabae, Botrytis elliptica, Botrytis cinerea, Sclerotinia sclerotiorum, Mollinia fructicola, Fusarium graminearum, Septoria tritici, Cercospora zeae-maydis, Exserohilum turcicum, Leptosphaeria maculans, Ascochyta rabiei, Diaporthe toxica toxica, Phoma medicaginis, Leptosphaerulina trifoliitrifoli, Pseudopeziza medicaginis, Stemphyllium botryosum, Stagonospora metiloti, Pleiochaeta setosa, Fusarium oxysporum, Rhizoctonia solani, and Pythium spp.

[0173] Preferably, the lesion-forming pathogen is a pathogen affecting tomato plants. Preferably, in that case, the tomato plant is the host. Therefore, preferably, the lesion-forming pathogen is a tomato pathogen, preferably a necrotrophic tomato pathogen, preferably a necrotrophic fungal tomato pathogen or a necrotrophic viral tomato pathogen. Preferred necrotrophic fungi affecting tomato plants may be selected from Alternaria alternata, Alternaria solani, Botrytis cinerea, Sclerotinia sclerotiorum, Stemphyllium botryosum, Fusarium oxysporum, and Pythium spp. Suitable necrotrophic viruses that affect tomato plants may be selected from Tomato yellow leaf curl virus (TYLCV), and Tomato brown rugose fruit virus (ToBRFV).

[0174] Preferably, the pathogen that forms the lesions belongs to the genus Botrytis or Alternaria. Preferably, the pathogen that forms the lesions may therefore be selected from the species Alternaria alternata, Alternaria solani, Alternaria brassicola, Botrytis fabae, Botrytis elliptica, and Botrytis cinerea.

[0175] Alternatively, the lesion-forming pathogen may be a hemibiotrophic tomato pathogen, preferably a hemibiotrophic oomycete tomato pathogen. Suitable hemibiotrophic oomycetes affecting tomato plants may be Phytophthora infestans, Phytophthora capsici or Phytophthora parasitica.

[0176] In one embodiment, the pathogen that forms the lesions is Botrytis cinerea or Alternaria solani. In one embodiment, the pathogen that forms the lesions is Tomato brown rugose fruit virus (ToBRFV). In one embodiment, the pathogen that forms the lesions is Phytophthora infestans.

[0177] Preferably, the lesion forming pathogen causes a disease in the plant. Suitable diseases may be selected from bright disease, botrytis blight, gray mold, white mold, early blight, late blight, leaf blight, powdery mildew, rot, spot disease, fruit rot, brown spot disease, black spot disease, yellow brown spot disease, gray spot disease, head blight disease, ear rot, lesions, stem canker, stem blight, black stem disease, crown rot, wilt disease, root rot, and seedling wilt disease.

[0178] Preferably, the pathogen that forms the lesion causes a disease that is preferably a necrotic disease in which cell death occurs. Preferably, the pathogen that forms the lesion causes a disease selected from blight, such as Botrytis blight, early blight, or late blight, mould, such as Botrytis cinerea, and rot. Thus, preferably, the plant of the present invention has increased resistance or reduced susceptibility to necrotic disease. Preferably, the plant of the present invention has increased resistance or reduced susceptibility to blight, such as Botrytis blight, early blight, or late blight, mould, such as Botrytis cinerea, or rot. In one embodiment, the plant of the present invention has increased resistance or reduced susceptibility to blight, preferably Botrytis blight.

[0179] In one embodiment, the tomato plant of the present invention has increased resistance to blight caused by a pathogen forming a lesion. In one embodiment, the tomato plant of the present invention has increased resistance to blight caused by a fungal or oomycete or viral pathogen forming a lesion. In one embodiment, the tomato plant of the present invention has increased resistance to blight caused by a necrotrophic or hemibiotrophic pathogen. In one embodiment, the tomato plant of the present invention has increased resistance to blight caused by a necrotrophic or hemibiotrophic fungal or oomycete pathogen. In one embodiment, the tomato plant of the present invention has increased resistance to blight caused by a Botrytis or Alternaria pathogen. In one embodiment, the tomato plant of the present invention has increased resistance to blight caused by Botrytis cinerea or Alternaria solani, preferably caused by Botrytis cinerea. In one embodiment, the tomato plants of the present invention have increased resistance to blight caused by Phytophthora infestans. In one embodiment, the tomato plants of the present invention have increased resistance to blight caused by Tomato brown rugose fruit virus (ToBRFV).

[0180] Advantageously, the tomato plants of the present invention may have increased resistance to two or more lesion-forming pathogens and thereby may have increased resistance to two or more diseases. Advantageously, the tomato plants of the present invention may have increased resistance to a combination of the lesion-forming pathogens described herein, or preferably to any combination of the diseases described herein that may be caused by the lesion-forming pathogens.

[0181] Preferably, the tomato plant of the present invention may have increased resistance to any combination of pathogens forming fungal lesions, pathogens forming viral lesions, and / or pathogens forming oomycete lesions. Preferably, the tomato plant of the present invention may have increased resistance to any combination of the pathogens listed above. Preferably, the tomato plant of the present invention may have increased resistance to any combination of Botrytis cinerea, Alternaria solani, Tomato brown rugose fruit virus (ToBRFV), and / or Phytophthora infestans.

[0182] Increased resistance Preferably, the tomato plant of the invention has increased resistance relative to a reference tomato plant, preferably increased resistance relative to a lesion-forming pathogen.

[0183] A suitable reference tomato plant is a control plant. Preferably, such a reference tomato plant comprises the same genetic background as the tomato plant of the invention, but does not comprise a reduction in the level, expression or activity of Pub17 protein. Preferably, the reference tomato plant may be a wild-type plant. Preferably, the reference tomato plant may be a tomato plant belonging to the same plant variety as the plant of the invention, and does not comprise a reduction in the level, expression or activity of Pub17 protein. The term "plant variety" is understood herein according to the definition of UPOV. Preferably, the reference tomato plant has not been modified to reduce the level, expression or activity of Pub17 protein. Preferably, the reference tomato plant does not contain a modified Pub17 allele. Preferably, the reference tomato plant contains a wild-type Pub17 allele. Preferably, the reference tomato plant is grown for the same time and under the same conditions as the tomato plant of the invention. Suitably, the reference tomato plant may be a near-isogenic line, an inbred line or a hybrid, provided that it has the same genetic background as the tomato plant of the invention, except that the reference tomato plant has not been modified to reduce the level, expression or activity of Pub17 protein and suitably does not contain a modified Pub17 allele of the invention.

[0184] For example, a reference tomato plant, in the context of the present invention, may comprise the tomato reference genome HEINZ or the Moneymaker tomato reference genome (https: / / www.ebi.ac.uk / ena / browser / view / SAMEA2340764).

[0185] Advantageously, the tomato plants of the present invention have a statistically significant increase in resistance to one or more lesion-forming pathogens compared to a reference tomato plant.

[0186] Preferably, resistance to lesion-forming pathogens can be measured by a significant reduction in the number of lesions per tomato plant or plant material. Preferably, this can be measured, for example, using the Mann-Whitney test (α=1, 2.5 or 5%) or the Student's test (P<0.05). Preferably, the plants of the invention have at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80% fewer lesions than the reference tomato plant. Preferably, the tomato plants of the invention have 25-50% fewer lesions than the reference tomato plant.

[0187] Preferably, resistance to lesion-forming pathogens can be measured by a significant reduction in the diameter of the lesions on the tomato plant or plant material, preferably a reduction in the average diameter of the lesions on the tomato plant. Preferably, this can be measured, for example, using a Mann-Whitney test (α=1, 2.5 or 5%) or a Student's test (P<0.05). Preferably, the tomato plants of the invention have lesions that are at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80% smaller than the lesions on the reference tomato plant, preferably as measured by the average diameter of the lesions on the tomato plant. Preferably, the plants of the invention have lesions that are 20-30% smaller than the lesions on the reference tomato plant, preferably as measured by the average diameter of the lesions on the tomato plant.

[0188] Preferably, such a measure of resistance is calculated after a step of exposing the tomato plant or part thereof to the lesion-forming pathogen for a suitable period of time. The suitable period of time is a period of time sufficient to allow the lesion-forming pathogen to infect the tomato plant or part thereof and cause the appearance of lesions. The suitable period of time may be 1 to 28 days, preferably 1 to 14 days, preferably 1 to 7 days, after exposure of the tomato plant or part thereof to the lesion-forming pathogen.

[0189] Screening Methods Aspects of the invention further relate to methods of identifying or screening for tomato plants having increased resistance to one or more lesion-forming pathogens.

[0190] Preferably, the method relates to identifying tomato plants within the population that have the desired trait of increased resistance to one or more lesion-forming pathogens. Preferably, the population of plants may be a mutant or wild population of tomato plants. Preferably, the mutant population of tomato plants may be generated by mutagenesis, as described elsewhere herein. Preferably, by chemical mutagenesis, preferably by the use of a chemical mutagen such as EMS. Thus, preferably, the method may comprise an initial step of obtaining or generating a mutant population of tomato plants, preferably by EMS mutagenesis.

[0191] Preferably, the tomato plant may be directly identified as having resistance to the lesion-forming pathogen, alternatively or additionally, the tomato plant may be indirectly identified by having a reduced level, expression or activity of Pub17 protein.

[0192] Preferably, the identification of resistance to lesion-forming pathogens in tomato plants can be determined by inoculation or exposure assays, where preferably tomato plants are exposed to a lesion-forming pathogen and the response is evaluated in comparison to a reference tomato plant. The increased resistance to lesion-forming pathogens can be determined by assays such as, for example, a detached leaf assay, as performed in the examples herein. Thus, preferably, the method may comprise a step of performing an inoculation or exposure assay on each tomato plant, optionally a population of tomato plants. Preferably, such an assay may comprise identifying plants that, when exposed to a lesion-forming pathogen, show a reduction in the number and / or average size of lesions compared to a reference plant. The preferred level of reduction is defined elsewhere herein.

[0193] Alternatively or additionally, resistance to pathogens that form lesions in tomato plants can be determined by identifying tomato plants with modified Pub17 alleles. Preferably, tomato plants with modified Pub17 alleles with the above-mentioned mutations. Preferably, this can be determined by molecular methods such as PCR or genome sequencing of the tomato plants. Preferably, this can be determined by genotyping of the tomato plants. Genotyping of plants includes using techniques such as isozyme electrophoresis, restriction fragment length polymorphism (RFLP), randomly amplified polymorphic DNA (RAPD), arbitrarily primed polymerase chain reaction (AP-PCR), allele-specific PCR (AS-PCR), DNA amplification fingerprinting (DAF), sequence characterized amplified regions (SCAR), amplified fragment length polymorphism (AFLP), simple sequence repeats (SSR), also called "microsatellites".

[0194] "Sequencing DNA" refers to determining the nucleic acid sequence of a fragment of DNA, for example, a gene. Standard methods and commercial services are known in the art. Basic methods for DNA sequencing include the Maxam-Gilbert method and the chain termination method. High-throughput techniques have also been developed and are preferably used in the method of the present invention. These high-throughput techniques include, but are not limited to, massively parallel signature sequencing (MPSS), polony sequencing, 454 pyrosequencing, Illumina (Solexa) sequencing, combinatorial probe anchor synthesis (cPAS), SOLiD sequencing, ion torrent semiconductor sequencing, DNA nanoball sequencing, Heliscope single molecule sequencing, single molecule real-time (SMRT) sequencing and nanopore DNA sequencing.

[0195] Preferably, the presence or absence of the modified Pub17 allele can be determined by PCR, e.g. real-time PCR, using a double-stranded DNA dye or a fluorescent reporter probe. Preferably, a specific primer pair is used that is complementary to the modified Pub17 allele described herein in association with the kit. Preferably, the primer pair detects the presence of a SNP at position 1477 of the Pub17 allele according to SEQ ID NO: 1, or a position corresponding thereto. Thus, preferably, the method may comprise the step of performing PCR using suitable primers, e.g. as specified for the kit, followed by sequencing the resulting amplification product, or optionally performing genomic sequencing of each tomato plant in a population of tomato plants.

[0196] As used herein, the term "primer" refers to an oligonucleotide that can anneal to a nucleic acid target and serve as a starting point for DNA synthesis when placed under conditions in which synthesis of a primer extension product is induced (e.g., in the presence of an agent for polymerization, such as nucleotides and DNA polymerase, and at a suitable temperature and pH). A primer (in some instances, an extension primer, and in some instances, an amplification primer) may be single-stranded for maximum efficiency in extension and / or amplification. A primer may be an oligodeoxyribonucleotide. A primer is typically long enough to prime the synthesis of an extension and / or amplification product in the presence of an agent for polymerization. The minimum length of a primer may depend on many factors, including, but not limited to, the temperature and composition (A / T vs. G / C content) of the primer. In the context of amplification primers, they are typically provided as a pair of bidirectional primers consisting of one forward and one reverse primer, or as a pair of forward primers commonly used in the art of DNA amplification, for example, in PCR amplification.

[0197] Therefore, preferably, a method of identifying or screening tomato plants may comprise using a SNP at position 1477 of the Pub17 allele according to SEQ ID NO: 1, or a position corresponding thereto, as a marker for identifying the presence of resistance to a lesion-forming pathogen in a tomato plant, preferably for identifying the presence of a modified Pub17 allele of the invention in a tomato plant.

[0198] Therefore, a further aspect of the present invention is the use of a SNP at position 1477 of the Pub17 allele of SEQ ID NO: 1, or a position corresponding thereto, for the identification and / or diagnostic selection and / or genotyping of resistance alleles of lesion-forming pathogens in tomato plants or parts thereof, preferably in cultivated tomato plants.

[0199] Suitably, the identification or screening method further comprises the step of selecting each tomato plant which has been identified as having a reduced level, expression or activity of Pub17 protein and / or selecting each tomato plant which has been identified as therefore having increased resistance to one or more lesion forming pathogens.

[0200] Preferably, the identification or screening method may further comprise the step of breeding each selected tomato plant, preferably to produce progeny. Preferably, the screening method may further comprise additional rounds of screening the progeny and breeding selected progeny having the desired trait. Preferably, this may comprise the additional step of screening the progeny for the presence of the desired trait, as explained above, and one or more further steps of breeding the selected progeny.

[0201] Hybrids and breeding methods The hybrid or cultivated plant can be produced by crossing a first plant of the present invention with a second reference plant to obtain progeny. Preferably, the hybrid or cultivated plant is a tomato plant.

[0202] Preferably, the generation of the hybrid tomato plant comprises crossing a first tomato plant according to the invention with a second reference tomato plant as defined above. Preferably, the reference tomato plant lacks a reduced level, expression or activity of Pub17 protein, and preferably, the reference tomato plant lacks a modified Pub17 allele as described herein. However, preferably, the reference plant belongs to the same species, preferably the same variety as the tomato plant of the invention. Preferably, the reference plant and the plant of the invention are tomato plants.

[0203] Preferably, the first plant comprises at least one copy, preferably two copies, of a modified Pub17 allele of the invention.

[0204] Suitably, there is provided a method for providing a cultivated tomato plant, preferably a cultivated plant Solanum lycopersicum, plant part or seed, comprising the steps of: a) crossing a first plant according to any of the preceding embodiments with a second plant lacking a Pub17 allele of the invention; b) obtaining progeny plants; c) optionally selecting said progeny plants, characterized in that said plants exhibit improved resistance to pathogens causing lesions; A method is provided that includes:

[0205] Preferably, the crossing of the tomato plants produces progeny, preferably hybrid progeny. Preferably, the method of producing a hybrid tomato plant may optionally further comprise selecting hybrid tomato plants from the progeny that show increased resistance to lesion-forming pathogens and / or that contain reduced levels, expression or activity of Pub17 protein. Preferably, the selection of hybrid tomato plants having the desired traits may be achieved using the screening techniques described above. Thus, preferably, the selecting step may be carried out by detecting the presence of the modified Pub17 allele of the invention by performing PCR using the primer pair of SEQ ID NOs: 24 and 25, preferably followed by sequencing the resulting amplification product. Alternatively, the selection step may comprise selecting plants from the progeny that show a reduction in the number and / or average size of lesions compared to the reference plant when exposed to a lesion-forming pathogen. Preferred levels of reduction are defined elsewhere herein.

[0206] A further aspect of the present invention is a method for producing a cultivated tomato plant, preferably a cultivated Solanum lycopersicum plant, which exhibits improved resistance to lesion-forming pathogens compared to a reference tomato plant, comprising the steps of: a) providing a seed of a tomato plant according to the present invention; b) germinating the seeds and allowing them to grow into mature, fertile tomato plants; c) inducing self-pollination of said tomato plants under a), growing a tomato fruit and harvesting fertile seeds therefrom; d) growing tomato plants from the seeds harvested under c) and selecting tomato plants having increased resistance to lesion-forming pathogens; The present invention relates to a method comprising the steps of:

[0207] Advantageously, selection of tomato plants having desired traits can be achieved using the screening techniques described above.

[0208] Thus, the plants exemplified herein can be used in breeding programs to develop additional at least partially disease-forming pathogen-resistant plants, such as commercial varieties of such plants. According to such methods, a first parent plant can be used to cross with a second parent plant, where at least one of the first parent plant or the second parent plant contains at least one nucleic acid molecule encoding a modified Pub17 allele as described herein. One application of the process is in the generation of F1 hybrid plants. Another aspect of this process is that it can be used to develop new parent, dihaploid or self-bred lines. For example, any plant line described herein can be crossed with any second plant, and each of the resulting hybrid progeny can be self-pollinated and / or sibbed for about 5 to 7 or more generations, thereby obtaining a large number of different parent lines. These parent lines can then be crossed with other lines, and the resulting hybrid progeny can be analyzed for advantageous characteristics. In this way, any new line imparting desirable characteristics can be identified. A variety of breeding methods can be used including haplotypes, pedigree breeding, haplotypes, improved haplotypes, recurrent selection, and backcrossing.

[0209] use A further aspect of the invention relates to the use of the tomato plant or part thereof, or seed of the invention, for growing a tomato plant and harvesting a crop yield, seed, and / or fruit therefrom. Preferably, methods for growing the plant are known in the art. In one embodiment, the crop yield is preferably tomato fruit.

[0210] A further aspect of the invention relates to the use of the tomato plant or part thereof, or seed of the invention for sowing in a field, a greenhouse, or a plastic house. In a further embodiment, the invention relates to the use of a cultivated plant, preferably a cultivated tomato plant, more preferably a cultivated Solanum lycopersicum plant, plant part, or seed according to any of the preceding embodiments as a rootstock plant.

[0211] A further aspect of the present invention relates to the use of a lesion-forming pathogen-resistant propagation material obtainable from a tomato plant according to the present invention for growing a tomato plant. Preferably, said lesion-forming pathogen resistance can be determined in an assay, preferably by testing the propagation material. A suitable assay may be a detached leaf assay according to the examples herein. Alternatively, the lesion-forming pathogen resistance of the propagation material can be determined by molecular methods to identify the presence of the modified Pub17 allele as described herein. Preferably, the growth of a tomato plant from the propagation material can be performed by culturing the propagation material according to techniques known in the art.

[0212] A further aspect of the invention relates to the use of a modified Pub17 allele of the invention to confer increased resistance to pathogens that form lesions on tomato plants lacking said allele. Suitably, further details of the modified Pub17 allele are provided above. Suitably, the modified Pub17 allele can be introduced into a plant or the plant can be modified to contain a modified Pub17 allele of the invention. Suitable techniques for providing a plant with a modified Pub17 allele of the invention are described above.

[0213] A further aspect of the invention relates to the use of a tomato plant according to the invention for introgressing a lesion-forming pathogen resistance trait into a tomato plant lacking said trait. Preferably, the trait is conferred by a modified Pub17 allele. Preferably, further details of the modified Pub17 allele are as defined above. Preferably, methods for introgressing a trait into a plant are known in the art.

[0214] kit The present invention further provides a kit for detecting alleles of a lesion-forming pathogen resistance trait in a tomato plant, preferably a kit for detecting a modified Pub17 allele of the present invention in a plant. In one embodiment, the plant is a tomato plant.

[0215] Advantageously, such a kit can be used in the above screening method.

[0216] Preferably, the kit comprises at least one PCR primer pair with a forward primer and a reverse primer that specifically bind to the Pub17 coding sequence. Preferably, the primers used can either specifically bind to the Pub17 gene or specifically bind to the modified Pub17 allele. Preferably, the primers that bind to the Pub17 gene can bind to a region of the gene adjacent to the modification, preferably adjacent to the SNP at position 1477 of SEQ ID NO: 1. Therefore, preferably, in a PCR using such primers, the modified allele, if present, is identified using subsequent sequencing. Preferably, the primers that specifically bind to the modified Pub17 allele allow the direct detection of the presence of the modification. Preferably, no subsequent sequencing step is required.

[0217] Preferably, the kit may comprise a PCR primer pair comprising a forward and reverse primer complementary to the Pub17 coding sequence. Preferably, the forward primer consists of SEQ ID NO: 25. Preferably, the reverse primer consists of SEQ ID NO: 24. Preferably, the kit can therefore be used to detect modified Pub17 alleles, preferably by subsequent sequencing of the resulting amplification product. Preferably, in such an embodiment, the kit is intended for use in gene-specific PCR.

[0218] Preferably, the resulting amplification product is generated from PCR. Preferably, the amplification product is sequenced and contains an A to T SNP at position 1477 of SEQ ID NO: 1 (wild type Pub17 allele) or a corresponding position thereto, e.g. in an orthologue or homologue sequence. Therefore, preferably, the SNP is used as a marker, preferably the A1477T mutation is used as a marker, preferably as a marker of resistance to lesion-forming pathogens.

[0219] Preferably, the kit may alternatively comprise a PCR primer pair comprising a forward primer and a reverse primer that specifically bind to a modified Pub17 allele of the invention. Preferably, the forward primer specifically binds to a modified Pub17 allele of the invention. Preferably, the forward primer is complementary to the modified Pub17 sequence. Preferably, the forward primer consists of SEQ ID NO: 31. Preferably, the reverse primer consists of SEQ ID NO: 32. Preferably, the kit may further comprise a second forward primer that specifically binds to a wild-type Pub17 allele. Preferably, said second forward primer is complementary to the unmodified Pub17 sequence. Preferably, the second forward primer consists of SEQ ID NO: 30. Preferably, the kit may comprise a total of three primers; a first forward primer according to SEQ ID NO: 31, a reverse primer according to SEQ ID NO: 32 and a second forward primer according to SEQ ID NO: 30. Therefore, preferably the kit is capable of detecting both modified and wild-type Pub17 alleles, if present.

[0220] Preferably, in such an embodiment, the kit is intended for use in allele-specific PCR, preferably in competitive allele-specific PCR, known in particular as KASP PCR, e.g. as described in (Semagn et al. 2014). Therefore, preferably, each forward primer comprises an indicator molecule, e.g. a fluorescent molecule. Preferably, the indicator molecule is tethered to the forward primers, preferably the first forward primer and the second forward primer. A suitable fluorescent molecule may be FAM or HEX. Preferably, in one embodiment, the first forward primer comprises FAM and the second forward primer comprises HEX.

[0221] Preferably, the resulting amplification product is generated from PCR. Preferably, the amplification product is sequenced and contains an A to T SNP at position 1477 of SEQ ID NO: 1 (wild type Pub17 allele) or a corresponding position thereto, e.g. in an orthologue or homologue sequence. Therefore, preferably, the SNP is used as a marker, preferably the A1477T mutation is used as a marker, preferably as a marker of resistance to lesion-forming pathogens.

[0222] Therefore, advantageously, the present invention further discloses the use of the SNP markers according to the present invention for the diagnostic selection and / or genotyping of alleles of lesion-forming pathogen resistance traits in cultivated plants, in particular cultivated tomato plants, more particularly cultivated Solanum lycopersicum plants.

[0223] The present invention further discloses the use of the SNP markers according to the present invention for identifying the presence of alleles of a lesion-forming pathogen resistance trait in a plant according to the present invention, in particular a cultivated tomato plant, more particularly a Solanum lycopersicum plant, and / or for monitoring the introgression of alleles of a lesion-forming pathogen resistance trait into a cultivated plant, in particular a cultivated tomato plant, more particularly a Solanum lycopersicum plant, according to the present invention and as described herein.

[0224] Preferably, the SNP markers are identified by one of the above PCR methods, preferably using the primers described above.

[0225] Suitably, the kit may further comprise other components suitable for carrying out PCR, such as polymerase, salts, buffers, instructions for use, etc.

[0226] A further aspect of the invention relates to an amplification product obtained from a PCR comprising said primer pair that correlates with a trait of pathogen resistance that forms a lesion and that co-segregates with the trait of pathogen resistance that forms a lesion or with the disclosed marker. Preferably, the amplification product is a nucleic acid.

[0227] A further aspect of the invention is a polynucleotide that has at least 70% identity with said amplification product, or preferably hybridizes to said amplification product with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 100% identity to said amplification product. Preferably, the amplification products can be used to generate new primers and / or probes for identifying modified Pub17 alleles. Preferably, these are inducible markers or probes that are genetically linked to the trait of lesion-forming pathogen resistance. Preferably, such inducible markers or probes can be equally used to identify plants with increased resistance to lesion-forming pathogens. EXAMPLES

[0228] Materials and Methods plant material Two different tomato cultivars were used in this experiment: cv. Micro-Tom (MT) and cv. Moneymaker (MM). MT seeds were obtained from Beekenkamp Plants BV (Maasdijk, The Netherlands).

[0229] Development of the Micro-Tom EMS population Given the advantages that the tomato cultivar Micro-Tom (MT) offers, for example, small size, the possibility of growing at high density, and having a short life cycle (Meissner et al. 1997), MT was selected as the tomato cultivar for the EMS population in our laboratory (Yan et al. 2021). In total, five batches of approximately 1000 MT seeds (M0) were presoaked in distilled water for 8 h and treated overnight with 1% EMS dilution. The resulting M1 seeds were thoroughly washed with distilled water and sown in a greenhouse. The plants were grown at a day / night temperature of 21 °C / 19 °C with a relative humidity of 60% during a 16 h day / 8 h night regime. Three-week-old seedlings were transplanted individually into 14 cm pots and grown until ripe fruits could be harvested. The collected M2 seeds were surface sterilized with 2% HCl (hydrogen chloride) followed by treatment with 10% trisodium phosphate (TSP) solution for at least 1 h and then air-dried. From the first two batches, 5 to 10 fruits were harvested per plant. However, for the last three batches, all of the developed fruits were harvested and more seeds were collected.

[0230] Botrytis cinerea disease assay Detached leaf assays (DLA) were performed according to a modified version of the potato DLA described by Sun et al. (2017). DLA for MT plants consisted of taking the middle leaflets of the third leaves from each plant in 20 / M2 families and arranging them in square Petri dishes containing water agar medium (15 g / L microagar in Milli-Q® water) with 6 leaves / Petri dish. DLA for MM consisted of taking the third leaves (left, middle and right leaflets of the three branch tips) from 6-week-old plants and arranging all three leaflets in square Petri dishes prepared as above. Leaves were inoculated on the adaxial side with 5–6 2 μl droplets of B. cinerea strain B05.10 (Amselem et al. 2011). Spores were soaked in a mixture of PDA (potato dextrose agar) and PDB (potato glucose broth) at a final concentration of half-strength PDB (12 g / l) and 1 × 10 6 The spores were suspended in 0.3% agar at a density of 100 spores / ml. After inoculation, the dishes were grouped (16-18 Petri dishes per group) and each group was mounted on a tray containing a sheet of moist filter paper. The trays were placed inside plastic bags to obtain 100% humidity. They were kept at 18°C ​​(16 h light / 8 h dark). At 3 and 4 days post inoculation (dpi), the lesion diameters on the leaves were measured using a caliper with a digital readout (Mitutoyo nr 500-161-30, Mitutoyo Nederland BV, Veenendaal, The Netherlands).

[0231] Stem assays were performed by cutting the third, fourth, and fifth leaves from 6-week-old plants, leaving approximately 2.5 cm petiole fragments. 10 μl of B. cinerea strain B05.10 at 1 × 10 6The plants were inoculated at a density of 10 spores / ml. The plants were kept in a plastic tent with high humidity for 24 hours. Symptoms were scored 3, 6, 10, 14, 17 and 21 days after inoculation. Scores were based on a scale of 0 to 4: 0: unchanged petiole fragments equivalent to mock treatment, 1: petiole fragments partially or completely thinned with brown coloration, 2: stem infection starting outward with small brown rings visible on the main stem around the axils of the inoculated petiole fragments, 3: spread of infection throughout the stem with the brown rings becoming irregular and spreading upwards and downwards along the stem, and 4: infection and wilting of the full main stem of the plant with internal browning, disintegration of the stem tissue, and descent leading to eventual folding and turning over of the plant top (Figure 15). In addition, petiole abscission was recorded.

[0232] Alternaria solani disease assay The detached leaf assay (DLA) was performed according to a modified version of the potato DLA described by Sun et al. (2017). DLA against MT followed the same process as for B. cinerea. DLA against MM consisted of harvesting the branch tip leaflets of the third, fourth and fifth true leaves from 6-week-old plants and placing all three leaflets in a square Petri dish prepared as above. Leaves were inoculated on the adaxial side with five to six 10 μl droplets of A. solani isolate “altNL03003” (accession number CBS143772). Spore collection was performed according to a previously reported method (Wolters et al. 2019). Spores were inoculated on a mixture of PDA (potato dextrose agar) and PDB (potato glucose broth) at a final concentration of half-strength PDB (12 g / l) and 1 × 10 5Spores were suspended in 0.3% agar at a density of 100 spores / ml. After inoculation, the dishes were grouped (16-18 Petri dishes per group) and each group was mounted on a tray containing a sheet of moist filter paper. The trays were placed inside plastic bags to obtain 100% humidity. They were kept at 18°C ​​(16 h light / 8 h dark). At 5 and 7 days post inoculation (dpi), the lesion diameters on the leaves were measured using a caliper with a digital readout (Mitutoyo nr 500-161-30, Mitutoyo Nederland BV, Veenendaal, The Netherlands).

[0233] Additional Disease Assays Screening for altered susceptibility to tomato powdery mildew (Pseudoidium neolycopersici) Wageningen isolate On-Ne was performed as described by Bai et al. (2003). Disease assays with Phytophthora infestans isolates PIC99177 or C65 were performed using DLA as described by Sun et al. (2016). Testing for Tomato yellow leaf curl virus (TYLCV) resistance was performed using agroinoculation as described by Verlaan et al. (2011). Tomato brown rugose fruit virus (ToBRFV) resistance was assayed by artificial infection of 10-day-old seedlings with ToBRFV-IL isolate (Luria et al. 2017; Genbank accession number KX619418). Leaves were rubbed with carboranda and then sap inoculated. Disease symptoms were monitored weekly and scored for 4 weeks after inoculation.

[0234] Development of segregating populations The mutant M2042, which shows reduced susceptibility to Botrytis cinerea, was self-pollinated until the M4 line was obtained. The M4 line was fixed for the mutation causing the reduced susceptibility. The confirmed mutant M4 line M2042-1-2-12 was crossed with MM and F1 seeds were collected. Five F1 plants were then self-pollinated and F2 seeds were collected.

[0235] Screening for d and sp mutations from Micro-Tom The tomato cultivar Micro-Tom contains at least two mutations responsible for small plant size, in the genes Self-Pruning (Sp; Solyc06g074350) and Dwarf (D; Solyc02g089160) (Marti et al. 2006). For identification of Micro-Tom SNPs responsible for the determined (sp, self-pruning) phenotype, a high-resolution melting (HRM) assay was developed. Forward and reverse primers SP_F (TGAGACGGACAAGATGACATGA) SEQ ID NO: 33 and SP_R (TGTCATTTCCCCTTCCAAAGT) SEQ ID NO: 34 flanking exon 2 were designed and generated a PCR product of 218 bp. These primers were used in PCR using the LightScanner® System (Idaho Technology) with Phire™ Hot Start DNA polymerase (ThermoFischer) and LCGreen™ Plus+ (BioChem) with the following amplification conditions: 98° C. for 30 s, 40 cycles of 98° C. for 5 s, 57° C. for 5 s, and 72° C. for 15 s, followed by 72° C. for 30 s, 94° C. for 30 s, 25° C. for 30 s, followed by cooling to 10° C. Using melting curve analysis, the three different genotypes (homozygous SpSp, heterozygous Spsp, and homozygous spsp) could be distinguished.

[0236] For identification of the Micro-Tom SNP responsible for the dwarf (d) phenotype in the F2 population, the CAPS marker was used with primer C (GGAACTTGGTGTAGCAGAAATTTCCACATTTC) SEQ ID NO:5 in exon 8 and primer D (TTAGTGAGCTGAAACTCTAATCCGTAGAC) SEQ ID NO:6 in exon 9 (Marti et al. 2006). PCR was performed using DreamTaq polymerase with a melting temperature of 60°C. The 243 bp PCR product was then incubated with the restriction enzyme HpyCH4V at 47°C for 4 hours. The product was then run on a 1.5% TBE gel at 110V for 1 hour. Digestion of the PCR product into 152 bp and 91 bp fragments indicated the presence of the wild type (MM-like) allele, while undigested products indicated the presence of the MT allele.

[0237] Identification of mutant genes by bulked segregant analysis combined with whole genome sequencing (BSA-WGS) In total, 200 F2 plants from a cross between EMS mutant M2042 and wild-type susceptible Moneymaker were assayed for resistance to B. cinerea. Plants showing either very small or very large lesion diameter sizes were selected and reinoculated to confirm resistance or susceptibility. Finally, 18 plants with the smallest lesions and 18 plants with the largest lesions were selected. DNA was isolated from leaf samples of these plants and from 10 individual wild-type MT plants using DNeasy Plant Mini Kit (Qiagen). DNA concentration was measured using NanoDrop® and Qubit® (ThermoFisher Scientific). DNA from resistant and susceptible F2 plants and wild-type MT plants were pooled in equimolar amounts, resulting in three DNA pools M2042R, M2042S and MTWT. These DNA pools were sequenced (whole genome resequencing, WGS) by Novogene Ltd (Hong Kong). In this case, a 350bp insert DNA library was prepared. Paired-end sequencing was performed on an Illumina® HiSeq platform with a read length of 150bp at each end (PE150) and genome coverage of approximately 35 times for each sample. Reads were mapped to the tomato Heinz reference genome (version SL2.50) and SNP detection was performed using the SAM tool.

[0238] In total, 2,659,728 SNPs were identified. For each pool, the number of reads containing the reference (Heinz) allele and the number of reads containing the alternative allele were recorded per SNP position. Several calculations were performed: 1) the sum of the number of reference allele (REF) and alternative allele (ALT) reads per SNP position per pool (total number of reads = coverage = read depth); 2) the percentage of alternative alleles per SNP position per pool; %ALT = (ALT / [REF+ALT]). *100; 3) the difference in the percentage of alternative alleles per SNP position (%ALT[R]-%ALT[S]) between the resistant and sensitive pools. Next, filtering of SNPs per chromosome was performed as follows: 1) only SNPs were kept if the total number of reads in the resistant pool (M2042R) was ≧35 (coverage at least 35); 2) only SNPs were kept if %ALT[R] was ≧80. In theory, alternative alleles should be present 100% in the resistant pool. However, to be on the safe side, a lower percentage was chosen. After this, each chromosome was checked for the occurrence of roughly contiguous regions with large differences in the percentage of alternative alleles per SNP position between M2042R and M2042S (%ALT[R]-%ALT[S]>50). For chromosome 2, there was a 6.6 Mbp region between positions 40900926 and 47531242 (SL2.50 reference genome) that fulfilled this criterion. The next filtering consisted of selecting SNP positions within exons of annotated genes where the alternative allele was present in the resistant and susceptible pools (M2042R and M2042S) but absent in the wild-type Micro-Tom pool (MTWT). In the chromosome 2 region, SNPs were allowed at filtered SNP positions with a coverage of ≥ 35, %ALT[R] ≥ 80, and (%ALT[R]-%ALT[S] > 50: the premature stop codon R493 * A [T / A] SNP at position SL2.50ch02:41352738 in gene Solyc02g072080 (SlPUB17), resulting in

[0239] Associating PUB17 mutations with Botrytis resistance For individual F2 plants of the M2042R and M2042S pools, the sequence of the candidate gene PUB17 was checked for the presence and homozygosity of alternative SNPs. The progeny were tested for Botrytis resistance to check whether segregation of disease resistance occurred and to associate resistance with the mutation.

[0240] Determination of gene expression levels by RT-qPCR Gene expression levels were determined by performing RT-qPCR on plant cDNA synthesized using iScript cDNA synthesis kit (BioRad) on RNA extracted through RNeasy plant mini kit (Qiagen). Primers PUB17_qPCR_Fw1 (5'-GGAAGTGAAGGTGTTGCGA-3') SEQ ID NO:7 and PUB17_qPCR_Rv1 (5'-CTACTGCCATTTCCTCATTGC-3') SEQ ID NO:8 specific for PUB17 were developed to obtain a PCR product of 100 bp. Elongation factor 1 alpha (Ef1α) was used as a reference gene with primers Ef1a-Fw (5'-ATTGGAAACGGATATGCCCCT-3') SEQ ID NO:9 and Ef1a-Rv (5'-TCCTTACCTGAACGCCTGTCA-3') SEQ ID NO:10 to obtain a PCR product of 101 bp. RT-qPCR was performed using a CFX96 real-time PCR instrument (BioRad), where two technical replicates were used per sample. Relative expression of PUB17 was calculated by the ΔΔCT method (Livak & Schmittgen 2001).

[0241] RNAi and CRISPR transformation to validate candidate genes Two PUB17 RNAi constructs were made using the binary vector pHellsgate12 (Helliwell and Waterhouse 2003). This vector contains the CaMV 35S promoter driving expression of the inverted repeat and a kanamycin resistance gene as a selectable marker. Primers were designed for PUB17 to amplify a fragment from the tomato gDNA sequence of cv. Moneymaker. Primer sequences are shown in Table 6. RNAi fragment 7 was amplified using forward primer caccGGTGTGGGAAATTGATGGCA (SEQ ID NO: 15) and reverse primer AAACGGCAGCCTTTTACCTG (SEQ ID NO: 16) to yield a 176 bp product targeting the UND domain of the PUB17 protein. RNAi fragment 3 was amplified using forward primer caccAGCCCACATCCTCAGTTCTC (SEQ ID NO: 13) and reverse primer CATATGTCTGCCCTGTTGCC (SEQ ID NO: 14) to yield a 240 bp product targeting the U-box domain. The forward primer contained CACC at the 5' end for directional cloning into pENTR / D-TOPO (ThermoFisher) vector. Primers were used in blunt-end PCR using Phusion™ high-fidelity DNA polymerase (ThermoFisher) and PCR products were cleaned up using a QIAquick PCR clean-up kit (Qiagen). The resulting DNA was cloned into pENTR / D-TOPO and transformed into E. coli DH5α. Cultures were plated on LB medium containing spectinomycin (100 μg / ul) and grown overnight at 37° C. Plasmid DNA of the clones was sequenced to verify the presence of the correct insert.

[0242] A CRISPR / Cas9 construct was designed to create a deletion in the PUB17 coding sequence using four sgRNAs flanking the Cas9 endonuclease gene and an NPTII plant selectable marker. The sgRNAs were designed using the CCTop-CRISPR / Cas9 target online predictor tool (https: / / crispr.cos.uni-heidelberg.de / ; Stemmer et al. 2015) and the tomato genome (Solanum lycopersicum cv. Heinz SL2.50) as a reference for target site evaluation. From the table of sgRNAs presented by the online predictor, only sgRNAs without exonic off-target sites were selected. Further, the selected sgRNAs were curated by verifying that their GC content was between 30-80% (http: / / www.endmemo.com / bio / gc.php) and their secondary structure was evaluated according to Liang et al. (2016) (http: / / unafold.rna.albany.edu / ?q=mfold / RNA-Folding-Form; Zuker, 2003). Additional scoring tools were used to compare, validate and select the best four sgRNAs (https: / / sgrnascorer.cancer.gov / ; Chari et al. 2017), (https: / / portals.broadinstitute.org / gpp / public / analysis-tools / sgrna-design; Sanson et al., 2018), (http: / / crispr.wustl.edu / ; Wongetal. 2015). The distance between the sgRNA target sites was approximately 600 bp.sgRNAs were selected to target different protein domains with guide 1 (GGAAATGACCTGAAATCGAA) SEQ ID NO: 17 located within the UND domain, guide 2 (TTCTATATCGAGGTGGATGG) SEQ ID NO: 18 located within the U-box domain, and guide 3 (GAGATTTGGGCACACCACAG) SEQ ID NO: 19 and guide 4 (CAGGAACAAAGCGCGCAAGG) SEQ ID NO: 20 located within the ARM repeat domain. Constructs were constructed using the Golden Gate cloning system (Engler et al. 2008). The selected sgRNAs were developed by using primers containing the sequence for the forward primer (5'-TGTGGTCTCA [sgRNA sequence] GTTTTAGAGCTAGAAATAGCAAG-3') SEQ ID NO: 21 and the sequence for the reverse primer (5'-TGTGGTCTCAAGCGTAATGCCAACTTTGTAC-3') SEQ ID NO: 22. Each forward and reverse primer pair was subjected to a level 0 reaction with the plasmid plCH86966 containing the kanamycin resistance gene as a template. The Level 0 products then underwent PCR cleanup (QIAquick PCR Purification Kit, Qiagen) and the clean products were used to construct Level 1 reactions. Level 1 reactions consisted of combining plasmid pICHSL01009 (AtU6 promoter), the designated plasmids for each guide position (pICH47751, pICH47761, pICH47772, and pICH47781), and the clean products from the Level 0 reactions. Reactions were performed by digesting the indicated plasmids with BsaI / Eco31I and religating with T4 DNA (Thermo Scientific, Bleiswijk, The Netherlands) and cloned into E. coli DH5α as follows: pICH47751 (position 1 for sgRNA guide 1), pICH47761 (position 2 for sgRNA guide 2), pICH47772 (position 3 for sgRNA guide 3), and pICH47781 (position 4 for sgRNA guide 4).Plasmids were purified using Qiagen® Plasmid Prep Kits (Qiagen Benelux BV, Venlo, The Netherlands). Level 1 constructs, together with NPTII (pICH47732), Cas9 (pICH47742), and linker (pICH41822), were assembled into the level 2 binary vector pAGM4723 by digestion with BpiI / BpsI and religation with T4 DNA and cloned into E. coli DH5α. Level 2 constructs were purified, sequenced, and verified.

[0243] Two RNAi constructs against PUB17 and one CRISPR / Cas9 construct were transformed into electrocompetent Agrobacterium tumefaciens AGL1+virG cells. Transformation of tomato cv. MM was performed as previously described by Huibers et al. (2013).

[0244] Analysis of CRISPR and RNAi transformants To determine the presence of mutations in CRISPR transformants, DNA was isolated from young leaves using CTAB buffer (1M Tris-HCl pH 7.5, 0.5M EDTA pH 8.0, 5M NaCl, 2% CTAB). Genomic DNA was then subjected to gene-specific PCR using DreamTaq DNA polymerase (Thermo Scientific, Bleiswijk, The Netherlands). Two different forward primers, FWD_MR_GX_CRISPR (5'-ACGGCGTTATCTTCTGAGCT-3') SEQ ID NO: 23 and AWPUB17_F1 (5'-AGAGAGTGGGACGCAGATT-3') SEQ ID NO: 25, were used to pair individually with the reverse primer REV_MR_GX_CRISPR (5'-CATGCTCACACCGTTGGAAT-3') SEQ ID NO: 24, resulting in PCR products of 1942 bp and 827 bp, respectively, for the wild-type (WT) allele. PCR products were sent to Macrogen Europe (Amsterdam, The Netherlands) for sequencing.

[0245] To confirm the integration of the T-DNA of the silencing construct into the genome of the RNAi transformants, PCR was performed to detect the presence of the NPTII gene and the 35S promoter. The forward and reverse primers NPTII_421_Fw (5'-GAAGGGACTGGCTGCTATTG-3') SEQ ID NO: 26 and NPTII_421_Rv (5'-AATATCACGGGTAGCCAACG-3') SEQ ID NO: 27 used to detect the NPTII gene gave a PCR product of 421 bp. The forward and reverse primers 35S_597_Fw (5'-TACAAAGGCGGCAACAAAC-3') SEQ ID NO: 28 and 35S_597_Rv (5'-AGCAAGCCTTGAATCGTCC-3') SEQ ID NO: 29 used to detect the 35S promoter amplified a region of 597 bp.

[0246] statistical analysis Data points from each DLA experiment were subjected to ANOVA F-tests using R studio v1.1.463 (2016). ANOVA tests were followed by post-hoc tests using Tukey HSD method to perform multiple pairwise comparisons.

[0247] Development of KASP markers for pub17 mutations The KASP™ marker assay (Semagn et al. 2014) was developed to track EMS-induced mutations in the PUB17 gene in the F2 population. Two forward primers were designed: K_RTWT_For1 5'-GAAGGTGACCAAGTTCATGCTGTCTGGCTTTGATAGTTGGAGTTTTGT-3' SEQ ID NO: 30 for the wild type allele and K_RTmut_For1:GAAGGTCGGAGTCAACGGATTGTCTGGCTTTGATAGTTGGAGTTTTGA SEQ ID NO: 31 for the pub17 mutant allele. The reverse primer K_RT_Rev70 5'-GTTGCTGCAGCATTTTCCCGTG-3' SEQ ID NO: 32 was used in combination with the forward primer. The forward primer for the WT sequence was labeled with HEX dye, while the forward primer for the mutant sequence was labeled with FAM dye. For PCR KASP V4.02X Master Mix 96 / 384, Low Rox (LCG group) was used. PCR was performed according to the KASP thermal protocol provided by the manufacturer (LCG group). Plates were read in a plate reader (Bio-Rad C1000 thermal cycler) and data were analyzed using Bio-Rad CFX Maestro 1.1.

[0248] result Reduced susceptibility to Botrytis cinerea in the tomato mutant M2042. To identify S genes against necrotrophic fungi, we screened the Micro-Tom EMS population (Yan et al. 2021) developed at Wageningen University-Plant Breeding. The EMS population consisted of 4500 M2 families, of which 692 were screened for phenotypic changes including dwarf, light green leaves, altered leaf shape, altered flower morphology and color, and altered fruit color. The M2 families included leaf blight (Phytophthora infestans isolate C65 or PIC99177), gray mold (Botrytis cinerea strain B05.10), and powdery mildew (Pseudoidium neolycopersici strain On-Ne), and each plant was disease tested with three pathogens. B. cinerea disease assays led to the identification of M2 family M2042 (Figure 1A), whose plant 1 showed reduced susceptibility and reduced mycelial growth compared to the WT control 9 days after inoculation. Furthermore, when the same plants from M2042 were tested for P. infestans, plant 1 showed smaller lesions with necrotic spots and reduced / arrested mycelial growth compared to the wild type 14 days after inoculation. The mutation in M2042 was fixed in the M4 accession, and subsequent Botrytis disease assays confirmed moderate resistance showing a 20-30% reduction in lesion diameter compared to Micro-Tom.

[0249] A premature stop codon mutation in PUB17 (Solyc02g072080) in mutant M2042 The mutation found in M2042 responsible for smaller lesions (termed intermediate resistance, IR) after B. cinerea infection was mapped through bulked segregant analysis and whole genome sequencing (BSA-WGS) approach. A segregating F2 population of 200 plants (Figure 1B), obtained from the cross with MM, was first phenotyped by measuring the lesion diameter of all plants, and two different pools of resistant and susceptible plants against B. cinerea were constructed. First, DLA was performed on a total of 200 plants, followed by visual inspection of the plants showing the smallest and largest lesion diameters. This was followed by a second confirmation and further selection of plants found under extreme conditions. Plants with extreme phenotypes were selected for two pools, "resistant" and susceptible, with 18 plants per pool. As a control, a third pool was developed consisting of wild-type Micro-Tom plants. An interesting nonsynonymous mutation was initially identified through whole genome sequencing and further filtering of SNPs as described in Materials and Methods. The mutation was located at the premature stop codon R493 * The A → T SNP at position 1477 in the coding region of gene Solyc02g072080 resulting in a phenotype similar to that of the tomato strain Solyc02g072080 (Figure 2). This gene is the tomato orthologue of PUB17.

[0250] To determine the relative expression levels of candidate genes, RT-qPCR was performed using moderately resistant wild-type MT plants and M4 progeny (M2042-1-1-17 and M2042-1-2-12). Leaves were mock inoculated or inoculated with B. cinerea, and samples were taken at three time points: 0, 24, and 48 hours post-infection (hpi). Expression of PUB17 was significantly induced upon B. cinerea infection in wild-type MT (Figure 3). However, expression of PUB17 was not induced in mutants M2042-1-1-17 and M2042-1-2-12.

[0251] To check whether the PUB17 mutation is associated with Botrytis resistance, disease assays were performed using progeny of selected M4 and F2 plants derived from a cross between MM and M4 plants M2042-1-2-12 (Figure 1B, Table 1). F3 and M5 progeny plants were tested for B. cinerea resistance to assess whether they were segregating for the phenotype.

[0252] [Table 1]

[0253] The progeny of M4 plants M2042-1-2-7 and M2042-1-2-12, and F2 plants 1-66, 2-59, 3-10, and 3-26, which are homozygous mutants for PUB17, all showed smaller lesion sizes than the wild-type control M2042-1-20-19, whereas the progeny of F2 plant 3-39, which is heterozygous (one mutant allele, one wild-type allele) for the PUB17 gene, showed segregation in response to Botrytis infection (Table 1).

[0254] The F3 progeny of 3-39 were genotyped for the PUB17 gene. In total, four homozygous mutant plants were found among the 24 progeny plants (Table 2). All four homozygous mutant plants expressed smaller lesions than the heterozygous wild-type progeny and the homozygous wild-type progeny. Taken together, these results support the hypothesis that the mutation causing the premature stop codon in PUB17 is a variant responsible for the moderate resistance of M2042 to B. cinerea.

[0255] [Table 2]

[0256] Silencing of PUB17 by RNAi confers increased resistance to B. cinerea To analyze whether the silencing of the identified PUB17 gene was sufficient to obtain reduced susceptibility to B. cinerea and that no other genes were involved (mutated), two RNAi constructs targeting PUB17 were generated: RNAi fragment 7 (176 bp) targeted the UND domain and RNAi fragment 3 (239 bp) targeted the U-BOX domain (Figure 4). A total of 50 RNAi transformants were obtained. After transfer of the transformants to the greenhouse, the relative expression levels of PUB17 could be determined for 24 RNAi transformants containing fragment 3 and 19 RNAi transformants containing fragment 7 (Figure 5).

[0257] RNAi fragment 3 appeared to be somewhat more efficient in silencing compared to RNAi fragment 7 (Figure 5). The transformant with the lowest PUB17 gene expression, T1 RNAi3-5 (T2 progeny TV181088, Table 3), was selected as the main candidate for further testing. Meanwhile, as part of the RNAi transformants, one RNAi3 transformant (3-29, TV181105) and one RNAi7 transformant (7-33, TV181136; not included in Figure 5) were found to show slight autonecrosis on leaves. We considered that this could be the result of silencing PUB17. Therefore, these two RNAi families TV181105 and TV181136 were also selected for further testing.

[0258] From the segregating T2 families TV181088 and TV181136, individual plants were selected based on the presence of a clear and intense fragment after PCR using NPTII primers, indicating the presence of T-DNA. T3 progeny were obtained from these selected plants (Table 3). T3 RNAi-silenced PUB17 transformants were then inoculated with the B05.10 strain of B. cinerea in stem and detached leaf assays (DLA). MM plants and an RNAi family (TV192024), which did not show the presence of NPTII, were used as susceptible controls.

[0259] For the stem assay, petiole fragments were inoculated and these were monitored over a period of 21 days. A disease severity index (DSI) score of 0-4 was given as "abs" in case of increased damage observed or detachment of the petiole fragment. Plants started to show disease symptoms 6 days after inoculation. The two negative controls MM and TV192024 showed susceptibility to B. cinerea, exhibiting a relatively high percentage of petioles with a DSI of 3 or 4. On the other hand, PUB17 RNAi silenced transformants showed a lower level of susceptibility to B. cinerea, based on a low percentage of stems with a DSI of 3 or 4, with families TV192027 and TV192029 having the lowest susceptibility phenotype (Figure 14).

[0260] [Table 3]

[0261] Concurrently, DLA was performed on the T3 family silenced by PUB17 RNAi in T1 transformants 3-5 and 7-33 (Table 3). Lesion diameters on infected leaves were measured 3 and 4 days postinoculation (dpi) (Fig. 6).

[0262] The results of the DLA test showed that the two controls MM and TV192024 showed similar B. cinerea lesion diameter sizes (Figure 6). In contrast, significantly smaller B. cinerea lesions were observed on leaves from the PUB17 RNAi silenced family TV192025, TV192026, TV192027, TV192028, and TV192029 at both 3 and 4 dpi. Multiple pairwise comparisons of Tukey HSD were performed for lesion diameters across all groups. Leaves of all PUB17 RNAi-silenced families TV192025, TV192026, TV192027, TV192028, and TV192029 showed significant differences (p<0.05) in mean lesion diameter when compared to the negative control MM and T3 families TV192024, while the negative controls showed no significant differences from each other at both 3 and 4 dpi.

[0263] Only T3 progeny were subsequently obtained from the T2 TV181105 of another RNAi-silenced family. Thus, the segregating T2 family was subjected to both stem and leaf assays as Botrytis tests. T2 plants were genotyped for the presence of NPTII to distinguish between transgenic and non-transgenic plants. Stem test results showed a lower level of susceptibility to B. cinerea in transgenic TV181105 plants compared to non-transgenic T2 plants and negative control MM, based on a lower percentage of stems showing DSI3 and an absence of stems showing DSI4. In a detached leaf assay, lesion diameter size was compared between the control, MM and plants lacking NPTII, and T2 plants containing NPTII (TV05, FIG. 7). As with the previously tested PUB17 RNAi family, a clear difference was observed between the lesion diameter of the transgenic TV181105 plants and that of the control. Tukey HSD multiple pairwise comparisons confirmed that transgenic T2 TV181105 plants had smaller lesion diameters than the negative controls (p<0.05), while the negative controls also showed statistical differences between each other.

[0264] CRISPR / Cas9-mediated mutation of wild-type PUB17 confers increased resistance to B. cinerea To further test whether the mutation of PUB17 in EMS mutant M2042 was sufficient to confer reduced susceptibility to Botrytis, CRISPR / Cas9-targeted mutation of PUB17 was performed using a construct carrying four sgRNAs (Figure 8).

[0265] Tomato cultivar Moneymaker was transformed with this construct, resulting in 56 transformants. Primary transformants were genotyped using specific primer pairs flanking all four sgRNAs (Figure 9A) or exclusively the last two sgRNAs (Figure 9B) (primers are presented in Table 7). From the 56 CRISPR PUB17 transformants, four that clearly carried mutant alleles were identified through PCR and electrophoresis (Figure 9).

[0266] For CRISPR transformants 9, 21, and 36, in addition to the PCR product with the size of the wild-type allele, smaller PCR products were observed in both PCRs. For plant 46, a small PCR product of about 700 bp indicated that a large deletion had occurred between the first and last sgRNA target sites. Because of this, amplification of the mutant allele was not possible with the primer combination used in panel B. On the other hand, plant 36 showed three clear PCR fragments, indicating a chimeric mutant. The bands were cut from the gel and sequenced using the primers used to obtain the PCR products. The sequences of the mutant alleles were aligned with the WT sequence to find the exact size of each deletion. The results are shown in Figure 10.

[0267] Small deletion or insertion mutations could not be identified by gel electrophoresis. Therefore, PCR products of all transformants showing approximately WT-sized bands were also sequenced. This led to the identification of an additional biallelic mutant, plant 7, which had a 1 bp deletion and a 1 bp insertion in one mutant allele, while the second mutant allele had two additional 1 bp insertions (Figure 11).

[0268] A summary of the identified mutations is provided in Table 4. The size of the deletion was recorded and the location relative to the PUB17 sgRNA was selected for the construct. The majority of mutations occurred within the region targeted by sgRNA3.

[0269] [Table 4]

[0270] For each mutant allele, the effect of the mutation on the predicted protein sequence was determined.

[0271] The deletions in plants 21, 46 and a 5 bp deletion in one of the alleles in plant 36 resulted in a premature stop codon, while the rest resulted in an out-of-frame mutation.

[0272] From T2 plants carrying the small ~345 bp deletion, T3 progeny could be obtained (Table 5). T3 PUB17 CRISPR transformants were subjected to DLA using the B. cinerea stem assay and the B05.10 lineage. All transformants tested were homozygous mutants for the indel mutation in PUB17. MM plants and the T2 PUB17 CRISPR transformant family TV181133 did not show the presence of the mutation observed in its T1 parent plant21 and were used as susceptible controls.

[0273] [Table 5]

[0274] For the stem assay, inoculated petioles were monitored over 21 days to detect disease symptoms at 6 dpi. The negative control, MM and T2 PUB17 transformant family TV181133 showed the highest level of susceptibility to B. cinerea, as indicated by a relatively high percentage of stems with a DSI of 4, followed by T3 families TV192008 and TV192012. On the other hand, T3 PUB17 CRISPR families TV192007, TV192009, TV192016, TV192019, TV192014 and TV192023 all showed reduced susceptibility to B. cinerea based on a low percentage of stems with a DSI of 3 or 4 (Figure 14).

[0275] Lesion diameters on infected leaves were measured in a detached leaf assay on days 3 and 4 after inoculation (Figure 12). The two control groups, MM and TV181133, showed similar B. cinerea lesion diameters. Significantly smaller B. cinerea lesion diameters (p<0.001) were observed in all eight PUB17 CRISPR mutant T3 families compared to the two negative controls.

[0276] Consequences of mutations on PUB17 protein structure / architecture To compare the sequence features of PUB17 protein in stable CRISPR mutants with the original PUB17 EMS mutant, multiple sequence alignment of predicted PUB17 protein was performed. Protein alignment was performed using the multiple sequence alignment program Clustal Omega provided by EMBL-EBI (Madeira et al., 2022). Protein domains were predicted using the ScanProsite tool (De Castro et al., 2006). Alignment showed that all mutant alleles contained intact UND domain (amino acids 20-171) and U-box domain (amino acids 297-364). While mutations in CRISPR mutant alleles 1, 2, and 3 caused frameshift mutations and premature stop codons, CRISPR mutant allele 4 contained a large deletion (345 bp), resulting in the removal of amino acids 454 to 568, but retaining the C-terminal region of the coding sequence.

[0277] Given that the armadillo repeat (ARM, amino acids 429-682) domain was compromised in all mutant alleles, the predicted effects of the mutations on the protein domain were analyzed (Figure 16). The WT allele contains four ARM repeats, while CRISPR mutant alleles 1-3 and the EMS mutant M2042 allele contain exclusively the first ARM repeat, the second ARM repeat is truncated, and ARM repeats 3-4 are deleted entirely. CRISPR mutant allele 4 lost the first three ARM repeats but retained the last predicted ARM repeat (ARM4).

[0278] Increased resistance to other pathogens As mentioned previously, it was found that the PUB17 mutant M2042 exhibited reduced susceptibility to the hemibiotrophic oomycete Phytophthora infestans in addition to the necrotrophic fungus Botrytis cinerea. To analyze whether the mutation in the PUB17 gene affected susceptibility to other tomato pathogens, disease assays were performed on the PUB17 mutant with the necrotrophic fungus Alternaria solani. We observed that the original mutant as well as the F3 mutant plants obtained after crossing with MM showed significantly reduced susceptibility to this fungus as indicated by the reduced lesion diameter size (Figure 13). Furthermore, DLA with A. solani was performed using two PUB17 CRISPR T3 families TV192007 and TV192023. These CRISPR mutants also showed a significant reduction in lesion diameter compared to MM controls (Figure 13C).

[0279] Furthermore, the mutants were tested against two important tomato-infecting viruses, the DNA virus TYLCV and the RNA virus ToBRFV, and PUB17 CRISPR mutant plants showed reduced ToBRFV symptoms compared to wild-type plants.

[0280] Breeding value of the EMS pub17 mutant The original EMS mutant plant M2042 had slightly smaller leaves than wild-type MT, and the leaves were slightly wrinkled. After crossing the EMS mutant with MM, backcrossing, and self-pollination of the progeny, plants with an MM-like phenotype could be obtained. However, autonecrosis on leaves was regularly observed in the progeny derived from the EMS mutant. To evaluate the breeding value of the EMS pub17 mutation, F3 plants obtained after crossing the EMS mutant with MM from F2 family 1-66 were backcrossed twice to different tomato breeding lines H1 and H2 and then self-pollinated (BC2S1) (Figure 17A). Plants of BC2S1_H1 had a normal phenotype comparable to the parent line H1. On the other hand, plants of BC2S1_H2 had leaves with small autonecrotic spots and were therefore not further used in breeding. This suggested that the occurrence of autonecrosis of the pub17 mutant was dependent on the genetic background. BC2S1_H1 plants carrying the pub17 mutation were crossed and backcrossed with the two parental lines (A and B) of the hybrid (Figure 17B). Different levels of autonecrosis were observed in some of the BC2S1 plants from line B, which is homozygous for the pub17 mutation (Figure 17C). However, F1 hybrids produced between line A-pub17pub17 and line B-1-pub17pub17 did not show autonecrosis. Furthermore, F1 plants of line A x line B carrying homozygous pub17 alleles showed normal plant phenotype and fruit set compared to F1 without the pub17 mutation (Figure 17D). Taken together, these results indicate that the EMS mutant allele of pub17 can be used in breeding without pleiotropic effects.

[0281] References Amselem J, Cuomo CA, van Kan JAL et al. (2011) Genomic analysis of the necrotrophic fungal pathogens Sclerotinia sclerotiorum and Botrytis cinerea.PLoS Genet 7:e1002230. Bai Y,Huang C-C,van der Hulst R,Meijer-Dekens F,Bonnema G,Lindhout P(2003)QTLs for tomato powdery mildew resistance(Oidium lycopersici)in Lycopersicum parviflorum G1.1601 co-localize with two qualitative powdery mildew resistance genes.Mol Plant-Microbe Interact 16:169-176. Benito EP,ten Have A,van’t Klooster JW,van Kan JAL(1998)Fungal and plant gene expression during synchronized infection of tomato leaves by Botrytis cinerea.Eur J Plant Pathol 104:207-220. Chetelat RT,Stamova L(1999)Tolerance to Botrytis cinerea.Acta Hortic 487:313-316. Cheung N,Tian L,Liu X, Li X(2020)The destructive fungal pathogen Botrytis cinerea-Insights from genes studied with mutant analysis.Pathogens 9:923. Davis J,Yu D,Evans W,Gokirmak T,Chetelat RT,Stotz HU(2009)Mapping of loci from Solanum lycopersicoides conferring resistance or susceptibility to Botrytis cinerea in tomato.Theor Appl Genet 119:305-314. Dean R, van Kan JAL, Pretorius ZA, Hammond-Kosack KE, Di Pietro A, Spanu PD, Rudd JJ, Dickman M, Kahmann R, Ellis J, Foster GD(2012).Mol Plant Pathol 13:414-430. Diez MJ,Nuet F(2008)Tomato.In:Vegetables II(pp.249-323).Springer,New York,NY. Egashira H, Kuwashima A, Ishiguro H, Fukushima K, Kaya T, Imanishi S(2000)Screening of wild accessions resistant to gray mold (Botrytis cinerea Pers.) in Lycopersicon.Acta Physiologiae Plantarum 22:324-326. Elad Y,Williamson B,Tudzynski P,Delen N(eds)(2007)Botrytis:Biology,Pathology and Control.Springer,Dordrecht,The Netherlands. Engler C,Kandzia R,Marillonnet S(2008)A one pot,one step,precision cloning method with high throughput capability.PloS One 3:e3647. Finkers R,van den Berg P,van Berloo R,ten Have A,van Heusden AW,van Kan JAL,Lindhout P(2007a)Three QTLs for Botrytis cinerea resistance in tomato.Theor Appl Genet 114:585-593. Finkers R,van Heusden AW,Meijer-Dekens F,van Kan JAL,Maris P,Lindhout P(2007b)The construction of a Solanum habrochaites LYC4 introgression line population and the identification of QTLs for resistance to Botrytis cinerea.Theor Appl Genet 114:1071-1080. Finkers R,Bai Y,van den Berg P,van Berloo R,Meijer-Dekens F,ten Have A,van Kan J,Lindhout P,van Heusden AW(2008)Quantitative resistance to Botrytis cinerea from Solanum neorickii.Euphytica 159:83-92. Guimaraes RL,Chetelat RT,Stotz HU(2004)Resistance to Botrytis cinerea in Solanum lycopersicoides is dominant in hybrids with tomato,and involves induced hyphal death.Eur J Plant Pathol 110:13-23. Hanika K,Schipper D,Chinnappa S,Oortwijn M,Schouten HJ,Thomma BPHJ,Bai Y(2021)Impairment of tomato WAT1 enhances resistance to vascular wilt fungi despite severe growth defects.Front Plant Sci 12:721674. He Q,McLellan H,Boevink PC,Sadanandom A,Xie C,Birch PRJ,Tian Z(2015)U-box E3 ubiquitin ligase PUB17 acts in the nucleus to promote specific immune pathways triggered by Phytophthora infestans.J Exp Bot 66:3189-3199. Huibers RP,Loonen AEHM,Gao D,Van den Ackerveken G,Visser RGF,Bai Y(2013)Powdery mildew resistance in tomato by impairment of SlPMR4 and SlDMR1.PLoS One 8:e67467. Jiang Y,Yu D(2016)The WRKY57 transcription factor affects the expression of jasmonate ZIM-domain genes transcriptionally to compromise Botrytis cinerea resistance.Plant Physiol 171:2771-2782. Jorgensen IH(1992)Discovery,characterization and exploitation of Mlo powdery mildew resistance in barley.Euphytica 63:141-152. Kusch S,Panstruga R(2017)mlo-based resistance:an apparently universal “weapon”to defeat powdery mildew disease.Mol Plant-Microbe Interact 30:179-189. Lin T,Zhu G,Zhang J,Xu X,Yu Q,Zheng Z,Zhang Z,Lun Y,Li S,Wang X,Huang Z,Li J,Zhang C,Wang T,Zhang Y,Wang A,Zhang Y,Lin K,Li C,Xiong G,Xue Y,Mazzucato A,Causse M,Fei Z,Giovannoni JJ,Chetelat RT,Zamir D,Staedler T,Li J,Ye Z,Du Y,Huang S(2014)Genomic analyses provide insights into the history of tomato breeding.Nature Genet 46:1220-1226. Livak KJ,Schmittgen TD(2001)Analysis of relative gene expression data using real-time quantitative PCR and the 2 -ΔΔC T method.Methods 25:402-408. Luria N,Smith E,Reingold V,Bekelman I,Lapidot M,Levin I,Elad N,Tam Y,Sela N,Abu-Ras A,Ezra N,Haberman A,Yitzhak L,Lachman O,Dombrovsky A(2017)A new Israeli Tobamovirus isolate infects tomato plants harboring Tm-2 2 resistance genes.PLoS ONE 12:e0170429. Marti E,Gisbert C,Bishop GJ,Dion MS,Garcia-Martinez JL(2006)Genetic and physiological characterization of tomato cv.Micro-Tom.J Exp Bot 57:2037-2047. McLellan H,Chen K,He Q,Wu X,Boevink PC,Tian Z,Birch PRJ(2020)The ubiquitin E3 ligase PUB17 positively regulates immunity by targeting a negative regulator,KH17,for degradation.Plant Comm 1:100020. Meissner R,Jacobson Y,Melamed S,Levyatuv S,Shalev G,Ashri A, Elkind Y,Levy A(1997)A new model system for tomato genetics.Plant J 12:1465-1472. Ni X,Tian Z,Liu J,Song B,Li J,Shi X,Xie C(2010)StPUB17,a novel potato UND / PUB / ARM repeat type gene,is associated with late blight resistance and NaCl stress.Plant Sci 178:158-169. Nicot PC,Moretti A,Romiti C,Bardin M,Caranta C,Ferriere H(2002)Differences in susceptibility of pruning wounds and leaves to infection by Botrytis cinerea among wild tomato accessions.TGS Report 52:24-26. Prins TW,Tudzynski P,von Tiedemann A,Tudzynski B,Ten Have A,Hansen ME,Tenberge K,van Kan JAL(2000)Infection strategies of Botrytis cinerea and related necrotrophic pathogens.In Kronstad JW(ed)Fungal Pathology(pp.33-64).Springer,Dordrecht. Qin T,Liu S,Zhang Z,Sun L,He X,Lindsey K,Zhu L,Zhang X(2019)GhCyP3 improves the resistance of cotton to Verticillium dahliae by inhibiting the E3 ubiquitin ligase activity of GhPUB17.Plant Mol Biol 99:379-393. Richards JK,Xiao C-L,Jurick II WM(2021)Botrytis spp.:A contemporary perspective and synthesis of recent scientific developments of a widespread genus that threatens global food security.Phytopathol111:432-436. RStudio Team(2016).RStudio:Integrated Development for R.RStudio,Inc.,Boston,MA URL http: / / www.rstudio.com / . Semagn K,Babu R,Hearne S,Olsen M(2014)Single nucleotide polymorphism genotyping using Kompetitive Allele Specific PCR(KASP):overview of the technology and its application in crop improvement.Mol Breed 33:1-14. Schouten HJ,Tikunov Y,Verkerke W,Finkers R,Bovy A,Bai Y,Visser RGF(2019)Breeding has increased the diversity of cultivated tomato in The Netherlands.Front Plant Sci 10:1606. Smith JE,Mengesha B,Tang H,Mengiste T,Bluhm BH(2014)Resistance to Botrytis cinerea in Solanum lycopersicoides involves widespread transcriptional reprogramming.BMC Genomics 15:334. Sun K,van Tuinen A,van Kan JAL,Wolters AMA,Jacobsen E,Visser RGF,Bai Y(2017)Silencing of DND1 in potato and tomato impedes conidial germination,attachment and hyphal growth of Botrytis cinerea.BMC Plant Biology 17:235. Sun K,Wolters AMA,Loonen AEHM,Huibers RP,van der Vlugt R,Goverse A,Jacobsen E,Visser RGF,Bai Y(2016)Down-regulation of Arabidopsis DND1 orthologs in potato and tomato leads to broad-spectrum resistance to late blight and powdery mildew.Transgenic Res 25:123-138. ten Have A,van Berloo R,Lindhout P,van Kan JAL(2007)Partial stem and leaf resistance against the fungal pathogen Botrytis cinerea in wild relatives of tomato.Eur J Plant Pathol 117:153-166. van Baarlen P,Woltering EJ,Staats M,van Kan JAL(2007)Histochemical and genetic analysis of host and non-host interactions of Arabidopsis with three Botrytis species:an important role for cell death control.Molecular Plant Pathology 8:41-54. van Kan JAL(2006)Licensed to kill:the lifestyle of a necrotrophic plant pathogen.Trends Plant Sci 11:247-253. van Kan JAL,Shaw MW,Grant-Downton RT(2014)Botrytis species:relentless necrotrophic thugs or endophytes gone rogue?Mol Plant Pathol 15:957-961. Verlaan MG,Szinay D,Hutton SF,de Jong H,Kormelink R,Visser RGF,Scott JW,Bai Y(2011)Chromosomal rearrangements between tomato and Solanum chilense hamper mapping and breeding of the TYLCV resistance gene Ty-1.Plant J 68:1093-1103. Williamson B,Tudzynski B,Tudzynski P,van Kan JAL(2007)Botrytis cinerea:the cause of gray mold disease.Mol Plant Pathol 8:561-580. Yan Z,Appiano M,van Tuinen A,Meijer-Dekens F,Schipper D,Gao D,Huibers R,Visser RGF,Bai Y,Wolters AMA(2021)Discovery and characterization of a novel tomato mlo mutant from an EMS mutagenized Micro-Tom population.Gene 12:719. Yang CW, Gonzalez-Lamothe R, Ewan RA, Rowland O, Yoshioka H, ​​Shenton M, Ye H, O'Donnell E, Jones JDG, Sadanandom A(2006)The E3 ubiquitin ligase activity of Arabidopsis PLANT U-BOX17 and its functional tobacco homolog ACRE276 are required for cell death and defense.Plant Cell 18:1084–1098. Zhang H, Zhang W, Jian G, Qi F, Si N (2016) The genes involved in the protective effects of phytohormones in response to Verticillium dahliae infection in Gossypium hirsutum.J Plant Biol 59:194-202. De Castro E, Sigrist CJA, Gattiker A, Bulliard V, Langendijk-Genevaux PS, Gasteiger E, Bairoch A, Hulo N.2006.ScanProsite: detection of PROSITE signature matches and ProRule-associated functional and structural residues in proteins.Nucleic Acids Research 34:W362-W365. Madeira F, Pearce M, Tivey ARN, Basutkar P, Lee J, Edbali O, Madhusoodanan N, Kolesnikov A, Lopez R. 2022. Search and sequence analysis tools services from EMBL-EBI in 2022. Nucleic Acids Research 50:W276-W279.

[0282] A brief description of the sequence Pub17 MicroTom wild type allele sequence (SEQ ID NO:1) [ka] Pub17 MicroTom modified allele sequence: A to T SNP at position 1477 is shown in bold (SEQ ID NO:2) [ka] Pub17 MicroTom wild type amino acid sequence (SEQ ID NO:3) [ka] Pub17 MicroTom modified amino acid sequence: the premature stop codon at position 493 is shown in bold (SEQ ID NO: 4) [ka] Primer C (SEQ ID NO:5) GGAACTTGGTGTAGCAGAAATTTCCACATTTC Primer D (SEQ ID NO:6) TTAGTGAGCTGAAACTCTAATCCGTAGAC PUB17_qPCR_Fw1 primer (SEQ ID NO: 7) GGAAGTGAAGGTGTTGCGA PUB17_qPCR_Rv1 primer (SEQ ID NO: 8) CTACTGCCATTTCCTCATTGC Ef1a-Fw (SEQ ID NO: 9) ATTGGAAACGGATATGCCCCT Ef1a-Rv (SEQ ID NO: 10) TCCTTACCTGAACGCCTGTCA Sequence of RNAi3 PUB17 silencing fragment (SEQ ID NO:11) [ka] Sequence of RNAi7 PUB17 silencing fragment (SEQ ID NO: 12) [ka]

[0283] [Table 6]

[0284] sgRNA1 (SEQ ID NO: 17) GAAATGACCTGAAATCGAA sgRNA2 (SEQ ID NO: 18) TTCTATATCGAGGTGGATGG sgRNA3 (SEQ ID NO: 19) GAGATTTGGGCACACCACAG sgRNA4 (SEQ ID NO: 20) CAGGAACAAAGCGCGCAAGG sgRNA forward primer (SEQ ID NO:21) TGTGGTCTCA [sgRNA sequence] GTTTTAGAGCTAGAAATAGCAAG sgRNA reverse primer (SEQ ID NO: 22) TGTGGTCTCAAGCGTAATGCCAACTTTGTAC

[0285] [Table 7]

[0286] NPTII_421_Fw primer (SEQ ID NO: 26) GAAGGGACTGGCTGCTATTG NPTII_421_Rv primer (SEQ ID NO: 27) AATATCACGGGTAGCCAACG 35S_597_Fw primer (SEQ ID NO: 28) TACAAAAGGCGGCAACAAAC 35S_597_Rv primer (SEQ ID NO: 29) AGCAAGCCTTGAATCGTCC KASP assay K_RTWT_For1 primer (SEQ ID NO: 30) GAAGGTGACCAAGTTCATGCTGTCTGGCTTTGATAGTTGGAGTTTTGT KASP assay K_RTmut_For1 primer (SEQ ID NO: 31) GAAGGTCGGAGTCAACGGATTGTCTGGCTTTGATAGTTGGAGTTTTGA KASP assay K_RT_Rev70 primer (SEQ ID NO: 32) GTTGCTGCAGCATTTTCCCGTG Primer SP_F (SEQ ID NO: 33) TGAGACGGACAAGATGACATGA Primer SP_R (SEQ ID NO: 34) TGTCATTTCCCCTTCCAAAGT

Claims

1. Tomato plants or plant materials having reduced levels, activity, or expression of the Pub17 protein, which confers increased resistance to a reference tomato plant or plant material to a pathogen that causes lesions.

2. The tomato plant or plant material according to claim 1, which is modified to reduce the level, activity, or expression of the Pub17 protein.

3. The tomato plant or plant material according to claim 1, comprising the modified Pub17 allele.

4. The modified Pub17 allele contains at least 70% identity with SEQ ID NO: 1 (wild-type Pub17 allele) or its ortholog or homolog, and the Pub17 allele contains mutations, according to claim 3, tomato plant or plant material.

5. The tomato plant or plant material according to claim 4, wherein the mutation is an SNP, preferably an A-to-T SNP.

6. The tomato plant or plant material according to claim 4, wherein the mutation is located within the 3' region of SEQ ID NO: 1 (wild-type allele), preferably within the ARM region of SEQ ID NO: 1 (wild-type allele), more preferably at nucleotide position 1477 of SEQ ID NO: 1 (wild-type allele), or at a corresponding position.

7. The pathogen that forms the lesion is a necrotrophic fungal pathogen, preferably a necrotrophic fungal pathogen selected from Alternaria alternata, Alternaria solani, gray mold fungus (Botrytis cinerea), Sclerotinia sclerotiorum, Tempyllium botryosum, Fusarium oxysporum, and Pythium species (Pythium spp), and preferably the pathogen that forms the lesion is gray mold fungus (Botrytis The tomato plant or plant material according to claim 1, which is cinerea.

8. A plant portion obtained from a tomato plant according to any one of claims 1 to 7.

9. Seeds capable of producing the tomato plant described in any one of claims 1 to 7.

10. A method for increasing resistance to pathogens that cause lesions in tomato plants or plant materials, comprising reducing the level, activity, or expression of Pub17 protein in the tomato plants or plant materials.

11. A method for producing tomato plants having increased resistance to pathogens that cause lesions, comprising reducing the level, activity, or expression of Pub17 protein in the tomato plants or plant material.

12. The method according to claim 10, comprising modifying the tomato plant or plant material to reduce the level, activity, or expression of the Pub17 protein in the tomato plant or plant material.

13. The method according to claim 10, comprising: obtaining a mutant population of tomato plants; and selecting modified tomato plants comprising a modified Pub17 allele having at least 70% identity with Sequence ID No. 1 (wild-type Pub17 allele) or its ortholog or homolog, and containing a mutation that results in a decrease in the level, activity, or expression of the Pub17 protein in the tomato plants or plant material.

14. A method for identifying tomato plants that have increased resistance to a disease-causing pathogen compared to a reference tomato plant or plant material, comprising: (a) determining the level, activity, or expression of Pub17 protein in one or more tomato plants and comparing it to the level, activity, or expression of Pub17 protein in a reference tomato plant; and (b) selecting tomato plants having a decrease in the level, activity, or expression of Pub17 protein compared to the reference tomato plant, wherein the decrease in the level, activity, or expression of Pub17 protein signifies increased resistance to a disease-causing pathogen compared to the reference tomato plant.

15. The method according to claim 14, comprising: (a) obtaining a population of mutant tomato plants; (b) screening the population of tomato plants for the presence of a Pub17 allele having at least 70% identity with Sequence ID No. 1 (wild-type Pub17 allele) or its ortholog or homolog, and containing a mutation that results in a decrease in the level, activity, or expression of the Pub17 protein in the tomato plant or plant material; and (c) selecting tomato plants having the Pub17 allele.

16. The method according to any one of claims 10 to 15, wherein the pathogen that forms the lesion is a necrotrophic fungal pathogen, preferably a necrotrophic fungal pathogen selected from Alternaria alternata, Alternaria solani, Botrytis cinerea, Sclerotinia sclerotiorum, Stemphylium botryosum, Fusarium oxysporum, and Pythium sp.

Images