Antisense Nucleic Acids for Use in Therapy for LMNA Mutation Carriers - Patent application

Abstract

The present invention relates to an isolated antisense molecule capable of inhibiting expression of the LMNA gene in a mammalian cell, the antisense molecule comprising an antisense nucleic acid strand that is substantially complementary to a target region of a transcript encoded by the LMNA gene, the antisense nucleic acid strand being at least complementary to SNP rs538089, rs505058, or rs4641 in the target region.

Description

[Technical field]

[0001] The present invention relates to antisense molecules suitable for the treatment of cardiac diseases. More specifically, the present invention relates to siRNAs and shRNAs suitable for use in the treatment of cardiac laminopathies, in particular dilated cardiomyopathy. [Background technology]

[0002] Therapies currently used for heart failure have been successful in improving symptoms and survival for most forms of heart failure. However, in a minority of patients, these evidence-based treatments do not stop the progression of the disease, which leaves these patients with treatment-resistant heart failure. Ironically, this most often involves young patients with inherited forms of heart failure, including those with heart failure caused by mutations in the Lamin A / C (LMNA) gene.

[0003] Currently, over 450 LMNA mutations have been reported, leading to a wide range of diseases (laminopathies), including dilated cardiomyopathy.

[0004] It is an object of the present invention to provide a treatment for inherited forms of heart failure caused by mutations in the LMNA gene. Summary of the Invention [Means for solving the problem]

[0005] The present invention provides an isolated antisense molecule capable of reducing or inhibiting expression of an allele of the LMNA gene in a mammalian cell, the antisense molecule comprising an antisense nucleic acid strand that is substantially complementary to a target region of a transcript encoded by the LMNA gene, the antisense nucleic acid strand being at least complementary to SNP rs538089, rs505058, or rs4641 in the target region.

[0006] Preferably, the antisense molecule is capable of reducing expression of a mutant LMNA allele, hi a most preferred embodiment, the antisense molecule is capable of reducing expression of a mutant LMNA allele while leaving a non-mutated LMNA allele unreduced.

[0007] Preferably, the isolated antisense molecule comprises: a. double-stranded nucleic acid (dsNA) or a chemically modified version thereof, or b.Antisense oligonucleotides (ASOs).

[0008] Preferably, the dsNA is an RNA, more preferably a short hairpin (shRNA) or a small interfering RNA (siRNA). Preferably, the dsNA is a dsRNA.

[0009] A preferred isolated antisense molecule according to the present invention comprises an antisense nucleic acid strand having a length of 15-30 nucleotides. Preferably, the antisense nucleic acid strand is complementary to at least 7, more preferably 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides in the target region. In some embodiments, there may be one or two mismatches between the antisense nucleic acid strand and the target region, provided that the antisense molecule specifically binds to a mutant LMNA allele. Preferably, the antisense nucleic acid strand is complementary to at least 7, more preferably 8, 9, 10, 11, or 12 consecutive nucleotides. Preferably, the target region comprises at least 15, 16, 17, 18, or 19 nucleotides in the target region.

[0010] In a preferred embodiment of the isolated antisense molecule, the target region is i. GAUGACCUGCUCCAUCACCACCACGUGAGUGGUAGCCGCCGCUGA (SEQ ID NO: 1), ii. GAUGACCUGCUCCAUCACCACCAUGUGAGUGGUAGCCGCCGCUGA (SEQ ID NO: 2), iii. GAUGACCUGCUCCAUCACCACCACGGCUCCCACUGCAGCAGCUC (SEQ ID NO: 3), and iv.GAUGACCUGCUCCAUCACCACCAUGGCUCCCACUGCAGCAGCUC (SEQ ID NO: 4) or a nucleic acid sequence which is at least 80% homologous thereto, more preferably at least 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% homologous thereto.

[0011] In another preferred embodiment, the target region is: i. CCUGCUCCAUCACCACCACGUGAGUGGUAGCCGCCGC (SEQ ID NO:5), ii. CCUGCUCCAUCACCACCAUGUGAGUGGUAGCCGCCGC (SEQ ID NO: 6), iii. CCUGCUCCAUCACCACCACGGCUCCCACUGCAGCAGC (SEQ ID NO: 7), and iv. CCUGCUCCAUCACCACCAUGGCUCCCACUGCAGCAGC (SEQ ID NO: 8) or a nucleic acid sequence which is at least 80% homologous thereto, more preferably at least 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% homologous thereto.

[0012] In a preferred embodiment of the isolated antisense molecule according to the present invention, the antisense nucleic acid strand comprises a nucleic acid sequence having a contiguous strand of at least 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides selected from the nucleic acid sequences set forth in SEQ ID NO: 151, SEQ ID NO: 152, SEQ ID NO: 153, or SEQ ID NO: 154. Preferably, the antisense nucleic acid strand comprises an antisense strand or a nucleic acid analogue sequence thereof as defined in Table 1. Preferably, the antisense nucleic acid strand further comprises a sense strand or a nucleic acid analogue sequence thereof as defined in Table 1. Preferably, the isolated antisense comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, and SEQ ID NO: 74.

[0013] In a preferred embodiment of the isolated dsNA, the dsNA comprises a sense nucleic acid strand of 15-30 nucleotides in length, the sense nucleic acid strand being complementary to the antisense nucleic acid strand, and the sense nucleic acid strand and the antisense nucleic acid strand form a double-stranded region.

[0014] Preferably, the antisense strand and the sense strand are operably linked by a loop strand to form a hairpin structure comprising a double-stranded structure and a loop structure. The loop structure may contain 4 to 13 nucleotides, such as 4, 5, or 6 nucleotides. Preferably, the loop contains the sequence UCAAGAC.

[0015] In a preferred embodiment of the isolated double-stranded nucleic acid (dsNA) or antisense oligonucleotide (ASO), the antisense nucleic acid strand is preferably 15-30 nucleotides long. Preferably, the dsNA is an isolated antisense strand of an RNA having a 5'-end and a 3'-end, preferably 15 nucleotides long, preferably 19 nucleotides long, where the antisense strand is preferably complementary to at least 15 nucleotides of the target region, preferably the 5'-end of the sense strand of the RNA is operably linked to a G nucleotide to form a first segment of the RNA, and an isolated antisense strand of an RNA having a 5'-end and a 3'-end, preferably 15-30 nucleotides long, where preferably at least 12 nucleotides of the antisense and sense strands are complementary to each other, preferably forming a small interfering RNA (siRNA) duplex under physiological conditions. Preferably, the siRNA silences only one allele of the LMNA gene in a cell. The duplex formed by the two strands of RNA can be 15 to 25 base pairs long, preferably 19 base pairs long. The antisense strand is preferably 19 nucleotides long. The sense strand is preferably 19 nucleotides long.

[0016] In the present invention, the sense and antisense strands of the RNA may be operably linked together by an RNA loop strand to form a hairpin structure to form a "double stranded structure" and a "loop structure". These loop structures may be nucleotides long, between 4 and 13, more preferably between 4 and 10 nucleotides. For example, the loop structures may be 4, 5, or 6 nucleotides long. The shRNA may further contain an overhang region. Such an overhang may be a 3' overhang region or a 5' overhang region. The overhang region may be, for example, 1 to 6 nucleotides long. In a preferred embodiment, the 5' overhang has the nucleic acid sequence CCGG. In a preferred embodiment, the 3' overhang has the nucleic acid sequence G.

[0017] The present invention further provides an isolated double-stranded nucleic acid or a nucleic acid encoding an ASO of the present invention. In a preferred embodiment, the antisense RNA of the present invention, such as an shRNA, is encoded by an oligonucleotide having the following structure: 5'-CCGGAA-19bp sense strand-TCAAGAC-19bp antisense strand-TTTTTTTG-3', and reverse 5'-AATTCAAAAAAA-19bp sense strand-GTCTTGA-19bp antisense strand-TT-3'. In this specification, the sense strand is the exact targeted sequence in the mRNA, and the antisense strand is its reverse complementary sequence that ultimately binds to the mRNA and induces its degradation and / or inhibition.

[0018] The present invention also provides an expression cassette comprising a nucleic acid encoding the antisense nucleic acid strand of the present invention. In a preferred embodiment, the nucleic acid encoding the antisense nucleic acid strand of the present invention comprises a nucleic acid sequence according to any of SEQ ID NOs: 75 to 150.

[0019] These expression cassettes may further contain a promoter. Such a promoter may be a regulatable promoter or a constitutive promoter. Examples of suitable promoters include CMV, RSV, pol II, or pol III promoters. The expression cassette may further contain a polyadenylation signal, such as a synthetic minimal polyadenylation signal. The expression cassette may further contain a marker gene. In one embodiment, the expression cassette comprises two nucleic acids encoding the antisense nucleic acid strands according to the invention, the first nucleic acid encoding an antisense strand that reduces Lamin A isoform, and the second nucleic acid encoding an antisense strand that can reduce Lamin C isoform. The expression of the antisense nucleic acid strands is preferably regulatable so that only one of the antisense nucleic acid strands is expressed or can be expressed in a target cell.

[0020] The present invention provides a vector containing the above-mentioned expression cassette. Furthermore, the vector may contain two expression cassettes, a first expression cassette containing a nucleic acid encoding the antisense strand of the RNA duplex, and a second expression cassette containing a nucleic acid encoding the sense strand of the RNA duplex. Examples of suitable vectors include adenovirus, lentivirus, adeno-associated virus (AAV), poliovirus, HSV, or mouse moloney-based viral vectors. In a preferred embodiment, the vector is a lentivirus vector. In another preferred embodiment, the vector is an AAV. Preferably, the expression cassette encodes either an ASO or a dsNA as described above.

[0021] The present invention further provides a cell comprising an expression cassette according to the present invention. Preferably, the cell is a mammalian cell, preferably a human cell. Preferably, the cell is a cardiac cell, preferably a human induced pluripotent stem cell-derived cardiomyocyte (hiPSC-CM).

[0022] The present invention further provides a pharmaceutical composition for reducing the expression of the LMNA gene in an organism, comprising an antisense molecule of the present invention and a pharma- ceutically acceptable carrier.

[0023] The present invention further provides an isolated antisense molecule according to the invention for use in medical treatment.

[0024] The present invention further provides an isolated antisense molecule according to the invention, a nucleic acid encoding the isolated antisense molecule of the invention, an expression cassette of the invention or an expression vector of the invention, a pharmaceutical composition according to the invention for use in the treatment of heart failure, preferably wherein the treatment is the treatment of a laminopathies, preferably dilated cardiomyopathy.

[0025] The present invention relates to a method for selecting antisense molecules suitable for the medical treatment of a disease caused by an autosomal dominant mutation present on a mutant allele of a gene, comprising the steps of: a. providing a nucleic acid sample from a subject suffering from a disease caused by an autosomal dominant mutation present on a mutant allele of a gene; b. determining the heterozygosity of the mutant allele of the gene responsible for the disease; c. determining the presence of heterozygous SNPs in the gene; d. determining the nucleic acid sequence of a target region containing a heterozygous SNP of a mutant allele of the gene; e. selecting an isolated antisense molecule that is complementary to the target nucleic acid strand.

[0026] In a preferred embodiment, the antisense molecule is as described herein. Preferably, the gene is the LMNA gene. Preferably, the SNP is selected from rs538089, rs505058, and rs4641.

[0027] The disease in question is heart failure, specifically a laminopathy such as dilated cardiomyopathy.

[0028] The present invention provides an in vitro method for reducing expression of a mutant LMNA allele in a cell, comprising: (a) introducing into a cell an antisense molecule of the invention, which, upon introduction into a cell expressing a LMNA mutant allele, reduces expression of the LMNA mutant allele; (b) maintaining the cells produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of the LMNA variant allele, thereby reducing expression of the LMNA variant allele in the cells. Preferably, said expression of the LMNA variant gene is at least 20%. [Brief description of the drawings]

[0029] [Figure 1]An overview of the siRNAs designed and tested is shown. The black outlined rectangle indicates the common shared exon 10 between lamin A and lamin C isoforms. After SNP rs4641 (nucleotides in bold, C nucleotide = C allele, T nucleotide = T allele), lamin C continues in exon 10B (grey hatched rectangle) and lamin A continues in exon 11 (grey filled rectangle) and exon 12 (not shown). shRNAs were designed to target either the C or T allele for each specific isoform. [Diagram 2] Summary of results of shRNA targeting lamin C in LMNA H222P hiPSC-CMs. Figure 2A shows the relative expression of the C allele, T allele, and total lamin A after treatment with shRNA targeting the C allele of rs4641 in lamin C. Figure 2B shows the relative expression of the C allele, T allele, and total lamin C after treatment with shRNA targeting the C allele of rs4641 in lamin C. Figure 2C shows the relative expression of the C allele, T allele, and total lamin A after treatment with shRNA targeting the T allele of rs4641 in lamin C. Figure 2D shows the relative expression of the C allele, T allele, and total lamin C after treatment with shRNA targeting the T allele of rs4641 in lamin C. Bars present the mean and error bars present SEM. N=4-12 in 3-4 experiments. [Diagram 3]A summary of the results of shRNA targeting the C allele of rs4641 in lamin A in LMNA H222P and healthy hiPSC-CMs is shown. Figure 3A shows the relative expression of the C allele, T allele, and total lamin A after treatment with shRNA targeting the C allele of rs4641 in lamin A in LMNA H222P hiPSC-CMs. Figure 3B shows the relative expression of the C allele, T allele, and total lamin C after treatment with shRNA targeting the C allele of rs4641 in lamin A in LMNA H222P hiPSC-CMs. Figure 3C shows the relative expression of the C allele, T allele, and total lamin A after treatment with shRNA targeting the C allele of rs4641 in lamin A in healthy hiPSC-CMs. Figure 3D shows the relative expression of the C allele, T allele, and total lamin C after treatment with shRNA targeting the C allele of rs4641 in lamin A in healthy hiPSC-CMs. Bars represent the mean and error bars represent SEM. N=4-9 in 2-3 experiments. [Figure 4] A summary of the results of shRNA targeting the T allele of rs4641 in lamin A in LMNA H222P and healthy hiPSC-CMs is shown. Figure 4A shows the relative expression of the C allele, T allele, and total lamin A after treatment with shRNA targeting the T allele of rs4641 in lamin A in LMNA H222P hiPSC-CMs. Figure 4B shows the relative expression of the C allele, T allele, and total lamin C after treatment with shRNA targeting the T allele of rs4641 in lamin A in LMNA H222P hiPSC-CMs. Figure 4C shows the relative expression of the C allele, T allele, and total lamin A after treatment with shRNA targeting the T allele of rs4641 in lamin A in healthy hiPSC-CMs. Figure 4D shows the relative expression of the C allele, the T allele, and total lamin C after treatment with shRNA targeting the T allele of rs641 in lamin A in healthy hiPSC-CMs. Bars represent the mean and error bars represent SEM. N=5-9 in 2-3 experiments. [Diagram 5]Figure 1 shows improvement of nuclear circularity following downregulation of mutant LMNA alleles by targeting the T allele of rs4641 with shRNA T17 in LMNA H222P hiPSC-CMs. Treatment of H222P hiPSC-CMs with negative control shRNA (NC), allele-specific shRNA C17 (C17), which downregulates wild-type LMNA alleles by targeting the C allele of rs4641, and allele-specific shRNA T17 (T17), which downregulates mutant LMNA alleles by targeting the T allele of rs4641. N=305-364 from three different differentiations. Black bars indicate the mean, ***=p<0.001. [Figure 6] Schematic diagram of targeting siRNA. LMNA gene codes for two mRNA splice isoforms, LMNA and LMNC. SNP rs4641 (shown in bold) is the last nucleotide shared by both isoforms in the middle of exon 10, after which LMNC does not splice and ends in exon 10, and LMNA splices immediately after rs4641 into exon 11. For splicing, LMNA (lower panel of siRNA) and LMNC (upper panel of siRNA) specific siRNAs need to be designed, and their sequences are shown in the figure to test for allele specificity. Please note that siRNA sequences are written from 3' to 5', while all other sequences are written from 5' to 3'. [Figure 7] shRNA design and its conversion into active siRNA. Virus-encoded shRNA consists of two complementary sequences (shaded in grey) with a non-complementary sequence in the middle. When transcribed from the virus, these sequences form a hairpin-like structure, where the complementary parts bind and the non-complementary parts form a loop. This loop is removed by the enzyme Dicer to form an siRNA duplex. Of this duplex, the so-called guide or antisense strand (shaded in dark grey) is incorporated into the RNA-induced silencing complex and binds to and degrades the target mRNA, while the other passenger or sense strand of the siRNA duplex is degraded. [Figure 8-1]Effect of shRNA targeting the C allele of LMNA on allele-specific expression of LMNA and LMNC splice isoforms, respectively. A&C allele-specific expression of wild-type (C) and mutant (T) alleles of LMNA and LMNC, respectively, and effect on total LMNA expression levels, compared to expression in the SCR negative control condition. B&D show the percentage of expression of mutant (T) and wild-type alleles (C) of LMNA and LMNC, respectively, to visualize the balance between expression of the two alleles. [Figure 8-2] See description of Figure 8-1. [Figure 9] Schematic diagram of mismatches in shRNA-C17 and shRNA-T17 targeting LMNA splice isoforms. The original sequences and shRNAs with their respective extra mismatches (indicated in bold and underlined) are shown in the figure. Note that the siRNA sequence is written from 3' to 5', while all other sequences are written from 5' to 3'. [Figure 10-1] Effect of additional mismatches in shC17 targeting the C allele of LMNA. A&C: Effects on allele-specific expression of wild-type (C) and mutant (T) alleles of LMNA and LMNC, respectively, and total LMNA / C expression levels, compared to expression in the SCR negative control condition. B&D show the percentage of expression of mutant (T) and wild-type alleles (C) of LMNA and LMNC, respectively. [Figure 10-2] See description of Figure 10-1. [Figure 11-1] Effect of shRNA targeting the T allele of LMNA on allele-specific expression of LMNA and LMNC splice isoforms, respectively. A&C Allele-specific expression of wild-type (C) and mutant (T) alleles of LMNA and LMNC, respectively, and effect on total LMNA expression levels, compared to expression in the SCR negative control condition. B&D show the percentage of expression of mutant (T) and wild-type alleles (C) of LMNA and LMNC, respectively, to visualize the balance between expression of the two alleles. [Figure 11-2] See description of Figure 11-1. [Figure 12-1] Effect of an additional mismatch in shT17 targeting the T allele of LMNA. A&C allele-specific expression of wild-type (C) and mutant (T) alleles of LMNA and LMNC, respectively, and effect on total LMNA / C expression levels, compared to expression in the SCR negative control condition. B&D show the percentage of expression of mutant (T) and wild-type alleles (C) of LMNA and LMNC, respectively, to visualize the balance between expression of the two alleles. [Figure 12-2] See description of Figure 12-1. [Figure 13-1] Effect of shRNA targeting the C allele of LMNC on allele-specific expression of LMNC and LMNA splice isoforms, respectively. A&C allele-specific expression of wild-type (C) and mutant (T) alleles of LMNC and LMNA, respectively, and effect on total LMNA / C expression levels, compared to expression in the SCR negative control condition. B&D show the percentage of expression of mutant (T) and wild-type alleles (C) of LMNC and LMNA, respectively, to visualize the balance between expression of the two alleles. [Figure 13-2] See description of Figure 13-1. [Figure 14] Schematic diagram of mismatches in shRNA-C11, shRNA-C13, and shRNA-T14 targeting LMNC splice isoforms. The original sequences and shRNAs with each extra mismatch (indicated in bold and underlined) are shown in the figure. Note that the siRNA sequence is written from 3' to 5', while all other sequences are written from 5' to 3'. [Figure 15-1]Effect of an additional mismatch in shC11 targeting the C allele of LMNC. Effect on A&C allele-specific expression of wild-type (C) and mutant (T) alleles of LMNC and LMNA, respectively, and total LMNA / C expression levels, compared to expression in the SCR negative control condition. B&D show the percentage of expression of mutant (T) and wild-type alleles (C) of LMNC and LMNA, respectively, to visualize the balance between expression of the two alleles. [Figure 15-2] See description of Figure 15-1. [Figure 16-1] Effect of an additional mismatch in shC13 targeting the C allele of LMNC. A&C allele-specific expression of wild-type (C) and mutant (T) alleles of LMNC and LMNA, respectively, and effect on total LMNA / C expression levels, compared to expression in the SCR negative control condition. B&D show the percentage of expression of mutant (T) and wild-type alleles (C) of LMNC and LMNA, respectively, to visualize the balance between expression of the two alleles. [Figure 16-2] See description of Figure 16-1. [Figure 17-1] Effect of shRNA targeting the T allele of LMNC on allele-specific expression of LMNC and LMNA splice isoforms, respectively. A&C Allele-specific expression of wild-type (C) and mutant (T) alleles of LMNC and LMNA, respectively, and effect on total LMNA / C expression levels, compared to expression in the SCR negative control condition. B&D show the percentage of expression of mutant (T) and wild-type alleles (C) of LMNC and LMNA, respectively, to visualize the balance between expression of the two alleles. [Figure 17-2] See description of Figure 17-1. [Figure 18-1]Effect of additional mismatches in shT14 targeting the T allele of LMNC. A&C allele-specific expression of wild-type (C) and mutant (T) alleles of LMNC and LMNA, respectively, and effect on total LMNA / C expression levels, compared to expression in the SCR negative control condition. B&D show the percentage of expression of mutant (T) and wild-type alleles (C) of LMNC and LMNA, respectively, to visualize the balance between expression of the two alleles. [Figure 18-2] See description of Figure 18-1. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0030] The present invention is based on the surprising discovery of allele-specific silencing of the LMNA gene through expression of small interfering RNA (siRNA). By targeting the region of the gene containing the single nucleotide polymorphism rs4641, the inventors significantly reduced the expression of a specific allele of this gene. By using genomic DNA derived from healthy controls and the LMNA H222P human induced pluripotent stem cell (hiPSC) line, the inventors sequenced the PCR amps containing rs4641 and found that both hiPSC lines were heterozygous carriers of the SNP rs4641 (C / T) and did not carry other variants.

[0031] SNP rs4641 is the last shared nucleotide of two mRNA isoforms derived from LMNA, namely Lamin A and Lamin C. Both isoforms share the first 566 amino acids, but differ after exon 10 due to alternative splicing. Lamin A follows exons 11 and 12, and Lamin C follows exon 10B. Because SNP rs4641 is the last shared nucleotide of both isoforms, we designed isoform-specific siRNAs. Furthermore, LMNA mutations, i.e. disease-causing mutations, can be located on both alleles (C or T alleles) of the SNP, meaning that we designed siRNAs for both SNP alleles on both Lamin A and Lamin C isoforms.

[0032] We show an improvement in nuclear circularity following downregulation of the mutant allele of LMNA with shRNA targeting the above regions, demonstrating that this silencing is effective.

[0033] One goal of the present invention is to provide a treatment in which mutant alleles are suppressed. To distinguish between mutant alleles and wild type (= healthy) alleles, we use a common variant (SNP rs4641) in LMNA. Therefore, to determine which allele needs to be suppressed, it is necessary to determine which allele the mutation is located on. For example, if a certain mutation is located on the SNP T allele (i.e., the mutation and SNP T are in cis), the SNP T allele needs to be suppressed. However, if the mutation is located on the SNP C allele (i.e., the mutation and SNP C are in cis), the SNP C allele needs to be suppressed. Since we suppress mutant alleles regardless of the specific mutation that causes laminopathies, the isolated antisense molecules of the present invention work for all mutations in the LMNA gene.

[0034] We used cell lines carrying LMNA H222P mutation. H222P mutation is located on rs4641T allele. Therefore, by suppressing rs4641C allele, they will potentially exacerbate disease (because wild type is healthy allele), but by suppressing rs4641 T allele, they will potentially alleviate disease (suppressing mutant allele).

[0035] I. Definition The term "antisense molecule" refers to an oligonucleotide molecule that contains sequence complementarity to target RNA molecules, such as mRNA, viral RNA, or other RNA species, and reduces the function of those target RNAs after sequence-specific binding.Examples of antisense molecules are provided by the terms antisense oligonucleotide (ASO), siRNA, shRNA, interference RNA molecule, and antisense oligomer, which terms may be used interchangeably hereinafter.

[0036] The term "nucleic acid" refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form, composed of monomers (nucleotides) containing sugars, phosphates, and bases that are either purines or pyrimidines. Unless otherwise limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences, as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues (Batzer et al., (1991) Nucleic Acids Research 19:5081; Ohtsuka et al., (1985) J Biol Chem 260:2605-2608; Rossolini et al., (1994) Mol Cell Probes 8:91-98).

[0037] A "nucleic acid fragment" is a portion of a given nucleic acid molecule.

[0038] The term "nucleotide sequence" refers to a polymer of DNA or RNA, which may be single-stranded or double-stranded, optionally containing synthetic, non-natural, or altered nucleotide bases that can be incorporated into a DNA or RNA polymer.

[0039] The terms "nucleic acid," "nucleic acid molecule," "nucleic acid fragment," "nucleic acid sequence or segment," or "polynucleotide" are used interchangeably and may be used interchangeably with gene, cDNA, DNA encoded by a gene, and RNA.

[0040] The term "nucleic acid analog" refers to compounds that are similar (structurally similar) to naturally occurring RNA and DNA. For example, RNA is a naturally occurring nucleic acid analog of DNA. Nucleic acids are chains of nucleotides that are composed of three parts: a phosphate backbone, a pentose sugar, either ribose or deoxyribose, and one of four nucleobases. Analogs can have any of these modified versions. Typically, analog nucleobases confer, among other things, different base-pairing and base-stacking properties. Examples include universal bases that can pair with all four canonical bases, and phosphate-sugar backbone analogs such as PNA. Artificial nucleic acids include peptide nucleic acids (PNAs), morpholinos and locked nucleic acids (LNAs), as well as glycol nucleic acids (GNAs), threose nucleic acids (TNAs), and hexitol nucleic acids (HNAs). Each of these is distinguished from naturally occurring DNA or RNA by changes in the backbone of the molecule.

[0041] The term "nucleic acid analog sequence of a particular SEQ ID NO. " refers to a nucleic acid sequence similar to the SEQ ID NO. For example, SEQ ID NO. 83 refers to the DNA sequence ccggaaatca ccaccacgtg agtggtcaag acccactcac gtggtggtga ttttttttg. The RNA analog nucleic acid has thymidine replaced for uracil. Another example of the nucleic acid analog sequence of SEQ ID NO. 83 is the PNA nucleic acid sequence with the same base.

[0042] The term "chemically modified version of a nucleic acid" refers to a chemical modification of one or more nucleotides in a nucleic acid that does not impair the binding of said nucleic acid to its complementary strand. A lengthy description of many known chemical modifications is described in published PCT patent application WO2003 / 70918, which is incorporated herein by reference, and will not be repeated here. Suitable modifications include, but are not limited to, modifications of the sugar moiety (i.e., the 2' position of the sugar moiety, such as, for example, 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78, 486-504), i.e., alkoxyalkoxy groups) or the base moiety (i.e., non-natural or modified bases that maintain the ability to pair with another specific base in an alternative nucleotide strand). Other modifications include so-called "backbone" modifications, including, but not limited to, replacing phosphoester groups (connecting adjacent ribonucleotides with, for example, phosphorothioates, chiral phosphorothioates, or phosphorodithioates).

[0043] The antisense or dsNA molecule of the present invention may be composed of naturally occurring nucleotides or may be composed of at least one modified nucleotide, such as 2'-O-methyl modified nucleotides, nucleotides containing 5'-phosphorothioate groups, and terminal nucleotides linked to cholesteryl derivatives or dodecanoic acid bisdecylamide groups. Alternatively, the modified nucleotide may be selected from the following group: 2'-deoxy-2'-fluoro modified nucleotides, 2'-deoxy modified nucleotides, locked nucleotides, abasic nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, phosphoramidates, and non-natural base containing nucleotides.

[0044] The term "isolated and / or purified" refers to the in vitro isolation of a nucleic acid, e.g., a DNA or RNA molecule, from its natural cellular environment and from association with other components of the cell, such as nucleic acids or polypeptides, so that it can be sequenced, replicated, and / or expressed. For example, an "isolated nucleic acid" can be a DNA molecule containing less than 31 consecutive nucleotides that are transcribed into siRNA. Such an isolated siRNA can, for example, be complementary to a sequence in a gene of interest, or hybridize to form a hairpin structure having a double stranded 21 base pairs in length that remains stably bound under stringency. Thus, an RNA or DNA is "isolated" in that it is free of at least one contaminating nucleic acid with which it is normally associated in the natural source of the RNA or DNA, and preferably is substantially free of any other mammalian RNA or DNA. The phrase "free of at least one contaminating source nucleic acid with which it is normally associated" includes cases where a nucleic acid is reintroduced into a source or natural cell, but is in a different chromosomal location or is adjacent to a nucleic acid sequence that is not otherwise normally found in the source cell, e.g., a vector or plasmid.

[0045] Fragments and variants of the disclosed nucleotide sequences and proteins or partial length proteins encoded thereby are also encompassed by the present invention. By "fragment" or "portion" is meant the full length or less than full length of a nucleotide sequence encoding a polypeptide or protein, or its amino acid sequence. It should be noted that the terms "polypeptide" and "protein" are used interchangeably. Both terms refer to a molecule made up of a chain of amino acid residues linked together via covalent peptide bonds.

[0046] The term "gene" is used broadly to refer to any segment of nucleic acid associated with a biological function. Thus, genes include coding sequences and / or regulatory sequences necessary for their expression. For example, "gene" refers to a nucleic acid fragment that expresses an mRNA, a functional RNA, or a specific protein, including regulatory sequences. "Gene" also includes non-expressed DNA segments, for example, that form recognition sequences for other proteins. "Gene" can be obtained from a variety of sources, including cloning from a source of interest or synthesis from known or predicted sequence information, and can include sequences designed to have desired parameters. "Allele" is one of several alternative forms of a gene occupying a given locus on a chromosome.

[0047] A "variant" of a molecule is a sequence that is substantially similar to the sequence of a naturally occurring molecule. For nucleotide sequences, variants include sequences that, due to the degeneracy of the genetic code, code for the same amino acid sequence of a naturally occurring protein. Naturally occurring allelic variants such as these can be identified using molecular biology techniques, such as, for example, polymerase chain reaction (PCR) and hybridization techniques. Variant nucleotide sequences also include synthetically derived nucleotide sequences, such as those generated by using site-directed mutagenesis to code for naturally occurring proteins, and those that code for polypeptides with amino acid substitutions. Generally, the nucleotide sequence variants of the present invention will have at least 40%, 50%, 60%, -70%, e.g., 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, -79%, typically at least 80%, e.g., 81%-84%, at least 85%, e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, -98% sequence identity to the naturally occurring (endogenous) nucleotide sequence.

[0048] "Conservatively modified variations" of a particular nucleic acid sequence refer to nucleic acid sequences that code for the same or essentially identical amino acid sequences. Due to the degeneracy of the genetic code, a large number of functionally identical nucleic acids code for any given polypeptide. For example, the codons CGT, CGC, CGA, CGG, AGA, and AGG all code for the amino acid arginine. Thus, at every position where arginine is specified by a codon, the codon can be modified to any of the corresponding codons described without modifying the encoded protein. Such nucleic acid variations are "silent variations," which are one species of "conservatively modified variations." Every nucleic acid sequence described herein that codes for a polypeptide also describes all possible silent variations, unless otherwise noted. Those skilled in the art will recognize that each codon in a nucleic acid (except ATG, which is usually the only codon for methionine) can be modified by standard techniques to result in a functionally identical molecule. Thus, each "silent variation" of a nucleic acid that codes for a polypeptide is implied in each described sequence.

[0049] A "recombinant DNA molecule" is a combination of DNA sequences that are joined together using recombinant DNA techniques and procedures used to ligate DNA sequences together, e.g., as described in Sambrook and Russell (2001) "Molecular Cloning". CSHL Press: Long Island, NY, USA.

[0050] A "homologous" DNA or RNA sequence is one that is naturally associated with the host cell into which it is introduced.

[0051] "Vector" is defined to include, inter alia, any viral vector, and any plasmid, cosmid, phage, or binary vector, in double- or single-stranded, linear or circular form, which may or may not be self-transmissible or mobilizable and which is capable of transforming a prokaryotic or eukaryotic host either by integration into a cellular genome or present extrachromosomally (e.g., an autonomously replicating plasmid having an origin of replication).

[0052] As used herein, "expression cassette" refers to a nucleic acid sequence capable of directing the expression of a particular nucleotide sequence in a suitable host cell, which may include a promoter operably linked to the nucleotide sequence of interest, which may be operably linked to a termination signal. It may also include sequences necessary for proper translation of the nucleotide sequence. The coding region usually codes for a protein of interest, but may also code for a functional RNA of interest, such as an antisense molecule according to the invention, an antisense RNA, a non-translated RNA in sense or antisense orientation, or an siRNA. The expression cassette containing the nucleotide sequence of interest may be chimeric. The expression cassette may also be naturally occurring, but obtained in a recombinant form useful for heterologous expression. The expression of the nucleotide sequence in the expression cassette may be under the control of a constitutive promoter or a regulatable promoter that initiates transcription only when the host cell is exposed to some specific stimulus. In the case of a multicellular organism, the promoter may also be specific to a particular tissue or organ or developmental stage.

[0053] "Gene silencing" refers to the suppression of gene expression, e.g., transgene, heterologous gene, and / or endogenous gene expression. Gene silencing can be mediated through processes that affect transcription and / or through processes that affect post-transcriptional mechanisms. In some embodiments, gene silencing occurs when siRNA initiates the degradation of the mRNA of a gene of interest in a sequence-specific manner via RNA interference. In some embodiments, gene silencing can be allele-specific. "Allele-specific" gene silencing refers to the specific silencing of one allele of a gene.

[0054] "RNA interference (RNAi)" is the process of sequence-specific, post-transcriptional gene silencing initiated by siRNA. RNAi is found in many organisms, such as fruit flies, nematodes, fungi, and plants, and is thought to be involved in antiviral defense, regulation of transposon activity, and regulation of gene expression. During RNAi, siRNA induces the degradation of target mRNA, resulting in sequence-specific reduction or even inhibition of gene expression.

[0055] "siRNA" or "small interfering ribonucleic acid" according to the present invention has the meaning known in the art, including the following aspects: siRNA consists of two strands of ribonucleotides that hybridize along complementary regions under physiological conditions. The strands are separate, but in certain embodiments, can be linked by a molecular linker. The individual ribonucleotides can be unmodified naturally occurring ribonucleotides, unmodified naturally occurring deoxyribonucleotides, or they can be chemically modified or synthesized as described elsewhere herein.

[0056] "RNA duplex" or "dsRNA" refers to a structure formed by complementary pairing between two regions of an RNA molecule. An siRNA is "targeted" to a gene in that the nucleotide sequence of the duplex portion of the siRNA is complementary to the nucleotide sequence of the LMNA gene. In some embodiments, the length of the duplex of the siRNA is less than 30 nucleotides. In some embodiments, the duplex can be 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, or 10 nucleotides long. In some embodiments, the length of the duplex is 19-25 nucleotides long. The RNA duplex portion of the siRNA can be part of a hairpin structure. In addition to the duplex portion, the hairpin structure can contain a loop portion disposed between the two sequences forming the duplex. The loop can vary in length. In some embodiments, the loop is 5, 6, 7, 8, 9, 10, 11, 12, or 13 nucleotides in length. The hairpin structure can also contain a 3' or 5' overhang portion. In some embodiments, the overhang is a 3' or 5' overhang that is 0, 1, 2, 3, 4, or 5 nucleotides in length.

[0057] The siRNA can be encoded by a nucleic acid sequence, and the nucleic acid sequence can also include a promoter. The nucleic acid sequence can also include a polyadenylation signal. In some embodiments, the polyadenylation signal is a synthetic minimal polyadenylation signal.

[0058] As used herein, "nucleotide overhang" refers to an unpaired nucleotide(s) that protrudes from the double-stranded structure of a dsRNA when the 3'-end of one strand of the dsRNA extends beyond the 5'-end of the other strand, or vice versa. "Blunt" or "blunt-ended" means that the dsRNA has no unpaired nucleotides at its end, i.e., no nucleotide overhangs. A "blunt-ended" dsRNA is a dsRNA that is double-stranded throughout its entire length, i.e., has no nucleotide overhangs at either end of the molecule.

[0059] The term "antisense strand" refers to the strand of a dsRNA which contains a region that is substantially complementary to a target sequence.

[0060] As used herein, the term "region of complementarity" refers to the region on the antisense strand that is substantially complementary to a sequence, e.g., a target sequence, as defined herein.

[0061] As used herein, the term "sense strand" refers to the strand of a dsRNA that includes a region that is substantially complementary to a region of the antisense strand.

[0062] As used herein, "treating" refers to ameliorating at least one symptom of a disease or condition, curing it, and / or preventing its onset.

[0063] As used herein, the term "encoded by" means that the DNA sequence in the gene or SEQ ID NO: is transcribed into an RNA of interest.

[0064] The term "can reduce the expression of the LMNA gene" refers to the process of substantially silencing the LMNA gene through RNA interference. RNA interference can be induced by antisense molecules, including those that are caused by double-stranded nucleic acid (dsNA) or single-stranded antisense oligonucleotides (ASO).

[0065] The "lamin A / C" gene is also known as the LMNA gene. The LMNA gene encodes an mRNA that is spliced ​​into several alternative mRNAs that encode different lamin proteins, such as lamin A or lamin C.

[0066] The process of substantially silencing the LMNA gene through RNA interference is preferably directed to specifically silencing an allele of the LMNA gene, while the expression of the second allele is not modified by the process.In a preferred embodiment, one allele of the LMNA gene is silenced.The advantage is that it allows silencing mutant alleles, which alleviates the disease phenotype of many hereditary forms of heart failure.Currently, more than 450 LMNA mutations have been reported, leading to a wide range of diseases (laminopathies), including dilated cardiomyopathy.Although it has not been possible to identify mutation hotspots for all these laminopathies, the majority of these mutations share the fact that they have a dominant negative effect, indicating that mutant gene products cause phenotypes in the presence of wild-type products.

[0067] As used herein, the term "mutant LMNA allele" or "mutant LMNA gene" refers to a variant of a LMNA allele or gene whose product adversely affects nuclear structure and function. Preferably, the mutant LMNA allele has a dominant negative effect, meaning that heterozygous expression of the mutant allele adversely affects nuclear structure and function.

[0068] The terms "antisense oligomer" or "antisense compound" or "antisense oligonucleotide" or "oligonucleotide" are used interchangeably and each refers to a sequence of cyclic subunits (i.e., purines or pyrimidines) linked by intersubunit bonds that allow hybridization to a target sequence in a nucleic acid (typically RNA) by Watson-Crick base pairing to form a nucleic acid:oligomer heteroduplex within the target sequence. The cyclic subunits may be based on ribose or another pentose sugar, or, in certain embodiments, morpholino groups. Peptide nucleic acids (PNAs), locked nucleic acids (LNAs), and 2'-O-methyl oligonucleotides, as well as other antisense agents known in the art, are also contemplated.

[0069] Such antisense oligomers can be designed to block or inhibit translation of an mRNA, or inhibit natural pre-mRNA splice processing, or induce degradation of the targeted mRNA, and may be said to be "directed at" or "targeted against" the target sequence to which they hybridize. In certain embodiments, the target sequence is the region surrounding or including the AUG start codon of the mRNA, the 3' or 5' splice site of the preprocessed mRNA, or the branch point. The target sequence may be within an exon or within an intron, or a combination. Target sequences for splice sites may include mRNA sequences that have their 5' end 1 to about 25 base pairs downstream of the normal splice acceptor junction in the preprocessed mRNA. Preferred target sequences for splices are any region of the preprocessed mRNA that includes the splice site, or is entirely contained within an exon coding sequence, or spans the splice acceptor or donor site. The preferred target sequences in the target region of a gene include single nucleotide polymorphisms (SNPs), for example allowing the degradation of specific alleles carrying mutations. More generally, when targeted to a target nucleic acid in the manner described above, the oligomer is said in the present invention to be "targeted to" a biologically relevant target, such as the human LMNA gene pre-mRNA encoding the Lamin A protein. The antisense oligomer is preferably designed to induce the degradation of specific alleles of the human LMNA gene, such as the SNP rs4641 T or SNP rs4641 C alleles carrying disease-causing mutations in cis configuration. As used herein, "antisense oligonucleotides" (ASOs) refer to agents that are unmodified or chemically modified single-stranded nucleic acid molecules (usually 15-30 nt long) that can selectively hybridize to their target complementary sequences in mRNA through Watson-Crick base pairing.The formation of ASO-mRNA heteroduplexes induces the following effects: 1) activates RNase H endonuclease or leads to the degradation of the bound mRNA, such as bacterial endoribonucleases-RNase III and RNase E-leaving the ASO intact, 2) causes translation arrest due to steric hindrance of ribosomal activity, 3) inhibits mRNA splicing, and 4) destabilizes pre-mRNA.While the actual effect depends on the ASO chemical composition and the position of hybridization, the subsequent result is a specific downregulation of target gene and protein expression.

[0070] As used herein, the term "rs4641" refers to a SNP located at chr1:156137743 (GRCh38.p13). See the World Wide Web at ncbi.nlm.nih.gov / snp / rs4641, released on April 9, 2021. As used herein, it also refers to the corresponding nucleotide polymorphism when present in the transcript encoded by the LMNA gene.

[0071] As used herein, the term "LMNA mutation" refers to a mutation in the LMNA gene that preferably has a dominant negative effect and specifically causes a laminopathies, more specifically cardiomyopathy.

[0072] Disclosed herein is a strategy that can cause the substantial silencing of specific targeted alleles through RNA interference.The use of this strategy can cause the in vitro and in vivo expression of targeted genes or alleles to be significantly reduced.This strategy is useful for reducing the expression of targeted genes or alleles to model biological processes or provide therapy for human diseases.

[0073] As used herein, the term "substantial silencing" in the context of silencing an allele means that the mRNA of the targeted allele is specifically inhibited and / or degraded by the presence of the introduced antisense molecule such that expression of the targeted allele is reduced by about 10% to 100% compared to the level of expression seen in the absence of the antisense molecule of the invention. Generally, when an allele is substantially silenced, it will have at least 40%, 50%, 60%, 70%, for example, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, generally at least 80%, for example, 81% to 84%, at least 85%, for example, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or even 100% reduced expression compared to when the isolated antisense molecule is not present. In contrast, expression of non-targeted alleles is not substantially altered compared to the level of expression seen when the antisense molecule of the present invention is not present. As used herein, the term "substantial silencing" in the context of silencing a gene means that the mRNA of the targeted allele is inhibited and / or degraded by the presence of the introduced isolated antisense molecule such that expression of the targeted allele is reduced by about 10% to 100% compared to the level of expression seen in the absence of the isolated antisense molecule. Generally, when an allele is substantially silenced, it will have at least 40%, 50%, 60%, ~70%, for example, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, ~79%, typically at least 80%, for example, 81% to 84%, at least 85%, for example, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or even 100% reduced expression compared to when the isolated antisense molecule is not present. As used herein, the term "substantially normal activity" refers to the level of expression of an allele or gene when the isolated antisense molecule is not introduced into a cell.

[0074] As outlined in the strategy in Figure 1, we developed siRNAs that specifically eliminate the production of Lamin A / C protein from mutant alleles, i.e., alleles that carry disease-causing mutations. By exploiting the base pair difference between the wild-type and mutant alleles, we succeeded in allele-specific silencing of mutant LMNA mRNA expression without interfering with wild-type mRNA expression. Because Lamin A / C is an essential protein, it is crucial to make efforts to silence only the mutant allele. This allele-specific strategy has clear therapeutic potential for the treatment of diseases caused by LMNA mutations, especially laminopathies, including dilated cardiomyopathy.

[0075] In a preferred embodiment, the antisense nucleic acid strand is 15-30 nucleotides in length. Preferably, the antisense nucleic acid strand is complementary to at least 7, more preferably 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides in the target region. In some embodiments, there may be one or two mismatches between the antisense nucleic acid strand and the target region. Preferably, there are no more than two mismatches, more preferably no more than one mismatch. If present, the mismatches will not interfere with allele-specific targeting of, for example, SNPs rs538089, rs505058, or rs4641. In certain preferred embodiments, there are no mismatches in complementarity. Advantageously, those skilled in the art can design the mismatch position with the highest discrimination potential according to the type of nucleotide change as described by Huang et al. [Nucleic Acids Res 2009,37,7560-7569,doi:10.1093 / nar / gkp835].Preferably, the antisense nucleic acid strand is complementary to at least 7, more preferably 8, 9, 10, 11 or 12 consecutive nucleotides.Preferably, the target region comprises at least 15, 16, 17, 18 or 19 nucleotides.

[0076] In a preferred embodiment, the isolated antisense molecule comprises: a. double-stranded nucleic acid (dsNA) or a chemically modified version thereof, or b. A single-stranded antisense oligonucleotide (ASO).

[0077] The preferred embodiment of dsNA is synthetic double-stranded small interfering RNA (siRNA) and vector-driven short hairpin RNA (shRNA). Both siRNA and vector-driven shRNA have been demonstrated to be effective in in vitro and in vivo applications, each with their respective advantages. Most siRNAs are structurally designed to promote efficient incorporation into Ago2 containing RISC, and RNase III containing Dicer substrate design improves the efficiency of siRNA by at least 10-fold through early association and processing at pre-RISC. Vector-driven shRNA utilizes the host microRNA biogenesis pathway, which appears to be highly efficient. siRNA is more easily chemically modified, but shRNA expression can be tailored and regulated by specific promoters. In addition, allele-specific suppression by shRNA can be long-lasting, since the vector encoding the shRNA can be integrated into the genome of the cell.

[0078] In one embodiment, to achieve intracellular expression of therapeutic siRNA, an RNA molecule is constructed that contains two complementary strands or hairpin sequences (such as 21bp hairpins) that represent sequences directed against a target region that is encoded in a portion of the LMNA gene, including SNPs rs538089, rs505058, or rs4641. The siRNA, or the nucleic acid that encodes the siRNA, is introduced into target cells, such as diseased cardiac cells. The siRNA reduces the target mRNA and protein expression of the targeted mutant allele.

[0079] In one embodiment, the dsRNA of the present invention is chemically modified to enhance stability. The nucleic acid of the present invention can be synthesized and / or modified by methods well established in the art, such as those described in "Current protocols in nucleic acid chemistry", Beaucage, SLet al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, which is incorporated herein by reference. Chemical modifications can include, but are not limited to, 2' modification, introduction of non-natural bases, covalent binding to ligands, replacement of phosphate bonds with thiophosphate bonds, and combinations thereof. In this embodiment, the integrity of the double-stranded structure is strengthened by at least one, preferably two, chemical bonds. Chemical bonds can be achieved by any of a variety of well-known techniques, for example, by introducing covalent, ionic, or hydrogen bonds, hydrophobic interactions, van der Waals, or stacking interactions, by metal-ion coordination, or through the use of purine analogs, and combinations thereof. Preferably, chemical groups that can be used to modify dsRNA include, without limitation, methylene blue, bifunctional groups, preferably bis-(2-chloroethyl)amine, N-acetyl-N'-(p-glyoxylbenzoyl)cystamine, 4-thiouracil, and psoralen. In one preferred embodiment, the linker is a hexaethylene glycol linker. In this case, the dsRNA is produced by solid-phase synthesis, and the hexa-ethylene glycol linker is incorporated according to standard methods (e.g., Williams, DJ, and KB Hall, Biochem. (1996) 35:14665-14670). In certain embodiments, the 5' end of the antisense strand and the 3' end of the sense strand are chemically linked via a hexaethylene glycol linker. In another embodiment, at least one nucleotide of the dsRNA comprises a phosphorothioate or phosphorodithioate group. The end of the dsRNA is preferably formed by a triple helix structure.

[0080] A construct encoding a therapeutic siRNA means that one or more strands of the siRNA are configured to be encoded by a nucleic acid that is immediately adjacent to and under the control of a promoter, which will drive the expression of the nucleic acid after introduction into a target cell. The construct is introduced into the target cell, for example, by injection, to allow reduced expression of the target allele in the cell.

[0081] The invention provides an expression cassette comprising a nucleic acid encoding at least the antisense nucleic acid strand, hi some embodiments, the expression cassette comprises a nucleic acid encoding a completely isolated antisense molecule according to the invention.

[0082] In one embodiment, the siRNA of the present invention may form a hairpin structure containing a double-stranded structure and a loop structure. The loop structure may contain 4 to 13, more preferably 4 to 10, nucleotides, for example, 4, 5, or 6 nucleotides. Preferably, the loop contains the sequence UCAAGAC. The double strand is less than 30 nucleotides in length, such as 19 to 25 nucleotides. The siRNA may further contain an overhang region. Such an overhang may be a 3' overhang region or a 5' overhang region. The overhang region may be, for example, 1 to 6 nucleotides in length.

[0083] The present invention also provides an expression cassette containing an isolated nucleic acid sequence encoding a first segment, a second segment located immediately 3' of the first segment, and a third segment located immediately 3' of the second segment, wherein the first and third segments are each less than 30 base pairs in length and each more than 10 base pairs in length, the sequence of the third segment is the complement of the sequence of the first segment, and the isolated nucleic acid sequence functions as a small interfering RNA molecule (siRNA) targeted against a gene of interest. The expression cassette can be contained in a vector, such as a viral vector.

[0084] The expression cassette may further contain a pol II promoter as described herein. Examples of pol II promoters include regulatable promoters and constitutive promoters. For example, the promoter may be a CMV or RSV promoter. The expression cassette may further contain a polyadenylation signal, such as a synthetic minimal polyadenylation signal. The nucleic acid sequence may further contain a marker gene. The expression cassette may be contained in a viral vector. Suitable viral vectors for use in the present invention may be adenovirus, lentivirus, adeno-associated virus (AAV), poliovirus, herpes simplex virus (HSV), or mouse moloney-based viral vectors.

[0085] The present invention provides a method for reducing the expression of a particular gene product in a cell by contacting the cell with an expression cassette as described above. It also provides a method for treating a patient by administering to the patient a composition of the expression cassette described above.

[0086] The present invention further provides a method of reducing the expression of a particular gene product in a cell by contacting the cell with an expression cassette as described above.

[0087] The invention also provides a method of treating a patient by administering to the patient a composition containing an expression cassette according to the invention, preferably comprising shC17, shC17mm5, shC17mm7, shC13mm17, shT14, shT17, shT17mm5, and shT17mm7, as described in Example 2.

[0088] II. Nucleic Acid Molecules of the Invention The sources of the nucleotide sequences from which the present nucleic acid molecules can be obtained include any vertebrate, preferably mammalian, cell source.

[0089] In addition to DNA sequences encoding siRNAs, the nucleic acid molecules of the invention include single- and double-stranded interfering RNA molecules, which are also useful for reducing expression of target alleles.

[0090] Oligonucleotide-mediated mutagenesis is a method for preparing substitution variants. This technique is known in the art. Briefly, a nucleic acid encoding an siRNA can be modified by hybridizing an oligonucleotide encoding the desired mutation to a DNA template, the template being a single-stranded form of a plasmid or bacteriophage containing the unmodified or native gene sequence. After hybridization, a DNA polymerase is used to synthesize an entire second complementary strand of the template, thus incorporating the oligonucleotide primer, coding for the selected modification in the nucleic acid encoding the siRNA. Generally, an oligonucleotide at least 25 nucleotides in length is used. An optimal oligonucleotide has 12-15 nucleotides that are completely complementary to the template on either side of the nucleotides coding for the selected modification. This ensures that the oligonucleotide hybridizes properly to the single-stranded DNA template molecule. Oligonucleotides are easily synthesized using techniques known in the art.

[0091] The DNA template can be generated by a vector derived from a bacteriophage M13 vector (the commercially available M13 mp 18 and M13 mp 19 vectors are suitable) or a vector containing a single-stranded phage origin of replication. Thus, the DNA to be modified can be inserted into one of these vectors to generate a single-stranded template.

[0092] Alternatively, single-stranded DNA template can be generated by denaturing double-stranded plasmid (or other) DNA using standard techniques.

[0093] For modification of the native DNA sequence, an oligonucleotide is hybridized to the single-stranded template under suitable hybridization conditions. A DNA polymerizing enzyme, usually the Klenow fragment of DNA polymerase I, is then added to synthesize the complementary strand of the template using the oligonucleotide as a primer for synthesis. Thus, a heteroduplex molecule is formed such that one strand of DNA codes for the modified form of DNA and the other strand (the original template) codes for the native unmodified sequence of DNA. This heteroduplex molecule is then transformed into a suitable host cell, usually a prokaryotic cell such as E. coli JM101. After the cells are grown, they are plated on agarose plates and screened using an oligonucleotide primer radiolabeled with 32-phosphate to identify bacterial colonies containing the modified DNA. The modified region is then removed and placed into an appropriate vector, generally an expression vector of the type typically used for transformation of a suitable host.

[0094] The method just described can be modified so that homoduplex molecules are created in which both strands of the plasmid contain the modification. The modification is as follows: A single-stranded oligonucleotide is annealed to the single-stranded template as described above. A mixture of the three deoxyribonucleotides, deoxyriboadenosine (dATP), deoxyriboguanosine (dGTP), and deoxyribothymidine (dTTP), is combined with a modified thiodeoxyribocytosine called dCTP-(*S) (which can be obtained from Amersham Corporation). This mixture is added to the template-oligonucleotide complex. Upon addition of DNA polymerase to this mixture, a DNA strand identical to the template is generated, except for the modified base. In addition, this new DNA strand contains dCTP-(*S) instead of dCTP, which serves to protect against restriction endonuclease digestion.

[0095] After the template strand of the double-stranded heteroduplex is nicked with an appropriate restriction enzyme, the template strand can be digested with ExoIII nuclease or another appropriate nuclease beyond the region containing the site to be modified. The reaction is then stopped, leaving a molecule that is only partially single-stranded. A complete double-stranded DNA homoduplex is then formed using DNA polymerase in the presence of all four deoxyribonucleotide triphosphates, ATP, and DNA ligase. This homoduplex molecule can then be transformed into a suitable host cell, such as E. coli JM101.

[0096] III. Expression Cassettes of the Invention To prepare an expression cassette, the recombinant DNA sequence or segment can be circular or linear, double-stranded or single-stranded. Generally, the DNA sequence or segment is in the form of a chimeric DNA, such as a plasmid DNA, or a vector, which can also contain a coding region adjacent to regulatory sequences that facilitate the expression of the recombinant DNA present in the resulting transformed cell.

[0097] A "chimeric" vector or expression cassette, as used herein, means a vector or cassette that contains nucleic acid sequences from at least two different species, or has nucleic acid sequences from the same species linked or associated in a way that does not occur "naturally" or in the wild type of the species.

[0098] Apart from recombinant DNA sequences that function as transcription units, or parts thereof, of the RNA transcript, portions of the recombinant DNA may be non-transcribed and serve a regulatory or structural function. For example, the recombinant DNA may have a promoter that is active in mammalian cells.

[0099] Other elements functional in host cells, such as introns, enhancers, polyadenylation sequences, etc., may also be part of the recombinant DNA. Such elements may or may not be necessary for the function of the DNA, but may provide improved expression of the DNA by affecting transcription, siRNA stability, etc. Such elements may be included in the DNA as desired to obtain optimal performance of the siRNA in the cell.

[0100] Control sequences are DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism. Control sequences suitable for prokaryotic cells include, for example, a promoter, optionally an operator sequence, and a ribosome binding site. Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers.

[0101] An operably linked nucleic acid is a nucleic acid that is placed in a functional relationship with another nucleic acid sequence. For example, a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence, or a ribosome binding site is operably linked to a coding sequence if it is positioned to facilitate translation. Generally, operably linked DNA sequences are linked DNA sequences that are contiguous. However, enhancers need not be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, synthetic oligonucleotide adaptors or linkers are used according to conventional practice.

[0102] The recombinant DNA introduced into the cells may contain either a selectable marker gene or a reporter gene, or both, to facilitate identification and selection of expressing cells from a population of cells that are desired to be transfected or infected through a viral vector. In other embodiments, the selectable marker may be carried on a separate piece of DNA and used in a co-transfection procedure. Both the selectable marker and the reporter gene may be flanked by appropriate regulatory sequences to allow expression in the host cell. Useful selectable markers are known in the art and include, for example, antibiotic resistance genes, such as neo.

[0103] Reporter genes are used to identify potentially transfected cells and evaluate the functionality of regulatory sequences. Reporter genes that code for easily assayable proteins are well known in the art. In general, reporter genes are genes that are not present in or expressed by the recipient organism or tissue, and that code for a protein whose expression is manifested by some easily detectable property, such as enzymatic activity. For example, reporter genes include the chloramphenicol acetyltransferase gene (cat) from Tn9 of E. coli and the luciferase gene from the firefly Photinus pyralis. Expression of the reporter gene is assayed at a suitable time after DNA is introduced into the recipient cells.

[0104] General methods for constructing recombinant DNA capable of transfecting target cells are well known to those of skill in the art, and the same compositions and methods of construction can be utilized to produce the DNA useful herein. For example, Sambrook and Russell, infra, provides suitable methods of construction.

[0105] Recombinant DNA can be easily introduced into host cells, such as mammalian, bacterial, yeast, or insect cells, by any procedure useful for introduction into a particular cell, for example, by transfection with an expression vector composed of DNA encoding siRNA, by physical or biological methods, to produce cells with recombinant DNA stably integrated into their genome or present as an episomal element, so that the DNA molecule or sequence of the present invention is expressed by the host cell.Preferably, DNA is introduced into the host cell via a vector.The host cell is preferably of eukaryotic origin, such as plant, mammalian, insect, yeast, or fungal origin, although host cells of non-eukaryotic origin can also be used.

[0106] Physical methods for introducing preselected DNA into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, etc. Biological methods for introducing DNA of interest into host cells include the use of DNA and RNA viral vectors. For mammalian gene therapy, as described herein below, it is desirable to use an efficient means of inserting copy genes into the host genome. Viral vectors, particularly retroviral vectors, have become the most widely used method for inserting genes into mammalian, e.g., human cells. Other viral vectors can be derived from poxviruses, herpes simplex virus I, adenoviruses, and adeno-associated viruses, etc.

[0107] As mentioned above, a "transfected" or "transduced" host cell or cell line is one whose genome has been modified or enhanced by the presence of at least one heterologous or recombinant nucleic acid sequence. The host cell of the present invention is typically produced by transfection with an antisense molecule, a DNA sequence in a plasmid expression vector, a viral expression vector, or as an isolated linear DNA sequence. The transfected DNA can be a chromosomally integrated recombinant DNA sequence that is composed of a sequence that codes for siRNA.

[0108] To confirm the presence of the recombinant DNA sequence in the host cell, various assays can be performed. Such assays include "molecular biological" assays well known to those skilled in the art, such as Southern and Northern blotting, RT-PCR, and PCR, "biochemical" assays, such as detecting the presence or absence of a particular peptide by immunological means (ELISA and Western blot), or by the assays described herein to identify agents falling within the scope of the invention.

[0109] RT-PCR can be used to detect and quantify the RNA produced from the introduced recombinant DNA segment. This application of PCR requires first reverse transcribing the RNA into DNA using an enzyme such as reverse transcriptase, and then amplifying the DNA through the use of conventional PCR techniques. In most cases, PCR techniques, while useful, will not demonstrate the integrity of the RNA product. Further information regarding the nature of the RNA product can be obtained by Northern blotting. This technique demonstrates the presence of an RNA species and gives information about the integrity of that RNA. The presence or absence of an RNA species can also be determined using dot or slot blot Northern hybridization. These techniques are modifications of Northern blotting and demonstrate only the presence or absence of an RNA species.

[0110] Southern blotting and PCR can be used to detect recombinant DNA segments of interest, but do not provide information regarding whether a preselected DNA segment is being expressed. Expression can be assessed by specifically identifying the peptide product of the introduced recombinant DNA sequence or by assessing a phenotypic change resulting from expression of the introduced recombinant DNA segment in a host cell.

[0111] The present invention provides a cell expression system for expressing exogenous nucleic acid material in a mammalian recipient. The expression system, also referred to as a "genetically modified cell", comprises a cell and an expression vector for expressing the exogenous nucleic acid material. The genetically modified cells are suitable for administration to a mammalian recipient, where they replace the recipient's endogenous cells. Thus, preferred genetically modified cells are non-immortalized and non-tumorigenic.

[0112] According to one embodiment, cells are transfected or otherwise genetically modified ex vivo. Cells are isolated from a mammal (preferably human), a nucleic acid is introduced (i.e., transduced or transfected in vitro) with a vector for expressing a heterologous (e.g., recombinant) gene encoding a therapeutic agent that expresses an antisense molecule, and then administered to a mammalian recipient for delivery of the therapeutic agent in situ. The mammalian recipient can be a human, and the cells to be modified are autologous cells, i.e., the cells are isolated from the mammalian recipient.

[0113] According to another embodiment, cells are transfected or transduced or otherwise genetically modified in vivo: cells from a mammalian recipient are transduced or transfected in vivo with a vector containing exogenous nucleic acid material for expressing a heterologous (e.g., recombinant) gene encoding a therapeutic agent that expresses an antisense molecule, and the therapeutic agent is delivered in situ.

[0114] VI. Delivery Vehicles for Expression Cassettes of the Invention Selection and optimization of a particular expression vector for expressing a particular siRNA in a cell can be accomplished by obtaining the nucleic acid sequence of the siRNA, optionally with one or more appropriate control regions (e.g., promoter, insertion sequence), preparing a vector construct comprising a vector into which the nucleic acid sequence encoding the siRNA is inserted, transfecting or transducing cultured cells in vitro with the vector construct, and determining whether the siRNA is present in the cultured cells.

[0115] Vectors for cellular gene therapy include viruses, such as replication-deficient viruses. Exemplary viral vectors are derived from Harvey Sarcoma Virus, Rous Sarcoma Virus, (MPSV), Moloney Murine Leukemia Virus, and DNA viruses (e.g., adenoviruses).

[0116] Replication-defective retroviruses can direct the synthesis of all virion proteins, but cannot produce infectious particles. Thus, these genetically modified retroviral expression vectors have general utility for highly efficient transduction of nucleic acid sequences in cultured cells, and particular utility for use in the methods of the present invention. Such retroviruses also have utility for efficient transduction of nucleic acid sequences into cells in vivo. Retroviruses are widely used to transfer nucleic acid materials into cells.

[0117] The advantage of using retroviruses in gene therapy is that the virus can insert the nucleic acid sequence encoding siRNA into the host cell genome, thereby allowing the nucleic acid sequence encoding siRNA to be inherited by cell progeny when dividing.It has been reported that promoter sequences in LTR regions enhance the expression of inserted coding sequences in various cell types.Some disadvantages of using retrovirus expression vectors are (1) insertional mutagenesis, i.e., the insertion of the nucleic acid sequence encoding siRNA into undesired positions in the genome of target cells, which can lead to unregulated cell proliferation, and (2) the need for target cell proliferation in order for the nucleic acid sequence encoding siRNA carried by the vector to be integrated into the target genome.

[0118] Another virus candidate that is useful as an expression vector for cell transformation is the adenovirus, a double-stranded DNA virus.Adenovirus is infectious in a wide range of cell types, including, for example, muscle cells and endothelial cells.Adenovirus has also been used as an expression vector in muscle cells in vivo.

[0119] Adenovirus (Ad) is a double-stranded linear DNA virus with a 36 kb genome. Several features of adenoviruses make them useful as transgene delivery vehicles for therapeutic applications, such as facilitating in vivo gene delivery. Recombinant adenovirus vectors have been shown to be capable of efficient in situ gene transfer into parenchymal cells of various organs, including the lung, brain, pancreas, gallbladder, and liver. This has allowed the use of these vectors in methods for treating inherited genetic diseases, such as cystic fibrosis, where the vector can be delivered to the target organ. In addition, the ability of adenovirus vectors to achieve in situ tumor transduction has allowed the development of various anti-cancer gene therapy methods for non-disseminated disease. In these methods, vector storage favors tumor cell-specific transduction.

[0120] Like retroviruses, the adenovirus genome can be adapted for use as an expression vector for gene therapy, i.e., by removing the genetic information that controls the production of the virus itself. Because adenoviruses function in an extrachromosomal manner, recombinant adenoviruses do not have the theoretical problem of insertional mutagenesis.

[0121] Several approaches have been used to generate recombinant adenovirus. One approach involves direct ligation of a restriction endonuclease fragment containing a nucleic acid sequence of interest to a portion of the adenovirus genome. Alternatively, the nucleic acid sequence of interest can be inserted into a defective adenovirus by homologous recombination. The desired recombinant is identified by screening the individual plaques generated in a lawn of complementation cells.

[0122] Most adenoviral vectors are based on the adenovirus type 5 (Ad5) backbone, into which an expression cassette containing a nucleic acid sequence of interest has been introduced in place of early region 1 (E1) or early region 3 (E3). Viruses in which E1 is deleted are replication defective and are propagated in human complementation cells (e.g., 293 or 911 cells), which supply the deleted genes E1 and pIX in trans.

[0123] Thus, as will be apparent to those skilled in the art, a variety of suitable viral expression vectors are available for transferring exogenous nucleic acid material into cells. Selection of an appropriate expression vector for expressing a therapeutic agent for a particular condition suitable for gene silencing therapy and optimization of the conditions for insertion of the selected expression vector into cells are within the scope of one of ordinary skill in the art without the need for undue experimentation.

[0124] In another embodiment, the expression vector is in the form of a plasmid, which is transferred into the target cells by one of a variety of methods: physically, electroporation, scrape-loading, microparticle bombardment, or cellular uptake as a chemical complex (e.g., calcium or strontium co-precipitation, complexation with lipids, complexation with ligands). Several commercial products are available for cationic liposome complexation, including Lipofectin™ (Gibco-BRL, Gaithersburg, Md.) and Transfectam™ (ProMega, Madison, Wis.). However, the efficiency of transfection by these methods is highly dependent on the nature of the target cells, and therefore conditions must be optimized for optimal transfection of nucleic acids into cells using the above procedures. Such optimization is within the scope of one of ordinary skill in the art without the need for undue experimentation.

[0125] VII. Methods for Selecting Antisense Molecules In diseases caused by autosomal dominant mutations, one of the alleles of a gene contains a mutation that has a dominant negative effect. It is therefore desirable to inhibit such a mutation present in the affected allele while allowing the unaffected allele of the gene to be expressed. In order to select a suitable antisense molecule that can selectively inhibit, i.e. reduce, the affected allele, a nucleic acid sample from a patient suffering from a disease caused by an autosomal dominant mutation is provided. Many such diseases are known. A non-limiting list of examples of such diseases includes tuberous sclerosis, breast cancer, neurofibromatosis type I, Huntington's disease, hypertrophic cardiomyopathy, polycystic kidney disease, osteogenesis imperfecta, chondrodysplasia, centronuclear myopathy, and Marfan syndrome. In principle, any such disease can be treated by an antisense molecule selected according to the present invention. The method of the present invention requires a nucleic acid, preferably a DNA sample from the patient. Any biological sample from the patient that contains DNA can be used, including but not limited to blood samples, saliva, buccal mucosa, etc. In certain embodiments, RNA can be used. DNA can be isolated from the sample according to methods known in the art. The presence of an autosomal dominant mutation is then determined by determining the nucleic acid sequence of the gene of both alleles present. The alleles are then screened for the presence of heterozygous SNPs in the alleles of the gene. In a preferred embodiment, the heterozygous SNPs are determined by selecting synonymous SNPs, since synonymous SNPs are expected to have the highest minor allele frequency (MAF). The nucleic acid sequence of the sense strand of the SNP of the gene is then determined using methods known in the art. An isolated antisense molecule is then selected, comprising an antisense nucleic acid strand that is substantially complementary to a target region of a transcript encoded by the gene, and the antisense nucleic acid strand is at least complementary to the SNP in the target region.

[0126] In a preferred embodiment, the method of selecting an antisense molecule of the invention further comprises the step of testing the selected antisense molecule in cells to determine the effect on reducing expression of the gene. Preferably, the method comprises determining the effect on reducing expression of mutant and / or non-mutated alleles of the gene. Preferably, the method comprises the step of determining a change in the allelic imbalance of the gene. Preferably, the step is performed on cells from a patient.

[0127] In a preferred embodiment, the isolated antisense molecule comprises: a. double-stranded nucleic acid (dsNA) or a chemically modified version thereof, or b.Antisense oligonucleotides (ASOs).

[0128] Preferably, the dsNA is an RNA, more preferably a short hairpin (shRNA) or a small interfering RNA (siRNA). Preferably, the dsNA is a dsRNA.

[0129] As used herein, the term siRNA refers to a double-stranded RNA molecule consisting of 15-31 base pairs (bp), preferably 20-25 bp, and comprising two RNA molecules. As used herein, the term shRNA refers to a partially double-stranded RNA molecule consisting of 15-31 bp, preferably 20-25 bp, and a single RNA molecule that forms a hairpin structure containing a single-stranded loop.

[0130] In a preferred embodiment, the isolated antisense molecule according to the present invention, the antisense nucleic acid strand is 15-30 nucleotides in length. Preferably, the antisense nucleic acid strand is complementary to at least 7, more preferably 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides in the target region. In some embodiments, there may be one or two mismatches between the antisense nucleic acid strand and the target region. Preferably, the antisense nucleic acid strand is complementary to at least 7, more preferably 8, 9, 10, 11, or 12 consecutive nucleotides. Preferably, the target region comprises at least 15, 16, 17, 18, or 19 nucleotides in the target region.

[0131] In a preferred embodiment of the isolated double-stranded nucleic acid (dsNA) according to the present invention, the dsNA comprises a sense nucleic acid strand of 15-30 nucleotides in length, the sense nucleic acid strand being complementary to the antisense nucleic acid strand, and the sense and antisense nucleic acid strands form a double-stranded region. Preferably, the dsNA is an shRNA containing an antisense nucleic acid strand of an RNA of 15-30 nucleotides, preferably 19 nucleotides in length, having a 5'-end and a 3'-end, the antisense nucleic acid strand being preferably complementary to at least 15 nucleotides of the target region, preferably the 5'-end of the sense strand of the RNA being operably linked to a G nucleotide to form a first segment of the RNA, and a sense strand of an RNA of 15-30 nucleotides in length, having a 5'-end and a 3'-end, preferably at least 12 nucleotides of the antisense and sense strands being complementary to each other, preferably forming a small interfering RNA (siRNA) duplex under physiological conditions.

[0132] Preferably, the antisense strand and the sense strand are operably linked by an RNA loop strand to form a hairpin structure comprising a double-stranded structure and a loop structure.

[0133] Preferably, the loop structure contains 4 to 13, more preferably 4 to 10 nucleotides. In one embodiment, the loop structure contains 4, 5, or 6 nucleotides. Preferably, the loop contains the sequence UCAAGAC.

[0134] The duplex formed by the two strands of RNA may be 15 to 25 base pairs long, preferably 19 base pairs long. The antisense strand is preferably 19 nucleotides long. The sense strand is preferably 19 nucleotides long. The shRNA may further contain an overhang region. Such an overhang may be a 3' overhang region or a 5' overhang region. The overhang region may be, for example, 1 to 6 nucleotides long.

[0135] The present invention further provides a nucleic acid encoding the isolated antisense molecule of the present invention. In a preferred embodiment, the shRNA of the present invention is encoded by an oligonucleotide having the following structure: forward 5'-CCGGAA-19bp sense strand-TCAAGAC-19bp antisense strand-TTTTTTTG-3', and / or reverse 5'-AATTCAAAAAAA-19bp sense strand-GTCTTGA-19bp antisense strand-TT-3'. As used herein, the sense strand has the same sequence as the targeted sequence in the mRNA, and the antisense strand has its reverse complementary sequence that ultimately binds to the mRNA and induces its degradation and / or inhibition.

[0136] Preferably, the gene is selected from LMNA, potassium voltage-gated channel subfamily Q member 1 (KCNQ1), neurofibromin 1 (NF1), fibrillin 1 (FBN1), breast cancer gene 1 (BRCA1), BRCA2, tuberous sclerosis complex 1 (TSC1), and TSC2 genes. Preferably, the SNP is selected from rs1057128, rs8234, and rs17215465. Preferably, the disease is heart failure, tuberous sclerosis, breast cancer, neurofibromatosis type I, Huntington's disease, hypertrophic cardiomyopathy, polycystic kidney disease, osteogenesis imperfecta, chondrodysplasia, centronuclear myopathy, and Marfan syndrome. Preferably, the heart failure is laminopathies, preferably dilated cardiomyopathy.

[0137] The invention will now be illustrated by the following non-limiting examples.

[0138] Working Example Example 1 Materials and Methods Human iPSC culture The LMNA H222P SV1122 hiPSC line, derived from a male patient carrying the LMNA H222P mutation, was generated in Hamburg, Germany. The UN1-22 line was derived from a healthy male and fully characterized previously (Shinnawi, 2015 Stem Cell Reports 2015;5:582-596.) Both lines are heterozygous for the SNP rs4641 located in LMNA. Colonies of both hiPSC lines were cultured in mTeSR-1 (StemCell Technologies, 85850) on plates coated with 1:500 diluted growth factor reduced matrigel (Corning, FAL356231). Cells were passaged every 4-6 days via dissociation with 0.5 mM EDTA (Invitrogen, 15575-038) and replated in mTeSR-1 supplemented with 2 μM thiazovivin (Selleck Chemicals, S1459). Between passages, mTeSR-1 medium was changed every day except for the first day after passaging.

[0139] Cardiac differentiation of hiPSCs Cardiac differentiation was performed according to a previously published protocol with minor adaptations (Burridge, 2014 Nat Methods 2014;11:855-860). Differentiation was induced 3–5 days after passaging by switching to CDM3 medium (RPMI 1640, Gibco 21875, 500 μg / ml human serum albumin, Sigma A9731, 213 μg / ml L-ascorbic acid diphosphate, Sigma A8960, 1% penicillin / streptomycin) supplemented with 6 μM CHIR99021 (Stemgent, 04-0004-10) for 2 days, followed by a 2-day change to CDM3 containing 2 μM Wnt-C59 (Selleck Chemicals, S7037). From day 4 to day 10, the medium was changed every other day to RPMI / B27 medium (RPMI-1640, 2% B27 supplement minus insulin (Gibco, A1895601), 1% penicillin / streptomycin). Spontaneous contractions could be identified from day 8 onwards. From day 10 onwards, the medium was changed once a week for hiPSC-CMs with glucose-free CDM3 medium (RPMI-1640 without glucose, Gibco, 11879) supplemented with 20 mM sodium lactate (Sigma-Aldrich, L7022) dissolved in 1 M HEPES solution for at least 2 weeks to metabolically select cardiomyocytes. After selection, the medium was changed once a week with CDM3 medium containing glucose.

[0140] We dissociated the purified cardiomyocyte populations by 15 min TrypLE Express (Gibco, 12604) incubation and seeded them onto Matrigel-coated plates in RPMI / B27 with 2 μM thiazovivin for further experiments. All experiments were performed on hiPSC-CMs 40–60 days after the initiation of differentiation, and replicated each observation in two to four independent experiments with hiPSC-CMs from different differentiations.

[0141] Plasmid generation For shRNA expression, the pLKO.1 backbone with puromycin as selection marker was used (pLKO.1 puro, Addgene, 8453). For cloning of shRNA sequences, the following oligonucleotides were designed: forward 5'-CCGGAA-19bp sense strand-TCAAGAC-19bp antisense strand-TTTTTTTG-3', and reverse 5'-AATTCAAAAAAA-19bp sense strand-GTCTTGA-19bp antisense strand-TT-3'. The sense strand is the very mRNA targeting sequence, and the antisense strand is its reverse complementary sequence that ultimately binds to the mRNA. The shRNA sequences were designed according to Huang et al. (2014). We annealed 1 nmol of these oligonucleotides and cloned them into the AgeI and EcoRI restriction sites in the pLKO.1-puro plasmid. The shRNA sequences are detailed in Table 1. All plasmid sequences were verified by Sanger sequencing to exclude plasmids containing mutations.

[0142] Virus production To produce third generation lentivirus of pLKO.1-puro based constructs, 4x10^6 HEK293T cells were co-transfected with 4μg of expression plasmid, 2.7μg of pMDLg / pRRE, 1μg of pRSV-Rev, 1.4μg of pVSVG using Genejammer (Agilent, 204130) according to the manufacturer's protocol. The next day, the HEK293T medium was replaced with CDM3 medium. This medium containing the lentivirus produced 24 hours after the previous replacement was collected and used as is for hiPSC-CM transduction.

[0143] HiPSC-CM infection To ensure homogenous cell populations between conditions, hiPSC-CMs were dissociated 2-4 days prior to lentiviral transduction. 2 ml / well in a 6-well plate of medium containing the virus was freshly added to the hiPSC-CMs. After 24 h, the medium containing the virus was removed and replaced with fresh CDM3 medium. Five days later, the medium was changed and puromycin selection was initiated with 8 μg / ml puromycin in CDM3 medium for 48 h. Cells were harvested after puromycin selection.

[0144] RNA isolation Total RNA was isolated from all samples using 1 ml of TriReagent (Sigma Aldrich, T9424). TriReagent was added directly to live cells growing on a dish. Total RNA isolation was performed according to the manufacturer's protocol.

[0145] Allele-specific qRT-PCR for mRNA To detect mRNA expression of each LMNA allele, 250 ng–1 μg of RNA was DNAse treated with DNAseI Amplification Grade (Invitrogen, 18068015) and reverse transcribed using Superscript II Reverse Transcriptase (Invitrogen, 18064014) with oligo-dT and random hexamer primers according to the manufacturer's protocol. The cDNA was diluted five times and 2 μl was used as input for qPCR.

[0146] qPCR was performed using 1 μM primers (Table 2) and LightCycler 480SYBR Green master 1 (Roche, 04887352001) on a LightCycler 480 system II (Roche) using the following cycling program: 5 min preincubation at 95°C, 40 cycles of 10 s denaturation at 95°C, 20 s annealing (temperatures in Table 2), and 20 s extension at 72°C. Data were analyzed using the LinRegPCR quantitative PCR analysis software (Ruijter, 2009), and the starting concentrations of transcripts estimated by this software were corrected for the geometric mean of the estimated starting concentrations of the three reference genes GAPDH, HPRT, and TBP. [Table 1-1] [Table 1-2] [Table 2]

[0147] result To test our hypothesis of silencing mutant alleles by allele-specific siRNAs targeting common variants independent of causal mutations, we searched for common variants in LMNA in our two human induced pluripotent stem cell (hiPSC) lines. There are three known common single nucleotide polymorphisms (SNPs) in LMNA, namely rs538089, rs505058, and rs4641, with heterozygosity of 21.8%, 20.4%, and 32.8%, respectively. By using genomic DNA derived from our hiPSC lines, we sequenced three PCR amplicons containing these three SNPs and found that both hiPSC lines were heterozygous carriers of SNP rs4641(C / T) and did not carry other variants. For this reason, we select SNP rs4641 as a targetable variant in LMNA.

[0148] SNP rs4641 is the last shared nucleotide of two mRNA isoforms derived from LMNA, namely Lamin A and Lamin C. Both isoforms share the first 566 amino acids, but due to alternative splicing, they differ after exon 10, with Lamin A continuing in exons 11 and 12 and Lamin C continuing in exon 10B. Because SNP rs4641 is the last shared nucleotide of both isoforms, it was necessary to design isoform-specific siRNAs. Furthermore, LMNA mutations can be located on both alleles of the SNP (C or T alleles), meaning that siRNAs are required for both SNP alleles on both Lamin A and Lamin C isoforms. Based on the literature and acquired knowledge on siRNA design, constructs were designed for each allele of each isoform (see Figure 1). As we envision delivering our constructs via gene therapy using short hairpin RNA (shRNA), we immediately used shRNA in our experiments to test the effect of shRNA in human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs).

[0149] No allele-specific effects of shRNA to downregulate lamin C were observed We first started testing our shRNAs targeting the C allele of Lamin C in LMNA H222P hiPSC-CMs. As expected, we did not observe downregulation of either the C or T allele of Lamin A isoform, indicating that our designed shRNAs directed against the C allele of Lamin C are isoform specific (Figure 2, Panel A). We observed downregulation of the C allele of Lamin C by shRNA C11 (Figure 2, Panel B). However, we also observed downregulation of the T allele of Lamin C by this shRNA, indicating that this shRNA is not allele specific. All other tested shRNAs did not show any downregulation (Figure 2, Panel B).

[0150] We next proceeded to test our shRNAs targeting the T allele of Lamin C in LMNA H222P hiPSC-CMs. Again, these shRNAs are isoform specific, as no downregulation of the Lamin A isoform is observed (Figure 2, Panel C). We observed downregulation of the T allele of Lamin C by shRNA T14 (Figure 2, Panel D). However, this effect is not allele specific, as the same amount of downregulation is observed in the C allele of Lamin C. All other tested shRNAs did not show any downregulation (Figure 2, Panel D).

[0151] In conclusion, none of our designed shRNAs targeting either the C or T allele showed allele-specific downregulation of lamin C.

[0152] shRNAs C17 and T17 result in isoform- and allele-specific downregulation of lamin A Next, we tested shRNAs targeting alleles of lamin A isoforms, starting with targeting the C allele of lamin A. We observed downregulation by shRNA C17 of 40% of the targeted C allele of lamin A in LMNA H222P hiPSC-CMs (Figure 3, Panel A). Moreover, this effect is allele-specific, since we did not observe downregulation of the T allele of lamin A. The allele-specific effect is also isoform-specific, since shRNA C17 did not show downregulation of any lamin C alleles (Figure 3, Panel B). All other tested shRNAs did not show lamin A or lamin C downregulation. We then tested the same shRNAs in healthy hiPSC-CMs. We observed the same effect of shRNA C17, with now even higher downregulation of 50% of the targeted C allele of lamin A (Figure 3, Panels C and D). However, here we also observed a small effect on the T allele of lamin A.

[0153] Finally, we tested shRNAs targeting the T allele of lamin A. We observed a 53% downregulation obtained by shRNA T17 in LMNA H222P hiPSC-CMs (Figure 4, Panel A). More importantly, this observed effect is allele- and isoform-specific (Figure 4, Panel B). Other tested shRNAs did not show downregulation. As before, we tested the same shRNAs in healthy hiPSC-CMs. Similarly, shRNA T17 showed a 55% isoform- and allele-specific downregulation (Figure 4, Panels C and D).

[0154] In conclusion, we found two shRNAs that down-regulate either the C or T allele of the Lamin A SNP rs4641 in an isoform- and allele-specific manner with approximately 50% efficiency in two different hiPSC-CM lines.

[0155] Downregulation of the mutant H222P allele with shRNA T17 improves nuclear circularity To evaluate the effect of downregulation of either the C or T allele by shRNAs C17 and T17 on the nuclear phenotype, H222P hiPSC-CMs were treated with negative control shRNA, shRNA C17 (downregulation of the C allele), and shRNA T17 (downregulation of the T allele). Plasmid cloning of LMNA PCR products surrounding both the SNP and the mutation on the cDNA of the H222P strain as well as Sanger sequencing of bacterial clones revealed that the heterozygous H222P mutation is located on the same allele as the T allele of rs4641. Thus, downregulation of the rs4641 C allele in H222P hiPSC-CMs results in downregulation of the wild-type allele, which is expected to exacerbate the phenotype, whereas downregulation of the rs4641 T allele is expected to downregulate the mutant allele and alleviate the phenotype.

[0156] LMNA is important for nuclear structure, since it encodes the nuclear lamina that supports the nuclear membrane. Thus, nuclear shape is a measure of how severely a cell is affected by a certain mutation. We evaluated the effect of shRNA-based downregulation of either wild-type or mutant alleles on the nuclear circularity of cells. We measured the nuclear circularity after treatment with two different conditions compared to the negative control. We did not observe a decrease in nuclear circularity after downregulation of the wild-type allele. However, the therapeutically much more interesting downregulation of the rs4641 T allele and therefore the mutant allele significantly improved nuclear circularity (p<0.001). See Figure 5. Thus, downregulation of the T allele, and thereby the H222P mutant allele by shRNA T17, resulted in an improvement of nuclear circularity in LMNA H222P hiPSC-CMs, indicating that these LMNA H222P hiPSC-CMs are more mildly affected by the mutation after downregulation of the mutant allele by shRNA targeting of SNP rs4641.

[0157] Example 2 Materials and Methods See Example 1 with the following additions: Cardiac differentiation of hiPSCs was performed as described or following the CHIR dilution protocol consisting of 6 microM CHIR99021 in 3 ml CDM3 medium on day 0, addition of 2 ml CDM3 medium on day 1, addition of another 1 ml CDM3 medium on day 2, and 2 microM WNT-C59 in CDM3 on day 3. From day 4 or 5 (no dilution vs. dilution protocol) to day 10, medium was changed to RPMI / B27 medium (RPMI-1640, 2% B27 supplement minus insulin (Gibco, A1895601), 1% penicillin / streptomycin) every other day.

[0158] Cardiomyocytes were dissociated by TrypLE Express (Gibco, 12604) incubation for 15-45 min, after which they were seeded onto Matrigel-coated plates in RPMI / B27 with 2 μM thiazovivin for further experiments.

[0159] For plasmid generation, shRNA sequences were designed according to Huang et al. (2014) and mismatches were added based on known interaction regions of miRNAs with their targets and the results of the original shRNA selection. Additional shRNA targeting sequences and primer sequences used for qRT-PCR are included in Tables 3 and 4, respectively.

[0160] result SNP identification for allele-specific targeting To allow allele-specific downregulation of LMNA by targeting common SNPs, the coding region of LMNA was searched for synonymous SNPs, since these are expected to have the highest minor allele frequency (MAF). As a result, the highest number of patients are heterozygous for these SNPs, which allows allele-specific targeting. This search revealed three synonymous SNPs in LMNA (rs538089, rs505058, and rs4641), with MAFs of 18%, 24%, and 21%, respectively, in the Genome Aggregation Database (gnomAD) population. These MAFs indicate that, according to Hardy-Weinberg equilibrium, 29% of patients should be heterozygous for SNP rs538089, 36% heterozygous for rs505058, and 33% for SNP rs4641. This means that targeting each of these SNPs will allow treating a similar amount of LMNA patients, regardless of the disease-causing mutation. Eight LMNA mutation carriers from the Amsterdam UMC outpatient clinic and hiPSC lines carrying the H222P mutation in LMNA were screened for heterozygosity of these SNPs, which revealed that five patients and hiPSC lines were heterozygous for rs4641 and none for rs538089 or rs505058. Therefore, an allele-specific shRNA approach was focused on SNP rs4641.

[0161] Design of allele-specific shRNAs against both alleles of rs4641 in LMNA and LMNC The LMNA gene codes for two mRNA splice isoforms, LMNA and LMNC, which share the sequence coding for the first 566 amino acids. Alternative splicing in exon 10 results in differences between the two isoforms at their C-terminus, with the LMNC isoform not spliced ​​and terminating at the end of exon 10, whereas the LMNA isoform uses a splice site in the middle of exon 10 to splice toward exons 11 and 12 (Figures 1 and 6). SNP rs4641 is located at the last nucleotide shared between the two isoforms. This, combined with the data of Huang et al. (Huang et al., 2009. Nucleic Acids Res 37:7560-7569), who showed that the highest allele specificity is obtained when the nucleotide that distinguishes both alleles is located in the middle of the siRNA, indicates that it is necessary to design allele-specific siRNAs that target both LMNA and LMNC separately. Furthermore, because both the T and C alleles of the SNP may be present on the mutant allele in different patients, it is necessary to design siRNAs that target both alleles of SNP rs4641. Based on the data of Huang et al., we selected six siRNAs predicted to target the C allele of LMNA with mismatches to the untargeted T allele at positions 10, 11, 12, 13, 14, and 17, and six siRNAs predicted to target the T allele of LMNA with mismatches to the untargeted C allele at positions 9, 10, 11, 12, 14, and 17 (Figure 6). Using a similar approach, we selected five siRNAs predicted to target the C allele of LMNC with mismatches to the untargeted T allele at positions 10, 11, 12, 13, and 17, and seven siRNAs predicted to target the T allele of LMNC with mismatches to the untargeted C allele at positions 9, 10, 11, 12, 14, 16, and 17 (Figure 6).To envision therapeutic delivery of these siRNAs via viral-mediated shRNA expression, these siRNAs were also expressed in vitro as viral shRNA constructs, following the design shown in FIG.

[0162] Allele-specific targeting of rs4641 in LMNA isoforms To test shRNAs, cardiomyocytes derived from the H222P hiPSC line were lentivirally transduced. This line was derived from a male patient with the Emery-Dreifuss muscular dystrophy phenotype, which affects both skeletal and cardiac muscles (Bonne et al., 2000. Ann Neurol 48:170-80). After lentiviral shRNA transduction, allele-specific qRT-PCR expression levels of mutant and wild-type LMNA alleles were compared to expression levels in cells transduced with a scrambled negative control shRNA (Scr). Targeting the C allele of rs4641 in the LMNA splice isoform, present in this H222P hiPSC line on the wild-type LMNA allele, revealed one shRNA, shC17, that downregulated the wild-type LMNA allele by nearly 50% and the untargeted mutant allele by only 10% (Figure 8A). Most mutations in LMNA, including the H222P mutation, have a dominant-negative mode of action, meaning that the mutant allele interferes with the function of the wild-type allele, and therefore the allelic balance between the wild-type and such mutant alleles determines disease severity. Therefore, we also investigated to what extent targeting the C allele of rs4641 affected the allelic balance between both LMNA alleles (Figure 8B). This revealed an almost equal expression of both alleles (52:48%) in this experiment in SCR-negative control cells, which shifted to a relative underexpression of the targeted wild-type LMNA allele (40:60%) in cells transduced by shC17. Surprisingly, the other shRNAs did not downregulate either LMNA allele, but instead led to an upregulation of both wild-type and mutant LMNA alleles. Although only LMNA splice isoforms are targeted by these shRNAs, we also performed allele-specific qRT-PCR on LMNC, which revealed no downregulation of any LMNC allele and thus no strong effect on the balance between mutant and wild-type LMNC isoforms (Figure 8C / D).

[0163] Previous studies have suggested that the introduction of additional mismatches in the seed region or Argonaute recognition region of shRNAs can improve discrimination between targeted and untargeted alleles. Having had a 10% knockdown of the untargeted T allele of rs4641 in the LMNA splice isoform by shC17 for LMNA, we added extra mismatches to this shC17 sequence in an attempt to further reduce this targeting. We added mismatches at positions 5, 6, and 7 in the seed region and at positions 10 and 11 in the Argonaute recognition region (Figure 9). We changed the nucleotides in the shRNA in such a way that the GC content was stable, but we expect other changes to have a similar effect. Allele-specific qRT-PCR after transduction of the original shC17 sequence and shRNAs with additional mismatches revealed that shC17mm5 induced a stronger downregulation of the targeted C allele of rs4641 in the LMNA isoform, but also a stronger downregulation of the untargeted T allele (Figure 10A). This resulted in a slightly stronger shift in allelic balance compared to the original C17 sequence (36:63% shC17mm5 and 39:61% shC17, FIG. 10B). Interestingly, shC17mm7 resulted in a comparable allelic imbalance of LMNA (40:60%), induced by a stronger upregulation of the untargeted allele than the targeted allele. We again demonstrated that these shRNAs targeting LMNA splice isoforms did not affect LMNC splice isoform levels. To further investigate whether the absolute level of mutant alleles or allelic imbalance is the most important factor determining disease severity in patients and phenotype in our hiPSC-CMs, we decided to further investigate shC17, shC17mm5, and shC17mm7 and compare their effects on disease phenotype in hiPSC-CMs.

[0164] Because both alleles of a SNP may be present on mutant LMNA alleles in different patients, we also targeted the T allele of rs4641 in LMNA, which is present on the mutant allele in our H222P hiPSC-CMs. This revealed one shRNA, shT17, that downregulated the targeted T allele by 53% and the untargeted allele by 8% (Figure 11A), while all other shRNAs similarly induced upregulation of both LMNA alleles. This 53% downregulation of the targeted allele also resulted in a shift in the allelic balance from 45:55% in SCR negative control transduced cells to a 61:39% ratio in shT17 transduced cells, meaning that in these cells the ratio shifted from a small relative overexpression of the mutant allele to a relative underexpression of the mutant allele with shT17 (Figure 11B). Also, shRNAs targeting the T allele of the LMNA splice isoform did not affect the allelic imbalance of the LMNC splice isoform. We also added extra mismatches to the shT17 sequence at positions 5, 6, and 7 in the seed region, and at positions 10 and 11 in the Argonaute recognition region. Interestingly, we observed a similar effect with the addition of these mismatches to the shC17 sequence (Figure 9). Similarly, the mismatch at position 5 induced a stronger downregulation of the targeted T allele, up to 83%, but also a stronger downregulation of the untargeted C allele, by 44%. The mismatch at position 7 resulted in a similar downregulation (20%) as the original T17 sequence in this experiment, but also a strong upregulation of the untargeted C allele (Figure 12A). As a result, both shRNAs with mismatches at positions 5 and 7 (76:24% and 74:26%) had a stronger effect on allelic imbalance compared to the original T17 sequence (70:30%, FIG. 12B). Similarly, these shRNAs had no effect on the allelic imbalance of LMNC (FIG. 12C / D).For the same question of whether the absolute level of mutant alleles or allelic imbalance is the most important factor determining disease severity in patients and the phenotype in our hiPSC-CMs, we decided to further study shT17, shT17mm5, and shT17mm7 and compare their effects on disease phenotype in hiPSC-CMs.

[0165] Allele-specific targeting of rs4641 in LMNC isoforms To test shRNAs targeting LMNC, cardiomyocytes derived from the H222P hiPSC line were lentivirally transduced with these shRNAs and allele-specific qRT-PCR expression levels of mutant and wild-type LMNC alleles were compared to expression levels in cells transduced with a scrambled negative control shRNA (Scr). Targeting the C allele of rs4641 in the LMNC splice isoform present in this H222P hiPSC line on the wild-type LMNC allele revealed three shRNAs, shC11, shC13, and shC17, with 31%, 6%, and 16% knockdown of the C allele, respectively (Figure 13). However, shC11 also had 30% knockdown of the untargeted T allele, and shC17 had 6%. This resulted in a small shift in allelic balance from 48:51% in scramble-transduced cells to 59:41% in shC11, 57:43% in shC13, and 36:64% in shC17. We also determined the effect of these shRNAs on LMNA expression levels and noticed that shC11 also inhibited the LMNA isoform by 25% in a non-allele specific manner, while shC17 increased the levels of both the C and T alleles, but to a greater extent the T allele, thus resulting in a small shift in the allelic balance of LMNA (from 48:52% in scramble-transduced cells to 43:57% in shC17). This means that shC17 may be a good candidate that can affect both splice isoforms. Considering the results of the mismatches added to shC17 targeting the LMNC isoforms described above, we speculate that adding mismatches 5 and 7 to shC17 targeting the LMNC isoforms may also further improve allele-specific targeting or allelic imbalance induction of LMNC, which may have the potential to immediately affect LMNA as well, which may reduce the need to target both splice isoforms separately.

[0166] To further improve allele-specific targeting by shC11 and shC13 targeting the C allele of the LMNC isoform, mismatches were added to these shRNA sequences (Figure 14). Mismatches added to shC11 additionally did not result in downregulation of the targeted or non-targeted LMNC alleles (Figure 15), and shC11mm5 resulted in a small upregulation that was stronger in the non-targeted allele, resulting in a slightly stronger allelic imbalance (40:60% scr, 36:64% shC11, and 30:70% shC11mm5). Addition of mismatches to the C13 shRNA sequence resulted in stronger downregulation of the targeted C allele for shC13mm17 (Figure 16). However, downregulation of the untargeted allele was almost equally strong, which resulted in a comparable allelic balance between the original C13 shRNA and shC13mm17 (66:34% vs. 65:35%). However, depending on the phenotyping results performed on the LMNA targeting shRNA, if the loss of absolute levels of the mutant allele proves to be more important than the effect on allelic balance, this shC13mm17 may be an interesting candidate for further phenotyping.

[0167] Similarly, because both alleles of rs4641 may exist on the mutant allele in different patients, shRNAs targeting the T allele of rs4641 in the LMNC isoforms were also tested. This revealed two shRNAs that could downregulate the targeted T allele by 33% for shT14 and 22% for shT17, and they also downregulated the untargeted C allele by 20% and 15%, respectively. Surprisingly, the allelic imbalance of shT17 shifted towards a relative overexpression of the more strongly downregulated targeted T allele (40:60% vs. 43:57% for scr). shT14 shifted the allelic imbalance in the expected direction towards a relative underexpression of the targeted T allele (51:49%, FIG. 17). Both shRNAs did not affect the allelic imbalance of the LMNA splice isoforms. No additional mismatches were added to shT17 targeting the LMNC isoform, but based on the effects observed after the addition of mismatches to shT17 targeting the LMNA splice isoform, it can be imagined that mismatches 5 and 7 may also improve targeting by shT17. Additional mismatches were added to shT14 (FIG. 18), which revealed that no shRNA was able to more strongly inhibit the targeted T allele or further affect allelic imbalance. [Table 3-1] [Table 3-2] [Table 4-1] [Table 4-2] [Table 4-3]

[0168] (Additional Note) (Appendix 1) An isolated antisense molecule capable of inhibiting or reducing allele-specific expression of the LMNA gene in a mammalian cell, said antisense molecule comprising an antisense nucleic acid strand that is substantially complementary to a target region of a transcript encoded by the LMNA gene, said antisense nucleic acid strand being at least complementary to SNP rs538089, rs505058, or rs4641 in said target region.

[0169] (Appendix 2) double-stranded nucleic acid (dsNA) or a chemically modified version thereof, or 2. The isolated antisense molecule of claim 1, selected from an antisense oligonucleotide (ASO).

[0170] (Appendix 3) The target region is GAUGACCUGCUCCAUCACCACCACGUGAGUGGUAGCCGCCGCUGA (SEQ ID NO: 1), GAUGACCUGCUCCAUCACCACCAUGUGAGUGGUAGCCGCCGCUGA (SEQ ID NO: 2), GAUGACCUGCUCCAUCACCACCACGGCUCCCACUGCAGCAGCUC (SEQ ID NO: 3), and GAUGACCUGCUCCAUCACCACCAUGGCUCCCACUGCAGCAGCUC (SEQ ID NO: 4) or a sequence which is at least 80% homologous thereto.

[0171] (Appendix 4) 4. The isolated antisense molecule of any one of claims 1 to 3, wherein the antisense nucleic acid strand comprises a nucleic acid sequence having a contiguous stretch of at least 12 nucleotides selected from the nucleic acid sequences set forth in SEQ ID NO: 151, SEQ ID NO: 152, SEQ ID NO: 153, or SEQ ID NO: 154.

[0172] (Appendix 5) 5. The isolated antisense molecule of any one of claims 1 to 4, wherein the antisense nucleic acid comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, and SEQ ID NO: 74.

[0173] (Appendix 6) 6. An isolated antisense molecule according to any one of appendices 1 to 5, comprising the antisense nucleic acids set forth in SEQ ID NO: 73 and SEQ ID NO: 74.

[0174] (Appendix 7) 7. The isolated antisense molecule according to any one of claims 1 to 6, wherein the antisense molecule comprises a sense nucleic acid strand having a length of 15 to 30 nucleotides, the sense nucleic acid strand being complementary to the antisense region, and the sense nucleic acid strand and the antisense nucleic acid strand forming a double-stranded region.

[0175] (Appendix 8) 8. The isolated antisense molecule of any one of claims 1 to 7, wherein the antisense strand and the sense strand are operably linked by an RNA loop strand to form a hairpin structure comprising a double-stranded structure and a loop structure.

[0176] (Appendix 9) A nucleic acid encoding an isolated antisense molecule according to any one of claims 1 to 8.

[0177] (Appendix 10) An expression cassette comprising a nucleic acid encoding an antisense molecule according to any one of claims 1 to 9.

[0178] (Appendix 11) An expression vector comprising the expression cassette described in Appendix 10.

[0179] (Appendix 12) 13. A pharmaceutical composition comprising an isolated antisense molecule according to any one of appendices 1 to 8, a nucleic acid according to appendices 9, an expression cassette according to appendix 10, or an expression vector according to appendix 11, and a pharma- ceutically acceptable carrier.

[0180] (Appendix 13) 17. An isolated antisense molecule according to any one of Appendix 1 to 8, a nucleic acid according to Appendix 9, an expression cassette according to Appendix 10, an expression vector according to Appendix 11, or a pharmaceutical composition according to Appendix 12, for use in medical treatment.

[0181] (Appendix 14) 13. The isolated antisense molecule of any one of Appendix 1 to 8, the nucleic acid of Appendix 9, the expression cassette of Appendix 10, the expression vector of Appendix 11, or the pharmaceutical composition of Appendix 12, for use in the treatment of heart failure.

[0182] (Appendix 15) 1. A method for selecting antisense molecules suitable for the medical treatment of a disease caused by an autosomal dominant mutation present in a mutant allele of a gene, comprising: Providing a nucleic acid sample from a subject suffering from a disease caused by an autosomal dominant mutation present in a mutant allele of a gene; determining the heterozygosity of the mutant allele of the gene responsible for the disease; determining the presence of heterozygous SNPs in said gene; determining the nucleic acid sequence of a target region containing a heterozygous SNP in a transcript of the mutant allele of the gene; selecting an isolated antisense molecule that is complementary to said target region.

[0183] (Appendix 16) 1. An in vitro method for inhibiting or reducing expression of a mutant LMNA allele in a cell, comprising: introducing into said cell an antisense molecule of the invention, which upon contact introduction with a cell expressing a LMNA mutant allele inhibits or reduces expression of said LMNA mutant allele; maintaining the cells produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of the LMNA mutant allele, thereby inhibiting and reducing expression of the LMNA mutant allele in the cells.

Claims

1. An isolated antisense molecule capable of inhibiting or reducing allele-specific expression of an LMNA gene in a mammalian cell, said antisense molecule comprising an antisense nucleic acid strand that is substantially complementary to a target region of a transcript encoded by said LMNA gene, said antisense nucleic acid strand being at least complementary to SNP rs538089, rs505058, or rs4641 in said target region.

2. double-stranded nucleic acid (dsNA) or a chemically modified version thereof, or The isolated antisense molecule of claim 1 , selected from antisense oligonucleotides (ASOs).

3. The target region is GAUGACCUGCUCCAUCCACCACCACGUGAGUGGUAGCCGCCGCUGA (SEQ ID NO: 1), GAUGACCUGCUCCAUCCACCACCAUGUGAGUGGUAGCCGCCGCUGA (SEQ ID NO: 2), GAUGACCUGCUCCAUCCACCACCACGGCUCCCACUGCAGCAGCUC (SEQ ID NO: 3), and GAUGACCUGCUCCAUCACCACCAUGGCUCCCACUGCAGCAGCUC (SEQ ID NO: 4) 3. The isolated antisense molecule of claim 1 or 2, comprising a nucleic acid sequence selected from the group consisting of: or a sequence that is at least 80% homologous thereto.

4. 4. The isolated antisense molecule of any one of claims 1 to 3, wherein the antisense nucleic acid strand comprises a nucleic acid sequence having a contiguous stretch of at least 12 nucleotides selected from the nucleic acid sequences set forth in SEQ ID NO:151, SEQ ID NO:152, SEQ ID NO:153, or SEQ ID NO:

154.

5. 5. The isolated antisense molecule of any one of claims 1 to 4, wherein the antisense nucleic acid comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, and SEQ ID NO:

74.

6. 6. The isolated antisense molecule according to any one of claims 1 to 5, comprising the antisense nucleic acids set forth in SEQ ID NO:73 and SEQ ID NO:

74.

7. 7. The isolated antisense molecule of any one of claims 1 to 6, wherein the antisense molecule comprises a sense nucleic acid strand of 15 to 30 nucleotides in length, the sense nucleic acid strand being complementary to the antisense region, and the sense nucleic acid strand and the antisense nucleic acid strand forming a double-stranded region.

8. 8. The isolated antisense molecule of any one of claims 1 to 7, wherein the antisense strand and the sense strand are operably linked by an RNA loop strand to form a hairpin structure comprising a double-stranded structure and a loop structure.

9. A nucleic acid encoding the isolated antisense molecule of any one of claims 1 to 8.

10. An expression cassette comprising a nucleic acid encoding the antisense molecule of any one of claims 1 to 9.

11. An expression vector comprising the expression cassette of claim 10.

12. A pharmaceutical composition comprising an isolated antisense molecule according to any one of claims 1 to 8, a nucleic acid according to claim 9, an expression cassette according to claim 10, or an expression vector according to claim 11, and a pharma- ceutically acceptable carrier.

13. 13. An isolated antisense molecule according to any one of claims 1 to 8, a nucleic acid according to claim 9, an expression cassette according to claim 10, an expression vector according to claim 11, or a pharmaceutical composition according to claim 12 for use in medical therapy.

14. 13. The isolated antisense molecule of any one of claims 1 to 8, the nucleic acid of claim 9, the expression cassette of claim 10, the expression vector of claim 11, or the pharmaceutical composition of claim 12, for use in the treatment of heart failure.

15. 1. A method for selecting antisense molecules suitable for the medical treatment of a disease caused by an autosomal dominant mutation present in a mutant allele of a gene, comprising: Providing a nucleic acid sample from a subject suffering from a disease caused by an autosomal dominant mutation present in a mutant allele of a gene; determining the heterozygosity of the mutant allele of the gene responsible for the disease; determining the presence of heterozygous SNPs in said gene; determining the nucleic acid sequence of a target region containing a heterozygous SNP in a transcript of the mutant allele of the gene; selecting an isolated antisense molecule that is complementary to said target region.

16. 1. An in vitro method for inhibiting or reducing expression of a mutant LMNA allele in a cell, comprising: introducing into said cell an antisense molecule of the invention, which upon contact introduction with a cell expressing a LMNA variant allele inhibits or reduces expression of said LMNA variant allele; maintaining the cells produced in step (a) for a time sufficient to obtain degradation of mRNA transcripts of said LMNA mutant allele, thereby inhibiting and reducing expression of said LMNA mutant allele in said cells.

Images