Improved Producer Cells
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- F HOFFMANN LA ROCHE & CO AG
- Filing Date
- 2023-06-01
- Publication Date
- 2026-05-26
AI Technical Summary
Current methods for producing recombinant therapeutic proteins in mammalian cells, such as CHO cells, face challenges with high levels of hydroxylysine formation, leading to increased filtration resistance, cell aggregation, and production of antibody-related by-products.
The development of engineered mammalian cells with reduced transcriptional activity of lysine hydroxylases, specifically lysine 5R-hydroxylases, which are achieved through gene knockout or functional inactivation, thereby reducing hydroxylysine formation.
This approach results in improved cell culture performance, increased biomass formation, higher recombinant protein titers, reduced by-product formation, improved filterability, and decreased cell aggregation.
Smart Images

Figure 00000000_0000_ABST 
Figure 00000000_0001_ABST
Abstract
Description
[Technical field]
[0001] The present invention is in the field of recombinant therapeutic protein production. More specifically, improved mammalian (e.g. Chinese Hamster Ovary (CHO) or Human Embryonic Kidney (HEK)) producer cells and their use for recombinant production of therapeutic proteins are reported herein, the improvement being achieved by reducing the transcriptional activity of lysine hydroxylases, in particular lysine 5R-hydroxylases. [Background technology]
[0002] In recent years, recombinant polypeptides, such as antibodies and antibody-based molecules, have found wide application in the field of disease treatment.
[0003] Specifically with respect to antibodies, after the first wave of antibody-based drugs, which included the naturally occurring IgG format, next-generation formats now increasingly see molecules with substantial modifications and derivatives from the classical IgG antibody format. The desire to target two or more antigens sequentially or simultaneously leads to increasingly complex antibody formats. As the complexity of the format increases, the number of possible antibody-related by-products, such as chain mismatching, increases.
[0004] One step for therapeutic antibodies on the way to the market is the development of stable production cell lines characterized by high expression combined with good quality of the recombinant protein, i.e., low content of antibody-related by-products.
[0005] Xie, Q., et al. (MABS8 (2016) 371-378) identified a previously unreported +16 Da modification in the sequence XXXXXXXXXWGQGTLVTVSSASTK (SEQ ID NO: 66) derived from post-translational hydroxylation of lysine in the consensus sequence (XKG) in a recombinant IgG1 monoclonal antibody expressed in Chinese hamster ovary (CHO). This consensus sequence was present at several positions in the antibody sequence, but only a single site on the heavy chain Fab was found to be modified. They outline that lysine hydroxylation of proteins containing collagen and collagen-like domains occurs in animals and typically plays a functional / structural role as a precursor for cross-linking and O-glycosylation. Hydroxylation of these lysines occurs via lysyl hydroxylase enzymes that recognize the consensus amino acid sequence Xaa-Lys-Gly and convert lysine to 5-hydroxylysine (Hyl). Xie et al. hypothesize that the explanation for the specific modification at position 124 of the heavy chain is that the structure of mAb1 around this position may be a more preferred substrate for lysyl hydroxylase, whereas the local structures around other consensus sequence sites are not as readily bound by the enzyme.
[0006] EP 1375510 reported the gene PLOD2 encoding telopeptide lysyl hydroxylase (TLH). This enzyme converts telopeptidyl Lys to telopeptidyl Hyl, which can then be converted to hydroxylysine crosslinks. Collagen with hydroxylysine crosslinks shows higher resistance to degradation by proteinases than collagen with hydroxylysine-derived crosslinks. In one aspect, EP 1375510 provides methods and compositions for preparing collagenous materials with different biodegradation rates by varying the ratio of hydroxylysine crosslinks to hydroxylysine crosslinks.
[0007] US Patent No. 5,328,913 reported a method for inhibiting cell proliferation and lysyl hydroxylase expression by using minoxidil derivatives.
[0008] Mia, MM and Bank, RA reported that the lκB kinase inhibitor ACHP strongly attenuated TGFβ1-induced myofibroblast formation and collagen synthesis.
[0009] WO 2021 / 028350 reported in situ glycosylated MHCII / CII peptide complexes, i.e. complexes that are naturally glycosylated during recombinant protein expression in a host cell. The host cell is a genetically engineered cell that recombinantly expresses lysyl hydroxylase and collagen galactosyltransferase, preferably lysyl hydroxylase 1 (LH1) and / or lysyl hydroxylase 2 (LH2) and collagen galactosyltransferase GLT25D1 and / or GLT25D2. CHO cells commonly used for protein production have been tested and it is outlined that they are unable to adequately add post-translational modifications to lysine residues resulting in galactosyl hydroxylysine (Gal-Hyl) in collagen or in the MHCII / CII peptide complexes described therein. Therefore, CHO cells need to be genetically engineered to recombinantly express lysyl hydroxylase and collagen galactosyltransferase.
[0010] Guo, T., et al. (Lab. Invest. 101 (2021) 564-569) reported that PLOD is overexpressed in ovarian cancer and associated with gap junctions via connexin 43. In particular, they reported that SKOV3 cells stably transfected with shRNA targeting PLOD3 grew after subcutaneous injection in mice, whereas CAOV3 cells were significantly inhibited in proliferation and failed to spot measurable tumors when PLOD3 was knocked down. Their conclusion was that the expression of PLOD1, PLOD2, and PLOD3 showed a trend toward mutual exclusivity, partially indicating functional nonredundancy. Summary of the Invention
[0011] The subject matter of the invention disclosed herein is based, at least in part, on the discovery that knocking out the PLOD gene reduces / eliminates the level of hydroxylysine formation in recombinantly produced heterologous proteins.
[0012] The subject matter of the invention disclosed herein is based, at least in part, on the discovery that knocking out the PLOD gene does not affect the overall cell culture performance of the respective modified cells. PLOD knockout cell lines have been found to have a higher ability to form biomass in culture, and therefore higher recombinant protein titers, compared to cells of the same genotype except for the PLOD knockout.
[0013] The subject matter of the invention disclosed herein is based, at least in part, on the discovery that knocking out the PLOD gene does not affect other protein quality attributes. CE-SDS and SEC evaluations were found to show comparable or even increased main peak levels, and comparable or even decreased by-product levels.
[0014] The subject matter of the invention disclosed herein is based at least in part on the discovery that knocking out the PLOD gene reduces filterability problems. Without being bound by this theory, it is believed that this is due to the fact that CHO cells, in particular, express many collagen genes at high levels and therefore are unable to cross-link collagen any more. It has been found that filterability is at least as good or even improved by reducing the increase in filtration pressure.
[0015] The subject matter of the invention disclosed herein is based, at least in part, on the discovery that knockout of the PLOD gene reduces cell aggregation in culture. Without being bound by this theory, it is believed that the reduction / absence of cross-linked collagen is unable to mediate trans-binding of different CHO cells via integrin α1β1.
[0016] In the present invention, the term "knockout" is used in a functional sense. That is, "knockout" refers to the functional inactivation of the respective gene. This can be, but is not limited to, for example, the deletion of the respective gene or a part thereof, the introduction of a nonsense mutation that results in a nonfunctional gene product after transcription and translation, the introduction of a premature stop codon that results in the production of a nonfunctional gene product. Thus, the term "knockout" encompasses different approaches that result in the reduction or elimination of the function of the respective gene by reducing or eliminating the production of a functional gene product, or by truncating, mutating or eliminating the respective gene.
[0017] The present invention encompasses the following independent aspects and dependent embodiments.
[0018] 1. An engineered mammalian cell in which the transcriptional activity of the gene encoding lysine hydroxylase is reduced.
[0019] 2. The modified mammalian cell according to aspect 1, further comprising reduced transcriptional activity of a gene encoding a prolyl hydroxylase.
[0020] 3. The modified mammalian cell of any one of aspects 1 or embodiment 2, wherein said lysine hydroxylase is a lysine 5R-hydroxylase.
[0021] 4. The modified mammalian cell of aspect 1 or any one of embodiments 2-3, wherein said lysine hydroxylase is an oxidoreductase of the enzyme class (EC) 1.14.11.
[0022] 5. The modified mammalian cell of aspect 1 or any one of embodiments 2-4, wherein said lysine hydroxylase is procollagen-lysine, 2-oxoglutarate 5-dioxygenase (PLOD).
[0023] 6. The modified mammalian cell of aspect 1 or any one of embodiments 2-5, wherein said lysine hydroxylase is in EC 1.14.11.4.
[0024] 7. The modified mammalian cell of any one of embodiments 2 to 6, wherein said prolyl hydroxylase is prolyl 3-hydroxylase (P3H).
[0025] 8. The modified mammalian cell of aspect 1 or any one of embodiments 2-7, wherein said lysine hydroxylase is one or two or all of procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 (PLOD1), procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 (PLOD2) and procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3 (PLOD3).
[0026] 9. The modified mammalian cell of any one of embodiments 2 to 8, wherein said prolyl hydroxylase is prolyl 3-hydroxylase 3 or prolyl 3-hydroxylase 4.
[0027] 10. The modified mammalian cell according to aspect 1 or any one of embodiments 2 to 9, wherein said transcriptional activity of one or more PLOD genes is reduced.
[0028] 11. The modified mammalian cell according to any one of embodiments 2 to 10, wherein said transcriptional activity of one or more P3H genes is reduced.
[0029] 12. The modified mammalian cell according to aspect 1 or any one of embodiments 2 to 11, wherein the transcriptional activity of the PLOD1 or / and PLOD2 or / and PLOD3 genes is reduced.
[0030] 13. The modified mammalian cell according to any one of embodiments 2 to 12, wherein said transcriptional activity of said P3H3 or / and P3H4 genes is reduced.
[0031] 14. The modified mammalian cell according to aspect 1 or any one of embodiments 2 to 13, wherein the transcriptional activity of one or two or all of said PLOD1, PLOD2 and PLOD3 genes is reduced.
[0032] 15. The modified mammalian cell according to aspect 1 or any one of embodiments 2 to 14, wherein said transcriptional activity of at least the PLOD2 gene is reduced, such that none of its splice variants are translated.
[0033] 16. The modified mammalian cell according to aspect 1 or any one of embodiments 2 to 15, wherein said modified mammalian cell is a modified CHO cell or a modified HEK cell.
[0034] 17. The modified mammalian cell according to aspect 1 or any one of embodiments 2 to 16, wherein said modified mammalian cell is a modified CHO K1 or a modified HEK293 cell.
[0035] 18. The modified mammalian cell according to aspect 1 or any one of embodiments 2 to 17, further comprising reduced transcriptional activity of one or more or all of the MYC gene or / and BAX gene or / and BAK gene or / and ICAM-1 gene or / and SIRT-1 gene.
[0036] 19. The modified mammalian cell according to aspect 1 or any one of embodiments 2 to 18, wherein said reduction is a permanent reduction.
[0037] 20. The modified mammalian cell according to aspect 1 or any one of embodiments 2 to 19, wherein said reduction is due to inactivation.
[0038] 21. The modified mammalian cell according to aspect 1 or any one of embodiments 2 to 20, wherein said reduction is due to gene knockout.
[0039] 22. The modified mammalian cell according to aspect 1 or any one of embodiments 2 to 21, wherein said reduction is by deleting all or part of said gene.
[0040] 23. The modified mammalian cell according to aspect 1 or any one of embodiments 2 to 21, wherein said reduction is due to the introduction of a mutation into said gene that results in the production of a non-functional gene product.
[0041] 24. The modified mammalian cell according to aspect 1 or any one of embodiments 2 to 21, wherein said reduction is due to the introduction of an additional stop codon into said gene, which results in the production of a non-functional gene product.
[0042] 25. The modified mammalian cell according to aspect 1 or any one of embodiments 2 to 24, wherein said reduction is mediated by CRISPR / Cas.
[0043] 26. The modified mammalian cell according to aspect 1 or any one of embodiments 2 to 25, wherein the modified mammalian cell comprises one or more targeted integration landing sites.
[0044] 27. The modified mammalian cell of aspect 1 or any one of embodiments 2-26, wherein the modified mammalian cell comprises one or more targeted integration landing sites each comprising two or three recombinase recognition sequences, whereby, in the case of two or more landing sites, the recombinase recognition sequences of each landing site are not compatible with each other.
[0045] 28. The modified mammalian cell according to aspect 1 or any one of embodiments 2-27, wherein said modified mammalian cell comprises one or more targeted integration landing sites, whereby one of the targeted integration landing sites comprises the recombinase recognition sequences 3L, LoxFas and L2.
[0046] 29. The modified mammalian cell of aspect 1 or any one of embodiments 2-28, wherein the modified mammalian cell comprises one or more targeted integration landing sites, whereby one or more nucleic acids encoding heterologous proteins are integrated into one targeted integration landing site.
[0047] 30. The modified mammalian cell according to aspect 1 or any one of embodiments 2 to 29, wherein at least said reduction in transcriptional activity of said gene encoding a lysine hydroxylase is achieved following stable introduction of one or more nucleic acids encoding a heterologous protein.
[0048] 31. The modified mammalian cell according to aspect 1 or any one of embodiments 2 to 28, wherein said modified mammalian cell comprises one or more targeted integration landing sites, whereby one or more nucleic acids encoding a monospecific or multispecific antibody are integrated at one targeted integration landing site.
[0049] 32. The modified mammalian cell according to aspect 1 or any one of embodiments 2 to 28 and 31, wherein at least said reduction in transcriptional activity of said gene encoding a lysine hydroxylase is achieved following stable introduction of one or more nucleic acids encoding a monospecific or multispecific antibody.
[0050] 33. A method for recombinant production of a heterologous protein, comprising: a) culturing a modified mammalian cell according to aspect 1 or any one of embodiments 2 to 30, further comprising one or more nucleic acids encoding said heterologous protein, in a culture medium under suitable conditions for recombinant expression of said heterologous protein; b) recovering the heterologous protein from the modified mammalian cell or the culture medium; c) optionally purifying the heterologous protein by one or more chromatography steps; thereby recombinantly producing said heterologous protein.
[0051] 34. A method for the recombinant production of monospecific or multispecific antibodies, comprising: a) culturing the modified mammalian cell according to any one of embodiments 31-32 in a culture medium under conditions suitable for recombinant expression of said monospecific or multispecific antibodies; b) recovering said monospecific or multispecific antibody from said modified mammalian cells or from said culture medium; c) optionally purifying said monospecific or multispecific antibodies by one or more chromatography steps; thereby recombinantly producing a monospecific or multispecific antibody.
[0052] 35. The method according to any one of aspects 33 to 34, wherein the culture is for 6 to 16 days.
[0053] 36. The method according to any one of aspects 33 to 34 or embodiment 35, wherein the culturing is for 12 to 15 days.
[0054] 37. The method according to any one of aspects 33-34 or embodiments 35-36, wherein the culturing is for about 14 days.
[0055] 38. A method according to any one of aspects 33 to 34 or embodiments 35 to 37, wherein the culture is initiated at a cell density of 3 to 5 x 10^5 cells / ml or more.
[0056] 39. A method according to any one of aspects 33 to 34 or embodiments 35 to 38, wherein the culture is initiated at a cell density of 100 x 10^5 cells / ml or more.
[0057] 40. The method according to any one of aspects 33 to 34 or embodiments 35 to 39, wherein the culture is a fed-batch culture.
[0058] 41. The method according to any one of aspects 33 to 34 or embodiments 35 to 40, wherein the culturing is a fed-batch culturing comprising feeding at least on days 1, 4, 7 and 10.
[0059] 42. The method according to any one of aspects 33-34 or embodiments 35-41, wherein the culture is a fed-batch culture comprising daily feeding.
[0060] 43. Use of a modified mammalian cell according to aspect 1 or any one of embodiments 2 to 30 for reducing the amount of lysine hydroxylation in a heterologous protein recombinantly produced using said modified mammalian cell.
[0061] 44. Use of a modified mammalian cell according to aspect 1 or any one of embodiments 2 to 30 for reducing the amount of hydroxylysine in a heterologous protein recombinantly produced using said modified mammalian cell.
[0062] 45. Use of a modified mammalian cell according to aspect 1 or any one of embodiments 2 to 30 for increasing biomass formation in a culture of said modified mammalian cell.
[0063] 46. Use of a modified mammalian cell according to aspect 1 or any one of embodiments 2 to 30 for increasing the titer of a heterologous protein recombinantly produced in said modified mammalian cell.
[0064] 47. Use of a modified mammalian cell according to aspect 1 or any one of embodiments 2 to 30 for reducing heterologous protein by-product formation in a culture of said modified mammalian cell recombinantly expressing said heterologous protein.
[0065] 48. Use of a modified mammalian cell according to aspect 1 or any one of embodiments 2 to 30 for reducing the filtration resistance in a heterologous protein preparation recombinantly produced using said modified mammalian cell.
[0066] 49. Use of a modified mammalian cell according to aspect 1 or any one of embodiments 2 to 30 for reducing cell aggregation in a culture of said modified mammalian cell.
[0067] 50. Use of a modified mammalian cell according to any one of embodiments 31 to 32 for reducing the amount of lysine hydroxylation in a monospecific or multispecific antibody produced using said modified mammalian cell.
[0068] 51. Use of a modified mammalian cell according to any one of embodiments 31 to 32 for reducing the amount of hydroxylysine in a monospecific or multispecific antibody produced using said modified mammalian cell.
[0069] 52. Use of a modified mammalian cell according to any one of embodiments 31 to 32 for increasing biomass formation in a culture of said modified mammalian cell.
[0070] 53. Use of a modified mammalian cell according to any one of embodiments 31 to 32 for increasing the titer of a monospecific or multispecific antibody produced using said modified mammalian cell.
[0071] 54. Use of a modified mammalian cell according to any one of embodiments 31 to 32 for reducing monospecific or multispecific antibody by-product formation in a culture of said modified mammalian cell recombinantly expressing said monospecific or multispecific antibody.
[0072] 55. Use of a modified mammalian cell according to any one of embodiments 31 to 32 for reducing the filtration resistance in a monospecific or polyspecific antibody preparation produced using said modified mammalian cell.
[0073] 56. Use of a modified mammalian cell according to any one of embodiments 31 to 32 for reducing cell aggregation in a culture of said modified mammalian cell.
[0074] 57. Use of reducing the transcriptional activity of one or more genes encoding lysine hydroxylases in a mammalian cell to reduce the amount of lysine hydroxylation in a heterologous protein recombinantly produced using said modified mammalian cell.
[0075] 58. The use of reducing the transcriptional activity of one or more genes encoding lysine hydroxylases in a mammalian cell to reduce the amount of hydroxylysine in a heterologous protein recombinantly produced using said modified mammalian cell.
[0076] 59. Use of reduced transcriptional activity of one or more genes encoding lysine hydroxylases in mammalian cells to increase biomass formation in cultures of modified mammalian cells.
[0077] 60. Use of a reduction in the transcriptional activity of one or more genes encoding lysine hydroxylases in a mammalian cell to increase the titer of a heterologous protein recombinantly produced in said modified mammalian cell.
[0078] 61. Use of reduced transcriptional activity of one or more genes encoding lysine hydroxylases in mammalian cells to reduce heterologous protein by-product formation in a culture of said modified mammalian cells recombinantly expressing said heterologous protein.
[0079] 62. The use of reduced transcriptional activity of one or more genes encoding lysine hydroxylases in mammalian cells to reduce filtration resistance in heterologous protein preparations recombinantly produced using modified mammalian cells.
[0080] 63. Use of a reduction in the transcriptional activity of one or more genes encoding lysine hydroxylases in mammalian cells to reduce cell aggregation in culture of said modified mammalian cells.
[0081] 64. The use according to any one of aspects 57 to 63, further wherein said transcriptional activity of a gene encoding a prolyl hydroxylase is reduced.
[0082] 65. The use according to any one of aspects 57 to 63 or embodiment 64, wherein the lysine hydroxylase is a lysine 5R-hydroxylase.
[0083] 66. The use according to any one of aspects 57 to 63 or embodiments 64 to 65, wherein the lysine hydroxylase is an oxidoreductase of the enzyme class (EC) 1.14.11.
[0084] 67. The use according to any one of aspects 57 to 63 or embodiments 64 to 66, wherein the lysine hydroxylase is procollagen-lysine, 2-oxoglutarate 5-dioxygenase (PLOD).
[0085] 68. The use according to any one of aspects 57 to 63 or embodiments 64 to 67, wherein the lysine hydroxylase is EC 1.14.11.4.
[0086] 69. The use according to any one of aspects 57 to 63 or embodiments 64 to 68, wherein the prolyl hydroxylase is a prolyl 3-hydroxylase (P3H).
[0087] 70. Use according to any one of aspects 57 to 63 or embodiments 64 to 69, wherein the lysine hydroxylase is procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 (PLOD1) or / and procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 (PLOD2) or / and procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3 (PLOD3).
[0088] 71. The use according to any one of embodiments 64 to 70, wherein the prolyl hydroxylase is prolyl 3-hydroxylase 3 or prolyl 3-hydroxylase 4.
[0089] 72. The use according to any one of aspects 57 to 63 or embodiments 64 to 71, wherein said transcriptional activity of one or more PLOD genes is reduced.
[0090] 73. The use according to any one of embodiments 64 to 72, in which the transcriptional activity of one or more P3H genes is reduced.
[0091] 74. Use according to any one of aspects 57 to 63 or embodiments 64 to 73, wherein the transcriptional activity of the PLOD1 or / and PLOD2 or / and PLOD3 genes is reduced.
[0092] 75. The use according to any one of embodiments 64 to 74, wherein the transcriptional activity of the P3H3 or / and P3H4 genes is reduced.
[0093] 76. The use according to any one of aspects 57 to 63 or embodiments 64 to 75, wherein the transcriptional activity of at least the PLOD2 gene is reduced.
[0094] 77. Use according to any one of aspects 57 to 63 or embodiments 64 to 76, wherein the transcriptional activity of the PLOD2 gene is reduced such that none of its splice variants are translated.
[0095] 78. The use according to any one of aspects 57 to 63 or embodiments 64 to 77, wherein the mammalian cell is a CHO cell or a modified HEK cell.
[0096] 79. The use according to any one of aspects 57 to 63 or embodiments 64 to 78, wherein the mammalian cell is a CHO K1 or HEK293 cell.
[0097] 80. The use according to any one of aspects 57 to 63 or embodiments 64 to 79, further comprising reducing the transcriptional activity of one or more or all of the MYC gene or / and BAX gene or / and BAK gene or / and ICAM-1 gene or / and SIRT-1 gene.
[0098] 81. The use according to any one of aspects 57 to 63 or embodiments 64 to 80, wherein the reduction is a permanent reduction.
[0099] 82. The use according to any one of aspects 57 to 63 or embodiments 64 to 81, wherein the reduction is inactivation.
[0100] 83. The use according to any one of aspects 57 to 63 or embodiments 64 to 81, wherein the reduction is due to deleting all or part of the gene.
[0101] 84. The use according to any one of aspects 57 to 63 or embodiments 64 to 81, wherein the reduction is due to the introduction of a mutation into the gene that results in the production of a non-functional gene product.
[0102] 85. The use according to any one of aspects 57 to 63 or embodiments 64 to 81, wherein the reduction is due to the introduction of an additional stop codon into the gene, which results in the production of a non-functional gene product.
[0103] 86. The use according to any one of aspects 57 to 63 or embodiments 64 to 85, wherein the reduction is due to gene knockout.
[0104] 87. The use according to any one of aspects 57 to 63 or embodiments 64 to 86, wherein the reduction is mediated by CRISPR / Cas.
[0105] 88. The use according to any one of aspects 57 to 63 or embodiments 64 to 87, wherein the mammalian cell comprises one or more targeted integration landing sites.
[0106] 89. The use according to any one of aspects 57 to 63 or embodiments 64 to 88, wherein the mammalian cell comprises one or more targeted integration landing sites, whereby one or more nucleic acids encoding heterologous proteins are integrated at one of the targeted integration landing sites.
[0107] 90. The use according to any one of aspects 57 to 63 or embodiments 64 to 89, wherein said reduction in transcriptional activity of at least the gene encoding lysine hydroxylase is brought about after stable introduction of one or more nucleic acids encoding heterologous proteins.
[0108] 91. The use according to any one of aspects 57 to 63 or embodiments 64 to 90, wherein the heterologous protein is a mono- or multispecific antibody.
[0109] In addition to the various aspects and embodiments specifically described and claimed, the subject matter disclosed herein also encompasses other embodiments having other combinations of the features disclosed and claimed herein. Thus, the specific features presented herein, particularly those presented as aspects or embodiments, can be combined with each other in other ways within the scope of the invention disclosed herein, such that the subject matter disclosed herein includes any suitable combination of the individual features or combinations of features disclosed herein. The description of the specific embodiments is presented for the purpose of illustrating and explaining the teachings of the present invention. It is not intended to be exhaustive or to limit the disclosed subject matter to the disclosed embodiments.
[0110] An aspect as used herein relates to an independent subject of the present invention, and an embodiment as used herein provides a more detailed realization of one or more or all of the independent aspects. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0111] Detailed Description The subject matter of the invention disclosed herein is based, at least in part, on the discovery that knocking out the PLOD gene reduces / eliminates the level of hydroxylysine formation in recombinantly produced heterologous proteins.
[0112] General definition Useful methods and techniques for carrying out the subject matter of the present invention are described, for example, in Ausubel, FM (ed.), Current Protocols in Molecular Biology, Volumes I to III (1997); Glover, ND, and Hames, BD, ed., DNA Cloning: A Practical Approach, Volumes I and II (1985), Oxford University Press; Freshney, RI (ed.), Animal Cell Culture-a practical approach, IRL Press Limited (1986); Watson, JD, et al., Recombinant DNA, Second Edition, CHSL Press (1992); Winnacker, EL, From Genes to Clones; NY, VCH Publishers (1987); Celis, J., ed., Cell Biology, Second Edition, Academic Press (1998); Freshney, RI, Culture of Animal Cells: A Manual of Basic Technique, second edition, Alan R. Liss, Inc., NY (1987). The use of recombinant DNA technology allows the creation of derivatives of nucleic acids. Such derivatives can be modified, for example, by substitution, alteration, replacement, deletion or insertion, at individual or several nucleotide positions. Modification or derivatization can be carried out, for example, by site-directed mutagenesis.Such modifications can be readily made by one of skill in the art (see, e.g., Sambrook, J., et al., Molecular Cloning: A laboratory manual (1999) Cold Spring Harbor Laboratory Press, New York, USA; Hames, BD, and Higgins, SG, Nucleic acid hybridization-a practical approach (1985) IRL Press, Oxford, England).
[0113] It should be noted that, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates to the contrary. Thus, for example, a reference to "a cell" includes a plurality of such cells and equivalents thereof known to those of skill in the art, and so forth. Similarly, the terms "a" (or "an"), "one or more," and "at least one" can be used interchangeably herein. It should also be noted that the terms "comprising," "including," and "having" can be used interchangeably.
[0114] The term "about" refers to a range of + / - 20% of the numerical value that follows. In certain embodiments, the term "about" refers to a range of ±10% of the numerical value that follows. In certain embodiments, the term "about" refers to a range of ±5% of the numerical value that follows.
[0115] As used herein, the terms "comprise(s) / include(s)," "having / has," "can," "containing," and variations thereof are intended to be open-ended transitional phrases, terms, or words that do not exclude the possibility of additional acts or structures. The term "comprising" also encompasses the term "consisting of." The present disclosure also contemplates other embodiments that "comprising," "consisting of," and "consisting essentially of" the embodiments or elements presented herein, whether or not expressly stated.
[0116] As used herein, the term "recombinant mammalian cell" refers to a mammalian cell that contains an exogenous nucleotide sequence capable of expressing a polypeptide. Such a recombinant mammalian cell is a cell into which one or more exogenous nucleic acids have been introduced, including the progeny of such a cell. Thus, the term "mammalian cell that contains a nucleic acid encoding a heterologous polypeptide" refers to a cell that contains an exogenous nucleotide sequence that is integrated into the genome of the mammalian cell and is capable of expressing a heterologous polypeptide. In certain embodiments, a mammalian cell that contains an exogenous nucleotide sequence is a cell that contains an exogenous nucleotide sequence integrated into a single site within a locus of the genome of the host cell, the exogenous nucleotide sequence comprising a first and a second recombination recognition sequence adjacent to at least one first selection marker, and a third recombination recognition sequence located between the first and second recombination recognition sequences, and the recombination recognition sequences are all different.
[0117] The term "recombinant cell" as used herein refers to a cell after genetic modification, such as a cell that expresses a heterologous polypeptide of interest and can be used for the production of said heterologous polypeptide of interest on any scale. For example, a "recombinant mammalian cell comprising an exogenous nucleotide sequence" refers to a cell in which a coding sequence of a heterologous polypeptide of interest has been introduced into the genome of a host cell. For example, a "recombinant mammalian cell comprising an exogenous nucleotide sequence" that has been subjected to recombinase-mediated cassette exchange (RMCE), thereby introducing a coding sequence of a polypeptide of interest into the genome of a host cell, is a "recombinant cell".
[0118] Both "mammalian cells containing an exogenous nucleotide sequence" and "recombinant cells" are "transformed cells." The term includes the primarily transformed cell and the progeny derived therefrom, regardless of the number of transfers. The progeny may not be completely identical to the parent cell, for example in nucleic acid content, but may contain mutations. Mutant progeny that have the same function or biological activity as screened or selected for in the originally transformed cell are included.
[0119] An "isolated" nucleic acid refers to a nucleic acid molecule that is separated from a component of its natural environment. Isolated nucleic acid includes a nucleic acid molecule that is contained in a cell that ordinarily contains the nucleic acid molecule, but where the nucleic acid molecule is present extrachromosomally or at a chromosomal location that is different from its natural chromosomal location.
[0120] An "isolated" polynucleotide or antibody refers to a polypeptide or antibody molecule which has been separated from a component of its natural environment.
[0121] The term "integration site" refers to a nucleic acid sequence in a cell genome where an exogenous nucleotide sequence is inserted. In certain embodiments, the integration site is between two adjacent nucleotides in the cell genome. In certain embodiments, the integration site comprises a stretch of nucleotide sequence. In certain embodiments, the integration site is located within a specific locus of the genome of a mammalian cell. In certain embodiments, the integration site is within an endogenous gene of a mammalian cell.
[0122] The terms "vector" or "plasmid" may be used interchangeably and, as used herein, refer to a nucleic acid molecule capable of propagating another nucleic acid to which it is linked. The term includes vectors that integrate into the genome of a host cell into which they are introduced, as well as vectors as self-replicating nucleic acid structures. Certain vectors are capable of directing the expression of a nucleic acid to which they are operatively linked. Such vectors are referred to herein as "expression vectors."
[0123] As used herein, the term "selection marker" refers to a gene that allows cells carrying a gene to be specifically selected or specifically eliminated in the presence of a corresponding selection agent. For example, but not limited to, a selection marker can allow host cells transformed with the selection marker gene to be positively selected in the presence of the respective selection agent (selective culture conditions), while untransformed host cells cannot grow or survive under the selective culture conditions. Selection markers can be positive, negative, or bifunctional. Positive selection markers can allow the selection of cells carrying the marker, whereas negative selection markers can allow the selective elimination of cells carrying the marker. Selection markers can confer resistance to drugs in host cells or complement metabolic or catabolic defects. In prokaryotic cells, genes that confer resistance to ampicillin, tetracycline, kanamycin, or chloramphenicol, among others, can be used. Resistance genes useful as selectable markers in eukaryotic cells include, but are not limited to, genes for aminoglycoside phosphotransferase (APH) (e.g., hygromycin phosphotransferase (HYG), neomycin, and G418 APH), dihydrofolate reductase (DHFR), thymidine kinase (TK), glutamine synthetase (GS), asparagine synthetase, tryptophan synthase (indole), histidinol dehydrogenase (histidinol D)), as well as genes encoding resistance to puromycin, blasticidin, bleomycin, phleomycin, chloramphenicol, zeocin, and mycophenolic acid. Additional marker genes are described in WO 92 / 08796 and WO 94 / 28143.
[0124] Beyond facilitating selection in the presence of a corresponding selection agent, a selection marker may alternatively be a molecule not normally present in cells, such as green fluorescent protein (GFP), enhanced GFP (eGFP), synthetic GFP, yellow fluorescent protein (YFP), enhanced YFP (eYFP), cyan fluorescent protein (CFP), mPlum, mCherry, tdTomato, mStrawberry, J-red, DsRed monomer, mOrange, mKO, mCitrine, Venus, YPet, Emerald, CyPet, mCFPm, Cerulean, and T-Sapphire. For example, cells expressing such molecules can be distinguished from cells that do not harbor this gene based on the detection or absence, respectively, of fluorescence emitted by the encoded polypeptide.
[0125] As used herein, the term "operably linked" refers to the juxtaposition of two or more components, where the components are in a relationship that allows them to function in their intended manner. For example, a promoter and / or enhancer is operably linked to a coding sequence if the promoter and / or enhancer play a role in regulating the transcription of the coding sequence. In certain embodiments, DNA sequences that are "operably linked" are contiguous and adjacent on a single chromosome. In certain embodiments, when it is necessary to join coding regions for two proteins, for example, a secretory leader and a polypeptide, the sequences are contiguous, adjacent, and in the same reading frame. In certain embodiments, an operably linked promoter can be located upstream of and adjacent to the coding sequence. In certain embodiments, for example, with respect to an enhancer sequence that regulates expression of a coding sequence, the two components can be operably linked, but not adjacent. An enhancer is operably linked to a coding sequence if it increases the transcription of the coding sequence. An operably linked enhancer can be located upstream, in, or downstream of a coding sequence, and can be located at a considerable distance from the promoter of the coding sequence. Operable linkage can be achieved by recombinant methods known in the art, for example, by using PCR methods and / or by ligation at a convenient restriction site. If no convenient restriction enzyme recognition site exists, synthetic oligonucleotide adaptors or linkers can be used according to the practice. An internal ribosome entry site (IRES) is operably linked to an open reading frame (ORF) if it can initiate translation of the ORF at an internal position, independent of the 5' end.
[0126] As used herein, the term "exogenous" refers to a nucleotide sequence that is not native to a particular cell and is introduced into the cell by a DNA delivery method, such as transfection, electroporation, or transformation. Thus, an exogenous nucleotide sequence is an artificial sequence, and an artifact can result, for example, from a combination of subsequences of different origins (e.g., a combination of a recombinase recognition sequence with an SV40 promoter and a coding sequence for green fluorescent protein is an artificial nucleic acid), or from partial deletion or nucleic acid base mutation of a sequence (e.g., a sequence or cDNA coding only for the extracellular domain of a membrane-bound receptor). The term "endogenous" refers to a nucleotide sequence that is derived from a cell. An "exogenous" nucleotide sequence may have an "endogenous" counterpart with identical base composition, but an "exogenous" sequence has been introduced into a cell, for example, by recombinant DNA technology.
[0127] As used herein, the term "heterologous" indicates that a polypeptide is not native to a particular cell, and that the respective encoding nucleic acid is introduced into the cell by a DNA delivery method, such as transfection, electroporation, or transformation. Thus, a heterologous polypeptide is an artificial polypeptide relative to the cell that expresses it, and thus does not depend on whether the polypeptide is a naturally occurring polypeptide originating from a different cell / organism, or a synthetic polypeptide.
[0128] The term "procollagen-lysine,2-oxoglutarate 5-dioxygenase" refers to an oxidoreductase that acts on a pair of donors with the incorporation or reduction of molecular oxygen, whereby 2-oxoglutarate acts as one donor and one atom of oxygen is incorporated into each donor. Procollagen-lysine 5-dioxygenase has the EC number 1.14.11.4. Synonyms for "procollagen-lysine,2-oxoglutarate 5-dioxygenase" are "collagen lysine hydroxylase", "lysyl protocollagen dioxygenase", "lysine-2-oxoglutarate dioxygenase", "peptidyl lysine,2-oxoglutarate:oxygen oxidoreductase", "peptidyl lysine,2-oxoglutarate:oxygen 5-oxidoreductase", "lysyl hydroxylase", "lysyl 5S-hydroxylase", "oxygenase,protocollagen lysine,di-", "LH", "LLH", "PLOD", "procollagen-lysine 1,2-oxoglutarate 5-dioxygenase", and "Ehlers-Danlos syndrome type VI".
[0129] Three different forms of "procollagen-lysine,2-oxoglutarate 5-dioxygenase" are known, designated "1", "2", and "3". Form 1 has the UniProtKB id Q02809.
[0130] "Procollagen-lysine, 2-oxoglutarate 5-dioxygenase" is encoded by the PLOD gene. In the case of PLOD2, two splice variants can be expressed (LH2a and LH2b), where LH2b differs from LH2a by the incorporation of a small exon 13A.
[0131] The term "prolyl oxygenase" refers to a proteoglycan that functions as a collagen prolyl hydroxylase, which is required for proper collagen biosynthesis, folding and assembly. The protein, like other family members, is believed to reside in the endoplasmic reticulum.
[0132] Different forms are known, designated "1", "2", "3" and "4".
[0133] Prolyl 3-hydroxylase 3 (encoded by the P3H3 gene; RefSeq NM_014262) has the enzyme class number 1.14.11.7. Alternative names are "leplecan-like protein 2" and "protein B". This protein has prolyl 3-hydroxylase activity that catalyzes the post-translational formation of 3-hydroxyproline at -Xaa-Pro-Gly- sequences in collagens, particularly types IV and V (by similarity). The enzymatic reaction is L-proline-[procollagen] + 2-oxoglutarate + O(2) = trans-3-hydroxy-L-proline-[procollagen] + succinate + CO(2).
[0134] The term "sirtuin-1" refers to an enzyme that is part of signal transduction in mammals, namely, NAD-dependent deacetylase sirtuin-1. Sirtuin-1 is encoded by the SIRT-1 gene. Chinese hamster sirtuin-1 has UniProtKB entry A0A3L7IF96. The effects of SIRT-1 gene inactivation are described in WO2020 / 260327, which is expressly incorporated herein by reference.
[0135] The term "myc proto-oncogene protein" refers to a family of regulatory genes that code for transcription factors. This family includes the proteins c-myc (encoded by the MYC gene), l-myc (encoded by the MYCL gene) and n-myc (encoded by the MYCN gene). The Chinese hamster myc proto-oncogene protein has a genomic location in the CHO genome (PICR genome) of RAZU01000002.1 (8,114,040-8,118,048) (see https: / / www.ncbi.nlm.nih.gov / assembly / GCF_003668045.3 / ). The effects of MYC inactivation are described in WO2022 / 063877, which is expressly incorporated herein by reference.
[0136] The term "bcl-2 associated X protein" refers to the pro-apoptotic Bcl-2 family member encoded by the BAX gene (also known as Bcl2l4).
[0137] The term "bcl-2 homologous antagonist / killer" refers to the pro-apoptotic Bcl-2 family member encoded by the BAK gene (also known as BCL2 antagonist / killer 1, Bak1, Cdn1, Bcl2l7, and Bak-like).
[0138] The effects of BAX and BAK gene inactivation are described in WO 2009 / 151591, expressly incorporated herein by reference.
[0139] The term "intercellular adhesion molecule 1" refers to a cell surface glycoprotein. Its binding partners are integrins of the type CD11a / CD18 or CD11b / CD18. It is also known as CD54 (cluster of differentiation 54). In humans, it is encoded by the ICAM-1 gene.
[0140] "Reduced transcriptional activity" with respect to a gene can be achieved by genetic manipulation, such as substitution, deletion, insertion, duplication, frameshift or translocation, in the gene, thereby reducing or eliminating one or more functions of the corresponding gene product. In some embodiments, reduced transcriptional activity is achieved by introducing a loss-of-function mutation in the gene, i.e., by introducing a null mutation that eliminates one or more functions of the corresponding gene product, such as, for example, a deletion that removes part or all of the coding sequence.
[0141] antibody General information regarding the nucleotide sequences of human immunoglobulin light and heavy chains is described in Kabat, EA, et al., Sequences of Proteins of Immunological Interest, 5th ed., Public Health Service, National Institutes of Health, Bethesda, MD (1991).
[0142] The term "antibody" herein is used in the broadest sense and encompasses a variety of antibody structures including, but not limited to, full length antibodies, monoclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody-antibody fragment-fusions and combinations thereof.
[0143] The term "natural antibody" refers to naturally occurring immunoglobulin molecules with various structures. For example, a natural IgG antibody is a heterotetrameric glycoprotein of about 150,000 daltons composed of two identical light chains and two identical heavy chains that are disulfide-bonded. From the N-terminus to the C-terminus, each heavy chain has a heavy chain variable region (VH) followed by three heavy chain constant domains (CH1, CH2, and CH3), which positions a hinge region between the first heavy chain constant domain and the second heavy chain constant domain. Similarly, from the N-terminus to the C-terminus, each light chain has a light chain variable region (VL) followed by a light chain constant domain (CL). The light chain of an antibody can be assigned to one of two types, called kappa (κ) and lambda (λ), based on the amino acid sequence of its constant domain.
[0144] The term "full-length antibody" refers to an antibody that has a structure substantially similar to that of a natural antibody. A full-length antibody comprises two full-length antibody light chains, each comprising, from N-terminus to C-terminus, a light chain variable region and a light chain constant domain, and two full-length antibody heavy chains, each comprising, from N-terminus to C-terminus, a heavy chain variable region, a first heavy chain constant domain, a hinge region, a second heavy chain constant domain, and a third heavy chain constant domain. In contrast to a natural antibody, a full-length antibody may comprise further immunoglobulin domains, such as one or more additional scFvs, or Fab fragments of the heavy or light chains, or scFabs that are conjugated to one or more ends of different chains of the full-length antibody, but only one fragment at each end. These conjugates are also encompassed by the term full-length antibody.
[0145] The "class" of an antibody refers to the type of constant domain or region, preferably the Fc region, possessed by the heavy chain. There are five major classes of antibodies, namely IgA, IgD, IgE, IgG, and IgM, some of which may be further divided into subclasses (isotypes), e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. The heavy chain constant domains corresponding to the different classes of immunoglobulins are called α, δ, ε, γ, and μ, respectively.
[0146] The term "heavy chain constant region" refers to the region of an immunoglobulin heavy chain that contains the constant domains, i.e., the CH1 domain, the hinge region, the CH2 domain, and the CH3 domain. In certain embodiments, the human IgG constant region extends from Ala118 to the carboxyl terminus of the heavy chain (numbering according to Kabat EU index). However, the C-terminal lysine (Lys447) of the constant region may or may not be present (numbering according to Kabat EU index). The term "constant region" refers to a dimer that includes two heavy chain constant regions that can be covalently linked to each other via hinge region cysteine residues that form interchain disulfide bonds.
[0147] The term "heavy chain Fc region" refers to the C-terminal region of an immunoglobulin heavy chain, including at least a portion of the hinge region (middle and lower hinge regions), the CH2 domain, and the CH3 domain. In certain embodiments, the human IgG heavy chain Fc region extends from Asp221 or Cys226 or Pro230 to the carboxyl terminus of the heavy chain (numbering according to Kabat EU index). Thus, the Fc region is smaller than the constant region but is essentially identical to the C-terminal portion. However, the C-terminal lysine (Lys447) of the heavy chain Fc region may or may not be present (numbering according to Kabat EU index). The term "Fc region" refers to a dimer comprising two heavy chain Fc regions, which can be covalently linked to each other via hinge region cysteine residues forming interchain disulfide bonds.
[0148] The constant region of an antibody, more precisely the Fc region (and also the constant region), is directly involved in complement activation, C1q binding, C3 activation and Fc receptor binding. The effect of an antibody on the complement system depends on the specific conditions, but the binding to C1q is caused by a defined binding site in the Fc region. Such binding sites are known in the state of the art and are described, for example, in Lukas, TJ, et al., J. Immunol. 127 (1981) 2555-2560; Brunhouse, R., and Cebra, JJ, Mol. Immunol. 16 (1979) 907-917; Burton, DR, et al., Nature 288 (1980) 338-344; Thommesen, JE, et al., Mol. Immunol. 37 (2000) 995-1004; Idusogie, EE, et al., J. Immunol. 164 (2000) 4178-4184; Hezareh, M., et al., J. Virol. 75 (2001) 12161-12168; Morgan, A., et al., Immunology 86 (1995) 319-324; and European Patent No. 0307434. Such binding sites are, for example, L234, L235, D270, N297, E318, K320, K322, P331 and P329 (numbering according to the Kabat EU index). Antibodies of the subclasses IgG1, IgG2 and IgG3 usually exhibit complement activation, C1q binding and C3 activation, whereas IgG4 does not activate the complement system, does not bind C1q and does not activate C3.
[0149] "Fc region of an antibody" is a term well known to those skilled in the art and is defined based on papain cleavage of an antibody.
[0150] As used herein, the term "monoclonal antibody" refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies constituting the population are identical and / or bind the same epitope, except for variant antibodies that may contain, for example, naturally occurring mutations or arise during production of the monoclonal antibody preparation, and such variants are generally present in small amounts. In contrast to polyclonal antibody preparations, which typically contain different antibodies against different determinants (epitopes), each monoclonal antibody of a monoclonal antibody preparation is directed against a single determinant on the antigen. Thus, the modifier "monoclonal" indicates the character of the antibody obtained from a substantially homogeneous population of antibodies and should not be construed as requiring production of the antibody by any particular method. For example, monoclonal antibodies can be produced by a variety of techniques, including, but not limited to, hybridoma methods, recombinant DNA methods, phage display methods, and methods utilizing transgenic animals containing all or part of the human immunoglobulin loci.
[0151] The term "valency" as used within this application refers to the presence of a particular number of binding sites in an antibody. Thus, the terms "bivalent," "tetravalent," and "hexavalent" refer to the presence of two binding sites, four binding sites, and six binding sites, respectively, in an antibody.
[0152] "Monospecific antibody" refers to an antibody that has a single binding specificity, i.e., that specifically binds to one antigen. Monospecific antibodies can be prepared as full-length antibodies or antibody fragments (e.g., F(ab')2) or combinations thereof (e.g., full-length antibodies with additional scFv or Fab fragments). Monospecific antibodies need not be monovalent, i.e., they may contain more than one binding site that specifically binds to one antigen. For example, naturally occurring antibodies are monospecific but bivalent.
[0153] A "multispecific antibody" refers to an antibody that has binding specificities for at least two different epitopes on the same antigen or two different antigens. Multispecific antibodies can be prepared as full-length antibodies or antibody fragments (e.g., F(ab')2 bispecific antibodies) or combinations thereof (e.g., full-length antibodies with additional scFv or Fab fragments). Multispecific antibodies are at least bivalent, i.e., contain two antigen-binding sites. Furthermore, multispecific antibodies are at least bispecific. Thus, bivalent bispecific antibodies are the simplest form of multispecific antibodies. Engineered antibodies with two, three or more (e.g., four) functional antigen-binding sites have been reported (see, e.g., U.S. Patent Application Publication No. 2002 / 0004587).
[0154] In certain embodiments of all aspects and embodiments of the subject matter of the invention disclosed herein, the cell according to the invention expresses an antibody. In certain embodiments, the antibody is a multispecific antibody, for example, at least a bispecific antibody. In certain embodiments, one of the binding specificities is for a first antigen and the other is for a different second antigen. In certain embodiments, the multispecific antibody can bind to two different epitopes of the same antigen. Multispecific antibodies may be used to localize cytotoxic agents to cells expressing one or more antigens.
[0155] Multispecific antibodies can be prepared as full-length antibodies or antibody-antibody fragment fusions.
[0156] Techniques for making multispecific antibodies include, but are not limited to, recombinant co-expression of two immunoglobulin heavy-light chain pairs with different specificities (see Milstein, C. and Cuello, A.C., Nature 305 (1983) 537-540; WO 93 / 08829; and Traunecker, A., et al., EMBO J. 10 (1991) 3655-3659) and "knobs-in-holes" engineering (see, e.g., U.S. Pat. No. 5,731,168). Multispecific antibodies can also be produced by manipulating electrostatic steering effects to create antibody Fc heterodimeric molecules (WO 2009 / 089004), cross-linking two or more antibodies or fragments (see, e.g., U.S. Pat. No. 4,676,980, and Brennan, M., et al., Science 229 (1985) 81-83), producing bispecific antibodies using leucine zippers (see, e.g., Kostelny, SA, et al., J. Immunol. 148 (1992) 1547-1553), using general light chain techniques to avoid light chain mispairing problems (see, e.g., WO 98 / 50431), using specific techniques to create bispecific antibody fragments (see, e.g., Holliger, P., et al., Proc. Natl. Acad. Sci. USA 90 (1993) 6444-6448), and by using techniques such as those described in, e.g., Tutt, A., et al. al., J. Immunol. 147 (1991) 60-69, for the preparation of trispecific antibodies.
[0157] Engineered antibodies with three or more antigen binding sites, including, for example, "Octopus antibodies," or DVD-Igs, are also included herein (see, for example, WO 2001 / 77342 and WO 2008 / 024715). Other examples of multispecific antibodies with three or more antigen binding sites can be found in WO 2010 / 115589, WO 2010 / 112193, WO 2010 / 136172, WO 2010 / 145792, and WO 2013 / 026831. Bispecific antibodies or antigen-binding fragments thereof also include "dual-acting Fabs" or "DAFs" (see, for example, U.S. Patent Application Publication Nos. 2008 / 0069820 and WO 2015 / 095539).
[0158] Multispecific antibodies can also be provided in an asymmetric manner with domain crossovers, i.e. by exchanging VH / VL domains (see, e.g., WO 2009 / 080252 and WO 2015 / 150447), CH1 / CL domains (see WO 2009 / 080253) or complete Fab arms (see WO 2009 / 080251, WO 2016 / 016299, see also Schaefer et al., Proc. Natl. Acad. Sci. USA 108 (2011) 1187-1191, and Klein at al., MAbs 8 (2016) 1010-1020) in one or more binding arms of the same antigen specificity. In certain embodiments of all aspects and embodiments of the inventive subject matter disclosed herein, the cells according to the invention express a multispecific antibody comprising a Cross-Fab fragment. The term "Cross-Fab fragment" refers to a Fab fragment in which either the variable or constant regions of the heavy and light chains are exchanged. A Cross-Fab fragment comprises a polypeptide chain composed of a light chain variable region (VL) and a heavy chain constant region 1 (CH1), and a polypeptide chain composed of a heavy chain variable region (VH) and a light chain constant region (CL). Asymmetric Fab arms can also be engineered by introducing charged or uncharged amino acid mutations at the domain interface to direct the pairing of the correct Fab heavy chain fragment with the cognate light chain. See, for example, WO 2016 / 172485.
[0159] The antibody or fragment may also be a multispecific antibody as described in WO 2009 / 080254, WO 2010 / 112193, WO 2010 / 115589, WO 2010 / 136172, WO 2010 / 145792 or WO 2010 / 145793.
[0160] The antibody or fragment thereof may also be a multispecific antibody as disclosed in WO 2012 / 163520.
[0161] Various additional molecular formats of multispecific antibodies are known in the art and may be produced using the cells according to the invention (see, e.g., Spiess et al., Mol. Immunol. 67 (2015) 95-106).
[0162] Bispecific antibodies are generally antibody molecules that specifically bind to two different, non-overlapping epitopes on the same antigen or to two epitopes on different antigens.
[0163] In certain embodiments of all aspects and embodiments of the inventive subject matter disclosed herein, the cell according to the invention expresses a composite (multispecific) antibody selected from the group of composite (multispecific) antibodies consisting of: Full-length antibodies with domain swapping (i.e., a multispecific IgG antibody comprising a first Fab fragment and a second Fab fragment, wherein in the first Fab fragment: a) only the CH1 and CL domains are replaced by each other (i.e. the light chain of the first Fab fragment comprises the VL and CH1 domains and the heavy chain of the first Fab fragment comprises the VH and CL domains); b) only the VH and VL domains are replaced by each other (i.e. the light chain of the first Fab fragment comprises the VH and CL domains and the heavy chain of the first Fab fragment comprises the VL and CH1 domains); or c) the CH1 and CL domains are replaced with each other and the VH and VL domains are replaced with each other (i.e., the light chain of the first Fab fragment comprises the VH and CH1 domains and the heavy chain of the first Fab fragment comprises the VL and CL domains); and the second Fab fragment comprises a light chain comprising a VL and a CL domain, and a heavy chain comprising a VH and a CH1 domain; A full-length antibody having domain exchange can comprise a first heavy chain comprising a CH3 domain and a second heavy chain comprising a CH3 domain, both CH3 domains being complementarily engineered by respective amino acid substitutions, e.g., as described in WO 96 / 27011, WO 98 / 050431, EP 1 870459, WO 2007 / 110205, WO 2007 / 147901, WO 2007 / 120366, WO 2007 / 110205, WO 2007 / 120367, WO 2007 / 120368, WO 2007 / 120369 ... supports heterodimerization of a first heavy chain and a modified second heavy chain as disclosed in WO 2009 / 089004, WO 2010 / 129304, WO 2011 / 90754, WO 2011 / 143545, WO 2012 / 058768, WO 2013 / 157954 or WO 2013 / 096291 (herein incorporated by reference); Full-length antibody with domain swapping and additional heavy chain C-terminal binding site (BS) (i.e., a multispecific IgG antibody, a) a full-length antibody comprising two pairs each of a full-length antibody light chain and a full-length antibody heavy chain, wherein a binding site formed by each pair of full-length heavy chains specifically binds to a first antigen; and b) one additional Fab fragment fused to the C-terminus of one heavy chain of the full-length antibody, the binding site of the additional Fab fragment specifically binding to a second antigen; Additional Fab fragments that specifically bind to a second antigen i) contain a domain crossover such that a) the light chain variable domain (VL) and the heavy chain variable domain (VH) are replaced by each other, or b) the light chain constant domain (CL) and the heavy chain constant domain (CH1) are replaced by each other, or ii) are single chain Fab fragments); 1-Arm Single Chain Antibody (i.e., an antibody that comprises a first binding site that specifically binds to a first epitope or antigen and a second binding site that specifically binds to a second epitope or antigen, whereby the individual chains are -Light chain (variable light domain + constant light kappa domain) -Light / heavy chain combination (variable light domain + light constant domain + peptide linker + variable heavy domain + CH1 + hinge + CH2 + CH3 with knob mutation) - heavy chain (variable heavy domain + CH1 + hinge + CH2 + CH3 with hole mutation), Two-arm single chain antibody (i.e., an antibody that comprises a first binding site that specifically binds to a first epitope or antigen and a second binding site that specifically binds to a second epitope or antigen, whereby the individual chains are -Light / Heavy Chain 1 Combination (Variable Light Domain + Light Chain Constant Domain + Peptide Linker + Variable Heavy Domain + CH1 + Hinge + CH2 + CH3 with Hole Mutation) - light chain / heavy chain 2 combination (variable light domain + light chain constant domain + peptide linker + variable heavy domain + CH1 + hinge + CH2 + CH3 with knob mutation)); Common light chain bispecific antibodies (i.e., an antibody that comprises a first binding site that specifically binds to a first epitope or antigen and a second binding site that specifically binds to a second epitope or antigen, whereby the individual chains are -Light chain (variable light domain + constant light domain) -Heavy Chain 1 (VH domain + CH1 + hinge + CH2 + CH3 with hole mutation) - heavy chain 2 (variable heavy domain + CH1 + hinge + CH2 + CH3 with knob mutation)); T cell bispecific antibody (TCB) (i.e., a full-length antibody with an additional heavy chain N-terminal binding site with domain swapping, - a first and a second Fab fragment, each binding site of the first and second Fab fragments specifically binding to a first antigen, - a third Fab fragment, the binding site of which specifically binds to a second antigen, the third Fab fragment comprising a domain crossover such that the variable light domain (VL) and the variable heavy domain (VH) are replaced by one another; an Fc region comprising a first Fc region polypeptide and a second Fc region polypeptide; the first Fab fragment and the second Fab fragment comprise a heavy chain fragment and a full-length light chain, respectively; the C-terminus of the heavy chain fragment of the first Fab fragment is fused to the N-terminus of the first Fc region polypeptide; the C-terminus of the heavy chain fragment of the second Fab fragment is fused to the N-terminus of the variable light chain domain of a third Fab fragment, and the C-terminus of the CH1 domain of the third Fab fragment is fused to the N-terminus of a second Fc region polypeptide; Antibody-multimer fusion (i.e., a multimeric fusion protein, (a) an antibody heavy chain and an antibody light chain, (b) a first fusion polypeptide comprising, from N-terminus to C-terminus, a first portion of a non-antibody multimeric polypeptide, an antibody heavy chain CH1 domain or an antibody light chain constant domain, an antibody hinge region, an antibody heavy chain CH2 domain, and an antibody heavy chain CH3 domain, and a second fusion polypeptide comprising, from N-terminus to C-terminus, a second portion of a non-antibody multimeric polypeptide, and an antibody light chain constant domain if the first polypeptide comprises the antibody heavy chain CH1 domain, or an antibody heavy chain CH1 domain if the first polypeptide comprises the antibody light chain constant domain; (i) the antibody heavy chain of (a) and the first fusion polypeptide of (b), (ii) the antibody heavy chain of (a) and the antibody light chain of (a), and (iii) the first fusion polypeptide of (b) and the second fusion polypeptide of (b) are each independently covalently linked to each other by at least one disulfide bond; A multimeric fusion protein in which the variable domains of an antibody heavy chain and an antibody light chain form a binding site that specifically binds an antigen.
[0164] "Knobs-into-holes" dimerization modules and their use in antibody engineering are described in Carter P.; Ridgway JBB; Presta LG: Immunotechnology, Volume 2, Number 1, February 1996, pp. 73-73(1).
[0165] The CH3 domains of the heavy chains of the antibody can be modified by the "knob-into-hole" technique. This is described in detail with some examples in, for example, WO96 / 027011, Ridgway, JB, et al., Protein Eng. 9 (1996) 617-621; and Merchant, AM, et al., Nat. Biotechnol. 16 (1998) 677-681. In this method, the interaction surface of the two CH3 domains is altered to increase the heterodimerization of these two CH3 domains, and thereby the heterodimerization of the polypeptides containing them. Each of the two CH3 domains (of the two heavy chains) can be a "knob" and the other one is a "hole". The introduction of disulfide bridges further stabilizes the heterodimers (Merchant, AM, et al., Nature Biotech. 16 (1998) 677-681; Atwell, S., et al., J. Mol. Biol. 270 (1997) 26-35) and increases the yield.
[0166] The mutation T366W in the CH3 domain (of the antibody heavy chain) is designated as a "knob mutation" or "mutated knob", and the mutations T366S, L368A, Y407V in the CH3 domain (of the antibody heavy chain) are designated as a "hole mutation" or "mutated hole" (numbering according to the EU index of Kabat). Additional interchain disulfide bridges between CH3 domains (Merchant, AM, et al., Nature Biotech. 16 (1998) 677-681) can also be used, for example, by introducing an S354C mutation in the CH3 domain of a heavy chain carrying a "knob mutation" (designated as a "knob-cys-mutation" or "mutated knob-cys") and by introducing a Y349C mutation in the CH3 domain of a heavy chain carrying a "hole mutation" (designated as a "hole-cys-mutation" or "mutated hole-cys") (numbering according to the EU index of Kabat).
[0167] The term "domain crossover" as used herein refers to the deviation of the domain sequence from that of the native antibody in that in a pair of an antibody heavy chain VH-CH1 fragment and its corresponding cognate antibody light chain, i.e., in the antibody Fab (fragment-antigen binding), at least one heavy chain domain is replaced by the corresponding light chain domain, or vice versa. There are three general types of domain crossovers: (i) crossovers of CH1 and CL domains, where the domain crossover in the light chain results in a VL-CH1 domain sequence and the domain crossover in the heavy chain fragment results in a VH-CL domain sequence (or a full-length antibody heavy chain having a VH-CL-hinge-CH2-CH3 domain sequence); (ii) domain crossovers of VH and VL domains, where the domain crossover in the light chain results in a VH-CL domain sequence and the domain crossover in the heavy chain fragment results in a VL-CH1 domain sequence; and (iii) domain crossovers of a complete light chain (VL-CL) and a complete VH-CH1 heavy chain fragment ("Fab crossover"), where the domain crossover results in a light chain with a VH-CH1 domain sequence and the domain crossover results in a heavy chain fragment with a VL-CL domain sequence (all domain sequences listed above are in the N-terminal to C-terminal direction).
[0168] As used herein, the term "replaced with each other" with respect to corresponding heavy and light chain domains refers to the domain crossover described above. Thus, when CH1 and CL domains are "replaced with each other", this term refers to the domain crossover described under item (i) and the resulting heavy and light chain domain sequences. Thus, when VH and VL are "replaced with each other", this term refers to the domain crossover described under item (ii), and when CH1 and CL domains are "replaced with each other" and VH and VL domains are "replaced with each other", this term refers to the domain crossover described under item (iii). Bispecific antibodies comprising domain crossovers have been reported, for example, in WO 2009 / 080251, WO 2009 / 080252, WO 2009 / 080253, WO 2009 / 080254, and Schaefer, W., et al, Proc. Natl. Acad. Sci. USA 108 (2011) 11187-11192. Such antibodies are generally referred to as CrossMab.
[0169] In certain embodiments of all aspects and embodiments of the inventive subject matter disclosed herein, the cells according to the invention express a multispecific antibody comprising at least one Fab fragment comprising either a domain crossover between the CH1 domain and the CL domain, or a domain crossover between the VH domain and the VL domain, or a domain crossover between the VH-CH1 domain and the VL-VL domain. In a multispecific antibody with domain crossover, Fabs that specifically bind to the same antigen are constructed to have the same domain sequence. Thus, when two or more Fabs with domain crossover are included in a multispecific antibody, the Fabs specifically bind to the same antigen.
[0170] A "humanized" antibody refers to an antibody that comprises amino acid residues from non-human HVRs and amino acid residues from human FRs. In certain embodiments, a humanized antibody comprises substantially all of at least one, and typically two, variable domains, in which all or substantially all of the HVRs (e.g., CDRs) correspond to those of a non-human antibody and all or substantially all of the FRs correspond to those of a human antibody. A humanized antibody may optionally comprise at least a portion of an antibody constant region derived from a human antibody. A "humanized form" of an antibody, e.g., a non-human antibody, refers to an antibody that has been subjected to humanization.
[0171] The term "recombinant antibody" as used herein means all antibodies (chimeric, humanized and human) prepared, expressed, generated or isolated by recombinant means, such as using cells according to the invention. This includes antibodies isolated from recombinant cells, such as NS0, HEK, BHK, amniotic cells, or CHO cells modified according to the invention.
[0172] As used herein, the term "antibody fragment" refers to a molecule other than an intact antibody that contains a portion of an intact antibody that binds to the same epitope of the same antigen that the intact antibody binds, i.e., it is a functional fragment. Examples of antibody fragments include, but are not limited to, Fv, Fab, Fab', Fab'-SH, F(ab')2, bispecific Fab, diabody, linear antibody, single chain antibody molecule (e.g., scFv or scFab).
[0173] Recombinant methods and compositions One aspect of the inventive subject matter disclosed herein is a method of producing a heterologous polypeptide or protein using a cell according to the invention, comprising culturing a cell according to the invention comprising one or more nucleic acid(s) encoding a heterologous polypeptide or protein under conditions suitable for expression of the heterologous polypeptide or protein, recovering the heterologous polypeptide or protein from the cells (or cell culture medium), and, optionally, purifying the heterologous polypeptide or protein by one or more chromatography steps.
[0174] Antibodies may be produced using recombinant methods and compositions, for example, as described in U.S. Patent No. 4,816,567. These methods provide one or more isolated nucleic acids encoding the antibody.
[0175] In one aspect of the inventive subject matter disclosed herein, there is provided a method of making an antibody, the method comprising culturing a cell according to the invention comprising one or more nucleic acids encoding the antibody under conditions suitable for expression of the antibody, and optionally recovering the antibody from the cell (or cell culture medium).
[0176] For example, in recombinant production of a heterologous polypeptide or protein, such as an antibody, nucleic acid encoding the heterologous polypeptide or protein is isolated and inserted into one or more vectors for further cloning and / or expression in a cell according to the invention. Such nucleic acid can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes capable of specifically binding to genes encoding the heavy and light chains of the antibody), or can be produced by recombinant methods, or can be obtained by chemical synthesis.
[0177] Generally, for recombinant large-scale production of a heterologous polypeptide or protein of interest, such as a therapeutic antibody, cells are required that stably express and secrete the heterologous polypeptide or protein of interest. These cells are called "recombinant cells" or "recombinant production cells" and the methods used to generate such cells are called "cell line development".
[0178] In the first step of the cell line development process, suitable host cells, e.g., CHO cells, modified according to the present invention, are transfected with a nucleic acid sequence suitable for expression of the heterologous polypeptide or protein of interest. In the second step, cells stably expressing the heterologous polypeptide or protein of interest are selected based on co-expression of a selectable marker that has been co-transfected with the nucleic acid encoding the heterologous polypeptide or protein of interest.
[0179] The nucleic acid encoding a heterologous polypeptide or protein, i.e., a coding sequence, is referred to as a structural gene. Such a structural gene is pure coding information. Therefore, additional regulatory elements are required for its expression. Therefore, the structural gene is incorporated into a so-called expression cassette. The minimum regulatory elements required for an expression cassette to be functional in a mammalian cell are a promoter functional in said mammalian cell, located upstream, i.e., 5', of the structural gene, and a polyadenylation signal sequence functional in said mammalian cell, located downstream, i.e., 3', of the structural gene. The promoter sequence, the structural gene sequence, and the polyadenylation signal sequence are arranged in an operably linked form.
[0180] If the heterologous protein of interest is a heteromultimeric protein composed of different (monomeric) polypeptides, such as, for example, an antibody or a complex antibody format, not only a single expression cassette is required, but multiple expression cassettes differing from one another in the structural genes they contain, i.e., at least one expression cassette for each of the different (monomeric) polypeptides of the heteromultimeric protein.
[0181] For example, a full-length antibody is a heteromultimeric polypeptide that contains two copies of a light chain and two copies of a heavy chain. Thus, a full-length antibody is composed of two different polypeptides. Therefore, two expression cassettes are required for the expression of a full-length antibody, one for the light chain and one for the heavy chain. For example, if a full-length antibody is a bivalent bispecific antibody, i.e., if the antibody contains two different binding sites that specifically bind to two different antigens, the two light chains and the two heavy chains are also different from each other. Thus, such a bivalent bispecific full-length antibody is composed of four different polypeptides, and therefore four expression cassettes are required.
[0182] One or more expression cassettes required for the expression of a heterologous polypeptide or protein of interest are incorporated into one or more so-called "expression vectors". An "expression vector" is a nucleic acid that provides all the elements required to amplify the vector in a prokaryotic cell and to express the contained structural gene in a mammalian cell. Typically, an expression vector contains a prokaryotic plasmid propagation unit, which contains, for example in the case of E. coli, an origin of replication and a prokaryotic selection marker, as well as a eukaryotic selection marker, and an expression cassette required for the expression of the structural gene of interest. An "expression vector" is a transport vehicle for introducing an expression cassette into a modified mammalian cell according to the present invention.
[0183] As outlined in the previous paragraph, the more complex the heterologous polypeptide or protein of interest, the greater the number of different expression cassettes required. Essentially, the total size of the nucleic acid integrated into the genome of the host cell, i.e., the number of base pairs, increases with the number of expression cassettes. At the same time, the size of the expression vector also increases. However, the practical upper limit of the vector size is in the range of about 15 kbp, above which the efficiency of manipulation and processing decreases significantly. This problem can be addressed by using two or more expression vectors. Thereby, the expression cassette is divided between different expression vectors, each of which contains only a part of the expression cassette, resulting in a reduction in the size (number of bp) of each individual vector.
[0184] For example, cell line development (CLD) for generating recombinant cells expressing heterologous polypeptides or proteins, such as multispecific antibodies, uses either random integration (RI) or targeted integration (TI) of nucleic acids containing the respective expression cassettes required for the expression and production of the heterologous polypeptide or protein of interest.
[0185] When RI is used, several vectors or their fragments are generally integrated into the genome of a cell at the same or different loci, and therefore the number and ratio of integrated expression cassettes cannot be controlled.
[0186] Using TI, typically a defined number of different expression cassettes are integrated into predefined "hot spots" within the genome of a cell.
[0187] Suitable cells for the expression of a (glycosylated) heterologous polypeptide or protein are generally derived from multicellular organisms, such as, for example, vertebrates.
[0188] host cell Any mammalian cell can be modified according to the inventive subject matter disclosed herein. This application of the modification according to the inventive subject matter disclosed herein is independent of the cell, whether it is an adherent growing cell or a cell growing in suspension, and the integration method, i.e., RI and TI. Any mammalian cell can be used.
[0189] Examples of mammalian cells that may be modified in accordance with the inventive subject matter disclosed herein include human amniotic cells (e.g., CAP-T cells as described in Woelfel, J. et al., BMC Proc. 5 (2011) p. 133), monkey kidney cells (CV1; monkey kidney CV1 cells transformed with SV40 (COS-7), human embryonic kidney cells (e.g., HEK293 cells or HEK293T cells as described in Graham, F. et al., J. Gen Virol. 36 (1977) 59-74), baby hamster kidney cells (BHK), mouse Sertoli cells (e.g., TM4 cells as described in Mather, JP, Biol. Reprod. 23 (1980) 243-252), African green monkey kidney cells (VERO-76), human cervical carcinoma cells (HELA), canine kidney cells (MDCK, buffalo rat liver cells (BRL 3A), human lung cells (W138), human liver cells (HepG2), mouse mammary tumor cells (MMT060562), TRI cells (described, for example, in Mather, JP et al., Annals NYAcad. Sci. 383 (1982) 44-68), MRC5 cells, and FS4 cells.
[0190] Particularly useful mammalian cells to be modified according to the inventive subject matter disclosed herein include Chinese hamster ovary (CHO) cells, including DHFR-CHO cells ((Urlaub, G. et al., Proc. Natl. Acad. Sci. USA 77 (1980) 4216-4220), and myeloma cells, e.g., Y0, NS0 and Sp2 / 0. For a review of certain mammalian host cell lines suitable for antibody production, see, e.g., Yazaki, P. and Wu, A.M., Methods in Molecular Biology, Vol. 248, Lo, BKC (ed.), Humana Press, Totowa, NJ (2004), pp. 255-268.
[0191] In certain embodiments of all aspects and embodiments of the inventive subject matter disclosed herein, the mammalian cell modified according to the invention or used in a method or use according to the invention is a Chinese Hamster Ovary (CHO) cell (e.g., CHO K1, CHO DG44, etc.), a human embryonic kidney (HEK) cell, a lymphoid cell (e.g., Y0, NS0, Sp2 / 0 cell) or a human amniotic cell (e.g., CAP-T, etc.). In a preferred embodiment of the inventive subject matter disclosed herein, the mammalian cell modified according to the invention or used in a method according to the invention is a CHO cell or a HEK cell.
[0192] In certain embodiments of the subject matter disclosed herein, the invention relates to modified mammalian cells, e.g., CHO cells, in which the expression of one or more mammalian cell endogenous products (e.g., host cell proteins) is reduced or eliminated. For example, but not limited to, methods for reducing or eliminating the expression of endogenous products in mammalian cells include: (1) modifying the gene encoding the endogenous product or its components, e.g., by introducing deletions, insertions, substitutions, or combinations thereof into the gene; (2) reducing or eliminating the transcription and / or stability of the mRNA encoding the endogenous product or its components; and (3) reducing or eliminating the translation of the mRNA encoding the endogenous product or its components. In certain embodiments of the subject matter disclosed herein, the reduction or elimination of protein expression is obtained by targeted genome editing. For example, CRISPR / Cas9-based genome editing can be used to modify one or more target genes, resulting in the reduction or elimination of the expression of the genes targeted for editing.
[0193] In certain embodiments of the subject matter disclosed herein, the mammalian cell endogenous product targeted for reduction or elimination of expression is selected based on its role in promoting lysine hydroxylation. Since lysine hydroxylation can result in the formation of undesirable by-products or by-products, reducing or eliminating the expression of such endogenous proteins can positively affect the yield and purity of the culture. For example, but not by way of limitation, the endogenous mammalian cell protein selected based on its role in promoting lysine hydroxylation is PLOD. In certain embodiments of the subject matter disclosed herein, the mammalian cell of the subject matter disclosed herein exhibits reduced or eliminated expression of PLOD. In certain embodiments of the subject matter disclosed herein, the mammalian cell of the present disclosure exhibits reduced or eliminated expression of PLOD1 or / and PLOD2 or / and PLOD3.
[0194] In certain embodiments of the inventive subject matter disclosed herein, the mammalian cell comprises an additional endogenous product whose expression is targeted for reduction or elimination.
[0195] In certain embodiments of the inventive subject matter disclosed herein, one or more additional mammalian cell endogenous products targeted for reduction or elimination of expression are selected based on their role in promoting apoptosis. Because apoptosis can reduce the viability and productivity of a culture, reducing or eliminating the expression of such proteins can have a positive effect on the viability and productivity of a culture. For example, but not by way of limitation, a mammalian cell protein selected based on its role in promoting apoptosis is BCL2 Binding X, Apoptosis Regulator (BAX) or BCL2 Antagonist / Killer 1 (BAK). In certain embodiments of the inventive subject matter disclosed herein, the mammalian cell of the present invention further exhibits reduced or eliminated expression of BAX. In certain embodiments of the inventive subject matter disclosed herein, the mammalian cell of the present invention further exhibits reduced or eliminated expression of BAK. In certain embodiments of the inventive subject matter disclosed herein, the mammalian cell of the present invention further exhibits reduced or eliminated expression of BAX and BAK.
[0196] In certain embodiments of the inventive subject matter disclosed herein, the additional mammalian cell endogenous product targeted for reduction or elimination of expression is selected based on its role in promoting clumping and / or aggregation during cell culture. When mammalian cells are used for the production of a recombinant product of interest, such clumping and / or aggregation during cell culture may result in a reduction in product titer due to the adverse effect of clumping and / or aggregation on the viability of mammalian cells. For example, but not limited to, an additional mammalian cell endogenous product selected based on its role in promoting clumping and / or aggregation during cell culture is intercellular adhesion molecule 1 (ICAM-1). In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the invention further exhibit a reduction or elimination of expression of ICAM-1.
[0197] In certain embodiments of the inventive subject matter disclosed herein, one or more of the additional mammalian cell endogenous products targeted for expression reduction or elimination are selected based on their role in promoting inefficient cell growth. Mammalian cells express many endogenous products that are not essential for cell growth, survival and / or productivity. Since the expression of these endogenous products consumes significant cellular energy and DNA / protein building blocks, reducing or eliminating the expression of such endogenous products can make cell growth more efficient and, in the case of cells used to produce a recombinant product of interest, can free up those cellular resources to achieve higher productivity of the recombinant product of interest. For example, but not limited to, additional mammalian cell endogenous products selected based on their role in promoting efficient cell growth and higher productivity of the recombinant product of interest are BAX, BAK, ICAM-1, Sirtuin 1 (SIRT-1) or MYC proto-oncogene, BHLH transcription factor (MYC). In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the invention further exhibit reduced or eliminated expression of SIRT-1. In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the invention further exhibit reduced or eliminated expression of MYC. In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the invention further exhibit reduced or eliminated expression of SIRT-1 and MYC. In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the invention further exhibit reduced or eliminated expression of BAX and MYC. In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the invention further exhibit reduced or eliminated expression of BAK and MYC. In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the invention further exhibit reduced or eliminated expression of ICAM-1 and MYC. In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the invention further exhibit reduced or eliminated expression of BAX and SIRT-1. In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the invention further exhibit reduced or eliminated expression of BAK and SIRT-1.In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the invention further exhibit reduced or eliminated expression of ICAM-1 and SIRT-1. In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the invention further exhibit reduced or eliminated expression of BAX, SIRT-1 and MYC. In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the invention further exhibit reduced or eliminated expression of BAK, SIRT-1 and MYC. In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the invention further exhibit reduced or eliminated expression of ICAM-1, SIRT-1 and MYC. In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the invention further exhibit reduced or eliminated expression of BAX, BAK, SIRT-1 and MYC. In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the invention further exhibit reduced or eliminated expression of BAX, ICAM-1, SIRT-1 and MYC. In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the invention further exhibit reduced or eliminated expression of BAK, ICAM-1, SIRT-1 and MYC. In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the invention further exhibit reduced or eliminated expression of BAX, BAK, MYC, SIRT-1 and ICAM.
[0198] In certain embodiments of the subject matter disclosed herein, the host cell of the present invention is modified to reduce or eliminate the expression of one or more endogenous products of the host cell, compared to the expression of the endogenous products of the host cell in an unmodified, i.e., "reference" host cell. In certain embodiments of the subject matter disclosed herein, the reference host cell is a host cell in which the expression of one or more specific endogenous products, such as, for example, PLOD, particularly PLOD1 or / and PLOD2 or / and PLOD3; BAX; ICAM-1; SIRT-1; and / or MYC polypeptides, is not reduced or eliminated. That is, the reference host cell has the same genotype as the modified cell, except for the respective endogenous genes whose expression is reduced or eliminated. In certain embodiments of the subject matter disclosed herein, the reference host cell is a cell that contains at least one or both wild-type alleles of genes encoding, for example, PLOD, particularly PLOD1 or / and PLOD2 or / and PLOD3; BAX; ICAM-1; SIRT-1; and / or MYC. For example, but not limited to, the reference host cell is a host cell having wild type alleles of both genes encoding, for example, PLOD, particularly PLOD1 or / and PLOD2 or / and PLOD3; BAX; ICAM-1; SIRT-1; and / or MYC. In certain embodiments of the inventive subject matter disclosed herein, the reference host cell is a WT host cell. In certain embodiments of the inventive subject matter disclosed herein, the modification that reduces or eliminates the expression of one or more host cell endogenous products is performed before the introduction of the exogenous nucleic acid that encodes the recombinant product of interest, i.e., the heterologous polypeptide or protein. In certain embodiments of the inventive subject matter disclosed herein, the modification that reduces or eliminates the expression of one or more host cell endogenous products is performed after the introduction of the exogenous nucleic acid that encodes the recombinant product of interest, i.e., the heterologous polypeptide or protein.
[0199] In certain embodiments of the subject matter of the invention disclosed herein, expression of one or more endogenous products, e.g., PLOD, particularly PLOD1 or / and PLOD2 or / and PLOD3; BAX; ICAM-1; SIRT-1; and / or MYC polypeptides, in a cell modified to reduce or eliminate expression of the endogenous product is less than about 90%, less than about 80%, less than about 70%, less than about 60%, less than about 50%, less than about 40%, less than about 30%, less than about 20%, less than about 10%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, or less than about 1% of the expression of the corresponding endogenous product in a reference cell, e.g., a WT host cell. In certain embodiments of the inventive subject matter disclosed herein, expression of one or more endogenous products in a cell modified to reduce or eliminate expression of the endogenous product is less than about 90%, less than about 80%, less than about 70%, less than about 60%, less than about 50%, less than about 40%, less than about 30%, less than about 20%, less than about 10%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, or less than about 1% of the expression of the corresponding endogenous product in a reference cell, e.g., a WT host cell.
[0200] In certain embodiments of the subject matter of the invention disclosed herein, expression of one or more endogenous products, e.g., PLOD, particularly PLOD1 or / and PLOD2 or / and PLOD3; BAX; ICAM-1; SIRT-1; and / or MYC polypeptides, in a host cell modified to reduce or eliminate expression of the endogenous product is at least about 90%, at least about 80%, at least about 70%, at least about 60%, at least about 50%, at least about 40%, at least about 30%, at least about 20%, at least about 10%, at least about 5%, at least about 4%, at least about 3%, at least about 2% or at least about 1% of the expression of the corresponding endogenous product in a reference host cell, e.g., a WT host cell. In certain embodiments of the inventive subject matter disclosed herein, expression of one or more endogenous products in a host cell that has been modified to reduce or eliminate expression of the endogenous product is at least about 90%, at least about 80%, at least about 70%, at least about 60%, at least about 50%, at least about 40%, at least about 30%, at least about 20%, at least about 10%, at least about 5%, at least about 4%, at least about 3%, at least about 2%, or at least about 1% of the expression of the corresponding endogenous product in a reference cell, e.g., a WT mammalian cell.
[0201] In certain embodiments of the subject matter of the invention disclosed herein, expression of one or more particular endogenous products, e.g., PLOD, particularly PLOD1 or / and PLOD2 or / and PLOD3; BAX; ICAM-1; SIRT-1; and / or MYC polypeptides, in a cell modified to reduce or eliminate expression of the endogenous product is about 90% or less, about 80% or less, about 70% or less, about 60% or less, about 50% or less, about 40% or less, about 30% or less, about 20% or less, about 10% or less, about 5% or less, about 4% or less, about 3% or less, about 2% or less, or about 1% or less of the expression of the corresponding endogenous product in a reference host cell, e.g., a WT host cell. In certain embodiments of the subject matter disclosed herein, the expression of one or more endogenous products, such as PLOD, particularly PLOD1 or / and PLOD2 or / and PLOD3; BAX; ICAM-1; SIRT-1; and / or MYC polypeptides, in a cell modified to reduce or eliminate expression of an endogenous product is about 40% or less of the expression of the corresponding endogenous product in a reference cell, e.g., a WT mammalian cell. In certain embodiments of the subject matter disclosed herein, the expression of one or more endogenous products in a cell modified to reduce or eliminate expression of an endogenous product is about 90% or less, about 80% or less, about 70% or less, about 60% or less, about 50% or less, about 40% or less, about 30% or less, about 20% or less, about 10% or less, about 5% or less, about 4% or less, about 3% or less, about 2% or less, or about 1% or less of the expression of the corresponding endogenous product in a reference cell, e.g., a WT host cell.
[0202] In certain embodiments of the inventive subject matter disclosed herein, the expression of one or more endogenous products, e.g., PLOD, particularly PLOD1 or / and PLOD2 or / and PLOD3; BAX; ICAM-1; SIRT-1; and / or MYC polypeptides, in a cell modified to reduce or eliminate expression of the endogenous product is between about 1% and about 90% of the expression of the corresponding endogenous product in a reference cell, e.g., a WT host cell, About 10% to about 90%, about 20% to about 90%, about 25% to about 90%, about 30% to about 90%, about 40% to about 90%, about 50% to about 90%, about 60% to about 90%, about 70% to about 90%, about 80% to about 90%, about 85% to about 90%, about 1% to about 80%, about 10% to about 80%, about 20% to about 80%, about 30% to about 80%, about 40% to about 80%, about 50% to about 80%, about 60% to about 80%, about 70% to about 80%, about 75% to about 80 %, about 1% to about 70%, about 10% to about 70%, about 20% to about 70%, about 30% to about 70%, about 40% to about 70%, about 50 to about 70%, about 60 to about 70%, about 65 to about 70%, about 1 to about 60%, about 10 to about 60%, about 20 to about 60%, about 30 to about 60%, about 40 to about 60%, about 50% to about 60%, about 55% to about 60%, about 1% to about 50%, about 10% to about 50%, about 20% to about 50%, about 30% to about 50%, about 40% to about 50%, about 45% to about 50%, about 1% to about 40%, about 10% to about 40%, about 20% to about 40%, about 30% to about 40%, about 35% to about 40%, about 1% to about 30%, about 10% to about 30%, about 20% to about 30%, about 25% to about 30%, about 1% to about 20%, about 5% to about 20%, about 10% to about 20%, about 15% to about 20%, about 1% to about 10%, about 5% to about 10%, about 5% to about 20%, about 5% to about 30%, and about 5% to about 40%.In certain embodiments of the inventive subject matter disclosed herein, the expression of one or more endogenous products, e.g., PLOD, particularly PLOD1 or / and PLOD2 or / and PLOD3; BAX; ICAM-1; SIRT-1; and / or MYC polypeptides, in a cell modified to reduce or eliminate expression of the endogenous product is between about 1% and about 90% of the expression of the corresponding endogenous product in a reference cell, e.g., a WT host cell, About 10% to about 90%, about 20% to about 90%, about 25% to about 90%, about 30% to about 90%, about 40% to about 90%, about 50% to about 90%, about 60% to about 90%, about 70% to about 90%, about 80% to about 90%, about 85% to about 90%, about 1% to about 80%, about 10% to about 80%, about 20% to about 80%, about 30% to about 80%, about 40% to about 80%, about 50% to about 80%, about 60% to about 80%, about 70% to about 80%, about 75% to about 80 %, about 1% to about 70%, about 10% to about 70%, about 20% to about 70%, about 30% to about 70%, about 40% to about 70%, about 50 to about 70%, about 60 to about 70%, about 65 to about 70%, about 1 to about 60%, about 10 to about 60%, about 20 to about 60%, about 30 to about 60%, about 40 to about 60%, about 50% to about 60%, about 55% to about 60%, about 1% to about 50%, about 10% to about 50%, about 20% to about 50%, about 30% to about 50%, about 40% to about 50%, about 45% to about 50%, about 1% to about 40%, about 10% to about 40%, about 20% to about 40%, about 30% to about 40%, about 35% to about 40%, about 1% to about 30%, about 10% to about 30%, about 20% to about 30%, about 25% to about 30%, about 1% to about 20%, about 5% to about 20%, about 10% to about 20%, about 15% to about 20%, about 1% to about 10%, about 5% to about 10%, about 5% to about 20%, about 5% to about 30%, and about 5% to about 40%.
[0203] In certain embodiments, expression of one or more endogenous products, e.g., PLOD, particularly PLOD1 or / and PLOD2 or / and PLOD3; BAX; ICAM-1; SIRT-1; and / or MYC polypeptides, in a cell modified to reduce or eliminate expression of the endogenous product is about 5% to about 40% of the expression of the corresponding endogenous product in a reference cell, e.g., a WT host cell.
[0204] In certain embodiments of the subject matter of the invention disclosed herein, the expression levels of one or more endogenous products, e.g., PLOD, particularly PLOD1 or / and PLOD2 or / and PLOD3; BAX; ICAM-1; SIRT-1; and / or MYC polypeptides, in various reference cells (e.g., cells containing at least one or both wild-type alleles of the corresponding genes) may vary.
[0205] In certain embodiments of the subject matter disclosed herein, a genetic engineering system is used to reduce or eliminate the functional expression of one or more specific endogenous products (e.g., PLOD, particularly PLOD1 or / and PLOD2 or / and PLOD3; BAX; ICAM-1; SIRT-1; and / or MYC expression). A variety of genetic engineering systems known in the art can be used for the methods disclosed herein. Non-limiting examples of such systems include the use of CRISPR / Cas systems, zinc finger nuclease (ZFN) systems, transcription activator-like effector nuclease (TALEN) systems, and other tools for reducing or eliminating protein expression by gene silencing, such as small interfering RNA (siRNA), short hairpin RNA (shRNA) and microRNA (miRNA). Any CRISPR / Cas system known in the art, including conventional, enhanced, or modified Cas systems, and other bacterial-based genome excision tools, such as Cpf1, can be used with the methods disclosed herein.
[0206] In certain embodiments of the subject matter disclosed herein, one or more genes, such as PLOD, particularly PLOD1 or / and PLOD2 or / and PLOD3; BAX; ICAM-1; SIRT-1; and / or MYC polypeptides, are deleted to reduce or eliminate the expression of the corresponding endogenous products in the host cell. In certain embodiments of the subject matter disclosed herein, at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, or at least about 90% of the genes are deleted. In certain embodiments, about 2% or less, about 5% or less, about 10% or less, about 15% or less, about 20% or less, about 25% or less, about 30% or less, about 35% or less, about 40% or less, about 45% or less, about 50% or less, about 55% or less, about 60% or less, about 65% or less, about 70% or less, about 75% or less, about 80% or less, about 85% or less, or about 90% or less of the genes are deleted.In certain embodiments of the subject matter disclosed herein, about 2% to about 90%, about 10% to about 90%, about 20% to about 90%, about 25% to about 90%, about 30% to about 90%, about 40% to about 90%, about 50% to about 90%, about 60% to about 90%, about 70% to about 90%, about 80% to about 90%, about 85% to about 90%, about 2% to about 80%, About 10% to about 80%, about 20% to about 80%, about 30% to about 80%, about 40% to about 80%, about 50% to about 80%, about 60% to about 80%, about 70% to about 80%, about 75% to about 80%, about 2% to about 70%, about 10% to about 70%, about 20% to about 70%, about 30% to about 70%, about 40% to about 70%, about 50% to about 70%, about 60% to about 70%, About 65% to about 70%, about 2% to about 60%, about 10% to about 60%, about 20% to about 60%, about 30% to about 60%, about 40% to about 60%, about 50% to about 60%, about 55% to about 60%, about 2% to about 50%, about 10% to about 50%, about 20% to about 50%, about 30% to about 50%, about 40% to about 50%, about 45% to about 50%, about 2% to about 40%, about 1 0% to about 40%, about 20% to about 40%, about 30% to about 40%, about 35% to about 40%, about 2% to about 30%, about 10% to about 30%, about 20% to about 30%, about 25% to about 30%, about 2% to about 20%, about 5% to about 20%, about 10% to about 20%, about 15% to about 20%, about 2% to about 10%, about 5% to about 10%, or about 2% to about 5% is deleted.
[0207] In certain embodiments of the subject matter of the invention disclosed herein, at least one exon of the gene encoding PLOD, in particular PLOD1 or / and PLOD2 or / and PLOD3; BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptides are at least partially deleted in the host cell.The term "partially deleted" as used herein refers to, for example, at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 100%, at least about 105%, at least about 106%, at least about 107%, at least about 108%, at least about 109%, at least about 200%, at least about 201%, at least about 202%, at least about 203%, at least about 204%, at least about 205%, at least about 206, at least about 207, at least about 208, at least about 209, at least about 300, at least about 301, at least about 302, at least about 303, at least about 304, at least about 305, at least about 306, at least about 307, at least about 308, at least about 309, at least about 309, at least about 310, at least about 311, at least about 312, at least about 313, at least about 314, at least about 315, at least about 316, at least about 317, at least about 318, at least about 319, at least about 320, at least about 321, at least about 322, at least about 323, at least about 324, at least about 325, at least about 326, at least about 5%, about 2% or less, about 5% or less, about 10% or less, about 15% or less, about 20% or less, about 25% or less, about 30% or less, about 35% or less, about 40% or less, about 45% or less, about 50% or less, about 55% or less, about 60% or less, about 65% or less, about 70% or less, about 75% or less, about 80% or less Lower, about 85% or less, about 90% or less, about 95% or less, about 2% to about 90%, about 10% to about 90%, about 20% to about 90%, about 25% to about 9 0%, about 30% to about 90%, about 40% to about 90%, about 50% to about 90%, about 60% to about 90%, about 70% to about 90%, about 80% to about 9 0%, about 85% to about 90%, about 2% to about 80%, about 10% to about 80%, about 20% to about 80%, about 30% to about 80%, about 40% to about 80%, about 50% to about 80%, about 60% to about 80%, about 70% to about 80%, about 75% to about 80%, about 2% to about 70%, about 10% to about 70%, about 20% to about 70%, about 30% to about 70%, about 40% to about 70%, about 50% to about 70%, about 60% to about 70%, about 65% to about 70%, about 2% to about 60%, about 10% to about 60%, about 20% to about 60%, about 30% to about 60%, about 40% to about 60%, about 50% to about 6 This refers to a loss of 0%, about 55% to about 60%, about 2% to about 50%, about 10% to about 50%, about 20% to about 50%, about 30% to about 50%, about 40% to about 50%, about 45% to about 50%, about 2% to about 40%, about 10% to about 40%, about 20% to about 40%, about 30% to about 40%, about 35% to about 40%, about 2% to about 30%, about 10% to about 30%, about 20% to about 30%, about 25% to about 30%, about 2% to about 20%, about 5% to about 20%, about 10% to about 20%, about 15% to about 20%, about 2% to about 10%, about 5% to about 10%, or about 2% to about 5%.
[0208] In certain non-limiting embodiments of the subject matter disclosed herein, the expression of one or more endogenous products, such as PLOD, particularly PLOD1 or / and PLOD2 or / and PLOD3; BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptides, is reduced or eliminated in host cells using the CRISPR / Cas9 system. The clustered regularly interspaced short palindromic repeats (CRISPR) system is a genome editing tool found in prokaryotic cells. When used for genome editing, the system includes Cas9 (a protein that can modify DNA using crRNA as a guide), CRISPR RNA (crRNA, which contains RNA to guide crRNA to the correct part of host DNA, along with a region that binds to tracrRNA (usually in hairpin loop form) that is used by Cas9 and forms an active complex with Cas9), and transactivation crRNA (tracrRNA, which binds to crRNA and forms an active complex with Cas9). The terms "guide RNA" and "gRNA" refer to any nucleic acid that facilitates the specific association (or "targeting") of an RNA-guided nuclease, such as Cas9, to a target sequence, such as a genomic or episomal sequence in a cell. gRNAs can be unimolecular (comprising a single RNA molecule, alternatively called a chimera) or modular (comprising two or more, typically two, separate RNA molecules, such as a crRNA and a tracrRNA, that are usually associated with each other, e.g., by duplexing).
[0209] In the CRISPR / Cas9 strategy, vectors can be used to transfect mammalian cells. Guide RNA (gRNA) can be designed for each application, as it is the sequence that uses Cas9 to identify and directly bind to target DNA in mammalian cells. Multiple crRNAs and tracrRNAs can be packaged together to form single-stranded guide RNA (sgRNA). The sgRNA can be spliced with the Cas9 gene and incorporated into a vector for transfection into mammalian cells.
[0210] In certain embodiments of the subject matter disclosed herein, the CRISPR / Cas9 system for use in reducing or eliminating the expression of one or more endogenous products, such as PLOD, particularly PLOD1 or / and PLOD2 or / and PLOD3, BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptides, comprises a Cas9 molecule and one or more gRNAs that comprise a targeted domain that is complementary to the target sequence of the gene that codes for the endogenous product or its components.In certain embodiments of the subject matter disclosed herein, the target gene is the region of the gene that codes for the endogenous product, such as PLOD, particularly PLOD1 or / and PLOD2 or / and PLOD3; BAX; ICAM-1; SIRT-1; and / or MYC polypeptides.The target sequence can be any exon or intron region within the gene.
[0211] In certain embodiments of the subject matter disclosed herein, the gRNA is administered to the mammalian cell in a single vector, and the Cas9 molecule is administered to the host cell in a second vector. In certain embodiments of the subject matter disclosed herein, the gRNA and the Cas9 molecule are administered to the host cell in a single vector. Alternatively, each of the gRNA and the Cas9 molecule can be administered by a separate vector. In certain embodiments of the subject matter disclosed herein, the CRISPR / Cas9 system can be delivered to the host cell as a ribonucleoprotein complex (RNP) that includes the Cas9 protein complexed with one or more gRNAs, for example, by electroporation (see, e.g., DeWitt et al., Methods 121-122:9-15 (2017) for additional methods of delivering RNPs to cells). In certain embodiments of the subject matter disclosed herein, administration of the CRISPR / Cas9 system to a host cell reduces or eliminates expression of endogenous products, such as those encoding PLOD, particularly PLOD1 or / and PLOD2 or / and PLOD3; BAX; ICAM-1; SIRT-1; and / or MYC polypeptides.
[0212] In certain embodiments of the subject matter disclosed herein, the genetic engineering system is a ZFN system for reducing or eliminating the expression of one or more specific endogenous products in mammalian cells, such as PLOD, particularly PLOD1 or / and PLOD2 or / and PLOD3; BAX; ICAM-1; SIRT-1; and / or MYC polypeptides. ZFNs can act as restriction enzymes, which are generated by combining zinc finger DNA binding domains with DNA cleavage domains. Zinc finger domains can be engineered to target specific DNA sequences, allowing zinc finger nucleases to target desired sequences within the genome. The DNA binding domain of an individual ZFN typically contains multiple individual zinc finger repeats, each capable of recognizing multiple base pairs. The most common method for creating new zinc finger domains is to combine small zinc finger "modules" with known specificity. The most common cleavage domain in ZFNs is the non-specific cleavage domain derived from the type II restriction endonuclease FokI. ZFNs modulate protein expression by creating double-stranded breaks (DSBs) within target DNA sequences, which are repaired by non-homologous end joining (NHEJ) in the absence of a homologous template. Such repair can result in base pair deletions or insertions, resulting in a frameshift and preventing the production of harmful proteins (Durai et al., Nucleic Acids Res.; 33(18):5978-90(2005)). Multiple pairs of ZFNs can also be used to completely remove entire large segments of genomic sequences (Lee et al., Genome Res.; 20(1):81-9(2010)).
[0213] In certain embodiments of the inventive subject matter disclosed herein, the genetic engineering system is a TALEN system for reducing or eliminating the expression of one or more specific endogenous products in mammalian cells, such as PLOD, particularly PLOD1 or / and PLOD2 or / and PLOD3; BAX; ICAM-1; SIRT-1; and / or MYC polypeptides. TALENs are restriction enzymes that can be engineered to cleave specific sequences in DNA. TALEN systems operate on a principle similar to ZFNs. TALENs are generated by combining a transcription activator-like effector DNA binding domain with a DNA cleavage domain. Transcription activator-like effectors (TALEs) are composed of a repeating motif of 33-34 amino acids with two variable positions that strongly recognize specific nucleotides. By assembling an array of these TALEs, the TALE DNA binding domain can be engineered to bind to a desired DNA sequence, thereby guiding the nuclease to cleave at a specific location in the genome (Boch et al., Nature Biotechnology; 29(2): 135-6 (2011)). In certain embodiments of the inventive subject matter disclosed herein, the target gene encodes, for example, a PLOD, in particular PLOD1 or / and PLOD2 or / and PLOD3; BAX; ICAM-1; SIRT-1; and / or MYC polypeptide.
[0214] In certain embodiments of the subject matter disclosed herein, the expression of one or more specific endogenous products, such as PLOD, particularly PLOD1 or / and PLOD2 or / and PLOD3; BAX; ICAM-1; SIRT-1; and / or MYC polypeptides, can be reduced or eliminated using oligonucleotides having complementary sequences to corresponding nucleic acids (e.g., mRNA). Non-limiting examples of such oligonucleotides include small interfering RNA (siRNA), short hairpin RNA (shRNA), and microRNA (miRNA). In certain embodiments of the subject matter disclosed herein, such oligonucleotides can be, for example, homologous to at least a portion of PLOD, particularly PLOD1 or / and PLOD2 or / and PLOD3; BAX; ICAM-1; SIRT-1; and / or MYC polypeptide nucleic acid sequences, and the homology of the portion to the corresponding nucleic acid sequence is at least about 75, or at least about 80, or at least about 85, or at least about 90, or at least about 95, or at least about 98 percent. In certain non-limiting embodiments of the inventive subject matter disclosed herein, the complementary portion can comprise at least 10 nucleotides, or at least 15 nucleotides, or at least 20 nucleotides, or at least 25 nucleotides, or at least 30 nucleotides, and the antisense nucleic acid, shRNA, mRNA, or siRNA molecule can be up to 15, or up to 20, or up to 25, or up to 30, or up to 35, or up to 40, or up to 45, or up to 50, or up to 75, or up to 100 nucleotides in length. The antisense nucleic acid, shRNA, mRNA, or siRNA molecule can comprise DNA or atypical or non-naturally occurring residues, such as, but not limited to, phosphorothioate residues.
[0215] The genetic engineering system disclosed herein can be delivered to mammalian cells using viral vectors, such as retroviral vectors, such as gamma retroviral vectors, and lentiviral vectors. If the capsid protein is functional to infect human cells, a combination of a retroviral vector and a suitable packaging line is suitable. A variety of amphotropic virus-producing cell lines are known, including, but not limited to, PA12 (Miller, et al. (1985) Mol. Cell. Biol. 5:431-437); PA317 (Miller, et al. (1986) Mol. Cell. Biol. 6:2895-2902); and CRIP (Danos, et al. (1988) Proc. Natl. Acad. Sci. USA 85:6460-6464). Non-amphotropic particles, such as those pseudotyped with VSVG, RD114 or GALV envelopes and any other known in the art, are also suitable. Possible methods of transduction include direct co-culture of the cells with producer cells, e.g., by the method of Bregni, et al. (1992) Blood 80:1418-1422, or culture with viral supernatant alone or concentrated vector stocks, with or without appropriate growth factors and polycations, e.g., by the method of Xu, et al. (1994) Exp. Hemat. 22:223-230; and Hughes, et al. (1992) J. Clin. Invest. 89:1817.
[0216] Other transduction virus vectors can be used to modify mammalian cells disclosed herein.In certain embodiments of the subject matter disclosed herein, the selected vector shows high infection efficiency and stable integration and expression (see, for example, Cayouette et al., Human Gene Therapy 8:423-430, 1997; Kido et al., Current Eye Research 15:833-844, 1996; Bloomer et al., Journal of Virology 71:6641-6649, 1997; Naldini et al., Science 272:263-267, 1996; and Miyoshi et al., Proc. Natl. Acad. Sci. USA 94:10319, 1997). Other viral vectors that can be used include, for example, adenovirus, lentivirus, and adeno-associated virus vectors, vaccinia virus, bovine papilloma virus, or herpes viruses, such as Epstein-Barr virus (see, e.g., Miller, Human Gene Therapy 15-14, 1990; Friedman, Science 244:1275-1281, 1989; Eglitis et al., BioTechniques 6:608-614, 1988; Tolstoshev et al., Current Opinion in Biotechnology 1:55-61, 1990; Sharp, The Lancet 337:1277-1278, 1991; Cornetta et al., Nucleic Acid Research and Molecular Biology 36:311-322, 1987; Anderson, Science 226:401-409, 1984; Moen, Blood Cells 17:407-416, 1991; Miller et al., Biotechnology 7:980-990, 1989; LeGal La Salle et al., Science 259:988-990, 1993; and Johnson, Chest 107:77S-83S, 1995).Retroviral vectors in particular have been developed and used in clinical settings (Rosenberg et al., N. Engl. J. Med 323:370, 1990; Anderson et al., U.S. Patent No. 5,399,346).
[0217] Non-viral approaches can also be used for the genetic engineering of mammalian cells as disclosed herein. For example, administration of nucleic acids in the presence of lipofection (Feigner et al., Proc. Natl. Acad. Sci. USA 84:7413, 1987; Ono et al., Neuroscience Letters 17:259, 1990; Brigham et al., Am. J. Med. Sci. 298:278, 1989; Staubinger et al., Methods in Enzymology 101:512, 1983), asialoorosomucoid-polylysine conjugation (Wu et al., Journal of Biological Chemistry 263:14621, 1988; Wu et al., Journal of Biological Chemistry 264:16985, 1989) or microinjection under surgical conditions (Wolff et al., Science Nucleic acid molecules can be introduced into mammalian cells by the ELISA kit (247:1465,1990). Other non-viral means for gene transfer include in vitro transfection using calcium phosphate, DEAE dextran, electroporation, and protoplast fusion. Liposomes can also be potentially useful for delivering nucleic acid molecules into mammalian cells. Transplantation of normal genes into diseased tissues of subjects can also be achieved by transferring normal nucleic acids into ex vivo culturable cell types (e.g., autologous or heterologous primary cells or their progeny), and then injecting the cells (or their progeny) into targeted tissues or systemically.
[0218] Targeted integration Targeted integration (TI) allows the integration of an exogenous nucleotide sequence into a defined site in the genome of a mammalian cell.
[0219] In certain embodiments of the subject matter disclosed herein, the use of TI host cells for the introduction of exogenous nucleic acids encoding heterologous polypeptides or proteins of interest provides robust and stable cell culture performance and reduces the risk of undesired secondary modifications in the resulting recombinant product of interest. TI host cells and strategies for their use are described in detail in U.S. Patent Application Publication No. 2021 / 0002669, the contents of which are incorporated by reference in their entirety.
[0220] In certain embodiments of the subject matter disclosed herein that use targeted integration, the exogenous nucleotide sequence encoding a heterologous polypeptide or protein is integrated into a site within a specific locus of the genome of the TI host cell.In certain embodiments of the subject matter disclosed herein, the locus into which the exogenous nucleotide sequence encoding a heterologous polypeptide or protein is integrated is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or at least about 99.9% homologous to the sequence selected from contigs NW_006874047.1, NW_006884592.1, NW_006881296.1, NW_003616412.1, NW_003615063.1, NW_006882936.1 and NW_003615411.1.
[0221] In certain embodiments of the subject matter disclosed herein, the nucleotide sequence 5' (immediately adjacent to the 5') of the integrated exogenous sequence encoding a heterologous polypeptide or protein is selected from the group consisting of nucleotides 41190 to 45269 of NW_006874047.1, nucleotides 63590 to 207911 of NW_006884592.1, nucleotides 253831 to 49 of NW_006881296.1, and the like. 1909, nucleotides 69303 to 79768 of NW_003616412.1, nucleotides 293481 to 315265 of NW_003615063.1, nucleotides 2650443 to 2662054 of NW_006882936.1, or nucleotides 82214 to 97705 of NW_003615411.1, and sequences at least 50% homologous thereto. In certain embodiments of the subject matter disclosed herein, the nucleotide sequence 5' to (immediately adjacent to) the integrated exogenous sequence encoding a heterologous polypeptide or protein is selected from the group consisting of nucleotides 41190 to 45269 of NW_006874047.1, nucleotides 63590 to 207911 of NW_006884592.1, nucleotides 253831 to 491909 of NW_006881296.1, nucleotides 69 to 81 of NW_003616412.1, and the like. nucleotides 303-79768 of NW_003615063.1, nucleotides 293481-315265 of NW_003615063.1, nucleotides 2650443-2662054 of NW_006882936.1, or nucleotides 82214-97705 of NW_003615411.1.
[0222] In certain embodiments of the subject matter disclosed herein, the nucleotide sequence 3' to (immediately adjacent to) the integrated exogenous sequence encoding a heterologous polypeptide or protein is selected from the group consisting of nucleotides 45270 to 45490 of NW_006874047.1, nucleotides 207912 to 792374 of NW_006884592.1, nucleotides 491910 to 66 of NW_006881296.1, and the like. nucleotides 7813, nucleotides 79769 to 100059 of NW_003616412.1, nucleotides 315266 to 362442 of NW_003615063.1, nucleotides 2662055 to 2701768 of NW_006882936.1, or nucleotides 97706 to 105117 of NW_003615411.1, and sequences at least 50% homologous thereto. In certain embodiments of the subject matter disclosed herein, the nucleotide sequence 3' to (immediately adjacent to) the integrated exogenous sequence encoding a heterologous polypeptide or protein is selected from the group consisting of nucleotides 45270 to 45490 of NW_006874047.1, nucleotides 207912 to 792374 of NW_006884592.1, nucleotides 491910 to 667813 of NW_006881296.1, nucleotides 791910 to 667813 of NW_003616412.1, and nucleotides 791910 to 667813 of NW_003616412.1. nucleotides 769-100059 of NW_003615063.1, nucleotides 315266-362442 of NW_003615063.1, nucleotides 2662055-2701768 of NW_006882936.1, or nucleotides 97706-105117 of NW_003615411.1.
[0223] In certain embodiments of the subject matter disclosed herein, the integrated exogenous sequence encoding a heterologous polypeptide or protein is selected from the group consisting of nucleotides 41190 to 45269 of NW_006874047.1, nucleotides 63590 to 207911 of NW_006884592.1, nucleotides 253831 to 491909 of NW_006881296.1, nucleotides 253831 to 491909 of NW_003616412.1, and the like. and nucleotides 69303 to 79768 of NW_003615063.1, nucleotides 293481 to 315265 of NW_003615063.1, nucleotides 2650443 to 2662054 of NW_006882936.1, and nucleotides 82214 to 97705 of NW_003615411.1, and sequences at least 50% homologous thereto. In certain embodiments of the subject matter disclosed herein, the integrated exogenous sequence encoding a heterologous polypeptide or protein is selected from the group consisting of nucleotides 45270 to 45490 of NW_006874047.1, nucleotides 207912 to 792374 of NW_006884592.1, nucleotides 491910 to 667813 of NW_006881296.1, nucleotides 491910 to 667813 of NW_003616412.1, and the like. and is adjacent 3' to a nucleotide sequence selected from the group consisting of nucleotides 79769-100059 of NW_003615063.1, nucleotides 315266-362442 of NW_003615063.1, nucleotides 2662055-2701768 of NW_006882936.1, and nucleotides 97706-105117 of NW_003615411.1, and sequences at least 50% homologous thereto.In certain embodiments of the subject matter disclosed herein, the nucleotide sequence flanking the 5' end of the integrated exogenous nucleotide sequence encoding a heterologous polypeptide or protein is selected from the group consisting of nucleotides 41190 to 45269 of NW_006874047.1, nucleotides 63590 to 207911 of NW_006884592.1, nucleotides 253831 to 491909 of NW_006881296.1, nucleotides 693 to 701 of NW_003616412.1, and nucleotides 703 to 713 of NW_003616412.1. nucleotides 2650443 to 2662054 of NW_006882936.1, and nucleotides 82214 to 97705 of NW_003615411.1. In certain embodiments of the subject matter disclosed herein, the nucleotide sequence 3' adjacent to the integrated exogenous nucleotide sequence encoding a heterologous polypeptide or protein is selected from the group consisting of nucleotides 45270 to 45490 of NW_006874047.1, nucleotides 207912 to 792374 of NW_006884592.1, nucleotides 491910 to 667813 of NW_006881296.1, nucleotides 79710 to 79779 of NW_003616412.1, and the like. nucleotides 69-100059 of NW_003615063.1, nucleotides 315266-362442 of NW_006882936.1, nucleotides 2662055-2701768 of NW_006882936.1, and nucleotides 97706-105117 of NW_003615411.1.
[0224] In certain embodiments of the subject matter disclosed herein, the integrated exogenous nucleotide sequence encoding a heterologous polypeptide or protein is operably linked to a nucleotide sequence selected from the group consisting of contigs NW_006874047.1, NW_006884592.1, NW_006881296.1, NW_003616412.1, NW_003615063.1, NW_006882936.1, and NW_003615411.1, and sequences at least 50% homologous thereto. In certain embodiments of the subject matter disclosed herein, the nucleotide sequence operably linked to the exogenous nucleotide sequence encoding a heterologous polypeptide or protein is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or at least about 99.9% homologous to a sequence selected from contigs NW_006874047.1, NW_006884592.1, NW_006881296.1, NW_003616412.1, NW_003615063.1, NW_006882936.1, and NW_003615411.1.
[0225] In targeted integration, site-specific recombination is used to introduce exogenous nucleic acid at a specific locus in the genome of a mammalian TI host cell. It is an enzymatic process in which the sequence at the site of integration in the genome is exchanged with the exogenous nucleic acid. One system used to perform such a nucleic acid exchange is the Cre-lox system. The enzyme that catalyzes the exchange is Cre recombinase. The sequence to be exchanged is defined by the location of two lox(P) sites in the genome as well as in the exogenous nucleic acid. These lox(P) sites are recognized by Cre recombinase. It does not require anything more, i.e. no ATP etc. The Cre-lox system was originally discovered in bacteriophage P1.
[0226] In certain embodiments of all aspects and embodiments of the inventive subject matter disclosed herein, the cells modified in accordance with the present subject matter have been subjected to targeted integration of a nucleic acid encoding a heterologous polypeptide or protein of interest prior to modification in accordance with the presently disclosed subject matter.
[0227] In certain embodiments of all aspects and embodiments of the inventive subject matter, the cells modified according to the inventive subject matter have been subjected to targeted integration of a nucleic acid encoding a heterologous polypeptide or protein of interest after modification according to the inventive subject matter.
[0228] In certain embodiments of all aspects and embodiments of the present subject matter, targeted integration is mediated by a recombinase that recognizes one or more recombination recognition sequences (RRS) present within the genome of the mammalian cell and within the exogenous nucleotide sequence encoding a heterologous polypeptide or protein to be integrated into the genome of the mammalian cell.
[0229] In certain embodiments of all aspects and embodiments of the present subject matter, the targeted integration is mediated by homologous recombination.
[0230] A "recombination recognition sequence" (RRS) is a nucleotide sequence that is recognized by a recombinase and is necessary and sufficient for a recombinase-mediated recombination event. The RRS can be used to define the location within a nucleotide sequence where a recombination event will occur.
[0231] In certain embodiments of all aspects and embodiments of the present subject matter, the RRS is recognized by Cre recombinase.
[0232] In certain embodiments of all aspects and embodiments of the present subject matter, the RRS is a LoxP site and Cre recombinase mediates targeted integration by recombination.
[0233] In certain embodiments of all aspects and embodiments of the present subject matter, the RRS is recognized by an FLP recombinase.
[0234] In certain embodiments of all aspects and embodiments of the present subject matter, the RRS is an FRT site and the FLP recombinase mediates targeted integration by recombination.
[0235] In certain embodiments of all aspects and embodiments of the present subject matter, the RRS is recognized by Bxb1 integrase.
[0236] In certain embodiments of all aspects and embodiments of the present subject matter, the RRS is a Bxb1 attP or Bxb1 attB site, and the Bxb1 integrase mediates targeted integration by recombination.
[0237] In certain embodiments of all aspects and embodiments of the present subject matter, the RRS is recognized by φC31 integrase.
[0238] In certain embodiments of all aspects and embodiments of the present subject matter, the RRS is a φC31 attP or φC31 attB site, and C31 integrase mediates targeted integration by recombination.
[0239] The recombinase can be introduced into the cell using an expression vector containing the coding sequence for the enzyme, or as a protein or mRNA.
[0240] For TI, any known or future mammalian cell that contains a landing site described herein integrated at a single site within a genomic locus and modified according to the present subject matter may be used in the present subject matter, such cells being referred to as mammalian TI host cells.
[0241] In certain embodiments of all aspects and embodiments of the present subject matter, the mammalian TI host cell is a hamster cell, a human cell, a rat cell, or a mouse cell that comprises a landing site as described herein. In one preferred embodiment of the present subject matter disclosed herein, the mammalian TI host cell is a CHO cell. In certain embodiments of the present subject matter disclosed herein, the mammalian TI host cell is a CHO K1 cell, a CHO K1SV cell, a CHO DG44 cell, a CHO DUKXB-11 cell, a CHO K1S cell, or a CHO K1M cell that comprises a landing site as described herein integrated at a single site within a genomic locus.
[0242] In certain embodiments of all aspects and embodiments of the subject matter of the present invention, the mammalian TI host cell comprises an integrated landing site, the landing site comprising one or more recombination recognition sequences (RRS). The RRS can be recognized by a recombinase, for example, Cre recombinase, FLP recombinase, Bxb1 integrase, or φC31 integrase. The one or more RRS can be selected, independently of each other, from the group consisting of LoxP sequence, LoxP L3 sequence, LoxP 2L sequence, LoxFas sequence, Lox511 sequence, Lox2272 sequence, Lox2372 sequence, Lox5171 sequence, Loxm2 sequence, Lox71 sequence, Lox66 sequence, FRT sequence, Bxb1 attP sequence, Bxb1 attB sequence, φC31 attP sequence, and φC31 attB sequence. If multiple RRSs must be present, the selection of each sequence is dependent on the other, to the extent that non-identical RRSs are selected.
[0243] In certain embodiments of all aspects and embodiments of the inventive subject matter, the landing site comprises one or more recombination recognition sequences (RRS), and the RRS can be recognized by a recombinase. In certain embodiments of the inventive subject matter disclosed herein, the integrated landing site comprises at least two RRSs. In certain embodiments of the inventive subject matter disclosed herein, the integrated landing site comprises three RRSs, and the third RRS is located between the first RRS and the second RRS. In certain preferred embodiments of the inventive subject matter disclosed herein, all three RRSs are different. In certain embodiments of the inventive subject matter disclosed herein, the landing site comprises a first RRS, a second RRS, and a third RRS, and at least one selectable marker located between the first RRS and the second RRS, and the third RRS is different from the first RRS and / or the second RRS. In certain embodiments of the inventive subject matter disclosed herein, the landing site further comprises a second selection marker, and the first and second selection markers are different. In certain embodiments of the inventive subject matter disclosed herein, the landing site further comprises a third selection marker and an internal ribosome entry site (IRES), and the IRES is operably linked to the third selection marker. The third selection marker can be different from the first or second selection marker.
[0244] An exemplary mammalian TI host cell suitable for modification according to the inventive subject matter and for use in the inventive subject matter methods is a CHO cell that carries a landing site integrated at a single site within a locus in its genome, the landing site containing three heterospecific loxP sites for Cre recombinase-mediated DNA recombination.
[0245] In this example, the heterospecific loxP sites are L3, LoxFas, and 2L (see, e.g., Lanza et al., Biotechnol. J. 7 (2012) 898-908; Wong et al., Nucleic Acids Res. 33 (2005) e147), where L3 and 2L are adjacent to the 5' and 3' ends of the landing site, respectively, and LoxFas is located between the L3 and 2L sites. The landing site further contains a bicistronic unit that couples the expression of an IRES-mediated selection marker to the expression of a fluorescent GFP protein, allowing for stabilization of the landing site by positive selection and for selection of absent sites after transfection and Cre recombination (negative selection). The green fluorescent protein (GFP) serves to monitor the RMCE reaction.
[0246] This construction of the landing site as outlined in the previous paragraph allows the simultaneous integration of two vectors, for example the so-called front vector carrying L3 and LoxFas sites and the back vector carrying LoxFas and 2L sites. The functional elements of the selection marker gene, which are different from those present in the landing site, can be distributed between both vectors, and the promoter and start codon can be located on the front vector, whereas the coding region and polyA signal are located on the back vector. Only the correct recombinase-mediated integration of the nucleic acid from both vectors induces resistance to the respective selection agents.
[0247] Generally, a mammalian TI host cell is a mammalian cell that comprises a landing site that integrates at a single site within a locus in the genome of the mammalian cell, the landing site comprising a first recombination recognition sequence and a second recombination recognition sequence adjacent to at least a first selectable marker, and a third recombination recognition sequence located between the first recombination recognition sequence and the second recombination recognition sequence, and wherein the recombination recognition sequences are all different.
[0248] The selection marker may be selected from the group consisting of genes encoding aminoglycoside phosphotransferases (APH) (e.g., hygromycin phosphotransferase (HYG), neomycin, and G418APH), dihydrofolate reductase (DHFR), thymidine kinase (TK), glutamine synthetase (GS), asparagine synthetase, tryptophan synthase (indole), histidinol dehydrogenase (histidinol D), and resistance to puromycin, blasticidin, bleomycin, phleomycin, chloramphenicol, zeocin, and mycophenolic acid. The selection marker may also be a fluorescent protein selected from the group consisting of green fluorescent protein (GFP), enhanced GFP (eGFP), synthetic GFP, yellow fluorescent protein (YFP), enhanced YFP (eYFP), cyan fluorescent protein (CFP), mPlum, mCherry, tdTomato, mStrawberry, J-red, DsRed monomer, mOrange, mKO, mCitrine, Venus, YPet, Emerald6, CyPet, mCFPm, Cerulean, and T-Sapphire.
[0249] An exogenous nucleotide sequence is a nucleotide sequence that is not native to a particular cell, but can be introduced into the cell by a DNA delivery method, such as transfection, electroporation, or transformation. In certain embodiments of the inventive subject matter disclosed herein, the mammalian TI host cell comprises at least one landing site integrated into one or more integration sites in the genome of the mammalian cell. In certain embodiments of the inventive subject matter disclosed herein, the landing site is integrated into one or more integration sites in a specific locus of the genome of the mammalian cell.
[0250] In certain embodiments of all aspects and embodiments according to the present subject matter, the integrated landing site comprises at least one selection marker. In certain embodiments of the inventive subject matter disclosed herein, the integrated landing site comprises a first RRS, a second RRS and a third RRS, and at least one selection marker. In certain embodiments, the selection marker is located between the first RRS and the second RRS. In certain embodiments of the inventive subject matter disclosed herein, the two RRSs are adjacent to at least one selection marker. That is, the first RRS is located 5' (upstream) of the selection marker, and the second RRS is located 3' (downstream) of the selection marker. In certain embodiments of the inventive subject matter disclosed herein, the first RRS is adjacent to the 5' end of the selection marker, and the second RRS is adjacent to the 3' end of the selection marker. In certain embodiments, the landing site comprises a first RRS, a second RRS, and a third RRS, and at least one selectable marker located between the first RRS and the third RRS.
[0251] In certain embodiments of all aspects and embodiments according to the present subject matter, the selection marker is located between the first and second RRSs, and the two flanking RRSs are different. In certain preferred embodiments of the inventive subject matter disclosed herein, the first flanking RRS is a LoxP L3 sequence and the second flanking RRS is a LoxP 2L sequence. In certain embodiments of the inventive subject matter disclosed herein, the LoxP L3 sequence is located 5' of the selection marker and the LoxP 2L sequence is located 3' of the selection marker. In certain embodiments of the inventive subject matter disclosed herein, the first flanking RRS is a wild-type FRT sequence and the second flanking RRS is a mutant FRT sequence. In certain embodiments of the inventive subject matter disclosed herein, the first flanking RRS is a Bxb1 attP sequence and the second flanking RRS is a Bxb1 attB sequence.
[0252] In certain embodiments of the subject matter disclosed herein, the first adjacent RRS is a φC31 attP sequence and the second adjacent RRS is a φC31 attB sequence. In certain embodiments of the subject matter disclosed herein, the two RRSs are arranged in the same orientation. In certain embodiments of the subject matter disclosed herein, the two RRSs are both forward or reverse. In certain embodiments of the subject matter disclosed herein, the two RRSs are arranged in opposite orientations.
[0253] In certain embodiments of all aspects and embodiments according to the inventive subject matter, the integrated landing site comprises a first and a second selection marker flanked by two RRSs, the first selection marker being different from the second selection marker. In certain embodiments of the inventive subject matter disclosed herein, both of the two selection markers are independently selected from the group consisting of a glutamine synthetase selection marker, a thymidine kinase selection marker, a HYG selection marker, and a puromycin resistance selection marker. In certain embodiments of the inventive subject matter disclosed herein, the integrated landing site comprises a thymidine kinase selection marker and a HYG selection marker. In certain embodiments of the inventive subject matter disclosed herein, the first selection marker is an aminoglycoside phosphotransferase (APH) (e.g., hygromycin phosphotransferase (HYG), neomycin, and G418). APH), dihydrofolate reductase (DHFR), thymidine kinase (TK), glutamine synthetase (GS), asparagine synthetase, tryptophan synthase (indole), histidinol dehydrogenase (histidinol D), and genes encoding resistance to puromycin, blasticidin, bleomycin, phleomycin, chloramphenicol, zeocin, and mycophenolic acid, and the second selection marker is selected from the group consisting of GFP, eGFP, synthetic GFP, YFP, eYFP, CFP, mPlum, mCherry, tdTomato, mStrawberry, J-red, DsRed monomer, mOrange, mKO, mCitrine, Venus, YPet, Emerald, CyPet, mCFPm, Cerulean, and T-Sapphire fluorescent protein. In certain embodiments of the inventive subject matter disclosed herein, the first selection marker is a glutamine synthetase selection marker and the second selection marker is a GFP fluorescent protein, in certain embodiments of the inventive subject matter disclosed herein, the two RRSs flanking both selection markers are different.
[0254] In certain embodiments of the subject matter disclosed herein, the selection marker is operably linked to a promoter sequence. In certain embodiments of the subject matter disclosed herein, the selection marker is operably linked to an SV40 promoter. In certain embodiments of the subject matter disclosed herein, the selection marker is operably linked to a human cytomegalovirus (CMV) promoter.
[0255] The Cre-lox system functions in a variety of cell types, including mammalian, plant, bacterial, and yeast.
[0256] In certain embodiments of all aspects and embodiments according to the inventive subject matter, an exogenous nucleic acid encoding a heterologous polypeptide or protein is integrated into a mammalian TI host cell by single or double recombinase-mediated cassette exchange (RMCE), thereby resulting in a recombinant mammalian cell, such as a recombinant CHO cell, in which a defined, specific expression cassette sequence is integrated into the genome at a single locus, which then results in efficient expression and production of the heterologous polypeptide.
[0257] Cre-LoxP site-specific recombination systems are widely used in many biological experimental systems. Cre recombinase is a 38 kDa site-specific DNA recombinase that recognizes 34 bp LoxP sequences. Cre recombinase is derived from bacteriophage P1 and belongs to the tyrosine family of site-specific recombinases. Cre recombinase can mediate both intra- and intermolecular recombination between LoxP sequences. The LoxP sequence consists of an 8 bp non-palindromic core region flanked by two 13 bp inverted repeats. Cre recombinase binds to the 13 bp repeats, thereby mediating recombination within the 8 bp core region. Cre-LoxP-mediated recombination occurs with high efficiency and does not require any other host factors. When two LoxP sequences are positioned in the same orientation on the same nucleotide sequence, Cre recombinase-mediated recombination results in the DNA sequence located between the two LoxP sequences being excised as a covalently closed circle. If two LoxP sequences are located in opposite orientations on the same nucleotide sequence, Cre recombinase-mediated recombination will invert the orientation of the DNA sequence located between the two sequences. If two LoxP sequences are on two different DNA molecules and one DNA molecule is circular, Cre recombinase-mediated recombination will result in the integration of the circular DNA sequence.
[0258] The term "matching RRS" indicates that recombination occurs between two RRSs. In certain embodiments of the subject matter disclosed herein, the two matching RRSs are the same. In certain embodiments of the subject matter disclosed herein, both RRSs are wild-type LoxP sequences. In certain embodiments of the subject matter disclosed herein, both RRSs are mutant LoxP sequences. In certain embodiments of the subject matter disclosed herein, both RRSs are wild-type FRT sequences. In certain embodiments of the subject matter disclosed herein, both RRSs are mutant FRT sequences. In certain embodiments of the subject matter disclosed herein, the two matching RRSs are different sequences but can be recognized by the same recombinase. In certain embodiments of the subject matter disclosed herein, the first matching RRS is a Bxb1 attP sequence and the second matching RRS is a Bxb1 attB sequence. In certain embodiments of the subject matter disclosed herein, the first matching RRS is a φC31 attB sequence and the second matching RRS is a φC31 attB sequence.
[0259] The "two-plasmid RMCE" strategy or "double RMCE" is used in the method according to the present subject matter when using a combination of two vectors. For example, but not limited to, the integrated landing site may comprise three RRSs, such as an arrangement in which a third RRS ("RRS3") is present between a first RRS ("RRS1") and a second RRS ("RRS2"), while the first vector comprises two RRSs that match the first and third RRSs on the integrated exogenous nucleotide sequence, and the second vector comprises two RRSs that match the third and second RRSs on the integrated exogenous nucleotide sequence.
[0260] The two-plasmid RMCE strategy involves performing two independent RMCEs simultaneously using three RRS sites. Thus, the landing site of a mammalian TI host cell using the two-plasmid RMCE strategy contains a third RRS site (RRS3) that has no cross activity towards either the first RRS site (RRS1) or the second RRS site (RRS2). The two plasmids to be targeted require the same flanking RRS sites for efficient targeting, with one plasmid (front) flanked by RRS1 and RRS3 and the other (back) flanked by RRS3 and RRS2. Furthermore, in two-plasmid RMCE, two selection markers are also required. One selection marker expression cassette was split into two parts. The front plasmid contains a promoter followed by a start codon and an RRS3 sequence. The back plasmid lacks a start codon (ATG) and has an RRS3 sequence fused to the N-terminus of the selection marker coding region. To ensure in-frame translation of the fusion protein, i.e., operative linkage, it may be necessary to insert additional nucleotides between the RRS3 site and the selection marker sequence. Only when both plasmids are correctly inserted will the complete expression cassette of the selection marker be assembled, thus conferring resistance to the respective selection agent to the cells.
[0261] Two-plasmid RMCE involves a double recombination crossover event between two heterospecific RRSs and a donor DNA molecule in a target genomic locus, catalyzed by a recombinase. Two-plasmid RMCE is designed to introduce copies of the combined DNA sequences from the front and back vectors into a predetermined locus of the mammalian TI host cell genome. RMCE can be performed such that no sequences of the prokaryotic vector are introduced into the mammalian TI host cell genome, thus reducing and / or preventing unwanted triggering of the host's immune or defense mechanisms. The RMCE procedure can be repeated with multiple DNA sequences.
[0262] In certain embodiments of all aspects and embodiments according to the inventive subject matter, targeted integration is achieved by two rounds of RMCE, where two different DNA sequences each contain at least one expression cassette encoding a portion of a heteromultimeric polypeptide and / or at least one selection marker or portion thereof flanked by two heterospecific RRSs, and both are integrated into a predetermined site in the genome of the corresponding RRS of the mammalian TI host cell. In certain embodiments of the inventive subject matter disclosed herein, targeted integration is achieved by multiple rounds of RMCE, where DNA sequences from multiple vectors each contain at least one expression cassette encoding a portion of a heteromultimeric polypeptide and / or at least one selection marker or portion thereof flanked by two heterospecific RRSs, and all are integrated into a predetermined site in the genome of the mammalian TI host cell. In certain embodiments of the inventive subject matter disclosed herein, the selection marker may be partially encoded in a first vector and partially encoded in a second vector, such that expression of the selection marker is only possible if both are correctly integrated by double RMCE.
[0263] It should be pointed out that in certain embodiments of the inventive subject matter disclosed herein, the reduction of transcriptional activity, e.g. by knockout, can be performed in a stably transfected clone or a pool of stably transfected clones before, as well as after, the introduction of an exogenous nucleic acid encoding a heterologous polypeptide or protein.
[0264] Specific embodiments of compositions and methods according to the present invention The presence of hydroxylated lysine residues in recombinantly produced heterologous product proteins requires laborious and time-consuming evaluation and monitoring of biological activity, pharmacokinetics, immunogenicity and safety.
[0265] It has been found that in recombinantly produced antibodies, lysine to hydroxylysine modification occurs to different degrees at different lysine residues, i.e., lysine residues that are not part of the Xaa-Lys-Gly consensus sequence.
[0266] This has been demonstrated for three trivalent bispecific antibodies with different binding specificities (TCB format), with the results shown in the table below. TIFF2025517572000002.tif137143TIFF2025517572000003.tif180143
[0267] It was now found that the formation of hydroxylysine is based on the action of procollagen-lysine, 2-oxoglutarate 5-dioxygenase.
[0268] The term "procollagen-lysine, 2-oxoglutarate 5-dioxygenase" refers to a protein having enzymatic activity encoded by the nucleic acid sequence of the PLOD gene or a nucleic acid sequence homologous thereto. The term also encompasses proteins derived from the complete mRNA sequence of PLOD or its splice variants, such as splice variants for PLOD2 LH2a and LH2b. The invention also encompasses knockouts of PLOD2 variants that differ in the nucleotide or even amino acid sequence of the encoded protein, for example, as long as the protein catalyzes the hydroxylation of lysine residues. As a result of the degeneracy of the genetic code, many different polynucleotide sequences can code for "procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2". However, only one of them is present in the genome.
[0269] PLOD is located in the rough ER. These enzymes are responsible for lysine hydroxylation. These enzymes require Fe as a cofactor. 2+ , ascorbic acid and α-ketoglutarate (αKG). The oxidative degradation of αKG requires CO 2+ succinate, resulting in the generation of Fe(IV)-oxo or other reactive oxygen species that hydroxylate the primary substrate. A complex composed of PLOD1, P3H3, and P3H4 that catalyzes the hydroxylation of lysine residues in collagen alpha chains and is required for normal assembly and cross-linking of collagen fibrils.
[0270] PLOD2 has been reported, for example, by Ruotsalainen, H., et al. (Matrix Biol. 18 (1999) 325-329 and 20 (2001) 137-146) and Valtavaara, M., et al. (J. Biol. Chem. 272 (1997) 6831-6834). Yeowell and Walker have reported the existence of splice variants in particular (Matrix Biol. 18 (1999) 179-187).
[0271] Three genes encoding "procollagen-lysine, 2-oxoglutarate 5-dioxygenase" (PLOD) have been identified: PLOD1, PLOD2 and PLOD3. The proteins show enzymatic activity towards the synthetic peptides ARGIKGIRGFS (SEQ ID NO: 51), GIKGIKGIKGIK (SEQ ID NO: 52) and IKGIKGIKG (SEQ ID NO: 53) (Scietti, L., et al., Nat. Comm. 9 (2018) 3136). The detailed substrate specificity is not known. See further, Valtavaara, M., et al., J. Biol. Chem. 272(1997)6831-6834 and 273(1998)12881-12886; Passoja, K., et al., Proc. Natl. Acad. Sci. USA 95(1998)10482-10486 and Scietti, L., et al., Nat. Comm. 9(2018)3136.
[0272] The PLOD1 and PLOD3 genes contain 19 exons and the intron / exon boundaries are identical. The PLOD2 gene is highly homologous to PLOD1 and PLOD3. However, it contains an additional exon, designated exon 13A, between exon 13 and exon 14 compared to PLOD1 and PLOD3. In the case of PLOD2, two splice variants can be expressed (LH2a and LH2b), with LH2b differing from LH2a by the incorporation of exon 13A.
[0273] The subject matter of the invention disclosed herein is based, at least in part, on the discovery that knocking out the PLOD gene reduces / eliminates the level of hydroxylysine formation in recombinantly produced heterologous proteins.
[0274] The subject matter of the invention disclosed herein is based, at least in part, on the discovery that knocking out the PLOD gene does not affect the overall cell culture performance of the respective modified cells. PLOD knockout cell lines have been found to have a higher ability to form biomass in culture, and therefore higher recombinant protein titers, compared to cells of the same genotype except for the PLOD knockout.
[0275] The subject matter of the invention disclosed herein is based, at least in part, on the discovery that knocking out the PLOD gene does not affect other protein quality attributes. CE-SDS and SEC evaluations were found to show comparable or even increased main peak levels, and comparable or even decreased by-product levels.
[0276] The subject matter of the invention disclosed herein is based at least in part on the discovery that knocking out the PLOD gene reduces filterability problems. Without being bound by this theory, it is believed that this is due to the fact that CHO cells, in particular, express many collagen genes at high levels and therefore are unable to cross-link collagen any more. It has been found that filterability is at least as good or even improved by reducing the increase in filtration pressure.
[0277] The subject matter of the invention disclosed herein is based, at least in part, on the discovery that knockout of the PLOD gene reduces cell aggregation in culture. Without being bound by this theory, it is believed that the reduction / absence of cross-linked collagen is unable to mediate trans-binding of different CHO cells via integrin α1β1.
[0278] Deletion of PLOD enzymatic activity can be achieved by inactivation of specific gene products, e.g., by CRISPR / Cas-based gene knockout, zinc finger nuclease-based knockout, etc. Inactivation / deletion of the enzymatic activity introduced into the host cell allows for its subsequent use in different projects. However, off-target effects and effects putatively interfering with other important cellular performance (e.g., cell growth and productivity) or quality attributes were unexpectedly not found.
[0279] This has been shown for the same three trivalent bispecific antibodies with different binding specificities, where the formation of hydroxylated lysines can be reduced by applying the method according to the invention, while increasing the titers obtained. The respective results are shown in the table below. TIFF2025517572000004.tif214143TIFF2025517572000005.tif194143TIFF2025517572000006.tif62143
[0280] Concomitant with the increase in titer, there was also an increase in viable cell density following introduction of the PLOD gene knockout, as shown by the integrated viable cell density over time (IVCD) in Figures 1-3 for Antibodies 1-3.
[0281] Concurrent with the increase in titer and viable cell density, filterability was also improved, i.e. the final pressure of filtration was reduced, as shown by the data presented in the table below and in FIG. 4 (data normalized to the respective produced biomass (IVCD)). TIFF2025517572000007.tif72143
[0282] Concurrent with the increased titer and viable cell density and improved filterability was the improved product content as determined by size exclusion chromatography (SEC), as shown in the table below. TIFF2025517572000008.tif67143***LMW: Low molecular weight species content; HMW: High molecular weight species content
[0283] The following examples, sequences and figures are provided to aid the understanding of the present invention, the true scope of which is set forth in the appended claims. It is understood that modifications can be made in the procedures set forth without departing from the spirit or scope of the invention.
[0284] Array Description SEQ ID NO: 01: Exemplary sequence of L3 recombinase recognition sequence AAGTCTCC SEQ ID NO: 02: Exemplary sequence of 2L recombinase recognition sequence: GCATACAT SEQ ID NO: 03: Exemplary sequence of LoxFas recombinase recognition sequence: TACCTTTC SEQ ID NOs: 04-06: Exemplary variants of the human CMV promoter SEQ ID NO:04: GTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTAGCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCCGTTTAGTGAACGTCAGATC SEQ ID NO:05: GTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTAGCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCCGTTTAGTGAACGTCAGATCTAGCTCTGGGAGAGGAGCCCAGCACTAGAAGTCGGCGGTGTTTCCATTCGGTGATCAGCACTGAACACAGAGGAAGCTTGCCGCCACC SEQ ID NO:06: SEQ ID NO: 07: An exemplary SV40 polyadenylation signal sequence: AACTTGTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTG SEQ ID NO: 08: An exemplary bGH polyadenylation signal sequence: TTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGATGCGGTGGGCTCTATGG SEQ ID NO: 09: Exemplary hGT terminator sequence: CAGGATAATATATGGTAGGGTTCATAGCCAGAGTAACCTTTTTTTTTAATTTTTATTTTATTTTATTTT GAG SEQ ID NO: 10: Exemplary SV40 promoter sequence: AGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTC CGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTCCCGGGAGCTTGTATATCCATTTTCG SEQ ID NO:11: An exemplary GFP nucleic acid sequence: ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTCCGGACTCAGATCTCGAGCTCAAGCTTCGAATTCTGCAGTCGACGGTACCGCGGGCCCGGGATCCACCGGATCTAGATGA
[0285] SEQ ID NOs: 12 to 14: SIRT-1 guide RNA SEQ ID NO:12 : gRNA_SIRT1_1: TATCATCCAACTCAGGTGGA SEQ ID NO:13 : gRNA_SIRT1_2: GCAGCATCTCATGATTGGCA SEQ ID NO:14 :gRNA_SIRT1_3:GCATTCTTGAAGTAACTTCA
[0286] SEQ ID NOs: 15-16: SIRT-1 PCR primers SEQ ID NO:15 :SIRT1_for:ATGGCAGTTTTAGACACC SEQ ID NO:16 :SIRT1_rev:CTTGGAACTCAGACAAGG
[0287] SEQ ID NOs: 17 to 19: MYC guide RNAs SEQ ID NO:17 :gRNA_MYC_1:CTATGACCTCGACTACGACT SEQ ID NO:18 :gRNA_MYC_2:GGACGCAGCGACCGTCACAT SEQ ID NO:19 :gRNA_MYC_3:CACCATCTCCAGCTGATCCG
[0288] SEQ ID NOs: 20-21: MYC PCR primers SEQ ID NO:20 :MYC_for:CACACACACACTTGGAAG SEQ ID NO:21 :MYC_rev:CTTGATGAAGGTCTCGTC
[0289] SEQ ID NOs: 22 to 25: ICAM-1 guide RNA SEQ ID NO:22 :gRNA_ICAM1_1:ACCTGCATGGATGCACCCCG SEQ ID NO:23 :gRNA_ICAM1_2:GCACCGTGCCCACCTCCAGG SEQ ID NO:24 :gRNA_ICAM1_3:TAACCGCCAGAGAAAGATC SEQ ID NO:25 :gRNA_ICAM1_4:ACCTGCATGGATGCACCCCG
[0290] SEQ ID NOs: 26-27: ICAM-1 PCR primers SEQ ID NO:26 :ICAM1_for:CCAAGCTAGGATGAG SEQ ID NO:27 :ICAM1_rev:GCCCTACCCTTTTAATAC
[0291] Range 28~32:BAK RNA SEQ ID NO:28 :gRNA_BAK_1:TACAGCATCTTGGGTCAGGT SEQ ID NO:29 :gRNA_BAK_2:GTCCATCTCGGGGTTGGCAG SEQ ID NO:30 :gRNA_BAK_3:AATCTTGGTGAAGAGTTCGT SEQ ID NO:31 :gRNA_BAK_4:TCATCACAGTCCTGCCTAGG SEQ ID NO:32 :gRNA_BAK_5:ATGGCGTCTGGACAAGGACC
[0292] Range 33~34:BAK PCR substrate SEQ ID NO:33 :BAK_for:CGATCTGAGTTCACGAAC SEQ ID NO:34 :BAK_rev:CCATCAGGAACAAGAGAC
[0293] Random 35~39:BAX RNA SEQ ID NO:35 :gRNA_BAX_1:ACAGGGGCCTTTTTGCTACA SEQ ID NO:36 :gRNA_BAX_2:GCTCATCTCCAATTCGCCTG SEQ ID NO:37 :gRNA_BAX_3:ACGAGAGGTCTTCTTCCGTG SEQ ID NO:38 :gRNA_BAX_4:GGGTCGGGGGAGCAGCTCGG SEQ ID NO:39 :gRNA_BAX_5:GGGTCCCGAAGTGAGAGG
[0294] SEQ ID NOs: 40-41: BAX PCR primers SEQ ID NO:40 :BAX_for:ATCTTGTCTCCCTCGTAG SEQ ID NO:41 :BAX_rev:TCCTGGACTTCTCTAACC
[0295] SEQ ID NOs: 42 to 44: PLOD1 guide RNA SEQ ID NO:42 :gRNA_PLOD1_1:TAAGAGTTCCCGGGGCCCCG SEQ ID NO:43 :gRNA_PLOD1_2:AACTCATCTACCCCGACCGG SEQ ID NO:44 :gRNA_PLOD1_3:CGCTTGCCATCAGACACCGT
[0296] SEQ ID NOs: 45 to 47: PLOD2 guide RNA SEQ ID NO:45 :gRNA_PLOD2_1:GTGGCCGGATAAGCGACTCG SEQ ID NO:46 :gRNA_PLOD2_2:GTTTACCAATGTGCACTACA SEQ ID NO:47 :gRNA_PLOD2_3:AAACGCTACCTGAATTCTGG
[0297] SEQ ID NOs: 48-50: PLOD3 guide RNA SEQ ID NO:48 :gRNA_PLOD3_1:GATGTTGCTCGAACAGTTGG SEQ ID NO:49 :gRNA_PLOD3_2:GGAGAAAATATGCAAACCGGG SEQ ID NO:50 :gRNA_PLOD3_3:CAAATTGCTGGTGATCACCG
[0298] SEQ ID NOs: 51 to 53: PLOD artificial substrates SEQ ID NO:51 :ARGIKGIRGFS SEQ ID NO:52 :GIKGIKGIKGIK SEQ ID NO:53 :IKGIKGIKG
[0299] SEQ ID NO: 54: HC(1) hydroxylation site-LTVLSSASTK(G) SEQ ID NO: 55: HC(2) hydroxylation site - LTVLSSASTKGPSVFPLAPSSK(S) SEQ ID NO: 56: HC(3) hydroxylation site - VTVSSASTK(G) SEQ ID NO: 57: HC(4) hydroxylation site - VTVSSASTKGPSVFPLAPSSK(S) SEQ ID NO: 58: HC(5) hydroxylation site-SSASTK(G) SEQ ID NO: 59: HC(6) hydroxylation site - SSASTKGPSVFPLAPSSK(S) SEQ ID NO: 60: HC-H hydroxylation site - NQVSLSCAVK(G) SEQ ID NO: 61: LC(2) hydroxylation site - LKSGTASVVCLLNNFYPR SEQ ID NO: 62: LC(3) hydroxylation site -DSTYSLSSTLTLSKADYEK(H) SEQ ID NO: 63: LC(3') hydroxylation site - DSTYSLSSTLTLSK(A) SEQ ID NO: 64: HC-K(1) hydroxylation site-SSASTK(G) SEQ ID NO: 65: HC-K(2) hydroxylation site - SSASTKGPSVFPLAPSSK(S) SEQ ID NO: 66: Background Art - WGQGTLVTVSSASTK [Brief description of the drawings]
[0300] [Figure 1] Integrated viable cell density (IVCD) over time for cells expressing Antibody 1 with (dark green) and without (light green) PLOD1-3 knockout. [Diagram 2] Integrated viable cell density (IVCD) over time for cells expressing Antibody 2 with (dark blue) and without (light blue) PLOD1-3 knockout. [Diagram 3]Integrated viable cell density (IVCD) over time for cells expressing Antibody 3 with (orange) and without (orange) PLOD1-3 knockout. [Figure 4] Change in final pressure during filtration of antibody 1-3 preparations obtained using cells with or without PLOD1-3 inactivation (data normalized to the respective generated biomass (IVCD)). EXAMPLES
[0301] Example 1 - General Technology 1) Recombinant DNA Technology DNA was manipulated using standard methods as described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, (1989). Molecular biological reagents were used according to the manufacturer's instructions.
[0302] 2) DNA sequencing DNA sequencing was performed at SequiServe GmbH (Vaterstetten, Germany) or Eurofins Genomics GmbH (Ebersberg, Germany) or Microsynth AG (Balgach, Switzerland).
[0303] 3) DNA and protein sequence analysis and sequence data management The EMBOSS (European Molecular Biology Open Software Suite) software package and Geneious prime 2021 (Auckland, New Zealand) were used for sequence creation, mapping, analysis, annotation, and illustration.
[0304] 4) Synthesis of genes and oligonucleotides The desired gene segments were prepared by chemical synthesis at Geneart GmbH (Regensburg, Germany) or Twist Bioscience (San Francisco, USA). The synthesized gene fragments were cloned into E. coli plasmids for propagation / amplification. The DNA sequences of the subcloned gene fragments were confirmed by DNA sequencing. Alternatively, short synthetic DNA fragments were constructed by annealing chemically synthesized oligonucleotides or via PCR. The respective oligonucleotides were prepared by metabion GmbH (Planegg-Martinsried, Germany).
[0305] 5) Reagents All commercially available chemicals, antibodies, and kits were used as provided according to manufacturer's protocols unless otherwise stated.
[0306] 6) Cultivation of TI host cell lines TI CHO host cells were cultured at 37°C in a humidified incubator with 85% humidity and 5% CO2. They were cultured in a proprietary DMEM / F12-based medium containing 300μg / ml hygromycin B and 4μg / ml of a second selection marker. Cells were split every 3 or 4 days at a concentration of 0.3x10^6 cells / ml into a total volume of 30ml. For culture, 125ml non-baffled Erlenmeyer shake flasks were used. Cells were shaken at 150 rpm with a shaking amplitude of 5cm. Cell number was determined using a Cedex HiRes Cell Counter (Roche). Cells were kept in culture until they reached 60 days of age.
[0307] 7) Cloning a) General: Cloning at the R site depends on the DNA sequence next to the gene of interest (GOI), which is the same as the sequence found in the next fragment. Similarly, assembly of the fragments is possible by overlapping of equal sequences and subsequent sealing of the nicks in the assembled DNA by DNA ligase. Thus, cloning of a single gene in a specific preparatory vector with the correct R site is necessary. After successful cloning of these preparatory vectors, the gene of interest adjacent to the R site is cut through restriction digestion with an enzyme that cuts immediately next to the R site. The final step is to assemble all the DNA fragments in one step. More specifically, a 5' exonuclease removes the 5' end of the overlapping region (the R site). Then, annealing of the R site can be performed and a DNA polymerase extends the 3' end to fill the gaps in the sequence. Finally, a DNA ligase seals the nicks between the nucleotides. The single fragments are assembled into one plasmid by adding an assembly master mix containing different enzymes such as exonuclease, DNA polymerase and ligase, and then incubating the reaction mix at 50° C. Competent E. coli cells are then transformed with the plasmid.
[0308] For some vectors, a restriction enzyme-mediated cloning strategy was used. By choosing the appropriate restriction enzyme, the desired gene of interest can be cut and then inserted into a different vector by ligation. Thus, using an enzyme that cuts at the multiple cloning site (MCS), selected in a smart way, allows for ligation of the fragments in the correct array. If the vector and fragments have been previously cut with the same restriction enzyme, the sticky ends of the fragment and vector will be perfectly compatible and can then be ligated by DNA ligase. After ligation, competent E. coli cells are transformed with the newly created plasmid.
[0309] b) Cloning by restriction digestion: For digestion of the plasmid with restriction enzymes, the following components were pipetted together on ice: (Table) Restriction digestion reaction mix TIFF2025517572000009.tif41128
[0310] When more enzyme was used per digest, 1 μl of each enzyme was used, adjusting the volume by adding more or less PCR-grade water. All enzymes were selected with the prerequisite that they were qualified for use in New England Biolabs' CutSmart buffer (100% activity) and at the same incubation temperature (all at 37°C).
[0311] Incubation was performed using a thermomixer or thermal cycler to allow the samples to incubate at a constant temperature (37°C). Samples were not stirred during incubation. The incubation time was set to 60 min. Samples were then mixed directly with loading dye and loaded onto agarose electrophoresis gels or stored at 4°C / on ice for further use.
[0312] A 1% agarose gel was prepared for gel electrophoresis. For that, 1.5 g of all-purpose agarose was weighed into a 125 Erlenmeyer shake flask and filled with 150 ml of TAE buffer. The mixture was heated in a microwave oven until the agarose was completely dissolved. 0.5 μg / ml of ethidium bromide was added to the agarose solution. The gel was then poured into a mold. After the agarose was set, the mold was placed in the electrophoresis chamber and the chamber was filled with TAE buffer. The sample was then loaded. In the first pocket (from the left), the appropriate DNA molecular weight marker was loaded, followed by the sample. The gel was run for approximately 60 minutes at less than 130 V. After electrophoresis, the gel was removed from the chamber and analyzed with a UV-Imager.
[0313] The target band was excised and transferred to a 1.5 ml Eppendorf tube. Gel purification was performed using Qiagen's QIAquick Gel Extraction Kit according to the manufacturer's instructions. DNA fragments were stored at -20°C for further use.
[0314] The fragments for ligation were pipetted together in a molar ratio of vector to insert of 1:2, 1:3 or 1:5, depending on the length of the insert and vector fragments and their correlation to each other. If the fragment to be inserted into the vector was short, a ratio of 1:5 was used. If the insert was long, less amount of insert was used in correlation to the vector. An amount of 50 Ng of vector was used for each ligation and the specific amount of insert was calculated with the NEBioCalculator. For the ligations, the T4 DNA Ligation Kit from NEB was used. An example of a ligation mixture is shown in the table below. (Table) Ligation reaction mix TIFF2025517572000010.tif73143
[0315] All components were pipetted together on ice, starting with a mix of DNA and water, adding buffer, and then adding enzyme. The reaction was mixed gently by pipetting up and down, microcentrifuged briefly, and then incubated at room temperature for 10 minutes. After incubation, the T4 ligase was heat inactivated at 65°C for 10 minutes. The samples were cooled on ice. In the final step, 10 beta-competent E. coli cells were transformed with 2 μl of the ligated plasmid (see below).
[0316] c) Cloning by R site assembly: For assembly, all DNA fragments with R sites at both ends were pipetted on ice. When assembling more than four fragments, an equimolar ratio of all fragments (0.05 ng) was used as recommended by the manufacturer. One half of the reaction mix was performed with NEBuilder HiFi DNA Assembly Master Mix. The total reaction volume was 40 μl, which was reached by filling with PCR-clean water. An exemplary pipetting scheme is shown in the table below. (Table) Assembly reaction mix TIFF2025517572000011.tif94143
[0317] After setting up the reaction mix, the tubes were incubated in a thermocycler for 60 minutes at a constant temperature of 50° C. After successful assembly, 10 beta-competent E. coli were transformed with 2 μl of the assembled plasmid DNA (see below).
[0318] d) Transform 10 beta-competent E. coli cells: For transformation, 10 beta-competent E. coli cells were thawed on ice. Then, 2 μl of plasmid DNA was pipetted directly into the cell suspension. The tube was flicked and placed on ice for 30 min. The cells were then placed in a 42°C warm thermal block and heat-shocked for exactly 30 s. Immediately afterwards, the cells were cooled on ice for 2 min. 950 μl of NEB10 beta growth medium was added to the cell suspension. The cells were incubated at 37°C for 1 h with shaking. Then, 50–100 μl was pipetted onto pre-warmed (37°C) LB-Amp agar plates and spread with a disposable spatula. The plates were incubated overnight at 37°C. Only bacteria that have successfully integrated the plasmid and carry the resistance gene for ampicillin are able to grow on these plates. Single colonies were picked the next day and cultured in LB-Amp medium for subsequent plasmid preparation.
[0319] e) Bacterial culture: The culture of E. coli was performed in LB medium, short for Luria Bertani, and 1 ml / L of 100 mg / ml ampicillin was added to give an ampicillin concentration of 0.1 mg / ml. For the different plasmid preparations, the following volumes were inoculated with a single bacterial colony: (Table) E.coli culture amount TIFF2025517572000012.tif40143
[0320] For the Mini-Prep, 96-well, 2 ml deep well plates were filled with 1.5 ml LB-Amp medium per well. Colonies were picked and pushed into the medium with a toothpick. All colonies were picked and the plate was closed with an adhesive air-porous membrane. The plate was incubated in a 37°C incubator with a shaking speed of 200 rpm for 23 hours.
[0321] For Mini-Prep, 15 ml tubes (with ventilated lids) were filled with 3.6 ml of LB-Amp medium and inoculated evenly with bacterial colonies. The toothpicks were not removed but left in the tubes during incubation. Similar to the 96-well plates, the tubes were incubated at 37°C and 200 rpm for 23 hours.
[0322] For Maxi-Prep, 200 ml of LB-Amp medium was filled into an autoclaved glass 1 L Erlenmeyer flask and inoculated with 1 ml of a ~5-h old day culture of bacteria. The Erlenmeyer flask was closed with a paper stopper and incubated at 37°C and 200 rpm for 16 h.
[0323] f) Plasmid preparation: For Mini-Prep, 50 μl of bacterial suspension was transferred to a 1 ml deep-well plate. The bacterial cells were then centrifuged in the plate at 3000 rpm for 5 min at 4° C. The supernatant was removed and the plate with the bacterial pellet was placed in an EpMotion. After approximately 90 min, the procedure was performed and the eluted plasmid DNA could be removed from the EpMotion for further use.
[0324] For the Mini-Prep, the 15 ml tube was removed from the incubator and 3.6 ml of bacterial culture was divided into two 2 ml Eppendorf tubes. The tubes were centrifuged at 6,800 × g for 3 minutes at room temperature in a tabletop microcentrifuge. Mini-Prep was then performed using the Qiagen QIAprep Spin Miniprep Kit according to the manufacturer's instructions. Plasmid DNA concentration was measured with a Nanodrop.
[0325] Maxi-Prep was performed using the Macherey-Nagel NucleoBond® Xtra Maxi EF kit according to the manufacturer's instructions. DNA concentration was measured with a Nanodrop.
[0326] g) Ethanol Precipitation: The volume of DNA solution was mixed with 2.5 volumes of ethanol 100%. The mixture was incubated at -20°C for 10 minutes. The DNA was then centrifuged at 14,000 rpm at 4°C for 30 minutes. The supernatant was carefully removed and the pellet was washed with 70% (v / v) ethanol. Again, the tube was centrifuged at 14,000 rpm at 4°C for 5 minutes. The supernatant was carefully removed by pipetting and the pellet was dried. Once the ethanol was evaporated, an appropriate amount of endotoxin-free water was added. The DNA was allowed to redissolve in water overnight at 4°C. A small aliquot was taken and the DNA concentration was measured with a Nanodrop device.
[0327] h) Protein Analysis CE-SDS The purified samples were analyzed by capillary electrophoresis (CE) to determine product fragmentation and mismatching. CE on chip was performed with the LabChip GXII system (PerkinElmer) and the respective protein kits used according to the manufacturer's instructions. Samples were analyzed under reducing conditions.
[0328] SEC Purified samples were analyzed by size exclusion chromatography (SEC) to determine the content of aggregated, fragmented and mismatched species.
[0329] LC-MS peptide map procedure The expressed and protein A affinity chromatography purified antibodies were denatured and reduced with 6 M guanidine and 16 mM DTT at pH 7 for 1 h at 37 °C. The denatured and reduced antibody samples were carboxymethylated using 73 mM IAA-C12 (Fluka) and then buffered on a NAP-5 column (GE Healthcare Life Sciences) in 50 mM TRIS, 2 mM CaCl, pH 7.5. 2 and the antibodies were digested with trypsin (Promega) for 1 h at 37 °C. The digested samples were analyzed by LC-MS / MS. Liquid chromatography was performed on a Waters Acquity UPLC (Waters) equipped with a reversed-phase column Acquity CSH C18, 1.7 μm, 130, 2.1 × 150 mm (Waters). The aqueous mobile phase (mobile phase A) contained 0.1% (v / v) formic acid (FA) in HPLC-grade water. The organic mobile phase (mobile phase B) contained 0.1% (v / v) FA in acetonitrile. The gradient utilized in this experiment used a two-step linear gradient of mobile phase B from 1% to 30% from 2 to 33 min, then to 60% by 42 min, followed by an increase to 90% between 42.5 and 44.5 min, and back to 50% between 44.6 and 50 min, followed by re-equilibration with 1% eluent B from 50 to 56 min. The column temperature was 65°C.
[0330] The UPLC was coupled to an Orbitrap Fusion™ mass spectrometer (Thermo Scientific). MS1 spectra were acquired on the Orbitrap mass spectrometer at a resolution of 120000, and MS / MS data were acquired on the Orbitrap at a resolution of 50000. MS / MS events on the Orbitrap were repeated for the topN precursor ions, allowing for 4.5 seconds of dynamic exclusion.
[0331] The acquired MS data was processed by Byos™ and Byonic™ (Protein Metrics Inc.). Manual data interpretation was performed using Byologic (Protein Metrics Inc.). MS / MS Byos™ search settings included a precursor mass tolerance of 5 ppm and a fragment mass tolerance of 20 ppm. Enzyme specificity was set to fully specific, allowing one missed cleavage.
[0332] Example 2 - Plasmid Construction Composition of the expression cassette For expression of the antibody chains, transcription units containing the following functional elements were used: the immediate early enhancer and promoter from human cytomegalovirus, including intron A; - human heavy chain immunoglobulin 5' untranslated region (5'UTR), - mouse immunoglobulin heavy chain signal sequence, - nucleic acids encoding each antibody chain, - the bovine growth hormone polyadenylation sequence (BGH pA), and - Optionally, the human gastrin terminator (hGT). In addition to the expression unit / cassette containing the desired gene to be expressed, a basic / standard mammalian expression plasmid contains: - an origin of replication from the vector pUC18, allowing replication of this plasmid in E. coli, and -The beta-lactamase gene that confers ampicillin resistance to E. coli.
[0333] Front and back vector cloning To construct the two plasmid antibody constructs, the antibody HC and LC fragments were cloned into a front vector backbone containing L3 and LoxFas sequences, and a back vector containing LoxFas and 2L sequences and a Pac selection marker. The Cre recombinase plasmid pOG231 (Wong, ET, et al., Nucl. Acids Res. 33 (2005) e147; O'Gorman, S., et al., Proc. Natl. Acad. Sci. USA 94 (1997) 14602-14607) was used for all RMCE processes.
[0334] cDNA encoding each antibody chain was generated by gene synthesis (Geneart, Life Technologies Inc.). Gene synthesis and backbone vectors were digested with HindIII-HF and EcoRI-HF (NEB) for 1 h at 37°C and separated by agarose gel electrophoresis. Insert and backbone DNA fragments were excised from the agarose gel and extracted using a QIAquick Gel Extraction Kit (Qiagen). The purified insert and backbone fragments were ligated at a 3:1 insert / backbone ratio using a Rapid Ligation Kit (Roche) according to the manufacturer's protocol. The ligation approach was then transformed into competent E. coli DH5α by heat shock at 42°C for 30 s and incubated at 37°C for 1 h before plating on agar plates containing ampicillin for selection. Plates were incubated at 37°C overnight.
[0335] The next day, clones were picked and incubated overnight at 37°C with shaking for Mini or Maxi-Preparation, performed using 5075 (Eppendorf) or QIAprep Spin Mini-Prep Kit (Qiagen) / NucleoBond Xtra Maxi EF Kit (Macherey & Nagel), respectively. All constructs were sequenced to ensure the absence of any unwanted mutations (SequiServe GmbH).
[0336] In the second cloning step, the precloned vector was digested with KpnI-HF / SalI-HF and SalI-HF / MfeI-HF using the same conditions as for the first cloning. The TI backbone vector was digested with KpnI-HF and MfeI-HF. Isolation and extraction were performed as described above. Ligation of the purified insert and backbone was performed overnight at 4°C using T4 DNA ligase (NEB) according to the manufacture's protocol with an insert / insert / backbone ratio of 1:1:1, and inactivated at 65°C for 10 min. The following cloning steps were performed as described above.
[0337] The cloned plasmids were used for TI transfection and pool generation.
[0338] Example 3 - Culture, transfection, selection and single cell cloning TI host cells were grown in a proprietary DMEM / F12-based medium in disposable 125 ml vented shake flasks under standard humidified conditions (95% rH, 37°C, and 5% CO2) at a constant agitation speed of 150 rpm. Every 3–4 days, cells were seeded at a concentration of 3×10^5 cells / ml in chemically defined medium containing effective concentrations of selection marker 1 and selection marker 2. Culture density and viability were measured with a Cedex HiRes cell counter (F. Hoffmann-La Roche Ltd, Basel, Switzerland).
[0339] For stable transfection, equimolar amounts of front and back vectors were mixed. The total DNA used per transfection was 30 μg with a plasmid ratio of 2.5:2.5:1 (front-, back-, Cre plasmid).
[0340] Two days prior to transfection, TI host cells were seeded in fresh medium at a density of 4x10^5 cells / ml. Transfections were performed using a MaxCyte STX electroporation device (MaxCyte Inc., Gaithersburg) with an OC-400 electroporation cassette according to the manufacturer's protocol. 3x10^7 cells were transfected with a total of 30μg of nucleic acid, either 30μg of plasmid (2.5:2.5:1 molar ratio of front:back:Cre plasmid) or 5μg of Cre mRNA and 25μg of front and back vector mix. After transfection, cells were seeded in 30ml of medium without selection agent.
[0341] Five days after seeding, the cells were centrifuged and transferred to 80 mL of chemically defined medium containing effective concentrations of puromycin (selection agent 1) and 1-(2'-deoxy-2'-fluoro-1-beta-D-arabinofuranosyl-5-iodo)uracil (FIAU; selection agent 2) at a concentration of 6x10^5 cells / ml for selection of recombinant cells. The cells were incubated at 37°C, 150 rpm, 5% CO2, and 85% humidity from this day on, without splitting. The cell density and viability of the cultures were monitored regularly. When the viability of the cultures started to increase again, the concentrations of selection agents 1 and 2 were reduced to approximately half of the amounts used previously.
[0342] More specifically, to facilitate cell recovery, the selection pressure was reduced when the viability was higher than 40% and the viable cell density (VCD) was higher than 0.5x10^6 cells / mL. Therefore, 4x10^5 cells / mL were centrifuged and resuspended in 40 ml of selection medium II (chemically defined medium, 1 / 2 selection markers 1 and 2). The cells were incubated in the same conditions as before and were not split.
[0343] Ten days after the start of selection, the success of Cre-mediated cassette exchange was confirmed by flow cytometry measuring the expression of intracellular GFP and extracellular heterologous polypeptides bound to the cell surface. APC antibodies (allophycocyanin-labeled F(ab')2 fragment goat anti-human IgG) against the light and heavy chains of human antibodies were used for FACS staining. Flow cytometry was performed using a BD FACS Canto II flow cytometer (BD, Heidelberg, Germany). 10,000 events were measured per sample. Live cells were gated on a plot of forward scatter (FSC) versus side scatter (SSC). A live cell gate was defined by untransfected TI host cells and was applied to all samples using FlowJo 10.8.1 EN software (TreeStar, Olten, Switzerland). GFP fluorescence was quantified in the FITC channel (excitation at 488 nm, detection at 530 nm). The heterologous polypeptide was measured in the APC channel (excitation at 645 nm, detection at 660 nm). Parental CHO cells, i.e. the cells used to generate the TI host cells, were used as negative controls for GFP and heterologous polypeptide expression. After 14-21 days from the start of selection, the viability was above 90% and the selection was considered complete.
[0344] After selection, the pool of stably transfected cells can be subjected to single cell cloning by limiting dilution. For this purpose, cells are stained with Cell Tracker Green™ (Thermo Fisher Scientific, Waltham, Massachusetts) and plated at 0.6 cells / well in 384-well plates. For single cell cloning and all further culture steps, selection agent 2 is omitted from the medium. Wells containing only one cell are identified by bright field and fluorescence-based plate imaging. Only wells containing one cell are further considered. Approximately 3 weeks after plating, colonies are picked from confluent wells and further cultured in 96-well plates.
[0345] Example 4 - FACS Screening FACS analysis was performed to examine the transfection efficiency and RMCE efficiency of the transfection. 4x10^5 cells of the transfected approach were centrifuged (1200 rpm, 4 min) and washed twice with 1 mL PBS. After a washing step with PBS, the pellet was resuspended in 400 μL PBS and transferred to a FACS tube (Falcon® round bottom tube with cell strainer cap, Corning). Measurements were performed using FACS Canto II and data were analyzed using the software FlowJo.
[0346] Example 5 - Fed-batch culture Fed-batch production cultures were performed in shake flasks or Ambr 15 vessels (Sartorius Stedim) using a proprietary chemically defined medium. Cells were seeded at 2x10^6 cells / ml on day 0. Cultures were fed with a proprietary feed medium on days 3, 7, and 10. Viable cell counts (VCC) and percentage viability of cells in cultures were measured on days 0, 3, 7, 10, and 14 using a Cedex HiRes instrument (Roche Diagnostics GmbH, Mannheim, Germany). Concentrations of glucose, lactate, and product titer were measured on days 3, 5, 7, 10, 12, and 14 using a Cobas Analyzer (Roche Diagnostics GmbH, Mannheim, Germany). 14 days after the start of fed-batch cultures, supernatants were harvested by centrifugation (10 min, 1000 rpm and 10 min, 4000 rpm) and clarified by filtration (0.22 μm). Protein A affinity chromatography with UV detection was used to determine titers on day 14. Product quality was determined by Caliper's LabChip (Caliper Life Sciences).
[0347] Example 6 - RNP-Based CRISPR-Cas9 Gene Knockout Material / Source: -Geneious 2021.2.211.1.5 software for guide and primer design - Single clone based on CHO TI host cell line expressing antibody 1, 2 or 3 - Gibco TrueCut Cas9 Protein, A45220P, Thermo Fisher TrueCut™ Cas9 Protein v2 (Invitrogen™) - sgRNA (custom designed for the target gene, 3 nm chemically modified sgRNA, Synthego) - Chemically defined medium (2.5 μg / ml selective agent 2) -DPBS - Dulbecco's Phosphate Buffered Saline (Ca and Mg free) (Thermo Fisher) -Microplate 24 deep well plate (Agilent Technologies, Porvoir science), with cover (homemade) - Elongated RNase-, DNase-, and pyrogen-free filter tip for loading OC-100 cassettes (Biozyme) -Hera Safe Hood(Thermo Fisher) -Cedex HiRes analyzer (Roche Innovatis AG, Bielfeld, Germany) -Liconic Incubator Storex IC -HyClone electroporation buffer -MaxCyte OC-100 Cassette -MaxCyte STX Electroporation System
[0348] CRISPR-Cas9 RNP delivery RNPs were pre-assembled by mixing 30 pmol of Cas9 per target gene with 30 pmol of gRNA mix (each gRNA in equal proportions - see table below for exemplary gene-specific gRNA sequences) and incubated for 20 min at RT. Cells at a concentration between 2-4x10^6 cells / mL were centrifuged (3 min, 300g) and washed with 500 μL of PBS. Cells were then centrifuged again (3 min at 300g) and resuspended in 90 μL of HyClone electroporation buffer. The pre-incubated RNP mix was added to the cells and incubated for 5 min. The cell / RNP solution was then transferred to an OC-100 cuvette and electroporated using a MaxCyte electroporation system with the program "CHO2". Immediately after electroporation, the cell suspension was transferred to a 24-well (dwell) and incubated for 30 min at 37 °C. Fresh pre-warmed medium was added to obtain a final cell concentration of 1x10^6 cells / mL and incubated at 37°C with shaking at 350 rpm for cell growth. For genomic DNA preparation (day 6 or 8), QuickExtract kit (Lucigen) was added to the cells and served as PCR template. Specific gene amplicons were PCR amplified using the standard Q5 Hot Start Polymerase protocol (NEB) and gene-specific primers spanning the gRNA target sites (see sequence listing for sequences used). Respective amplicons were purified using QIAquick PCR purification kit (Qiagen) and analyzed by Sanger sequencing by Eurofins Genomics GmbH to verify gene inactivation by knockout.
[0349] Example 7 - Cell Culture Cells were thawed and cultivated in shake flasks for 3–4 weeks in pre-culture medium with included selection pressure. Cells were passaged every 3–4 days and grown in pre-culture medium to reach the volume required for inoculation into non-selective production medium. Cells were cultivated in Multitron Cell incubators (Infors AG) for the seed and inoculum train stages. Small-scale fermentations were carried out in a fully controlled robotic ambr250 fermentation system, respectively from Sartorius Stedim Biotech AG. All fermentations were controlled for constant dissolved oxygen (DO), temperature and pH. External pH and pCO2 measurements were monitored using a blood gas analyzer system (pHOx, IUL instruments) or the respective pH and DO amber analytical modules. Viable and total cell density, as well as viability, were assessed using a Cedex HiRes system (Roche). The concentrations of products, substrates, and metabolites / process parameters (glucose, glutamine, glutamate, lactate, ammonium, lactate dehydrogenase, potassium and sodium ions) in the cell culture supernatants were determined with the aid of a Cedex BioHT (Roche Innovatis GmbH, Bielfeld, Germany). Amino acids were analyzed with an LC-MS system (HILIC-QQQ MS) using an Agilent 1290 HPLC and Ultivo QQQ MS instrument and MassHunter software (Agilent) to observe possible amino acid and substrate limitation and by-product formation.
Claims
1. Modified CHO cells or HEK cells in which the transcriptional activity of the genes encoding procollagen-lysine, 2-oxoglutaric acid 5-dioxygenase 1 (PLOD1), procollagen-lysine, 2-oxoglutaric acid 5-dioxygenase 2 (PLOD2), and procollagen-lysine, 2-oxoglutaric acid 5-dioxygenase 3 (PLOD3) is permanently reduced.
2. Furthermore, the modified CHO cells or HEK cells according to claim 1, wherein the transcriptional activity of the gene encoding prolyl hydroxylase is permanently reduced.
3. The modified CHO cell or HEK cell according to claim 2, wherein the prolyl hydroxylase is prolyl 3-hydroxylase (P3H).
4. The modified CHO cell or HEK cell according to claim 3, wherein the prolyl hydroxylase is prolyl 3-hydroxylase 3 or prolyl 3-hydroxylase 4.
5. The modified CHO cell or HEK cell according to claim 1, wherein the modified CHO cell or HEK cell is a modified CHO K1 cell or a modified HEK293 cell.
6. Furthermore, the modified CHO cells or HEK cells according to claim 1, wherein the transcriptional activity of one or more or all of the MYC gene and / or BAX gene, and / or BAK gene, and / or ICAM-1 gene, and / or SIRT-1 gene is permanently reduced.
7. The modified CHO cell or HEK cell according to claim 1, wherein each modified CHO cell or HEK cell comprises one or more targeted integration landing sites each containing two or three recombinase recognition sequences, so that, in the case of two or more landing sites, the recombinase recognition sequences of each landing site are not compatible with one another.
8. The modified CHO cell or HEK cell according to claim 7, wherein one of the targeted integration landing sites comprises the recombinase recognition sequences 3L, LoxFas, and L2.
9. The modified CHO cell or HEK cell according to claim 1, wherein at least the reduction in the transcriptional activity of the gene encoding PLOD is brought about after the stable introduction of one or more nucleic acids encoding heterologous proteins.
10. A method for the recombinant production of heterologous proteins, a) A step of culturing modified CHO cells or HEK cells according to any one of claims 1 to 9, further comprising one or more nucleic acids encoding the heterologous protein, in a culture medium under conditions suitable for recombinant expression of the heterologous protein; b) A step of recovering the heterologous protein from the modified CHO cells or HEK cells or the culture medium, c) Optionally, a step of purifying the heterologous protein by one or more chromatography steps. The method comprising, wherein a heterologous protein is recombinantly produced.
11. In CHO cells or HEK cells, Permanent reduction of transcriptional activity of genes encoding procollagen-lysine, 2-oxoglutaric acid 5-dioxygenase 1 (PLOD1), procollagen-lysine, 2-oxoglutaric acid 5-dioxygenase 2 (PLOD2), and procollagen-lysine, 2-oxoglutaric acid 5-dioxygenase 3 (PLOD3) to reduce the amount of lysine hydroxylation in heterologous proteins recombinantly produced using the modified CHO cells or HEK cells. Use.
12. In CHO cells or HEK cells, Permanent reduction of transcriptional activity of genes encoding procollagen-lysine, 2-oxoglutaric acid 5-dioxygenase 1 (PLOD1), procollagen-lysine, 2-oxoglutaric acid 5-dioxygenase 2 (PLOD2), and procollagen-lysine, 2-oxoglutaric acid 5-dioxygenase 3 (PLOD3) to reduce the amount of hydroxylysine in heterologous proteins recombinantly produced using the modified CHO cells or HEK cells. Use.
13. In CHO cells or HEK cells, Permanent reduction of transcriptional activity of genes encoding procollagen-lysine, 2-oxoglutaric acid 5-dioxygenase 1 (PLOD1), procollagen-lysine, 2-oxoglutaric acid 5-dioxygenase 2 (PLOD2), and procollagen-lysine, 2-oxoglutaric acid 5-dioxygenase 3 (PLOD3) to increase biomass formation in cultures of the modified CHO cells or HEK cells. Use.
14. In CHO cells or HEK cells, Permanent reduction of transcriptional activity of genes encoding procollagen-lysine, 2-oxoglutaric acid 5-dioxygenase 1 (PLOD1), procollagen-lysine, 2-oxoglutaric acid 5-dioxygenase 2 (PLOD2), and procollagen-lysine, 2-oxoglutaric acid 5-dioxygenase 3 (PLOD3) to increase the titer of heterologous proteins recombinantly produced using the modified CHO cells or HEK cells. Use.
15. In CHO cells or HEK cells, Permanent reduction of transcriptional activity of genes encoding procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 (PLOD1), procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 (PLOD2), and procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3 (PLOD3) to reduce heterologous protein byproduct formation in cultures of modified CHO or HEK cells that recombinantly express heterologous proteins. Use.