Adapter ligation
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- EPIGENICA AB
- Filing Date
- 2023-05-25
- Publication Date
- 2026-04-13
AI Technical Summary
Existing adapter ligation methods for oligonucleotides to DNA fragments, particularly protein-bound DNA, suffer from low efficiency and contamination issues due to the small size differences between adapters and DNA fragments, leading to inefficient size selection and adapter dimer formation.
A novel fill-in adapter design that is not amplified under conditions where unligated adapters are amplified, featuring a single-stranded amplification sequence and a nicking site, allowing for selective amplification of adapters ligated to DNA fragments while discriminating between free and ligated adapters.
The fill-in adapter enhances ligation efficiency, reduces adapter contamination, and promotes higher library diversity in next-generation sequencing applications, enabling more effective mapping of transcription factor footprints with high resolution.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of ligation of oligonucleotides to DNA fragments. The ligation method of the present invention can be used, for example, to attach oligonucleotides including adapters, primer binding sites, promoters, tags, barcodes, or any combination of the above to DNA fragments.
Background Art
[0002] Chromatin immunoprecipitation (ChIP) coupled with next-generation sequencing (ChIP-seq) is used to map the genomic occupancy of chromatin factors and histone modifications. To achieve high-throughput processing capabilities and to reduce technical variability between samples, multiplexed ChIP-seq by sample pooling prior to immunoprecipitation has recently emerged. Multiplexing is only possible when individual samples are first barcoded with unique DNA sequences in the form of adapters and then combined with other samples. However, adapter ligation to nucleosomes or other protein-bound DNA fragments typically suffers from low efficiency and is therefore often circumvented with excessive amounts of adapter molecules. Due to the small size differences between adapters (about 60 bp), transcription factor-binding DNA (about 50 bp), and nucleosomal DNA (about 150 bp), excessive free adapters may not be efficiently removed by conventional bead- or column-based size selection purification methods. Also, adapter dimers or concatemers formed when ligating adapters at high concentrations are very difficult to remove. These intact adapter forms are inevitably carried over throughout the ChIP workflow and contaminate subsequent sequencing. Due to their small size and relatively high copy number, adapter contamination can significantly consume sequencing reagents and thus significantly reduce the number of usable reads per sequencing run.
Summary of the Invention
[0003] Thus, there is a need for an adapter that can be ligated to DNA fragments, particularly protein-binding DNA fragments, with enhanced efficiency or, alternatively, can attach to them, while at the same time fulfilling the need for an adapter that allows for discrimination between free adapters or adapter dimers and adapters attached to the DNA.
[0004] In particular, there is no need for a sample barcode adapter that has been redesigned to enable enhanced ligation.
[0005] This patent application describes a novel design of a nucleotide barcode adapter that is not amplified under conditions where ligated adapters are amplified in their unligated, free form. Such an adapter is referred to herein as a "fill-in adapter". In particular, the adapter function of the fill-in adapter of the present invention is restored only when the fill-in adapter is ligated to other DNA fragments, such as genomic DNA fragments or cell-free DNA. By reducing adapter contamination, the fill-in adapter of the present invention is not only cost-effective when used, for example, in next-generation sequencing. The fill-in adapter of the present invention also promotes higher library diversity due to efficient ligation. Also, since monomeric adapters alone are non-functional, a more aggressive size selection scheme for retaining small DNA fragments is enabled. This is advantageous, for example, for mapping transcription factor footprints with high resolution using ChIP.
[0006] The present invention provides an adapter designed such that free adapters or adapter dimers can be discriminated from adapters attached to DNA fragments by selective amplification.
[0007] In particular, in embodiments of the present invention relating to ligating a filling adapter to chromatin fragments, the design of the filling adapter allows only the adapter ligated to the target chromatin fragment to be carried over during selective amplification. The target chromatin fragment is generally broadly defined as a bound transcription factor, typically about 50 bp, or a nucleosome, typically about 150 bp. The chromatin fragment may be, for example, prepared cell chromatin or cell-free chromatin. Ligation of the adapter to the target DNA is also referred to herein as promiscuous ligation, in contrast to self-ligation of the adapter.
[0008] More specifically, the adapter of the present invention includes a single-stranded amplification sequence and a nicking site. The single-stranded amplification sequence is located at one end of the adapter and functions as an amplification start site only in the form of double-stranded DNA, i.e., after synthesis of the complementary strand. Within such a complementary strand, the nicking site is located near the other end of the adapter. When the adapter is incubated at a high temperature after nicking, the resulting short stretch of oligonucleotide between the nicking site and the adapter end dissociates from the adapter. Similarly, when an adapter dimer is formed, the adapter dimer dissociates when incubated at a high temperature after nicking.
[0009] In contrast, the adapter ligated to the DNA fragment does not dissociate. The strand-displacing polymerase can extend the nicked strand, thereby synthesizing the complementary strand of the amplification start site.
[0010] The concept of the present invention is shown in FIG. 2. FIG. 2A shows a specific example of the filling adapter of the present invention, and FIG. 2B shows the principle. The filling adapter according to the present invention consists of two strands. The upper strand consists of three regions represented as A, B, and C, and the lower strand consists of three regions represented as A', B', and C'. A includes a single-stranded region (A1), and is either capable of constructing a promoter when binding to its complementary sequence or a sequence complementary to the primer binding site. A1' is substantially non-complementary to A1. Importantly, A is designed such that transcription of the filling adapter can occur only when A is annealed to its complementary sequence. A' is exonuclease-resistant. C' contains ribonucleotides located at the 3'-end of the segment. Thus, the mismatch between A1 and A1' creates a fork DNA structure that is resistant to DNA ligation. More importantly, such a single-stranded A is not capable of driving / priming transcription. Another important feature of the filling adapter is the presence of ribonucleotides that create an RNA nicking site. The resulting 3'-hydroxyl group generated after RNA nicking at the nicking site allows subsequent primer extension by strand displacement polymerase, which synthesizes a new lower strand and ultimately reconstructs the promoter or primer binding functionality of A. Such a one-pot sequential action of RNA nicking followed by strand regeneration by polymerase is possible only when the primer site of the lower strand is stable. In fact, the ribonucleotides are strategically embedded near the 5'-end of the lower strand, such that after RNA nicking, the resulting "primer" in the lower strand is very unstable due to its short length, especially under thermal exposure. However, when the adapter is ligated to another DNA fragment, the length of the lower strand primer, and thus its melting temperature (Tm), increases dramatically.
[0011] Thus, the length of the lower strand primer, and thus the resulting thermal stability, provides an effective selection basis for specifically reconstructing the A promoter / primer binding site in the case of the troublesome ligation product while the free adapter monomer remains inactive.
[0012] Adapter dimers can present yet another problem. Due to the fork structure at the tail end of the stuffed adapter, this does not support ligation and, since A1’ is exonuclease resistant, this is resistant to conventional end repair enzymes. Thus, adapter dimers can only exist in a head-to-head configuration as shown in Figure 1B. In this case, RNase can create nicks in both the upper and lower strands, essentially cleaving the adapter dimer into monomeric form. When subjected to heat exposure, the adapter dimer dissociates into monomeric form. This is also shown in Figure 1B.
[0013] An example of the concept of the present invention is shown in FIG. 2. In the example of FIG. 2, the fill adapter consists of a T7 promoter, a partial SBS primer binding site enabling sequencing on the Illumina platform, a randomized 8-nucleotide unique molecular identifier (UMI), followed by an 8-nucleotide sample-specific barcode. The T7 promoter is used for in vitro transcription (IVT) of any downstream DNA fragment. The upper strand of the T7 promoter is designed such that most of it is single-stranded by default, and the lower strand is replaced by a stretch of 7 consecutive cytosines interconnected by exonuclease-resistant phosphorothioate bonds. Thus, mismatches create a fork DNA structure that is resistant to DNA ligation. More importantly, such a single-stranded T7 promoter is not capable of driving IVT by T7 RNA polymerase. Another important feature of the fill adapter in this example is that the 5th nucleotide within the sample barcode (counted from the ligation end of the adapter) is RNA. Embedding a single ribonucleotide within a DNA duplex essentially creates a recognition site for RNase HII that specifically nicks on the 5' side with respect to the ribonucleotide. The resulting 3' hydroxyl group at the nicking site enables subsequent primer extension by strand-displacing Bst polymerase, which synthesizes a new lower strand and ultimately reconstructs a functional double-stranded T7 promoter. Such a one-pot sequential action of ribonucleotide nicking by RNase HII, followed by strand regeneration by Bst polymerase, is only possible if the priming site of the lower strand is stable. In fact, the ribonucleotide is strategically embedded at the 5th position of the adapter, such that after RNase HII nicking, the resulting 4-nucleotide "primer" in the lower strand becomes very unstable, especially under thermal exposure. However, when the adapter is ligated to a DNA fragment, such as a genomic DNA fragment or cell-free DNA, the length of the lower strand primer, and thus its melting temperature (Tm), increases dramatically.For example, adapter ligation to a short 30 bp transcription factor binding site having a putative 50% GC content increases the lower strand primer Tm to above 70°C.
[0014] Thus, the length of the lower strand primer, and thus the resulting thermal stability, provides an effective selection basis for specifically reconstructing the T7 promoter of the troublesome ligation product such that the free adapter monomer remains inactive for T7 transcription and is thus not carried over into downstream RNA adapter ligation and cDNA conversion. Adapter dimers can present yet another problem. Due to the fork structure at the tail end of the adapter, this does not support ligation. Due to the phosphorothioate bond of the mismatched poly C sequence, the fork structure is exonuclease resistant and thus resistant to conventional end repair enzymes. Thus, adapter dimers can only exist in a head-to-head configuration. In this case, as shown in Figure 2B, RNase HII can act as a restriction enzyme, nicking both the upper and lower strands and essentially acting by cleaving the adapter dimer into monomeric form.
[0015] In the present invention, 5’-A-B-C-3’ 3’-A’-B’-C’-5’ a partially double-stranded adapter comprising or consisting of an oligonucleotide of the general structure of a) A is the upper strand of a DNA amplification sequence, and A consists of 5’-A1-A2-3’, b) A’ consists of 3’-A1’-A2’-5’, c) A1’ is a nucleotide sequence that is substantially non-complementary to A1, has a 3’ end that is exonuclease resistant and / or contains a primer extension blocking group, d) either A2 and A2’ are absent or A2 and A2’ are nucleotide sequences that are substantially complementary to each other, e) B and B’ are sequences in the range of 5 to 100 deoxyribonucleotides that are substantially complementary to each other, and f) C and C’ are sequences of up to 10 deoxyribonucleotides that are complementary to each other, and C’ consists of a deoxynucleotide and one ribonucleotide, and the ribonucleotide is located at the 3’ end of C’, and a partially double-stranded adapter is provided.
[0016] A method for attaching an adapter to a DNA fragment, comprising: a) providing at least one adapter according to any one of the preceding items; b) providing a sample containing the DNA fragment; c) attaching the adapter to the DNA fragment in the sample; d) incubating the sample with an RNA nicking enzyme under conditions that allow the activity of the enzyme; e) incubating the sample at a temperature higher than the Tm of i) and ii), where i) and ii) are as follows: i) 5’-C-3’ 3’-C’-5’, ii) 5’-C-C’-3’ 3’-C’-C-5’; f) incubating the sample with a strand-displacing DNA polymerase. A method is further provided herein.
[0017] Also provided herein is a method for amplifying a DNA fragment, the method comprising the following steps: a) preparing a DNA fragment attached to an adapter by the method presented herein; and b) amplifying the DNA fragment attached to the adapter in vitro, Optionally, the amplification is carried out by RNA polymerase-driven transcription, for example, the RNA polymerase is T7 RNA polymerase. A method is provided herein. BRIEF DESCRIPTION OF THE DRAWINGS
[0018]
Figure 1
[0019]
Figure 2A
[0020]
Figure 2B
[0021]
Figure 3
[0022]
Figure 4
[0023]
Figure 5
Figure 6
Mode for Carrying Out the Invention
[0024] [Definitions] As used herein, the term "adapter" refers to an oligonucleotide that is double-stranded at one end and thus can be ligated to a DNA fragment.
[0025] As used herein, the term "amplification" in relation to a nucleic acid refers to any in vitro method for increasing the number of copies of a nucleotide sequence using a polymerase. Amplification reactions include, for example, polymerase chain reaction (PCR), transcription, reverse transcription, replication, or combinations thereof. Preferably, "DNA amplification" includes PCR.
[0026] As used herein, two nucleotide sequences are considered to be "complementary" to each other when the nucleotide sequences can hybridize to each other via the formation of Watson-Crick base pairs, such that all of the nucleotides of one sequence are base-paired with all of the nucleotides of the second sequence.
[0027] As used herein, the term "DNA amplification sequence" refers to a sequence that promotes the transcription or replication of DNA, where the transcription or replication is promoted only when the lower strand of the DNA amplification sequence is available. In particular, a DNA amplification sequence may include or consist of a promoter or a primer binding site.
[0028] As used herein, the term "endonuclease" refers to an enzyme that cleaves a nucleic acid molecule at an internal position.
[0029] As used herein, the term "exonuclease" means a nuclease enzyme that hydrolyzes nucleotides from the ends of a DNA strand.
[0030] As used herein, the term "melting temperature" in relation to a nucleic acid is the temperature at which 50% of two substantially complementary nucleotide sequences form a stable double helix and the other 50% are separated into single-stranded molecules. The melting temperature is also referred to as Tm. Preferably, as used herein, Tm is calculated using the nearest neighbor method based on the method described in Breslauer et al., Proc. Natl. Acad. Sci. 83, 3746-50 (1986), using a salt concentration parameter of 50 mM and a nucleotide sequence concentration of 900 nM. For example, the method is implemented by the software "Multiple Primer Analyzer" from Life Technologies / Thermo Fisher Scientific Inc.
[0031] As used herein, the term "nicking enzyme" refers to an enzyme that cleaves only one strand of a double-stranded nucleic acid at a specified recognition site. Preferably, the nicking enzyme is RNase HII that cleaves 5' with respect to a ribonucleotide within the context of double-stranded DNA.
[0032] As used herein, two nucleotide sequences are considered "non-complementary" when they are not capable of hybridizing to each other, preferably under standard conditions for hybridization, for example, in a storage buffer having 10 mM Tris and 1 mM EDTA, at a pH of 8.0, and at a temperature 5°C lower than the melting temperature of one of the nucleotide sequences having a complementary sequence that forms Watson-Crick base pairs at all positions. For example, two nucleotide sequences are considered "non-complementary" to each other when, when the sequences are aligned with each other, at most 30%, preferably at most 20%, more preferably at most 10% of the nucleotides of one sequence are capable of forming Watson-Crick base pairs with the nucleotides of the second sequence.
[0033] As used herein, the term "sequence identity" describes the relatedness between two amino acid sequences or two nucleotide sequences, i.e., between a candidate sequence and a reference sequence, based on their pairwise alignment. For the purposes of the present invention, the sequence identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48:443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16:276-277), preferably version 5.0.0 or later (available at https: / / www.ebi.ac.uk / Tools / psa / emboss_needle / ). The parameters used are a gap open penalty of 10, a gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. The output of Needle labeled "longest identity" (obtained using the -nobrief option) is used as the percent identity and is calculated as follows. (Number of identical residues × 100) / (Length of alignment - Total number of gaps in alignment)
[0034] The Needleman-Wunsch algorithm is also used to determine whether a given amino acid in a sequence other than the reference sequence corresponds to a given position in the reference sequence.
[0035] As used herein, "strand-displacing polymerase" refers to a nucleic acid polymerase that has strand-displacement activity in addition to its nucleic acid synthesis activity. That is, a strand-displacing nucleic acid polymerase can continue nucleic acid synthesis based on the sequence of the template strand (i.e., the lead of the template strand) while displacing the complementary strand annealed to the nucleic acid template strand.
[0036] As used herein, two nucleotide sequences are considered to be "substantially complementary" to each other when the nucleotide sequences can hybridize to each other, preferably under standard conditions for hybridization, such as in a storage buffer having 10 mM Tris and 1 mM EDTA, at a pH of 8.0, and at a temperature 5°C lower than the melting temperature of one of the nucleotide sequences having a complementary sequence that forms Watson-Crick base pairs at all positions. For example, two nucleotide sequences are considered to be "substantially complementary" to each other when, when the sequences hybridize to each other, at least 80%, preferably at least 90% of the nucleotides of one sequence can form Watson-Crick base pairs with the nucleotides of the second sequence.
[0037] As used herein, the term "upper strand" refers to the sense strand of DNA, and the term "lower strand" refers to the antisense strand.
[0038] Filling adapter The present invention relates to an adapter, also referred to herein as a "filling" adapter. Generally, a filling adapter is at least partially double-stranded oligonucleotide of a known sequence. However, a filling adapter can also contain stretches of unknown or random sequences, such as UMI sequences.
[0039] The filling adapter can be ligated to a DNA fragment, and depending on the exact sequence of the filling adapter, the ligation of the adapter can enable the generation of a product ready for amplification of the target DNA fragment. Preferably, the adapter of the present invention is typically a partially double-stranded oligonucleotide that conforms to a fork-like configuration. Most of the adapter is typically double-stranded, but one end is non-complementary, and thus the adapter contains a single strand at one of the ends. The upper strand contains or consists of three regions represented herein as A, B, and C, and the lower strand contains or consists of three regions represented herein as A', B', and C'. Each of A, B, C, A', B', and C' consists of a nucleotide sequence. Each of A, B, C, A', B', and C' will be described in more detail below, and the filling adapter of the present invention may include any of A, B, C, A', B', and C' described in the following sections herein.
[0040] Preferably, the filling adapter of the present invention is 5'-A-B-C-3' 3'-A'-B'-C'-5' a partially double-stranded adapter containing or consisting of an oligonucleotide of the general structure of a) A is the upper strand of the DNA amplification sequence, and A consists of 5'-A1-A2-3', b) A' consists of 3'-A1'-A2'-5', c) A1' is a nucleotide sequence that is substantially non-complementary to A1, has a 3'-end that is exonuclease-resistant, and / or contains a primer extension blocking group, d) either A2 and A2' are absent, or A2 and A2' are a nucleotide sequence that is substantially complementary to each other, e) B and B' are sequences in the range of 5 to 100 deoxyribonucleotides that are substantially complementary to each other, and f) C and C’ are sequences of up to 10 deoxyribonucleotides that are complementary to each other, and C’ consists of a deoxynucleotide and one ribonucleotide, and the ribonucleotide is located at the 3’ end of C’, and it is a partially double-stranded adapter.
[0041] Preferably, the filling adapter of the present invention is 5’-A-B-C-3’ 3’-A’-B’-C’-P-5’ a partially double-stranded adapter that includes or consists of an oligonucleotide having the general structure of a) A is the upper strand of a DNA amplification sequence, and A consists of 5’-A1-A2-3’, b) A’ consists of 3’-A1’-A2’-5’, c) A1’ is a sequence of nucleotides that is substantially non-complementary to A1, the 3’ end is exonuclease-resistant, and / or contains a primer extension blocking group, d) Either A2 and A2’ do not exist, or A2 and A2’ are sequences of nucleotides that are substantially complementary to each other, e) B and B’ are sequences in the range of 5 to 100 deoxyribonucleotides that are substantially complementary to each other, f) C and C’ are sequences of up to 10 deoxyribonucleotides that are complementary to each other, C’ consists of a deoxynucleotide and one ribonucleotide, the ribonucleotide is located at the 3’ end of C’, and g) P is a phosphate, and it is a partially double-stranded adapter.
[0042] Except for the ribonucleotide contained in C’, most of the other nucleotides are preferably deoxyribonucleotides. Therefore, preferably, all nucleotides of A, A2’, B, and B’ are deoxyribonucleotides. More preferably, the adapter does not contain any ribonucleotides except for the ribonucleotide contained in C’.
[0043] [Filling Adapter: A] The following section describes Adapter A of the present disclosure.
[0044] A is the upper strand of the DNA amplification sequence, and A consists of 5'-A1-A2-3'.
[0045] In some embodiments, A2 is absent, and in this case, A consists of A1.
[0046] The fact that A is the upper strand of the DNA amplification sequence is a remarkable feature of the present invention. The DNA amplification sequence can be any sequence that promotes DNA transcription or replication when the lower strand of the DNA amplification sequence is available. The filling adapter contains A but does not contain a sequence complementary to A1. Therefore, the DNA amplification sequence of the free filling adapter is non-functional and does not promote transcription / replication. However, when the lower strand of the DNA amplification sequence is reconstructed, the DNA amplification sequence promotes transcription / replication. As described elsewhere herein, when the filling adapter is ligated to a DNA fragment and the adapter is nicked with a nicking enzyme, the lower strand of the filling adapter can be generated using the nicked 3'-end as a priming site with the assistance of a strand-displacing polymerase, thereby reconstructing the active DNA amplification sequence.
[0047] Therefore, the DNA amplification sequence can be any sequence that promotes transcription or replication only when the lower strand is reconstructed.
[0048] In some embodiments, the DNA amplification sequence is a promoter sequence for RNA polymerase. In such embodiments, A is recognized and bound by RNA polymerase when in double-stranded DNA form having its complementary sequence.
[0049] In a preferred embodiment, A comprises or consists of a T7 promoter or an SP6 promoter. Thus, in such an embodiment, A is recognized by T7 RNA polymerase or SP6 RNA polymerase when bound to its complementary sequence. The T7 promoter preferably comprises or consists of the sequence of SEQ ID NO: 102, or a sequence sharing at least 90%, preferably at least 95% sequence identity therewith.
[0050] In one embodiment of the present disclosure, A contains a sequence complementary to the primer binding site. Thus, both the adapter and any DNA fragment ligated thereto can be amplified using a primer that binds to the primer binding site. The primer binding site can be any sequence complementary to the primer. Preferably, the primer and the primer binding site have no tendency to form secondary structures.
[0051] A can be of any suitable length. When A comprises or consists of a promoter sequence, A should be at least the length of the promoter, and frequently, A is exactly the length of the promoter. When A is a sequence complementary to the primer binding site, A is preferably of a length sufficient to allow hybridization of the primer to the primer binding site with high affinity.
[0052] Generally, A consists of a nucleotide sequence in the range of 10 to 100 nucleotides, such as in the range of 15 to 50 nucleotides, such as in the range of 15 to 40 nucleotides. Preferably, the nucleotides are deoxyribonucleotides. Thus, preferably, A consists of a sequence of deoxyribonucleotides in the range of 10 to 100 deoxyribonucleotides, such as in the range of 15 to 50 deoxyribonucleotides, such as in the range of 15 to 40 deoxyribonucleotides.
[0053] [Filling adapter: A'] The following section describes A’ of the adapter of the present disclosure. A’ is a part of the lower strand of the adapter and is thus described herein in the 3’→5’ direction.
[0054] A’ consists of 3’-A1’-A2’-5’.
[0055] In some embodiments, A2’ is absent, in which case A’ consists of A1’. However, when A2 is present, A2’ is also present, and when A2 is absent, A2’ is also absent.
[0056] When A2 and A2’ are present, A2 and A2’ are nucleotide sequences that are substantially complementary to each other. The lengths of A2 and A2’ are not critical, but typically, A2 and A2’ are of the same length and are relatively short, for example, less than 10 nucleotides, for example, less than 5 nucleotides. Preferably, the nucleotides are deoxyribonucleotides. Thus, A2 and A2’ may comprise less than 10 deoxyribonucleotides, for example, less than 5 deoxyribonucleotides.
[0057] A1’ is a nucleotide sequence that is non-complementary to A1. Thus, A1 does not hybridize to A1’, which results in a fork-like structure at one end of the filling adapter. The 3’ end of A1’ is exonuclease-resistant and / or contains a primer extension blocking group. In this manner, the 3’ end of A’ cannot function as a priming site for extension. Then, DNA amplification occurs when the complementarity of A is restored in double-stranded DNA form.
[0058] Preferably, A1’ is exonuclease-resistant. In this manner, A1’ is not removed by exonuclease. If A1’ is removed by exonuclease, this may create a priming site for polymerase and allow extension even when the adapter is not ligated to the DNA fragment.
[0059] The 3'-end of A1' can be exonuclease-resistant in any manner known to those skilled in the art. In one embodiment of the present disclosure, A1' comprises, or consists of, a sequence of nucleotides connected via exonuclease-resistant phosphorothioate linkages. For example, A1' may comprise, or consist of, a sequence in the range of 3 to 35, such as 5 to 15, consecutive nucleotides connected via exonuclease-resistant phosphorothioate linkages. The nucleotide can be any nucleotide, but in one embodiment, the nucleotide is deoxycytidine monophosphate.
[0060] Thus, in one embodiment of the present disclosure, A1' comprises, or consists of, a sequence of 3 to 35 consecutive cytosines connected via exonuclease-resistant phosphorothioate linkages.
[0061] A1' may also contain one or more nucleotide analogs or modifications that are exonuclease-resistant, and the nucleotide analogs or modifications can be selected from the group consisting of, for example, phosphoramidite C3 spacers, inverted deoxythymidine bases, 2'-O-methyl, and 2'-O-methoxyethyl nucleosides.
[0062] Also included within the present invention is that the 3'-end of A1' may contain a nucleotide modified to block extension. In this manner, the 3'-end of the lower strand of the adapter does not extend when the adapter is not ligated to a DNA fragment. The modification for blocking extension can be any modification known to those skilled in the art for blocking primer extension.
[0063] In one embodiment of the present disclosure, the 3'-end of A1' contains a dideoxynucleotide.
[0064] In one embodiment of the present disclosure, the 3'-end of A1' contains a phosphoramidite C3 spacer.
[0065] In addition, A1' can contain sequences that prevent RNA polymerase association and function in other ways. For example, A1' can contain sequences that support the formation of hairpins, loops, or other secondary structures.
[0066] A' can be of any desired length. The length of A' does not depend on the length of A. Thus, A' can be either shorter than A, longer than A, or the same length as A. Similarly, A1 and A1' can be of the same or different lengths.
[0067] In some embodiments of the present disclosure, A' is a nucleotide sequence in the range of 2 to 100 nucleotides, for example, in the range of 2 to 35 nucleotides, for example, in the range of 2 to 10 nucleotides. Preferably, none of the nucleotides are ribonucleotides.
[0068] [Filling adapter: -B-C- and -B'-C'-] The filling adapter of the present invention includes the structure -B-C- in the upper strand and the structure -B'-C'- in the lower strand. The structure can also be represented as follows. 5'-B-C-3' 3'-B'-C'-5'
[0069] B and B' are nucleotide sequences that are substantially complementary to each other. B and B' are typically of the same length, but the lengths of B and B' are not very important and can be adjusted according to the requirements of adapter designation. For example, B and / or B' can contain one or more functionalities, such as primer binding sites, barcodes, and / or UMIs. Typically, B and B' can be in the length range of 5 to 100 nucleotides. The nucleotides can preferably be deoxyribonucleotides.
[0070] C and C’ are also nucleotide sequences that are substantially complementary to each other. C and C’ are preferably complementary to each other. C and C’ typically have the same length and C and C’ are generally relatively short. Preferably, C and C’ are sequences of up to 10 nucleotides.
[0071] C’ consists of a deoxynucleotide and one ribonucleotide, and the ribonucleotide is located at the 3’ end of C’. The single ribonucleotide embedded within the sequence of C’ creates a recognition site for an RNA nicking enzyme, such as RNase HII, that specifically nicks 5’ to the ribonucleotide.
[0072] As described above, B and / or B’ may include one or more functionalities. Also, it is within the present invention that -B-C- together and / or -B’-C’- together include one or more functionalities. Considering the relatively short lengths of C and C’, typically most of the functionality is included within B and / or B’.
[0073] For example, -B-C- and / or -B’-C’- may include one or more functionalities, such as a primer binding site, barcode, and / or UMI.
[0074] In one embodiment of the present disclosure, -B-C- and / or -B’-C’- contain a primer binding site. The primer binding site can be any sequence that is complementary to a primer. Preferably, the primer and the primer binding site have no tendency to form secondary structures. In some embodiments, ligation of an adapter to a DNA fragment can facilitate subsequent handling of the DNA fragment. Thus, the primer binding site can be any primer binding site that is useful for subsequent handling of the DNA fragment.
[0075] Many platforms for next-generation sequencing involve the use of platform-specific primers. When DNA fragments are analyzed by next-generation sequencing, the fill adapters, particularly -B-C- or -B'-C'- may contain primer binding sites for the platform-specific primers. For example, -B-C- and / or -B'-C'- may contain partial or full-length SBS3 primer binding sites.
[0076] Also included within the present invention is that -B-C- and / or -C'-B'- may contain a random DNA sequence that acts as a unique molecular identifier, also referred to herein as a UMI sequence. Thus, in principle, each UMI sequence is different. The UMI may comprise a random sequence in the range of 4 to 20 nucleotides, for example, in the range of 6 to 16 nucleotides. Preferably, each UMI consists of a random sequence in the range of 5 to 15 nucleotides.
[0077] Also included within the present invention is that -B-C- and / or -C'-B'- may contain a barcode sequence. The barcode sequence is a unique sequence contained within all adapters ligated to a designated selection of DNA fragments. The barcode sequence is particularly useful for multiplexing. Thus, different barcode sequences can be used, for example, to label DNA fragments from different samples, such that all adapters ligated to the DNA fragments of one sample contain the same barcode sequence, and all adapters ligated to the DNA fragments of another sample contain different barcode sequences. In this manner, each DNA fragment ligated to an adapter can be assigned to a designated sample, even when DNA fragments from different samples are mixed. Each barcode may comprise a sequence in the range of 4 to 20 nucleotides, for example, in the range of 6 to 16 nucleotides. Preferably, each barcode consists of a sequence in the range of 5 to 15 nucleotides.
[0078] In one embodiment of the present disclosure, -B-C- and / or -B'-C'- additionally contain one or more random sequences, for example, random sequences in the range of 5 to 15 nucleotides.
[0079] As described above, the ribonucleotide is located at the 3'-end of C'. Thus, upon nicking with an RNA nicking enzyme, C' is released from the remainder of the lower strand of the fill adapter. Upon heat treatment, C' dissociates from the adapter when the fill adapter is not ligated to the DNA fragment.
[0080] Therefore, C' (and thus also C) is preferably short enough to be easily dissociated from the remainder of the fill adapter upon RNase HII nicking and heat treatment. Thus, preferably, C' is at most 10 nucleotides. Also, C' is preferably at least 2 nucleotides in length. Thus, C' can be 2 to 10 nucleotides in length, preferably C' is 3 to 9 nucleotides in length, for example, 4 to 9 nucleotides in length, preferably 5 to 8 nucleotides in length.
[0081] [Method] The present disclosure also provides a method of attaching an adapter (e.g., any of the fill adapters described herein) to a DNA fragment, comprising: a) providing at least one fill adapter according to the present invention; b) providing a sample containing the DNA fragment; c) attaching the adapter to the DNA fragment in the sample; d) incubating the sample with an RNA nicking enzyme under conditions that allow the activity of the enzyme; e) incubating the sample at a temperature higher than the Tm of i) and ii), where i) and ii) are: i) 5'-C-3' 3'-C'-5', ii) 5'-C-C'-3' 3'-C'-C-5'. f) incubating the sample with a strand-displacing DNA polymerase, to provide a method.
[0082] The step of incubating the sample at a temperature higher than the Tm of i) and ii), and the step of incubating the sample with a strand-displacing DNA polymerase can be performed either sequentially or simultaneously.
[0083] In one embodiment of the present disclosure, the sample is incubated with a strand-displacing DNA polymerase at a temperature higher than the Tm of i) and ii).
[0084] In one embodiment of the present disclosure, the method further includes a step of cold shock, in which a sample containing a DNA fragment ligated to an adapter is rapidly transferred to a low temperature after RNase HII nicking and heat treatment. The cold shock usually includes incubation at a temperature in the range of 0°C to 4°C, and the step is performed immediately after step e).
[0085] In one embodiment of the present disclosure, the RNA nicking enzyme is RNase HII. RNase HII is an endoribonuclease that specifically cleaves one strand at the 5'-end with respect to ribonucleotides within the context of double-stranded DNA.
[0086] Preferably, the RNA nicking enzyme is RNase HII or a functional homolog thereof that shares at least 70%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, such as 100% sequence identity with any one of the RNase HIIs of SEQ ID NOs: 1-42 and SEQ ID NOs: 103-122. In particular, it is preferred that the functional homolog of RNase HII includes all the amino acids conserved within RNase HII, such as all the amino acids labeled by the black boxes in FIG. 5.
[0087] The step of incubating the sample with the RNA nicking enzyme is performed under conditions that allow the activity of the enzyme. One of ordinary skill in the art can determine the suitable conditions for the RNA nicking enzyme of their choice.
[0088] However, typically, step d) is performed at a temperature in the range of 20 °C to 80 °C.
[0089] The method also includes a heat treatment step, which is performed after RNA nicking to allow C’ to dissociate from the unligated filler adapter and / or to allow -C’-C- to dissociate from either adapter dimer. Thus, the heat treatment step should be performed at a temperature higher than the Tm of i) and ii), where i) and ii) are as follows: i) 5’-C-3’ 3’-C’-5’, ii) 5’-C-C’-3’ 3’-C’-C-5’.
[0090] Typically, step e) is performed at a temperature in the range of 40 °C to 80 °C, such as in the range of 45 °C to 70 °C, such as in the range of 50 °C to 70 °C.
[0091] The method of the present invention also includes a step of incubating the sample with a strand-displacing DNA polymerase.
[0092] The strand-displacing DNA polymerase can be any DNA polymerase having the ability to displace downstream DNA encountered during synthesis with newly synthesized DNA. A plurality of strand-displacing DNA polymerases are commercially available, and any one of these can be used with the present invention. In one embodiment, the strand-displacing DNA polymerase is Bst polymerase.
[0093] Thus, the strand-displacing DNA polymerase can be any DNA polymerase that shares at least 70%, for example, at least 80%, for example, at least 85%, for example, at least 90%, for example, at least 95%, for example, 100% sequence identity with the Bst DNA polymerase of SEQ ID NO: 123.
[0094] In one embodiment of the present disclosure, the strand-displacing DNA polymerase is a Bst polymerase comprising a large fragment, wherein the large fragment comprises or consists of a sequence that shares at least 70%, for example, at least 80%, for example, at least 85%, for example, at least 90%, for example, at least 95%, for example, 100% sequence identity with the large fragment of the Bst polymerase of SEQ ID NO: 124.
[0095] In one embodiment of the present disclosure, the strand-displacing DNA polymerase is a DNA polymerase that shares at least 70%, for example, at least 80%, for example, at least 85%, for example, at least 90%, for example, at least 95%, for example, 100% sequence identity with the phi 29 DNA polymerase of SEQ ID NO: 125 or the Taq DNA polymerase of SEQ ID NO: 126. Incubation with the strand-displacing DNA polymerase is carried out under conditions that allow the activity of the enzyme. One of ordinary skill in the art can determine suitable conditions for the DNA polymerase of their choice. Typically, step f) is carried out at a temperature in the range of 20 to 80 °C, for example, in the range of 25 to 75 °C, for example, 20 to 50 °C, for example, in the range of 25 to 37 °C.
[0096] [DNA fragment] The filling adapter of the present invention is useful for ligation to any DNA fragment.
[0097] In one embodiment of the present disclosure, the DNA fragment consists of or comprises genomic DNA (gDNA), for example, gDNA fragments.
[0098] In one embodiment of the present disclosure, the DNA fragment is a protein-binding DNA fragment.
[0099] In a preferred embodiment, the DNA fragment is a gDNA fragment bound to a protein. Thus, the fragment may comprise, or consist of, chromatin proteins such as nucleosomes and / or other genomic DNA fragments bound to transcription factors, for example. Preferably, most of the gDNA fragment is in the form of nucleosomes, for example, mononucleosomes.
[0100] In another embodiment of the present disclosure, the DNA fragment is naked genomic DNA.
[0101] The gDNA can be derived from any organism of interest, and thus the genomic DNA can be, for example, a eukaryote or a prokaryote.
[0102] In some embodiments, the DNA fragment comprises, or consists of, cell-free DNA. Cell-free DNA is typically already fragmented, and thus frequently no further fragmentation of the cell-free DNA is required. In some embodiments, the cell-free DNA is bound to a protein. Preferably, the cell-free DNA is in the form of chromatin fragments. For example, the cell-free DNA can mainly be in the form of nucleosomes. In some embodiments, the cell-free DNA is in the form of naked DNA, i.e., not bound to a protein.
[0103] As used herein, the term "cell-free DNA" refers to DNA molecules or sets of DNA molecules that freely circulate in a biological sample, such as blood. Cell-free DNA is also known as "circulating DNA". Cell-free DNA is extracellular and this term is used in contrast to intracellular DNA, which can be found, for example, within the cell nucleus or mitochondria.
[0104] In one embodiment of the present disclosure, the DNA fragment is selected from the group consisting of cDNA, DNA produced by whole genome amplification, primer extension products containing at least one double-stranded end, and PCR amplicons.
[0105] In one embodiment of the present disclosure, the DNA fragment is obtained by isolating chromatin from a cell sample and fragmenting the chromatin. Alternatively, the DNA fragment is obtained by lysing the cells of the cell sample and fragmenting the chromatin. The fragmentation can be performed by any useful means. For example, the DNA fragment may be prepared by mechanical shearing and / or enzymatic digestion, spraying, sonication, point sink shearing, passage through a pressure cell, use of a French pressure cell, transposon-mediated fragmentation, and / or digestion with a restriction enzyme and / or endonuclease. In one embodiment, genomic DNA is fragmented by MNase digestion. MNase digestion mainly results in fragmentation into mononucleosomes and / or dinucleosomes.
[0106] The fragmentation is preferably performed such that the fragmented DNA contains or consists essentially of chromatin fragments. The DNA fragment can have any desired size, but the method of the present invention is particularly useful for ligating adapters to short DNA fragments. Frequently, the DNA fragment contains, on average, more than 10 base pairs, such as more than 15 base pairs, such as more than 150 base pairs, such as in the range of 10 to 500 base pairs, such as in the range of 20 to 200 base pairs. Chromatin fragments can typically include transcription factor binding fragments that are less than 150 bp, such as approximately 50 bp, and / or mononucleosomes that are typically 150 to 230 bp, such as approximately 150 bp, and / or dinucleosomes that are more than 300 bp, such as approximately 300 bp.
[0107] The adapter can be attached to the DNA fragment by any useful means, but preferably, the attachment in step c) is performed by ligation, for example, blunt-end ligation. In particular, the ligation can be carried out by incubation with a ligase, for example, T4 DNA ligase. The incubation with the ligase is carried out under conditions that allow the activity of the enzyme. A person skilled in the art can determine the suitable conditions for the ligase of their choice.
[0108] Often, it may be beneficial to perform one or more steps for preparing the DNA fragment for ligation. Thus, the method of the invention may also include such steps.
[0109] In one embodiment of the present disclosure, the adapter contains a sample-specific barcode, and the DNA fragment is obtained from a sample labeled with the barcode.
[0110] [Amplification] When the filling adapter of the present invention attaches to the DNA fragment, the ligated adapter can be amplified.
[0111] Thus, the present invention also provides a method for amplifying a DNA fragment. The method comprises the following steps: a) preparing a DNA fragment attached to an adapter by the method described above; b) amplifying the DNA fragment attached to the adapter in vitro.
[0112] In one embodiment of the present disclosure, at least one step of the amplification is performed using the RNA polymerase by RNA polymerase-driven transcription. This can be applied particularly when the adapter contains a DNA amplification sequence that is a promoter sequence for the RNA polymerase. The RNA polymerase can preferably be T7 RNA polymerase.
[0113] In one embodiment of the present disclosure, A of the filling adapter contains a sequence complementary to the primer binding site. In such an embodiment, it is preferable that at least one step of the amplification includes the use of a primer capable of binding to the primer binding site.
[0114] [Sample] The term "sample" as used in the method of the present invention refers to various samples containing DNA fragments.
[0115] Examples of such samples include samples prepared from, containing, or consisting of cultured cells, cultured cell lysates, culture supernatants, and / or mammalian materials. The term "mammalian material" refers to all biological materials derived from mammals, such as tissues or biopsies collected from mammals (e.g., tissues collected after surgery), and / or body fluids, such as blood, serum, plasma, urine, cerebrospinal fluid, saliva, lymph, tears, or semen. Preferably, such mammalian material is blood, serum, or plasma.
[0116] As described above, the sample may include or consist of the above-mentioned cultured cells, cultured cell lysates, culture supernatants, and / or mammalian materials.
[0117] The sample can also be prepared from cultured cells, cultured cell lysates, culture supernatants, and / or mammalian materials. For example, the sample may contain fragmented and / or isolated DNA from the above materials. In one embodiment, the sample is prepared by a method that includes lysing the cells and fragmenting the genomic DNA of the cells, from any of the above materials containing cells.
[0118] The mammalian material can be obtained from any mammal. In some embodiments, the mammal is a human.
[0119] In some embodiments, the DNA fragment is obtained by isolating or partially isolating DNA from mammalian tissue. In such embodiments, the DNA is preferably subjected to fragmentation, which can be performed before isolation, after isolation, or simultaneously with isolation. In some embodiments, the DNA fragment is obtained by isolating or partially isolating DNA from a body fluid. In some embodiments, the DNA fragment is obtained by isolating or partially isolating DNA from serum. In some embodiments, the DNA fragment is obtained by isolating or partially isolating DNA from plasma. In some embodiments, the DNA fragment is obtained by isolating or partially isolating DNA from urine. In some embodiments, the DNA fragment is obtained by isolating or partially isolating DNA from cerebrospinal fluid. In some embodiments, the DNA fragment is obtained by isolating or partially isolating DNA from saliva. In some embodiments, the DNA fragment is obtained by isolating or partially isolating DNA from lymph fluid. In some embodiments, the DNA fragment is obtained by isolating or partially isolating DNA from tears. In some embodiments, the DNA fragment is obtained by isolating or partially isolating DNA from semen. In some embodiments, the DNA fragment is obtained by isolating or partially isolating DNA from blood. In any of the above embodiments, the DNA can be subjected to fragmentation, which can be performed, for example, before isolation, after isolation, or simultaneously with isolation as described above.
[0120] In some embodiments, the sample comprises purified DNA. In some embodiments, the sample comprises purified nucleosomes. In some embodiments, the sample comprises purified chromatin. In some embodiments, the sample comprises a cell lysate, for example, a cell lysate that has been subjected to fragmentation. In some embodiments, the sample comprises plasma. In some embodiments, the sample comprises blood. In some embodiments, the sample comprises serum. In some embodiments, the sample comprises urine. In some embodiments, the sample comprises cerebrospinal fluid. In some embodiments, the sample comprises saliva. In some embodiments, the sample comprises lymph fluid. In some embodiments, the sample comprises tears. In some embodiments, the sample comprises semen.
[0121] In one embodiment of the present disclosure, some or substantially all of the DNA fragments of a given sample are ligated to the filling adapter of the present invention. The filling adapter may contain a sample-specific barcode, whereby the DNA fragments of a given sample can be identified by the barcode.
[0122] [Item] The present invention disclosed may be further defined by any of the following items. 1. 5’-A-B-C-3’ 3’-A’-B’-C’-5’ A partially double-stranded adapter comprising or consisting of an oligonucleotide of the general structure of, a) A is the upper strand of a DNA amplification sequence, A consists of 5’-A1-A2-3’, b) A’ consists of 3’-A1’-A2’-5’, c) A1’ is a nucleotide sequence that is substantially non-complementary to A1, has a 3’ end that is exonuclease-resistant, and / or contains a primer extension blocking group, d) Either A2 and A2’ are absent, or A2 and A2’ are nucleotide sequences that are substantially complementary to each other. e) B and B’ are sequences in the range of 5 to 100 deoxyribonucleotides that are substantially complementary to each other, and f) C and C’ are sequences of up to 10 deoxyribonucleotides that are complementary to each other, and C’ consists of a deoxynucleotide and one ribonucleotide, with the ribonucleotide located at the 3’ end of C’, a partially double-stranded adapter.
[0123] 2. The adapter 5’-A-B-C-3’ 3’-A’-B’-C’-P-5’ contains or consists of an oligonucleotide having the general structure of a) A is the upper strand of a DNA amplification sequence, and A consists of 5’-A1-A2-3’. b) A’ consists of 3’-A1’-A2’-5’. c) A1’ is a nucleotide sequence that is substantially non-complementary to A1, with a 3’ end that is exonuclease-resistant and / or contains a primer extension blocking group. d) Either A2 and A2’ are absent, or A2 and A2’ are nucleotide sequences that are substantially complementary to each other. e) B and B’ are sequences in the range of 5 to 100 deoxyribonucleotides that are substantially complementary to each other. f) C and C’ are sequences of up to 10 deoxyribonucleotides that are complementary to each other, and C’ consists of a deoxynucleotide and one ribonucleotide, with the ribonucleotide located at the 3’ end of C’, and g) P is a 5’ phosphate, the adapter according to item 1.
[0124] 3. A is in the range of 10 to 100 nucleotides, the adapter according to any one of the preceding items. 4. The adapter according to any one of the preceding items, wherein A consists of a range of 15 to 50 nucleotides. 5. The adapter according to any one of the preceding items, wherein A consists of a range of 15 to 40 nucleotides. 6. The adapter according to any one of the preceding items, wherein A' consists of a range of 2 to 100 nucleotides. 7. The adapter according to any one of the preceding items, wherein A' consists of a range of 2 to 35 nucleotides.
[0125] 8. The adapter according to any one of the preceding items, wherein A' consists of a range of 2 to 10 nucleotides. 9. The adapter according to any one of the preceding items, wherein the DNA amplification sequence is an RNA polymerase promoter sequence or contains a primer binding site. 10. The adapter according to any one of the preceding items, wherein A is recognized by RNA polymerase when bound to its complementary sequence as double-stranded DNA. 11. The adapter according to any one of the preceding items, wherein A is recognized by T7 RNA polymerase or SP6 RNA polymerase when bound to its complementary sequence as double-stranded DNA. 12. The adapter according to any one of the preceding items, wherein A contains a sequence complementary to the primer binding site.
[0126] 13. The adapter according to any one of the preceding items, wherein A1' contains or consists of a sequence of nucleotides connected via exonuclease-resistant phosphorothioate bonds. 14. The adapter according to any one of the preceding items, wherein A1' is non-complementary to A1. 15. The adapter according to any one of the preceding items, wherein A1' contains or consists of a sequence of 3 to 35 consecutive nucleotides connected via exonuclease-resistant phosphorothioate bonds. 16. The adapter according to any one of the preceding items, wherein A1’ comprises or consists of a sequence of 3 to 35 consecutive cytosines connected via an exonuclease-resistant phosphorothioate bond. 17. The adapter according to any one of the preceding items, wherein the 3’ end of A1’ contains a nucleotide modified to block primer extension.
[0127] 18. The adapter according to any one of the preceding items, wherein the 3’ end of A1’ contains a dideoxynucleotide. 19. The adapter according to any one of the preceding items, wherein the 3’ end of A1’ contains a phosphoramidite C3 spacer. 20. The adapter according to any one of the preceding items, wherein A1’ contains one or more nucleotide analogs or modifications that are exonuclease-resistant and are selected from the group consisting of phosphorothioate bonds, phosphoramidite C3 spacers, inverted deoxythymidine bases, 2’-O-methyl, and 2’-O-methoxyethyl nucleosides. 21. The adapter according to any one of the preceding items, wherein A1’ contains a sequence that prevents RNA polymerase association and function, such as a sequence that supports the formation of a hairpin, loop, or other secondary structure. 22. The adapter according to any one of the preceding items, wherein -B-C- and / or -B’-C’- contains a primer binding site.
[0128] 23. The adapter according to any one of the preceding items, wherein -B-C- and / or -B’-C’- contains a partial or full-length SBS3 primer binding site. 24. The adapter according to any one of the preceding items, wherein -B-C- and / or -B’-C’- contains a randomized unique molecular identifier consisting of a range of 5 to 15 nucleotides. 25. The adapter according to any one of the preceding items, wherein -B-C- and / or -B’-C’- contains a barcode sequence consisting of a range of 5 to 15 nucleotides. 26. The adapter according to any one of the preceding items, wherein -B-C- and / or -B'-C'- additionally contain a random sequence in the range of 5 to 15 nucleotides. 27. The adapter according to any one of the preceding items, wherein C' is at least 2 nucleotides in length.
[0129] 28. The adapter according to any one of the preceding items, wherein C' is 2 to 10 nucleotides in length. 29. The adapter according to any one of the preceding items, wherein C' is 3 to 9 nucleotides in length, for example, 4 to 9 nucleotides in length, for example, 5 to 8 nucleotides in length. 30. The adapter according to any one of the preceding items, wherein all nucleotides of A, A2', B, and B' are deoxyribonucleotides. 31. The adapter according to any one of the preceding items, which contains no ribonucleotides other than the ribonucleotides contained in C'.
[0130] 32. A method for attaching an adapter to a DNA fragment, comprising: a) providing at least one adapter according to any one of the preceding items; b) providing a sample containing the DNA fragment; c) attaching the adapter to the DNA fragment in the sample; d) incubating the sample with an RNA nicking enzyme under conditions that allow the activity of the enzyme; e) incubating the sample at a temperature higher than the Tm of i) and ii), where i) and ii) are as follows: i) 5'-C-3' 3'-C'-5'; ii) 5'-C-C'-3' 3'-C'-C-5'; f) incubating the sample with a strand-displacing DNA polymerase.
[0131] 33. The method according to item 32, wherein steps e) and f) are executed simultaneously. 34. The method according to item 32 or 33, wherein the sample is incubated with a strand displacement DNA polymerase at a temperature higher than the Tm of i) and ii). 35. The method according to any one of items 32 to 34, wherein the method further includes a step of incubation at a temperature in the range of 0°C to 4°C, and the step is executed immediately after step e). 36. The method according to item 35, wherein step f) is executed at a temperature in the range of 20 to 80°C, for example, in the range of 25 to 75°C, for example, in the range of 20 to 50°C, for example, in the range of 25 to 37°C. 37. The method according to any one of items 32 to 36, wherein the RNA nicking enzyme is RNase HII.
[0132] 38. The method according to any one of items 32 to 37, wherein the RNA nicking enzyme is an RNase HII that shares at least 70%, for example, at least 80%, for example, at least 85%, for example, at least 90%, for example, at least 95%, for example, 100% sequence identity with any one of the RNase HIIs of SEQ ID NOs: 1 to 42 and SEQ ID NOs: 103 to 122. 39. The method according to any one of items 32 to 38, wherein the strand displacement DNA polymerase is Bst polymerase. 40. The method according to any one of items 32 to 39, wherein the strand displacement DNA polymerase is a DNA polymerase that shares at least 70%, for example, at least 80%, for example, at least 85%, for example, at least 90%, for example, at least 95%, for example, 100% sequence identity with the Bst DNA polymerase of SEQ ID NO: 123. 41. The strand displacement DNA polymerase is Bst polymerase containing a large fragment, where the large fragment contains or consists of a sequence sharing at least 70%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, such as 100% sequence identity with the large fragment of Bst polymerase SEQ ID NO: 124, the method according to any one of items 32 to 40. 42. The strand displacement DNA polymerase is a DNA polymerase sharing at least 70%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, such as 100% sequence identity with phi 29 DNA polymerase of SEQ ID NO: 125 or Taq DNA polymerase of SEQ ID NO: 126, the method according to any one of items 32 to 41.
[0133] 43. The DNA fragment consists of or contains genomic DNA, the method according to any one of items 32 to 42. 44. The DNA fragment is a protein-bound DNA fragment, the method according to any one of items 32 to 43. 45. The DNA fragment is naked genomic DNA, the method according to any one of items 32 to 43. 46. The DNA fragment is cell-free DNA, the method according to any one of items 32 to 43. 47. The DNA fragment contains nucleosomes, for example, most of the DNA fragment is in the form of nucleosomes, the method according to any one of the preceding items.
[0134] 48. Most of the cell-free DNA fragment is in the form of nucleosomes, the method according to item 46. 49. The DNA fragment is naked cell-free DNA, the method according to any one of items 32 to 43. 50. The DNA fragment contains chromatin proteins, such as nucleosomes and / or genomic DNA fragments bound to transcription factors, the method according to any one of items 32 to 45. 51. The method according to any one of items 32 to 50, wherein the genomic DNA is a eukaryote or a prokaryote. 52. The method according to any one of items 32 to 51, wherein the DNA fragment is selected from the group consisting of cDNA, DNA produced by whole genome amplification, primer extension products containing at least one double-stranded end, and PCR amplicons.
[0135] 53. The method according to any one of items 32 to 52, wherein the DNA fragment is obtained by lysing cells from a cell culture or mammalian material and fragmenting chromatin from the lysed cells. 54. The method according to any one of items 32 to 52, wherein the DNA fragment is obtained by isolating chromatin from a cell sample and fragmenting the chromatin. 55. The method according to any one of items 32 to 53, wherein the DNA fragment is obtained by isolating, partially isolating, and / or fragmenting DNA from cultured cells, cell lysates, cell culture supernatants, and / or mammalian materials. 56. The method according to any one of items 32 to 53, wherein the DNA fragment is obtained by isolating, partially isolating, and / or fragmenting DNA from a mammalian material, and the mammalian material can be, for example, a material collected from a mammal, such as a tissue or biopsy, and / or a body fluid, such as blood, serum, plasma, urine, cerebrospinal fluid, saliva, lymph fluid, tear fluid, or semen. 57. The method according to any one of items 32 to 56, wherein the sample contains purified DNA, purified nucleosomes, purified chromatin, and cell lysates.
[0136] 58. The method according to any one of items 32 to 57, wherein the sample contains or consists of plasma, blood, serum, urine, cerebrospinal fluid, saliva, lymph fluid, tear fluid, or semen. 59. The method according to item 58, wherein the DNA fragment is a cell-free DNA fragment. 60. The method according to any one of items 32 to 59, wherein the DNA fragment is prepared by mechanical shearing and / or enzymatic digestion. 61. The method according to any one of items 32 to 60, wherein the DNA fragment contains, on average, more than 10 base pairs, for example, more than 15 base pairs, for example, more than 150 base pairs, for example, in the range of 10 to 15,000 base pairs, for example, in the range of 10 to 10,000 base pairs, for example, in the range of 10 to 5,000 base pairs, for example, in the range of 10 to 500 base pairs. 62. The method according to any one of items 32 to 61, wherein the attaching in step c) is performed by ligation, for example, blunt-end ligation.
[0137] 63. The method according to item 62, wherein the ligation is carried out by incubation with a ligase, for example, T4 DNA ligase. 64. The method according to item 62, wherein the method further includes a step of preparing the DNA fragment for ligation. 65. The method according to any one of items 62 to 64, wherein the ligation is performed by incubating the DNA fragment and the adapter with the ligase under conditions that allow the activity of the ligase. 66. The method according to any one of items 32 to 65, wherein the adapter contains a sample-specific barcode and the DNA fragment obtained from the sample is used. 67. The method according to any one of items 32 to 66, wherein step d) is performed at a temperature in the range of 20°C to 80°C. 68. The method according to items 32 to 67, wherein step e) is performed at a temperature in the range of 40°C to 80°C, for example, in the range of 45°C to 70°C, for example, in the range of 50°C to 70°C.
[0138] 69. A method for amplifying a DNA fragment, comprising the following steps: a) Preparing the DNA fragment attached to the adapter by the method according to items 32 to 68. b) amplifying the DNA fragment attached to the adapter in vitro, A method comprising: 70. The method according to item 69, wherein the amplification is carried out by RNA polymerase-driven transcription. 71. The method according to item 70, wherein the RNA polymerase is T7 RNA polymerase. 72. The method according to any one of items 69 to 71, wherein A of the adapter contains a sequence complementary to the primer binding site, and a primer capable of binding to the primer binding site is used for amplification.
Example
[0139] [Example 1: Adapter Ligation and Target DNA Amplification] The following example outlines a typical workflow for nucleotide barcoding for multiplex ChIP-seq.
[0140] [Materials and Methods] MINUTE-ChIP is carried out essentially as described in Kumar et al, 2019, except that the adapter according to the present invention is used.
[0141] The first step involves chromatin fragmentation and adapter ligation. Cell pellets from various sources, e.g., cell cultures, are used directly in their native state or after formaldehyde fixation. Chromatin is fragmented in situ to mononucleosome length by MNase digestion, which is then quenched with EGTA-containing DNA end repair and ligation buffer. In the EGTA-containing DNA end repair and ligation buffer, adapters are ligated to the blunt ends of the target DNA fragments using the Fast-Link™ DNA Ligation Kit (Epicentre® Biotechnologies). The next step involves sample pooling, in which individual samples ligated to unique barcode adapters are quenched with EDTA and then combined as a single pool. The soluble fraction is recovered after centrifugation and aliquoted for immunoprecipitation experiments. Immunoprecipitation is performed on an aliquot of the pooled supernatant using magnetic beads conjugated to anti-H3 antibody or anti-CTCF antibody. After thorough bead washing and crosslink reversal, the captured DNA molecules are purified. The T7 promoter of the adapter is reconstructed when ligated to genomic DNA after sequential RNase HII nicking, heat exposure, and primer extension by Bst 3.0 DNA polymerase. Specifically, the purified input or ChIP DNA material is digested with recombinant E. coli RNase HII (NEB M0288S) in the manufacturer's Thermo Pol buffer at 37 °C for 2 h, followed by heat exposure at 68 °C for 10 min. Subsequently, a cold shock is applied to the reaction tube by immediate incubation on ice for 5 min. Next, the Bst 3.0 DNA polymerase (NEB M0374S) reaction mixture in the manufacturer's amplification buffer is added to the RNase HII-digested material and incubated at 68 °C for 2 h for adapter filling. These DNA fragments are then purified and linearly amplified by T7-RNA polymerase-driven transcription according to the manufacturer's instructions (NEB E2040S).The resulting RNA is treated with DNase I and then purified for 3’ adapter ligation using recombinant T4 RNA ligase (NEB M0373L). Such adapters provide a priming site for subsequent conversion of the cDNA, which is then further PCR amplified into a full-length library for the Illumina sequencing platform.
[0142] [Results] The mismatches created by the single-stranded sequence of the T7 promoter and the sequence of seven consecutive cytosines connected via phosphorothioate linkages create a fork-like structure at the tail end of the adapter, and the fork-like structure prevents the T7 promoter from being able to drive in vitro transcription by T7 RNA polymerase. A single ribonucleotide embedded within the barcode sequence at the opposite end of the adapter creates a recognition site for RNase HII that specifically nicks on the 5' side relative to the ribonucleotide. When the adapter is ligated to the target DNA fragment, the resulting 3' hydroxyl group at the nicking site enables primer extension by strand-displacing Bst polymerase, which synthesizes a new lower strand and ultimately reconstructs a functional double-stranded T7 promoter. The exclusion of adapter contaminants results from the instability of the resulting 4-nucleotide priming site due to its low melting temperature (Tm) when ligation to the target genomic fragment did not occur. Thus, the length of the lower strand primer, and hence the resulting thermal stability, provides a basis for selection to specifically reconstruct the T7 promoter of the promiscuous ligation products such that free adapter monomers remain inert for T7 transcription and are thus not carried over into downstream RNA adapter ligation and cDNA conversion. Also, these adapter contaminants are removed by DNase I treatment during the RNA purification step after IVT. Adapter dimers can present yet another problem. Due to the fork structure at the tail end of the adapter, this does not support ligation. Due to the phosphorothioate linkages of the mismatched polyC sequence, the fork structure is exonuclease-resistant and thus resistant to conventional end repair enzymes. Thus, adapter dimers can only exist in a head-to-head configuration. In this case, RNase HII can act as a restriction enzyme and nick both the upper and lower strands, essentially cleaving the adapter dimer into monomeric form. This is schematically presented in Figure 2B.
[0143] [Conclusion] The present invention disclosed enables the discrimination of a desired ligation product from contaminating free adapters or adapter dimers based on the stability of double-stranded DNA proximal to the RNase HII nick site. Contaminating unligated adapter monomers and adapter dimers have a low Tm and thus cannot provide a stable priming site for Bst polymerase extension. By sequential treatment with RNase HII and Bst polymerase, a functional T7 promoter is exclusively reconstructed on the ligated genomic fragment, and adapters, which are contaminants with a defective T7 promoter, are excluded from subsequent in vitro transcription amplification and conventional library preparation pipelines.
[0144] [Example 2: Performance comparison of r5 and C3 adapters] The following example compares adapter contamination obtained in a MINUTE-ChIP experiment performed essentially as described in Kumar et al, 2019, except that the adapters described herein were used. Thus, the following example was performed using the adapter "r5" shown in the lower panel of FIG. 1. As a control, a prior art adapter known as the "3C" adapter shown in the upper panel of FIG. 1 was used.
[0145] [Materials and methods] MINUTE-ChIP was performed essentially as described in Kumar & Elsasser, 2019. Briefly, 1-2×10 6Formaldehyde cross-linked mouse embryonic stem cell pellets containing individual cells were barcoded with either r5 at 2.5 μM (see lower panel of Figure 1) or a prior art (3C) adapter (upper panel of Figure 1), and subjected to ChIP using either an anti-H3 antibody or an anti-CTCF antibody. All experiments were performed in duplicate. Briefly, cells were first lysed and digested with MNase to enrich for the mononucleosome population. The digestion was quenched with EGTA-containing end repair and ligation buffer, and each sample was ligated to an r5 or 3C adapter molecule bearing a unique barcode in EGTA-containing end repair and ligation buffer. The ligation was quenched with EDTA-containing lysis dilution buffer, and then all samples were combined in one tube. After centrifugation to remove insoluble cell debris, the supernatants were pooled together and aliquoted for individual ChIP reactions. 2×10 6 cell equivalents of the pooled supernatant were used for ChIP, and ChIP was performed with an anti-H3 antibody against histone H3 (Abcam #ab1791) or an anti-CTCF antibody against CTCF (Millipore #07-729) pre-bound to protein A magnetic beads. After thorough washing, ChIP DNA was purified after crosslink reversal and overnight proteinase K treatment at 65 °C.
[0146] The r5 samples were subjected to enzymatic removal of adapter contamination by sequential treatment with RNase HII and Bst polymerase as described in Example 1. The r5 adapter-ligated DNA fragments were then purified and prepared together with the pre-purified 3C samples for T7-RNA polymerase-driven in vitro transcription. The amplified RNA products were treated with DNase I, purified, and then ligated to a pre-adenylated RNA 3’ adapter (RA3) that functions as a primer binding site for reverse transcription. The resulting cDNA was treated with RNase A and RNase H, purified, and then used as a template for library PCR with barcoded primers compatible with the Illumina sequencing platform. Typically, 1 - 2×105 Pooled supernatants of individual cell equivalents were used as input. The input was subjected to the same experimental workflow as ChIP DNA for library construction. All nucleic acid purifications were performed using the AMPure SPRI size selection method (Beckman Coulter) with either the standard or small fragment (sf) purification protocol. Library size distribution was evaluated by an Agilent Bioanalyzer, quantified by a Qubit DNA high-sensitivity assay, and then diluted for paired-end sequencing on the Illumina platform.
[0147] [Results] The r5 adapter resulted in approximately 20 - 50-fold lower adapter contamination in the final library, i.e., approximately 20 - 50-fold lower free adapter (Figure 3A). The insert size distribution in the input library, when derived from read pair mapping to the mm9 genome (using the Picard tool), demonstrated that only the r5 sample showed the desired enrichment for mononucleosome (150 - 180 bp) fragments in the standard size selection protocol and additionally showed DNA-binding protein footprints (50 - 75 bp) in the small fragment preparation (Figure 3B). The average profile of the CTCF-ChIP signal across the shown CTCF binding sites demonstrated that the adapter reduction protocol did not change the ChIP signal (Figure 3C).
[0148] [Conclusion] The disclosed invention resulted in lower contamination and increased the percentage of mappable reads in the final library compared to standard adapters.
[0149] [Example 3: Performance Comparison of Filling Adapters with Different Ribonucleotide Embedding Positions] The following examples compare the performance between a conventional adapter having only deoxyribonucleotides (DNA, SEQ ID NO: 91, 92) in barcode-fragmented chromatin from mouse embryonic stem cells (mESC), or a filling adapter of the present invention having ribonucleotides replacing the deoxyribonucleotides of the lower strand, at the second (r2, SEQ ID NO: 93a, 94), fifth (r5, SEQ ID NO: 93b, 95), eighth (r8, SEQ ID NO: 96, 97), eleventh (r11, SEQ ID NO: 98, 99), or thirteenth (r13, SEQ ID NO: 100, 101) nucleotides from the 5'-end.
[0150] [Materials and Methods] Adapter barcoding reactions were performed using a conventional DNA-only adapter or the filling adapters r2, r5, r8, r11, and r13 of the present invention via the MINUTE-ChIP protocol as described in Example 2. 1 - 2×10 5 cell equivalents of barcoded DNA material were crosslink-reversed and purified for the library preparation workflow, and the library preparation workflow was initiated with sequential nicking by RNase HII and primer extension by Bst polymerase as described in Example 2, followed by in vitro transcription by T7 RNA polymerase, cDNA conversion, and library PCR.
[0151] [Results] The fill adapters having ribonucleotide positions that are distant from the 5'-end showed improved mappable reads from about 20% in DNA-only adapters to 70 - 80% exemplified by the r2, r5, and r8 fill adapters (Figure 4A). Similarly, library diversity increased gradually from over 50M reads (in r2) to over 80M reads (in r5) and over 100M reads (in r8) as the ribonucleotide position was located further away from the 5'-end of the lower strand, compared to only over 20M unique reads obtained by conventional DNA-only adapters (Figure 4B). Only the fill adapters having ribonucleotide positions beyond r8, as exemplified in r11 and r13, showed only performance similar to that of conventional DNA-only adapters in both mappable reads and library diversity.
[0152] [Conclusion] The disclosed fill adapters of the present invention having ribonucleotides located at the 2nd to 8th nucleotide positions from the 5'-end of the lower strand improved both mappable reads and library diversity compared to conventional DNA-only adapters.
[0153] [Example 4: Ligation of Fill Adapters to Cell-Free DNA (cfDNA) Fragments in Human Blood] The following example shows that the "fill" adapters can be ligated to cell-free DNA fragments. The cfDNA fragments can be amplified and sequenced by next-generation sequencing.
[0154] [Materials and Methods] Human plasma was obtained from whole blood samples by centrifugation (10 minutes, 800 g, 4 °C), the supernatant was collected, and the supernatant was used fresh or snap-frozen and stored at -80 °C, and then used. Four plasma samples were each set up at 200 μL in a parallel ligation reaction (with T4 polynucleotide kinase (2.5 U) and T4 ligase (2.5 U) 10× buffer, 3% PEG 4000, 0.2 mM ATP) for 2 hours at room temperature, and the r5 adapter was ligated directly onto cfDNA in plasma regardless of whether it was in the form of nucleosomes or naked DNA. r5 is as described in Example 3 above (SEQ ID NOs: 93b, 95), and in this example, r5 contained four barcode pairs provided herein as SEQ ID NOs: 51 + 52, 53 + 54, 55 + 56, 57 + 58. The ligation reactions (250 μL each) were stopped by adding stop buffer (50 mM Tris-Hcl, 150 mM NaCl, 1% Triton X-100, 50 mM EGTA, 50 mM EDTA, 0.1% DOC), and the four barcoded plasma samples were pooled (total volume of 1.5 mL). 150 μL of the resulting pool was collected as "input", and the remaining pool was equally divided into two ChIP reactions, and the two ChIP reactions were incubated overnight at 4 °C with magnetic beads conjugated to an antibody against histone H3 (3 μL of Active Motif 39763) and an antibody against histone H3K4me3 (3 μL of Millipore 04745). After ChIP, the precipitated material was subjected to sequential treatment with RNase HII and Bst polymerase, in vitro transcription with T7 RNA polymerase, cDNA conversion, and library PCR together with the input, to obtain input, H3, and H3K4me3 libraries. The libraries were further diluted to 2 nM, pooled, and then sequenced on an Illumina NextSeq 2000 platform.
[0155] [Results] The results shown in Figure 6 (Figure 6A) demonstrate that the adapter of the present invention can be efficiently ligated onto cell-free DNA (cfDNA) fragments in human plasma. The adapter ligation method captures free cfDNA fragments (< 150 bp), nucleosome fragments (150 - 230 bp), and dinucleosome fragments (> 300 bp) (Figure 6B). After chromatin immunoprecipitation (ChIP) with a general anti-H3 antibody or a modification-specific anti-H3K4me3 antibody, mainly mono- and dinucleosome fragments are recovered (Figure 6B). Within each library, DNA molecules from all four plasma samples are represented. The total number of unique molecules was extrapolated based on the number of sequenced molecules and the proportion of duplicate sequences (Figure 6C). Histone H3K4me3 is known to associate with the promoters of active genes in cellular chromatin. H3K4me3 ChIP specifically enriches cfDNA fragment mapping to transcription start sites, demonstrating that H3K4me3-modified circulating nucleosomes are derived from promoters within cellular chromatin and can inform gene activity in the cells from which these cfDNA molecules originated (Figure 6D).
[0156] [Conclusion] The adapter of the present invention can be efficiently ligated onto cell-free DNA (cfDNA) fragments regardless of whether they are in the form of nucleosomes. CfDNA barcoded with the filling adapter described in the present invention may be amplified into a sequencing library after purification, or may be subjected to ChIP (H3 ChIP) to recover cfDNA fragments bound to nucleosomes, or may be subjected to ChIP (H3K4me3 ChIP) to recover cfDNA fragments bound to nucleosomes with specific histone modifications.
[0157] Examples of useful adapter sequences according to the present invention are provided in Table 1. Each adapter is constructed from two distinct sequences, denoted as F and R in Table 1, where F is the upper strand of the filling adapter and R is the lower strand. As an example, F-M2-BC01 is the upper strand of adapter M2-BC01, and R-M2-BC01 is the lower strand. The same set of adapter sequences segmented by segments is shown in Table 2.
[0158] The symbols used in Tables 1 and 2 are as follows. N-deoxyribonucleotide, any of A, T, G, or C rN-ribonucleotide, where N can be A, U, G, or C. *-exonuclease-resistant phosphorothioate bond / 5Phos / -phosphorylated 5' end
[0159]
Table 1-1
[0160]
Table 1-2
[0161]
Table 1-3
[0162]
Table 1-4
[0163]
Table 2-1
[0164]
Table 2-2
[0165]
Table 2-3
[0166]
Table 2-4
[0167]
Table 2-5
[0168] [Array Summary] In the following lists, accession numbers having the prefix WP or three-letter code prefixes (e.g., STV, KAE, TET) refer to accession numbers from the National Center for Biotechnology Information (NCBI).
[0169] Six-character / numeric codes (e.g., G9YZR1, A7MI15), or accession numbers having the prefix A0, refer to accession numbers from UniProt.
[0170] Accession number 1 [WP_032201780.1] Ribonuclease HII sequence from Escherichia coli Accession number 2 [WP_000569409.1] Ribonuclease HII sequence from Salmonella bongori Accession number 3 [WP_062740401.1] Ribonuclease HII sequence from Enterobacter lignolyticus Accession number 4 [WP_213200917.1] Ribonuclease HII sequence from Cronobacter sakazakii Accession number 5 [WP_138095852.1] Ribonuclease HII sequence from Jejubacter calystegiae
[0171] Accession number 6 [WP_049635063.1] Ribonuclease HII sequence from Yersinia aldovae Accession number 7 [WP_064598940.1] Ribonuclease HII sequence from Mangrovibacter phragmitis Accession number 8 [WP_021014886.1] Ribonuclease HII sequence from Serratia sp. ATCC 39006 Accession number 9 [WP_215484407.1] Ribonuclease HII sequence from Pectobacterium punjabense Accession number 10 [WP_225817150.1] Ribonuclease HII sequence from Photorhabdus sp. UCH-936
[0172] Accession number 11 [WP_045425094.1 MULTISPECIES:] Ribonuclease HII sequence from Edwardsiella Accession number 12 [WP_096012109.1] Ribonuclease HII sequence from Pantoea allii Accession number 13 [STV79714.1] Ribonuclease HII sequence from Klebsiella michiganensis Accession number 14 [WP_154147248.1] Ribonuclease HII sequence from Ewingella americana Accession number 15 [WP_131867065.1] Ribonuclease HII sequence from Biostraticola tofi
[0173] Accession number 16 [WP_074013020.1] Ribonuclease HII sequence from Candidatus Sodalis sp. SoCistrobi Accession number 17 [WP_068441297.1] Ribonuclease HII sequence from Providencia heimbachae Accession number 18 [WP_128179464.1 MULTISPECIES:] Ribonuclease HII sequence from Erwiniaceae Accession number 19 [WP_135023959.1] Ribonuclease HII sequence from Proteus mirabilis Accession number 20 [WP_007524108.1] Ribonuclease HII sequence from Haemophilus sputorum
[0174] Accession number 21 [WP_201264077.1] Ribonuclease HII sequence from Salinivibrio sp. HTSP Accession number 22 [WP_000569405.1] Ribonuclease HII sequence from Vibrio parahaemolyticus Accession number 23 [A0A7H0F8W7] Ribonuclease HII sequence from Leclercia adecarboxylata Accession number 24 [A0A5Q2TAM2] Ribonuclease HII sequence from Kluyvera intermedia Accession number 25 [WP_039078444.1] Ribonuclease HII sequence from Grimontella sp. AG753
[0175] Accession number 26 [WP_039078444] Ribonuclease HII sequence from Kluyvera intestini Accession number 27 [A0A6L6YA52] Ribonuclease HII sequence from Raoultella sp. 10-1 Accession number 28 [A0A0G3QHT9] Ribonuclease HII sequence from Phytobacter ursingii Accession number 29 [A0A7H0F8W7] Ribonuclease HII sequence from Kosakonia sacchari Accession number 30 [A0A6N3D9R3] Ribonuclease HII sequence from Metakosakonia massiliensis
[0176] Accession number 31 [A0A5D4Y9S6] Ribonuclease HII sequence from Lelliottia nimipressuralis Ribonuclease HII sequence from Trabulsiella odontotermitis [A0A0L0GJZ6] Ribonuclease HII sequence from Metakosakonia sp. MRY16-398 [A0A348DJ93] Ribonuclease HII sequence from Cedecea lapagei [A0A3S5DPY6] Ribonuclease HII sequence from AG348 [WP_045512034.1]
[0177] Ribonuclease HII sequence from Franconibacter pulveris [A0A0J8VNF4] Ribonuclease HII sequence from Trabulsiella guamensis [A0A085AD34] Ribonuclease HII sequence from Yokenella regensburgei [G9YZR1] Ribonuclease HII sequence from Mesorhizobium sp. (plant metagenome) [WP_047346420] Ribonuclease HII sequence from Atlantibacter subterranea [A0A3R9GA20]
[0178] Ribonuclease HII sequence from Cronobacter sakazakii [A7MI15] Ribonuclease HII sequence from Scandinavium goeteborgense [A0A4R6ELG6] Sequence number 102: T7 promoter: GAATTTAATACGACTCACTATAGGG Ribonuclease HII sequence from Pyrococcus abyssi [WP_010867642.1] Ribonuclease HII sequence from Pyrococcus sp. ST04 [WP_014734632.1] Accession No. 105 [WP_013904999.1] Ribonuclease HII sequence from Pyrococcus yayanosii
[0179] Accession No. 106 [WP_042680107.1] Ribonuclease HII sequence from Thermococcus paralvinellae Accession No. 107 [WP_167905566.1] Ribonuclease HII sequence from Thermococcus sp. CX2 Accession No. 108 [WP_088864705.1] Ribonuclease HII sequence from Thermococcus barossii Accession No. 109 [WP_062372977.1] Ribonuclease HII sequence from Thermococcus guaymasensis Accession No. 110 [WP_088863500.1] Ribonuclease HII sequence from Thermococcus celer
[0180] Accession No. 111 [WP_010478817.1] Ribonuclease HII sequence from Thermococcus zilligii Accession No. 112 [WP_088883124.1] Ribonuclease HII sequence from Thermococcus sp. P6 Accession No. 113 [WP_048164811.1] Ribonuclease HII sequence from Palaeococcus pacificus Accession No. 114 [NPA47432.1] Ribonuclease HII sequence from Thermococci archaea Accession No. 115 [NPA70987.1] Ribonuclease HII sequence from Crenarchaeota archaea
[0181] Accession No. 116 [MBU4075191.1] Ribonuclease HII sequence from Euryarchaeota archaea Accession No. 117 [RLI24472.1] Ribonuclease HII sequence from Candidatus Bathyarchaeota archaea Accession number 118 [RLF20972.1] Ribonuclease HII sequence from Thermoprotei archaea Accession number 119 [MBS7251087.1] Ribonuclease HII sequence from Candidatus Freyarchaeota archaea Accession number 120 [TET11529.1] Ribonuclease HII sequence from Candidatus Thorarchaeota archaea
[0182] Accession number 121 [KAE8738669.1] Ribonuclease HII sequence from Frankliniella occidentalis Accession number 122 [WP_072094022.1] Ribonuclease HII sequence from Oryza sativa Indica group Accession number 123 [WP_033014420] Bst DNA polymerase (DNA polymerase I from Geobacillus stearothermophilus) Accession number 124 Large fragment of Bst DNA polymerase (LF) 587 a.a. (290 - 876) (N-terminally truncated DNA polymerase I from Geobacillus stearothermophilus) Accession number 125 Bacillus phage phi29 DNA polymerase Accession number 126 Taq DNA polymerase I
Claims
1. 5'-A-B-C-3' 3'-A'-B'-C'-5' A partially double-stranded adapter comprising or consisting of an oligonucleotide having a general structure, a) A is the upper strand of the DNA amplification sequence, and A is 5'-A 1 -A 2 -3' consists of, b) A' is 3'-A 1 '-A 2 It consists of '-5', c) A 1 'But, A 1 A nucleotide sequence that is substantially non-complementary, wherein the 3' end is exonuclease-resistant and / or contains a primer extension blocking group, d) A 2 and A 2 ’ does not exist, or either A 2 and A 2 ’ is a nucleotide sequence that is substantially complementary to each other e) B and B' are sequences of 5 to 100 deoxyribonucleotides that are substantially complementary to each other, and f) A partially double-stranded adapter in which C and C' are sequences of up to 10 complementary deoxyribonucleotides, C' consisting of a deoxyribonucleotide and one ribonucleotide, the ribonucleotide located at the 3' end of C'.
2. a) A consists of a range of 10 to 100 nucleotides, for example, a range of 15 to 50 nucleotides, for example, a range of 15 to 40 nucleotides, and / or b) The adapter according to claim 1, wherein A' is in the range of 2 to 100 nucleotides, for example, in the range of 2 to 35 nucleotides, for example, in the range of 2 to 10 nucleotides.
3. The adapter according to claim 1, wherein the DNA amplification sequence is either a promoter sequence for RNA polymerase or includes a primer binding site, and optionally A is recognized by RNA polymerase when bound to its complementary sequence as double-stranded DNA, for example, A is recognized by T7 RNA polymerase or SP6 RNA polymerase when bound to its complementary sequence as double-stranded DNA.
4. A 1 'but, a) A 1 It is non-complementary, b) comprising or consisting of a sequence of nucleotides linked via exonuclease-resistant phosphothioate bonds, c) A sequence comprising or consisting of 3 to 35 consecutive nucleotides linked via exonuclease-resistant phosphothioate bonds, d) Consisting of or comprising a sequence of 3 to 35 consecutive cytosines linked via exonuclease-resistant phosphothioate bonds, e) comprising one or more exonuclease-resistant nucleotide analogs or modifications selected from the group consisting of phosphothioate bonds, phosphoramidite C3 spacers, inverted deoxythymidine bases, 2'-O-methyl, and 2'-O-methoxyethyl nucleosides, and / or f) The adapter according to claim 1, comprising a sequence that prevents RNA polymerase association and function, for example, a sequence that supports the formation of a hairpin, loop, or other secondary structure.
5. A 1 The 3' end of ' contains a modified nucleotide to block elongation, for example, the A 1 The 3' end of ' contains a dideoxynucleotide, for example, the A 1 The adapter according to claim 1, wherein the '3' end includes a phosphoramidite C3 spacer.
6. -B-C- and / or -B'-C'- are a) Contains a primer binding site, b) Containing a partial or full-length SBS3 primer binding site, c) Contains a randomized unique molecular identifier consisting of 5 to 15 nucleotides, d) Containing a barcode sequence consisting of 5 to 15 nucleotides, and / or e) The adapter according to claim 1, further comprising a random sequence in the range of 5 to 15 nucleotides.
7. The adapter according to claim 1, wherein C' is 2 nucleotides or longer, for example, C' is 2 to 10 nucleotides long, for example, 3 to 9 nucleotides long, for example, 4 to 9 nucleotides long, for example, 5 to 8 nucleotides long.
8. A method for attaching an adapter to a DNA fragment, a) To provide at least one adapter according to any one of claims 1 to 7, b) To provide a sample containing DNA fragments. c) Attaching the adapter to the DNA fragment in the sample, d) Incubate the sample together with the RNA nicking enzyme under conditions that enable the enzyme to become active. e) Incubating the sample at a temperature higher than the Tm of i) and ii), wherein i) and ii) are as follows: i) 5'-C-3' 3'-C'-5', ii) 5'-C-C'-3' It is 3'-C'-C-5', to incubate. f) A method comprising incubating the sample with a strand-displacement DNA polymerase.
9. The method according to claim 8, wherein the RNA nicking enzyme is RNAse HII, and for example, the RNA nicking enzyme is an RNAse HII that shares at least 70%, for example, at least 80%, for example, at least 85%, for example, at least 90%, for example, at least 95%, for example, 100% sequence identity with any one of the RNAse HIIs of SEQ ID NOs. 1 to 42 and 103 to 122.
10. The aforementioned strand substitution DNA polymerase a) A DNA polymerase that shares at least 70%, for example, at least 80%, for example, at least 85%, for example, at least 90%, for example, at least 95%, for example, 100% sequence identity with Bst DNA polymerase of Sequence ID No. 123, or b) A Bst polymerase comprising a large fragment, wherein the large fragment contains or comprises a sequence that shares at least 70%, for example, at least 80%, for example, at least 85%, for example, at least 90%, for example, at least 95%, for example, 100% sequence identity with the large fragment of the Bst polymerase of Sequence ID No. 124, or c) The method according to claim 8, wherein the DNA polymerase shares at least 70%, for example, at least 80%, for example, at least 85%, for example, at least 90%, for example, at least 95%, for example, 100% sequence identity with the phi 29 DNA polymerase of SEQ ID NO: 125 or the Taq DNA polymerase of SEQ ID NO:
126.
11. The aforementioned DNA fragment, a) consisting of or containing genomic DNA, b) A protein-bound DNA fragment, c) It is naked genome DNA, d) Cell-free DNA, e) Chromatin proteins, for example, nucleosomes and / or genomic DNA fragments bound to transcription factors, f) comprising mononucleosomes and / or dinucleosomes, g) Selected from the group consisting of cDNA, DNA produced by whole-genome amplification, primer extension products containing at least one double-stranded end, and PCR amplicons, h) Chromatin is isolated from the cell sample and obtained by fragmenting the chromatin, i) Obtained by lysing cells from cell cultures or mammalian materials and fragmenting chromatin from the lysed cells, j) DNA is obtained by isolating and / or partially isolating it from cultured cells, cultured cell solubles, cell culture supernatants, and / or mammalian materials. k) Prepared by mechanical shearing and / or enzymatic digestion, and / or l) The method according to claim 8, wherein on average, more than 10 base pairs, for example more than 15 base pairs, for example more than 150 base pairs, for example the range of 10 to 15,000 base pairs, for example the range of 10 to 10,000 base pairs, for example the range of 10 to 5,000 base pairs, for example the range of 10 to 500 base pairs.
12. The method according to claim 8, wherein the sample is prepared from, purified from, contains, or consists of cell solubilized and / or mammalian material.
13. The method according to claim 11, wherein the mammalian material is tissue, biopsy, plasma, blood, serum, urine, cerebrospinal fluid, salvia, lymph, tears, or semen.
14. The method according to claim 8, wherein the adapter contains a sample-specific barcode and the DNA fragment obtained from the sample is used.
15. A method for amplifying a DNA fragment, wherein the method comprises the following steps: a) Prepare the DNA fragment attached to the adapter by the method described in claim 8, b) Amplifying the DNA fragment attached to the adapter in vitro, The method wherein the amplification is optionally carried out by RNA polymerase-driven transcription, for example, the RNA polymerase is T7 RNA polymerase.