BTK-reducing molecules for the treatment of cancer and immune system disorders
By administering BTK-reducing molecules to target cells with constitutively activated PLCγ2, the treatment of cancers and immune system disorders resistant to conventional BTK inhibitors is facilitated, addressing the challenge of acquired resistance mechanisms.
Patent Information
- Application Number
- JP2024570455
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-05-31
- Filing Date
- 2023-05-30
- Publication Date
- 2025-06-19
AI Technical Summary
There is a need for new pharmaceuticals to treat diseases or disorders associated with PLCγ2 deficiency, such as cancer and immune system disorders, as existing treatments like BTK inhibitors face challenges due to acquired resistance mechanisms.
Administering BTK-reducing molecules, such as BTK degrading agents or nucleic acid inhibitor molecules, to target and kill cells with constitutively activated PLCγ2, thereby addressing the resistance mechanisms and providing a treatment modality for associated diseases.
The use of BTK-reducing molecules effectively targets and kills cells with constitutively activated PLCγ2, offering a potential solution for treating cancers and immune system disorders that are resistant to conventional BTK inhibitors.
Smart Images

Figure 2025518710000001_ABST
Abstract
Description
Technical Field
[0001] Cross - Reference to Related Applications This application claims the benefit of priority to U.S. Provisional Application No. 63 / 365,509, filed May 31, 2022, the entire contents of which are incorporated herein by reference in their entirety.
[0002] Sequence Listing The sequence listing associated with this application is submitted in electronic format as an XML file and is incorporated herein by reference in its entirety. The name of the XML file containing the sequence listing is 0437_0002_PCT_SL.xml, and the size of the text file is 11 KB.
[0003] Field of the Disclosure The present disclosure generally relates to methods of treating diseases or disorders associated with dysfunctional phosphatidylinositol - specific phospholipase Cγ2 (PLCγ2), such as cancer and immune system disorders, using Bruton's tyrosine kinase (BTK) - reducing molecules, such as BTK degrading agents.
Background Art
[0004] The B - cell receptor signaling pathway is important for proper B - cell development, activation, proliferation, differentiation, and thus the adaptive immune response. Phosphatidylinositol - specific phospholipase Cγ2 (PLCγ2) is a signaling enzyme activated by various cell - surface receptors, including the B - cell receptor. These receptors recruit kinases such as tyrosine - protein kinases SYK and LYN, Bruton's tyrosine kinase (BTK), and B - cell linker protein (BLNK) to phosphorylate and activate PLCγ2, which then generates the important second messenger molecules inositol 1,4,5 - trisphosphate (IP3) and diacylglycerol (DAG). IP3 and DAG then mediate diverse biological functions, including cell proliferation, endocytosis, and calcium flux.
[0005] The interactions and interdependencies among the various components of the B cell receptor pathway are not fully understood, but it is widely accepted that signaling through the B cell receptor pathway is dependent on activated BTK and subsequently transmits signals to downstream effectors via PLCγ2. Therefore, gain-of-function mutations in downstream PLCγ2 are considered to be one of the major acquired resistance mechanisms to BTK inhibitors in B cell lymphomas such as chronic lymphocytic leukemia (CLL). See, for example, Woyach et al., J. Clinical Oncology, 2017, 35(13):1437-1443; Ahn et al., Blood, 2017, 129(11):1469-1479.
[0006] PLCγ2 deficiency is also associated with various diseases including those with immunological bases such as inflammation, autoimmunity, immunodeficiency and allergy, as well as hematological malignancies. See, for example, Jackson et al., J. Biol. Chem., 2021, 297(2):100905. Therefore, manipulation of PLCγ2 activity can be considered a treatment modality in some malignancies and immune disorders.
[0007] Therefore, there is still a need for new pharmaceuticals for treating diseases or disorders associated with PLCγ2 deficiency.
Summary of the Invention
[0008] This application demonstrates, for example, that reduction or elimination of BTK, such as by proteolytic degradation of BTK or reduction of BTK expression, can be used to target and kill cells having constitutively activated PLCγ2, in contrast to simply inhibiting the catalytic function of BTK. Considering the downstream position of PLCγ2 compared to BTK in the signaling cascade and the clinical observation of gain-of-function mutations in PLCγ2 that confer acquired resistance to BTK inhibitors, it is unexpected that BTK-reducing molecules can be used to treat diseases or disorders associated with constitutively active PLCγ2.
[0009] A method of treating a disease or disorder associated with constitutively activated PLCγ2, such as cancer and immune system disorders, comprising administering to a subject in need thereof an effective amount of a Bruton's tyrosine kinase (BTK) reducing molecule is disclosed herein. In some embodiments, prior to administering the BTK reducing molecule to the subject, the subject has been identified as having constitutively activated PLCγ2 in one or more cells. In some embodiments, the method further comprises identifying cells obtained from the subject as having constitutively activated PLCγ2 as compared to control cells, or identifying cells obtained from the subject as having one or more gain-of-function mutations in the gene encoding PLCγ2. In some embodiments, the subject is human.
[0010] In some embodiments, constitutively activated PLCγ2 of interest is caused by one or more gain-of-function mutations in the gene encoding PLCγ2, such as one or more nucleotide deletions in the gene encoding PLCγ2, or one or more mutations that cause substitutions at P139, T168, I169, D334, Y482, N571, P664, R665, S707, A708, S718, R742, L845, L848, D993, D1140, M1141, F1142, or D1144 of PLCγ2 (SEQ ID NO: 1). In some embodiments, the one or more gain-of-function mutations are one or more of the following mutations: P139S, T168A, I169V, D334H, Y482H, N571S, P664S, R665W, S707Y, S707P, S707F, A708P, S718R, R742P, L845F, L845V, L848P, D993Y, D993H, D1140G, D1140Y, D1140N, D1140E, D1140V, M1141L, M1141R, M1141K, F1142L, D1144N, or D1144G of SEQ ID NO: 1, or a deletion of at least amino acids L845 - L848 of SEQ ID NO: 1, or a deletion of at least amino acids S707 - A708 of SEQ ID NO: 1, or a deletion of one or more nucleotides in exons 19 - 22 of the gene encoding PLCγ2. In some embodiments, the one or more gain-of-function mutations are located within the regulatory domain and / or calcium-binding domain of PLCγ2, for example, at the mutations in amino acids Y482, N571, P664, R665, S707, A708, S718, R742, L845, L848, D1140, M1141, F1142, or D1144 of SEQ ID NO: 1.
[0011] In some embodiments, diseases or disorders associated with constitutively activated PLCγ2 are cancers such as solid tumors or blood cancers (e.g., B cell malignancies including, but not limited to, non-Hodgkin lymphoma (NHL), such as chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), mantle cell lymphoma (MCL), marginal zone lymphoma (MZL), or Waldenström macroglobulinemia (WM)). In some embodiments, the cancer is resistant to BTK inhibitors (e.g., ibrutinib, acalabrutinib, zanubrutinib, or tirabrutinib, etc.).
[0012] In some embodiments, diseases or disorders associated with constitutively activated PLCγ2 are immune system disorders such as PLCγ2-related antibody deficiency and immunodeficiency syndrome (PLAID), familial cold autoinflammatory syndrome (FCAS3), autoinflammation, antibody deficiency and immunodeficiency syndrome (APLAID), or common variable immunodeficiency (CVID).
[0013] In some embodiments, the BTK-reducing molecule is a BTK degrader molecule, such as a compound of Formula I (e.g., Formulas IA - IP) disclosed herein. In some embodiments, the BTK-reducing molecule is a nucleic acid inhibitor molecule such as an antisense oligonucleotide, microRNA, RNAi molecule, antagomir, aptamer, or ribozyme.
[0014] The accompanying drawings, which are incorporated herein and constitute a part of this specification, illustrate specific embodiments and, together with the description set forth herein, serve to explain the particular principles of the methods and devices disclosed herein. BRIEF DESCRIPTION OF THE DRAWINGS
[0015]
Figure 1A
Figure 1B
Figure 1C
[0016]
Figure 2A
Figure 2B
Figure 2C
[0017] Here, various exemplary embodiments are referred to in detail, and examples thereof are shown in the accompanying drawings. It should be understood that the following detailed description is provided to give the reader a more complete understanding of the details of specific embodiments, features, and aspects of the present disclosure and should not be construed as a limitation on the scope of the present disclosure.
[0018] Definitions To more readily understand the present disclosure, certain terms are first defined below. Additional definitions of the following terms and other terms may be set forth throughout this specification. If the definitions of the terms set forth below conflict with the definitions in an application or patent incorporated by reference, the definitions set forth in this application shall be used to understand the meaning of such terms.
[0019] As used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural references unless the context clearly dictates otherwise. Thus, for example, a reference to “a method” includes one or more methods and / or steps of the type described herein and / or that would be apparent to one of ordinary skill in the art upon reading the present disclosure.
[0020] The term “about” as used herein is used to mean within a typical margin of error in the art. For example, “about” can be understood as being about two standard deviations from the average. According to certain embodiments, when referring to a measurable value such as an amount, “about” means including a variation of ±20%, ±10%, ±5%, ±1%, ±0.9%, ±0.8%, ±0.7%, ±0.6%, ±0.5%, ±0.4%, ±0.3%, ±0.2%, or ±0.1% from the specified value, such variations being appropriate for carrying out the disclosed methods and / or for making and using the disclosed devices. It is understood that when “about” is present prior to a series of numbers or a range, “about” can modify each of the numbers within the series or range.
[0021] As used herein, the terms “administer,” “administering,” or “administration” refer to directly administering to a patient a composition comprising a compound or a pharmaceutically acceptable salt or ester of a compound.
[0022] As used in this specification and the claims, the term "and / or" is to be understood to mean "either or both" of the elements so joined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Except for the elements specifically identified by the "and / or" clause, other elements may optionally be present, whether or not related to those specifically identified, unless clearly indicated otherwise. Thus, by way of non-limiting example, reference to "A and / or B" when used in combination with open-ended language such as "comprising" can refer, in one embodiment, to A without B (optionally including elements other than B); in another embodiment, to B without A (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); and so forth.
[0023] The term "at least" before a number or series of numbers (e.g., "at least two") is understood to include the number adjacent to the term "at least" and all subsequent numbers or integers that can logically be included, as apparent from the context. When "at least" is present before a series of digits or a range, it is understood that "at least" can modify each of the digits within the series or range.
[0024] The terms "disease", "disorder", and "symptom" are used interchangeably herein.
[0025] As used herein, the term "in some embodiments" refers to embodiments of all aspects of the present disclosure, unless the context clearly indicates otherwise.
[0026] As used herein, the term "BTK-reducing molecule" refers to a molecule that reduces or eliminates the amount of BTK, as contrasted with a molecule that can inhibit the function of BTK (e.g., a BTK inhibitor that inhibits kinase activity) but does not reduce the amount of BTK. Reducing or eliminating the amount of BTK not only reduces or eliminates the kinase activity of BTK, but also reduces or eliminates the ability of BTK to interact with other molecules, including other molecules in signal transduction cascades such as PLCγ2.
[0027] As used herein and as defined above, the "BTK degrader molecule" refers to a molecule that reduces or eliminates the amount of BTK by inducing proteolytic degradation of BTK. In some embodiments, the BTK degrader molecules of the present disclosure are proteolysis-targeting chimeras.
[0028] As used herein, a "BTK inhibitor" refers to a molecule that blocks the catalytic function of BTK, for example, by binding to the catalytic region of the kinase. A BTK inhibitor only blocks the catalytic function of BTK and does not otherwise reduce or eliminate the amount of BTK in a cell. Thus, a "BTK inhibitor" as used herein is not a "BTK-reducing molecule" or a "BTK degrader molecule" as defined herein. Examples of BTK inhibitors include, but are not limited to, ibrutinib, acalabrutinib, zanubrutinib, and tirabrutinib.
[0029] As used herein, an "effective amount" of a compound refers to an amount sufficient to elicit a desired biological response. As will be understood by those of skill in the art, the effective amount of a compound or molecule of the present disclosure can vary depending on factors such as the desired biological endpoint, the pharmacokinetics of the compound, the disease being treated, the mode of administration, and the age, health status, and symptoms of the subject. Effective amounts include both therapeutic and prophylactic treatments.
[0030] As used herein, the term "gain-of-function mutation" refers to any mutation in a gene that causes the protein encoded by the gene (i.e., the mutant protein) to acquire a function that is not normally associated with the normal wild-type protein. A gain-of-function mutation can be a deletion, addition, or substitution of nucleotide(s) in the gene that results in a change in the function of the encoded protein. In some embodiments, a gain-of-function mutation changes the function of the mutant protein or causes an interaction with another protein. In other embodiments, a gain-of-function mutation causes a decrease or removal of the normal wild-type protein, for example, by an interaction between the altered mutant protein and the normal wild-type protein. In the context of the present disclosure, in some embodiments, a PLCγ2 mutant that exhibits higher PLCγ2 activity than normal wild-type PLCγ2 is considered a gain-of-function mutant and can be identified as such using an assay suitable for detecting PLCγ2 activity, such as an assay for analyzing inositol phosphate formation in COS-7 cells transfected with wild-type or mutant PLCγ2 as described by Everett et al. (J. Biol. Chem., 2009, 284(34):23083-23093), or an assay for determining intracellular calcium flux related to PLCγ2 function as described by Woyach et al. (N. Engl. J. Med., 2014, 370:2286-2294) and Novice et al. (J. Clin. Immunol., 2020, 40:267-276), the contents of all of which are incorporated herein by reference. A gain-of-function mutation in PLCγ2 typically results in a higher level of phospholipase activity as measured using a suitable cell assay, such as those described by Novice et al. (J. Clin. Immunol., 2020, 40:267-276), compared to appropriate control cells.However, in some instances, gain-of-function mutations in PLCγ2 that result in constitutively activated PLCγ2, as observed in certain non-malignant immune cells, can lead to a decrease in PLCγ2-dependent signaling and function. This loss of PLCγ2 downstream function in specific immune cells may be a direct result of chronic signaling induced by gain-of-function mutations in PLCγ2, similar to the way chronic B cell receptor stimulation leads to a decreased amplitude calcium current, changes in the signaling cascade, and ultimately proliferative anergy (Ombrello et al., N. Engl. J. Med., 2012, 366:330-338). However, in these examples where gain-of-function mutations in PLCγ2 lead to a decrease in PLCγ2-dependent signaling and function, it is still possible to identify the PLCγ2 mutant as a gain-of-function mutation if the PLCγ2 mutation shows higher PLCγ2 activity than normal wild-type PLCγ2 in an assay to analyze inositol phosphate formation in COS-7 cells transfected with wild-type or mutant PLCγ2 as described by Everett et al. (J. Biol. Chem., 2009, 284(34):23083-23093) or in DT40 cells stably expressing wild-type or mutant PLCγ2 as described by Woyach et al. (N. Engl. J. Med., 2014, 370:2286-2294).
[0031] The terms "identity" or "identical," as known in the art, refer to a relationship between two or more polypeptide sequences or two or more polynucleotide sequences that is determined by comparing the sequences. In the art, "identity" or "identical" also means the degree of sequence relatedness determined by the match between such sequences of strings of polypeptides or polynucleotides. "Identity" and "similarity" can be readily calculated by known methods including, but not limited to, those described in Computational Molecular Biology, Lesk, A.M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D.W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A.M., and Griffin, H.G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; and Carillo, H., and Lipman, D., Siam J. Applied Math., 48:1073 (1988). A typical method for determining identity is designed to give the maximum match between the sequences being tested. Methods for determining identity and similarity are codified in publicly available computer programs.Typical computer program methods for determining identity and similarity between two arrays include, but are not limited to, the GCG program package (Devereux, J., et al., Nucleic Acids Research 12(1):387(1984)), BLASTP, BLASTN, and FASTA (Atschul, S.F. et al., J. Molec. Biol. 215:403-410(1990)). The BLAST X program is publicly available from NCBI and other information sources (BLAST Manual, Altschul, S., et al., NCBINLM NIH Bethesda, Md. 20894: Altschul, S., et al., J. Mol. Biol. 215:403-410(1990)). Identity may be determined using the well-known Smith Waterman algorithm.
[0032] As used herein, "pharmaceutically acceptable carrier" refers to a non-toxic carrier, adjuvant, or vehicle that does not destroy the pharmacological activity of the compound formulated therewith. Pharmaceutically acceptable carriers, adjuvants or vehicles that may be used in the compositions described herein include, but are not limited to, ion exchangers, alumina, aluminum stearate, lecithin, serum proteins such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes such as protamine sulfate, sodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinylpyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, polyethylene glycol and lanolin.
[0033] As used herein, "pharmaceutically acceptable salts" refer to salts that, within the scope of sound medical judgment, are suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response, etc., and that commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, Berge et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences (1977) 66:1-19. Pharmaceutically acceptable salts of the compounds of the present invention include those derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable non-toxic acid addition salts are inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid, or organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid, or salts of amino groups formed by using other methods used in the art such as ion exchange. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, etc. Pharmaceutically acceptable salts derived from suitable bases include alkali metals, alkaline earth metals, ammonium and N + (C 1-4Examples of the (alkyl)4 salts include. Representative alkali metal salts or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Further pharmaceutically acceptable salts include, where appropriate, non-toxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, lower alkyl sulfonates, and aryl sulfonates.
[0034] As used herein, the "subject" for which administration is contemplated includes humans (i.e., males or females of any age group, such as pediatric subjects (e.g., infants, children, adolescents) or adult subjects (e.g., young adults, middle-aged adults, or elderly adults)) and / or non-human animals, such as mammals, such as primates (e.g., cynomolgus monkeys, rhesus monkeys), cows, pigs, horses, sheep, goats, rodents, cats, and / or dogs, but is not limited thereto. In certain embodiments, the subject is a human. In certain embodiments, the subject is a non-human animal. The terms "human," "patient," and "subject" are used interchangeably herein.
[0035] As used herein, terms such as "target nucleic acid sequence," "targeted region," "target gene," etc. are used interchangeably and refer to an RNA or DNA sequence that is "targeted" for cleavage mediated by a nucleic acid inhibitor molecule containing a nucleic acid sequence that is partially, substantially, or completely or fully complementary to the target sequence.
[0036] As used herein, unless otherwise specified, a "therapeutically effective amount" of a compound is an amount sufficient to provide a therapeutic benefit in the treatment of a disease, disorder, or condition or to delay or minimize one or more symptoms associated with the disease, disorder, or condition. A therapeutically effective amount of a compound means an amount of a therapeutic agent that provides a therapeutic benefit in the treatment of a disease, disorder, or condition, alone or in combination with other treatments. The term "therapeutically effective amount" may encompass an amount that improves the overall treatment, reduces or avoids the symptoms or causes of a disease or condition, or enhances the therapeutic efficacy of another therapeutic agent.
[0037] The embodiments disclosed herein are not intended to be limited in any way by the above exemplary lists of chemical groups and substituents. Those skilled in the art will recognize that several embodiments are possible within the scope and spirit of the present disclosure. The following description is illustrative of the present disclosure and should not by any means be construed as limiting the scope of the invention described herein.
[0038] Treatment method Provided herein is a method of treating a disease or disorder associated with constitutively activated PLCγ2 by administering to a subject in need thereof an effective amount of a BTK-reducing molecule. PLCγ2 plays an important role in both the adaptive and innate immune systems. In particular, in the adaptive immune system, PLCγ2 plays a fundamental role in B cell development, affects the survival and antibody production of mature B cells, and is an essential and immediate proximal component of the B cell receptor (BCR) signaling cascade that occurs when the BCR is bound and stimulated by its cognate antigen. Apart from the involvement of the BCR, there are alternative signaling pathways such as CD38, CD40, IL-4R, etc. that are initiated via extracellular immunoreceptors that also rely on PLCγ2 to transmit signals.
[0039] This application demonstrates that, for example, reduction or elimination of BTK, by proteolytically degrading BTK or reducing BTK expression, is synthetically lethal to cells having constitutively activated PLCγ2, as opposed to merely inhibiting the catalytic function of BTK. In particular, it is unexpected that BTK-reducing molecules can be used to treat disorders having constitutively active PLCγ2, given that gain-of-function mutations in PLCγ2 are thought to be one of the major mechanisms of acquired resistance to therapeutic BTK inhibitors in B-cell lymphoma. See, for example, Woyach et al., J. Clinical Oncology, 2017, 35(13):1437-1443; Ahn et al., Blood, 2017, 129(11):1469-1479. Considering the downstream position of PLCγ2 relative to BTK in the signaling cascade and the clinical observation of gain-of-function mutations in PLCγ2 that confer acquired resistance to BTK inhibitors, one of ordinary skill in the art would not have expected that reducing or eliminating the amount of BTK in a cell would have any effect on constitutively active PLCγ2. Without intending to be bound by any theory, it is believed that reducing or eliminating the amount of BTK not only reduces or eliminates the kinase activity of BTK, but also reduces or eliminates BTK-mediated scaffold interactions with other molecules in the signaling cascade, such as PLCγ2.
[0040] Since PLCγ2 deficiency is associated with various diseases, including those having an immunological basis such as inflammation, autoimmunity, immunodeficiency, and allergies, as well as hematological malignancies (Jackson et al., J. Biol. Chem., 2021, 297(2):100905), this finding has important implications in the treatment of diseases or disorders associated with constitutively activated PLCγ2, such as cancer and immune system disorders.
[0041] Accordingly, in one aspect, the present disclosure provides the use of a BTK-reducing molecule for treating in a subject in need of treatment for a disease or disorder associated with constitutively activated PLCγ2.
[0042] In another aspect, the present disclosure provides the use of a BTK-reducing molecule in the manufacture of a medicament for the treatment of a subject in need of treatment for a disease or disorder associated with constitutively activated PLCγ2.
[0043] In a further aspect, the present disclosure provides a method of treating a disease or disorder associated with constitutively activated PLCγ2, the method comprising administering to a subject in need thereof an effective amount of a BTK-reducing molecule. In some embodiments, the subject does not have a mutation in the BTK gene.
[0044] In some embodiments, the disease or disorder associated with constitutively activated PLCγ2 is a cancer, such as a blood cancer or a solid tumor. In some embodiments, the cancer is resistant to a BTK inhibitor (e.g., ibrutinib, acalabrutinib, zanubrutinib, or tirabrutinib, etc.). In some embodiments, the cancer is resistant to ibrutinib. In some embodiments, the disease or disorder associated with constitutively activated PLCγ2 is an immune system disorder.
[0045] Blood cancers such as B-cell malignancies may include, but are not limited to, leukemia, lymphoma, B-cell lymphoma, non-Hodgkin lymphoma (NHL), chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), mantle cell lymphoma (MCL), marginal zone lymphoma (MZL), Waldenström macroglobulinemia (WM), transformed CLL or Richter transformation, diffuse large B-cell lymphoma (DLBCL), follicular lymphoma (FL), central nervous system (CNS) lymphoma, endemic Burkitt lymphoma (EBL), and mucosa-associated lymphoid tissue (MALT)-associated gastric lymphoma, Hodgkin lymphoma (HL), and multiple myeloma (MM). Thus, in some embodiments, the disease or disorder associated with constitutively activated PLCγ2 according to the present disclosure is a B-cell malignancy. In some embodiments, the disease or disorder associated with constitutively activated PLCγ2 according to the present disclosure is leukemia, lymphoma, B-cell lymphoma, NHL, CLL, SLL, MCL, MZL, WM, transformed CLL or Richter transformation, DLBCL, FL, CNS lymphoma, EBL, MALT-associated gastric lymphoma, HL, or MM. In some embodiments, the disease or disorder associated with constitutively active PLCγ2 according to the present disclosure is CLL, SLL, MCL, MZL, or WM.
[0046] Solid tumors may include, but are not limited to, skin cancer, bladder cancer, breast cancer, uterine cancer, ovarian cancer, urothelial cancer, prostate cancer, lung cancer, colorectal cancer, cervical cancer, liver cancer, head and neck cancer, pancreatic cancer, kidney cancer, gastric cancer, brain cancer, sarcoma, osteosarcoma, esophageal squamous cell carcinoma, esophageal adenocarcinoma, and mesothelioma. Thus, in some embodiments, the disease or disorder associated with constitutively activated PLCγ2 according to the present disclosure is skin cancer, bladder cancer, breast cancer, uterine cancer, ovarian cancer, urothelial cancer, prostate cancer, lung cancer, colorectal cancer, cervical cancer, liver cancer, head and neck cancer, pancreatic cancer, kidney cancer, gastric cancer, brain cancer, sarcoma, osteosarcoma, esophageal squamous cell carcinoma, esophageal adenocarcinoma, or mesothelioma. In some embodiments, the disease or disorder associated with constitutively activated PLCγ2 according to the present disclosure is lung cancer, breast cancer, prostate cancer, colorectal cancer, urothelial cancer, pancreatic cancer, or liver cancer.
[0047] Immune system disorders can include, but are not limited to, allergies, autoinflammatory diseases, chronic inflammatory disorders, autoimmune diseases, rheumatoid arthritis (RA), osteoarthritis (OA), systemic lupus erythematosus (SLE), multiple sclerosis (MS), Sjögren's syndrome, systemic sclerosis, pemphigus, immune thrombocytopenic purpura (ITP), idiopathic pulmonary fibrosis (IPF), myositis, atopic dermatitis (AD), psoriasis, chronic graft-versus-host disease (GvHD), atherosclerosis, asthma, chronic obstructive pulmonary disease (COPD), and inflammatory bowel disease (IBD). Immune system disorders caused by PLCγ2 dysfunction, particularly constitutively activated PLCγ2, can include, but are not limited to, PLCγ2-related antibody deficiency and immunodeficiency syndrome (PLAID), familial cold autoinflammatory syndrome 3 (FCAS3), autoinflammation, antibody deficiency and immunodeficiency syndrome (APLAID), and common variable immunodeficiency (CVID). Thus, in some embodiments, the disease or disorder associated with constitutively activated PLCγ2 according to the present disclosure is an allergy, an autoinflammatory disease, a chronic inflammatory disorder, an autoimmune disease, an autoinflammatory disease, a chronic inflammatory disorder, RA, OA, SLE, MS, Sjögren's syndrome, systemic sclerosis, ITP, IPF, AD, psoriasis, chronic GvHD, atherosclerosis, asthma, COPD, or IBD. In some embodiments, the disease or disorder associated with constitutively activated PLCγ2 according to the present disclosure is PLAID, FCAS3, APLAID, or CVID.
[0048] In some embodiments, prior to administering a BTK-reducing molecule to a subject, the subject has been identified as having constitutively activated PLCγ2 in one or more cells. Thus, in some embodiments, the methods of the disclosure further comprise identifying cancer cells or immune cells obtained from a subject as having constitutively activated PLCγ2 as compared to control cells. Since constitutively activated PLCγ2 in cancer cells is due to somatic mutations, the control cells used to identify whether cancer cells have constitutively activated PLCγ2 can be non-cancer cells obtained from the same subject. Conversely, since constitutively activated PLCγ2 in immune cells is due to germline mutations, the control cells used to identify whether immune cells have constitutively activated PLCγ2 can be cells obtained from a healthy subject. As used herein, a "healthy subject" refers to a subject who does not have, or is not suspected of having, any disease or disorder, particularly an immune system disorder. Preferably, the cells obtained from a healthy subject are from the same tissue as the immune cells obtained from the subject.
[0049] Accordingly, in some embodiments, provided herein is a method of treating a subject in need of treatment for cancer associated with constitutively activated PLCγ2, the method comprising identifying cancer cells obtained from the subject as having constitutively activated PLCγ2 as compared to non-cancer cells obtained from the same subject, and administering to the subject an effective amount of a BTK-reducing molecule. In some embodiments, provided herein is a method of treating a subject in need of treatment for an immune system disorder associated with constitutively activated PLCγ2, the method comprising identifying immune cells obtained from the subject as having constitutively activated PLCγ2 as compared to cells obtained from a healthy subject, and administering to the subject an effective amount of a BTK-reducing molecule.
[0050] Whether cells such as cancer cells or immune cells constitutively express activated PLCγ2 can be determined by any method known in the art. For example, since PLCγ2 catalyzes the hydrolysis of the cell membrane lipid phosphatidylinositol 4,5-bisphosphate (PIP2) to generate inositol 3,4,5-trisphosphate (IP3) and diacylglycerol (DAG), the activity of PLCγ2 can be determined by measuring the production of IP3 by hydrolysis of the substrate PIP2 in the cell. Cells with constitutively activated PLCγ2 have an increased ability to produce IP3 compared to control cells that can be determined using standard chemical or radiolabeling techniques known in the art. For example, the measurement of IP3 kinetics can be performed based on the isotopic labeling of cell populations followed by extraction of the active (1,4,5) isomer from the inactive (1,3,4) isomer and HPLC separation (Balla et al., PNAS, 1986, 83(24):9323-9327). Alternatively, a radioligand assay can be used to measure the absolute mass change of IP3 from cell populations (Matsu-ura et al., Journal of Cell Biology, 2006, 173(5):755-765). IP3 sensors engineered to track intracellular IP3 changes in single live cells and cell populations can also be used (Gulyas et al., PLoS ONE, 2015, 10(5):e0125601). Constitutive activation of PLCγ2 can also be determined by measuring an increase in the level of calcium flux stimulated by IP3 (Novice et al., J. Clin. Immunology, 2020, 40:267-276). Other methods for determining the activity of PLCγ2 are also known in the art and may include detection of PLCγ2 phosphorylation by Western blot analysis, immunohistology and / or use of enzyme assays, or detection of the activity of one or more components of the signaling pathway.
[0051] In some embodiments, constitutively activated PLCγ2 is caused by one or more gain-of-function mutations in the gene encoding PLCγ2. Human PLCγ2 (GenBank accession number P16885, NP_002652.2) is a multi-domain protein 1265 amino acids in length and has the following amino acid sequence:
Chemical formula
Chemical formula
Chemical formula
Table 1
[0052] Numerous gain-of-function mutations in PLCγ2 are known in the art and are associated with various pathologies. For example, gain-of-function somatic mutations in PLCγ2 associated with cancer occur after treatment with BTK inhibition (e.g., use of the BTK inhibitor ibrutinib) for chronic lymphocytic leukemia and can result in constitutive downstream signaling and lymphocyte proliferation. Such gain-of-function somatic mutations in PLCγ2 associated with cancer include D334H (Maddocks et al., JAMA Oncol., 2015, 1(1):80-87), P664S (Ahn et al., Blood, 2017, 129(11):1469-1479), R665W (Woyach et al., N. Engl. J. Med., 2014, 370:2286-2294), S707Y (Woyach et al., N. Engl. J. Med., 2014, 370:2286-2294), S707P (Maddocks et al., JAMA Oncol., 2015, 1(1):80-87), S707F (Maddocks et al., JAMA Oncol., 2015, 1(1):80-87), A708P (Jones et al., Leukemia, 2017, 31:1645-1647), R742P (Maddocks et al., JAMA Oncol., 2015, 1(1):80-87), L845F (Woyach et al., N. Engl. J. Med., 2014, 370:2286-2294), L845V (Jones et al., Leukemia, 2017, 31:1645-1647), D993Y (Woyach et al., N. Engl. J. Med., 2014, 370:2286-2294), D993H (Jones et al., Leukemia, 2017, 31:1645-1647), D1140G (Maddocks et al., JAMA Oncol., 2015, 1(1):80-87), D1140Y (Jones et al., Leukemia, 2017, 31:1645-1647), D1140N (Jones et al., Leukemia, 2017, 31:1645-1647), D1140E (Jones et al.,Leukemia,2017,31:1645-1647), D1140V (Jones et al., Leukemia,2017,31:1645-1647), M1141R (Burger et al., Nature Communications,2016,7:11589), F1142L (Jones et al., Leukemia,2017,31:1645-1647), M1141K (Burger et al., Nature Communications,2016,7:11589), D1144N (Jones et al., Leukemia,2017,31:1645-1647), D1144G (Jones et al., Leukemia,2017,31:1645-1647) may be included, but are not limited thereto. Furthermore, a gain-of-function mutation associated with cancer caused by a partial deletion of the PLCγ2 gene, including a 6-nucleotide deletion (c.2120-2125del) in exon 20 of the PLCγ2 gene resulting in the deletion of S707 and A708 of SEQ ID NO: 1, has also been reported (Ahn et al., Blood,2017,129(11):1469-1479).
[0053] Similarly, germline heterozygous gain-of-function mutations in PLCγ2 that result in various immunodeficiencies are also known in the art, including but not limited to the P139S (Kutukculer et al., Clin. Case Rep., 2021, 9:2023-2031), T168A (Kutukculer et al., Clin. Case Rep., 2021, 9:2023-2031), I169V (Wu et al., Front. Immunol., 2021, 12:667430), Y482H (Kutukculer et al., Clin. Case Rep., 2021, 9:2023-2031), N571S (Kutukculer et al., Clin. Case Rep., 2021, 9:2023-2031), S707Y (Zhou et al., Am. J. Hum. Genet., 2012, 91:713-720), S707P (Park et al., European Journal of Medical Genetics, 2022, 65(1):104387), A708P (Martin-Nalda et al, Annual Meeting of European Society for Immunodeficiencies, 2017), S718R (Kutukculer et al., Clin. Case Rep., 2021, 9:2023-2031), L848P (Neves et al., Front. Immunol., 2018, 9:2863; Park et al., European Journal of Medical Genetics, 2022, 65(1):104387), M1141L (Jackson et al., J. Biol. Chem., 2021, 297(2):100905), M1141K (Novice et al., Journal of Clinical Immunology, 2020, 40:267-276) mutations in human PLCγ2 (SEQ ID NO: 1).Furthermore, gain-of-function mutations associated with immunodeficiency caused by partial deletion of the PLCγ2 gene have also been reported, including exon 19 deletion (Ombrello et al., N. Engl. J. Med., 2012, 366:330-338), exon 20-22 deletion (Ombrello et al., N. Engl. J. Med., 2012, 366:330-338), and deletion of L845-L848 of SEQ ID NO: 1 (Martin-Nalda et al, Annual Meeting of European Society for Immunodeficiencies, 2017).
[0054] Accordingly, in some embodiments, one or more gain-of-function mutations in the gene encoding PLCγ2 that result in constitutively activated PLCγ2 include one or more nucleotide deletions in the PLCγ2 gene and / or one or more mutations at P139, T168, I169, D334, Y482, N571, P664, R665, S707, A708, S718, R742, L845, L848, D993, D1140, M1141, F1142, or D1144 of SEQ ID NO: 1. In some embodiments, one or more gain-of-function mutations in the gene encoding PLCγ2 that result in constitutively activated PLCγ2 include one or more of the following mutations: P139S, T168A, I169V, D334H, Y482H, N571S, P664S, R665W, S707Y, S707P, S707F, A708P, S718R, R742P, L845F, L845V, L848P, D993Y, D993H, D1140G, D1140Y, D1140N, D1140E, D1140V, M1141L, M1141R, M1141K, F1142L, D1144N, or D1144G of SEQ ID NO: 1, or a deletion of at least amino acids S707 - A708 of PLCγ2 (SEQ ID NO: 1), or a deletion of at least amino acids L845 - L848 of PLCγ2 (SEQ ID NO: 1), or a deletion of one or more nucleotides in exons 19 - 22 of the gene encoding PLCγ2. In some embodiments, the deletion is a partial deletion of exons 19 - 22. In some embodiments, the deletion is a deletion of exon 19 in its entirety or a deletion of exons 20 - 22. In some embodiments, the deletion is a complete deletion of exon 19 in its entirety of the PLCγ2 gene. In some embodiments, the deletion is a complete deletion of exons 20 - 22 in its entirety of the PLCγ2 gene.
[0055] In some embodiments, one or more gain-of-function mutations in the gene encoding PLCγ2 that result in constitutively activated PLCγ2 include one or more of the following mutations: D334H, P664S, R665W, S707Y, S707P, S707F, A708P, R742P, L845F, L845V, D993Y, D993H, D1140G, D1140Y, D1140N, D1140E, D1140V, M1141R, M1141K, F1142L, D1144N, or D1144G of SEQ ID NO: 1, or at least a deletion of S707 - A708 of PLCγ2 (SEQ ID NO: 1), or a deletion of one or more nucleotides in exon 20 of the gene encoding PLCγ2, and the disease or disorder associated with constitutively activated PLCγ2 is cancer. In other embodiments, one or more gain-of-function mutations in the gene encoding PLCγ2 that result in constitutively activated PLCγ2 include one or more of the following mutations: P139S, T168A, I169V, Y482H, N571S, S707Y, S707P, A708P, S718R, L848P, M1141L, or M1141K of SEQ ID NO: 1, or at least a deletion of amino acids L845 - L848 of PLCγ2 (SEQ ID NO: 1), or a deletion of one or more nucleotides in exons 19 - 22 of the gene encoding PLCγ2, such as a complete deletion of exon 19 or a complete deletion of exons 20 - 22 of the PLCγ2 gene, and the disease or disorder associated with constitutively activated PLCγ2 is an immune system disorder.
[0056] Human PLCγ2 is a multi-domain protein characterized by an N-terminal pleckstrin homology (PH) domain (amino acid residues 15-134 of SEQ ID NO: 1), an EF hand domain (amino acid residues 138-294 of SEQ ID NO: 1), a catalytic domain, and a calcium-binding (C2) domain (amino acid residues 1061-1187 of SEQ ID NO: 1). Further, specifically to the PLCγ family, PLCγ2 has a specific array of domains (γSA) inserted via a loop within a catalytic domain (amino acid residues 320-454 and 928-1027 of SEQ ID NO: 1) that includes a "split PH domain", two SH2 domains (amino acid residues 531-617 and 646-735 of SEQ ID NO: 1), and one SH3 domain (amino acid residues 772-827 of SEQ ID NO: 1). This multi-domain insert (amino acid residues 477-907 of SEQ ID NO: 1) in the catalytic domain constitutes the regulatory domain of PLCγ2. See, for example, Magno et al., Molecular Neurodegeneration, 2121, 16:22. Genomic deletions (Δ19 and Δ20-22) and APLAID-related somatic mutations that cause PLAID are located within the regulatory domain of PLCγ2 (e.g., S707Y, L848P, A708P of SEQ ID NO: 1) or within the calcium-binding domain (e.g., M1141L of SEQ ID NO: 1), and mutations obtained as a result of BTK inhibition (e.g., S707Y, L845F of SEQ ID NO: 1) have been reported to be found in the regulatory domain of PLCγ2. See, for example, Jackson et al., J. Biol. Chem., 2021, 297(2):100905. Thus, in some embodiments, one or more gain-of-function mutations within the gene encoding PLCγ2 that result in constitutively activated PLCγ2 are located within the regulatory domain and / or the calcium-binding domain of PLCγ2. As used herein, "regulatory domain" and "calcium-binding domain" refer to regions located within or in the immediate vicinity (e.g., plus / minus 6 amino acid residues) of amino acid residues 477-907 and amino acid residues 1061-1187 of human PLCγ2 (SEQ ID NO: 1), respectively.In some embodiments, one or more gain-of-function mutations located within the regulatory domain and / or calcium-binding domain of PLCγ2 include one or more mutations at Y482, N571, P664, R665, S707, A708, S718, R742, L845, L848, D1140, M1141, F1142, or D1144 of SEQ ID NO: 1. In some embodiments, one or more gain-of-function mutations located within the regulatory domain and / or calcium-binding domain of PLCγ2 include one or more of the following mutations: Y482H, N571S, P664S, R665W, S707Y, S707P, S707F, A708P, S718R, R742P, L845F, L845V, L848P, D993Y, D993H, D1140G, D1140Y, D1140N, D1140E, D1140V, M1141L, M1141R, M1141K, F1142L, D1144N, or D1144G of SEQ ID NO: 1.
[0057] Gain-of-function mutations in PLCγ2 typically result in constitutive phospholipase activity, as measured by standard enzyme assays described elsewhere in this specification, such as those described in Everett et al. (J. Biol. Chem., 2009, 284(34):23083-23093), Woyach et al. (N. Engl. J. Med., 2014, 370:2286-2294), or Novice et al. (J. Clin. Immunol., 2020, 40:267-276), which in turn can lead to a gain-of-function phenotype due to constitutively activated PLCγ2. However, in some situations, such as in certain non-malignant immune cells, constitutively activated PLCγ2 can lead to a decrease in PLCγ2-dependent signaling and function, i.e., loss of PLCγ2 downstream functions that can be a direct result of chronic signaling, in the same way that chronic B cell receptor stimulation leads to decreased amplitude calcium currents, changes in signaling cascades, and ultimately proliferative anergy (Ombrello et al., N. Engl. J. Med., 2012, 366:330-338). There are several possible explanations for the mechanism underlying the reduction of PLCγ2-mediated signaling. For example, increased phospholipase activity can lead to depletion of one or more substrates, such as the substrate PIP2 that is proximal to PLCγ2, resulting in impairment of IP3 production and IP3-mediated calcium release. Alternatively, if the concentration of the product of PLCγ2 is too high, it can induce downregulation of feedback-mediated distal signaling pathways and induce anergy. Nevertheless, the specific mechanism that results in the reduction of PLCγ2-mediated signaling has not been elucidated. See Ombrello et al., N. Engl. J. Med., 2012, 366:330-338.
[0058] Thus, in some embodiments, one or more gain-of-function mutations in PLCγ2 can result in a gain-of-function phenotype in a subject to be treated by the methods disclosed herein. In other embodiments, one or more gain-of-function mutations in PLCγ2 can result in a loss-of-function phenotype in a subject to be treated by the methods disclosed herein.
[0059] BTK-reducing molecule Any molecule that can reduce or eliminate the amount of BTK in a cell can be used as a BTK-reducing molecule in any of the methods disclosed herein. Reduction or elimination of the amount of BTK can be achieved in several ways. For example, small molecules that can induce proteolytic degradation of BTK, such as proteolysis-targeting chimeras, can be used to reduce or eliminate the amount of BTK (see, e.g., Sakamoto et al., PNAS, 2001, 98:8554-8559; Sakamoto et al., Methods Enzymol., 2005, 399:833-847). Alternatively, the amount of BTK can be reduced or eliminated using nucleic acid molecules that can induce sequence-specific inhibition of BTK gene expression, such as antisense oligonucleotides, microRNAs, ribozymes, antagomirs, aptamers, or RNAi molecules.
[0060] a. BTK degrading agent molecule In one aspect, the BTK-reducing molecules of the present disclosure are BTK degrader molecules such as small molecules that reduce or eliminate the amount of BTK by inducing proteolytic degradation of BTK. Proteolysis-targeting chimeras are a novel strategy for the selective knockdown of target proteins by small molecules (Sakamoto et al., PNAS, 2001, 98:8554-8559; Sakamoto et al., Methods Enzymol., 2005, 399:833-847). Proteolysis-targeting chimeras utilize the ubiquitin-protease system to target specific proteins and induce their degradation within cells (Zhou et al., Mol. Cell, 2000, 6(3):751-756; Neklesa et al., Pharmacol. Ther., 2017, 174:138-144; Lu et al., Eur. J. Med. Chem., 2018, 146:251-259). Thus, in some embodiments, the BTK degrader molecules of the present disclosure are proteolysis-targeting chimeras.
[0061] In some embodiments, the BTK degrader molecules useful in the methods of the present disclosure are compounds of Formula I described in PCT Application No. PCT / US22 / 14830, which is hereby incorporated by reference in its entirety:
Chemical formula
Chemical formula
Chemical formula
[0062] In some embodiments, L in formula I has a length of 2 to 12 carbon atoms, and one or more carbon atoms may be independently C(=O), O, S, S(O), SO2, C(O)NH, C(O)NCH3, C(O)NCH2CH3, NH, NCH3, NCH2CH3, C2-alkynyl [Chemical formula] is replaced by a group selected from.
[0063] In some embodiments, the BTK degrader molecules useful in the methods of the present disclosure are [Chemical formula] [Chemical formula] [Chemical formula] compounds of or a pharmaceutically acceptable salt thereof. Methods for preparing compounds of Formula I, such as compounds of Formulas I-A to I-P, are described in PCT Application No. PCT / US22 / 14830, which is hereby incorporated by reference in its entirety.
[0064] In some embodiments, the BTK degrader molecules useful in the methods of the present disclosure are compounds of Formula II described in International Publication No. WO 2021 / 113557, which is hereby incorporated by reference: [Chemical formula] or a pharmaceutically acceptable salt thereof, wherein W is CH or N; D is a bond or -NH-; Ring A is phenyl, a substituted phenyl group; Ring B is a 4- to 6-membered heterocycloalkyl where the heterocyclic alkyl can be substituted with halogen, CN, and a heterocycle, and the heterocycle can contain N and / or O; L is C, where each carbon can be substituted with -O-, -N(R)-C(O)-, -N(R)-, -C(O)-, -S-, -SO-, SO2-, -C(O)-N(R)-, a 4- to 6-membered monocyclic cycloalkyl or a 4- to 6-membered monocyclic heterocycle 0-12 is a linker, and R can be lower alkyl, and lower alkyl substituted with halogen, alkoxy, CN and hydroxyl groups, Y is,
Chemical formula
[0065] In some embodiments, the BTK degrader molecules useful in the methods of the present disclosure are compounds having the following formula described in International Publication No. WO 2021 / 113557, which is incorporated herein by reference:
Chemical formula
[0066] In some embodiments, the BTK degrader molecules useful in the methods of the present disclosure are compounds of Formula III described in International Publication No. WO 2020 / 239103, which is incorporated herein by reference:
Chemical formula
Chemical formula
Chemical formula
[0067] In some embodiments, the BTK degrader molecules useful in the methods of the present disclosure are compounds having the following formula described in International Publication No. WO 2020 / 239103, which is incorporated herein by reference: [Chemical Formula] or a pharmaceutically acceptable salt thereof.
[0068] In some embodiments, the BTK degrader molecules useful in the methods of the present disclosure are compounds of Formula IV described in International Publication No. WO 2021 / 219071, which is incorporated herein by reference: [Chemical Formula] [wherein X and Y can independently be CH or N] or a pharmaceutically acceptable salt thereof.
[0069] The BTK degrader molecules of Formula 1 can be synthesized according to Schemes 1, 2, 3, and 4 below.
[0070] Scheme 1: Synthesis of BTK degrader molecules having Formula I-A to Formula I-J, Formula I-L, and Formula I-M. [Chemical Formula]
[0071] Scheme 2: Synthesis of BTK degrader molecules having Formula I-K and Formula I-N. [Chemical Formula]
[0072] Scheme 3: Synthesis of BTK degrader molecules having Formula I-O. [Chemical Formula]
[0073] Scheme 4: Synthesis of BTK degrader molecules having formula I-P.
Chemical formula
[0074] BTK degrader molecules having formulae II-A, II-B and II-C can be prepared according to the methods described in International Publication No. WO 2021 / 113557, which is incorporated herein by reference. BTK degrader molecules having formulae III-A, III-B, III-C and III-D can be prepared according to the methods described in International Publication Nos. WO 2020 / 239103 and WO 2022 / 052950, which are incorporated herein by reference. BTK degrader molecules having formula IV can be prepared according to the procedures described in International Publication No. WO 2021 / 219071, which is incorporated herein by reference.
[0075] b. BTK nucleic acid inhibitor molecules In another aspect, the BTK-reducing molecule of the present disclosure is a nucleic acid inhibitor molecule that reduces or eliminates the expression of BTK, resulting in a reduction or elimination in the amount of BTK. As used herein, the term "nucleic acid inhibitor molecule" refers to an oligonucleotide molecule that reduces or eliminates the expression of a target gene, and the oligonucleotide molecule contains a region that specifically targets a sequence in the target gene mRNA (i.e., BTK mRNA). Typically, the targeting region of the nucleic acid inhibitor molecule contains a sequence that is sufficiently complementary to a segment of the target nucleic acid sequence (e.g., SEQ ID NO: 3) to direct the effect of the nucleic acid inhibitor molecule to a specific target gene (i.e., the BTK gene). The nucleic acid inhibitor molecule may contain ribonucleotides, deoxyribonucleotides, and / or modified nucleotides. RNAi inhibitor molecules (including small interfering RNAs ("siRNAs")), antisense oligonucleotides, ribozymes, microRNAs, antagomirs, and aptamers are all examples of nucleic acid inhibitor molecules that have demonstrated the ability to regulate the intracellular RNA levels of a target gene. Antisense oligonucleotides and RNAi molecules against the human BTK gene have been previously disclosed, for example, in U.S. Patent No. 9,982,265, which is hereby incorporated by reference in its entirety.
[0076] The sequence corresponding to the mRNA transcript of human BTK is shown below (SEQ ID NO: 3). This corresponds to the database sequence under GenBank accession number NM_000061.3, which is a 2575 nucleotide sequence defined as "Homo sapiens Bruton tyrosine kinase (BTK), transcript variant 1, mRNA". The coding region is located at nucleotides 161-2140. As is understood in the art, the thymine bases of SEQ ID NO: 3 are replaced by uracil bases in the RNA molecule. Thus, as used herein, the DNA sequence (e.g., SEQ ID NO: 3) and the RNA sequence corresponding to the DNA sequence (i.e., the sequence of SEQ ID NO: 3 in which the thymine bases are replaced by uracil bases) are considered to contain the same "sequence".
Chemical formula
[0077] In certain embodiments, the nucleic acid inhibitor molecule is a single-stranded nucleic acid inhibitor molecule. Single-stranded nucleic acid inhibitor molecules include, for example, antisense oligonucleotides, microRNAs, ribozymes, aptamers, antagomirs, and single-stranded RNAi inhibitor molecules, all of which are known in the art.
[0078] As used herein, the term "antisense oligonucleotide" refers to a single-stranded oligonucleotide that inhibits the expression of a target gene by one of the following mechanisms: (1) steric hindrance, e.g., the antisense oligonucleotide interferes with some steps in a series of events involved in gene expression and / or the production of the encoded protein by directly interfering with, for example, gene transcription, pre-mRNA splicing, and mRNA translation; (2) induction of enzymatic digestion of the RNA transcript of the target gene by RNase H; (3) induction of enzymatic digestion of the RNA transcript of the target gene by RNase L; (4) induction of enzymatic digestion of the RNA transcript of the target gene by RNase P; (5) induction of enzymatic digestion of the RNA transcript of the target gene by double-stranded RNase; and (6) a combination of steric hindrance and induction of enzymatic digestion activity in the same antisense oligo. Conventional antisense oligonucleotides do not have an RNAi mechanism of action like RNAi molecules. Antisense oligonucleotides have been used for decades to reduce the expression of specific target genes. See, for example, Pelechano and Steinmetz, Nature Review Genetics, 2013, 14:880-93. RNAi molecules can be distinguished from antisense oligonucleotides in several ways, including the requirement for Ago2 to bind to the RNAi antisense strand such that the antisense strand is directed towards the intended target(s) of the Ago2 protein, and the case where Ago2 is required for silencing of the target. The antisense oligonucleotides of the present disclosure can be of any length effective for inhibition of the BTK gene / coding sequence.
[0079] Typically, antisense oligonucleotides are from about 6 to about 50 nucleotides (e.g., at least about 12, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides), and can be of a length of about 100 to about 200 nucleotides or more. In certain embodiments, the antisense oligonucleotide has 8 - 80, 14 - 50, 16 - 30, 12 - 25, 12 - 22, 14 - 20, 18 - 22 or 20 - 22 nucleotides. In certain embodiments, the antisense oligonucleotide has 18 - 22, e.g., 18 - 20 nucleotides. In certain embodiments, the antisense oligonucleotide or a portion thereof is completely complementary to the target nucleic acid sequence within SEQ ID NO: 3. In certain embodiments, the antisense oligonucleotide or a portion thereof is complementary to at least 12, 13, 14, 15, 16, 17, 18, 19, 20 or more consecutive nucleotides of the target nucleic acid sequence within SEQ ID NO: 3. In certain embodiments, the antisense oligonucleotide contains 5, 4, 3, 2 or 1 or fewer non - complementary nucleotides relative to the target nucleic acid sequence within SEQ ID NO: 3. It is possible to reduce the length of the antisense oligonucleotide and / or introduce mismatched bases without eliminating activity.
[0080] In some embodiments, the nucleic acid inhibitor molecule is an antisense oligonucleotide comprising a single - stranded polynucleotide containing a sequence that is at least about 90% or at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% complementary to a segment of human BTK mRNA or the coding DNA sequence (SEQ ID NO: 3).
[0081] In some embodiments, the nucleic acid inhibitor molecule is an RNAi molecule. As used herein, the term "RNAi molecule" refers to (a) a double-stranded nucleic acid inhibitor molecule (a "dsRNAi molecule," also referred to as an siRNA molecule in the art) having a sense strand (passenger) and an antisense strand (guide), wherein the antisense strand or a portion of the antisense strand is used by the Argonaute 2 (Ago2) endonuclease in the cleavage of the target mRNA, or (b) a single-stranded nucleic acid inhibitor molecule (an "ssRNAi molecule") having a single-stranded antisense strand, wherein the antisense strand (or a portion of the antisense strand) is used by the Ago2 endonuclease in the cleavage of the target mRNA. See, for example, Matsui et al., Molecular Therapy, 2016, 24(5):946-55.
[0082] In certain embodiments, the nucleic acid inhibitor molecule is an ssRNAi molecule. In certain embodiments, the nucleic acid inhibitor molecule is an ssRNAi molecule having 14 to 50, 16 to 30, or 15 to 25 nucleotides. In other embodiments, the ssRNAi molecule has 18 to 22 or 20 to 22 nucleotides. In certain embodiments, the ssRNAi molecule has 20 nucleotides. In other embodiments, the ssRNAi molecule has 22 nucleotides. In some embodiments, the ssRNAi molecule comprises a single-stranded polynucleotide comprising a sequence that is at least about 90% or at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary to a segment of the human BTK mRNA or the coding DNA sequence (SEQ ID NO: 3).
[0083] In certain embodiments, the nucleic acid inhibitor molecule is a dsRNAi molecule. Various double-stranded RNAi inhibitor molecule structures are known in the art. Initial studies on RNAi inhibitor molecules focused on double-stranded nucleic acid molecules having a size of 19-25 nucleotides with at least one 3' overhang of 1-5 nucleotides on each strand (see, for example, U.S. Patent No. 8,372,968). Subsequently, longer double-stranded RNAi inhibitor molecules that are processed in vivo by the Dicer enzyme into active RNAi inhibitor molecules were developed (see, for example, U.S. Patent No. 8,883,996). Later studies have developed extended double-stranded nucleic acid inhibitor molecules in which at least one end of at least one strand extends beyond the double-stranded targeting region of the molecule.
[0084] The dsRNAi molecules of the present disclosure can be of any length effective for the inhibition of the BTK gene / coding sequence. In some embodiments of the dsRNAi molecule, the sense strand and the antisense strand range from 15-66, 25-40, or 19-25 nucleotides. In some embodiments, the sense strand is 18-66 nucleotides in length. In certain embodiments, the sense strand is 18-25 nucleotides in length. In certain embodiments, the sense strand is 18, 19, 20, 21, 22, 23, or 24 nucleotides in length. In certain embodiments, the sense strand is 25 nucleotides to 45 nucleotides in length. In certain embodiments, the sense strand is 30-40 nucleotides in length. In certain embodiments, the sense strand is 36, 37, 38, 39, or 40 nucleotides in length. In certain embodiments, the sense strand is 25-30 nucleotides in length. In certain embodiments, the sense strand is 25, 26, or 27 nucleotides in length.
[0085] In some embodiments of the dsRNAi molecule, the antisense strand is 18 to 66 nucleotides in length. Typically, the antisense strand contains a sequence that is sufficiently complementary to a sequence in the BTK gene / coding sequence to direct the effect of the nucleic acid inhibitor molecule to the target BTK gene. In some embodiments, the antisense strand contains a nucleic acid sequence that is at least about 90% or at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% complementary to a segment of the human BTK mRNA or coding DNA sequence (SEQ ID NO: 3). In certain embodiments, the antisense strand contains a sequence that is perfectly complementary to the sequence contained in the human BTK mRNA or coding DNA sequence (SEQ ID NO: 3).
[0086] In certain embodiments, the antisense strand is 18 to 40 nucleotides in length. In some of these particular embodiments, the antisense strand is 20 to 50 nucleotides in length. In certain embodiments, the antisense strand is 20 to 30 nucleotides in length. In certain embodiments, the antisense strand is 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides in length. In certain embodiments, the antisense strand is 35 to 40 nucleotides in length. In some of these particular embodiments, the antisense strand is 36, 37, 38 or 39 nucleotides in length.
[0087] In some embodiments of the dsRNAi inhibitor molecule, the sense and antisense strands form a double-stranded structure of 15 to 50 base pairs. In certain embodiments, the double-stranded region is 15 to 30 base pairs in length, such as 19 to 30 base pairs in length, more typically 18 to 26 base pairs in length, such as 19 to 23 base pairs in length, and in certain cases 19 to 21 base pairs in length. In certain embodiments, the double-stranded region is 19, 20, 21, 22, 23, 24, 25, or 26 base pairs in length.
[0088] In certain embodiments, the dsRNAi inhibitor molecule comprises a sense strand, an antisense strand, and a double-stranded region of 19-21 nucleotides (the sense strand is 19-21 nucleotides in length and the antisense strand is 21-23 nucleotides in length), and includes a single-stranded overhang of 1-2 nucleotides at its 3' end.
[0089] In certain embodiments, the dsRNAi inhibitor molecule has a 21-nucleotide-long antisense strand and a 21-nucleotide-long sense strand, with two nucleotide 3'-passenger strand overhangs (3' end of the sense strand / 5' end of the antisense strand) on the right side of the molecule and two nucleotide 3'-guide strand overhangs (5' end of the sense strand / 3' end of the antisense strand) on the left side of the molecule. Such a molecule has a 19-base pair double-stranded region.
[0090] In certain embodiments, the dsRNAi inhibitor molecule has a 23-nucleotide-long antisense strand and a 21-nucleotide-long sense strand, with a blunt end (3' end of the sense strand / 5' end of the antisense strand) on the right side of the molecule and two nucleotide 3'-guide strand overhangs (5' end of the sense strand / 3' end of the antisense strand) on the left side of the molecule. Such a molecule has a 21-base pair double-stranded region.
[0091] In some embodiments, the nucleic acid inhibitor molecule is a microRNA. As used herein, the terms "microRNA" and "miRNA" are interchangeable and refer to non-coding RNA molecules encoded in the genomes of plants and animals. Typically, mature microRNAs are about 18 to 25 nucleotides in length. In certain examples, highly conserved endogenously expressed microRNAs regulate gene expression by binding to the 3' untranslated region (3'-UTR) of a particular mRNA. Certain mature microRNAs often appear to be derived from long endogenous primary microRNA transcripts (also known as pre-microRNA, pri-microRNA, pri-mir, pri-miR or pri-pre-microRNA) that are hundreds of nucleotides in length (Lee, et al., EMBO J., 2002, 21(17):4663-4670).
[0092] In some embodiments, the nucleic acid inhibitor molecule is an aptamer. As used herein, the term "aptamer" refers to an oligonucleotide having binding affinity for a specific target, including nucleic acids, proteins, specific whole cells or specific tissues. Aptamers may be obtained using methods known in the art, for example, by in vitro selection from large random sequence pools of nucleic acids. Lee et al., Nucleic Acid Res., 2004, 32:D95-D100.
[0093] In some embodiments, the nucleic acid inhibitor molecule is an antagomir. As used herein, the term "antagomir" refers to an oligonucleotide having binding affinity for a specific target that includes an exogenous RNAi inhibitor molecule or the guide strand of a natural miRNA (Krutzfeldt et al. Nature 2005, 438(7068):685-689).
[0094] In some embodiments, the nucleic acid inhibitor molecule is a ribozyme. As used herein, the term "ribozyme" refers to a catalytic nucleic acid molecule that specifically recognizes and cleaves a distinct target nucleic acid sequence, which can be either DNA or RNA. Each ribozyme has a catalytic component (also referred to as the "catalytic domain") and a target sequence binding component consisting of two binding domains, one on each side of the catalytic domain.
[0095] Methods for making nucleic acid inhibitor molecules such as antisense oligonucleotides or RNAi molecules are conventional. For example, in vitro methods for making RNAi molecules include processing a polynucleotide sequence in a cell-free system (e.g., digestion of long dsRNA by RNase III or Dicer), transcribing recombinant double-stranded DNA in vitro, and preferably, chemical synthesis of a nucleotide sequence homologous to the BTK sequence. See, for example, Tuschl et al., Genes & Dev., 1999, 13:3191-3197. In vivo methods, on the other hand, can include: (1) Transfecting a cell with a DNA vector such that the substrate is converted to an RNAi molecule in vivo (see, for example, Kawasaki et al., Nucleic Acids Res., 2003, 31:700-707; Miyagishi et al., Nature Biotechnol., 2003, 20:497-500; Lee et al., Nature Biotechnol., 2003, 20:500-505; Brummelkamp et al., Science, 2003, 296:550-53; McManus et al., RNA, 2002, 8:842-850; Paddison et al., Gene.Dev., 2002, 16:948-958; Paddison et al., PNAS, 2002, 99:1443-1448; Paul et al., Nature Biotechnol., 2002, 20:505-508; Yu et al., PNAS, 2002, 99:6047-6052); (2)Using an RNA polymerase III (pol III) promoter to express shRNA from a plasmid system (see, e.g., Kawasaki et al., supra; Miyagishi et al., supra; Lee et al., supra; Brummelkamp et al., supra; McManus et al., supra; Paddison et al., supra (both); Paul et al., supra, and Yu et al., supra); and / or (3)Expressing short RNAs from tandem promoters (see, e.g., Miyagishi et al., supra; Lee et al., supra).
[0096] When synthesized in vitro, typical micromolar scale RNA synthesis provides about 1 mg of RNAi molecules, which is sufficient for about 1000 transfection experiments using a 24-well tissue culture plate format. Generally, to inhibit BTK expression in cells in culture, one or more RNAi molecules can be added to the cells in the culture medium, typically at about 1 ng / ml to about 10 μg of RNAi molecules / ml.
[0097] For further guidance on designing and preparing RNAi molecules, testing them for efficacy, and using them in methods of RNAi (both in vitro and in vivo), see, for example, Allshire, Science, 2002, 297:1818-1819; Volpe et al., Science, 2002, 297:1833-1837; Jenuwein, Science, 2002, 297:2215-2218; Hall et al., Science, 2002, 297:2232-2237; Hutvagner et al., Science, 2002, 297:2056-2060; McManus et al., supra; Reinhart et al., Genes. Dev., 2002.16:1616-1626; Reinhart et al., Science, 2002, 297:1831; Moss, Curr. Biol., 2001, 11:R772-775; Brummelkamp et al., Science, 2002, 296:550-553; Bass, Nature, 2001, 411:428-429; Elbashir et al., supra; U.S. Patent No. 6,506,559; U.S. Patent Application 2003 / 0206887; WO99 / 07409; WO99 / 32619; WO00 / 01846; WO 00 / 44914; WO00 / 44895; WO2001 / 29058; WO2001 / 36646; WO2001 / 75164; WO2001 / 92513; WO2001 / 29058; WO2001 / 89304; WO2001 / 90401; WO2002 / 16620; and WO2002 / 29858 (all of which are incorporated herein by reference).
[0098] The nucleic acid inhibitor molecules of the present disclosure, such as antisense oligonucleotides, RNAi molecules, microRNAs, aptamers, antagomirs or ribozymes, can take any form including modified versions described for antisense nucleic acid molecules; they can be delivered to cells and introduced into cells as oligonucleotides (single-stranded or double-stranded), or in the form of expression vectors, using any method known in the art.
[0099] Dosage Forms and Compositions The methods disclosed herein include administering to a subject an effective amount of a BTK-reducing molecule. This can occur, for example, after identifying a subject as having a disease or disorder associated with constitutively activated PLCγ2, such as cancer or an immune system disorder, by identifying the subject as having constitutively activated PLCγ2 or one or more gain-of-function mutations in the gene encoding PLCγ2 in one or more cells.
[0100] Accordingly, the present disclosure provides a pharmaceutical composition containing, as an active ingredient, a BTK-reducing molecule disclosed herein and one or more pharmaceutically acceptable excipients, carriers (including inert solid diluents and fillers), diluents (including sterile aqueous solutions and various organic solvents), permeation enhancers, solubilizing agents, and adjuvants. The pharmaceutical composition can be administered alone or in combination with other therapeutic agents. Such compositions are prepared by methods well known in the pharmaceutical art (see, for example, Remington’s Pharmaceutical Sciences, Mace Publishing Co., Philadelphia, Pa. 17th Ed. (1985); and Modern Pharmaceutics, Marcel Dekker, Inc. 3rd Ed. (G.S. Banker & C.T. Rhodes, Eds.)).
[0101] The pharmaceutical composition can be in the form of a liquid, solution, suspension, emulsion, elixir, syrup, tablet, lozenge, granule, powder, capsule, cachet, pill, ampule, suppository, pessary, ointment, gel, paste, cream, spray, mist, foam, lotion, oil, bolus, electrophoresis, or aerosol.
[0102] The pharmaceutical composition can be administered in a single dose or multiple doses by any of the acceptable modes of administration of agents having similar utility, including, for example, oral (e.g., by ingestion); topical (e.g., including transdermal, intranasal, ocular, oral, and sublingual); pulmonary (e.g., by inhalation or insufflation therapy, e.g., using an aerosol, e.g., via the mouth or nose); rectal; vaginal; parenteral, e.g., by injection including subcutaneous, intradermal, intramuscular, intravenous, intraarterial, intracardiac, intrathecal, intraspinal, intracapsular, subcapsular, intraorbital, intraperitoneal, intratracheal, subepidermal, intraarticular, subarachnoid, and intrasternal; and, for example, by implant of a depot, e.g., subcutaneous or intramuscular. In some embodiments, the compounds or pharmaceutical compositions of the present disclosure are administered orally.
[0103] One mode of administration is parenteral, particularly by injection. Forms in which the compositions of the present disclosure can be incorporated for parenteral administration include aqueous or oily suspensions or emulsions (including sesame oil, corn oil, cottonseed oil, or peanut oil), as well as elixirs, mannitol, dextrose, or sterile aqueous solutions, and similar pharmaceutical vehicles. Aqueous solutions of physiological saline have also been conventionally used for injection, but are less preferred in the context of the present disclosure. Ethanol, glycerol, propylene glycol, liquid polyethylene glycols, etc. (and suitable mixtures thereof), cyclodextrin derivatives, and vegetable oils can also be used. Suitable fluidity can be maintained, for example, by use of a coating such as lecithin, by maintenance of the required particle size in the case of a dispersion, and by use of a surfactant. Prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc.
[0104] The sterile injection solution is prepared by incorporating the required amount of the compound according to the present disclosure, in the required amount in a suitable solvent, together with various other ingredients listed above as appropriate, followed by filtration sterilization. Generally, the dispersion is prepared by incorporating various sterilized active ingredients into a sterilized vehicle containing a basic dispersion medium and the necessary other ingredients from those listed above. In the case of sterile powders for the preparation of sterile injection solutions, the preferred method of preparation is vacuum drying and lyophilization techniques that yield a powder of the active ingredient + any additional desired ingredients from its previously sterilized solution.
[0105] Oral administration is another route for administering the BTK-reducing molecule according to the present disclosure. Administration can be effected via capsules or tablets, etc. In manufacturing a pharmaceutical composition containing at least one BTK-reducing molecule described herein, the active ingredient is usually diluted by an excipient and / or encapsulated in such a carrier which can be in the form of a capsule, sachet, paper or other container. When the excipient acts as a diluent, it can be in the form of a solid, semi-solid or liquid material (such as those mentioned above) that acts as a vehicle, carrier or medium for the active ingredient. Thus, the composition can be in the form of tablets, pills, powders, lozenges, sachets, cachets, elixirs, suspensions, emulsions, solutions, syrups, aerosols (as a solid or liquid medium), for example ointments containing up to 10% by weight of the active compound, soft and hard gelatin capsules, sterile injection solutions, and sterile packaged powders.
[0106] Some examples of suitable excipients include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, tragacanth, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, sterile water, syrup, and methylcellulose. The formulations can further contain lubricants such as talc, magnesium stearate, and mineral oil; wetting agents; emulsifying and suspending agents; preservatives such as methyl hydroxybenzoate and propyl hydroxybenzoate; sweetening agents; and flavoring agents.
[0107] The compositions of the present disclosure can be formulated to provide rapid, sustained, or delayed release of the active ingredient after administration to a subject by using procedures known in the art. Controlled release drug delivery systems for oral administration include osmotic pump systems and dissolution systems containing polymer-coated reservoirs or drug-polymer matrix formulations. Examples of controlled release systems are provided in U.S. Patent Nos. 3,845,770; 4,326,525; 4,902,514; and 5,616,345. Another formulation for use in the methods of the present invention uses a transdermal delivery device (“patch”). Such transdermal patches can be used to provide continuous or discontinuous infusion of a controlled amount of the compounds of the present disclosure. The construction and use of transdermal patches for the delivery of pharmaceuticals are well known in the art. See, for example, U.S. Patent Nos. 5,023,252, 4,992,445, and 5,001,139. Such patches can be constructed for continuous, pulsatile, or on-demand delivery of pharmaceuticals.
[0108] The composition is preferably formulated in unit dosage forms of from about 1 to 1000 mg, or from about 1 to 500 mg, or from about 1 to 250 mg, or from about 1 to 150 mg, or from about 0.5 to 100 mg, or from about 1 to 50 mg of the active ingredient(s) per about 50 - 70 kg subject. The term "unit dosage form" refers to physically discrete units suitable as unitary dosages for human subjects and other mammals, each unit containing a predetermined quantity of the active material calculated to produce the desired therapeutic effect in association with a suitable pharmaceutical excipient (e.g., tablet, capsule, ampoule). The BTK-reducing molecule is generally administered in a pharmaceutically effective amount. Preferably, for oral administration, each dosage unit contains from about 1 mg to about 2 g of the BTK-reducing molecule described herein, and for parenteral administration, preferably from about 0.1 to about 700 mg of the BTK-reducing molecule described herein. However, the actual amount of the BTK-reducing molecule administered will usually be determined by the physician in light of the relevant circumstances including the condition being treated, the selected route of administration, the actual BTK-reducing molecule administered and its relative activity, the age, weight and response of the individual patient, the severity of the patient's symptoms, etc.
[0109] In some embodiments, any of the BTK-reducing molecules of the present disclosure, such as the BTK degrading agent molecules disclosed herein, are administered to a subject at a dosage of from about 0.1 mg / kg to about 500 mg / kg (e.g., from about 0.5 mg / kg to about 400 mg / kg, from about 0.7 mg / kg to about 300 mg / kg, from about 1 mg / kg to about 250 mg / kg, from about 1.5 mg / kg to about 200 mg / kg, from about 2 mg / kg to about 150 mg / kg, from about 1 mg / kg to about 100 mg / kg, from about 0.1 mg / kg to about 100 mg / kg, from about 0.1 mg / kg to about 50 mg / kg, or from about 0.1 mg / kg to about 10 mg / kg).
[0110] To prepare solid compositions such as tablets, the main active ingredient is mixed with pharmaceutical excipients to form a solid preformulation composition containing a homogeneous mixture of the BTK-reducing molecules of the present disclosure. When these preformulation compositions are referred to as homogeneous, it means that the active ingredient is evenly dispersed throughout the composition so that the composition can be easily subdivided into equally effective unit dosage forms such as tablets, pills, and capsules.
[0111] The tablets or pills of the present disclosure may be coated or otherwise formulated to provide a dosage form that provides the advantage of a long-acting effect or to protect from the acidic conditions of the stomach. For example, a tablet or pill can include inner and outer dosage component, with the latter in the form of an envelope over the former. The two components can be separated by an enteric layer that resists disintegration in the stomach and allows the inner component to enter the duodenum intact or allows for a delayed release. A variety of materials can be used for such enteric layers or coatings, such materials including a number of polymeric acids and mixtures of polymeric acids with materials such as shellac, cetyl alcohol, and cellulose acetate.
[0112] Compositions for inhalation or insufflation include solutions and suspensions in pharmaceutically acceptable aqueous or organic solvents or mixtures thereof, as well as powders. Liquid or solid compositions may contain the appropriate pharmaceutically acceptable excipients described above. Preferably, the compositions are administered by the oral or nasal respiratory route for local or systemic effects. Preferably, the compositions in pharmaceutically acceptable solvents can be nebulized by the use of an inert gas. Nebulized solutions may be inhaled directly from the nebulizing device or the nebulizing device may be attached to a face mask tent or intermittent positive pressure breathing apparatus. Solution, suspension or powder compositions may be administered from a device that delivers the formulation, preferably orally or nasally.
[0113] In one aspect, provided herein is a dosage form or a composition in a dosage form that includes a BTK-reducing molecule disclosed herein in an amount of from about 0.1 mg to about 1 g (e.g., from about 0.1 mg to about 750 mg, from about 0.2 mg to about 500 mg, from about 0.5 mg to about 200 mg, from about 1 mg to about 150 mg, from about 2.5 mg to about 150 mg, from about 10 mg to about 120 mg) and a pharmaceutically acceptable excipient.
[0114] In some embodiments, the dosage form or the composition in the dosage form includes a BTK-reducing molecule disclosed herein in an amount of about 1 g, about 750 mg, about 500 mg, about 200 mg, 190 mg, 180 mg, 170 mg, 160 mg, 150 mg, 140 mg, 130 mg, 120 mg, 110 mg, 100 mg, about 90 mg, about 85 mg, about 80 mg, about 75 mg, about 70 mg, about 65 mg, about 60 mg, about 55 mg, about 50 mg, about 45 mg, about 40 mg, about 35 mg, about 30 mg, about 25 mg, about 20 mg, about 15 mg, about 10 mg, about 7 mg, about 5 mg, about 2.5 mg, about 2 mg, about 1.5 mg, or about 1 mg.
[0115] In another aspect, the present disclosure provides a dosage form or a composition in a dosage form that includes a plurality of particles of a BTK-reducing molecule disclosed herein and a pharmaceutically acceptable excipient, wherein the amount of the plurality of particles of the BTK-reducing molecule disclosed herein in the dosage form is from about 0.1 mg to about 500 mg (e.g., from about 0.5 mg to about 200 mg, from about 1 mg to about 150 mg, from about 10 mg to about 120 mg).
[0116] In some embodiments, the plurality of particles of the BTK-reducing molecule disclosed herein in the dosage form or the composition is from about 2.5 mg to about 150 mg (e.g., from about 10 mg to about 150 mg, from about 20 mg to about 150 mg, from about 70 mg to about 120 mg, from about 30 mg to about 60 mg, about 100 mg, about 50 mg).
[0117] In some embodiments, the dosage form or composition is configured for oral administration. In some embodiments, the dosage form is in solid form. In some embodiments, the dosage form is in the form of a capsule. In some embodiments, the pharmaceutical excipients in the capsule are fillers (e.g., cellulose derivatives (e.g., microcrystalline cellulose), starches (e.g., hydrolyzed starch and partially pregelatinized starch), anhydrous lactose, lactose monohydrate, sugar alcohols (e.g., sorbitol, xylitol, and mannitol)).
[0118] In some embodiments, the dosage form is in liquid form. In some embodiments, the dosage form is in the form of a solution. In some embodiments, the pharmaceutical excipients in the solution are selected from the group consisting of fillers (e.g., polymers (e.g., PEG 400)), emulsifiers (e.g., castor oil derivatives (e.g., Kolliphor RH40)), surfactants (e.g., glycerides (e.g., Labrafil M2125 CS), vitamin derivatives (e.g., vitamin E TPGS)), and solvents (e.g., propylene glycol, ethanol, diethylene glycol monoethyl ether (or Transcutol HP)).
[0119] In some embodiments, the concentration of the BTK-reducing molecule disclosed herein in solution is from about 0.1 mg / mL to about 10 mg / mL (e.g., from about 0.5 mg / mL to about 10 mg / mL, from about 1 mg / mL to about 10 mg / mL, from about 2 mg / mL to about 10 mg / mL, from about 3 mg / mL to about 10 mg / mL, from about 4 mg / mL to about 10 mg / mL, from about 5 mg / mL to about 10 mg / mL, from about 6 mg / mL to about 10 mg / mL, from about 0.1 mg / mL to about 8 mg / mL, from about 0.5 mg / mL to about 8 mg / mL, from about 1 mg / mL to about 8 mg / mL, from about 2 mg / mL to about 8 mg / mL, from about 3 mg / mL to about 8 mg / mL, from about 4 mg / mL to about 8 mg / mL, from about 5 mg / mL to about 8 mg / mL, from about 6 mg / mL to about 8 mg / mL, from about 0.5 mg / mL to about 6 mg / mL, from about 1 mg / mL to about 6 mg / mL, from about 2 mg / mL to about 6 mg / mL, from about 3 mg / mL to about 6 mg / mL, from about 4 mg / mL to about 6 mg / mL, from about 0.5 mg / mL to about 4 mg / mL, from about 1 mg / mL to about 4 mg / mL, or from about 2 mg / mL to about 4 mg / mL).
[0120] In some embodiments, the concentration of the BTK-reducing molecule disclosed herein in solution is about 0.1 mg / mL, about 0.5 mg / mL, about 1 mg / mL, about 2 mg / mL, about 3 mg / mL, about 4 mg / mL, about 5 mg / mL, about 6 mg / mL, about 7 mg / mL, about 8 mg / mL, about 9 mg / mL, or about 10 mg / mL.
[0121] In some embodiments, the dosage form is in the form of a suspension. In some embodiments, the concentration of the BTK-reducing molecule disclosed herein in the suspension is about 0.1 mg / mL, about 0.5 mg / mL, about 1 mg / mL, about 1.5 mg / mL, about 2 mg / mL, about 2.5 mg / mL, about 3 mg / mL, about 3.5 mg / mL, about 4 mg / mL, about 4.5 mg / mL, about 5 mg / mL, about 6 mg / mL, about 7 mg / mL, about 8 mg / mL, about 9 mg / mL, about 10 mg / mL, about 11 mg / mL, about 12 mg / mL, about 13 mg / mL, about 14 mg / mL, about 15 mg / mL, about 20 mg / mL, about 25 mg / mL.
[0122] In some embodiments, the concentration of the BTK-reducing molecules disclosed herein in the suspension is from about 0.1 mg / mL to about 10 mg / mL (e.g., from about 0.5 mg / mL to about 10 mg / mL, from about 1 mg / mL to about 10 mg / mL, from about 2 mg / mL to about 10 mg / mL, from about 3 mg / mL to about 10 mg / mL, from about 4 mg / mL to about 10 mg / mL, from about 5 mg / mL to about 10 mg / mL, from about 6 mg / mL to about 10 mg / mL, from about 0.1 mg / mL to about 8 mg / mL, from about 0.5 mg / mL to about 8 mg / mL, from about 1 mg / mL to about 8 mg / mL, from about 2 mg / mL to about 8 mg / mL, from about 3 mg / mL to about 8 mg / mL, from about 4 mg / mL to about 8 mg / mL, from about 5 mg / mL to about 8 mg / mL, from about 6 mg / mL to about 8 mg / mL, from about 0.5 mg / mL to about 6 mg / mL, from about 1 mg / mL to about 6 mg / mL, from about 2 mg / mL to about 6 mg / mL, from about 3 mg / mL to about 6 mg / mL, from about 4 mg / mL to about 6 mg / mL, from about 0.5 mg / mL to about 4 mg / mL, from about 1 mg / mL to about 4 mg / mL, or from about 2 mg / mL to about 4 mg / mL).
[0123] In vivo administration can be affected in one dose continuously or intermittently throughout the course of treatment (e.g., in divided doses at appropriate intervals). The most effective means and amounts of administration are well known to those skilled in the art and vary depending on the formulation used in the treatment, the purpose of the treatment, the target cells being treated, and the subject being treated. Single or multiple administrations can be carried out at dose levels and patterns selected by the treating physician.
Example
[0124] The following examples are provided so that the embodiments described herein can be more fully understood. The examples described in this application are provided to illustrate the compounds, pharmaceutical compositions, and methods provided herein and should in no way be construed as limiting their scope.
[0125] Example 1. Effects of the BTK-reducing molecule of Formula I-D and the BTK inhibitor ibrutinib on the inhibition of cancer cell proliferation in vitro The parental REC1 cells were obtained from the American Type Culture Collection (ATCC). The PLCγ2 gene in the REC-1 cell line was edited using CRISPR-Cas9 technology to create a point mutation from S to Y at residue 707 of the PLCγ2 protein, or a point mutation from L to F at residue 845 of the PLCγ2 protein. For gene editing, first, the gRNA complex of PLCγ2 S707Y or PLCγ2 L845F was prepared using Alt-R CRISPR-Cas9 tracrRNA and crRNA PLCγ2 S707Y (5’-CAGACTCTCAAAATAGGCGG-3’) or PLCγ2 L845F (5’-TTATTGAAGACAATCCCTTA-3’) (IDT-Integrated DNA Technologies), and then the ribonucleoprotein (RNP) complex of PLCγ2 S707Y or PLCγ2 L845F was prepared using each gRNA complex and Alt-R S.p.Cas9 nuclease V3 (IDT-Integrated DNA Technologies). Next, 1×10 5Individual REC-1 cells were electroporated with the PLCγ2 S707Y or PLCγ2 L845F RNP complex, the Alt-R Cas9 Electroporation Enhancer, and the respective ultramer DNA oligo of PLCγ2 S707Y (5’-TCCTGCTCCAGGGCTAGGGGCAAGGTAAAGCATTGTCGCATCAACCGGGACGGCCGGCACTTTGTGCTGGGGACCTACGCTTATTTTGAGAGTCTGGTGGAGCTCGTCAGTTACTACGAGAAGCATTCACTCTACCGAAAGATGAGACTGCGCT-3’) or PLCγ2 L845F (5’-TTTTCTTTTTATTATTCCCGTTACAACTAACGTGAGTTATGTCTTGTTTCTTCACAGATTATTGAAGACAATCCCTTTGGCTCTCTTTGCAGAGGAATATTGGACCTCAATACCTATAACGTCGGTACGTGCACACATCATCTTAGCCTGGAT-3’) (IDT-Integrated DNA Technologies) using the Neon Transfection System (Thermo Fisher) at 1400 V, 10 ms, 3 pulses. The cells were then seeded into 96-well plates for 10 days and selected with 100 nM ibrutinib for at least 6 passages. The S707Y and L845F mutations of PLCγ2 were further verified by Sanger sequencing using gDNA extracted from these cells.
[0126] The BTK-reducing molecule used in this study is a BTK degrader having the chemical structure of Formula I-D, which is shown below and described in PCT Application No. PCT / US22 / 14830, incorporated herein by reference, and was prepared according to the methods described therein. The BTK inhibitor used in this study was ibrutinib.
Chemical Structure
[0127] Parental REC1 cells (ATCC), engineered REC1 PLCγ2S707Y cells, or engineered REC-1 PLCγ2 L845F Cells were seeded at 8,000 cells / well in a 96-well plate in 90 μl of RPMI 1640 growth medium containing 10% heat-inactivated FBS and 1× penicillin streptomycin, and then incubated overnight at 37°C. The next day, test compounds were administered to the cells at various concentrations using a 10-fold compound stock solution prepared in growth medium. After compound administration, the cells were incubated at 37°C for 6 days. Prior to the CellTiter-Glo assay, the plates were equilibrated at room temperature for approximately 10 minutes. 100 μl of CELLTITER-GLO® reagent (Promega) was added to each well. The plates were then incubated at room temperature for 10 minutes, and luminescence was recorded by an EnSpire plate reader (PerkinElmer).
[0128] The results are shown in FIGS. 1A - 1C. As demonstrated in FIGS. 1B and 1C, in vitro treatment with the BTK degrader of formula I-D (“BTK degrader I-D”) significantly inhibited cell proliferation in engineered REC1 PLCγ2 S707Y cells and engineered REC-1 PLCγ2 L845F cells 6 days after administration, compared to in vitro treatment with ibrutinib, a conventional small molecule BTK inhibitor.
[0129] Example 2. In Vivo Efficacy of the BTK-Reducing Molecule of Formula I-D and the BTK Inhibitor Ibrutinib in a Mouse Xenograft Tumor Model As described in Example 1, parental REC1 cells (ATCC), engineered REC1 PLCγ2 S707Y cells, and engineered REC-1 PLCγ2 L845F cells were maintained in vitro as monolayer cultures at 37°C in an atmosphere of 5% CO2 in air in RPMI 1640 medium supplemented with 10% fetal bovine serum and 1× penicillin streptomycin. Tumor cells were passaged daily twice a week. Cells growing in the exponential growth phase were harvested and counted for tumor inoculation. Under the right flank of each mouse, 5×10 in 0.1 mL of PBS mixed with 0.1 mL of Matrigel for tumor development6 Individual tumor cells were subcutaneously inoculated. Treatment with the BTK degrader of Formula I-D (1.5 mg / kg, 3 mg / kg, 6 mg / kg, or 15 mg / kg, PO), ibrutinib (25 mg / kg, PO) or vehicle (PO) started when the average tumor size reached approximately 100 mm 3 The mice were assigned to groups using Excel-based randomization software that performs stratified randomization based on their tumor volumes. Tumor size was measured two-dimensionally three times a week using calipers, and the volume was calculated as V = 0.5a × b 2 (where a and b are the major and minor axes of the tumor, respectively) in mm 3 and expressed. Tumor growth inhibition (TGI) was calculated for each group using the formula: TGI (%) = [1 - (Ti - T0) / (Vi - V0)] × 100. Ti is the average tumor volume of the treatment group on a given day, T0 is the average tumor volume of the treatment group on the first day of treatment, Vi is the average tumor volume of the vehicle control group on the same day as Ti, and V0 is the average tumor volume of the vehicle group on the first day of treatment. The results are shown in Figures 2A - 2C. Figure 2A shows that ibrutinib and the BTK degrader of Formula I-D ("BTK degrader I-D") have similar effects in inhibiting tumor growth in control mice without the PLCγ2 mutation. However, in vivo treatment with the BTK degrader of Formula I-D significantly inhibited tumor growth in engineered REC1 PLCγ2 S707Y knock-in mice and REC-1 PLCγ2 L845F knock-in mice 14 days after dosing compared to in vivo treatment with ibrutinib, as demonstrated in Figures 2B and 2C. As shown in Figure 2B, when mice with engineered REC1 PLCγ2 S707Y knock-in tumors were treated in vivo with the BTK degrader of Formula I-D at doses of 3 mg / kg, 6 mg / kg or 15 mg / kg (PO), TGI of 61%, 74% or 86% was obtained 14 days after dosing, respectively, while only 5% TGI was obtained with in vivo treatment with ibrutinib. Similarly, as shown in Figure 2C, when mice with engineered REC1 PLCγ2 L845FWhen mice bearing knock-in tumors were treated in vivo with a BTK degrader of Formula I-D at a dose of 3 mg / kg, 6 mg / kg or 15 mg / kg (PO), TGI of 63%, 81% or 88% was obtained respectively 14 days after dosing, while only 12% TGI was obtained with in vivo treatment with ibrutinib.
[0130] Example 3. Analysis of inositol phosphate formation in COS-7 cells transfected with wild-type and mutant PLCγ2. The activity of PLCγ2 can be determined by analyzing inositol phosphate formation in cells such as COS-7 cells transfected with wild-type or mutant PLCγ2, as described in Everett et al., Characterization of Phospholipase Cγ Enzymes with Gain-of-Function Mutations, J. Biol. Chem., 2009, 284(34):23083-23093.
[0131] Briefly, COS-7 cells are maintained in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum and 1× penicillin streptomycin at 37°C in an atmosphere of 5% CO2 in air. Prior to transfection, COS-7 cells are seeded in 6-well plates at a density of 250,000 cells / well and grown overnight in 2 ml of growth medium. 1 μg of plasmid DNA of wild-type PLCγ2 or mutant PLCγ2 is transfected using Lipofectamine (Invitrogen) according to the manufacturer's protocol. 24 hours after transfection, COS-7 cells are washed twice with serum-free inositol-free DMEM and incubated in 0.25% fatty acid-free bovine serum albumin (Sigma) and 1.5 uCi / ml of myo-[2- 3Incubate in 1.5 ml of the same medium supplemented with inositol (MP Biomedicals) for 24 hours. After an additional 24 hours, incubate the cells for 1 hour in 1.2 ml of inositol-free DMEM containing serum with or without stimulation by 100 ng / ml of EGF (Calbiochem) and containing 20 mM of LiCl.
[0132] Lyse the cells by the addition of 1.2 ml of 4.5% perchloric acid and incubate on ice for 30 minutes. Then centrifuge the lysed sample at 3700 g for 20 minutes. Remove the supernatant and neutralize it by adding 3 ml of 0.5 M potassium hydroxide / 9 mM sodium tetraborate, and centrifuge at 3700 g for an additional 20 minutes.
[0133] Load the supernatant onto an AG1-X8 200 - 400 column (Bio-Rad), convert it to the formate form by the addition of 2 M ammonium formate / 0.1 M formic acid, and equilibrate with water. Wash the column three times with 5 ml of 60 mM ammonium formate / 5 mM sodium tetraborate, and elute inositol phosphates with 5 ml of 1.2 M ammonium formate / 0.1 M formic acid. Add 5 ml of Ultima-Flo scintillation fluid (PerkinElmer Life Sciences) to the eluate and quantify radioactivity by liquid scintillation counting. The values represent total inositol phosphates.
[0134] Resuspend the pellet from the first centrifugation in 100 μl of water and add 375 μl of chloroform / methanol / HCl (200:100:15). Vortex the sample and add an additional 125 μl of chloroform and 125 μl of 0.1 M HCl. After further vortexing, centrifuge the sample at 700 g for 10 minutes. Place 10 μl of the lower phase into a scintillation vial containing 3 ml of Ultima-Flo scintillation fluid and quantify radioactivity by liquid scintillation counting. The values obtained correspond to the radioactivity of inositol lipids.
[0135] PLCγ2 activity is in the phospholipid pool3 It is expressed as the total 3 H]-inositol phosphate formed relative to the amount of
[0136] Example 4. An assay for detecting the activity of PLCγ2 in DT40 cells stably expressing either wild-type or mutant PLCγ2. The activity of PLCγ2 can also be determined by measuring the increased level of calcium flux in DT40 cells stably expressing either wild-type or mutant PLCγ2, as described in Woyach et al., Resistance Mechanisms for the Bruton’s Tyrosine Kinase Inhibitor Ibrutinib, New England Journal of Medicine, 2014, 370:2286-2294.
[0137] Briefly, the intracellular calcium level of DT40 cells stably expressing either wild-type or mutant PLCγ2 is detected using a calcium assay kit (BD Biosciences) and measured using a Beckman Coulter DTX880 microplate reader according to the manufacturer's protocol. 195 seconds after acquisition to determine the baseline, 3 μg / ml anti-chicken IgM (SouthernBiotech) is added to stimulate the cells, and the fluorescence signal is recorded for an additional 660 seconds.
[0138] A PLCγ2 mutant that shows a higher calcium influx signal than wild-type PLCγ2 in the above assay is considered a gain-of-function mutant.
[0139] Example 5. Assay for detecting the activity of PLCγ2 in primary patient cells. The activity of PLCγ2 can also be determined by measuring the increased levels of calcium flux stimulated by IP3, as described in Novice et al., A Germline Mutation in the C2 Domain of PLCγ2 Associated with Gain-of-Function Expands the Phenotype for PLCG2-Related Diseases, Journal of Clinical Immunology, 2020, 40:267-276.
[0140] Briefly, PBMCs from a subject (e.g., a patient or healthy control) are washed once in HBSS (without Ca 2+ , without Mg 2+ , Life Technologies) + 1% FBS (GIBCO®) and resuspended at a concentration of 1×10 6 PBMC / mL in a dye loading buffer consisting of 4 μM FLUO-4AM (Molecular Probes) and probenecid (Life Technologies) in HBSS + 1% FBS for 45 minutes at 37°C. The cells are washed again with HBSS + 1% FBS and then incubated on ice for 20 minutes with 5 μL of PACIFIC BLUE™-CD19 (HIB19; BioLegend), followed by the addition of 1 mL of HBSS + 1% FBS. The sample is warmed again to 37°C and within 10 minutes, the baseline fluorescence in the CD19+ positive fraction is detected using an FITC filter on an LSR II flow cytometer. Intracellular calcium flux is induced by B cell receptor stimulation with 10 μg / mL of anti-IgM antibody (Jackson Immunoresearch) followed by the addition of extracellular Ca 2 and the external flux is measured. Intracellular and plasma calcium fluxes after B cell receptor stimulation in primary B cells of the subject are measured by flow cytometry.
[0141] An increase in extracellular calcium influx in primary B cells of a subject induced by B cell receptor stimulation compared to a control indicates that the subject has a gain-of-function mutation in PLCγ2.
[0142] The above disclosure has been described in some detail by way of illustration and example for clarity and understanding, but various changes in form and detail can be made without departing from the true scope of the disclosure, and it will be apparent to those skilled in the art upon reading this disclosure that it can be practiced within the scope of the appended claims. For example, all features, steps, elements, or other aspects of the constructs, methods, and / or components can be used in various combinations.
[0143] A claim or statement that includes "or" among one or more members of a group is considered satisfied if, unless otherwise indicated or unless it is clear from the context that it is not the case, one, more than one, or all of the group members are present in, used in, or otherwise related to a given product or process. The present disclosure includes embodiments where exactly one member of the group is present in, used in, or otherwise related to a given product or process. The present disclosure also includes embodiments where more than one or all of the group members are present in, used in, or otherwise related to a given product or process. Further, unless otherwise indicated or unless it is apparent to one of ordinary skill in the art that a contradiction or inconsistency would result, the present disclosure is to be understood to encompass all variations, combinations, and substitutions in which one or more limitations, elements, clauses, descriptive terms, etc. from one or more of the recited claims are introduced into another claim (or, as relevant, any other claim) that depends from the same basic claim. It is to be understood that when elements are presented as a list (e.g., a Markush group or similar format), each subgroup of the elements is also disclosed and any element(s) can be removed from the group. Generally, when an embodiment or aspect of the present disclosure is referred to as including a particular element, feature, etc., the particular embodiment or aspect consists of or consists essentially of such element, feature, etc. For the sake of brevity, such embodiments are not specifically described in as many words in all cases herein. It is also to be understood that any embodiment or aspect of the present disclosure can be explicitly excluded from the claims, whether or not a specific exclusion is recited herein.
[0144] All patents, patent applications, websites, other publications or documents, accession numbers, etc. cited herein are hereby incorporated by reference in their entirety for all purposes to the same extent as if each individual item were specifically and individually indicated to be incorporated by reference.
Claims
**Claim 1** A method of treating a disease or disorder associated with constitutively activated phosphatidylinositol-specific phospholipase Cγ2 (PLCγ2) in a subject in need thereof, the method comprising administering to the subject an effective amount of a Bruton's tyrosine kinase (BTK) reducing molecule. **Claim 2** A method of treating a disease or disorder associated with constitutively activated phosphatidylinositol-specific phospholipase Cγ2 (PLCγ2) in a subject in need thereof, the method comprising administering to the subject an effective amount of a Bruton's tyrosine kinase (BTK) reducing molecule, wherein the subject has been identified as having constitutively activated PLCγ2 in one or more cells prior to administering the BTK reducing molecule to the subject. **Claim 3** The method according to claim 1 or 2, wherein the constitutively activated PLCγ2 is caused by one or more gain-of-function mutations in the gene encoding PLCγ2. **Claim 4** The method according to any one of claims 1 to 3, wherein the disease or disorder associated with the constitutively activated PLCγ2 is cancer. **Claim 5** The method according to claim 4, wherein the cancer is a hematologic cancer or a solid tumor. **Claim 6** The method according to claim 5, wherein the hematologic cancer is a B cell malignancy. **Claim 7** The method according to claim 6, wherein the B cell malignancy is non-Hodgkin lymphoma (NHL). **Claim 8** The method according to claim 7, wherein the non-Hodgkin lymphoma (NHL) is chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), mantle cell lymphoma (MCL), marginal zone lymphoma (MZL), or Waldenström macroglobulinemia (WM). **Claim 9** The method according to any one of claims 4 to 8, wherein the cancer is resistant to a BTK inhibitor.
10. The method according to claim 9, wherein the BTK inhibitor is ibrutinib, acalabrutinib, zanubrutinib or tirabrutinib.
11. The method according to any one of claims 4 to 10, further comprising identifying that the cancer cells obtained from the subject have the constitutively activated PLCγ2 as compared with non-cancer cells obtained from the subject.
12. The method according to any one of claims 4 to 11, further comprising identifying that the cancer cells obtained from the subject have one or more gain-of-function mutations in the gene encoding PLCγ2.
13. The method according to any one of claims 1 to 3, wherein the disease or disorder associated with the constitutively activated PLCγ2 is an immune system disorder.
14. The method according to claim 13, wherein the immune system disorder is PLCγ2-related antibody deficiency and immunodysregulation syndrome (PLAID), familial cold autoinflammatory syndrome (FCAS3), autoinflammation, antibody deficiency and immunodysregulation syndrome (APLAID), common variable immunodeficiency (CVID).
15. The method according to claim 13 or 14, further comprising identifying that the immune cells obtained from the subject have the constitutively activated PLCγ2 as compared with cells obtained from a healthy subject.
16. The method according to any one of claims 13 to 15, further comprising identifying that the immune cells obtained from the subject have one or more gain-of-function mutations in the gene encoding PLCγ2.
17. The method according to any one of claims 3 to 16, wherein the one or more gain-of-function mutations include one or more mutations at amino acids P139, T168, I169, D334, Y482, N571, P664, R665, S707, A708, S718, R742, L845, L848, D993, D1140, M1141, F1142, or D1144 of SEQ ID NO: 1, or a deletion of one or more amino acids of SEQ ID NO:
1.
18. The method according to claim 17, wherein the one or more gain-of-function mutations include one or more of the following mutations: P139S, T168A, I169V, D334H, Y482H, N571S, P664S, R665W, S707Y, S707P, S707F, A708P, S718R, R742P, L845F, L845V, L848P, D993Y, D993H, D1140G, D1140Y, D1140N, D1140E, D1140V, M1141L, M1141R, M1141K, F1142L, D1144N, or D1144G of SEQ ID NO: 1, or a deletion of at least amino acids L845 to L848 of SEQ ID NO: 1, or a deletion of one or more nucleotides in exons 19 to 22 of the gene encoding SEQ ID NO:
1.
19. The method according to any one of claims 4 to 12, wherein the one or more gain-of-function mutations are one or more mutations in SEQ ID NO: 1, and the one or more mutations include one or more mutations selected from D334H, P664S, R665W, S707Y, S707P, S707F, A708P, R742P, L845F, L845V, D993Y, D993H, D1140G, D1140Y, D1140N, D1140E, D1140V, M1141R, M1141K, F1142L, D1144N, and D1144G, or a deletion of at least S707 to A708 of SEQ ID NO: 1, or a deletion of one or more nucleotides in exon 20 of the gene encoding SEQ ID NO:
1.
20. The above-mentioned one or more gain-of-function mutations are one or more mutations in SEQ ID NO: 1, and the one or more mutations are selected from P139S, T168A, I169V, Y482H, N571S, S707Y, S707P, A708P, S718R, L848P, M1141L, and M1141K, or a deletion of at least amino acids L845 to L848 of SEQ ID NO: 1, or a deletion of one or more nucleotides in exons 19 to 22 of the gene encoding SEQ ID NO:
1. The method according to any one of claims 13 to 16.
21. The above-mentioned one or more gain-of-function mutations are located within the regulatory domain and / or calcium-binding domain of PLCγ2. The method according to any one of claims 3 to 16.
22. The above-mentioned one or more gain-of-function mutations located within the regulatory domain and / or calcium-binding domain of PLCγ2 include one or more mutations at amino acids Y482, N571, P664, R665, S707, A708, S718, R742, L845, L848, D1140, M1141, F1142, or D1144 of SEQ ID NO:
1. The method according to claim 21.
23. The above-mentioned one or more gain-of-function mutations located within the regulatory domain and / or calcium-binding domain of PLCγ2 are one or more of the following mutations: Y482H, N571S, P664S, R665W, S707Y, S707P, S707F, A708P, S718R, R742P, L845F, L845V, L848P, D993Y, D993H, D1140G, D1140Y, D1140N, D1140E, D1140V, M1141L, M1141R, M1141K, F1142L, D1144N, or D1144G of SEQ ID NO:
1. The method according to claim 22.
24. The BTK-reducing molecule is a BTK degrading agent molecule. The method according to any one of claims 1 to 23.
25. The BTK degrading agent molecule is a compound of formula I: 【Chemical 1】 being wherein X is CH or N; wherein Y is CH or N; wherein R 1 is H, C 1 -C 3 alkyl, C 1 -C 3 haloalkyl, dialkylamino group, amino group, -CN, hydroxyl, C 1 -C 4 alkoxy, and halogen; wherein each R 2 and R 3 is independently selected from H, halogen, -CN, hydroxyl, dialkylamino group, C 1 -C 5 alkyl, deuterated C 1 -C 5 alkyl, C 1 -C 5 alkoxy, deuterated C 1 -C 5 alkoxy, and C 1 -C 5 haloalkyl; wherein Q is L-W 1 or L-W 2 ; wherein L is a linker having a length of 2 to 20 carbon atoms, and one or more carbon atoms are optionally independently replaced by a group selected from C(=O), O, N(R 6 ), S, S(O), SO 2 , C(O)NH, C(O)NCH 3 , C(O)NCH 2 CH 3 , C 2 -alkenyl, C 2 -alkynyl, cycloalkyl, heterocycloalkyl, heterocycle, aryl, or heteroaryl, each being independently substituted with 0, 1, 2, or 3 R 7 ; wherein W 1 is [Chemical Formula 2] selected from, wherein, R 4 is selected from H, halogen, -CN, C 1 -C 5 -alkyl, C 1 -C 5 -alkoxy, and C 1 -C 5 -haloalkyl; and wherein, W 2 is [Chemical Formula 3] and wherein, R 5 is selected from H, halogen, -CN, C 1 -C 5 -alkyl, deuterated C 1 -C 5 -alkyl, C 1 -C 5 -alkoxy, deuterated C 1 -C 5 -alkoxy, and C 1 -C 5 -haloalkyl; wherein, each R 6 is independently selected from H, C 1 -C 3 -alkyl, -C(=O)-(C 1 -C 3 -alkyl), -C(=O)-O-(C 1 -C 3 -alkyl), and -C(=O)-NH-(C 1 -C 3 -alkyl), each being substituted with 0, 1, 2, or 3 R 7 ; and wherein, each R 7 is independently selected from halogen, hydroxyl, amino group, C 1 -C 3 -alkyl, C 1 -C 3 -alkoxy, C 1 -C 3 -haloalkyl, -N(R 6 )2, and -CN, a compound, or a pharmaceutically acceptable salt thereof, the method according to claim 24.
26. L has a length of 2 to 12 carbon atoms, and one or more carbon atoms are optionally and independently C(=O), O, S, S(O), SO 2 , C(O)NH, C(O)NCH 3 , C(O)NCH 2 CH 3 , NH, NCH 3 , NCH 2 CH 3 , C 2 -alkynyl, 【Chemical formula 4】 The method according to claim 25, wherein the group is selected from and is replaced by a group.
27. The BTK degrading agent molecule is 【Chemical formula 5-1】 【Chemical formula 5-2】 【Chemical formula 5-3】 【Chemical formula 5-4】 Or a pharmaceutically acceptable salt thereof, the method according to claim 25 or 26.
28. The BTK degrading agent molecule is administered to the subject at a dose of about 0.1 mg / kg to about 500 mg / kg, the method according to any one of claims 24 to 27.
29. The BTK reducing molecule is a nucleic acid inhibitor molecule, the method according to any one of claims 1 to 23.
30. The nucleic acid inhibitor molecule is an antisense oligonucleotide, microRNA, RNAi molecule, aptamer, antagomir, or ribozyme, the method according to claim 29.
31. The subject is human, the method according to any one of claims 1 to 30.