Production of immune cells

By generating immune cells with a replaceable 'placeholder' TCR expression cassette, the method addresses the limitations of current immune cell therapies by enabling the production of antigen-specific immune cells that can effectively target cancer cells, thereby enhancing immunotherapy outcomes.

JP2025519445APending Publication Date: 2025-06-26ADAPTIMMUNE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024571908
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-06-10
Filing Date
2023-06-12
Publication Date
2025-06-26

AI Technical Summary

Technical Problem

Current adoptive immune cell therapies for cancer are limited by the lack of suitable patients and tumor-specific immune cells, necessitating the development of therapeutically sufficient and functional antigen-specific immune cells for effective immunotherapy.

Method used

The method involves generating immune cells with a heterologous expression cassette for a 'placeholder' productive T cell receptor (TCR), which is then replaced with an expression construct encoding a therapeutic antigen receptor, such as one specific to a patient's cancer cells, to prime the immune cells for therapeutic use.

Benefits of technology

This approach enables the production of immune cells that can specifically target cancer cells, enhancing the magnitude and duration of antitumor responses and expanding the eligible patient population and range of tumor types.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025519445000016
    Figure 2025519445000016
  • Figure 2025519445000017
    Figure 2025519445000017
  • Figure 2025519445000018
    Figure 2025519445000018
Patent Text Reader

Abstract

The present invention relates to a method for producing immune cells that express a therapeutic antigen receptor. Immune cells containing a heterologous expression cassette are provided. The heterologous expression cassette comprises (a) a coding sequence for a productive TCR, (b) a constitutive promoter operably linked to the coding sequence, (c) a 5' targeting site, and optionally (d) a 3' targeting site. The expression construct is then introduced into the immune cells at the site of the heterologous expression cassette. The expression construct contains a coding sequence for a therapeutic antigen receptor, and the therapeutic antigen receptor is then expressed in the immune cells. A method, reagents for use in the method, and immune cells.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the production of immune cells, for example, for use in immunotherapy.

Background Art

[0002] Immunotherapy is poised to transform the cancer treatment landscape by promising long-term survival (McDermott et al., Cancer Treat Rev. 2014 Oct; 40(9): 1056-64). There is a clear unmet medical need for new immunomodulatory agents to expand the eligible patient population and the range of tumor types. Furthermore, new agents are needed to enhance the magnitude and duration of antitumor responses. The development of these agents has been possible over the past 20 years due to a deep understanding of the basic principles that govern T cell immunity (Sharma and Allison, Cell. 2015 Apr 9; 161(2): 205-14). This typically requires tumor-specific immune cells, such as CD4+ and CD8+ T cells, which recognize tumor-associated peptide antigens presented by MHC molecules. Different vaccination strategies and adoptive transfer of ex vivo-expanded tumor-infiltrating lymphocytes have shown the ability of tumor-specific immune cells to treat advanced cancer in some cases (Rosenberg et al., Nat Med. 2004 Sep; 10(9): 909-15).

[0003] However, current adoptive immune cell therapies are limited by the lack of suitable patients and tumor-specific immune cells, and there is a need for therapeutically sufficient and functional antigen-specific immune cells for effective use in immunotherapy.

Summary of the Invention

[0004] The inventors have developed methods involving the generation of immune cells that include a heterologous expression cassette for a "placeholder" productive T cell receptor (TCR). After generation, the heterologous expression cassette may then be replaced with an expression construct encoding a therapeutic antigen receptor, such as an antigen receptor that binds to a patient's cancer cells, to prime the immune cells for therapeutic use in a patient. These methods can be useful for the production of immune cells, such as allogeneic immune cells for use in immunotherapy, particularly for the production of "personalized" immune cells having a therapeutic antigen receptor selected to bind to a patient's cancer cells.

[0005] A first aspect of the invention provides a method for producing immune cells that express a therapeutic antigen receptor, the method comprising: (i) providing immune cells that include a heterologous expression cassette, wherein the heterologous expression cassette (a) comprises a coding sequence for a productive T cell receptor (TCR), (b) a constitutive promoter operably linked to the coding sequence, and (c) a target site, and (ii) introducing into the immune cells, at the site of the heterologous expression cassette, an expression construct that includes a coding sequence for a therapeutic antigen receptor, wherein the introducing is such that the therapeutic antigen receptor is expressed within the immune cells.

[0006] In some embodiments of the first aspect of the invention, the heterologous expression cassette may be replaced by an expression construct that includes a coding sequence for a therapeutic antigen receptor. For example, a method for producing immune cells that express a therapeutic antigen receptor comprises: (i) providing immune cells that include a heterologous expression cassette, wherein the heterologous expression cassette (a) comprises a coding sequence for a productive T cell receptor (TCR), (b) a constitutive promoter operably linked to the coding sequence, and (c) a target site, (ii) introducing an expression construct comprising a coding sequence of a therapeutic antigen receptor into an immune cell at a site of a heterologous expression cassette, such that the therapeutic antigen receptor is expressed within the immune cell.

[0007] A second aspect of the present invention provides a method for producing an immune cell expressing a therapeutic antigen receptor, the method comprising: (i) providing an induced pluripotent stem cell (iPSC) comprising a heterologous expression cassette at a site in the genome of the iPSC, wherein the heterologous expression cassette comprises: (a) a coding sequence of a productive T cell receptor (TCR), (b) a constitutive promoter operably linked to the coding sequence, and (c) a target site; (ii) differentiating the iPSC into an immune cell; (iii) introducing an expression construct comprising a coding sequence of a therapeutic antigen receptor into the immune cell at a site of the heterologous expression cassette, such that the therapeutic antigen is expressed within the immune cell.

[0008] For example, a method for producing an immune cell expressing a therapeutic antigen receptor comprises: (i) providing an induced pluripotent stem cell (iPSC) comprising a heterologous expression cassette at a site in the genome of the iPSC, wherein the heterologous expression cassette comprises: (a) a coding sequence of a productive T cell receptor (TCR), (b) a constitutive promoter operably linked to the coding sequence, and (c) a target site; (ii) differentiating the iPSC into an immune cell; (iii) replacing the heterologous expression cassette in the immune cell with an expression construct comprising a coding sequence of a therapeutic antigen receptor, such that the coding sequence of the therapeutic antigen is expressed within the immune cell. This includes producing and replacing immune cells that express a therapeutic antigen receptor.

[0009] iPSCs may be provided in a method of a second aspect by transfecting the iPSCs with a nucleic acid containing a heterologous expression cassette, such that the heterologous expression cassette is integrated into the genome of the iPSCs.

[0010] A third aspect of the present invention provides immune cells comprising a heterologous expression cassette integrated into their genome, wherein the heterologous expression cassette (a) a coding sequence for producing a T cell receptor (TCR), (b) a constitutive promoter operably linked to the coding sequence, and (c) a target site.

[0011] In some embodiments of the first to third aspects, the therapeutic antigen receptor can specifically bind to cancer cells.

[0012] A fourth aspect of the present invention provides iPSCs comprising a heterologous expression cassette integrated into their genome, wherein the heterologous expression cassette (a) a coding sequence for producing a T cell receptor (TCR), (b) a constitutive promoter operably linked to the coding sequence, and (c) a target site.

[0013] In some embodiments of the first to fourth aspects, the target site may be a 5' target site. The heterologous expression cassette may further comprise a 3' target site.

[0014] The heterologous expression cassettes of the first to fourth aspects may further include a coding sequence for a poly(A) sequence.

[0015] A fifth aspect of the present invention provides a population of immune cells produced by the method of the first or second aspect.

[0016] The sixth aspect of the present invention provides a pharmaceutical composition comprising the population of immune cells of the fifth aspect and a pharmaceutically acceptable excipient.

[0017] The seventh aspect of the present invention provides a treatment method comprising administering a therapeutically effective dose of the population of immune cells of the fifth aspect to an individual in need thereof.

[0018] The individual may have a cancer condition.

[0019] Other aspects and embodiments of the present invention are described in more detail below.

Brief Description of the Drawings

[0020]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12A

Figure 12B

Figure 13

Figure 14A

Figure 14B

Figure 14C

Figure 14D

Figure 15A

Figure 15B

Figure 15C

Figure 15D

Figure 16A

Figure 16B

Figure 16C

Figure 16D

Figure 17A

Figure 17B

Figure 17C

Figure 17D

Figure 18A

Figure 18B

Figure 18C

Figure 18D

Figure 19A

Figure 19B

Figure 19C

Figure 19D

[0021] [Detailed Description of the Invention] The present invention relates to the production of immune cells that express a therapeutic antigen receptor, such as a T cell receptor (TCR). The immune cells are generated from iPSCs and contain a heterologous expression cassette that expresses a “placeholder” production TCR. Expression of the production TCR in the cells avoids differentiation arrest and enables the generation of mature immune cells, such as CD3+ T cells. The immune cells may then be primed using the heterologous expression cassette as a “landing pad” for an expression construct that contains a nucleotide sequence encoding a therapeutic antigen receptor. The expression construct is inserted into the genome of the immune cells at the site of the heterologous expression cassette. For example, the expression construct may replace the heterologous expression cassette in the immune cells. The expression construct replaces the heterologous expression cassette in the immune cells and then expresses the therapeutic antigen receptor. The immune cells produced as described herein may be useful for immunotherapy.

[0022] For example, the methods described herein may be useful for the rapid generation of immune cells for the treatment of cancer in a patient. Therapeutic antigen receptors expressed by the immune cells may be selected as being reactive with the patient's cancer cells. The antigen receptor may be, for example, a TCR obtained from the patient, or an antigen receptor expressed by other tumor infiltrating lymphocytes (TIL), or an antigen receptor known to be reactive with a tumor antigen identified as being expressed by the patient's cancer cells. An expression construct containing a nucleotide sequence encoding the antigen receptor may be used to replace the heterologous expression cassette to generate immune cells that are specifically reactive with the patient's cancer cells and may be useful for the treatment of the patient's cancer.

[0023] Immune cells suitable for use as described herein include T cells such as αβ+ T cells, γδ+ T cells, mucosal associated invariant (MAIT) T cells, and NK T cells.

[0024] T cells (also referred to as T lymphocytes) are white blood cells that play a central role in cell-mediated immunity. T cells can be distinguished from other lymphocytes by the presence of a T cell receptor (TCR) on the cell surface. There are several types of T cells, each with a distinct function.

[0025] T helper cells (T H cells) express the CD4 surface glycoprotein and are thus known as CD4 + T. CD4 + T cells play an important role in the adaptive immune system and assist the activity of other immune cells by releasing T cell cytokines and by helping to suppress or regulate the immune response. They are essential for the activation and proliferation of CD8+ T cells. CD8+ T cells (T C cells, CTLs, killer T cells, CD8+ T cells) express the CD8 surface glycoprotein. CD8 + T cells act to destroy virus-infected cells and tumor cells. Most CD8 +T cells express a TCR that can recognize specific antigens presented on the surface of infected or damaged cells by class I MHC molecules. Specific binding of the TCR and CD8 glycoprotein to the antigen and MHC molecule results in T cell-mediated destruction of the infected or damaged cell.

[0026] The T cells produced as described herein may be double-positive CD4+CD8+ T cells, or single-positive CD4+ or CD8+ T cells. Preferred T cells include CD8+ T cells.

[0027] Preferred T cells may include TCRαβ+ T cells. The TCR αβ+ T cells produced as described herein may be mature CD3+ T cells. For example, the T cells may have an αβTCR+CD3+CD45+CD28+ phenotype.

[0028] In the methods described herein, immune cells are primed for therapeutic use by inserting an expression construct encoding a therapeutic TCR at the site of a heterologous expression cassette encoding a native TCR. For example, the heterologous expression cassette encoding a native TCR may be replaced with an expression construct encoding a therapeutic TCR.

[0029] The TCR is a disulfide-bonded membrane-anchored heterodimeric protein that includes highly variable alpha (α) and beta (β) chains, or delta (δ) and gamma (γ) chains, expressed as a complex with invariant CD3 chain molecules. T cells that express these types of TCRs are referred to as αβ (or α:β) and δγ (δ:γ) T cells.

[0030] The TCR specifically binds to the major histocompatibility complex (MHC) on the surface of cancer cells presenting peptide fragments of the target antigen. The TCR can specifically bind to the major histocompatibility complex (MHC) on the surface of cancer cells presenting peptide fragments of the tumor antigen. Alternatively, the TCR can recognize a specific antigen, or its peptide, independent of MHC presentation. T cells containing such TCRs can be produced according to the methods of the present invention. MHC is a set of cell surface proteins that enables the adaptive immune system to recognize "foreign" molecules. Proteins are degraded intracellularly and presented on the cell surface by MHC. MHC presenting "foreign" peptides, such as viral or cancer-related peptides, are recognized by T cells with suitable TCRs, promoting the cell destruction pathway. MHC on the surface of cancer cells can present peptide fragments of tumor antigens, i.e., antigens that are present on cancer cells but not on corresponding non-cancerous cells. T cells that recognize these peptide fragments can exert a CD8+ effect on cancer cells.

[0031] The production and therapeutic TCRs described herein are not naturally expressed by the iPSCs or immune cells described herein (i.e., the TCRs are exogenous, or heterologous). Suitable heterologous TCRs can specifically bind to class I or II MHC molecules presenting peptide fragments of the target antigen. The production and therapeutic TCRs can be synthetic or artificial TCRs, i.e., TCRs that do not exist in nature.

[0032] The produced TCR and the therapeutic TCR may be encoded by heterologous nucleic acids. The term "heterologous" refers to a polypeptide or nucleic acid that is foreign to a particular biological system, such as a host cell, and does not naturally occur in that system. Heterologous polypeptides or nucleic acids may be introduced into a biological system by artificial means, for example, using recombinant techniques. For example, a heterologous nucleic acid encoding a polypeptide can be inserted into a suitable expression construct, which can then be used to transform a host cell to produce the polypeptide. Heterologous polypeptides or nucleic acids may be synthetic or artificial, or may be present in different biological systems, such as different species or cell types. Endogenous polypeptides or nucleic acids originate from a particular biological system, such as a host cell, and naturally occur in that system. Recombinant polypeptides are expressed from heterologous nucleic acids introduced into cells by artificial means, for example, using recombinant techniques. Recombinant polypeptides may be identical to polypeptides that naturally occur in the cells or may be different from polypeptides that naturally occur in those cells.

[0033] The coding sequences of TCRs, such as the produced TCR or a therapeutic antigen receptor, may include the coding sequences of the alpha (α) and beta (β) chains, or the delta (δ) and gamma (γ) chains, separated by a nucleotide sequence encoding a self-cleaving peptide such as a 2A peptide. This allows for the stochastic expression of both chains from a single transcript.

[0034] A heterologous expression cassette is a recombinant nucleic acid that is integrated into the genome of an immune cell and its precursors. The heterologous expression cassette supports the production of mature immune cells by enabling the expression of the produced TCR. For example, the expression of the produced TCR enables the differentiation of precursor cells into T cells. After the production of mature immune cells, the heterologous expression cassette forms a "landing pad" that allows the expression construct to replace the heterologous expression cassette at the same site within the genome. The expression cassette may contain any suitable nucleic acid sequence, as described below. Preferred heterologous expression cassettes may be excised with a single guide RNA to completely remove the produced TCR.

[0035] The produced TCR is expressed during its production by immune cells and their precursors. Differentiation into immune cells is arrested in cells lacking TCR expression. Expression of the produced TCR can promote the production of mature immune cells such as T cells. For example, expression of the produced TCR in immune cells can induce or promote surface expression of CD3 and enable differentiation into the lymphoid lineage such as CD3+ T cells. After differentiated CD3+ immune cells are generated, the therapeutic antigen receptor can be inserted at the site of the produced TCR. For example, the produced TCR may be replaced with the therapeutic antigen receptor in the cell.

[0036] Suitable produced TCRs include any TCR that supports T cell differentiation and surface expression of CD3 and prevents differentiation arrest. Unlike the therapeutic antigen receptor, the produced TCR is not patient-specific and does not mediate any therapeutic effect on immune cells in the patient.

[0037] In some embodiments, the produced TCR may lack binding activity. For example, the produced TCR may be functionally inactive and lack TCR functions other than promoting T cell differentiation and surface CD3 expression. This can be useful, for example, to reduce the need to isolate or purify T cells expressing the therapeutic antigen receptor after replacement of the produced TCR. Suitable functionally inactive produced TCRs may lack, for example, one or both TCR variable regions. For example, the produced TCR may lack the alpha chain variable region and / or the beta chain variable region.

[0038] In some embodiments, the produced TCR may bind to class 1 MHC presenting a fragment of an antigen that is not clinically relevant. For example, the produced TCR may not show binding or may show substantially no binding to a tumor antigen or other clinically relevant antigen and may not bind to the patient's cancer cells. In some embodiments, the produced TCR may be engineered to reduce or abrogate its affinity or avidity for an antigen.

[0039] Suitable produced TCRs can include various different combinations of an alpha chain and a beta chain, or variants thereof, or a gamma chain and a delta chain, or variants thereof. The produced TCRs can be human or non-human, such as, for example, mouse TCRs. For example, the produced TCRs can be (i) full-length alpha and beta chains, (ii) alpha and beta constant domains (TRAC (P01848-1) and TRBC (P01850-1)), (iii) single-chain alpha-beta TCRs (e.g., TCRs having an alpha chain and a beta chain linked by a peptide linker), (iv) beta and chimeric chains comprising the variable and constant domains of an alpha chain fused to the transmembrane and cytoplasmic domains of a pre-alpha chain, (v) full-length beta chain and full-length pre-alpha chain, (vi) full-length beta chain and a truncated pre-alpha chain having a 48a deletion (Δ48) at the C-terminus, (vii) a fragment of a beta chain comprising or consisting of residues 125-176 (P01850-1; TRBC1_human aa 125-176;), and a fragment of a pre-alpha chain comprising or consisting of residues 126-281 (PTCRA_human aa 126-281 (A0A087WTE9-1)), or (viii) can comprise or consist of the constant domains of a beta chain and a full-length pre-alpha chain.

[0040] In some preferred embodiments, the produced TCRs can comprise or consist of (i) full-length alpha and beta chains, or (ii) full-length beta chain and full-length pre-alpha chain.

[0041] In other preferred embodiments, the produced TCRs can comprise or consist of (i) alpha-beta and chimeric chains comprising the variable, constant, and transmembrane domains of an alpha chain fused to the cytoplasmic domain of a pre-alpha chain, or (ii) beta and chimeric chains comprising the variable and constant domains of an alpha chain fused to the transmembrane and cytoplasmic domains of a pre-alpha chain.

[0042] The amino acid and coding nucleotide sequences of suitable alpha, pre-alpha, and beta chains, and domains thereof, are well known in the art.

[0043] Productive TCRs suitable for use as described herein are readily available in the art and include MAGE-A10 αβ TCR clone 796 (SEQ ID NOs: 14-17, SEQ ID NO: 60), MR1 TCR MC.7.G5 clone - αβ TCR (TRAV38.2 / DV8 TRAJ31 α-chain, TRBV25.1 TRBJ2.3 β-chain) (Crowther et al. 2020 Nature Immunology 21 178-185), invariant NKT αβ TCR (Vα24-Jα18 paired with Vβ11), γδ TCR Vγ5Vδ1 or Vγ1Vδ4 (Ribot et al. (2021) Nature Rev Immunology 21 221-232), γδ TCR Vγ9JPVδ2 (Ravens et al. (2018) Fron Immunol 9 510, Di Lorenzo et al. (2019) Sci Data 6 115, Xu et al. 2021 Cell Mol Immunol. 2021 Feb;18(2):427-439), and, for example, HLA-E restricted TCRs against viral antigens such as CMV and HIV (Yang et al(2021)Sci Immunol 6 57,;Pietra et al.(2003) PNAS USA 100 (19) 10896-10901). In some preferred embodiments, MAGE-A10 αβ TCR clone 796, having the α-chain amino acid sequence of SEQ ID NO: 14 and the β-chain amino acid sequence of SEQ ID NO: 15, or MAGE-A10 αβ TCR clone 794, having the α-chain amino acid sequence of SEQ ID NO: 67 and the β-chain amino acid sequence of SEQ ID NO: 72, can be used. Suitable α-chains may be encoded by the nucleotide sequence of SEQ ID NO: 16 or SEQ ID NO: 66, and suitable β-chains may be encoded by the nucleotide sequence of SEQ ID NO: 17 or SEQ ID NO: 71.

[0044] Suitable nucleotide sequences are well known in the art. The heterologous expression cassette may comprise one or more nucleic acids encoding the produced TCR. The heterologous nucleic acid encoding the TCR may encode all subunits of the receptor. Preferably, the chains of the produced TCR are expressed in a single transcript. For example, the nucleic acid encoding the TCR may comprise a first nucleotide sequence encoding the TCRα chain and a second nucleotide sequence encoding the TCRβ chain, or a first nucleotide sequence encoding the TCRδ chain and a second nucleotide sequence encoding the TCRγ chain. The coding nucleic acid may further comprise a nucleotide sequence encoding a 3' poly(A) sequence. Suitable nucleotide sequences encoding the poly(A) sequence are shown in SEQ ID NO: 4, SEQ ID NO: 10, and SEQ ID NO: 40.

[0045] In some embodiments, the heterologous expression cassette may comprise one or more nucleic acids encoding a CD3 chimeric fusion receptor instead of the produced TCR.

[0046] The self-cleaving peptide coding sequence may be located between a first nucleotide sequence encoding the TCRα or TCRδ chain and a second nucleotide sequence encoding the TCRβ or TCRγ chain. The self-cleaving peptide causes cleavage of the nascent peptide chain during translation via ribosome skipping, separating the chains of the TCR. Suitable 2A peptides may include T2A, P2A, E2A, and F2A peptides (Poddar et al (2018), Kim et al (2011) PLoS ONE 6, e18556 supra). Preferred 2A peptides may comprise the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 29, SEQ ID NO: 31, or SEQ ID NO: 69. The self-cleaving peptide coding sequence may comprise the nucleotide sequences of SEQ ID NO: 2, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 70, and SEQ ID NO: 80.

[0047] The nucleic acid encoding the furin cleavage site may be located adjacent to the self-cleaving peptide coding sequence. This may be useful for removing self-cleaving peptide residues from the TCR chain. Suitable furin cleavage sites, and coding sequences, are shown in SEQ ID NOs: 11, 12, 24-27, and 68.

[0048] The expression cassette may further include a promoter operably linked to the coding sequence of the produced TCR. The promoter may drive the expression of the produced TCR in immune cells. Suitable promoters include constitutive promoters such as the SV40, CMV, UBC, EF1A, EF1AS, PGK, JeT, MND, or CAGG promoter, or variants thereof. The nucleotide sequences of suitable EF1A promoters are shown in SEQ ID NOs: 3, 36, and 65. Examples of the nucleotide sequences of the expression cassettes for the A2M10-produced TCR are shown in SEQ ID NOs: 58, and 76.

[0049] The heterologous expression cassette includes a target site. The target site is a nucleotide sequence that mediates the insertion of the expression construct at the site of the expression cassette. For example, the target site may mediate the replacement of the heterologous expression cassette in the immune cell genome by the expression construct. In some embodiments, the target site may be located upstream of the constitutive promoter within the heterologous expression cassette. Preferably, the target site may be located at the 5' end of the cassette. In other embodiments, the target site may be located within the coding sequence of the produced TCR.

[0050] In some embodiments, the heterologous expression cassette may include 5' and 3' target sites. For example, the heterologous expression cassette may be cleaved at the 5' and 3' target sites and excised from the genome of the immune cell. In some embodiments, the nucleotide sequence of the target site, or the 5' and 3' target sites, is unique in the genome of the immune cell.

[0051] In some embodiments, the 5' target site may be located upstream of the constitutive promoter within the heterologous expression cassette. Preferably, the 5' target site is located at the 5' end of the cassette.

[0052] In some embodiments, the 3' target site may be located downstream of the coding sequence or at the 3' end of the coding sequence. Preferably, the 3' target site is located at the 3' end of the cassette.

[0053] One of the 5' and 3' target sites may be located within the coding sequence of the produced TCR.

[0054] The selection of the 5' and 3' target sites may depend on the technique selected for the exchange of the expression cassette. For example, suitable 5' and 3' target sites may include CRISPR guide RNA recognition sequences for CRISPR-mediated replacement, loxP sites for CRE-LOXP-mediated replacement, FRT sites for FLP-FRT-mediated replacement, and recognition sites for site-specific nucleases such as transcription activator-like effector nucleases (TALENs).

[0055] The expression construct may be inserted into the cell genome at the site of the expression cassette using any suitable technique. In some preferred embodiments, the expression cassette may be replaced by the expression construct using CRISPR-mediated replacement technology. For example, the 5' and 3' target sites may include CRISPR guide RNA recognition sequences. Suitable guide RNA recognition sequences may contain, for example, 19 to 21 nucleotides. Preferably, the guide RNA recognition sequence is unique within the immune cell genome to avoid off-target effects. Examples of suitable guide RNA recognition sequences include SEQ ID NOs: 5-9. Methods for designing suitable guide RNA recognition sequences for use in CRISPR-mediated replacement are well established in the art.

[0056] In some embodiments, the target site, or one of the 5' and 3' target sites, preferably the 3' target site, may be located within the coding sequence for generating the TCR, for example, within the TCR chain constant region coding sequence such as the TCRα chain constant region coding sequence (TRAC) or the TCRβ chain constant region coding sequence (TRBC). An example of a preferred 5' target site that includes the sequence from the MAGE-A10 c796 TCR alpha chain (TRAC) coding sequence is shown in SEQ ID NO: 13. The corresponding 3' target site is located within the MAGE-A10 c796 TCR alpha chain coding sequence of the expression cassette (see SEQ ID NO: 16).

[0057] In other embodiments, the target site, or one of the 5' and 3' target sites, preferably the 3' target site, may include a nucleotide sequence from the locus into which the expression cassette is inserted.

[0058] In some embodiments, the 5' and 3' target sites may include the same nucleotide sequence. This may, for example, facilitate removal of the heterologous expression cassette using a single guide RNA. For example, the same target site may be positioned at both the 5' end and the 3' end of the expression cassette. For example, the expression cassette may include the TRAC, or TRBC sequence, at its 5' end and 3' end.

[0059] An example of the nucleotide sequence of the plasmid for insertion of the A2M10-producing TCR is shown in SEQ ID NO: 59.

[0060] The heterologous expression cassette may be integrated into the genome of immune cells. In some embodiments, the heterologous expression cassette may be integrated into the genome of immune cells within a gene locus containing an endogenous promoter. For example, the heterologous expression cassette may be integrated within an exon of a gene within the locus, preferably within or immediately adjacent to the last exon of the gene within the locus. The integration retains the natural reading frame of the gene, such that expression of the therapeutic antigen receptor is driven by the endogenous promoter after replacement of the heterologous expression cassette with the expression construct described herein. Suitable gene loci may be active in differentiated T cells and may include TRAC, PTPRC, EEF1A1, CD3E, CD3D, CD3G, CD8A, and CD2.

[0061] In other embodiments, the heterologous expression cassette may be integrated into the genome of immune cells within a safe harbor locus. Thereby, expression of the therapeutic antigen receptor can be driven by a constitutive promoter contained in the expression construct. Suitable expression constructs may include, for example, a nucleic acid encoding a poly(A) sequence and a constitutive promoter. Suitable safe harbor loci include AAVS1 and are shown in Table 1.

[0062] The therapeutic antigen receptor is expressed by immune cells after insertion of the expression construct at the site of the expression cassette. For example, the receptor may be expressed after replacement of the expression cassette with the expression construct.

[0063] Therapeutic antigen receptors mediate the therapeutic effect of immune cells. Preferably, the therapeutic antigen receptor binds to the cancer cells of the patient. For example, a therapeutic T antigen receptor can specifically bind to class I or II MHC molecules that present peptide fragments of tumor antigens expressed by the cancer cells of a cancer patient. In some embodiments, the therapeutic T antigen receptor can recognize a target antigen on cancer cells, or a peptide fragment of the target antigen, independently of MHC presentation. Tumor antigens expressed by the cancer cells of a cancer patient can be identified using standard techniques. Preferred tumor antigens include NY-ESO1, PRAME, alpha-fetoprotein (AFP), MAGE A4, MAGE A1, MAGE A10, and MAGE B2, most preferably NY-ESO-1 and MAGE-A10.

[0064] In some embodiments, a tumor antigen in a patient can be identified and a therapeutic antigen receptor that binds to the selected tumor antigen for use in an expression construct can be identified.

[0065] In some embodiments, the therapeutic antigen receptor can be a chimeric antigen receptor (CAR). A CAR is an artificial receptor engineered to include an immunoglobulin antigen-binding domain, such as a single-chain variable fragment (scFv). The CAR can include, for example, an scFv fused to a TCR CD3 transmembrane region and an endodomain. The scFv can be a fusion protein of the variable regions of the heavy chain (V H ) and light chain (V L ) of an immunoglobulin, connected by a short linker peptide of about 10-25 amino acids (Huston J.S. et al. Proc Natl Acad Sci USA 1988; 85(16):5879-5883). The linker can be glycine-rich for flexibility, or serine- or threonine-rich for solubility, and the N-terminus of V H to V LIt may be connected to the C-terminus of , or vice versa. A signal peptide that directs the protein to the endoplasmic reticulum and then to the T cell surface may precede the scFv. In the CAR, the scFv may be fused to the TCR transmembrane domain and the endodomain. A flexible spacer may be included between the scFv and the TCR transmembrane domain to allow for variable orientation and antigen binding. The endodomain is the functional signaling domain of the receptor. The endodomain of the CAR may include, for example, an intracellular signaling domain derived from a receptor such as the CD3 ζ chain, or CD28, 41BB, or ICOS. The CAR may include multiple signaling domains, for example, but not limited to, CD3z-CD28-41BB, or CD3z-CD28-OX40.

[0066] The CAR can specifically bind to a tumor-specific antigen expressed by cancer cells. For example, T cells may be modified to express a CAR that specifically binds to a tumor antigen expressed by the cancer cells of a particular cancer patient. Tumor antigens expressed by the cancer cells of a cancer patient can be identified using standard techniques.

[0067] In other embodiments, the therapeutic antigen receptor may be a natural killer cell receptor (NKCR).

[0068] In other embodiments, the therapeutic antigen receptor may be a T cell receptor (TCR). TCRs are described elsewhere herein and can include αβ TCR heterodimers, and γδ TCR heterodimers. Suitable heterologous TCRs can specifically bind to class I or II MHC molecules presenting peptide fragments of the target antigen. For example, T cells may be modified to express a heterologous TCR that specifically binds to class I or class II MHC molecules presenting peptide fragments of tumor antigens expressed by cancer cells of a particular cancer patient. Tumor antigens expressed by cancer cells of a cancer patient can be identified using standard techniques. Preferred tumor antigens include NY-ESO1, PRAME, alpha-fetoprotein (AFP), MAGE A4, MAGE A1, MAGE A10, and MAGE B2, most preferably NY-ESO-1, and MAGE-A10.

[0069] In some preferred embodiments, the heterologous TCR can specifically bind to HLA-A * 02:01 presenting the MAGEA4 peptide fragment GVYDGREHTV.

[0070] Suitable therapeutic TCRs can include, for example, non-MHC-dependent TCRs, NKT cell TCRs, and intraepithelial lymphocyte (IEL) TCRs that recognize and bind non-peptide antigens presented by single-type antigen-presenting molecules such as CD1 and MR1. In some embodiments, the therapeutic TCR can recognize a target antigen, or a peptide fragment of the target antigen, on cancer cells independently of MHC presentation.

[0071] Suitable therapeutic TCRs include patient-derived TCRs. For example, the therapeutic TCR may be a TCR derived from immune cells, such as tumor-infiltrating lymphocytes (TILs), obtained from a donor individual. For example, tumors in a patient may be profiled to identify tumor antigens expressed by cancer cells within the tumor. TCRs reactive with the identified tumor antigens can be identified and inserted into an expression construct for use as the therapeutic TCRs described herein. In other embodiments, TCRs expressed by immune cells, such as those expressed by tumor-infiltrating lymphocytes (TILs) obtained from a patient, can be sequenced and cloned into an expression construct. For example, diverse repertoires of patient-derived TCRs may be cloned into an expression construct for insertion into the immune cells described herein. Suitable techniques for obtaining the coding sequence of a TCR from immune cells such as tumor-infiltrating lymphocytes (TILs) obtained from a patient and inserting it into an expression construct are established in the art. The target tumor antigen of the TCR from TILs may or may not be identified. The donor individual may be the same person as the recipient individual to whom the immune cells are administered after production as described herein, i.e., the therapeutic TCR may be derived from the patient to whom the immune cells are administered.

[0072] For example, a therapeutic TCR may be engineered to increase its affinity or binding activity for a tumor antigen (i.e., a high-affinity TCR). A high-affinity TCR may contain one or more mutations relative to a naturally occurring TCR, for example, one or more mutations in the hypervariable complementarity-determining regions (CDRs) of the variable regions of the α and β chains of the TCR. These mutations increase the affinity of the TCR for MHC presenting a peptide fragment of the tumor antigen expressed by the cancer cell. Suitable methods for generating high-affinity TCRs include screening a library of TCR mutants using phage display or yeast display, and are well known in the art (see, e.g., Robbins et al J Immunol (2008) 180(9):6116, San Miguel et al (2015) Cancer Cell 28 (3) 281-283, Schmitt et al (2013) Blood 122 348-256, Jiang et al (2015) Cancer DIPSCovery 5 901).

[0073] An example of the amino acid sequence of A2M4 TCRα is shown in SEQ ID NO:79, and an example of the amino acid sequence of A2M4 TCRβ is shown in SEQ ID NO:82. An example of the amino acid sequence of a therapeutic TCR is shown in SEQ ID NO:62.

[0074] The expression construct is a recombinant nucleic acid that is integrated into the genome of immune cells at the site of the heterologous expression cassette. For example, the expression construct may replace the heterologous expression cassette. The expression construct contains the coding sequence of a therapeutic TCR. The coding sequence of the therapeutic TCR may include, for example, a first nucleotide sequence encoding the TCRα chain and a second nucleotide sequence encoding the TCRβ chain, or a first nucleotide sequence encoding the TCRγ chain and a second nucleotide sequence encoding the TCRδ chain. Examples of suitable first nucleotide sequences encoding the ADB959 TCRα chain are shown in SEQ ID NO: 33 and SEQ ID NO: 38. Examples of suitable second nucleotide sequences encoding the ADB959 TCRβ chain are shown in SEQ ID NO: 32 and SEQ ID NO: 37. An example of a suitable first nucleotide sequence encoding the A2M4 TCRα chain is shown in SEQ ID NO: 78, and an example of a suitable second nucleotide sequence encoding the A2M4 TCRβ chain is shown in SEQ ID NO: 81.

[0075] The first and second nucleotide sequences may be located within a single open reading frame or may be separated by a third nucleotide sequence encoding a self-cleaving peptide such as a 2A peptide and / or a Furin linker. Suitable self-cleaving peptides are described in more detail above.

[0076] An example of the amino acid sequence (PTPRC exon 33_T2A_ADB959_TCRβ_P2A_TCRα) encoded by the expression construct is shown in SEQ ID NO: 34. The amino acid sequence includes the T2A and P2A sequences for separating the ADB959 TCR chains and the PTPRC exon sequence.

[0077] In some embodiments, the expression construct may further include a promoter operably linked to the coding sequence of the therapeutic antigen receptor. The promoter may drive the expression of the therapeutic antigen receptor in immune cells. Suitable promoters include constitutive promoters such as the SV40, CMV, UBC, EF1A, EF1AS, PGK, JeT, MND, or CAGG promoter, or variants thereof. The nucleotide sequences of suitable EF1A promoters are shown in SEQ ID NO: 3 and SEQ ID NO: 36.

[0078] The expression construct may be inserted into the genome of the immune cell at the same site as the heterologous expression cassette. For example, the heterologous expression cassette may be replaced within the immune cell by the expression construct. This primes the immune cells for therapeutic use in an individual. Preferably, the heterologous expression cassette is completely excised such that no sequences from the heterologous expression cassette remain in the immune cell after replacement. Any suitable technique may be used to achieve replacement of the heterologous expression cassette with the expression construct.

[0079] An example of the nucleotide sequence of the plasmid for insertion of the A2M4 therapeutic TCR is shown in SEQ ID NO: 61.

[0080] Suitable techniques include HR-mediated gene replacement techniques such as CRISPR / Cas9-based techniques, and recombinase-mediated gene replacement techniques such as Cre-Lox, FLP-FRT, or phiC31 integrase techniques. Suitable techniques are well known in the art (see, for example, Yamamoto et al Chromosoma. (2018) 127(4): 405-420; Sakuma et al; (2016) Nat Protoc 11(1) 118-133).

[0081] In some preferred embodiments, the expression cassette may be replaced by HR-mediated target gene replacement. For example, the heterologous expression cassette is a method comprising Introducing a nucleic acid molecule, such as a DNA molecule, containing an expression construct adjacent to 5' and 3' homology arms, wherein the 5' and 3' homology arms are complementary to the nucleotide sequences at the 5' and 3' ends of the heterologous expression cassette and / or genomic sequences adjacent to the heterologous expression cassette, whereby the expression construct can be replaced by a method comprising introducing the expression construct to replace the expression cassette in the genome of the immune cell.

[0082] The homology arms mediate replacement of the heterologous expression cassette with the expression construct after cleavage of the heterologous expression cassette at the 5' and 3' target sites. Suitable homology arms may comprise sequences of 300 to 500 nucleotides that are complementary to the nucleotide sequence of the heterologous expression cassette and / or genomic sequences adjacent to the heterologous expression cassette, which are the 5' or 3' of each of the 5' and 3' target sites, whereby the homology arms are complementary to the sequences at the locus or safe harbor locus after removal or excision of the sequence of the heterologous expression cassette between the target sites.

[0083] In some embodiments, HR-mediated target gene replacement may be mediated by a programmable nuclease, such as a site-specific nuclease such as zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), and meganuclease, or an RNA-guided nuclease such as a clustered regularly interspaced short palindromic repeat (CRISPR) nuclease.

[0084] Zinc finger nucleases (ZFNs) contain one or more Cys2-His2 zinc finger DNA binding domains and a cleavage domain (i.e., a nuclease). The DNA binding domains may be engineered to recognize and bind any nucleic acid sequence using conventional techniques (see, e.g., Qu et al. (2013) Nucl Ac Res 41(16):7771-7782). The use of ZFNs to introduce mutations into target genes is well known in the art (see, e.g., Beerli et al Nat. Biotechnol.2002; 20:135-141, Maeder et al Mol. Cell. 2008; 31:294-301, Gupta et al Nat. Methods. 2012; 9:588-590) and engineered ZFNs are commercially available (Sigma-Aldrich (St. Louis, MO).

[0085] Transcription activator-like effector nucleases (TALENs) contain a non-specific DNA cleavage nuclease fused to a DNA binding domain that includes a series of modular TALEN repeats that are linked together to recognize contiguous nucleotide sequences. The use of TALEN-targeted nucleases is well known in the art (see, e.g., Joung & Sander (2013) Nat Rev Mol Cell Bio 14:49-55, Kim et al Nat Biotechnol. (2013); 31:251-258, Miller JC, et al. Nat. Biotechnol. (2011) 29:143-148, Reyon D, et al. Nat. Biotechnol. (2012); 30:460-465).

[0086] Meganucleases are endodeoxyribonucleases characterized by large recognition sites (12- to 40-base pair double-stranded DNA sequences), such that this site generally occurs only once in any given genome (see, e.g., Silva et al. (2011) Curr Gene Ther 11(1):11-27).

[0087] A CRISPR-targeted nuclease (e.g., Cas9) complex with a guide RNA (gRNA) for sequence-specific cleavage of genomic DNA. The crRNA and tracrRNA of the guide RNA may be used separately or combined into a single RNA to enable site-specific mammalian genome cleavage at the 5' and 3' target sites of an expression cassette. For example, the use of the CRISPR / Cas9 system to introduce double-strand breaks into a gene locus as a method of introducing gene transfer is well known in the art (see, e.g., Cader et al Nat Immunol 2016 17 (9) 1046-1056, Hwang et al. (2013) Nat. Biotechnol 31:227-229, Xiao et al., (2013) Nucl Acids Res 1-11, Horvath et al., Science (2010) 327:167-170, Jinek M et al. Science (2012) 337:816-821, Cong L et al. Science (2013) 339:819-823, Jinek M et al. (2013) eLife 2:e00471, Mali P et al. (2013) Science 339:823-826, Qi LS et al. (2013) Cell 152:1173-1183, Gilbert LA et al. (2013) Cell 154:442-451, Yang H et al. (2013) Cell 154:1370-1379, and Wang H et al. (2013) Cell 153:910-918).

[0088] In some preferred embodiments, the targetable nuclease is a Cas endonuclease that is targeted by a guide RNA and expressed in immune cells in combination with the guide RNA to cleave a heterologous expression cassette at the 5' and 3' target sites.

[0089] Preferably, HR-mediated target gene replacement is mediated by CRISPR / Cas9. For example, DNA double-strand breaks (DSBs) at the target site may be induced by the CRISPR / Cas9 system, the repair of DSBs may introduce an expression construct into the cellular genome at the target site, or the nucleic acid may be introduced using an rAAV vector (AAV-mediated gene editing; Hirsch et al 2014 Methods Mol Biol 1114 291-307). For example, a heterologous expression cassette is a method of introducing a nucleic acid molecule, such as a DNA molecule, containing an expression construct flanked by 5' and 3' homology arms into an immune cell, wherein the 5' homologous and 3' homology arms are complementary to the nucleotide sequences at the 5' and 3' ends of the heterologous expression cassette and / or the genomic sequences adjacent to the heterologous expression cassette, and introducing into the immune cell a nucleic acid molecule such as a DNA molecule containing an expression construct flanked by 5' and 3' homology arms, wherein the 5' homologous and 3' homology arms are complementary to the nucleotide sequences at the 5' and 3' ends of the heterologous expression cassette and / or the genomic sequences adjacent to the heterologous expression cassette, and introducing into the immune cell CRISPR / Cas9 targeting the 5' and 3' target sites, whereby the expression construct can be replaced by a method comprising introducing the expression construct to replace the expression cassette in the genome of the immune cell.

[0090] Suitable homology arms may comprise sequences of 300 to 500 nucleotides as described above and complementary to the nucleotide sequences at the 5' and 3' ends of the heterologous expression cassette and / or the genomic sequences adjacent to the heterologous expression cassette.

[0091] Suitable homology arms for a DNA molecule for an expression cassette in exon 33 of PTPRC or for a targeting vector are shown in SEQ ID NOs: 22 and 23. Suitable homology arms for a DNA molecule for an expression cassette in intron 1 of PPP1R12C (AAVS1) or for a targeting vector are shown in SEQ ID NOs: 35 and 41. Other suitable homology arms are shown in SEQ ID NOs: 64 and 74, or SEQ ID NOs: 77 and 83, or are described elsewhere in this specification.

[0092] The DNA molecule containing the expression construct may be a single-stranded DNA molecule. Suitable single-stranded DNA molecules can be contained in a recombinant adeno-associated virus (rAAV) vector. The single-stranded DNA molecule can be introduced into immune cells by transfecting the cells with the rAAV vector.

[0093] Suitable target sites, such as 5' and 3' target sequences, can contain nucleotide sequences that are complementary to the guide RNA of CRISPR / Cas9. Suitable sequences can consist of, for example, 17 to 24 nucleotides. The target site can further contain additional nucleotide sequences adjacent to the complementary nucleotide sequence, which may be required for improving the effectiveness when removing the heterologous expression cassette. For example, the target site may contain an additional 1 to 15 nucleotides, preferably about 12 nucleotides, at the 5' and 3' ends of the complementary nucleotide sequence.

[0094] In some embodiments, the 3' target site may be a nucleotide sequence located within the coding sequence for the constant region of the TCRα chain within the expression cassette. For example, the 3' target site may be the 3' end of the sequence encoding the constant region of the TCRα chain. The 5' target site may have the same nucleotide sequence as the 3' target site, i.e., the 5' target site may be a copy of the 3' end of the sequence encoding the constant region of the TCRα chain. The 5' target site may be located upstream of the promoter within the expression cassette.

[0095] CRISPR / Cas9 may be introduced directly into cells as a protein and gRNA, for example, within lipid nanoparticles, or as a nucleic acid encoding CRISPR / Cas9, such as mRNA, plasmid, or viral vector, and then expressed intracellularly. The nucleic acid encoding CRISPR / Cas9 can be introduced into immune cells by any convenient method, such as RNP electroporation.

[0096] Because they have the same sequence, a single guide RNA can target CRISPR / Cas9 to both the 5' and 3' target sites, thereby cleaving the expression cassette at its 5' and 3' ends and removing it from the genome. After excision of the sequence of the expression cassette between the 5' target site and the 3' target site, the complementary sequences at the locus, or the 5' and 3' homology arms, which are safe harbor loci outside the target sites, mediate the integration of the expression construct into the locus.

[0097] Suitable guide RNA sequences for CRISPR-Cas9-mediated gene replacement can be designed using standard techniques. For example, suitable guide RNA sequences for targeting TRAC1 include SEQ ID NOs: 5 and 6. A suitable guide RNA sequence for targeting the AAVS1 safe harbor sequence includes SEQ ID NO: 7. A suitable guide RNA sequence for targeting exon 2 of the B2M sequence includes SEQ ID NO: 8. A suitable guide RNA sequence for targeting the PTPRC sequence includes SEQ ID NO: 9.

[0098] The methods described herein may further include reducing or silencing the expression of endogenous TCR in a cell, for example, by inactivating the endogenous TCR gene, or the endogenous RAG1 or RAG2 gene. For example, the method may further include inactivating the endogenous TCRα (TRAC) chain gene, or the TCRβ (TRBC1 or 2) chain gene, or the endogenous RAG1, or RAG2 gene. This may be useful for reducing or preventing off-target toxicity of immune cells. The endogenous gene may be inactivated in immune cells or progenitor cells such as iPSCs. For example, the endogenous gene may be inactivated in iPSCs before the heterologous expression cassette is integrated.

[0099] Any suitable technique may be used to inactivate the endogenous TCR gene. Conveniently, the endogenous TCR gene is inactivated simultaneously with the replacement of the heterologous expression cassette. In some preferred embodiments, the expression cassette is replaced using CRISPR / Cas9 targeting sequences within the cassette encoding the constant region of the TCRα chain. CRISPR / Cas9 may also target sequences within the endogenous gene encoding the constant region of the TCRα chain. This may introduce one or more inactivating mutations into the endogenous TCRα chain constant region (TRAC) gene.

[0100] The methods described herein may further include reducing or silencing the expression of class II transactivator (CIITA) and / or beta-2-microglobulin (B2M), for example, by inactivating the endogenous B2M or CIITA gene. The endogenous gene may be inactivated in immune cells or progenitor cells such as iPSCs. This may be useful for reducing alloreactive effects and improving the persistence of immune cells in vivo. In some embodiments, the methods described herein may further include expressing heterologous B2M-HLA-E (mBE) and B2M-HLA-G (mBG) fusion proteins in immune cells. A construct containing a heterologous nucleic acid encoding a fusion protein operably linked to a suitable promoter may be inserted into immune cells or progenitor cells such as iPSCs. This may be useful for protecting cells from allogeneic NK cell-mediated lysis.

[0101] The immune cells may exhibit expression of a therapeutic TCR or therapeutic TCRs and may not exhibit expression of the endogenous TCR.

[0102] Immune cells containing a heterologous expression cassette may be produced by directed differentiation from induced pluripotent stem cells (iPSCs). For example, a method for generating immune cells containing a heterologous expression cassette is (i) Transfecting iPSCs with a nucleic acid containing a heterologous expression cassette such that the cassette is integrated into the genome of the iPSCs, wherein the expression cassette comprises: (a) a coding sequence of a produced T cell receptor (TCR); (b) a constitutive promoter operably linked to the coding sequence; and (c) a target site, and (ii) differentiating the iPSC into an immune cell comprising the expression cassette.

[0103] In some embodiments, the target site may be a 5' target site, and the cassette may further comprise a 3' target site.

[0104] The heterologous expression cassette may be integrated into the target locus of the iPSC by a method comprising: introducing into the iPSC a nucleic acid molecule, such as a DNA molecule, comprising an expression cassette flanked by 5' and 3' homology arms, wherein the 5' and 3' homology arms are complementary to nucleotide sequences flanking the integration site within the target locus; introducing CRISPR / Cas9 into the immune cell to target the integration site within the target locus; whereby the expression cassette is integrated into the genome of the immune cell at the integration site within the target locus.

[0105] Suitable homology arms may comprise sequences of 300-500 nucleotides that are complementary to nucleotide sequences flanking the integration site within the target locus as described above. The homology arms may be designed for any target locus using standard techniques.

[0106] Suitable target gene loci are described above and shown in Table 1. In some embodiments, the heterologous expression cassette may be integrated into exon 33 of PTPRC. Suitable homology arms for the DNA molecule or targeting vector of exon 33 of PTPRC are shown in SEQ ID NOs: 18 and 19. In other embodiments, the heterologous expression cassette may be integrated into intron 1 of PPP1R12C (AAVS1). Suitable homology arms for the DNA molecule or targeting vector for intron 1 of PPP1R12C (AAVS1) are shown in SEQ ID NOs: 20 and 21.

[0107] The DNA molecule containing the heterologous expression cassette may be a single-stranded DNA molecule. Suitable single-stranded DNA molecules can be contained in a recombinant adeno-associated virus (rAAV) vector. The single-stranded DNA molecule can be introduced into immune cells by transfecting the cells with the rAAV vector.

[0108] Induced pluripotent stem cells (iPSCs) are pluripotent cells derived from non-pluripotent, fully differentiated donors, or progenitor cells. iPSCs can self-renew in vitro, exhibit an undifferentiated phenotype, and have the potential to differentiate into any fetal, or adult cell type of any of the three germ layers (endoderm, mesoderm, and ectoderm). The population of iPSCs may be clonal, i.e., genetically identical cells descended from a single common ancestor cell. iPSCs may express one or more of the following pluripotency-related markers: POU5f1 (Oct4), Sox2, alkaline phosphatase, SSEA-3, Nanog, SSEA-4, Tra-1-60, KLF4, and c-myc, preferably one or more of POU5f1, NANOG, and SOX2. iPSCs may lack markers associated with specific differentiation fates, such as Bra, Sox17, FoxA2, αFP, Sox1, NCAM, GATA6, GATA4, Hand1, and CDX2. In particular, iPSCs may lack markers associated with the endodermal fate.

[0109] Preferably, the iPSC is a human iPSC (hiPSC).

[0110] In some embodiments, the iPSCs may be gene-edited to inactivate or delete, for example, the HLA gene or other genes associated with immunogenicity or GVHD.

[0111] The iPSCs may be induced or reprogrammed from donor cells, which may be somatic cells or other progenitor cells obtained from a source such as a donor individual. The donor cells may be mammalian, preferably human cells. Suitable donor cells include adult fibroblasts and blood cells, such as peripheral blood cells, for example, HPCs or monocytes. Suitable donor cells for reprogramming into the iPSCs described herein can be obtained from a donor individual. In other embodiments, the donor individual may be a different person than the patient or recipient individual to whom immune cells are administered after production as described herein (allogeneic treatment). For example, the donor individual may be a healthy individual whose human leukocyte antigen (HLA) matches that of the recipient individual suffering from cancer (either before or after donation). In other embodiments, the donor individual may not be HLA-compatible with the recipient individual. Preferably, the donor individual may be a neonate (newborn), for example, the donor cells may be obtained from a sample of cord blood.

[0112] Suitable donor individuals preferably do not contain infectious viruses (e.g., HIV, HPV, CMV) and foreign substances (e.g., bacteria, mycoplasma) and do not contain known genetic abnormalities.

[0113] In some embodiments, a population of peripheral blood cells, such as HPCs, for reprogramming may be isolated from a blood sample obtained from a donor individual, preferably a cord blood sample. Methods suitable for the isolation of HPCs or other peripheral blood cells are well known in the art and include, for example, magnetic-activated cell sorting (see, e.g., Gaudernack et al 1986 J Immunol Methods 90 179), fluorescence-activated cell sorting (FACS: see Rheinherz et al (1979) PNAS 76 4061), cell panning (see, e.g., Lum et al (1982) Cell Immunol 72 122). HPCs can be identified in a sample of blood cells by expression of CD34. In other embodiments, a population of fibroblasts for reprogramming can be isolated from a skin biopsy after dispersion using collagenase or trypsin and growth under suitable cell culture conditions.

[0114] Donor cells are typically reprogrammed into iPSCs by introduction of reprogramming factors such as Oct4, Sox2, and Klf4 into the cells. The reprogramming factors may be proteins or may encode nucleic acids and may be introduced into differentiated cells by any suitable technique including plasmid, transposon, or, more preferably, viral transfection or direct protein delivery. Other reprogramming factors such as Klf genes such as Klf-1, -2, -4, and -5, Myc genes such as C-myc, L-myc, and N-myc, Nanog, SV40 Large T antigen, Lin28, and short hairpin (shRNA) targeted genes such as p53 may also be introduced into the cells to increase the induction efficiency. After introduction of the reprogramming factors, the donor cells may be cultured. Cells expressing pluripotency markers may be isolated and / or purified to generate a population of iPSCs. Techniques for the production of iPSCs are well known in the art (see Yamanaka et al Nature 2007; 448:313-7, Yamanaka 6 2007 Jun 7; 1(1):39-49, Kim et al Nature. 2008 Jul 31; 454(7204):646-50, Takahashi Cell. 2007 Nov 30; 131(5):861-72, Park et al Nature. 2008 Jan 10; 451(7175):141-6, Kimet et al Cell Stem Cell. 2009 Jun 5;4(6):472-6, Vallier, L., et al. Stem Cells, 2009. 9999(999A): p. N / A, Baghbaderani et al 2016; Stem Cell Rev. 2016 Aug; 12(4):394-420, Baghbaderani et al. (2015) Stem Cell Reports, 5(4), 647-659).

[0115] Conventional techniques can be used for the culture and maintenance of iPSCs (Vallier, L. et al Dev. Biol. 275, 403-421 (2004), Cowan, C.A. et al. N. Engl. J. Med. 350, 1353-1356 (2004), Joannides, A. et al. Stem Cells 24, 230-235 (2006) Klimanskaya, I. et al. Lancet 365, 1636-1641 (2005), Ludwig, T.E. et al. Nat. Biotechnol. 24, 185-187 (2006)). iPSCs for use in the present method can be grown under defined conditions or on feeder cells. For example, iPSCs can be cultured in a culture dish on a layer of feeder cells such as irradiated mouse embryonic fibroblasts (MEFs) at a suitable density (e.g., 10 5 ~10 6 cells / 60 mm dish), or on a suitable substrate, in feeder-conditioned or defined iPSC maintenance medium, in a conventional manner. iPSCs for use in the present method can be passaged by enzymatic or mechanical means. In some embodiments, iPSCs may be passaged on matrigel(®), or an ECM protein such as vitronectin, in an iPSC maintenance medium such as mTeSR(®)1, or TeSR(®)2 (StemCell Technologies) or E8flex (Life Thermo) culture medium.

[0116] IPSCs may be transfected with a nucleic acid containing a heterologous expression cassette, such that the cassette is integrated into the genome of the iPSC. Suitable techniques are well established in the art. Transfection at the iPSC stage enables the isolation of single clones and the differentiation of homogeneous cell populations.

[0117] Nucleic acids may be introduced into cells by any convenient technique. Techniques suitable for transporting heterologous expression cassettes into iPSCs are well known in the art and include calcium phosphate transfection, DEAE-dextran, electroporation, liposome-mediated transfection, for example, those by gene editing at specific loci such as AAV-mediated gene editing, and transduction using retroviruses or other viruses, such as vaccinia virus or lentivirus. In some embodiments, the CAS9 guide RNA ribonucleoprotein complex (RNP) may be delivered by electroporation, and nucleic acid molecules encoding the expression cassette, such as DNA molecules such as targeting vectors, are packaged as rAAV (serotype 6). Alternatively, RNA and DNA molecules encoding the expression cassette (as ssDNA) may be co-delivered by electroporation.

[0118] Targeting integration sites within the genome of iPSCs is provided by the use of CRISPR / Cas9 to generate double-strand breaks in combination with homology arms within the nucleic acid molecule. Suitable sites for integration include gene loci and safe harbor loci, which are described in more detail above. All clones can be screened to confirm integration at the correct site.

[0119] When introducing or integrating heterologous nucleic acids into iPSCs, certain concerns well-known to those skilled in the art need to be taken into account. The nucleic acid to be inserted should be assembled within a construct or vector that contains effective regulatory elements to drive transcription in T cells. For example, many known techniques and protocols regarding the preparation of nucleic acid constructs, the introduction of DNA into cells, and the manipulation and transformation of nucleic acids in gene expression are described in detail in Protocols in Molecular Biology, Second Edition, Ausubel et al. eds. John Wiley & Sons, 1992. In some embodiments, the nucleic acid may be introduced into the cell by gene editing. For example, double-strand DNA breaks (DSBs) at the target site may be induced by the CRISPR / Cas9 system, the repair of the DSB may introduce the heterologous nucleic acid into the cellular genome at the target site, or the nucleic acid may be introduced using an rAAV vector (AAV-mediated gene editing; Hirsch et al 2014 Methods Mol Biol 1114 291-307).

[0120] Also provided are iPSCs containing a heterologous expression cassette integrated into their genome, wherein the expression cassette (a) comprises a coding sequence for a produced T cell receptor (TCR), (b) a constitutive promoter operably linked to the coding sequence, and (c) a target site.

[0121] The target site may be a 5' target site, and the cassette may further comprise a 3' target site.

[0122] The heterologous expression cassette is described in more detail above.

[0123] iPSCs can be differentiated and matured into immune cells such as T cells in a series of steps. The differentiation and maturation of cell populations in these steps are induced by culturing the cells in a culture medium supplemented with a set of differentiation factors. The set of differentiation factors in each culture medium is preferably comprehensive, and the medium may lack other differentiation factors. In a preferred embodiment, the culture medium is a chemically defined medium. For example, the culture medium can consist of a chemically defined nutrient medium supplemented with an effective amount of one or more differentiation factors as described below. The chemically defined nutrient medium may include a basal medium supplemented with one or more serum-free culture medium supplements.

[0124] Differentiation factors are factors that regulate, for example, promote or inhibit, the signaling pathways that mediate differentiation in mammalian cells. Differentiation factors can include growth factors, cytokines, and small molecules that regulate one or more of Activin / Nodal, FGF, Wnt or BMP, or their signaling pathways. Examples of differentiation factors include Activin / Nodal, FGF, BMP, retinoic acid, vascular endothelial growth factor (VEGF), stem cell factor (SCF), TGFβ ligands, GDF, LIF, interleukins, GSK-3 inhibitors, and phosphatidylinositol 3-kinase (PI3K) inhibitors.

[0125] Differentiation factors used in one or more of the media described herein include TGFβ ligands such as Activin, fibroblast growth factor (FGF), bone morphogenetic protein (BMP), stem cell factor (SCF), vascular endothelial growth factor (VEGF), GSK-3 inhibitors (such as CHIR-99021), interleukins, and hormones such as IGF-1 and angiotensin II. The differentiation factors may be present in the media described herein in an amount effective to regulate the signaling pathways in the cells cultured in the medium.

[0126] In some embodiments, the differentiation factors listed above or below may be replaced by factors having the same effect (i.e., stimulation or inhibition) on the same signaling pathway in the culture medium. Suitable factors are known in the art and include proteins, nucleic acids, antibodies, and small molecules.

[0127] The degree of differentiation of the cell population at each step can be determined by monitoring and / or detecting the expression of one or more cell markers in the differentiated cell population. For example, an increase in the expression of markers characteristic of a more differentiated cell type, or a decrease in the expression of markers characteristic of a less differentiated cell type, may be determined. The expression of cell markers can be determined by any suitable technique, including immunocytochemistry, immunofluorescence, RT-PCR, immunoblotting, fluorescence-activated cell sorting (FACS), and enzyme assays. In a preferred embodiment, when the marker is detectable on the cell surface, the cell can be said to express the marker. For example, cells described herein that do not express the marker may show active transcription and intracellular expression of the marker gene, but the detectable level of the marker may not be present on the surface of the cell.

[0128] Populations of partially differentiated cells produced by the steps of the methods described herein, such as mesoderm cells, hematopoietic endothelium (HE; i.e., hematopoietic endothelial cells, or HEC), HPC, or T cell precursors, can be cultured, maintained, or expanded prior to the next differentiation step. Partially differentiated cells can be expanded by any convenient technique.

[0129] After each step, the population of partially differentiated cells produced by that step may not contain or may substantially not contain other cell types. For example, the population may contain 60% or more, 70% or more, 80% or more, or 90% or more partially differentiated cells after culturing in the medium. Preferably, the cell population does not sufficiently contain other cell types that do not require purification. Optionally, the population of partially differentiated cells can be purified by any convenient technique, such as MAC or FACS.

[0130] Cells can be cultured in a monolayer or on a surface or substrate coated with an extracellular matrix protein such as fibronectin, laminin, or collagen in the absence of feeder cells. Suitable methods and techniques for cell culture are well known in the art (e.g., Basic Cell Culture Protocols, C. Helgason, Humana Press Inc. U.S. (15 Oct 2004) ISBN: 1588295451, Human Cell Culture Protocols (Methods in Molecular Medicine S.) Humana Press Inc., U.S. (9 Dec 2004) ISBN: 1588292223, Culture of Animal Cells: A Manual of Basic Technique, R. Freshney, John Wiley & Sons Inc (2 Aug 2005) ISBN: 0471453293, Ho WY et al J Immunol Methods. (2006) 310:40-52, Handbook of Stem Cells (ed. R. Lanza) ISBN: 0124366430) Basic Cell Culture Protocols’ by J. Pollard and J. M. Walker (1997), ‘Mammalian Cell Culture: Essential Techniques’ by A. Doyle and J. B. Griffiths (1997), ‘Human Embryonic Stem Cells’ by A. Chiu and M. Rao (2003), Stem Cells: From Bench to Bedside’ by A. Bongso (2005), Peterson & Loring (2012) Human Stem Cell Manual: A Laboratory Guide Academic Press and ‘Human Embryonic Stem Cell Protocols’ by K. Turksen (2006)).The medium and its components can be obtained from commercial sources (e.g., Gibco, Roche, Sigma, Europa bioproducts, R&D Systems). Standard mammalian cell culture conditions may be used for the above culture steps, e.g., 37°C, 5% or 21% oxygen, 5% carbon dioxide. The medium is preferably changed every two days, and the cells are sedimented by gravity.

[0131] The cells may be cultured in a culture vessel. Suitable cell culture vessels are well-known in the art and include culture plates, dishes, flasks, bioreactors, and multi-well plates, e.g., 6-well, 12-well, or 96-well plates.

[0132] The culture vessel is preferably treated for tissue culture by coating one or more surfaces of the vessel with an extracellular matrix protein such as fibronectin, laminin, or collagen. The culture vessel may be treated for tissue culture using standard techniques, e.g., by incubating with the coating solution described herein, or may be pre-treated by a commercial supplier.

[0133] The iPSCs are as follows: (i) differentiating the iPSCs into mesodermal cells, (ii) differentiating the mesodermal cells into hematopoietic endothelial cells (HECs), (iii) differentiating the HECs into a population of hematopoietic progenitor cells (HPCs), (iv) differentiating the HPCs into immune cell precursors, (v) maturing a population of progenitor immune cells to produce a population of immune cells that express the heterologous expression cassette, and may be differentiated into immune cells using a multi-step process.

[0134] In the first stage, the population of iPSCs can be differentiated into mesodermal cells. The iPSCs can be differentiated into mesodermal cells, for example, by culturing the population of iPSCs under suitable conditions for promoting mesodermal differentiation. For example, the iPSC cells can be continuously cultured in a first, a second, and a third mesoderm induction medium to induce differentiation into mesodermal cells. In a preferred embodiment, the first, second, and third mesoderm induction media are chemically defined media. For example, the first mesoderm induction medium can consist of a chemically defined nutrient medium supplemented with an effective amount of activin, preferably activin A, for example, 50 ng / ml of activin A; the second mesoderm induction medium can consist of a chemically defined nutrient medium supplemented with an effective amount of activin, preferably activin A, for example, 5 ng / ml of activin A, BMP, preferably BMP4, for example, 10 ng / ml of BMP4, and FGF, preferably bFGF (FGF2), for example, 5 ng / ml of bFGF; and the third mesoderm induction medium can consist of a chemically defined nutrient medium supplemented with an effective amount of activin, preferably activin A, for example, 5 ng / ml of activin A, BMP, preferably BMP4, for example, 10 ng / ml of BMP4, FGF, preferably bFGF (FGF2), for example, 5 ng / ml of bFGF, and a GSK3 inhibitor, preferably CHIR-99021, for example, 10 μM of CHIR-99021.

[0135] In the second stage, the mesodermal cells can be differentiated into hematopoietic endothelial cells. The mesodermal cells can be differentiated into hematopoietic endothelial (HE) cells by culturing the population of mesodermal cells under suitable conditions for promoting HE differentiation. For example, the mesodermal cells may be cultured in an HE induction medium. In a preferred embodiment, the HE induction medium is a chemically defined medium. For example, the HE induction medium may consist of a chemically defined nutrient medium supplemented with an effective amount of VEGF, for example, 15 ng / ml of VEGF, and SCF, for example, 100 ng / ml of SCF. Preferably, the mesodermal cells are cultured in an HE induction medium consisting of a chemically defined nutrient medium and two differentiation factors, and the two differentiation factors are SCF and VEGF.

[0136] In the third stage, hematopoietic endothelial cells can differentiate into hematopoietic progenitor cells (HPCs). Hematopoietic endothelial (HE) cells can differentiate into hematopoietic progenitor cells (HPCs) by culturing a population of HE cells under suitable conditions for promoting hematopoietic differentiation. For example, HE cells may be cultured in a hematopoietic induction medium. In a preferred embodiment, the hematopoietic induction medium is a chemically defined medium. For example, the hematopoietic induction medium may consist of a chemically defined nutrient medium supplemented with effective amounts of VEGF, e.g., 15 ng / ml, SCF, e.g., 100 ng / ml, thrombopoietin (TPO), e.g., 30 ng / ml, Flt3 ligand (FLT3L), e.g., 25 ng / ml, IL-3, e.g., 25 ng / ml, IL-6, e.g., 10 ng / ml, IL-7, e.g., 10 ng / ml, IL-11, e.g., 5 ng / ml, IGF-1, e.g., 25 ng / ml, BMP, e.g., BMP4 at 10 ng / ml, FGF, e.g., bFGF at 5 ng / ml, sonic hedgehog (SHH), e.g., 25 ng / ml, erythropoietin (EPO), e.g., 2 U / ml, angiotensin II, e.g., 10 μg / ml, and an angiotensin II type 1 receptor (AT1) antagonist, e.g., losartan at 100 μM.

[0137] In the fourth stage, HPCs may differentiate into immune cell progenitors, such as T cell progenitors. Hematopoietic progenitor cells (HPCs) can differentiate into progenitor immune cells by culturing a population of HPCs under suitable conditions for promoting lymphocyte differentiation. For example, hematopoietic progenitor cells may be cultured in a lymphocyte proliferation medium. In a preferred embodiment, the lymphocyte proliferation medium is a chemically defined medium. For example, the lymphocyte proliferation medium may consist of a chemically defined nutrient medium supplemented with effective amounts of the above differentiation factors. Suitable lymphocyte proliferation media are well known in the art and include Stemspan® SFEM II (catalog number 9605, StemCell Technologies Inc, CA) containing Stemspan® Lymphocyte Supplement (catalog number 9915, StemCell Technologies Inc, CA).

[0138] In the fifth stage, the precursor immune cells can mature into TCR αβ+ immune cells such as TCR αβ+ T cells. The precursor immune cells can be matured into TCR αβ+ immune cells by culturing the population of precursor immune cells under suitable conditions for promoting maturation. For example, the precursor immune cells may be cultured in a maturation medium. In a preferred embodiment, the T cell maturation medium is a chemically defined medium. For example, the T cell maturation medium can consist of a chemically defined nutrient medium supplemented with an effective amount of the above differentiation factors. Suitable T cell maturation media are well known in the art and include Stemspan® SFEM II (catalog number 9605, StemCell Technologies Inc, CA), which contains Stemspan® T cell maturation supplement (catalog number 9930, StemCell Technologies Inc, CA), and other media suitable for the proliferation of PBMC and CD3+ cells such as ExCellerate Human T cell proliferation medium (R&D Systems, USA). Other suitable T cell maturation media can include a basal medium such as IMDM supplemented with ITS, albumin, and lipids and further supplemented with an effective amount of the above differentiation factors, as described elsewhere herein.

[0139] In the sixth stage, a population of TCR αβ+ immune cells such as TCR αβ+ T cells can be activated and / or proliferated to produce or increase the proportion of single positive CD4+ immune cells, or more preferably, single positive CD8+ immune cells. Suitable methods for activating and proliferating immune cells such as T cells are well known in the art. For example, T cells can be exposed to a T cell receptor (TCR) agonist under suitable culture conditions. Suitable TCR agonists include ligands such as peptides presented on class I or II MHC molecules (MHC-peptide complexes) on the surface of antigen-presenting cells such as beads or dendritic cells, as well as soluble factors such as anti-TCR antibodies, for example, anti-CD28 antibodies, and multimeric MHC-peptide complexes such as MHC-peptide tetramers, pentamers, or dextramers.

[0140] Suitable conditions and media for use in Stages 1-6 are known in the art. Some preferred conditions and media are disclosed in WO2021 / 032836, WO2021 / 032855, WO2021 / 032851, and WO2021 / 032852, the contents of which, including the conditions and culture media, are incorporated by reference.

[0141] As described above, upon induction of differentiation and maturation, immune cells comprising a heterologous expression cassette are generated. Also provided are immune cells comprising a heterologous expression cassette integrated into their genome. The expression cassette (a) a coding sequence for a productive T cell receptor (TCR), (b) a constitutive promoter operably linked to the coding sequence, and (c) a target site.

[0142] The target site may be a 5' target site, and the cassette may further comprise a 3' target site.

[0143] Immune cells are described elsewhere herein. For example, the immune cells may be TCR αβ+ immune cells, such as TCR αβ+ T cells.

[0144] After production, immune cells comprising a heterologous expression cassette may be stored or primed for use in therapies such as adoptive cell therapy or adoptive immunotherapy. Immune cells are primed by introducing an expression construct encoding a therapeutic TCR into the cell genome at the site of the heterologous expression cassette described herein. For example, immune cells may be primed by replacing the heterologous expression cassette with an expression construct encoding a therapeutic TCR described herein. A primed population of immune cells expressing a therapeutic TCR may be for use as a medicament. For example, a population of immune cells expressing a therapeutic TCR may be used in immunotherapy, such as adoptive cell therapy or adoptive immunotherapy.

[0145] Adoptive cell therapy or adoptive immunotherapy refers to the adoptive transfer of human immune cells, such as T lymphocytes expressing a TCR specific for an antigen expressed on target cells in a patient, or a peptide thereof, and / or a TCR specific for a peptide-MHC complex expressed on target cells. This can be used to treat a variety of diseases depending on the selected target, for example, a tumor-specific antigen for treating cancer. Adoptive cell therapy (ACT) involves removing a portion of donor cells, such as white blood cells. The cells are then used to generate iPSCs in vitro, which are transfected with a heterologous expression cassette and used to efficiently generate immune cells. The immune cells are expanded, washed, concentrated, and / or frozen to allow for testing and transported and stored until the patient is ready to receive an infusion of the immune cells. The immune cells are then primed at the site of the heterologous expression cassette as described herein by insertion of an expression construct encoding a therapeutic TCR specific for an antigen or a peptide thereof expressed on target cells and / or a peptide-MHC complex on target cells such as cancer cells in a patient. The expression construct may replace the heterologous expression cassette. The nucleotide sequence encoding the therapeutic TCR may be derived from cancer-reactive immune cells obtained from the patient, such as infiltrating lymphocytes.

[0146] In some embodiments, the population of immune cells is primed by a population of expression constructs encoding therapeutic TCRs that are inserted into the site of the heterologous expression cassette of the immune cells in the population, specific for different antigens or peptides thereof expressed on target cells such as cancer cells, and / or specific for different peptide-MHC complexes on target cells such as cancer cells in a patient, as described herein. For example, the heterologous expression cassette may be replaced by the expression construct. The therapeutic TCRs encoded by the population of expression constructs may be reactive with different tumor antigens in a patient. The nucleotide sequences encoding different therapeutic TCRs in the population of expression constructs may be derived from cancer-reactive immune cells obtained from the patient, such as tumor-infiltrating lymphocytes. A population of immune cells thus primed may be reactive with multiple different cancer antigens in a patient.

[0147] After production and priming, the population of immune cells that produce, or express, a therapeutic TCR, produced as described herein, may be mixed with other reagents such as buffers, carriers, diluents, preservatives, and / or pharmaceutically acceptable excipients. Suitable reagents are described in more detail hereinafter. The methods described herein may include mixing a population of immune cells with a pharmaceutically acceptable excipient.

[0148] Pharmaceutical compositions suitable for administration (e.g., by infusion) may include aqueous and non-aqueous isotonic pyrogen-free sterile injection solutions that may contain antioxidants, buffers, preservatives, stabilizers, bacteriostatic agents, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that may contain suspending and thickening agents. Examples of isotonic vehicles suitable for use in such formulations include sodium chloride injection, Ringer's solution, or lactated Ringer's injection. Suitable vehicles can be found in standard pharmaceutical textbooks such as Remington’s Pharmaceutical Sciences, 18th edition, Mack Publishing Company, Easton, Pa., 1990.

[0149] In some preferred embodiments, the immune cells can be formulated into a pharmaceutical composition suitable for intravenous injection into an individual.

[0150] As used herein, the term "pharmaceutically acceptable" refers to compounds, materials, compositions, and / or dosage forms that are suitable for use in contact with the tissues of a subject (e.g., a human) without undue toxicity, irritation, allergic reaction, or other problems or complications, within the scope of sound medical judgment, and commensurate with a reasonable benefit / risk ratio. Each carrier, excipient, etc. must also be "acceptable" in the sense of being compatible with the other ingredients of the formulation.

[0151] Another aspect of the invention is the use of an immune cell population expressing a therapeutic TCR produced as described herein or a therapeutic TCR for the manufacture of a drug for the treatment of cancer, an immune cell population expressing a therapeutic TCR produced as described herein for the treatment of cancer, and an immune cell population expressing a therapeutic TCR produced as described herein, which comprises administering the immune cell population to a subject in need thereof, to provide a method for treating cancer.

[0152] The immune cell population may be allogeneic, i.e., the immune cells may originally be obtained from an individual different from the individual to whom they are later administered (i.e., the donor individual and the recipient individual are different). Allogeneic refers to a graft derived from different animals of the same species.

[0153] To avoid GVHD and other undesirable immune effects, such as rejection, the donor individual and the recipient individual may be HLA-matched. Alternatively, the donor individual and the recipient individual may not be HLA-matched, or the HLA genes in the cells derived from the donor individual may be modified, for example, by gene editing, to remove the HLA mismatch with the recipient.

[0154] A population of immune cells suitable for administration to a recipient individual may be produced by providing a population of cells, preferably an initial population of T cells obtained from a donor individual, reprogramming the cells to iPSCs, transfecting the iPSCs with a heterologous expression cassette, differentiating the iPSCs into immune cells, and optionally replacing the heterologous expression cassette with an expression construct encoding a therapeutic TCR that specifically binds to a cancer cell, and / or its antigen, or peptide, presented by a cancer cell complexed with MHC in the recipient individual, or by replacing the heterologous expression cassette in the immune cells with a population of expression constructs each encoding a therapeutic TCR that specifically binds to a different antigen, or a peptide thereof, presented by a cancer cell complexed with MHC in the recipient individual, thereby priming the immune cells.

[0155] Following administration of a therapeutic TCR or immune cells expressing a therapeutic TCR, the recipient individual may mount a cell-mediated immune response against cancer cells in the recipient individual. This may have a beneficial effect on the cancer state of the individual.

[0156] As used herein, the terms “cancer,” “neoplasm,” and “tumor” are used interchangeably and refer to cells that have undergone pathological, malignant transformation with respect to a host organism, in either the singular or plural form.

[0157] Primary cancer cells can be readily distinguished from non-cancer cells by well-established techniques, particularly histological examination. Cancer cells include not only primary cancer cells but also any cells derived from cancer cell progenitors. These include metastatic cancer cells, as well as in vitro cultures and cell lines derived from cancer cells. When referring to the types of cancer that typically present as solid tumors, a "clinically detectable" tumor is detectable based on the mass of the cancer, for example, by procedures such as computerized tomography (CT) scans, magnetic resonance imaging (MRI), X-rays, ultrasound, or palpation during a physical examination, and / or detectable due to the expression of one or more cancer-specific antigens in a sample obtainable from the patient.

[0158] The cancer state can be characterized by the abnormal proliferation of malignant cancer cells and includes, for example, leukemias such as AML, CML, ALL, and CLL, lymphomas such as Hodgkin lymphoma, non-Hodgkin lymphoma, and multiple myeloma, and solid cancers such as sarcomas, skin cancer, melanoma, bladder cancer, brain cancer, breast cancer, uterine cancer, ovarian cancer, prostate cancer, lung cancer, colorectal cancer, cervical cancer, liver cancer, head and neck cancer, esophageal cancer, pancreatic cancer, kidney cancer, adrenal cancer, stomach cancer, testicular cancer, gallbladder and biliary tract cancer, thyroid cancer, thymic cancer, bone cancer, and brain cancer, as well as cancer of unknown primary (CUP).

[0159] Cancer cells in an individual can be immunologically distinct from the individual's normal somatic cells (i.e., a cancerous tumor can be immunogenic). For example, cancer cells may be capable of inducing a systemic immune response in an individual against one or more antigens expressed by the cancer cells. Tumor antigens that induce an immune response can be specific to cancer cells or can be shared by one or more normal cells in the individual.

[0160] Cancer cells of an individual suitable for the treatment described herein may express antigens and / or may be of an HLA type appropriate to bind to the αβTCR expressed by T cells.

[0161] Individuals suitable for the above treatment may be mammals. In a preferred embodiment, the individual is a human. In other preferred embodiments, non-human mammals, particularly mammals that have been conventionally used as models for demonstrating therapeutic efficacy in humans (e.g., mice, primates, pigs, dogs, or rabbit animals} may be used.

[0162] In some embodiments, after the first cancer treatment, the individual may have minimal residual disease (MRD).

[0163] An individual having cancer may present at least one distinguishable sign, symptom, or laboratory finding sufficient to diagnose the cancer according to clinical standards known in the art. Examples of such clinical criteria can be found in medical textbooks such as Harrison’s Principles of Internal Medicine, 15th Ed., Fauci AS et al., eds., McGraw-Hill, New York, 2001. In some cases, the diagnosis of cancer in an individual may include the identification of a specific cell type (e.g., cancer cells) in a body fluid or tissue sample obtained from the individual.

[0164] The anti-tumor effect is a biological effect, which can be manifested by a decrease in tumor growth rate, a decrease in tumor volume, a decrease in the number of tumor cells, a decrease in the number of metastases, an increase in mean life span, or an improvement in various physiological symptoms associated with the cancer state. The “anti-tumor effect” may also be evidenced by the ability of peptides, polynucleotides, cells, particularly T cells, and the antibodies described herein in preventing the occurrence of tumors at the primary site, produced according to the methods of the present invention.

[0165] Treatment can be any procedure and / or therapy that achieves some desired therapeutic effect, such as inhibition or delay of disease progression, regardless of whether it is in humans or animals (e.g., veterinary use). This can include a decrease in the rate of progression, a halt in the rate of progression, improvement of the condition, cure or remission of the condition (whether partial or complete), prevention, delay, reduction, or inhibition of one or more symptoms and / or signs of the condition, or an extension of the lifespan of the subject or patient beyond what would be expected in the absence of treatment.

[0166] Treatment may also be prophylactic (i.e., preventive). For example, an individual who is prone to developing or has a risk of developing or recurring cancer may be treated as described herein. Such treatment can prevent or delay the development or recurrence of cancer in the individual.

[0167] Specifically, treatment may include inhibiting cancer growth, including complete remission of cancer and / or inhibition of cancer metastasis. Cancer growth generally refers to any one of a number of indicators that indicate a change to a more advanced form in cancer. Thus, indicators for measuring inhibition of cancer growth include a decrease in cancer cell survival, a decrease in tumor volume or morphology (e.g., determined using computed tomography (CT), ultrasound, or other imaging diagnostic methods), a delay in tumor growth, disruption of the tumor vasculature, an improvement in the results of a delayed hypersensitivity skin test, an increase in T cell activity, and a decrease in the level of tumor-specific antigens. Administration of immune cells modified as described herein can improve an individual's ability to resist cancer growth, particularly the growth of cancer already present in the subject, and / or reduce the tendency for cancer growth in the individual.

[0168] Immune cells, or pharmaceutical compositions containing immune cells, can be administered to a subject by any convenient route of administration, including but not limited to parenteral routes such as injection, whether systemically / localized or at the desired site of action. Injection includes administration of T cells in a suitable composition via a needle or catheter. Typically, T cells are injected intravenously or subcutaneously, but T cells may also be injected via other parenteral routes such as intramuscular injection and the epidural route. Suitable injection techniques are known in the art and are commonly used in therapy (see, for example, Rosenberg et al., New Eng. J. of Med., 319:1676, 1988).

[0169] Typically, the number of cells administered is from about 10 5 to about 10 10 cells per kg of body weight, for example, about 1, 2, 3, 4, 5, 6, 7, 8, or 9 cells per individual × 10 5 cells, × 10 6 cells, × 10 7 cells, × 10 8 cells, × 10 9 cells, or × 10 10 cells, typically about 2 × 10 8 cells to 2 × 10 10Individual cells, and the treatment is repeated as needed, for example, at intervals of several days to several weeks. It will be appreciated that the suitable dosage of the composition comprising TCRαβ+ T cells and immune cells may vary from patient to patient. Determining the optimal dosage generally involves balancing the level of therapeutic effect against any risks or adverse side effects of the treatment of the present invention. The selected dosage level depends on various factors including, but not limited to, the activity of specific cells, cytokine release syndrome (CRS), route of administration, administration time, rate of cell loss or inactivation, treatment duration, other drugs, compounds, and / or substances co-administered, and the patient's age, gender, weight, condition, general health, and previous medical history. The amount of cells and the route of administration are ultimately at the discretion of the physician, but generally the dosage is to achieve a local concentration at the site of action that achieves the desired effect without causing substantial adverse effects or harmful side effects.

[0170] Immune cells can be administered alone, but in some situations, the immune cells may be cells that are administered in combination with a target antigen, an APC presenting the target antigen, CD3 / CD28 beads, IL-2, IL7, and / or IL15 to promote in vivo expansion of the immune cell population. The combined administration may be by separate, simultaneous, or sequential administration of the combined components.

[0171] The immune cell population may be administered in combination with one or more other treatments such as cytokines, for example, IL-2, CD+4, CD+8 chemotherapy, radiation, and cancer immunotherapy agents (including checkpoint inhibitors such as anti-B7-H3, anti-B7-H4, anti-TIM3, anti-KIR, anti-LAG3, anti-PD-1, anti-PD-L1, and anti-CTLA4 antibodies, etc.). The combined administration may be by separate, simultaneous, or sequential administration of the combined components.

[0172] One or more other treatments can preferably be administered by any convenient means at a site separate from the site of administration of the immune cells.

[0173] Administration of immune cells can be achieved once, continuously, or intermittently (e.g., in divided doses at suitable intervals) throughout the course of treatment. Methods for determining the most effective means and dosage of administration are well known to those skilled in the art and vary depending on the formulation used in the treatment, the purpose of the treatment, the target cells being treated, and the subject being treated. Single or multiple administrations can be performed at dosage levels and patterns selected by the attending physician. Preferably, the immune cells are administered in a single infusion of, for example, 500 million, 1 billion, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 billion T cells, e.g., at least 1×10 9 T cells of any of these are administered in a single infusion.

[0174] Other aspects and embodiments of the present invention provide the foregoing aspects and embodiments with the term "comprising" replaced by the term "consisting of", and the foregoing aspects and embodiments with the term "comprising" replaced by the term "consisting essentially of".

[0175] It should be understood that this application discloses all combinations of the above aspects and the foregoing embodiments with each other, unless the context requires otherwise. Similarly, this application discloses all combinations of preferred and / or any features, alone or in combination with any of the other aspects, unless the context requires otherwise.

[0176] Modifications, further embodiments, and modifications of the above embodiments will be apparent to those skilled in the art upon reading this disclosure and are themselves within the scope of the present invention.

[0177] All documents and sequence database entries referred to herein are hereby incorporated by reference in their entirety for all purposes.

[0178] As used herein, "and / or" is understood as a specific disclosure that each of two specified features, or components, either includes or does not include the other. For example, "A and / or B" is understood as (i) A, (ii) B, and (iii) each of A and B, as if each were individually recited herein.

[0179] Experiment IPSC cell culture Knock-in of the TCR landing pad construct (Figs. 7 and 8) was performed on the iPSC line GR1.1 (Baghbaderani et al 2015, supra. For editing experiments, the GR1.1 iPSC line was maintained on tissue culture-treated plates coated with Matrigel (0.25 μg / cm2) (Solemtim) using complete mTeSR™ Plus culture medium (STEMCELL Technologies). GR1.1 iPSC line cells were passaged every 4-5 days with Versene (ThermoFisher), or Accutase (STEMCELL Technologies). The iPSC cultures were maintained in a humidified 37 °C, 5% O2, 5% CO2 incubator. Expression of pluripotency markers (POU5F1, NANOG, TRA-1-60, and SOX2), and the absence of the differentiation marker SSEA-1 were routinely monitored by FACS analysis. Prior to differentiation, edited iPSC clones were adapted to growth maintenance on Synthemax Matrix (Corning). All other culture conditions were identical.

[0180] Generation of rAAV targeting vectors The AAV targeting construct (Figs. 7 and 8) was generated via Gibson assembly. The homology arm regions were PCR amplified from genomic DNA, and the remaining components of the targeting vector were synthesized. rAAV vectors (serotype 6) were produced via transient transfection of HEK293T cells using the targeting vector and the pDP6 packaging plasmid (Plasmid Factory). HEK293T was transfected with PEI pro at a plasmid to PEI ratio of 1 μg plasmid: 1 μl PEI. The PEI ratio of 1 μg plasmid: rAAV was purified using iodixanol gradient ultracentrifugation according to the standard protocol (Strobel et al. (2015) Hum Gen Ther Methods 26(4) 147 - 157).

[0181] Guide RNA sequence PTPRC exon 33 was targeted with the guide RNA GCAAGTCCAGCTTTAAATCA (SEQ ID NO: 9) (Chr 1 198756152 - 198756171 (Human GRCh38 - Ensembl release 104 - May 2021)), and PPP1r12C intron 1 was targeted with the guide RNA GTCCCCTCCACCCCACAGTG (SEQ ID NO: 7) (Chr19: 55,115,770 - 55,115,790 Human GRCh38 - Ensembl release 104 - May 2021). TRAC exon 1 was targeted with the guide RNA AGAGTCTCTCAGCTGGTACA (SEQ ID NO: 6) (Chr14 22547530 - 22547549 Human GRCh38 - Ensembl release 104 - May 2021), and the guide RNA sequences were synthesized by IDT.

[0182] Preparation of ribonucleoprotein (RNP) complexes The crRNA and tracrRNA were annealed by initial denaturation at 95 °C for 5 minutes before cooling to room temperature. Equal molar amounts of annealed crRNA / tracrRNA duplex and Cas9 protein (IDT) were incubated at room temperature for 15 minutes to generate a 10 μM ribonucleoprotein (RNP) complex.

[0183] Targeting the ADB796 landing pad to knock-in PTPRC exon 33, or PPP1R12C intron 1 The RNP complex targeting PTPRC exon 33, or PPP1R12C intron 1, was introduced into iPSC cells via nucleofection using a 4D-Nucleofector® with 16-well Nucleocuvette® strips (Lonza). 200 × 103 GR 1.1 was resuspended in buffer P3 (Lonza P3 Primary Cell 4D-Nucleofector®) (10 × 106 / ml). 3 μl of the RNP complex (10 μM) was added to 20 μl of the cell suspension. Nucleofection was performed using program CA-137. After nucleofection, the cells were immediately seeded into complete mTESR Plus supplemented with 1× CloneR® (STEMCELL TECHNOLOGIES). AAV transduction (2 × 103 vector genomes / cell) was performed 6 - 8 hours after cell seeding. The edited GR1.1 cells were then cultured in complete mTESR Plus. The cells were passaged once before isolation of iPSC clones derived from single cells and genotyping of the edited clones. Single cells were seeded into 96-well plates using a Solentim VIPS instrument and grown for 10 - 14 days. The edited clones were genotyped by PCR according to a standard protocol using primers corresponding to genomic DNA outside the homology arm region and within the TCR transgene. Furthermore, the integration of the ADB796 TCR landing pad into the desired genomic location (PTPRC exon 33, or PPP1R12C (intron 1)) was confirmed using TLA analysis (Cergentis).

[0184] Exchange of MAGE-A10 TCR ADB796 and MAGE-A4 / B2 TCR ADB959 Excision of the ADB796 TCR landing pad was performed using RNPs containing the TGTACCAGCTGAGAGACTCT guide RNA. PTPRCWT / ADB796 landing pad, or PPP1R12CWT / ADB796 landing pad iPSC cells were differentiated into iT cells. CD4 / CD8 double-positive iT cells were harvested at the end of differentiation (stage 5). Nucleofection was performed using the P2 Primary Cell 4D-Nucleofector X kit S (registered trademark) with 16-well Nucleocuvette (registered trademark) strips. 1×10 6 individual iT cells were resuspended in 20 μl of P2. 3 μl of the RNP complex (10 μM) was added to 20 μl of the cell suspension. Nucleofection was performed using program EH100. AAV transduction (5×10 3 vector genomes / cell) was performed 6 - 8 hours after cell seeding. After culturing the cells for 72 hours, phenotypic analysis was performed by FACS. Cells were analyzed by FACS for the expression of ADB796 and ADB959 by staining with anti-Vbeta13.2 (specific for ADB796) and anti-TCR Valpha24 (specific for ADB959).

[0185] Design and generation of the landing pad strategy 1 TCR A2M10 placeholder construct (ADB00794_001). An rAAV repair template encoding a recombinant AAV production vector was designed to enable constitutive expression of the A2M10 TCR from the EF-1a promoter. The expression cassette was adjacent to a 41 bp sequence present in human B2M. The placeholder cassette was composed of six elements as shown in Figure 12. · Right homology arm required for integration based on homology-directed repair (HDR) of the cassette into the PPP1R12C (AAVS1) locus (Chr19: 55115773-55115274 GRCh38.p14, present in humans). · The B2M target site present in human B2M (Chr15: 44715435-44715475, GRCh38.p14) was used as a targetable DNA sequence for replacement of the placeholder TCR with the exchange TCR (A2M4). · EF-1α promoter. · A2M10 TCR sequence (Border et al., Oncoimmunology, 2018). · SV40 polyadenylation signal · The left homology arm is required for integration of the cassette into the PPP1R12C (AAVS1) locus (Chr19: 55116272-55115774, GRCh38.p14, present in human PPP1R12C) based on homology-directed repair (HDR).

[0186] This construct was designed to be cloned into the rAAV production backbone (Agilent pAAV_MCS) using Gibson cloning.

[0187] Generation of the Landing Pad Strategy 1 TCR A2M10 placeholder construct: ADB00794_001 The A2M10 expression cassette was synthesized by Twist Bioscience and inserted into the pTwist-puro backbone. Next, the A2M10 expression cassette was PCR amplified using the 41bp B2M (Chr15: 44715435-44715475, GRCh38.p14) target sequence (SEQ ID NOs: 42 and 43).

[0188] The left homology arm (LHA) was amplified from genomic DNA isolated from GR1.1 iPSC (Baghbaderani et al., Stem Cell Reports, 2015) cells using the FWD and REV primers of SEQ ID NOs: 44 and 45 (present in humans, Chr19: 55115774-55116274 GRCh38.p14).

[0189] The right homology arm (RHA) was amplified from genomic DNA isolated from GR1.1 iPSC cells using the FWD and REV primers of SEQ ID NOs: 46 and 47 (present in humans, Chr19: 55115773-55115274 GRCh38.p14).

[0190] All PCRs were performed using Q5 DNA polymerase (NEB, M0491L) according to the standard protocol. The PCR products - the A2M10 expression cassette, RHA, and LHA adjacent to the B2M target sequence were purified by gel extraction using the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, 740609.50) according to the manufacturer's instructions and assembled into the NotI-digested adeno-associated virus vector backbone (Agilent pAAV-MCS) using equimolar ratios of DNA fragments with the Gibson Assembly® Cloning Kit (NEB, E5510S). Clones were screened by restriction enzyme digestion and the sequences were verified by Sanger sequencing.

[0191] Generation of the Landing Pad Strategy 1 TCR A2M4 Exchange Construct: ADB01032_026 The A2M4 TCR_BGHpolyA expression plasmid was synthesized by GeneART.

[0192] A2M4TCR_BGHpolyA (Sanderson et al., Oncoimmunology, 2019) was PCR amplified using the FWD and REV primers of SEQ ID NOs: 48 and 49.

[0193] The left homology arm (LHA) containing the 500 bp sequence (PPP1R12C, Chr19:55116273 - 55115793 GRCh38.p14 present in humans) was amplified from ADB00794_001 using the FWD and REV primers of SEQ ID NOs: 50 and 51.

[0194] The right homology arm (RHA) containing the 501 bp sequence (PPP1R12C, Chr19: 55115775 - 55115274 GRCh38.p14 present in humans) was amplified from ADB00794_001 using the FWD and REV primers of SEQ ID NOs: 52 and 53.

[0195] All PCRs were performed using Q5 DNA polymerase (NEB, M0491L) according to the standard protocol. The PCR products - A2M4TCR_BGHpolyA, RHA, and LHA, and the EF - 1α promoter were purified by gel extraction using the NucleoSpin Gel and PCR Clean - up Kit (Macherey - Nagel, 740609.50), and assembled into the NotI - digested adeno - associated virus vector backbone (pAAV - MCS) using equimolar ratios of DNA fragments using the Gibson Assembly® Cloning Kit (NEB, E5510S). Clones were screened by restriction enzyme digestion and verified by Sanger sequencing. The EF - 1α promoter was amplified from ADB00794 - 001 using the forward primer (GGCTCCGGTGCCCGTCAGTGGGC) and the reverse primer (GGTGGCGGCAAGCTTGGCAGCGGC).

[0196] iPSC cell culture Knock-in of the TCR landing pad construct (Figure 2) was performed with the iPSC line GR1.1 (Baghbaderani et al 2015). For the editing experiments, the GR1.1 iPSC line was maintained on tissue culture-treated plates coated with vitronectin (0.5 μg / cm2) (Gibco, A14700) using complete mTeSR® Plus culture medium (STEMCELL Technologies, 100-0276). GR1.1 iPSC line cells were passaged every 4 - 5 days with Versene (ThermoFisher, 15040066), or Accutase (STEMCELL Technologies, 07920). The iPSC cultures were maintained in a humidified 37 °C, 5% O2, 5% CO2 incubator.

[0197] Generation of A2M10 placeholder TCR knock-in iPSC cells The guide RNA targeting the intron 1 PPP1R12C locus of the sequence GTCCCCTCCACCCCACAGTG (SEQ ID NO: 7; Chr19: 55,115,770 - 55,115,790 Human GRCh38 - Ensembl release 104 - May 2021) was synthesized by Synthego as a single guide RNA. The ADB00794_001 repair template was packaged into AAV6 and purified by Virovek Inc. Using the purified AAV6 - ADB00794_001 virus, the placeholder cassette was knocked into GR1.1 iPSC cells using CRISPR - Cas9. Briefly, 250,000 cells were electroporated with 62 pmole of high - fidelity SpyFi Cas9 (Aldevron, 9214 - 0.25MG) having a 1.2 molar ratio of guide RNA and the PPP12R1C locus was targeted using the CA - 137 program on the 4D - Nucleofector™ system. Electroporation was performed using the P3 Primary Cell 4D - Nucleofector X kit S™ with 16 - well Nucleocuvette® strips. After electroporation, the cell suspension was transferred to a 24 - well plate containing 500 μl of complete mTESR™ Plus supplemented with 1×CloneR® 2 (STEMCELL TECHNOLOGIES, 100 - 0691), and 9 1.25×10 of AAV6 - ADB01032_026 vg was added. Then, the cells were cultured for 2 weeks and single cells were seeded into 96 - well plates using the Solentim Verified In - Situ Plate Seeding (VIPS) platform. The cells were screened for targeted transgene integration using junction PCR (Geisinger, 2016, Nucleic Acids Research). Junction PCR primers of SEQ ID NOs: 54 - 57 were used.

[0198] To maximize the reliability of the correct gene editing results, integration was confirmed at both the 5' and 3' ends. The allele frequency of the integrated landing pad cassette was confirmed by amplicon PCR, followed by agarose gel electrophoresis.

[0199] rAAV6-A2M4 exchange repair template generation rAAV was produced by transient transfection of suspension HEK293T using a 2-plasmid system. After transfection, it contained 2 mM sodium butyrate for 24 hours. Cells were harvested 48 hours after transfection via centrifugation (350 g, 5 minutes), washed with PBS, and resuspended in 5 mM Tris pH 8.5, 150 mM NaCl (18 ml / 250 ml of the original culture volume). The resuspended cells were lysed by freeze-thaw (frozen on dry ice and thawed in a 37°C water bath). The cell lysate was treated with Benzonase (250 U / ml, adding MgCl2 to a concentration of 2 mM) at 37°C for 1 hour. The Benzonase-treated lysate was purified by centrifugation (4000×g for 30 minutes), and the supernatant was filtered through a 0.45 um filter and then purified by () chromatography. The purified lysate was loaded onto a POROS Capture Select AAVX 1 ml column at a flow rate of 0.5 ml / min, washed with a high-salt buffer (10 mM Tris pH 8, 1 M NaCl), and eluted with a low-pH glycine buffer (50 mM Glycine pH 2.7, 500 mM NaCl). The eluted AAV was neutralized by adding Tris pH 8 to a concentration of 80 mM and analyzed by SDS-PAGE and dPCR.

[0200] Generation of A2M10 placeholder-bearing precursor T cells iPSC clones were differentiated into CD34+ hematopoietic progenitor stem cells and then into CD3+ iT cell progenitor cells according to an in-house protocol. The expression of the A2M10 placeholder TCR was confirmed by flow cytometry (Figure 13).

[0201] Exchange of A2M10 placeholder TCR to A2M4 in early T cell progenitors The A2M10 TCR was replaced with A2M4 TCR in the iPSC clone 15F2_AAVS1. - / A2M10LP , and 16D5_AAVS1 A2M10LP / A2M10LP This was performed at different stages of differentiation in iT cells differentiated from 15F2_AAVS1. - / A2M10LP 3.5×10 5 iT cell precursors were electroporated with Cas9-guide RNA ribonucleoprotein (RNP) (SEQ ID NO: 63: ucacgucauccagcagagaa) and transduced with rAAV6-ADB01032_026 immediately after electroporation (Figure 12). 48 hours after transduction, the medium was changed and flow cytometry analysis was performed 24 hours later (Figures 14, 15). A list of antibodies used can be seen in Table 2. DNA PK inhibitors (M3814, S8586, Selleckchem) were used to improve HDR editing results (Riesenberg et al., 2019 Nucleic Acids Research, Fu et al., 2021 Nucleic Acids Research). A2M10 placeholder TCR replacement was performed in the independent cell line 16D5_AAVS1 A2M10LP / A2M10LP This was reproduced in the GR1.1 strain (Figs. 16 and 17).

[0202] Exchange of A2M10 placeholder TCR to A2M4 in late T cell precursors 1×10 6 Late stage 15F2_AAVS1 - / A2M10LPT cell precursors were electroporated with Cas9-guide RNA RNP (SEQ ID NO: 63: ucacgucauccagcagagaa), activated with ImmunoCult® Human CD3 / CD28 T Cell Activator (STEMCELL TECHNOLOGIES, 10971) on day 35, and then transduced with AAV6-A2M4 on day 38. Electroporation was performed using the P3 Primary Cell 4D-Nucleofector X kit® with a 96-well Nucleocuvette® plate having the DZ100 program. Forty-eight hours after transduction, the medium was changed and flow cytometry analysis was performed 48 hours later (Figures 18, 19). The list of antibodies used can be seen in Table 2.

Table 1

Table 2

[0203] Sequence GSGATNFSLL KQAGDVEENP GP SEQ ID NO: 1 - P2A cleavage sequence

[0204] GGAAGCGGAGCT ACTAACTTCA GCCTGCTGAA GCAGGCTGGA GACGTGGAGG AGAACCCTGG GCCT Nucleotide sequence encoding SEQ ID NO: 2 - P2A peptide.

[0205] GCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAG SEQ ID NO: 3 - Ef1a short promoter

[0206] CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGG SEQ ID NO: 4 - Bovine growth hormone polyA signal

[0207] TCTCTCAGCTGGTACACGGC SEQ ID NO: 5 - TRAC EXON 1 Chr14 22547526 to 22547545 (-) (Human GRCh38 - Ensembl release 104 - May 2021)

[0208] AGAGTCTCTCAGCTGGTACA SEQ ID NO: 6 - TRAC EXON 1 Chr14 22547530 to 22547549 (-) (Human GRCh38 - Ensembl release 104 - May 2021)

[0209] GTCCCCTCCACCCCACAGTG Array number 7 - PPP1R12C INTRON1 Chr19: 55,115,770 - 55,115,790 (Human GRCh38 - Ensembl release 104 - May 2021)

[0210] TCACGTCATCCAGCAGAGAA Array number 8 - B2M EXON 2 CHr15 44715446 - 44715465 (Human GRCh38 - Ensembl release 104 - May 2021)

[0211] GCAAGTCCAGCTTTAAATCA Array number 9 - PTPRC Chr 1 198756152 - 198756171 (+) (Human GRCh38 - Ensembl release 104 - May 2021)

[0212] AACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTA Array number 10 - SV40 PolyA sequence

[0213] CGGGCCAAGAGAAGCGGATCCGGC Array number 11 - Nucleotide sequence encoding furin cleavage site and SG linker

[0214] RAKRSGSG Array number 12 - Peptide sequence encoding furin cleavage site and SG linker

[0215] CAGAACCCTGACCCTGCCGTGTACCAGCTGAGAGACTCTAAATCCAGT Array number 13 - Cleaved TRAC domain - nucleotide sequence

[0216] ATGTCTCTGGGCCTGCTGTGCTGTGGCGTGTTCTCCCTGCTGTGGGCCGGACCTGTGAATGCCGGCGTGACCCAGACCCCCAAGTTCCGGGTGCTGAAAACCGGCCAGAGCATGACACTGCTGTGCGCCCAGGACATGAACCACGACTACATGTATTGGTACAGACAGGACCCCGGCATGGGCCTGCGGCTGATCCACTATTCTGTGGGCGAGGGCACCACCGCCAAGGGCGAAGTGCCTGATGGCTACAACGTGTCCCGGCTGAAGAAGCAGAACTTCCTGCTGGGCCTGGAAAGCGCCGCTCCTAGCCAGACCAGCGTGTACTTCTGCGCCAGCAGCTTCACCGACACCCAGTACTTCGGCCCTGGCACCAGACTGACCGTGCTGGAGGACCTGAAGAACGTGTTCCCCCCAGAGGTGGCCGTGTTCGAGCCCTCTGAGGCCGAGATCAGCCACACCCAGAAAGCCACCCTGGTCTGCCTGGCCACCGGCTTCTACCCCGACCACGTGGAACTGTCTTGGTGGGTGAACGGCAAAGAGGTGCACAGCGGCGTCAGCACCGACCCTCAGCCCCTGAAAGAGCAGCCCGCCCTGAACGACAGCCGGTACTGCCTGAGCAGCAGACTGCGGGTGTCCGCCACCTTCTGGCAGAACCCCCGGAACCACTTCAGATGCCAGGTGCAGTTCTACGGCCTGAGCGAGAACGACGAGTGGACCCAGGACCGGGCCAAGCCTGTGACCCAGATCGTGTCTGCCGAAGCATGGGGGCGCGCCGATTGCGGCTTCACAAGCGAGAGCTACCAGCAGGGCGTGCTGAGCGCCACCATCCTGTACGAGATCCTGCTGGGCAAGGCCACCCTGTACGCCGTGCTGGTGTCCGCTCTGGTGCTGATGGCCATGGTGAAACGGAAGGACAGCCGGGGC SEQ ID NO: 14 - MAGE - A10 c796 TCR beta chain nucleotide sequence

[0217] MSLGLLCCGVFSLLWAGPVNAGVTQTPKFRVLKTGQSMTLLCAQDMNHDYMYWYRQDPGMGLRLIHYSVGEGTTAKGEVPDGYNVSRLKKQNFLLGLESAAPSQTSVYFCASSFTDTQYFGPGTRLTVLEDLKNVFPPEVAVFEPSEAEISHTQKATLVCLATGFYPDHVELSWWVNGKEVHSGVSTDPQPLKEQPALNDSRYCLSSRLRVSATFWQNPRNHFRCQVQFYGLSENDEWTQDRAKPVTQIVSAEAWGRADCGFTSESYQQGVLSATILYEILLGKATLYAVLVSALVLMAMVKRKDSRG SEQ ID NO: 15 - MAGE - A10 c796 TCR beta chain amino acid sequence

[0218] ATGATGAAGTCCCTGCGGGTGCTGCTGGTCATCCTGTGGCTGCAGCTGTCCTGGGTCTGGTCCCAGCAGAAAGAGGTGGAGCAGAACAGCGGCCCTCTGAGCGTGCCCGAGGGCGCTATCGCCAGCCTGAACTGCACCTACAGCGACAGAGGCAGCCAGAGCTTCTTCTGGTACAGACAGTACAGCGGCAAGAGCCCCGAGCTGATCATGAGCATCTACAGCAACGGCGACAAAGAGGACGGCCGGTTCACCGCCCAGCTGAACAAGGCCAGCCAGTACGTGTCCCTGCTGATCCGGGACAGCCAGCCCAGCGACAGCGCCACCTACCTGTGCGCCGTGAGAGGCACAGGCAGAAGGGCCCTGACATTTGGCAGCGGCACCAGACTGCAGGTGCAGCCCAATATCCAGAACCCTGACCCTGCCGTGTACCAGCTGAGAGACTCTAAATCCAGTGACAAGTCTGTCTGCCTATTCACCGATTTTGATTCTCAAACAAATGTGTCACAAAGTAAGGATTCTGATGTGTATATCACAGACAAAACTGTGCTAGACATGAGGTCTATGGACTTCAAGAGCAACAGTGCTGTGGCCTGGAGCAACAAATCTGACTTTGCATGTGCAAACGCCTTCAACAACAGCATTATTCCAGAAGACACCTTCTTCCCCAGCCCAGAAAGTTCCTGTGATGTCAAGCTGGTCGAGAAAAGCTTTGAAACAGATACGAACCTAAACTTTCAAAACCTGTCAGTGATTGGGTTCCGAATCCTCCTCCTGAAAGTGGCCGGGTTTAATCTGCTCATGACGCTGCGGCTGTGGTCCAGC SEQ ID NO: 16 - MAGE - A10 c796 TCR alpha chain nucleotide sequence

[0219] MMKSLRVLLVILWLQLSWVWSQQKEVEQNSGPLSVPEGAIASLNCTYSDRGSQSFFWYRQYSGKSPELIMSIYSNGDKEDGRFTAQLNKASQYVSLLIRDSQPSDSATYLCAVRGTGRRALTFGSGTRLQVQPNIQNPDPAVYQLRDSKSSDKSVCLFTDFDSQTNVSQSKDSDVYITDKTVLDMRSMDFKSNSAVAWSNKSDFACANAFNNSIIPEDTFFPSPESSCDVKLVEKSFETDTNLNFQNLSVIGFRILLLKVAGFNLLMTLRLWSS Array number 17-MAGE-A10 c796 TCR alpha chain amino acid sequence

[0220] CAAATTCACATTGCAAAGAAATGTGGATACAGGAAGGAAAATAAGTTTTATATTCTTGTAATCGATCTATCGTGTATACCCTCTATGTGGTAGTAACTGTAGATGGTCATCTGGGAATTAATCCTTATTCACAGTGTAAACTTAATTACTCACTAAAATATATAAAGCTTTTAATCATGTATGATATTGAGATTTCATATCTTGGTACTTAAAAATGTATCAAATGCTTGCTATGTGCTCTTGCTATAAAGAGCTAATTGGTATGAGGGAAAGCCAGGTATTTACTAATCAATGTAGTGAGTAAAATGACAGAAAAATTATAAGAAGAACATGAATGAGGGCATTTAATTTAAACTTTAGGAATCAAGAAACGCTTCTCGAAGCAGTGATTCCTGCCCTGATTCTTAAATAATGTGTAGGCATTAGACAGGAGGATAAGTACAAAACGTGGCATCATGAGCAAAGGCATGGAAATGGCCCATGAGCGGAGTGAACACTGGTTTGGGGTTGCTCCAAGGTAAAGTTCAAAAAGTATCCTGCAGTCAACCCTTTAGCACCATAAAGAAACTAAATTATTTAGATGTTTTTATGAGAACATATCAAAAAGTACTTTTCTGTCATCCAATACTTCCACAAATAAATCATTAGTTCTTGCTAATCTTCATCTGGCATAAAAATAATGACATCAACTTTCTTCATGTAATTTCCCACTTAATTCCTTTACTAGGAGCAATATCAATTCCTATATGACGTCATTGCCAGCACCTACCCTGCTCAGAATGGACAAGTAAAGAAAAACAACCATCAAGAAGATAAAATTGAATTTGATAATGAAGTGGACAAAGTAAAGCAGGATGCTAATTGTGTTAATCCACTTGGTGCCCCAGAAAAGCTCCCTGAAGCAAAGGAACAGGCTGAAGGTTCTGAACCCACGAGTGGCACTGAGGGGCCAGAACATTCTGTCAATGGTCCTGCTAGCCCTGCATTGAACCAAGGTTCA。 Array number 18 - PTPRC exon 33 targeting vector - left homology arm (Chr1:198755130-198756201 Human GRCh38 - Ensembl release 104 - May 2021)

[0221] GAAAAGACATAAATGAGGAAACTCCAAACCTCCTGTTAGCTGTTATTTCTATTTTTGTAGAAGTAGGAAGTGAAAATAGGTATACAGTGGATTAATTAAATGCAGCGAACCAATATTTGTAGAAGGGTTATATTTTACTACTGTGGAAAAATATTTAAGATAGTTTTGCCAGAACAGTTTGTACAGACGTATGCTTATTTTAAAATTTTATCTCTTATTCAGTAAAAAACAACTTCTTTGTAATCGTTATGTGTGTATATGTATGTGTGTATGGGTGTGTGTTTGTGTGAGAGACAGAGAAAGAGAGAGAATTCTTTCAAGTGAATCTAAAAGCTTTTGCTTTTCCTTTGTTTTTATGAAGAAAAAATACATTTTATATTAGAAGTGTTAACTTAGCTTGAAGGATCTGTTTTTAAAAATCATAAACTGTGTGCAGACTCAATAAAATCATGTACATTTCTGAAATGACCTCAAGATGTCCTCCTTGTTCTACTCATATATATCTATCTTATATAGTTTACTATTTTACTTCTAGAGATAGTACATAAAGGTGGTATGTGTGTGTATGCTACTACAAAAAAGTTGTTAACTAAATTAACATTGGGAAATCTTATATTCCATATATTAGCATTTAGTCCAATGTCTTTTTAAGCTTATTTAATTAAAAAATTTCCAGTGAGCTTATCATGCTGTCTTTACATGGGGTTTTCAATTTTGCATGCTCGATTATTCCCTGTACAATATTTAAAATTTATTGCTTGATACTTTTGACAACAAATTAGGTTTTGTACAATTGAACTTAAATAAATGTCATTAAAATAAATAAATGCAATATGTATTAATATTCATTGTATAAAAATAGAAGAATACAAACATATTTGTTAAATATTTACATATGAAATTTAATATAGCTATTTTTATGGAATTTTTCATTGATATGAAAAATATGATATTGCATATGCATAGTTCCCATGTTAAATCCCATTCATAACTTTCATTA。 Array number 19 - PTPRC exon 33 targeting vector - right homology arm (chromosome 1: 198,756,132 - 198,757,230 Human GRCh38 - Ensembl release 104 - May 2021)

[0222] GCTCCCATAGCTCAGTCTGGTCTATCTGCCTGGCCCTGGCCATTGTCACTTTGCGCTGCCCTCCTCTCGCCCCCGAGTGCCCTTGCTGTGCCGCCGGAACTCTGCCCTCTAACGCTGCCGTCTCTCTCCTGAGTCCGGACCACTTTGAGCTCTACTGGCTTCTGCGCCGCCTCTGGCCCACTGTTTCCCCTTCCCAGGCAGGTCCTGCTTTCTCTGACCTGCATTCTCTCCCCTGGGCCTGTGCCGCTTTCTGTCTGCAGCTTGTGGCCTGGGTCACCTCTACGGCTGGCCCAGATCCTTCCCTGCCGCCTCCTTCAGGTTCCGTCTTCCTCCACTCCCTCTTCCCCTTGCTCTCTGCTGTGTTGCTGCCCAAGGATGCTCTTTCCGGAGCACTTCCTTCTCGGCGCTGCACCACGTGATGTCCTCTGAGCGGATCCTCCCCGTGTCTGGGTCCTCTCCGGGCATCTCTCCTCCCTCACCCAACCCCATGCCGTCTTCACTCGCTGGGTTCCCTTTTCCTTCTCCTTCTGGGGCCTGTGCCATCTCTCGTTTCTTAGGATGGCCTTCTCCGACGGATGTCTCCCTTGCGTCCCGCCTCCCCTTCTTGTAGGCCTGCATCATCACCGTTTTTCTGGACAACCCCAAAGTACCCCGTCTCCCTGGCTTTAGCCACCTCTCCATCCTCTTGCTTTCTTTGCCTGGACACCCCGTTCTCCTGTGGATTCGGGTCACCTCTCACTCCTTTCATTTGGGCAGCTCCCCTACCCCCCTTACCTCTCTAGTCTGTGCTAGCTCTTCCAGCCCCCTGTCATGGCATCTTCCAGGGGTCCGAGAGCTCAGCTAGTCTTCTTCCTCCAACCCGGGCCCCTATGTCCACTTCAGGACAGCATGTTTGCTGCCTCCAGGGATCCTGTGTCCCCGAGCTGGGACCACCTTATATTCCCAGGGCCGGTTAATGTGGCTCTGGTTCTGGGTACTTTTATCTGTCCCCTCCACCCCA。 Array number 20 - AAVS1 intron 1 - targeted vector - left homology arm (CHr 19:55115776 - 55116775 Human GRCh38 - Ensembl release 104 - May 2021)

[0223] Array number 21 - AAVS1 intron 1 targeting vector - right homology arm (Chr 19:55114775 - 55115775 Human GRCh38 - Ensembl release 104 - May 2021)

[0224] Knock-in to the PTPRC Exon 33 TCR landing pad of Array No. 22 MAGE-B2 / A4 ADB959 - Left homology arm Chr1: 198,754,605 - 198,756,226 (Human GRCh38 - Ensembl release 104 - May 2021)

[0225] Knock-in to the PTPRC exon 33 TCR landing pad - right homology arm of Array number 23 MAGE-B2 / A4 ADB959; TRAC domain sequence (nucleotides 1-396), BGH polyA signal (397-621), and nucleotides corresponding to chromosome 1: 198,756,132 - 198,757,230 Human GRCh38 - Ensembl release 104 - May 2021) are included

[0226] AGTTCAGGTTCAAGAGCTAAAAGGAGCGGATCAGGT Array number 24 - Furin SG linker

[0227] GGCAGCCGGGCCAAGAGATCTGGATCCGGC Array number 25 - Furin SG linker

[0228] SSGSRAKRSGS Array number 26 Furin SG linker

[0229] GSRAKRSGSG Array number 27 Furin SG linker

[0230] GAGGGCAGAGGCAGCCTGCTGACATGTGGCGACGTGGAAGAAAACCCTGGCCCT Array number 28 - T2A skip-like sequence nucleotide sequence

[0231] EGRGSLLTCGDVEENPGP Array number 29 - T2A skip-like sequence amino acid sequence

[0232] GCTACCAACTTTAGCCTGCTGAAGCAGGCCGGGGACGTGGAAGAAAACCCTGGCCCT Array number 30 - P2A skip-like sequence nucleotide sequence

[0233] ATNFSLLKQAGDVEENPGP Array number 31-P2A skip-like array amino acid sequence

[0234] ATGGCCAGCCTGCTGTTCTTCTGCGGCGCCTTCTACCTGCTGGGCACCGGCTCTATGGATGCCGACGTGACCCAGACCCCCCGGAACAGAATCACCAAGACCGGCAAGCGGATCATGCTGGAATGCTCCCAGACCAAGGGCCACGACCGGATGTACTGGTACAGACAGGACCCTGGCCTGGGCCTGCGGCTGATCTACTACAGCTTCGACGTGAAGGACATCAACAAGGGCGAGATCAGCGACGGCTACAGCGTGTCCAGACAGGCTCAGGCCAAGTTCAGCCTGTCCCTGGAAAGCGCCATCCCCAACCAGACCGCCCTGTACTTTTGTGCCACAAGCGGCCAGGGCGCCTACAACGAGCAGTTCTTTGGCCCTGGCACCCGGCTGACAGTGCTGGAAGATCTGAAGAACGTGTTCCCCCCAGAGGTGGCCGTGTTCGAGCCTTCTGAGGCCGAAATCAGCCACACCCAGAAAGCCACACTCGTGTGTCTGGCCACCGGCTTCTACCCCGACCACGTGGAACTGTCTTGGTGGGTCAACGGCAAAGAGGTGCACAGCGGCGTGTCCACCGATCCCCAGCCTCTGAAAGAACAGCCCGCCCTGAACGACAGCCGGTACTGCCTGAGCAGCAGACTGAGAGTGTCCGCCACCTTCTGGCAGAACCCCAGAAACCACTTCAGATGCCAGGTGCAGTTTTACGGCCTGAGCGAGAACGACGAGTGGACCCAGGACAGAGCCAAGCCCGTGACACAGATCGTGTCTGCCGAAGCTTGGGGGCGCGCCGATTGTGGCTTTACCAGCGAGAGCTACCAGCAGGGCGTGCTGAGCGCCACCATCCTGTACGAGATCCTGCTGGGAAAGGCCACACTGTACGCCGTGCTGGTGTCTGCCCTGGTGCTGATGGCCATGGTCAAGCGGAAGGACAGCCGGGGC SEQ ID NO: 32 - ADB959 TCR beta chain nucleotide sequence

[0235] ATGAAGAAGCACCTGACCACCTTTCTCGTGATCCTGTGGCTGTACTTCTACCGGGGCAACGGCAAGAACCAGGTGGAACAGAGCCCCCAGAGCCTGATCATCCTGGAAGGCAAGAACTGCACCCTGCAGTGCAACTACACCGTGTCCCCCTTCAGCAACCTGCGGTGGTACAAGCAGGACACCGGCAGAGGCCCTGTGTCCCTGACCATCGTGACCTTCAGCGAGAACACCAAGAGCAACGGCCGGTACACCGCCACCCTGGACGCCGATACAAAGCAGAGCAGCCTGCACATCACCGCCAGCCAGCTGAGCGATAGCGCCAGCTACATCTGCGTGGTGTCCGGCGGCACAGACAGCTGGGGCAAGCTGCAGTTTGGCGCCGGAACACAGGTGGTCGTGACCCCCGACATCCAGAACCCTGACCCTGCAGTATATCAGCTGAGAGACTCTAAATCCAGTGACAAGTCTGTCTGCCTATTCACCGATTTTGATTCTCAAACAAATGTGTCACAAAGTAAGGATTCTGATGTGTATATCACAGACAAAACTGTGCTAGACATGAGGTCTATGGACTTCAAGAGCAACAGTGCTGTGGCCTGGAGCAACAAATCTGACTTTGCATGTGCAAACGCCTTCAACAACAGCATTATTCCAGAAGACACCTTCTTCCCCAGCCCAGAAAGTTCCTGTGATGTCAAGCTGGTCGAGAAAAGCTTTGAAACAGATACGAACCTAAACTTTCAAAACCTGTCAGTGATTGGGTTCCGAATCCTCCTCCTGAAAGTGGCCGGGTTTAATCTGCTCATGACGCTGCGGCTGTGGTCCAGCTGA SEQ ID NO: 33 - ADB959 TCR alpha chain nucleotide sequence

[0236] EQYQFLYDVIASTYPAQNGQVKKNNHQEDKIEFDNEVDKVKQDANCVNPLGAPEKLPEAKEQAEGSEPTSGTEGPEHSVNGPASPALNQGSSSGSRAKRSGSGEGRGSLLTCGDVEENPGPMASLLFFCGAFYLLGTGSMDADVTQTPRNRITKTGKRIMLECSQTKGHDRMYWYRQDPGLGLRLIYYSFDVKDINKGEISDGYSVSRQAQAKFSLSLESAIPNQTALYFCATSGQGAYNEQFFGPGTRLTVLEDLKNVFPPEVAVFEPSEAEISHTQKATLVCLATGFYPDHVELSWWVNGKEVHSGVSTDPQPLKEQPALNDSRYCLSSRLRVSATFWQNPRNHFRCQVQFYGLSENDEWTQDRAKPVTQIVSAEAWGRADCGFTSESYQQGVLSATILYEILLGKATLYAVLVSALVLMAMVKRKDSRGGSRAKRSGSGATNFSLLKQAGDVEENPGPMKKHLTTFLVILWLYFYRGNGKNQVEQSPQSLIILEGKNCTLQCNYTVSPFSNLRWYKQDTGRGPVSLTIVTFSENTKSNGRYTATLDADTKQSSLHITASQLSDSASYICVVSGGTDSWGKLQFGAGTQVVVTPDIQNPDPAVYQLRDSKSSDKSVCLFTDFDSQTNVSQSKDSDVYITDKTVLDMRSMDFKSNSAVAWSNKSDFACANAFNNSIIPEDTFFPSPESSCDVKLVEKSFETDTNLNFQNLSVIGFRILLLKVAGFNLLMTLRLWSS Sequence number 34 - Translated sequence PTPRC exon 33_T2A_ADB959_TCRβ_P2A_TCRα

[0237] Knock-in to the AAVS1 TCR landing pad of Array No. 35-MAGE-B2 / A4 ADB959 - Left homology arm (Chr 19: 55,115,701-55,117,349 Human GRCh38 - Ensembl release 104 - May 2021)

[0238] GCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAG Array No. 36 - EF1A short promoter

[0239] ATGGCCAGCCTGCTGTTCTTCTGCGGCGCCTTCTACCTGCTGGGCACCGGCTCTATGGATGCCGACGTGACCCAGACCCCCCGGAACAGAATCACCAAGACCGGCAAGCGGATCATGCTGGAATGCTCCCAGACCAAGGGCCACGACCGGATGTACTGGTACAGACAGGACCCTGGCCTGGGCCTGCGGCTGATCTACTACAGCTTCGACGTGAAGGACATCAACAAGGGCGAGATCAGCGACGGCTACAGCGTGTCCAGACAGGCTCAGGCCAAGTTCAGCCTGTCCCTGGAAAGCGCCATCCCCAACCAGACCGCCCTGTACTTTTGTGCCACAAGCGGCCAGGGCGCCTACAACGAGCAGTTCTTTGGCCCTGGCACCCGGCTGACAGTGCTGGAAGATCTGAAGAACGTGTTCCCCCCAGAGGTGGCCGTGTTCGAGCCTTCTGAGGCCGAAATCAGCCACACCCAGAAAGCCACACTCGTGTGTCTGGCCACCGGCTTCTACCCCGACCACGTGGAACTGTCTTGGTGGGTCAACGGCAAAGAGGTGCACAGCGGCGTGTCCACCGATCCCCAGCCTCTGAAAGAACAGCCCGCCCTGAACGACAGCCGGTACTGCCTGAGCAGCAGACTGAGAGTGTCCGCCACCTTCTGGCAGAACCCCAGAAACCACTTCAGATGCCAGGTGCAGTTTTACGGCCTGAGCGAGAACGACGAGTGGACCCAGGACAGAGCCAAGCCCGTGACACAGATCGTGTCTGCCGAAGCTTGGGGGCGCGCCGATTGTGGCTTTACCAGCGAGAGCTACCAGCAGGGCGTGCTGAGCGCCACCATCCTGTACGAGATCCTGCTGGGAAAGGCCACACTGTACGCCGTGCTGGTGTCTGCCCTGGTGCTGATGGCCATGGTCAAGCGGAAGGACAGCCGGGGC SEQ ID NO: 37 - ADB959 TCR beta chain nucleotide sequence

[0240] ATGAAGAAGCACCTGACCACCTTTCTCGTGATCCTGTGGCTGTACTTCTACCGGGGCAACGGCAAGAACCAGGTGGAACAGAGCCCCCAGAGCCTGATCATCCTGGAAGGCAAGAACTGCACCCTGCAGTGCAACTACACCGTGTCCCCCTTCAGCAACCTGCGGTGGTACAAGCAGGACACCGGCAGAGGCCCTGTGTCCCTGACCATCGTGACCTTCAGCGAGAACACCAAGAGCAACGGCCGGTACACCGCCACCCTGGACGCCGATACAAAGCAGAGCAGCCTGCACATCACCGCCAGCCAGCTGAGCGATAGCGCCAGCTACATCTGCGTGGTGTCCGGCGGCACAGACAGCTGGGGCAAGCTGCAGTTTGGCGCCGGAACACAGGTGGTCGTGACCCCCGACATCCAGAACCCTGACCCTGCAGTATATCAGCTGAGAGACTCTAAATCCAGTGACAAGTCTGTCTGCCTATTCACCGATTTTGATTCTCAAACAAATGTGTCACAAAGTAAGGATTCTGATGTGTATATCACAGACAAAACTGTGCTAGACATGAGGTCTATGGACTTCAAGAGCAACAGTGCTGTGGCCTGGAGCAACAAATCTGACTTTGCATGTGCAAACGCCTTCAACAACAGCATTATTCCAGAAGACACCTTCTTCCCCAGCCCAGAAAGTTCCTGTGATGTCAAGCTGGTCGAGAAAAGCTTTGAAACAGATACGAACCTAAACTTTCAAAACCTGTCAGTGATTGGGTTCCGAATCCTCCTCCTGAAAGTGGCCGGGTTTAATCTGCTCATGACGCTGCGGCTGTGGTCCAGCTGA SEQ ID NO: 38 - ADB959 TCR alpha chain nucleotide sequence

[0241] MASLLFFCGAFYLLGTGSMDADVTQTPRNRITKTGKRIMLECSQTKGHDRMYWYRQDPGLGLRLIYYSFDVKDINKGEISDGYSVSRQAQAKFSLSLESAIPNQTALYFCATSGQGAYNEQFFGPGTRLTVLEDLKNVFPPEVAVFEPSEAEISHTQKATLVCLATGFYPDHVELSWWVNGKEVHSGVSTDPQPLKEQPALNDSRYCLSSRLRVSATFWQNPRNHFRCQVQFYGLSENDEWTQDRAKPVTQIVSAEAWGRADCGFTSESYQQGVLSATILYEILLGKATLYAVLVSALVLMAMVKRKDSRGGSRAKRSGSGATNFSLLKQAGDVEENPGPMKKHLTTFLVILWLYFYRGNGKNQVEQSPQSLIILEGKNCTLQCNYTVSPFSNLRWYKQDTGRGPVSLTIVTFSENTKSNGRYTATLDADTKQSSLHITASQLSDSASYICVVSGGTDSWGKLQFGAGTQVVVTPDIQNPDPAVYQLRDSKSSDKSVCLFTDFDSQTNVSQSKDSDVYITDKTVLDMRSMDFKSNSAVAWSNKSDFACANAFNNSIIPEDTFFPSPESSCDVKLVEKSFETDTNLNFQNLSVIGFRILLLKVAGFNLLMTLRLWSS- Sequence number 39 - ADB959 TCRΒ_P2A_TCRΑ amino acid sequence

[0242] CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGG Sequence number 40 - BGH polyA signal

[0243] SEQ ID NO: 41 - Knock-in of MAGE-B2 / A4 ADB959 into the AAVS1 TCR landing pad - Right homology arm - TRAC domain sequence (nucleotides 1 to 396), BGH polyA signal (397 to 621), and nucleotides corresponding to Chr19: 55,114,725 - 55,115,825 Human GRCh38 - Ensembl release 104 - May 2021)

[0244] 5’- TTCAGGTTTACTCACGTCATCCAGCAGAGAATGGAAAGTCA GGCTCCGGTGCCCGTCA - 3’ SEQ ID NO: 42 (B2M FWD target sequence is underlined)

[0245] 5’- TGACTTTCCATTCTCTGCTGGATGACGTGAGTAAACCTGAA AACTTGTTTATTGCAGCTTATAATGG - 3’ SEQ ID NO: 43 (B2M FWD target sequence is underlined)

[0246] 5’CGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCGCTGGGTTCCCTTTTCCTTC 3’ SEQ ID NO: 44 (FWD; binds to Chr19:55116254 - 55116274 GRCh38.p14)

[0247] 5’-GACTTTCCATTCTCTGCTGGATGACGTGAGTAAACCTGAATGTGGGGTGGAGGGGACAG - 3’ SEQ ID NO: 45 (REV binds to Chr19:55115774 - 55115792 GRCh38.p14)

[0248] 5’-TCAGGTTTACTCACGTCATCCAGCAGAGAATGGAAAGTCAGTGGGGCCACTAGGGACAGGATTG - 3’ SEQ ID NO: 46 (FWD binds to Chr19:55115750 - 55115773 GRCh38.p14)

[0249] 5’-GAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCGCTACTGGCCTTATCTCACAG-3’ SEQ ID NO: 47 (REV binding Chr19:55115274-55115292 GRCh38.p14)

[0250] 5’GTCGATCCTACCATCCACTCGACACACCCGCCAGCGGCCGCTGCCAAGCTTGCCGCCACCATGAAGAAGCACCTGACCACCTTTCTCGTGATC -3’ SEQ ID NO: 48 (FWD)

[0251] 5’-CCAATCCTGTCCCTAGTGGCCCCACTGACTTTCCATTCCCATAGAGCCCACCGCATCCCCAG -3’ SEQ ID NO: 49 (REV)

[0252] 5’CGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCGCTGGGTTCCCTTTTCCTTC -3’ SEQ ID NO: 50 (FWD)

[0253] 5’GTGGGCGATGTGCGCTCTGCCCACTGACGGGCACCGGAGCCTCTGCTGGATGACGTGAGTAAACCTGAATGTGGGGTGGAGGGGACAG -3’ SEQ ID NO: 51 (REV)

[0254] 5’-GAATGGAAAGTCAGTGGGGCCACTAGGGACAGGATTGG -3’ SEQ ID NO: 52 (FWD)

[0255] 5’TTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCGCTACTGGCCTTATCTCACAG -3’ SEQ ID NO: 53 (REV)

[0256] 5’- GGATGCTCTTTCCGGAGCAC-3’ SEQ ID NO: 54 (5’FWD; binds to Chr19:55116402-55116383 GRCh38.p14)

[0257] 5’- GCACCGGTTCAATTGCCGAC-3’ SEQ ID NO: 55 (5’REV; binds to EF1-α of ADB00794_001)

[0258] 5’- TGGTGAACACCTAGGACGCA-3’ SEQ ID NO: 56 (3’FWD; binds to Chr19:55115182-55115201 GRCh38.p14)

[0259] 5’- GGCTCTCGGAGAATGACGA-3’ SEQ ID NO: 57 (3’REV; binds to A2M10 of ADB00794_001)

[0260] TIFF2025519445000003.tif240170TIFF2025519445000004.tif130170SEQ ID NO: 58 (A2M10 TCR cassette of ADB00794_001, underline = EF-1α promoter, dotted underline = SV40 polyadenylation signal, dashed underline = A2M10 TCR, double underline = furin cleavage site, P2A)

[0261] TIFF2025519445000005.tif101170TIFF2025519445000006.tif245170TIFF2025519445000007.tif245170TIFF2025519445000008.tif221170SEQ ID NO: 59 (Plasmid containing A2M10 placeholder TCR cassette (ADB00794_001), solid underline = homology arm, wavy underline = B2M target site, dashed underline = A2M10 TCR Dotted underline = EF-1α promoter, double underline = furin cleavage site, P2A, dash-dot underline = SV40 polyA signal)

[0262] MMKSLRVLLVILWLQLSWVWSQQKEVEQNSGPLSVPEGAIASLNCTYSDRGSQSFFWYRQYSGKSPELIMSIYSNGDKEDGRFTAQLNKASQYVSLLIRDSQPSDSATYLCAVRGTGRRALTFGSGTRLQVQPNIQNPDPAVYQLRDSKSSDKSVCLFTDFDSQTNVSQSKDSDVYITDKTVLDMRSMDFKSNSAVAWSNKSDFACANAFNNSIIPEDTFFPSPESSCDVKLVEKSFETDTNLNFQNLSVIGFRILLLKVAGFNLLMTLRLWSSGSRAKRSGSGATNFSLLKQAGDVEENPGPRMSLGLLCCGVFSLLWAGPVNAGVTQTPKFRVLKTGQSMTLLCAQDMNHEYMYWYRQDPGMGLRLIHYSVAEGTTAKGEVPDGYNVSRLKKQNFLLGLESAAPSQTSVYFCASSFTDTQYFGPGTRLTVLEDLKNVFPPEVAVFEPSEAEISHTQKATLVCLATGFYPDHVELSWWVNGKEVHSGVSTDPQPLKEQPALNDSRYCLSSRLRVSATFWQNPRNHFRCQVQFYGLSENDEWTQDRAKPVTQIVSAEAWGRADCGFTSESYQQGVLSATILYEILLGKATLYAVLVSALVLMAMVKRKDSRG SEQ ID NO: 60 (Protein sequence of A2M10 placeholder TCR)

[0263] TIFF2025519445000009.tif235170TIFF2025519445000010.tif245170TIFF2025519445000011.tif245170TIFF2025519445000012.tif86170Plasmid containing SEQ ID NO: 61 (A2M4-swapped TCR cassette (ADB01032_026)), dotted underline = homology arm, solid underline = EF-1α promoter, dashed underline = A2M10 TCR, double underline = furin cleavage site, P2A, dash-dot underline = BGH polyA signal

[0264] MKKHLTTFLVILWLYFYRGNGKNQVEQSPQSLIILEGKNCTLQCNYTVSPFSNLRWYKQDTGRGPVSLTILTFSENTKSNGRYTATLDADTKQSSLHITASQLSDSASYICVVSGGTDSWGKLQFGAGTQVVVTPDIQNPDPAVYQLRDSKSSDKSVCLFTDFDSQTNVSQSKDSDVYITDKTVLDMRSMDFKSNSAVAWSNKSDFACANAFNNSIIPEDTFFPSPESSCDVKLVEKSFETDTNLNFQNLSVIGFRILLLKVAGFNLLMTLRLWSSGSRAKRSGSGATNFSLLKQAGDVEENPGPRMASLLFFCGAFYLLGTGSMDADVTQTPRNRITKTGKRIMLECSQTKGHDRMYWYRQDPGLGLRLIYYSFDVKDINKGEISDGYSVSRQAQAKFSLSLESAIPNQTALYFCATSGQGAYEEQFFGPGTRLTVLEDLKNVFPPEVAVFEPSEAEISHTQKATLVCLATGFYPDHVELSWWVNGKEVHSGVSTDPQPLKEQPALNDSRYCLSSRLRVSATFWQNPRNHFRCQVQFYGLSENDEWTQDRAKPVTQIVSAEAWGRADCGFTSESYQQGVLSATILYEILLGKATLYAVLVSALVLMAMVKRKDSRG SEQ ID NO: 62 (Protein sequence of A2M4-swapped TCR)

[0265] UCACGUCAUCCAGCAGAGAA Sequence number 63 (CRISPR-Cas9 guide RNA)

[0266] CTGGGTTCCCTTTTCCTTCTCCTTCTGGGGCCTGTGCCATCTCTCGTTTCTTAGGATGGCCTTCTCCGACGGATGTCTCCCTTGCGTCCCGCCTCCCCTTCTTGTAGGCCTGCATCATCACCGTTTTTCTGGACAACCCCAAAGTACCCCGTCTCCCTGGCTTTAGCCACCTCTCCATCCTCTTGCTTTCTTTGCCTGGACACCCCGTTCTCCTGTGGATTCGGGTCACCTCTCACTCCTTTCATTTGGGCAGCTCCCCTACCCCCCTTACCTCTCTAGTCTGTGCTAGCTCTTCCAGCCCCCTGTCATGGCATCTTCCAGGGGTCCGAGAGCTCAGCTAGTCTTCTTCCTCCAACCCGGGCCCCTATGTCCACTTCAGGACAGCATGTTTGCTGCCTCCAGGGATCCTGTGTCCCCGAGCTGGGACCACCTTATATTCCCAGGGCCGGTTAATGTGGCTCTGGTTCTGGGTACTTTTATCTGTCCCCTCCACCCCACA Sequence number 64 - Plasmid ADB00794_001 left homology arm (Chr 19:55115774-55116272 Human GRCh38.p14 Primary Assembly

[0267] Array No. 65-EF1 alpha promoter DNA sequence

[0268] ATGATGAAATCCTTGAGAGTTTTACTAGTGATCCTGTGGCTTCAGTTGAGCTGGGTTTGGAGCCAACAGAAGGAGGTGGAGCAGAATTCTGGACCCCTCAGTGTTCCAGAGGGAGCCATTGCCTCTCTCAACTGCACTTACAGTGACCGAGGTTCCCAGTCCTTCTTCTGGTACAGACAATATTCTGGGAAAAGCCCTGAGTTGATAATGTCCATATACTCCAATGGTGACAAAGAAGATGGAAGGTTTACAGCACAGCTCAATAAAGCCAGCCAGTATGTTTCTCTGCTCATCAGAGACTCCCAGCCCAGTGATTCAGCCACCTACCTCTGTGCCGTGAGAGGCACGGGCAGGAGAGCACTTACTTTTGGGAGTGGAACAAGACTCCAAGTGCAACCAAATATCCAGAACCCTGACCCTGCCGTGTACCAGCTGAGAGACTCTAAATCCAGTGACAAGTCTGTCTGCCTATTCACCGATTTTGATTCTCAAACAAATGTGTCACAAAGTAAGGATTCTGATGTGTATATCACAGACAAAACTGTGCTAGACATGAGGTCTATGGACTTCAAGAGCAACAGTGCTGTGGCCTGGAGCAACAAATCTGACTTTGCATGTGCAAACGCCTTCAACAACAGCATTATTCCAGAAGACACCTTCTTCCCCAGCCCAGAAAGTTCCTGTGATGTCAAGCTGGTCGAGAAAAGCTTTGAAACAGATACGAACCTAAACTTTCAAAACCTGTCAGTGATTGGGTTCCGAATCCTCCTCCTGAAAGTGGCCGGGTTTAATCTGCTCATGACGCTGCGGCTGTGGTCCAGC Array No. 66-A2M10 c794 TCR alpha chain nucleotide sequence (derived from ADB00794_001)

[0269] MMKSLRVLLVILWLQLSWVWSQQKEVEQNSGPLSVPEGAIASLNCTYSDRGSQSFFWYRQYSGKSPELIMSIYSNGDKEDGRFTAQLNKASQYVSLLIRDSQPSDSATYLCAVRGTGRRALTFGSGTRLQVQPNIQNPDPAVYQLRDSKSSDKSVCLFTDFDSQTNVSQSKDSDVYITDKTVLDMRSMDFKSNSAVAWSNKSDFACANAFNNSIIPEDTFFPSPESSCDVKLVEKSFETDTNLNFQNLSVIGFRILLLKVAGFNLLMTLRLWSS Sequence number 67 - Alpha chain amino acid sequence of A2M10 c794 (derived from ADB00794_001)

[0270] GGCAGCCGGGCCAAGAGAAGCGGATCCGGC Sequence number 68 - Furin SG linker nucleotide sequence

[0271] GCCACCAACTTCAGCCTGCTGAAGCAGGCCGGCGACGTGGAGGAAAACCCTGGCCCTAGG Sequence number 69 - P2A skip-like sequence nucleotide sequence

[0272] ATNFSLLKQAGDVEENPGPR Sequence number 70 - P2A skip-like sequence amino acid sequence

[0273] ATGAGCCTCGGGCTCCTGTGCTGTGGGGTGTTTTCTCTCCTGTGGGCAGGTCCAGTGAATGCTGGTGTCACTCAGACCCCAAAATTCCGGGTCCTGAAGACAGGACAGAGCATGACACTGCTGTGTGCCCAGGATATGAACCATGAATACATGTACTGGTATCGACAAGACCCAGGCATGGGGCTGAGGCTGATTCATTACTCAGTTGCCGAGGGTACAACTGCCAAAGGAGAGGTCCCTGATGGCTACAATGTCTCCAGATTAAAAAAACAGAATTTCCTGCTGGGGTTGGAGTCGGCTGCTCCCTCCCAAACATCTGTGTACTTCTGTGCCAGCAGTTTCACAGATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCGAGGACCTGAAAAACGTGTTCCCACCCGAGGTCGCTGTGTTTGAGCCATCAGAAGCAGAGATCTCCCACACCCAAAAGGCCACACTGGTGTGCCTGGCCACAGGCTTCTACCCCGACCACGTGGAGCTGAGCTGGTGGGTGAATGGGAAGGAGGTGCACAGTGGGGTCAGCACAGACCCGCAGCCCCTCAAGGAGCAGCCCGCCCTCAATGACTCCAGATACTGCCTGAGCAGCCGCCTGAGGGTCTCGGCCACCTTCTGGCAGAACCCCCGCAACCACTTCCGCTGTCAAGTCCAGTTCTACGGGCTCTCGGAGAATGACGAGTGGACCCAGGATAGGGCCAAACCTGTCACCCAGATCGTCAGCGCCGAGGCCTGGGGTAGAGCAGACTGTGGCTTCACCTCCGAGTCTTACCAGCAAGGGGTCCTGTCTGCCACCATCCTCTATGAGATCTTGCTAGGGAAGGCCACCTTGTATGCCGTGCTGGTCAGTGCCCTCGTGCTGATGGCCATGGTCAAGAGAAAGGATTCCAGAGGC SEQ ID NO: 71 - A2M10 c794 TCR beta chain nucleotide sequence (derived from ADB00794_001)

[0274] MSLGLLCCGVFSLLWAGPVNAGVTQTPKFRVLKTGQSMTLLCAQDMNHEYMYWYRQDPGMGLRLIHYSVAEGTTAKGEVPDGYNVSRLKKQNFLLGLESAAPSQTSVYFCASSFTDTQYFGPGTRLTVLEDLKNVFPPEVAVFEPSEAEISHTQKATLVCLATGFYPDHVELSWWVNGKEVHSGVSTDPQPLKEQPALNDSRYCLSSRLRVSATFWQNPRNHFRCQVQFYGLSENDEWTQDRAKPVTQIVSAEAWGRADCGFTSESYQQGVLSATILYEILLGKATLYAVLVSALVLMAMVKRKDSRG SEQ ID NO: 72 - A2M10 c794 TCR beta chain amino acid sequence (derived from ADB00794_001)

[0275] TAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTT SEQ ID NO: 73 - SV40 polyA signal nucleotide sequence

[0276] GTGGGGCCACTAGGGACAGGATTGGTGACAGAAAAGCCCCATCCTTAGGCCTCCTCCTTCCTAGTCTCCTGATATTGGGTCTAACCCCCACCTCCTGTTAGGCAGATTCCTTATCTGGTGACACACCCCCATTTCCTGGAGCCATCTCTCTCCTTGCCAGAACCTCTAAGGTTTGCTTACGATGGAGCCAGAGAGGATCCTGGGAGGGAGAGCTTGGCAGGGGGTGGGAGGGAAGGGGGGGATGCGTGACCTGCCCGGTTCTCAGTGGCCACCCTGCGCTACCCTCTCCCAGAACCTGAGCTGCTCTGACGCGGCTGTCTGGTGCGTTTCACTGATCCTGGTGCTGCAGCTTCCTTACACTTCCCAAGAGGAGAAGCAGTTTGGAAAAACAAAATCAGAATAAGTTGGTCCTGAGTTCTAACTTTGGCTCTTCACCTTTCTAGTCCCCAATTTATATTGTTCCTCCGTGCGTCAGTTTTACCTGTGAGATAAGGCCAGTA Sequence number 74 - Plasmid ADB00794_001 Right Homology Arm (Chr 19: 55115274 to 55115773 Human GRCh38.p14 Primary Assembly)

[0277] GACTTTCCA TTCTCTGCTGGATGACGTGA GTAAACCTGAATGTGGGGTGGAGGGGACAG Sequence number 75 - Reverse Primer for Amplification of Plasmid ADB00794_001 Left Homology Arm (Binding Chr 19:55115774 - 55115792 GRCh38.p14) Underline - B2M sgRNA Target Site

[0278] TIFF2025519445000013.tif145170TIFF2025519445000014.tif245170TIFF2025519445000015.tif34170Nucleotide sequence of the array number 76 - A2M10 TCR cassette Underline = EF-1α promoter Dotted underline = SV40 polyadenylation signal. Dashed underline = A2M10 TCR Double underline = furin cleavage site, P2A

[0279] GCTGGGTTCCCTTTTCCTTCTCCTTCTGGGGCCTGTGCCATCTCTCGTTTCTTAGGATGGCCTTCTCCGACGGATGTCTCCCTTGCGTCCCGCCTCCCCTTCTTGTAGGCCTGCATCATCACCGTTTTTCTGGACAACCCCAAAGTACCCCGTCTCCCTGGCTTTAGCCACCTCTCCATCCTCTTGCTTTCTTTGCCTGGACACCCCGTTCTCCTGTGGATTCGGGTCACCTCTCACTCCTTTCATTTGGGCAGCTCCCCTACCCCCCTTACCTCTCTAGTCTGTGCTAGCTCTTCCAGCCCCCTGTCATGGCATCTTCCAGGGGTCCGAGAGCTCAGCTAGTCTTCTTCCTCCAACCCGGGCCCCTATGTCCACTTCAGGACAGCATGTTTGCTGCCTCCAGGGATCCTGTGTCCCCGAGCTGGGACCACCTTATATTCCCAGGGCCGGTTAATGTGGCTCTGGTTCTGGGTACTTTTATCTGTCCCCTCCACCCCACATTCAGGTTTACTCACGTCATCCAGCAGA Array number 77 - Plasmid ADB01032_026 left homology arm (Human Chr19: 55115774 to 55116273, Chr15: 44715434 to 44715462 GRCh38.p14 Primary Assembly)

[0280] ATGAAGAAGCACCTGACCACCTTTCTCGTGATCCTGTGGCTGTACTTCTACCGGGGCAACGGCAAGAACCAGGTGGAACAGAGCCCCCAGAGCCTGATCATCCTGGAAGGCAAGAACTGCACCCTGCAGTGCAACTACACCGTGTCCCCCTTCAGCAACCTGCGGTGGTACAAGCAGGACACCGGCAGAGGCCCTGTGTCCCTGACCATCCTGACCTTCAGCGAGAACACCAAGAGCAACGGCCGGTACACCGCCACCCTGGACGCCGATACAAAGCAGAGCAGCCTGCACATCACCGCCAGCCAGCTGAGCGATAGCGCCAGCTACATCTGCGTGGTGTCCGGCGGCACAGACAGCTGGGGCAAGCTGCAGTTTGGCGCCGGAACACAGGTGGTCGTGACCCCCGACATCCAGAACCCTGACCCTGCCGTGTACCAGCTGCGGGACAGCAAGAGCAGCGACAAGAGCGTGTGCCTGTTCACCGACTTCGACAGCCAGACCAACGTGTCCCAGAGCAAGGACAGCGACGTGTACATCACCGACAAGACCGTGCTGGACATGCGGAGCATGGACTTCAAGAGCAATAGCGCCGTGGCCTGGTCCAACAAGAGCGACTTCGCCTGCGCCAACGCCTTCAACAACAGCATTATCCCCGAGGACACATTCTTCCCAAGCCCCGAGAGCAGCTGCGACGTCAAGCTGGTGGAAAAGAGCTTCGAGACAGACACCAACCTGAACTTCCAGAACCTGAGCGTGATCGGCTTCAGAATCCTGCTGCTGAAGGTGGCCGGCTTCAACCTGCTGATGACCCTGAGACTGTGG SEQ ID NO: 78 - A2M4 c1032 TCR alpha chain nucleotide sequence (derived from ADB01032_026)

[0281] MKKHLTTFLVILWLYFYRGNGKNQVEQSPQSLIILEGKNCTLQCNYTVSPFSNLRWYKQDTGRGPVSLTILTFSENTKSNGRYTATLDADTKQSSLHITASQLSDSASYICVVSGGTDSWGKLQFGAGTQVVVTPDIQNPDPAVYQLRDSKSSDKSVCLFTDFDSQTNVSQSKDSDVYITDKTVLDMRSMDFKSNSAVAWSNKSDFACANAFNNSIIPEDTFFPSPESSCDVKLVEKSFETDTNLNFQNLSVIGFRILLLKVAGFNLLMTLRLW SEQ ID NO: 79 - A2M4 c1032 TCR alpha chain amino acid sequence (derived from ADB01032_026)

[0282] GCTACCAACTTTAGCCTGCTGAAGCAGGCCGGGGACGTGGAAGAAAACCCTGGCCCTAGG SEQ ID NO: 80 - P2A skip - like sequence nucleotide sequence

[0283] ATGGCCAGCCTGCTGTTCTTCTGCGGCGCCTTCTACCTGCTGGGCACCGGCTCTATGGATGCCGACGTGACCCAGACCCCCCGGAACAGAATCACCAAGACCGGCAAGCGGATCATGCTGGAATGCTCCCAGACCAAGGGCCACGACCGGATGTACTGGTACAGACAGGACCCTGGCCTGGGCCTGCGGCTGATCTACTACAGCTTCGACGTGAAGGACATCAACAAGGGCGAGATCAGCGACGGCTACAGCGTGTCCAGACAGGCTCAGGCCAAGTTCAGCCTGTCCCTGGAAAGCGCCATCCCCAACCAGACCGCCCTGTACTTTTGTGCCACAAGCGGCCAGGGCGCCTACGAGGAGCAGTTCTTTGGCCCTGGCACCCGGCTGACAGTGCTGGAAGATCTGAAGAACGTGTTCCCCCCAGAGGTGGCCGTGTTCGAGCCTTCTGAGGCCGAAATCAGCCACACCCAGAAAGCCACACTCGTGTGTCTGGCCACCGGCTTCTACCCCGACCACGTGGAACTGTCTTGGTGGGTCAACGGCAAAGAGGTGCACAGCGGCGTGTCCACCGATCCCCAGCCTCTGAAAGAACAGCCCGCCCTGAACGACAGCCGGTACTGCCTGAGCAGCAGACTGAGAGTGTCCGCCACCTTCTGGCAGAACCCCAGAAACCACTTCAGATGCCAGGTGCAGTTTTACGGCCTGAGCGAGAACGACGAGTGGACCCAGGACAGAGCCAAGCCCGTGACACAGATCGTGTCTGCCGAAGCTTGGGGGCGCGCCGATTGTGGCTTTACCAGCGAGAGCTACCAGCAGGGCGTGCTGAGCGCCACCATCCTGTACGAGATCCTGCTGGGAAAGGCCACACTGTACGCCGTGCTGGTGTCTGCCCTGGTGCTGATGGCCATGGTCAAGCGGAAGGACAGCCGGGGCTAA Sequence number 81 - A2M4 c1032 TCR beta chain nucleotide sequence (derived from ADB01032_026)

[0284] MASLLFFCGAFYLLGTGSMDADVTQTPRNRITKTGKRIMLECSQTKGHDRMYWYRQDPGLGLRLIYYSFDVKDINKGEISDGYSVSRQAQAKFSLSLESAIPNQTALYFCATSGQGAYEEQFFGPGTRLTVLEDLKNVFPPEVAVFEPSEAEISHTQKATLVCLATGFYPDHVELSWWVNGKEVHSGVSTDPQPLKEQPALNDSRYCLSSRLRVSATFWQNPRNHFRCQVQFYGLSENDEWTQDRAKPVTQIVSAEAWGRADCGFTSESYQQGVLSATILYEILLGKATLYAVLVSALVLMAMVKRKDSRG Array number 82 - A2M4 c1032 TCR beta chain amino acid sequence (derived from ADB01032_026)

[0285] GAATGGAAAGTCAGTGGGGCCACTAGGGACAGGATTGGTGACAGAAAAGCCCCATCCTTAGGCCTCCTCCTTCCTAGTCTCCTGATATTGGGTCTAACCCCCACCTCCTGTTAGGCAGATTCCTTATCTGGTGACACACCCCCATTTCCTGGAGCCATCTCTCTCCTTGCCAGAACCTCTAAGGTTTGCTTACGATGGAGCCAGAGAGGATCCTGGGAGGGAGAGCTTGGCAGGGGGTGGGAGGGAAGGGGGGGATGCGTGACCTGCCCGGTTCTCAGTGGCCACCCTGCGCTACCCTCTCCCAGAACCTGAGCTGCTCTGACGCGGCTGTCTGGTGCGTTTCACTGATCCTGGTGCTGCAGCTTCCTTACACTTCCCAAGAGGAGAAGCAGTTTGGAAAAACAAAATCAGAATAAGTTGGTCCTGAGTTCTAACTTTGGCTCTTCACCTTTCTAGTCCCCAATTTATATTGTTCCTCCGTGCGTCAGTTTTACCTGTGAGATAAGGCCAGTA Array number 83 - Plasmid ADB01032_026 Right Homology Arm (Human Chr19: 55115274 to 55115775 GRCh38.p14 Primary Assembly)

[0286] GGCTCCGGTGCCCGTCAGTGGGC Array number 84 - Forward primer for amplification of EF1 alpha promoter

[0287] GGTGGCGGCAAGCTTGGCAGCGGC Array number 85 - Reverse primer for amplification of EF1 alpha promoter

Claims

**Claim 1** A method for generating immune cells that express a therapeutic antigen receptor, comprising: (i) providing immune cells comprising a heterologous expression cassette, wherein the expression cassette comprises: (a) a coding sequence for a productive T cell receptor (TCR), (b) a constitutive promoter operably linked to the coding sequence, and (c) a target site; and (ii) replacing the heterologous expression cassette in the immune cells with an expression construct comprising a coding sequence for a therapeutic antigen receptor, wherein the therapeutic antigen receptor is expressed within the immune cells. **Claim 2** The method of claim 1, wherein the therapeutic antigen receptor specifically binds to an MHC that presents a peptide fragment of a target antigen expressed by a cell, or specifically binds to a target antigen or a peptide thereof expressed by a cell independently of MHC presentation. **Claim 3** The method of claim 2, wherein the therapeutic antigen receptor specifically binds to an MHC that presents a peptide fragment of a tumor antigen expressed by a cancer cell, or specifically binds to a tumor antigen or a peptide fragment thereof expressed by a cancer cell independently of MHC presentation. **Claim 4** The method according to any one of the preceding claims, wherein the immune cells are T cells. **Claim 5** The heterologous expression cassette is as follows: introducing into the immune cells a nucleic acid molecule comprising the expression construct and a 5' homology arm, wherein the 5' homology arm is complementary to the 5' target site of the heterologous expression cassette; The method according to any one of the preceding claims, wherein the expression construct is introduced into the immune cells such that it replaces the expression cassette in the genome of the immune cells. **Claim 6** The method of claim 5, further comprising introducing into the immune cells a vector comprising a nucleic acid encoding CRISPR / Cas9 that targets the target site. **Claim 7** The method according to any one of the preceding claims, wherein the target site is a 5' target site. **Claim 8** The method of claim 7, wherein the cassette further comprises a 3' target site. **Claim 9** The heterologous expression cassette is as follows: Introducing a nucleic acid molecule such as a DNA molecule containing an expression construct adjacent to 5' and 3' homology arms into the immune cell, wherein the 5' and 3' homology arms are complementary to the 5' and 3' target sites of the heterologous expression cassette, The method according to claim 8, wherein the expression construct is introduced into the immune cell by a method comprising introducing it so as to replace the expression cassette in the genome of the immune cell.

10. The method according to claim 9, wherein the method further comprises introducing into the immune cell a vector containing a nucleic acid encoding CRISPR / Cas9 that targets the 5' and 3' target sites.

11. The method according to any one of the preceding claims, wherein the therapeutic antigen receptor is a T cell receptor (TCR).

12. The method according to claim 11, wherein the therapeutic TCR specifically binds to cancer cells.

13. The method according to any one of the preceding claims, wherein the expression cassette contains 5' and 3' target sites, and the target sites contain a nucleotide sequence from the constant region of the TCRα chain.

14. The method according to claim 13, wherein the 3' target site is located within the coding sequence of the produced TCR.

15. The immune cell containing the heterologous expression cassette is as follows: (i) Transfecting induced pluripotent stem cells (iPSCs) with a nucleic acid containing a heterologous expression cassette such that the cassette is integrated into the genome of the iPSCs, The expression cassette is (a) a coding sequence for a produced T cell receptor (TCR), (b) a constitutive promoter operably linked to the coding sequence, and (c) a target site, and (ii) differentiating the iPSCs into immune cells containing the heterologous expression cassette, and is produced by a method comprising the above, and is the method according to any one of the preceding claims.

16. The method according to claim 15, wherein the target site is a 5' target site.

17. The method according to claim 16, wherein the cassette further contains a 3' target site.

18. The iPSCs are as follows: (i) differentiating the iPSCs into mesoderm cells, (ii) differentiating the mesoderm cells into hematopoietic endothelial cells, (iii) differentiating the hematopoietic endothelial cells into a population of hematopoietic progenitor cells (HPCs), (iv) differentiating the HPCs into immune cell precursors, The method according to claim 15, 16, or 17, wherein the population of precursor immune cells is differentiated into immune cells by a method comprising maturing the population of precursor immune cells to produce a population of immune cells.

19. culturing the iPSCs continuously in a first, a second, and a third mesoderm induction medium to induce differentiation into mesoderm cells, wherein the first mesoderm induction medium consists of a chemically defined nutrient medium supplemented with one or more differentiation factors, and the one or more differentiation factors consist of activin, wherein the second mesoderm induction medium consists of a chemically defined nutrient medium supplemented with one or more differentiation factors, and the one or more differentiation factors consist of activin, BMP, and FGF, and wherein the third mesoderm induction medium consists of a chemically defined nutrient medium supplemented with one or more differentiation factors, and the one or more differentiation factors consist of activin, BMP, FGF, and a GSK3 inhibitor, according to the method of claim 18.

20. culturing the mesoderm cells in an HE induction medium to induce differentiation into HECs, wherein the HE induction medium consists of a chemically defined nutrient medium supplemented with one or more differentiation factors, and the one or more differentiation factors consist of SCF and VEGF, according to the method of claim 18 or 19.

21. The HEC is cultured in a hematopoietic induction medium to induce differentiation into HPC, the hematopoietic induction medium consists of a chemically defined nutrient medium supplemented with one or more differentiation factors, and the one or more differentiation factors are VEGF, SCF, thrombopoietin (TPO), Flt3 ligand (Flt3L), IL-3, IL-6, IL-7, IL-11, IGF-1, BMP, FGF, sonic hedgehog (SHH), erythropoietin (EPO), angiotensin II, and an angiotensin II type 1 receptor (AT 1 ), antagonist, and the method according to any one of claims 18 to 20.

22. the HPCs are cultured in a lymphocyte proliferation medium to produce the precursor immune cells, wherein the lymphocyte proliferation medium consists of a chemically defined nutrient medium supplemented with one or more differentiation factors, and the one or more differentiation factors consist of SCF, FLT3L, TPO, and IL7, according to the method of any one of claims 18 to 21.

23. the precursor immune cells are matured by a method comprising culturing the population of precursor immune cells in a maturation medium to produce the immune cells, wherein the maturation medium consists of a chemically defined nutrient medium supplemented with one or more differentiation factors, and the one or more differentiation factors consist of SCF, FLT3L, and IL7, according to the method of any one of claims 18 to 22.

24. The method according to any one of the preceding claims, comprising concentrating the population of immune cells that express the therapeutic antigen receptor.

25. The method according to any one of the preceding claims, comprising storing the population of immune cells that express the therapeutic antigen receptor.

26. The method according to any one of the preceding claims, comprising formulating the population of immune cells expressing the therapeutic antigen receptor with a pharmaceutically acceptable excipient.

27. A population of immune cells expressing one or more therapeutic antigen receptors, produced by the method according to any one of claims 1 to 26.

28. A pharmaceutical composition comprising a population of immune cells expressing one or more therapeutic antigen receptors, produced by the method according to any one of claims 1 to 26, and a pharmaceutically acceptable excipient.

29. A population of immune cells expressing one or more therapeutic antigen receptors, produced by the method according to any one of claims 1 to 26, for use in a method of treatment.

30. A population of immune cells expressing one or more therapeutic antigen receptors, produced by the method according to any one of claims 1 to 26, for use in a method of treating cancer.

31. A method of treating cancer, comprising administering to a subject in need thereof a population of immune cells expressing one or more therapeutic antigen receptors, produced by the method according to any one of claims 1 to 26.

32. Use of a population of immune cells expressing one or more therapeutic antigen receptors, produced by the method according to any one of claims 1 to 26, in the manufacture of a medicament for use in the treatment of cancer.

33. An immune cell comprising a heterologous expression cassette integrated into its genome, wherein the expression cassette comprises (a) a coding sequence for a productive T cell receptor (TCR), (b) a constitutive promoter operably linked to the coding sequence, and (c) a target site.

34. The immune cell according to claim 31, wherein the target site is a 5' target site.

35. The immune cell according to claim 34, wherein the cassette further comprises a 3' target site.

36. An iPSC comprising a heterologous expression cassette integrated into its genome, wherein the expression cassette comprises (a) a coding sequence for a productive T cell receptor (TCR), (b) a constitutive promoter operably linked to the coding sequence, and (c) a target site.

37. The iPSC according to claim 33, wherein the target site is a 5' target site.

38. The iPSC according to claim 37, wherein the cassette further comprises a 3' target site.