CAR-expressing pluripotent stem cell-derived neutrophils loaded with drug nanoparticles and uses thereof

CAR-expressing neutrophils derived from pluripotent stem cells, loaded with nanoparticles, address the limitations of current GBM treatments by crossing the BBB and targeting GBM specifically, enhancing drug delivery and antitumor activity without additional inflammation, thus improving treatment efficacy and reducing off-target toxicity.

JP2025520412APending Publication Date: 2025-07-03PURDUE RES FOUND
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024573419
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-10-14
Filing Date
2023-06-14
Publication Date
2025-07-03

AI Technical Summary

Technical Problem

Current treatments for glioblastoma (GBM) are hindered by the blood-brain barrier (BBB) and blood-tumor barrier (BBTB), requiring invasive surgical resection to induce inflammation for neutrophil mobilization, and there are concerns about off-target toxicity and immunosuppressive tumor-associated neutrophils (TANs).

Method used

Chimeric antigen receptor (CAR)-expressing neutrophils differentiated from pluripotent stem cells, loaded with nanoparticles, that can cross the BBB and selectively target GBM, enhancing antitumor activity without additional inflammation, using biodegradable nanoparticles like rough silica nanoparticles containing chemotherapeutic agents.

Benefits of technology

The CAR-expressing neutrophils effectively deliver drugs to GBM, reducing off-target toxicity and extending survival in GBM models by combining direct cell lysis and chemotherapy, while maintaining native neutrophil properties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025520412000001_ABST
    Figure 2025520412000001_ABST
Patent Text Reader

Abstract

Chimeric antigen receptor (CAR)-expressing neutrophils loaded with nanoparticles containing a drug, and a method of treating a subject's cancer or other disorder, the method comprising administering to the subject a therapeutically effective amount of the CAR-expressing neutrophils.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Priority This application is related to and claims the benefit of priority of U.S. Provisional Patent Application No. 63 / 351,906, filed on June 14, 2022, and U.S. Provisional Patent Application No. 63 / 416,026, filed on October 14, 2022. The entire content of the foregoing applications is incorporated herein by reference.

[0002] The present disclosure relates to chimeric antigen receptor (CAR)-expressing neutrophils differentiated from pluripotent stem cells modified to express CARs loaded with nanoparticles containing drugs, and methods for treating cancer and other disorders using such neutrophils.

[0003] Description of the Sequence Listing A computer-readable format (CRF) sequence listing is submitted simultaneously with this application. The file 69903-03_SeqListing.xml was generated on June 13, 2023, with a file size of 54 kilobytes, which is incorporated herein by reference in its entirety. The content of the computer-readable format is the same as the written sequence listing, and the information recorded in the computer-readable format is the same as that of the written sequence listing.

Background Art

[0004] Glioblastoma (GBM) is one of the most malignant and lethal solid tumors in humans. GBM is characterized by a poor prognosis with a high tendency to recur, a short survival period, and a high mortality rate. Yang et al., Synergistic immunotherapy of glioblastoma by dual targeting of IL-6 and CD40, Nature Communications 12: 3424 (2021); Lim et al., Current state of immunotherapy for glioblastoma, Nat' l Review Clinical Oncology 15:422-442 (2018). The therapeutic effectiveness of both surgery and chemotherapeutic drugs can generally be hindered by the particularly delicate structure of the brain and the physiological blood-brain barrier (BBB) or blood-brain tumor barrier (BBTB).

[0005] Agliardi et al.,, Intratumoral IL-12 delivery empowers CAR-T cell immunotherapy in a pre-clinical model of glioblastoma, Nature Communications 12: 444 (2021; Nemeth et al., Neutrophils as emerging therapeutic targets, Nature Reviews Drug Discovery 19: 253-275 (2020); Subhan & Torchilin, Neutrophils as an emerging therapeutic target and tool for cancer therapy, Life Sciences 285(15): 119952 (2021).

[0006] Since they have the natural ability to migrate towards the site of inflammation, cross the BBB / BBTB, and infiltrate solid tumors, neutrophil-mediated delivery of nanoparticulated chemotherapeutic agents has been investigated to enhance targeted drug delivery to brain tumors for improved therapeutic efficacy. Xue et al., Neutrophil-mediated anticancer drug delivery for suppression of postoperative malignant glioma recurrence, Nature Nanotechnology 12: 692-700 (2017); Chu et al., Photosensitization Priming of Tumor Microenvironments Improves Delivery of Nanotherapeutics via Neutrophil Infiltration, Advanced Materials 29(27): 1701021 (2017); Wu et al., MR imaging tracking of inflammation-activatable engineered neutrophils for targeted therapy of surgically treated glioma, Nature Communications 9: 4777 (2018). However, prior to neutrophil / chemotherapeutic agent administration, invasive surgical resection of the tumor or initial stimulation of the tumor microenvironment (TME) is required to induce additional inflammation for neutrophil mobilization, and neutrophil mobilization to tumor sites beyond the inflamed resection margins is limited. Osuka & Van Meir, Cancer therapy: Neutrophils traffic in cancer nanodrugs, Nature Nanotechnology 12: 616-618 (2017). Furthermore, most neutrophil-mediated chemotherapeutic agents are concentrated in the spleen.

[0007] Necrosis was not observed in the major organs of experimental brain tumor-bearing mice, but there are concerns regarding off-target tissue toxicity or even systemic toxicity in human patients. Lin et al., Roles of Neutrophils in Glioma and Brain Metastases, Frontiers in Immunology 12 (2021). Additionally, the innate immunity and neutrophil plasticity against various pathogens, including GBM, have not been fully explored or have been ignored in these studies. Lin et al. (2021), supra; Fridlender et al., Polarization of tumor-associated neutrophil phenotype by TGF-beta: “N1” versus “N2” TAN, Cancer Cell 16(3): 183-194 (2009); Blaisdell et al., Neutrophils Oppose Uterine Epithelial Carcinogenesis via Debridement of Hypoxic Tumor Cells, Cancer Cell 28(6): 785-799 (2015); Mahiddine et al., Relief of tumor hypoxia unleashes the tumoricidal potential of neutrophils, J Clinical Investigation 130(1): 389-403 (2020); Yan et al., Human polymorphonuclear neutrophils specifically recognize and kill cancerous cells, Oncoimmunology 3(7) (2014).

[0008] Given that previous studies have focused on mouse neutrophils, the feasibility and safety of using human neutrophils for drug delivery remain unclear because the extraction of a large number of neutrophils from preoperative patients can lead to neutropenia or other risks. In addition, the inherent antitumor activity of naive neutrophils needs to be explored and, if possible, boosted to achieve optimal therapeutic efficacy when used as a drug carrier in combination with chemotherapeutic agents.

[0009] Circulating neutrophils in the blood home to the hypoxic TME, where they become heterogeneous tumor-associated neutrophils (TANs), which are essential components of the immunosuppressive TME that contribute to cancer progression and tumor treatment resistance. Lin et al. (2021), supra; Jaillon et al., Neutrophil diversity and plasticity in tumour progression and therapy, Nature Reviews Cancer 20: 485-503 (2020). Similar to macrophages, antitumor N1 and tumor-promoting N2 phenotypes of TANs have been found within the hypoxic TME. Li et al., Research Progress About Glioma Stem Cells in the Immune Microenvironment of Glioma, Frontiers in Pharmacology 12 (2021); Gieryng et al., Immune microenvironment of gliomas, Laboratory Investigations 97(5): 498-518 (2017); Jung et al., Tumor cell plasticity, heterogeneity, and resistance in crucial microenvironmental niches in glioma, Nature Communications 12: 1014 (2021); Dunn et al., Sonabend, Emerging immunotherapies for malignant glioma: From immunogenomics to cell therapy, Neuro-Oncology 22(10): 1425-1438 (2020).

[0010] A variety of treatment strategies have been developed to directly target neutrophils, focusing on neutrophil depletion or inhibition, leading to several clinical trials (e.g., the CCR5 inhibitor maraviroc in NCT03274804). Lin et al. (2021), supra; Yee et al., Neutrophil-induced ferroptosis promotes tumor necrosis in glioblastoma progression, Nature Communications 11: 5424 (2020). However, the direct application of untreated neutrophils as nanocarriers may impose additional risks on cancer patients, as drug-transporting neutrophils can be reprogrammed in the TME into an immunosuppressive tumor-promoting N2 phenotype after homing to the tumor site. Fridlender et al. (2009), supra; Sagiv et al., Phenotypic diversity and plasticity in circulating neutrophil subpopulations in cancer, Cell Reports 10(4): 562-573 (2015).

[0011] Chimeric antigen receptor (CAR) modification significantly enhances the anti-tumor activity of immune T or natural killer (NK) cells, but their effectiveness in solid tumors remains limited, partly due to relatively low transportability and tumor penetration ability. Li et al., Human iPSC-Derived Natural Killer Cells Engineered with Chimeric Antigen Receptors Enhance Anti-tumor Activity, Cell Stem Cell 23(2): 181-192 (2018); Kim et al., High-affinity mutant Interleukin-13 targeted CAR T cells enhance delivery of clickable biodegradable fluorescent nanoparticles to glioblastoma, Bioactive Materials 5(3): 624-635 (2020); Nguyen et al., A novel ligand delivery system to non-invasively visualize and therapeutically exploit the IL13Rα2 tumor-restricted biomarker, Neuro-Oncology 14(10): 1239-1253 (2012); Wang et al., Chlorotoxin-directed CAR T cells for specific and effective targeting of glioblastoma, Science Translational Medicine 12(533) (2020). Although effective therapeutic agents such as new CAR-T cells and chemotherapeutic drugs have been developed for the treatment of various cancers, their effectiveness in GBM treatment is generally hindered by the BBB or BBTB. Therefore, there is an urgent need for a safer and more effective human neutrophil-mediated biomimetic drug delivery system mainly based on the natural chemotactic activity of GBM. Summary of the Invention

[0012] Chimeric antigen receptor (CAR)-expressing neutrophils loaded with nanoparticles containing a drug are provided. The CAR-expressing neutrophils can be differentiated from pluripotent stem cells (PSCs) modified to express CAR and are preferably differentiated. The PSCs can be human PSCs (hPSCs). The hPSCs can include human embryonic stem cells (hESCs) and / or induced pluripotent stem cells (iPSCs).

[0013] The nanoparticles can include one or more of rough silica nanoparticles, cytosine arabinoside-based liposomes (e.g., DepoCyt®), polyamidoamine (PAMAM) dendrimer albumin nanoparticles, and / or fullerenes (e.g., gadofullerenol / fullerenol). The rough silica nanoparticles can be biodegradable mesoporous organic silica.

[0014] The drug can be a prodrug (e.g., preclinical or clinical), a chemotherapeutic agent, or a radiosensitizer. The prodrug can be activated by hypoxia, acidic pH, an enzyme (e.g., horseradish peroxidase), or irradiation. The drug can be, for example, tirapazamine, temozolomide, climacostol, or indole-3-acetic acid. The drug can be selected from the group consisting of everolimus, bevacizumab, belzutifan, carmustine, naxitamab-gqgk, and romustine.

[0015] The CAR of the CAR-expressing neutrophils can include a neutrophil-specific transmembrane domain. The neutrophil-specific transmembrane domain can be a TLR4 polypeptide, a TLR2 polypeptide, a MET polypeptide, a granulocyte colony-stimulating factor receptor (G-CSFR), a Myd88 polypeptide, a TRIF polypeptide, a Syk peptide, a CD40 polypeptide, CD32a, dectin-1, an IL-6 receptor (IL6R), an Fc epsilon receptor Ig (FCER1G) polypeptide, toll-like receptor 7 (TLR7), or a CD16 transmembrane aaCD8 polypeptide, a CD28 polypeptide, an OX40 polypeptide, an ICOS polypeptide, a CTLA-4 polypeptide, a PD-1 polypeptide, a LAG-3 polypeptide, a BTLA polypeptide, a natural killer group 2D (NKG2D), dectin-1 or CD16.

[0016] The CAR can include a 36-amino acid glioblastoma (GBM) target chlorotoxin peptide, a CD4 transmembrane domain, and a CD3ζ intracellular domain. The CAR can include a 36-amino acid GBM target chlorotoxin peptide, a C32a transmembrane domain, and a CD3ζ intracellular domain. The CAR can include a 36-amino acid GBM target chlorotoxin peptide, either a CD32a transmembrane domain or a CD16 transmembrane domain, and a CD3ζ intracellular signaling domain. The CAR can include a 36-amino acid GBM target chlorotoxin peptide, either a CD32a transmembrane domain or a CD16 transmembrane domain, and either a CD32aγ intracellular signaling domain or a CD16 intracellular signaling domain, and in various embodiments, can further include an additional CD3ζ intracellular signaling domain. The CAR of the CAR-expressing neutrophils can include a 36-amino acid GBM target chlorotoxin peptide, either a CD32a transmembrane domain or a CD16 transmembrane domain, and either a CD32aγ intracellular signaling domain or a CD16 intracellular signaling domain.

[0017] The CAR can comprise a 36 - amino - acid GBM - targeting chlorotoxin peptide, an NKG2D transmembrane domain, a 2B4 co - stimulatory domain, and a CD3ζ intracellular signaling domain. The CAR can comprise an IL - 13 receptor α2 (IL - 13Rα2) - targeting quadruple - mutant IL - 13 (TQM13) T - CAR, a GD2 - targeting scFV, a HER2 - targeting scFV, a type vIII - mutant epidermal growth factor receptor (EGFRvIII) - targeting scFV or other glioma - targeting scFVs, a CD4 transmembrane domain, and a CD3ζ intracellular signaling domain.

[0018] Neutrophils can have an anti - tumor N1 phenotype. Neutrophils can exhibit anti - GBM activity in the hypoxic tumor microenvironment.

[0019] The CAR of the CAR - neutrophils can be encoded by SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or a functional variant of SEQ ID NO: 2, 3, or 4.

[0020] Neutrophil - specific CAR constructs are also provided. In certain embodiments, the neutrophil - specific CAR construct comprises one or more sequences encoding a disease - target peptide, a neutrophil - specific transmembrane domain, and an intracellular domain.

[0021] The neutrophil - specific transmembrane domain can be CD32a. The neutrophil - specific transmembrane domain can be CD4. The neutrophil - specific transmembrane domain can be NKG2D, dectin 1, IL - 6 receptor, or CD16. The disease - target peptide can be a 36 - amino - acid GBM - targeting chlorotoxin. The intracellular domain can be a CD3ζ signaling domain. The intracellular domain can be either a CD32aγ intracellular signaling domain or a CD16 intracellular signaling domain. In certain embodiments, the CAR further comprises a sequence encoding one (i.e., an additional) CD3ζ intracellular signaling domain. The construct can further comprise one or more sequences encoding a 2B4 co - stimulatory domain, for example, the intracellular domain can be a CD3ζ intracellular signaling domain.

[0022] In certain embodiments of the CAR construct, the transmembrane domain is the CD4 transmembrane domain, the intracellular domain is the CD3ζ intracellular signaling domain, and the CAR further comprises one or more sequences encoding an IL-13 receptor α2 (IL-13Rα2)-targeted quadruple mutant IL-13 (TQM13) T-CAR, a GD2-targeted single-chain variable fragment (scFV), a human epidermal growth factor receptor 2 (HER2)-targeted scFV, a type vIII mutant epidermal growth factor receptor (EGFRvIII)-targeted scFV, or other glioma-targeted scFV.

[0023] In certain embodiments, the CAR construct comprises SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or a functional variant of SEQ ID NO: 2, 3, or 4.

[0024] Also provided are modified neutrophil cell lines. In certain embodiments, the modified neutrophil cell line comprises any of the CARs described herein. For example, the CAR can comprise a disease target peptide, a neutrophil-specific transmembrane domain, and an intracellular domain. The neutrophil-specific transmembrane domain can be CD32a. The disease target peptide can be the 36-amino acid GBM target chlorotoxin. The neutrophil-specific transmembrane domain can be the CD4 transmembrane domain. The transmembrane domain can be NKG2D, dectin 1, the IL-6 receptor, or CD16. The neutrophil-specific transmembrane domain can be either the CD32a transmembrane domain or the CD16 transmembrane domain. The intracellular domain can be the CD3ζ intracellular signaling domain. In certain embodiments, the intracellular domain comprises the CD32aγ intracellular signaling domain or the CD16 intracellular signaling domain. The CAR of the modified neutrophil cell line can comprise either the CD32a transmembrane domain or the CD16 transmembrane domain, and either the CD32aγ intracellular signaling domain or the CD16 intracellular signaling domain. The CAR can further comprise the CD3ζ intracellular signaling domain. The CAR can further comprise the 2B4 co-stimulatory domain.

[0025] In certain embodiments of the modified neutrophil cell line, the disease target peptide is the 36 - amino - acid GBM target chlorotoxin, the neutrophil - specific transmembrane domain is the CD4 transmembrane domain, the intracellular domain is the CD3ζ intracellular signaling domain, and the CAR further comprises an IL - 13Rα2 - TQM13 T - CAR, a GD2 - target scFV, a HER2 - target scFV, an EGFRvIII - target scFV, or other glioma - target scFVs.

[0026] Furthermore, a pharmaceutical composition is provided. The pharmaceutical composition can comprise any one of the neutrophils of either CAR - expressing neutrophils or the modified neutrophil cell line and a pharmaceutically acceptable carrier and / or diluent. The pharmaceutical composition can further comprise a pharmaceutically acceptable excipient.

[0027] In certain embodiments, there is provided the use of any one of CAR - expressing neutrophils, a modified neutrophil cell line, or a pharmaceutical composition in the manufacture of a medicament for treating a disease of a subject. The disease can be cancer (e.g., GLB). In certain embodiments, the disease is a neurological disorder (e.g., Parkinson's disease or Alzheimer's disease).

[0028] A method of treating cancer in a subject is also provided. In certain embodiments, the method comprises administering to the subject a primary treatment comprising a therapeutically effective amount of any population of CAR - expressing neutrophils, any population of neutrophils of a modified neutrophil cell line, or a pharmaceutical composition, whereby the cancer of the subject is treated. The cancer can be a brain cancer such as GLB. The cancer can be prostate cancer.

[0029] The administration of the primary treatment can comprise a delivery route selected from the group consisting of intravenous, intraperitoneal, intramuscular, intradermal, subcutaneous, intrathecal, intraosseous, and any combination thereof. The primary and secondary treatments can be administered sequentially and / or alternately.

[0030] The method can further include administering a secondary treatment, which can vary depending on the type of disease being treated. In certain embodiments, the secondary treatment is, and / or includes, surgical removal of cancerous cells from the subject. Additionally or alternatively, the secondary treatment can include chemotherapy, radiation therapy, or both.

[0031] In certain embodiments, the method of treating cancer further includes imaging the subject's cancer before and / or during administration of the primary and / or secondary treatment.

[0032] Also provided is a method of delivering a therapeutic agent to a targeted location in a subject having a disease. In certain embodiments, such a method includes administering to the subject a primary treatment comprising a therapeutically effective amount of any population of CAR-expressing neutrophils, any population of neutrophils of a modified neutrophil cell line, or any pharmaceutical composition, wherein the targeted location crosses the blood-brain barrier of the subject relative to the site of administration.

[0033] The disease can be cancer, such as brain cancer. The disease can be GLB. The disease can be a neuropathy. The neuropathy can involve protein aggregation of a protein that tends to aggregate. The neuropathy can be a tauopathy. The neuropathy can be Alzheimer's disease or Parkinson's disease.

[0034] In certain embodiments, the method of delivering a therapeutic agent to a targeted location further includes administering a secondary treatment to the subject.

[0035] Secondary treatment can include surgical removal of cancerous cells from a subject (e.g., if the disease is cancer). Secondary treatment can include chemotherapy, radiation therapy, or both. The method can further include imaging a targeted location of the subject before or during administration of the primary and / or secondary treatment. The targeted location can include brain tissue. Secondary treatment can include a microtubule stabilizer. The primary and secondary treatments can be administered sequentially and / or alternately.

[0036] The disclosed embodiments, other features, advantages and aspects included herein, and the matters for achieving these will become clear in light of the following modes for carrying out the invention for various exemplary embodiments of the present disclosure. The modes for carrying out such an invention are better understood in conjunction with the accompanying drawings.

Brief Description of the Drawings

[0037]

Figure 1

Figure 2-1

Figure 2-2

Figure 2-3

Figure 2-4

Figure 3-1

Figure 3-2

Figure 3-3

Figure 3-4

Figure 3-5

Figure 4-1

Figure 4-2

Figure 4-3

Figure 4-4

Figure 4-5

Figure 4-6

Figure 5-1

Figure 5-2

Figure 5-3

Figure 5-4

Figure 5-5

Figure 6-1

Figure 6-2

Figure 6-3

Figure 6-4

Figure 7-1

Figure 7-2

Figure 8-1

Figure 8-2

Figure 8-3

Figure 8-4

Figure 8-5

Figure 8-6

Figure 9-1

Figure 9-2

Figure 10

Figure 11-1

Figure 11-2

Figure 12-1

Figure 12-2

Figure 12-3

Figure 12-4

Figure 13

Figure 14

Figure 15-1

Figure 15-2

Figure 16-1

Figure 16-2

Figure 17

Figure 18

Figure 19-1

Figure 19-2

Figure 20

[0038] Although the present disclosure is amenable to various modifications and alternative forms, illustrative embodiments are shown by way of example in the drawings and will be described in detail herein.

[0039] The concepts of the present disclosure are illustrated and described in detail in the present specification, but the results in the description are to be regarded as illustrative and not restrictive, only illustrative embodiments are shown and described, and it is understood that all changes and modifications falling within the spirit of the present disclosure are desirable to be protected.

[0040] Considering the innate ability to cross natural immunity and physiological barriers against pathogens, the present disclosure provides human neutrophils modified with synthetic chimeric antigen receptors (CARs). CAR-expressing neutrophils can provide improved direct antitumor cell lysis of nanoparticle-formulated chemotherapeutic drugs and enhanced non-invasive glioblastoma (GBM) targeted delivery without additional inflammation-inducing chemotaxis. Primary neutrophils are short-lived and cannot be genetically modified, which has conventionally limited these broad applications in CAR-directed immunotherapy. Roberts et al., Antigen-specific cytolysis by neutrophils and NK cells expressing chimeric immune receptors bearing zeta or gamma signaling domains, J Immunology 161(1): 375-384 (1998). On the other hand, human pluripotent stem cells (hPSCs) are amenable to gene editing, can be differentiated into neutrophils on a large scale, and can provide an unlimited source of high-quality CAR neutrophils for targeted immunotherapy under chemically defined xeno-free conditions. Chang et al., Engineering chimeric antigen receptor neutrophils from human pluripotent stem cells for targeted cancer immunotherapy, Cell Reports 40(3) (2022).

[0041] The present disclosure utilizes the ability of self-renewing hPSCs to generate an unlimited number of de novo CAR-expressing human neutrophils to provide a potent bioinspired neutrophil-mediated drug delivery system using CAR modification. Neutrophil-specific CAR-expressing constructs are provided as CAR-expressing neutrophils. In certain embodiments, CAR-expressing neutrophils (or CAR neutrophils) loaded with nanoparticles (e.g., containing a drug) are provided. The term "CAR neutrophil" means a neutrophil modified to express a CAR on its surface via molecular biological methods. The use of the modified CAR neutrophils as nanocarriers (e.g., for drugs) is also provided. Such modified CAR neutrophils can have prominent antitumor activity and can be used, in certain embodiments, to treat various disease states including GBM and, optionally, to target.

[0042] CAR constructs and CAR-expressing neutrophils In view of the above, provided are neutrophil-specific CAR-expressing gene constructs and CAR-expressing neutrophils loaded with nanoparticles.

[0043] The CAR can be any suitable CAR known in the art. A CAR is an artificially constructed hybrid receptor protein or polypeptide that can graft any arbitrary specificity onto immune effector cells such as NK cells. See, for example, Sadelain et al., “The Basic Principles of Chimeric Antigen Receptor Design,” Cancer Discovery OF1-11 (2013). Non-limiting examples of complementarity-determining regions (CDRs) include, but are not limited to, CD19 (USPN7,446,190; USPAPN 2013 / 0071414), HER2 (Ahmen et al., Clin Cancer Res (2010)), MUC16 (Chekmasova et al. (2011)), and PSMA (Zhong et al., Molec Ther 18(2); 413-410 (2010)). The CAR can have a predefined binding specificity for a desired target, such as matrix metalloprotease 2 (MMP2), for example, MMP2 for gliomas such as GBM. The terms “polypeptide,” “peptide,” and “protein” are used interchangeably herein (unless otherwise specifically indicated) to refer to a polymer of amino acid residues, a polypeptide, or a fragment of a polypeptide, peptide, or fusion polypeptide. These terms apply to amino acid polymers in which one or more amino acid residues are artificial chemical mimics of the corresponding naturally occurring amino acids, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymers.

[0044] Generally, a CAR can be a fusion protein that can include a recognition region, a co-stimulatory domain, various signaling domains, a co-stimulatory domain, a spacer, and / or a hinge. Desirably, the CAR is suitable for treating cancer using CAR neutrophils. For example, the CAR binds with high specificity to a cell surface antigen of cancerous cells.

[0045] In certain embodiments, the CAR is encoded by SEQ ID NO: 2 or a functional variant thereof. In certain embodiments, the CAR is encoded by SEQ ID NO: 3 or a functional variant thereof. In certain embodiments, the CAR is encoded by SEQ ID NO: 4 or a functional variant thereof. The term "functional variant" refers to a CAR, polypeptide, or protein having substantial or significant sequence identity or similarity to the CAR, and the functional variant retains the biological activity of the CAR that is the variant. Functional variants include, for example, variants of a CAR (parent CAR) that retain the ability to recognize target cells to a similar, the same, or a higher degree as the parent CAR. With reference to the nucleic acid sequence encoding the parent CAR, in some embodiments, the nucleic acid sequence encoding a functional variant of the CAR has about 10% identity, about 25% identity, about 30% identity, about 50% identity, about 65% identity, about 80% identity, about 90% identity, about 95% identity, or about 99% identity to the nucleic acid sequence encoding the parent CAR.

[0046] The use of terms and phrases related to CAR binding specificity, such as "binds specifically", "binds with high affinity", "binds with high specificity", or "binds specifically" or "selectively", refers to the binding reaction between a CAR, such as a CAR that includes neutrophil CLTX, and a target molecule, such as a protein (e.g., a receptor, an enzyme (e.g., MMP2), or a cell surface marker) present on a target cell, such as a cancerous cell (e.g., a cell containing a tumor) or other diseased cells. Thus, under binding conditions that promote, facilitate, or otherwise enhance the binding of CAR neutrophils to a target molecule present on a target cell, such as a cancerous cell or other diseased cells, such CAR neutrophils do not bind significantly, if at all, to other molecules, such as proteins (e.g., receptors, enzymes, and cell surface markers) present on normal healthy cells. Specific binding or binding with high affinity is at least 25% greater, more frequently at least 50% greater, most frequently at least 100% (2-fold) greater, generally at least 10-fold greater, more generally at least 20-fold greater, and most generally at least 100-fold greater than binding to any other non-targeted molecule.

[0047] In certain embodiments, these CARs bind with high specificity to cancer cells (e.g., brain cancer cells). In certain embodiments, these CARs bind with high specificity to beta-amyloid (e.g., for use in targeting / treating neuropathy). The CARs can be designed, for example, to target beta-amyloid (e.g., soluble oligomers of amyloid-beta peptide (AβO)). Since the accumulation of AβO in the brain is associated with synaptic deficits and memory impairment in Alzheimer's disease, targeting such AβO can be useful for effectively delivering nanoparticles / drug cargo to treat, for example, Alzheimer's disease and / or related symptoms. Selles et al., AAV-mediated neuronal expression of an scFv antibody selective for Aβ oligomers protects synapses and rescues memory in Alzheimer models, Molecular Therapies 31(2): 409-419 (2023). In certain embodiments, the CAR can comprise NUscl, which is a single-chain variable fragment (scFv) that selectively targets the population of AβO in a subject.

[0048] The CAR can comprise an extracellular domain, a transmembrane domain, and an intracellular domain. The extracellular domain can comprise an antigen-binding / recognition region / domain and / or an scFv derived from an antibody to be targeted. The antigen-binding domain of the CAR can bind to a specific antigen such as a cancer / tumor antigen (e.g., for the treatment of cancer), a pathogenic antigen such as a viral antigen (e.g., for the treatment of viral infection), or a CD antigen.

[0049] Examples of tumor antigens include, but are not limited to, carbonic anhydrase IX (CAIX), carcinoembryonic antigen (CEA), CD5, CD7, CD10, CD19, CD20, CD22, CD30, CD33, CD34, CD38, CD41, CD44, CD49f, CD56, CD74, CD123, CD133, CD138, antigens of cytomegalovirus-infected cells (e.g., cell surface antigens), epithelial glycoprotein 2 (EGP2), epithelial glycoprotein 40 (EGP40), epithelial cell adhesion molecule (EpCAM), receptor tyrosine protein kinases erb-B2, 3 or 4, folate-binding protein (FBP), fetal acetylcholine receptor (AChR), folate receptor α (FRα), folate receptor β (FRβ), ganglioside G2 (GD2), ganglioside G3 (GD3), human epidermal growth factor receptor 2 (HER2), human telomerase reverse transcriptase (hTERT), interleukin 13 (IL-13) receptor subunit α2 (IL-13Rα2), κ light chain, kinase insert domain receptor (IDR), Lewis A (CA19.9), Lewis Y (LeY), L1 cell adhesion molecule (L1CAM), melanoma antigen family A1 (MAGE-A1), mucin 16 (Muc-16), mucin 1 (Muc-1), mesothelin (MSLN), natural killer group 2D (NKG2D) ligand, cancer-testis antigen NY-ESO-1, tumor fetal antigen (h5T4), prostate stem cell antigen (PSCA), prostate-specific membrane antigen (PSMA), tumor-associated glycoprotein 72 (TAG-72), vascular endothelial growth factor receptor (VEGF-R such as R2), and Wilms tumor protein (Wt-1).

[0050] A particular CAR is a fusion with binding functionality to the CD3 zeta (CD3ζ) transmembrane and endodomain (e.g., an scFv derived from a monoclonal antibody). Such a molecule can effectuate the transmission of zeta signals in response to recognition by the binding functionality of its target recognition receptor. However, many alternatives exist. As non-limiting examples, the antigen recognition domains of the natural T cell receptor (TCR) alpha and beta signaling chains can be used as the binding functionality. Alternatively, a receptor extracellular domain (e.g., the CD4 extracellular domain) can be used. Anything that requires binding functionality should be able to specifically bind to a given target with high affinity.

[0051] In certain embodiments, the CAR includes a neutrophil-specific transmembrane domain. Examples of neutrophil-specific transmembrane domains include, but are not limited to, the TLR4 polypeptide, the TLR2 polypeptide, the MET polypeptide, the granulocyte colony-stimulating factor receptor (G-CSFR), the Myd88 polypeptide, the TRIF polypeptide, the Syk peptide, the CD40 polypeptide, CD32a, dectin 1, the interleukin-6 receptor (IL6R), the Fc epsilon receptor Ig (FCER1G) polypeptide, toll-like receptor 7 (TLR7), or the CD16 transmembrane aaCD8 polypeptide, the CD28 polypeptide, the OX40 polypeptide, the ICOS polypeptide, the CTLA-4 polypeptide, the PD-1 polypeptide, the LAG-3 polypeptide, and the BTLA polypeptide. In certain embodiments, the neutrophil-specific transmembrane domain is CD32a. In certain embodiments, the neutrophil-specific transmembrane domain is CD4. In certain embodiments, the neutrophil-specific transmembrane domain is NKG2D, dectin 1, the interleukin-6 receptor, or CD16.

[0052] The intracellular domain can include, for example, a CD3ζ peptide and can further include at least one co-stimulatory signaling region that includes at least one co-stimulatory molecule. A “co-stimulatory molecule” refers to a cell surface molecule or receptor other than an antigen receptor / ligand that is required for an efficient response of lymphocytes to an antigen. The co-stimulatory signaling region can include a CD28 polypeptide, a 4-1BB polypeptide, an OX40 polypeptide, an ICOS polypeptide, a DAP-10 polypeptide, a PD-1 polypeptide, a LAG-3 polypeptide, a 2B4 polypeptide, a BTLA polypeptide, or a CTLA-4 polypeptide. Neutrophil-specific intracellular domains can also be used, and these can be derived from FCER1G, CD32a, dectin 1, IL6R, TLR4, or TLR2.

[0053] The CAR can be produced by any method known in the art, but is preferably produced using recombinant DNA technology. Nucleic acid sequences encoding several regions of the CAR (i.e., the CAR construct) can be prepared and assembled into a complete coding sequence by standard techniques of molecular cloning and / or genetic modification techniques (genomic library screening, PCR, primer-assisted ligation, site-directed mutagenesis, and gene editing techniques such as CRISPR, etc.). Such techniques are generally known in the art (see, for example, Sambrook et al., “Molecular Cloning: A Laboratory Manual,” 3 rd ed., Cold Spring Harbor Laboratory Press (2001); and Green and Sambrook, “Molecular Cloning: A Laboratory Manual,” 4 th ed., Cold Spring Harbor Laboratory Press (2012), which are both specifically incorporated herein by reference for teachings regarded as the same. ) and / or exemplified herein.

[0054] The obtained coding region can be inserted into an expression vector for subsequent insertion into recipient cells such as hPSCs. The term "vector" means any nucleic acid that functions to carry, possess, or express a nucleic acid of interest. Nucleic acid vectors can have special functions such as expression, packaging, pseudotyping, or transduction. Vectors can also have manipulative functions when adapted for use as cloning or shuttle vectors. The structure of the vector can be realized to be made and can include any desired form desirable for a particular use. Such forms can include, for example, circular forms such as plasmids and phagemids, as well as linear or branched forms. Nucleic acid vectors can be composed of, for example, DNA or RNA, and can partially or completely contain nucleotide derivatives, analogs, or mimics. Such vectors can be obtained from natural sources, produced recombinantly, or chemically synthesized.

[0055] As non-limiting examples, plasmids or viral expression vectors (e.g., lentiviral vectors, retroviral vectors, sleeping beauty, and piggyback (transposon / transposase systems including non-viral mediated CAR gene delivery systems)) can be prepared that encode a fusion protein (i.e., a CAR construct) containing a recognition region, one or more co-stimulatory domains, and an activation signaling domain linked in-frame in the 5' to 3' direction.

[0056] CAR expression can be driven using any suitable promoter, such as those exemplified herein. Examples of promoters include, but are not limited to, various constitutive and inducible promoters such as the constitutive CAG promoter, EF1a promoter, UBC constitutive promoter, or Teton-3G inducible promoter.

[0057] The placement of the recognition region into the fusion protein / construct is generally such that presentation of the outer region of the neutrophil is achieved. Optionally, the CAR may also include additional elements such as a signal peptide (e.g., CD8α signal peptide) to ensure proper trafficking of the fusion protein to the cell surface, a transmembrane domain to ensure that the fusion protein is maintained as an integral membrane protein (e.g., CD3ζ transmembrane domain), and a hinge domain that confers mobility to the recognition region and allows for strong binding to the targeting moiety.

[0058] T- and NK-cell specific CAR constructs have been widely used to enhance the anti-tumor activity of T and NK cells, but neutrophil-specific CARs that improve the anti-tumor function of neutrophils have not been previously described. CD4ζ and CD4γ chimeric immunoreceptors have previously been reported to enhance human neutrophil lysis in vitro against HIVenv-transfected cells, but the lysis efficiency was only approximately 10% at an effector-to-target (E:T) ratio of 10:1. Roberts et al. (1998), supra. FcγRIIA (CD32a) is highly expressed on neutrophils (30,000-60,000 molecules / cell), and ligation thereof induces Fcγ-dependent functions in neutrophils such as granule content release, Ca 2+ mobilization, anti-tumor cell cytotoxicity, and phagocytosis, and is a low-affinity single-chain transmembrane receptor for monomeric immunoglobulin G (IgG). Wang & Jonsson, Expression, role, and regulation of neutrophil Fcγ receptors, Frontiers Immunology 10 (2019); Nagarajan et al., Cell-specific, activation-dependent regulation of neutrophil CD32A ligand-binding function, Blood 95(3): 1069-1077 (2000).

[0059] Considering the prominent role of CD32a in the activation and function of neutrophils, in certain embodiments, CD32a-based CAR constructs are provided. Such CAR constructs are screened and optimized as described in the following examples, and the results demonstrate that CD3ζ, when expressed in hPSC-derived neutrophils, can mediate cytolysis significantly better than CD32aγ. This may be partly due to the fact that CD3ζ has three copies of ITAM compared to one copy in CD32aγ, and the expression level of ζ is higher than that of γ on the cell surface of neutrophils. Roberts et al. (1998), supra.

[0060] Similar to CD32a, FcγRIII (CD16b) is another low-affinity receptor for monomeric IgG and is expressed at a much higher level than CD32a in neutrophils. Crosslinking of CD16b induces 2+ only mobilization and degranulation and does not induce phagocytosis and cytolysis in neutrophils, but the ability of CD3ζCAR and CD16bγCAR to trigger and enhance the anti-tumor function of neutrophils can be systematically compared. Roberts et al. (1998), supra; Fanger et al., Cytotoxicity mediated by human Fc receptors for IgG, Immunology Today 10(3): 92-99 (1989); Wang & Jonsson (2019), supra.

[0061] In certain embodiments, the CAR construct can include an antigen recognition domain that is directed, for example, to a tumor-associated antigen and contains a disease target peptide or a fragment thereof that promotes binding affinity to a targeted disease site. Thus, neutrophils expressing the CAR construct can be used to target a specific site (e.g., the TME) within a subject, which can reduce or eliminate off-target effects of the carried drug cargo. The antigen recognition domain of the CAR can be an entire antibody or an antibody fragment (e.g., scFv). The disease target peptide can be, for example, a cancer target peptide such as a GBM target peptide, or a functional fragment thereof. The disease target peptide can be, for example, a fibroblast target peptide such as fibroblast activation protein (FAP), or a functional fragment thereof. The terms “fragment of an antibody,” “antibody fragment,” “functional fragment of an antibody,” and “antigen-binding portion” are used interchangeably herein to mean one or more fragments or portions of an antibody that retain the ability to specifically bind to an antigen.

[0062] In certain embodiments, the CAR construct is an anti-GBM CAR construct (e.g., an anti-GBM chlorotoxin (CLTX)-CAR construct) that includes a T-specific or neutrophil-specific signaling domain. Such anti-GBM CAR constructs can be optimized, and genetically modified hPSCs having the optimized CAR can be screened via CRISPR / Cas9-mediated gene knock-in at the AAVS1 safe harbor locus as described in the following examples to identify CAR constructs optimized for neutrophil-mediated tumor killing. Wang et al. (2020), supra.

[0063] In certain embodiments, the CAR construct encodes a neutrophil-specific transmembrane domain. The neutrophil-specific transmembrane domain can be CD32a. The neutrophil-specific transmembrane domain can be CD4. The neutrophil-specific transmembrane domain can be CD32a. The neutrophil-specific transmembrane domain can be NKG2D, dectin 1, the IL-6 receptor, or CD16.

[0064] In various embodiments of the present specification, for example, when CAR-expressing neutrophils are used for the treatment of GBM, the CAR can include a GBM-targeting peptide such as the 36-amino acid GBM-targeting chlorotoxin (CLTX) peptide. In such embodiments, the GBM-targeting peptide (e.g., the 36-amino acid GBM-targeting chlorotoxin peptide) is coupled with a CD4 transmembrane domain and a CD3ζ intracellular domain such that the CAR includes the 36-amino acid GBM-targeting chlorotoxin peptide, the CD4 transmembrane domain, and the CD3ζ intracellular domain. In other embodiments, the GBM-targeting peptide (e.g., the 36-amino acid GBM-targeting chlorotoxin peptide) is coupled with (i) either the CD32a transmembrane domain or the CD16 transmembrane domain, and (ii) the CD3ζ intracellular signaling domain such that the CAR includes (i) the 36-amino acid GBM-targeting chlorotoxin peptide, (ii) the CD32a transmembrane domain or the CD16 transmembrane domain, and (iii) the CD3ζ intracellular signaling domain. In still other embodiments, the GBM-targeting peptide (e.g., the 36-amino acid GBM-targeting chlorotoxin peptide) is coupled with (i) either the CD32a transmembrane domain or the CD16 transmembrane domain, and (ii) the CD3ζ intracellular signaling domain such that the CAR includes (i) the 36-amino acid GBM-targeting chlorotoxin peptide, (ii) the CD32a transmembrane domain or the CD16 transmembrane domain, and (iii) the CD3ζ intracellular signaling domain.In yet other embodiments, the GBM target peptide (e.g., the 36 - amino acid GBM - targeting chlorotoxin (CLTX) peptide) is coupled to the CAR such that the CAR comprises only (i) the 36 - amino acid GBM - targeting chlorotoxin peptide, (ii) either the CD32a transmembrane domain or the CD16 transmembrane domain, and (iii) either the CD32aγ intracellular signaling domain or the CD16 intracellular signaling domain, or (iv) further combinations with the CD3ζ intracellular signaling domain, or is coupled to only (i) either the CD32a transmembrane domain or the CD16 transmembrane domain, and (ii) either the CD32aγ intracellular signaling domain or the CD16 intracellular signaling domain, or (iii) further combinations with the CD3ζ intracellular signaling domain. In still yet other embodiments, the GBM target peptide (e.g., the 36 - amino acid GBM - targeting chlorotoxin peptide) is coupled to the NKG2D transmembrane domain, the 2B4 co - stimulatory domain, and the CD3ζ intracellular signaling domain such that the CAR comprises the 36 - amino acid GBM - targeting chlorotoxin peptide, the NKG2D transmembrane domain, the 2B4 co - stimulatory domain, and the CD3ζ intracellular signaling domain.

[0065] The CAR construct can comprise SEQ ID NO: 2 or a functional variant thereof. The CAR construct can comprise SEQ ID NO: 3 or a functional variant thereof. The CAR construct can comprise SEQ ID NO: 4 or a functional variant thereof. The term "functional variant" refers to a CAR, polypeptide, or protein having substantial or significant sequence identity or similarity to the CAR, and the functional variant retains the biological activity of the CAR that is the variant. Functional variants include, for example, variants of a CAR (parent CAR) that retain the ability to recognize target cells to a similar, the same, or a higher degree as the parent CAR. With reference to the nucleic acid sequence encoding the parent CAR, in some embodiments, the nucleic acid sequence encoding a functional variant of the CAR has about 10%, about 25%, about 30%, about 50%, about 65%, about 80%, about 90%, about 95%, or about 99% identity to the nucleic acid sequence encoding the parent CAR.

[0066] In various other embodiments, for example when CAR-expressing neutrophils are used for the treatment of cancer, the CAR comprises an interleukin 13 (IL-13) receptor alpha 2 (IL-13Rα2)-targeting tetravalent mutant IL-13 (TQM13) T-CAR, a GD-2-targeting scFV, a HER2-targeting scFV, a type vIII mutant epidermal growth factor receptor (EGFRvIII)-targeting scFV or other glioma-targeting scFVs, a CD4 transmembrane domain, and a CD3ζ intracellular signaling domain.

[0067] In certain embodiments, an (e.g., optimized) CAR construct is provided that comprises one or more sequences encoding a 36-amino acid GBM-targeting CLTX peptide, a CD4 transmembrane domain, and a CD3ζ intracellular domain. In certain embodiments, a neutrophil-specific CAR construct comprises one or more sequences encoding a 36-amino acid GBM-targeting CLTX peptide, an NKG2D transmembrane domain, and an intracellular domain. The transmembrane domain can alternatively, and in certain embodiments, be either a CD32a transmembrane domain or a CD16 transmembrane domain.

[0068] The intracellular domain can be a CD3ζ signaling domain. The intracellular domain can be either a CD32aγ intracellular signaling domain or a CD16 intracellular signaling domain.

[0069] In certain embodiments, the CAR construct can further comprise one or more sequences encoding a 2B4 co-stimulatory domain, and optionally the intracellular domain can be a CD3ζ signaling domain. In certain embodiments of the CAR construct, the transmembrane domain is a CD4 transmembrane domain, the intracellular domain is a CD3ζ intracellular signaling domain, and the CAR further comprises one or more sequences encoding an IL-13 receptor α2 (IL-13Rα2)-targeted tetravalent mutant IL-13 (TQM13) T-CAR, a GD2-targeted scFV, a HER2-targeted scFV, an EGFRvIII-targeted scFV, or other glioma-targeted scFV.

[0070] As described above, the CAR construct can be used to produce stable CAR-expressing hPSCs, which can then be differentiated into a large number of neutrophils expressing the CAR construct (i.e., CAR-expressing neutrophils or CAR neutrophils, which are used interchangeably herein). In certain embodiments, the CAR-expressing neutrophils can have (and maintain) an anti-tumor N1 phenotype. Such neutrophils can exhibit anti-glioblastoma activity, for example, in a hypoxic tumor microenvironment (TIM).

[0071] CAR-encoding nucleic acids, such as plasmids, can be delivered into hPSCs using any suitable method known in the art and exemplified herein. Examples of methods include nucleofection / electroporation, transfection via Lipofectamine Stem (ThermoFisher, STEM00001) or similar transfection reagents, or lentiviral, retroviral, sleeping beauty, piggyback (transposon / transposase systems including non-viral vector-mediated CAR gene delivery systems) or adeno-associated virus (AAV)-mediated delivery, but are not limited thereto. Illustrated are methods using plasmids and CRISPR / Cas9, and it is also possible to use transposons, ribonucleoproteins, and double-stranded DNA to integrate CAR into, for example, the AAVS1 safe harbor locus or the CLYBL locus of the hPSC genome.

[0072] CAR-expressing neutrophils can be differentiated from pluripotent stem cells (PSCs) modified to express CAR and are preferably differentiated. The use of "pluripotent" to describe stem cells refers to the ability of the cells to form all cell lineages of an organism, in this case, all cell lineages of a human. Characteristics of pluripotency include, but are not limited to, morphology (e.g., small, round, high nucleus-to-cytoplasm ratio, prominent nucleoli, and intercellular spaces), potential for unlimited self-renewal, expression of pluripotent stem cell markers (e.g., SSEA3 / 4, SSEA5, TRA1-60 / 81, TRA1-85, TRA2-54, GCTM-2, TG343, TG30, CD9, CD29, CD133 / prominin, CD140a, CD56, CD73, CD90, CD105, OCT4, NANOG, SOX2, CD30, and / or CD50), the ability to differentiate into ectoderm, mesoderm, and endoderm, teratoma formation, and embryoid body formation.

[0073] PSCs are known in the art and can be modified to express CARs using the methods exemplified herein. The use of CRISPR / Cas9-mediated gene knock-in technology to introduce constructs into the AAVS1 safe harbor locus to genetically modify hPSCs is exemplified herein, but any suitable genome editing method can be used. Genome editing, also referred to as genomic editing or genetic editing, is a type of genetic modification in which DNA is inserted into, deleted from, and / or replaced in the genome of a target cell. Targeted editing can be achieved via nuclease-independent or nuclease-dependent approaches. Nuclease-independent editing involves homologous recombination guided by homologous sequences flanking the exogenous polynucleotide inserted into the genome. Alternatively, specific endonucleases can be used to introduce double-strand breaks into the DNA, which can then be repaired. CRISPR / Cas9 (clustered regularly interspaced short palindromic repeat associated 9) is an RNA-guided nuclease. Other endonucleases include, but are not limited to, zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs). Another system is DICE (dual integrase cassette exchange), which utilizes phiC31 and Bxb1 integrases for targeted integration.

[0074] The adeno-associated virus site 1 (AAVS1) safe harbor locus is exemplified herein, but other sites for targeted integration include, but are not limited to, other safe harbor loci or genomic safe harbors (GSHs) which are, in theory, intragenic / intergenic regions of the human genome that can accept predictable expression of newly integrated DNA without having a deleterious effect on the host cell or recipient organism. A useful safe harbor must permit sufficient transgene expression to yield the desired level of vector-encoded protein or non-coding RNA. The safe harbor must also not predispose cells to malignant transformation or alter cell function. Ideally, a safe harbor locus is characterized by the absence of regulatory elements or gene disruption and is an intergenic region at a gene-dense region or position at the convergence of two genes transcribed in opposite directions, maintaining an interval that minimizes the potential for long-range interaction between a vector-encoded transcriptional activator and the promoters of adjacent genes (particularly cancer-related and microRNA genes) and having ubiquitous transcriptional activity. The position should also avoid repetitive elements and conserved sequences and should permit easy design of primers for amplification. Suitable sites for human genome editing include, in addition to AAVS1, the chemokine (CC motif) receptor 5 gene locus, the human ortholog of the mouse ROSA26 locus, the human ortholog of the mouse H11 locus, the collagen locus, and the HTRP locus. The selected site must be validated for specific integration and, in many cases, the insertion strategy, promoter, gene sequence, and construct design will require optimization.

[0075] Neutrophils can be differentiated from PSCs using methods known in the art and / or exemplified herein. The PSCs can be hPSCs. The hPSCs can include human embryonic stem cells (hESCs) and / or induced pluripotent stem cells (iPSCs). In one embodiment, the hPSCs can be autologous cells, but heterologous cells can also be used, for example, if the patient being treated has received high-dose chemotherapy or radiation treatment and the patient's immune system has been destroyed. In one embodiment, allogeneic cells can be used. Where appropriate, the hPSCs can be obtained from a subject by methods well known in the art.

[0076] CAR-expressing neutrophils can be loaded with any suitable nanoparticles, i.e., nanoparticles known in the art that can contain a drug or prodrug. The nanoparticles can be loaded into the CAR-expressing neutrophils using any suitable method known in the art and / or exemplified herein.

[0077] In certain embodiments, the nanoparticles are biodegradable. In certain embodiments, the nanoparticles are biocompatible. The nanoparticles can include biodegradable mesoporous organosilica nanoparticles. In certain embodiments, the nanoparticles include biodegradable mesoporous organosilica (R-SiO2) nanoparticles having a rough surface. In certain embodiments, the nanoparticles include biodegradable mesoporous organosilica (S-SiO2) nanoparticles having a smooth surface. Examples of suitable nanoparticles include, but are not limited to, rough silica nanoparticles, cytosine arabinoside-based liposomes (e.g., DepoCyt®), polyamidoamine (PAMAM) dendrimer albumin nanoparticles, and fullerenes (e.g., gadofullerene / fullerol). The rough silica nanoparticles can be biodegradable mesoporous organosilica. In certain embodiments, the nanoparticles include one or more of rough silica nanoparticles, cytosine arabinoside-based liposomes, PAMAM dendrimer albumin nanoparticles, and / or fullerenes. In certain embodiments, the nanoparticles are biodegradable mesoporous organosilica.

[0078] The nanoparticles can include any drug (e.g., a therapeutic compound or agent) (e.g., as a cargo) that can be used for a therapeutic or prophylactic treatment, such as a therapeutic treatment of cancer. The drug can be a prodrug. The drug can be a preclinical or clinical drug or prodrug, an anti-neoplastic / chemotherapeutic agent, or a radiosensitizer.

[0079] Antineoplastic / Chemotherapeutic agents can be classified into alkylating agents, antimetabolites, natural products, hormones and antagonists, and others (see, for example, Antineoplastic Agents, LiverTox: Clinical and Research Information on Drug-Induced Liver Injury [Internet publication], publicly available via the U.S. National Library of Medicine, National Center for Biotechnology Information website). Such drugs can also be classified by indication, mechanism of action, chemical structure, or cytotoxicity / non-specificity versus non-cytotoxicity / targeting. Examples of alkylating agents include, but are not limited to, altretamine, bendamustine, busulfan, carmustine, chlorambucil, cyclophosphamide, dacarbazine, ifosfamide, lomustine, mechlorethamine, melphalan, procarbazine, streptozocin, temozolomide, thiotepa, trabectedin, and platinum coordination complexes (e.g., carboplatin, cisplatin (radiosensitizer), and oxaliplatin). Examples of antibiotics and cytotoxic agents include, but are not limited to, bleomycin, actinomycin (catinomycin), daunorubicin, doxorubicin, epirubicin, idarubicin, mitomycin (radiosensitizer), mitoxantrone, plicamycin, and valrubicin. Non-limiting examples of antimetabolites include folic acid antagonists (e.g., methotrexate, pemetrexed, pralatrexate, and trimethoprim), purine analogs (e.g., azathioprine, cladribine, fludarabine (radiosensitizer), mercaptopurine, and thioguanine), and pyrimidine analogs (e.g., azacitidine, capecitabine, cytarabine, decitabine, floxuridine, fluorouracil (radiosensitizer), gemcitabine (radiosensitizer), and trifluridine / tipiracil).Biological response modifiers include, for example, aldesleukin (IL-2), denileukin diftitox, and interferon gamma (IFNγ). Histone deactylase inhibitors include, for example, belinostat, panobinostat, romidepsin, and vorinostat. Hormonal agents include antiandrogens (e.g., abiraterone, apalutamide, bicalutamide, cyproterone, enzalutamide, flutamide, and nilutamide), antiestrogens and aromatase inhibitors (e.g., anastrozole, exemestane, fulvestrant, letrozole, raloxifene, tamoxifen, and toremifene), gonadotropin-releasing hormone analogs (e.g., degarelix, goserelin, histrelin, leuprolide, and triptorelin), and peptide hormones (e.g., lanreotide, octreotide, and pasireotide). There are many examples of monoclonal antibodies, especially alemtuzumab, atezolizumab, bevacizumab, blinatumomab, semipramab, cetuximab, daratumumab, dinutuximab, elotuzumab, gemtuzumab, and inotuzumab. Similarly, there are many examples of protein kinase inhibitors, especially abemaciclib, acalabrutinib, binimetinib, bortezomib, cabozantinib, carfilzomib, dabrafenib, dacomitinib, enasidenib, encorafenib, fedratinib, gefitinib, ibrutinib, lapatinib, midostaurin, and neratinib. Taxanes include, but are not limited to, cabazitaxel, docetaxel (a radiosensitizer), and paclitaxel (a radiosensitizer). Topoisomerase inhibitors include, but are not limited to, etoposide, irinotecan, teniposide (a radiosensitizer), and topotecan. Vinca alkaloids include, but are not limited to, vinblastine, vincristine, and vinorelbine.Other anti-cancer / chemotherapeutic agents include asparaginase, bexarotene, eribulin, everolimus, hydroxyurea (radiosensitizer), ixabepilone, lenalidomide, mitotane, omacetaxine, pomalidomide, tagraxofusp, telotristate, temsirolimus, thalidomide, and venetoclax. In various embodiments, the drug is tirapazamine (radiosensitizer), temozolomide, climacostol, or indole-3-acetic acid. In other embodiments, the drug is everolimus, bevacizumab, belzutifan, carmustine, naxitamab-gqgk, or romustine. In certain embodiments, the drug is the hypoxia-activated prodrug tirapazamine (TPZ) or the clinical chemotherapeutic agent temozolomide (TMZ). In certain embodiments, the drug is the compound JNJ64619187.

[0080] In embodiments where the nanoparticle comprises a prodrug, the prodrug can be activated by hypoxia, acidic pH, an enzyme (e.g., horseradish peroxidase), irradiation, etc.

[0081] As described in more detail in the Examples, hPSC-derived CAR neutrophils are not harmed by nanoparticulated cargo and retain the native biophysiological properties of naive neutrophils (Figure 1A). For example, CAR neutrophils loaded with TPZ-containing or TMZ-containing SiO2 nanoparticles exhibited excellent anti-tumor activity against GBM, a combination of CAR-enhanced direct cell lysis and chemotherapy drug-mediated tumor killing due to intracellular release of TPZ or TMZ and glutathione (GSH)-induced degradation of the nanoparticles after cellular uptake into targeted tumor cells (Figure 1B). In the Insights GBM xenograft model, hPSC-derived CAR neutrophils specifically and effectively delivered SiO2 nanoparticles loaded with TPZ to the brain tumor without having an invasive surgical incision that amplifies inflammation, significantly inhibited tumor growth, and extended the animal's survival period. The anti-GBM activity was excellent, specific, and off-target drug delivery was significantly reduced.

[0082] Furthermore, the CAR neutrophil-mediated drug delivery system can rely solely on the natural chemotactic ability of GBM without amplifying postoperative inflammatory signals, which supports its high specificity and therapeutic potential for eradicating deep-infiltrating gliomas that cannot be removed surgically. Since surgical resection and adjuvant chemotherapy / radiotherapy are the main clinical interventions for GBM, the combined treatment of CAR neutrophil nanocarriers with surgery / radiotherapy can achieve optimal therapeutic efficacy and is worthy of further investigation. Lin et al. (2021), supra.

[0083] The hPSC neutrophil-based drug delivery platform can be modular, and the CAR constructs and ultimately the CAR-expressing neutrophils can be re-engineered and fine-tuned to support other neutrophil-based efforts to treat devastating human diseases, making it versatile. As shown above, CAR modification is more available in hPSCs than in primary immune T / NK cells and requires only one genomic editing to achieve stable homogeneous expression of various CARs. In addition to CLTX-CAR, stable hPSC lines are constructed that express a universal anti-fluorescein isothiocyanate (FITC) or anti-PD-L1 CAR (both of which can be used to obtain universal solid tumor-targeted nano-carrier CAR neutrophils). Lee et al., Regulation of CAR T cell-mediated cytokine release syndrome-like toxicity using low molecular weight adapters, Nature Communications 10: 2681 (2019); Kagoya et al., A novel chimeric antigen receptor containing a JAK-STAT signaling domain mediates superior antitumor effects, Nature Medicine 24: 352-359 (2018). Other genetic modifications such as a fibrosis-targeting anti-FAP CAR can also be implemented to direct neutrophil nano-carriers towards the treatment of fetal regenerative diseases including traumatic brain injury and cardiac fibrosis. Aghajanian et al., Targeting cardiac fibrosis with engineered T cells, Nature 573: 430-433 (2019). Thus, in certain embodiments, the CAR construct includes a fibrosis-targeting anti-FAP CAR construct.

[0084] Furthermore, CAR-expressing hPSCs can be easily adapted to produce CAR-T or NK cells, and combinations of these immunotherapies with CAR neutrophil nano-carriers can have significant anti-tumor treatment benefits.

[0085] In summary, the CAR constructs and biomimetic CAR-expressing neutrophils (e.g., loaded with nanoparticles) provided herein offer a safe and powerful multipurpose platform for treating GBM and other devastating diseases. Also, considering that neutrophils preferentially phagocytose microbial pathogens with rough or long surfaces, such as Staphylococcus aureus (S. aureus) and Escherichia coli (E. coli), this property can be taken into account when designing nanoparticles for neutrophil-mediated drug delivery. Safari et al., Neutrophils preferentially phagocytose elongated particles - An opportunity for selective targeting in acute inflammatory diseases, Science Advances 6(24) (2020). Indeed, it has been recently reported that the preferential phagocytosis of elongated particles without complex surface modifications administered intravenously is by circulating neutrophils. Safari et al. (2020), supra; Chang et al., Crystallographic facet-dependent stress responses by polyhedral lead sulfide nanocrystals and the potential “safe-by-design” approach, Nano Research 9: 3812-3827 (2016); Chang et al., Achievement of safer palladium nanocrystals by enlargement of {100} crystallographic facets, Nanotoxicology 11(7): 907-922 (2017). Such an approach can maximize drug loading into neutrophils and achieve therapeutic-level drug delivery to the target site. Indeed, the findings presented herein support that treatments involving the administration of a combination of functional CAR neutrophils and chemoimmunotherapy can exhibit excellent specific anti-GBM activity, a significant reduction in off-target drug delivery, and an extension of the lifespan of tumor-bearing mice.

[0086] Furthermore, although the present disclosure illustrates the introduction of CAR into hPSCs and subsequent differentiation into neutrophils, those skilled in the art will understand and recognize that hPSC-derived hematopoietic endothelial cells, hematopoietic progenitor cells, and neutrophils, such as neutrophils generated by the methods described herein, can be directly targeted to generate CAR neutrophils.

[0087] Still further, the CAR-mediated drug delivery system is not limited to use for any particular disease or disorder, but rather is modular so that it can be specially tailored as desired. For example, CAR neutrophils can be prepared using any desired CAR (e.g., a CAR comprising a target peptide having binding affinity for a disease-specific or disorder-specific target), and nanoparticles containing a drug or prodrug selected to treat the targeted disease or disorder can be loaded. This can be particularly beneficial considering the ability of such CAR neutrophils to deliver nanoparticles to the site of interest within a subject regardless of the presence of the blood-brain barrier (BBB) or other biophysical barriers, as the CAR neutrophils can cross the BBB and other biophysical barriers in the subject's body.

[0088] Modified neutrophil cell line Still further provided is a modified neutrophil cell line (e.g., derived from hPSCs). In certain embodiments, the modified neutrophil cell line comprises a CAR having a 36-amino acid GBM-targeting chlorotoxin peptide, CD4, NKG2D, CD32a, or CD16 transmembrane domain, and an intracellular domain (e.g., the CD3ζ intracellular signaling domain). The transmembrane domain can be the CD4 transmembrane domain. The transmembrane domain can be the NKG2D transmembrane domain. The transmembrane domain can be either the CD32a transmembrane domain or the CD16 transmembrane domain.

[0089] The intracellular domain can be a CD3ζ intracellular signaling domain. The intracellular domain can include a CD32aγ intracellular signaling domain or a CD16 intracellular signaling domain. In certain embodiments, the CAR further includes a CD3ζ intracellular signaling domain (e.g., in addition to other intracellular domains of the CAR). The CAR can also further include a 2B4 co-stimulatory domain.

[0090] In certain embodiments, the transmembrane domain is a CD4 transmembrane domain, the intracellular domain is a CD3ζ intracellular signaling domain, and the CAR further has / includes an IL-13Rα2-targeted quadruple mutant IL-13 (TQM13) T-CAR, a GD2-targeted scFV, a HER2-targeted scFV, an EGFRvIII-targeted scFV, or other glioma-targeted scFV.

[0091] In certain embodiments, the CAR of the modified neutrophil cell line includes either a CD32a transmembrane domain or a CD16 transmembrane domain, and either a CD32aγ intracellular signaling domain or a CD16 intracellular signaling domain.

[0092] The modified neutrophil cell line can comprise / include a chimeric antigen receptor (CAR) having / including a 36-amino acid GBM-targeting chlorotoxin peptide, a CD4 transmembrane domain, and a CD3ζ intracellular signaling domain. In certain embodiments, the modified neutrophil cell line comprises / include a CAR having / including a 36-amino acid GBM-targeting chlorotoxin peptide, either a CD32a transmembrane domain or a CD16 transmembrane domain, and a CD3ζ intracellular signaling domain. In certain embodiments, the modified neutrophil cell line comprises / include a CAR having / including a 36-amino acid GBM-targeting chlorotoxin peptide, either a CD32a transmembrane domain or a CD16 transmembrane domain, and either a CD32aγ intracellular signaling domain or a CD16 intracellular signaling domain. In certain embodiments, the modified neutrophil cell line comprises / include a CAR having / including a 36-amino acid GBM-targeting chlorotoxin peptide, an NKG2D transmembrane domain, a 2B4 co-stimulatory domain, and a CD3ζ intracellular signaling domain. In certain embodiments, the modified neutrophil cell line comprises / include a CAR having / including an IL-13 receptor α2 (IL-13Rα2)-targeting quadruple mutant IL-13 (TQM13) T-CAR, a GD2-targeting scFV, a HER2-targeting scFV, an EGFRvIII-targeting scFV, or other glioma-targeting scFV; a CD4 transmembrane domain; and a CD3ζ intracellular signaling domain. The modified neutrophil cell line can comprise / include a CAR additionally including a CD3ζ intracellular signaling domain.

[0093] Composition Even more provided is a pharmaceutical composition. The pharmaceutical composition can comprise a population of isolated CAR neutrophils described herein or otherwise obtained by the methods, or a population of neutrophils from the cell lines described above. The pharmaceutical composition further comprises a pharmaceutically acceptable carrier and / or diluent.

[0094] The term "isolated" means that a material has been removed from its original environment, e.g., if of natural origin, from its natural environment. For example, a neutrophil of natural origin present in vivo is not isolated, but the same neutrophil separated from some or all of the materials coexisting in the natural system is isolated.

[0095] The terms "pharmaceutically acceptable" and grammatical variations are used interchangeably when referring to compositions, carriers, diluents, reagents, etc., indicating that the material can be administered to a mammal without undue toxicity, irritation, allergic reaction, and / or the production of undesirable physiological effects, e.g., nausea, dizziness, gastric upset, etc., and can be initiated with a reasonable benefit / risk ratio. In other words, a material that is not biologically or otherwise undesirable, i.e., the material can be administered to an individual with CAR neutrophils without causing any undesirable biological effects, or interacting significantly in a harmful way with any of the other components of the pharmaceutical composition.

[0096] The term "pharmaceutically acceptable carrier" is recognized in the art and refers to a pharmaceutically acceptable material, composition, or vehicle that participates in the support or conveyance of a composition or its components, such as a liquid or solid filler, diluent, excipient, solvent, or encapsulating material. Each carrier must be "acceptable" in the sense of being compatible with the subject composition and its components and not injurious to the patient. Some examples of materials that can function as pharmaceutically acceptable carriers include: (1) sugars, such as lactose, glucose, and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; (4) tragacanth powder; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository wax; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol, and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethanol; (20) phosphate buffer solution; and (21) other non-toxic compatible substances used in pharmaceutical formulations.

[0097] The choice of carrier is determined in part by a particular CAR, CAR-encoding nucleic acid sequence, vector, or host cell expressing the CAR, as well as by the particular method used for administration of the CAR-encoding nucleic acid sequence, vector, or host cell expressing the CAR. Thus, there are various suitable formulations for pharmaceutical compositions. For example, the pharmaceutical composition can contain a preservative. Suitable preservatives can include, for example, methylparaben, propylparaben, sodium benzoate, and benzalkonium chloride. A mixture of two or more preservatives can optionally be used. The preservative or mixture thereof is typically present in an amount of about 0.0001 wt% to about 2 wt% of the total composition.

[0098] The particular formulation used also depends at least in part on the particular route of administration. For example, a formulation suitable for systemic administration, such as intravenous administration, can differ from a formulation suitable for intracranial administration. Such modifications are within the scope of ordinary skill in the art.

[0099] Methods of Treatment and Use Provided is the use of any of the CAR-expressing neutrophils provided herein, any of the modified neutrophil cell lines or neutrophils derived therefrom, or a pharmaceutical composition comprising them, in the manufacture of a medicament for treating a disease of a subject. In certain embodiments, the disease is cancer. In certain embodiments, the disease is fibrosis.

[0100] Also provided is a method of treating cancer in a subject (e.g., in need thereof). The method can comprise administering to the subject a primary treatment comprising a therapeutically effective amount of (a) any population of CAR neutrophils described herein or a pharmaceutical composition comprising any of the CAR neutrophils, as well as a pharmaceutically acceptable carrier and / or diluent, or (b) a population of neutrophils from the above cell lines or a pharmaceutical composition comprising the same, as well as a pharmaceutically acceptable carrier and / or diluent.

[0101] In certain embodiments, the method further comprises administering a secondary treatment (e.g., using a therapeutically effective amount) and, compared to administering only a single compound or combination to the subject for treatment, the method can include a synergistic combination therapy so as to provide an increased cytotoxic effect against the subject's cancer.

[0102] The secondary treatment can include surgical removal of one or more cancerous cells from the subject, chemotherapy, and / or radiation therapy (e.g., a therapeutically effective amount). In certain embodiments, the method further comprises administering a therapeutically effective amount of chemotherapy to the subject. In certain embodiments, the method further comprises administering a therapeutically effective amount of radiation therapy to the subject. In certain embodiments, the method further comprises administering both a therapeutically effective amount of chemotherapy and radiation therapy to the subject.

[0103] In some embodiments, the cancer is additionally imaged before administering the CAR neutrophils or the CAR-expressing neutrophil composition to the subject. The cancer can be imaged during or after administration, additionally or alternatively, for example, to assess metastasis and to assess the effectiveness of treatment. In some embodiments, the imaging is performed by positron emission tomography (PET) imaging, magnetic resonance imaging (MRI), or single photon emission computed tomography (SPECT) / computed tomography (CT) imaging. The imaging method can be any suitable imaging method known in the art.

[0104] In some embodiments, the method further comprises imaging the solid tumor and / or the cancer before or during administration of the CAR neutrophils, the composition comprising CAR neutrophils, and / or the secondary treatment.

[0105] The cancer can be any cancer. "Cancer" includes any neoplastic condition, whether malignant, premalignant or non - malignant, and includes a group of diseases associated with abnormal cell proliferation that, in some cases, have the potential to invade or spread (i.e., metastasize) to other parts of the body. However, generally, the neoplastic condition is malignant. Both solid and non - solid tumors are included, and "cancer (ous) cells" can be used interchangeably with "tumor (ous) cells".

[0106] Examples of cancers include, but are not limited to, leukemia (e.g., ALL, AML, CLL, and CML), adrenocortical carcinoma, AIDS - related cancers (e.g., Kaposi's sarcoma), lymphomas (e.g., T - cell, Hodgkin, and non - Hodgkin), astrocytoma, basal cell carcinoma, bladder cancer, bone cancer, brain cancer (e.g., GBM), breast cancer, prostate cancer, lung cancer, cervical cancer, colon cancer, colorectal cancer, DCIS, esophageal cancer, gastric cancer, glioma, head and neck cancer, liver cancer, stomach cancer, pancreatic cancer, kidney cancer (e.g., renal cell and Wilms), oral cancer, oropharyngeal cancer, ovarian cancer, testicular cancer, and pharyngeal cancer.

[0107] The cancer can be brain cancer. The brain cancer can be GBM. The cancer can be prostate cancer. The cancer can be capable of expressing protein matrix metallopeptidase 2. A population of neutrophils (e.g., neutrophils from a CAR - expressing neutrophil and / or a modified neutrophil cell line) or a pharmaceutical composition containing them can be administered systemically or intracranially.

[0108] Also provided is a method of delivering a therapeutic agent to a targeted location in a subject (e.g., having a disease). In certain embodiments, the method includes administering to the subject a primary treatment comprising a therapeutically effective amount of any population of CAR - expressing neutrophils, any population of neutrophils from a modified neutrophil cell line, or any pharmaceutical composition, wherein the targeted location crosses the blood - brain barrier of the subject relative to the administration site.

[0109] The disease can be cancer (e.g., brain cancer or prostate cancer). The cancer can be any of the cancers described herein. The disease can be glioblastoma. In embodiments where the disease is cancer, the CAR of the CAR-expressing neutrophils used in the method can include a cancer target peptide such as chlorotoxin peptide, FAP, or other cancer target peptides that are currently known or will be developed in the future.

[0110] The disease can be a neuropathy. The neuropathy (e.g., neurodegenerative disorder) can be associated with protein aggregation of proteins that tend to aggregate. The neuropathy can be tauopathy. In certain embodiments where the disease is a neuropathy, the CAR of the CAR-expressing neutrophils used in the method can include a brain target (i.e., brain-specific) peptide that is currently known or will be developed in the future.

[0111] Proteins that tend to aggregate include, but are not limited to, islet amyloid polypeptide, amyloid β, alpha-synuclein (α-syn), tubulin associated unit (tau), and transthyretin. Tau can be tau isoform 2N4R or 1N4R. The CAR-expressing neutrophils described herein can be used to inhibit the aggregation of α-syn by loading with compounds that inhibit such aggregation. Diseases associated with protein aggregation include, but are not limited to, AA amyloidosis, Alzheimer's disease, monoclonal immunoglobulin light chain amyloidosis, Huntington's disease, Parkinson's disease, Creutzfeldt-Jakob disease, prion disease, amyotrophic lateral sclerosis, type 2 diabetes, or transthyretin amyloidosis.

[0112] CAR-expressing neutrophils can be used to inhibit the aggregation of α-syn in subjects having or at risk of Alzheimer's disease, Lewy body dementia (DLB), or multiple system atrophy (MSA), particularly due to their ability to cross the BBB and other biophysical barriers of the subject's body. CAR-expressing neutrophils can be used to inhibit the formation of α-syn inclusion bodies when loaded with nanoparticles containing compounds that inhibit the formation of α-syn inclusion bodies, for example, in subjects having neuroblastoma. In certain embodiments, the nanoparticles of the CAR-expressing neutrophils are selected from the group consisting of donepezil, galantamine, aducanumab, and monoclonal antibodies (e.g., donanemab).

[0113] CAR-expressing neutrophils can be used to inhibit tau protein aggregation in tauopathy, and the loaded nanoparticles can contain any suitable drug or prodrug for treating such tauopathy. In certain embodiments, the drug or prodrug includes a Fyn inhibitor (e.g., saracatinib), a GSK-3β inhibitor (e.g., tideglusib), or a p75 inhibitor (e.g., LM11A). Tauopathy is a group of disorders caused by, for example, abnormal tau phosphorylation, abnormal tau levels, abnormal tau splicing, and mutations in the tau gene. Neurodegenerative diseases are classified based on this protein accumulation. Tauopathy encompasses over 20 clinicopathological conditions, including Alzheimer's disease, the most common tauopathy. Other tauopathies include familial AD, primary age-related tauopathy (PART), Creutzfeldt-Jakob disease, pugilistic dementia, Gerstmann-Straussler-Scheinker disease (GSS), inclusion body myositis, corticobasal degeneration (CBD), Pick's disease (PiD), progressive supranuclear palsy (also known as Steele-Richardson-Olszewski disorder), Down syndrome, Parkinson's disease dementia, myotonic dystrophy, prion protein cerebral amyloid angiopathy, traumatic brain injury (TBI), amyotrophic lateral sclerosis (ALS), Parkinsonism-dementia complex of Guam, non-Guamanian motor neuron disease with neurofibrillary tangle, argentophilic grain disease, diffuse neurofibrillary tangles with calcification, frontotemporal dementia with Parkinsonism linked to chromosome 17 (FTDP-17), Hallervorden-Spatz disease, multiple system atrophy (MSA), Niemann-Pick disease type C, pallido-ponto-nigraldegeneration), progressive subcortical gliosis, progressive supranuclear palsy (PSP), subacute sclerosing panencephalitis, tangle predominant dementia, post-encephalitic parkinsonism, myotonic dystrophy, subacute sclerosis panencephalopathy, mutations in LRRK2, chronic traumatic encephalopathy (CTE), familial British dementia, familial Danish dementia, other frontotemporal lobar degenerations, Guadeloupean Parkinsonism, neurodegeneration with brain iron accumulation, SLC9A6-related mental retardation, white matter tauopathy with globular glial inclusion, epilepsy, Lewy body dementia (LBD), mild cognitive impairment (MCI), multiple sclerosis, Parkinson's disease, HIV-related dementia, adult-onset diabetes, senile cardiac amyloidosis, glaucoma, ischemic attack, AD-type psychosis, Huntington's disease, and prion diseases with tangle are included, but not limited to these. Most neurodegenerative diseases are characterized by insoluble protein deposits in cells of the neuromuscular system.

[0114] According to certain embodiments for methods of delivering a therapeutic agent to a subject having a disease, the disease is Alzheimer's disease. In certain embodiments for methods of delivering a therapeutic agent to a subject having a disease, the disease is Parkinson's disease.

[0115] A method of delivering a therapeutic agent to a subject having a disease can further comprise administering a secondary treatment to the subject. The secondary treatment can be, for example, surgical removal of cancerous cells from the subject (e.g., if the disease is cancer). The secondary treatment can include chemotherapy, radiation therapy, or both. The secondary treatment can include, for example, if the disease is cancer, imaging a targeted location in the subject (e.g., cancer (e.g., TME) or brain tissue) before or during administration of the primary and / or secondary treatment. In certain embodiments, for example, if the disease is neuropathy, the secondary treatment can include, but is not limited to, microtubule stabilizers such as docetaxel, epothilone D and / or paclitaxel. In certain embodiments, the primary and secondary treatments are administered sequentially and / or alternately with each other.

[0116] The method can reduce systemic off-target toxicity and can further reduce it significantly. "Off-target toxicity" means damage to an organ or tissue that is undesirable to the physician or other person treating the subject, or weight loss of the subject, or any other effect on the subject that is a potentially harmful indicator to the treating physician, such as B cell aplasia, fever, blood pressure drop, or pulmonary edema.

[0117] The terms "treating," "treatment," "being treated," and "treatment" (with respect to a disease or condition such as cancer) are used to describe a method of obtaining a beneficial or desired result such as a clinical outcome, and can include, but are not limited to, improvement of a condition associated with the disease, cure of the disease, reduction of the severity of the disease, improvement of the quality of life of a human suffering from the disease, prolongation of survival, and / or one or more of prophylactic treatments. When referring specifically to cancer, the terms "treating," "treatment," "being treated," or "treatment" can additionally mean reduction of tumor size, complete or partial removal of the tumor (e.g., complete or partial response), stabilization of the disease, prevention of cancer progression (e.g., progression-free survival), or any other effect on cancer considered by a physician to be a therapeutic or prophylactic treatment of cancer. More specifically, a curative treatment refers to any of alleviation, relief and / or elimination, reduction and / or stabilization (e.g., not progressing to a more advanced stage), and delay of progression of the signs / symptoms of a particular disorder. A prophylactic treatment refers to any of preventing onset, reducing the risk of occurrence, reducing the incidence, delaying onset, reducing occurrence, and increasing the time until the symptoms of a particular disorder develop. Desirable treatment effects include, but are not limited to, prevention of the occurrence or recurrence of a disease, alleviation of symptoms, reduction of any direct or indirect pathological consequence of the disease, prevention of metastasis, reduction of the disease recurrence rate, amelioration or temporary remission of the disease state, and remission or improvement of the prognosis. In some embodiments, the composition is used to delay the onset of a disease and / or tumor, or to slow (or even arrest) the progression of disease and / or tumor growth.

[0118] The terms "patient" or "subject" include humans, as well as non-human animals, such as companion animals (e.g., dogs and cats) and livestock animals. Livestock animals are animals that are raised for food production. The subject to be treated is preferably a mammal, particularly a human.

[0119] As used herein, the term "administering" includes all methods of introducing a pharmaceutical composition comprising neutrophils and neutrophils into a patient. Examples include, but are not limited to, oral (po), parenteral, systemic / intravenous (iv), intramuscular (im), subcutaneous (sc), transdermal, intrasternal, intraarterial, intraperitoneal, epidural, intraurethral, intranasal, buccal, intraocular, sublingual, intravaginal, intrarectal, etc. Routes of administration to the brain include, but are not limited to, intracerebral, intraventricular, intracranial, etc.

[0120] Exemplary methods of parenteral administration include needle (including microneedle) injectors, needle-free injectors, and infusion techniques, as well as any other method of parenteral administration recognized in the art. Parenteral formulations are typically aqueous solutions that may contain excipients such as salts, carbohydrates, and buffers (preferably at a pH in the range of about 3 to about 9). Preparation of parenteral formulations under sterile conditions can be readily accomplished using standard pharmaceutical techniques well known to those skilled in the art.

[0121] Neutrophils can be formulated as a pharmaceutical composition and administered to a mammalian host such as a human patient in various forms suitable for the selected route of administration. For example, the pharmaceutical composition can be formulated for oral, or parenteral, intravenous, intraarterial, intraperitoneal, intrathecal, epidural, lateral ventricular, intraurethral, intrasternal, intracranial, intratumoral, intramuscular, topical, inhalation, and / or subcutaneous routes and administered via these. In fact, neutrophils or a composition containing neutrophils can be administered directly into the bloodstream, muscle, or viscera.

[0122] The neutrophil / composition can be administered via infusion or injection (e.g., using a needle (including microneedle) injector and / or a needle-free injector). The solution of the composition can optionally be mixed with a non-toxic surfactant and / or can be aqueous and contain carriers or excipients such as salts, carbohydrates, and buffers (preferably at a pH of 3 - 9).

[0123] The percentages of neutrophils, compositions, and formulations may vary and can be about 1 to about 99 weight percent active ingredient, as well as binders, excipients, disintegrants, lubricants, and / or sweeteners (known in the art). The amount of neutrophils in such therapeutically useful compositions is such that an effective dosage level is obtained.

[0124] In some embodiments, the neutrophils are administered as a composition comprising one or more pharmaceutically acceptable carriers, adjuvants, diluents, excipients, vehicles, or combinations thereof.

[0125] The term "therapeutically effective amount," as used herein, refers to an amount of modified neutrophils that induces a biological or medical response (e.g., a desired therapeutic effect) in a tissue system, animal, or human being that is being investigated by a researcher, veterinarian, physician, or clinician, including alleviation of the symptoms of the disorder or disease being treated. In one aspect, a therapeutically effective amount is one that can treat or alleviate a disease or the symptoms of a disease with a reasonable benefit / risk ratio applicable to any medical treatment. However, it should be understood that the total daily usage of modified neutrophils can be determined within the sound medical judgment of the attending physician. In the treatment of cancer, the desired therapeutic effect can be inhibition of cancer progression, e.g., in the proliferation and / or metastasis of cancerous cells. Desirably, administration of a therapeutically effective amount kills cancerous cells such that the number of cancerous cells is decreased, desirably to the point of eradication.

[0126] The specific therapeutically effective dosage level of CAR neutrophils for any particular patient will depend on a variety of factors, including the disorder being treated and the state / severity of the disorder; the specific composition being used; the age, weight, general health, gender, and diet of the patient; the time and route of administration; the duration of the treatment; drugs used in combination with, or concurrently with, the modified neutrophils; and like factors well known to researchers, veterinarians, physicians, or other clinicians in the art. By way of example, the dosage of CAR-expressing neutrophils can be 10 2 per square meter of the patient's body surface area, or 10 5 to 1012 It can be within the range of. Thus, the absolute amount of modified neutrophils contained in a predetermined unit dosage form can vary widely and is affected by factors such as the age, weight, and health status of the subject, as well as the method of administration.

[0127] Depending on the route of administration, a wide range of acceptable dosages are contemplated herein. The dosage may be single or divided and may be administered according to a wide range of protocols, including q.d. (once a day), b.i.d. (twice a day), t.i.d (three times a day), or even once every other day, once a week, once a month, once a quarter, etc. In each of these cases, the therapeutically effective amount described herein corresponds to the total daily, weekly, monthly, or quarterly dosage determined by an example of administration or a dosing protocol.

[0128] Multiple injections may be required to effectively treat the subject. For example, 2, 3, 4, 5, 6, or more separate injections may be administered to the patient at intervals of about 24 hours to about 48 hours, or every 3, 4, 5, 6, or 7 days. The injections may be administered weekly, biweekly, or monthly. Monthly administration can be repeated for 2 to 6 months or more, for example, for 9 months to 1 year.

[0129] The dosage of modified neutrophils administered for treating cancer, such as brain tumor, glioma, GBM, or cancer expressing MMP2, or other diseases or disorders, is in accordance with the dosages and schedule regimens practiced by those skilled in the art. Typically, a dosage of >10 9 cells / patient is administered to patients undergoing adoptive cell transfer therapy. Determination of the effective amount or dosage is well within the ability of those skilled in the art, especially in light of the detailed disclosure provided herein.

[0130] The modified neutrophils administered to the subject are about 1×10 5 to about 1×10 15 , or 1×10 6 to about 1×10 15can include transduced CAR-T cells. In various embodiments, about 1×10 5 ~ about 1×10 10 、about 1×10 6 ~ about 1×10 10 、about 1×10 6 ~ about 1×10 9 、about 1×10 6 ~ about 1×10 8 、about 1×10 6 ~ about 2×10 7 、about 1×10 6 ~ about 3×10 7 、about 1×10 6 ~ about 1.5×10 7 、about 1×10 6 ~ about 1×10 7 、about 1×10 6 ~ about 9×10 6 、about 1×10 6 ~ about 8×10 6 、about 1×10 6 ~ about 7×10 6 、about 1×10 6 ~ about 6×10 6 、about 1×10 6 ~ about 5×10 6 、about 1×10 6 ~ about 4×10 6 、about 1×10 6 ~ about 3×10 6 、about 1×10 6 ~ about 2×10 6 、about 2×10 6 ~ about 6×10 6 、about 2×10 6 ~ about 5×10 6 、about 3×10 6 ~ about 6×10 6 、about 4×10 6 ~ about 6×10 6 、about 4×10 6 ~ about 1×10 7 、about 1×10 6 ~ about 1×10 7 、about 1×10 6 ~ about 1.5×10 7 、about 1×10 6 ~ about 2×10 7 、about 0.2×10 6 ~ about 1×10 7 、about 0.2×106 ~ about 1.5 × 10 7 、 about 0.2 × 10 6 ~ about 2 × 10 7 、 or about 5 × 10 6 cells.

[0131] The modified neutrophils administered to a subject can contain about one million, about two million, about three million, about four million, about five million, about six million, about seven million, about eight million, about nine million, about ten million, about eleven million, about twelve million, about twelve and a half million, about thirteen million, about fourteen million, or about fifteen million cells. The cells can be administered in a single dose or multiple doses. The modified neutrophils can be administered by the number of CAR-expressing neutrophils per kg of the subject's body weight.

[0132] The CAR-expressing neutrophils can be administered by any suitable route. Such routes include, but are not limited to, intravenous and intratumoral. The formulation of a composition suitable for the administration of CAR-expressing neutrophils, including compositions suitable for administration by intravenous and intratumoral routes, is within the scope of the ordinary skill in the art. The CAR-expressing neutrophils can contain one or more pharmaceutically acceptable carriers, diluents, and / or other pharmaceutically acceptable components. The carrier, diluent, and / or other components can be determined in part by the particular route of administration (see, e.g., Remington's Pharmaceutical Sciences, 17 th ed. (1985)). The components of the composition must be of sufficiently high purity and sufficiently low toxicity such that the composition is suitable for administration to humans. The composition is preferably stable.

[0133] Overview All patents, patent application publications, academic papers, textbooks, and other publications described herein are indicative of the level of those of ordinary skill in the art relevant to the present disclosure.

[0134] In the above description, numerous specific details have been set forth in order to provide a thorough understanding of the present disclosure. Specific examples can be practiced without having some or all of these specific details, and the present disclosure, while of course subject to variations, is still understood to be applicable to particular biological systems, particular cancers, or particular organs or tissues that may be contemplated in view of the data provided herein.

[0135] In addition, various techniques and mechanisms of the present disclosure sometimes describe a connection or coupling between two components. Words such as “couple,” “coupling,” “coupled,” “connect,” “connection,” and similar terms with these inflectional morphemes are used interchangeably unless a difference is indicated or is otherwise clear from the context. These words and expressions do not necessarily denote a direct connection and can include connections through intervening components. It should be noted that a connection between two components does not necessarily mean a connection that is direct and unimpeded, and that various other components can be present between the two components. Thus, a connection does not necessarily mean a connection that is direct and unimpeded unless specifically indicated.

[0136] Furthermore, the present disclosure is presented in this way for purposes of illustration only, and it is understood that the principles and embodiments described herein can be applied to compounds and / or composition components having configurations other than the specific configurations specifically described herein. In fact, it is expressly contemplated that the components and compounds of the present disclosure can be adapted to further the desired uses.

[0137] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains to chemistry and biology. Any methods and materials similar to and equivalent to those described herein can be used in the practice or testing of the subject matter of this application, but the preferred methods and materials are described herein.

[0138] When the term "about" refers to a number, or a numerical value or range of numerical values (including, for example, natural numbers, fractions, and percentages), the number or range of numerical values being referred to means an approximation within the range of experimental variability (or within the range of statistical experimental error), and thus the numerical value or range of numerical values can vary by 1% to 15% of the stated number or range of numerical values (for example, + / - 5% to 15% of the recited values), provided that a person of ordinary skill in the art would consider it to be equivalent to the recited value (for example, having the same function or result).

[0139] When ranges are used herein with respect to physical properties such as molecular weight or chemical properties such as chemical formula, all combinations and sub-combinations of the ranges, as well as specific embodiments, are intended to be included.

[0140] The present disclosure can be preferably practiced in the absence of any element or limitation not specifically disclosed herein. Thus, for example, each instance in this specification of any of the terms "comprising", "consisting essentially of", and "consisting of" (and related terms, such as "comprise", "comprises", "having", or "including") can be replaced with another recited term. Similarly, the singular forms "a", "an", and "the" include plural references unless the context clearly dictates otherwise. Thus, for example, a reference to "the method" includes one or more of certain methods and / or steps, which are described and / or will be apparent to a person of ordinary skill in the art upon reading this disclosure. The term "substantially" can allow for a degree of variation in a value or range, for example, within 90%, 95%, or 99% of the stated value, or the stated limits of the range.

[0141] The term "receptor" refers to a chemical structure in a biological system that receives and transmits signals.

[0142] Unless otherwise expressly stated, the structures depicted include all stereochemical forms of the structure, i.e., the right-handed (R) and left-handed (S) configurations of each chiral center. Thus, single stereochemical isomers as well as mixtures of enantiomers and diastereomers are within the scope of this disclosure.

[0143] One of ordinary skill in the art will further appreciate that the SMDCs described above can be "deuterated," which means that one or more hydrogen atoms can be replaced with deuterium. Since deuterium and hydrogen have nearly the same physical properties, deuterium substitution is the smallest structural change that can be made. Replacement of hydrogen with deuterium can increase stability in the presence of other drugs, thereby reducing unwanted drug-drug interactions, and can significantly decrease the metabolic rate (due to the kinetic isotope effect). By decreasing the metabolic rate, the half-life can be increased, formation of toxic metabolites can be reduced, and the dose and / or frequency of administration can be decreased.

[0144] Pharmaceutical compositions are also provided. As used herein, the term "composition" generally refers to any product that contains more than one component, e.g., one or more populations of CAR neutrophils and a carrier.

[0145] It is recognized that various modifications are possible within the scope of this disclosure. Accordingly, while this disclosure has been specifically disclosed in the context of preferred embodiments and optional features, one of ordinary skill in the art may rely on variations and modifications of the concepts disclosed herein. Such variations and modifications are considered to be within the scope of this disclosure as claimed herein.

[0146] Accordingly, this specification and the appended claims are intended to cover all modifications and variations that are apparent to those skilled in the art based on this disclosure. For example, when a method of treatment or therapy involves administering more than one treatment, compound, or composition to a subject, the order, timing, number, concentration, and amount of administration are understood to be limited only by medical requirements and the constraints of the treatment (i.e., two treatments can be administered to the subject, for example, simultaneously, consecutively, sequentially, alternately, or according to any other regimen).

[0147] In addition, in the description of representative embodiments, the disclosure may present methods and / or processes as a particular order of steps. To the extent that a method or process does not depend on a particular order of the steps described herein, the method or process should not be limited to the particular order of steps described. As will be understood by those skilled in the art, other orders of steps may be possible. Accordingly, the particular order of steps disclosed herein should not be construed as a limitation on the claims. In addition, claims directed to methods and / or processes should not be limited to performing these steps in the written order, and those skilled in the art can readily understand that the order can vary and still be within the spirit and scope of the disclosure.

[0148] Furthermore, the use of headings and subheadings is for the sake of document length and ease of reference. The description under a heading and subheading (e.g., a subheading in the mode for carrying out the invention) is not intended to be limited only to the topic described under a particular heading or subheading.

[0149] The present disclosure has been made with reference to humans, as well as human cells and genes, but it is contemplated that CAR-expressing neutrophils can be generated from other species, for example, other species of mammals, using cells and genes of that species. Such CAR-expressing neutrophils can be used to treat members of that species according to the teachings provided herein.

Examples

[0150] The following examples serve to illustrate the present disclosure. The examples are not intended to limit the scope of the claimed invention in any way.

[0151] Materials and Methods The general methodologies and materials used in the examples described herein are provided in this section. Any research-specific modifications to these general materials and methods are described in the specific examples.

[0152] [Table 1]

[0153] Synthesis of Degradable Dendritic Mesoporous Organosilica Nanoparticles (DDMON). DDMON was synthesized via a one-pot synthesis using NaSal as a structure-directing agent and cetyltrimethylammonium bromide (CTAB) as a cationic surfactant, tetraethyl orthosilicate (TEOS) and bis[3-(triethoxysilyl)propyl]tetrasulfide (BTES) as silica sources, and triethanolamine (TEA) as a catalyst. The synthesis was carried out in a 50 mL flat-bottom glass bottle equipped with a 3 cm stirring bar. Typically, 0.034 g of triethanolamine (TEA) was added to 12.5 mL of water and gently stirred (about 700 rpm) at 80 °C for 0.5 h in an oil bath under a magnetic stirrer. Then, 190 mg of CTAB and 42 mg of NaSal were added to the above solution and stirred for an additional 1 h. After complete dissolution of CTAB and NaSal, a mixture of 1 mL of TEOS and 0.8 mL of BTES was added to the mixture solution, followed by vigorous stirring for 12 h. The nanoparticles were collected by centrifugation at 20,000 rpm for 5 min and washed three times with ethanol to remove residual reactants. The powder was then dried in a vacuum oven at 40 °C for 6 h.

[0154] The collected product was extracted three times with HCl and methanol solution at 60 °C for 6 h to remove the template, followed by vacuum drying overnight at room temperature.

[0155] Preparation of spherical mesoporous silica nanoparticles (SMSN). To prepare SMSN, 240 mL of an aqueous solution containing 0.5 g of CTAB was prepared in a conical flask. Then 1.5 mL of NaOH (2 mol L -1 ) was added to the CTAB solution with stirring for 10 minutes. The temperature of the mixture was adjusted to 80 °C, and 2.5 mL of TEOS was added dropwise to the solution, followed by stirring for 2 hours. Then the obtained SMSN was centrifuged and washed several times with ethanol and deionized water to remove the surfactant template. The remaining powder was dried in a vacuum oven at 40 °C for 6 hours. The collected product was extracted three times with HCl and methanol solution at 60 °C for 6 hours to remove the residual template, and then vacuum dried overnight at room temperature.

[0156] Flow cytometry analysis. Cell cultures were gently pipetted and filtered through a 70 or 100 μm filter placed on a 50 mL tube. Then the cells were pelleted by centrifugation and washed twice with PBS- / - solution containing 1% bovine serum albumin (BSA). The cells were stained with the appropriate conjugated antibody in the dark at room temperature for 25 minutes, washed with BSA-containing PBS- / - solution, and then analyzed with an Accuri C6 plus cytometer (Beckton Dickinson). FlowJo software was used for flow data analysis.

[0157] Measurement of reactive oxygen species (ROS) production. U87MG cells (100 μL, 30,000 cells / mL) were seeded in the wells of a 96-well plate 12 hours before adding neutrophils at a neutrophil-to-tumor ratio of 10:1. After co-incubating for 12 hours, the obtained cell mixture was treated with 10 μM H2DCFDA at 37 °C for 50 minutes, and the fluorescence emission signal (480 - 600 nm) was collected with a SpectraMax iD3 microplate reader (Molecular Devices, Sunnyvale, CA) at an excitation wavelength of 475 nm.

[0158] Statistical analysis. Data are presented as mean ± standard deviation (SD). Statistical significance was determined by Student's t-test (two-sided) between two groups and by one-way analysis of variance (ANOVA) for three or more groups. P < 0.05 was considered statistically significant.

[0159] [Example 1] Screening of CAR constructs with enhanced neutrophil-mediated antitumor activity Four different CAR constructs were first designed, screened, and optimized for antitumor activity in hPSC neutrophils. The donor plasmid targeting the AAVS1 locus was constructed as previously described by Chang et al., Fluorescent indicators for continuous and lineage-specific reporting of cell-cycle phases in human pluripotent stem cells, Biotechnology & Bioengineering 117(7): 2177-2186 (2020). Briefly, the chlorotoxin (CLTX) sequence containing the granulocyte macrophage colony-stimulating factor receptor (GM-CSFR) signal peptide and IgG4 hinge, as well as CD3ζ and / or CD32aγ with CD4 or CD32a transmembrane domains, was directly synthesized (GeneWiz) and cloned into the AAVS1-Puro CAG-FUCCI donor plasmid (Addgene #136934). Wang et al. (2020), supra. The resulting CLTX-CAR constructs were sequenced and submitted to Addgene (#171963~#171865; SEQ ID NOs: 1~3).

[0160] As shown above, these four CAR constructs all shared the same extracellular granulocyte macrophage colony-stimulating factor receptor (GM-CSFR) signal peptide (SP), glioblastoma target domain CLTX, and IgG4 hinge (Figure 2A). Wang et al. (2020), supra; Chang et al. (2022), supra.

[0161] CAR #1 (SEQ ID NO: 1) was the first generation of a T cell-specific CAR using the CD4 transmembrane (tm) domain and the CD3ζ intracellular signaling domain. CAR #2 (SEQ ID NO: 2), CAR #3 (SEQ ID NO: 3), and CAR #4 (SEQ ID NO: 4) differed from CAR #1 in that they used the transmembrane domain from neutrophil-specific CD32a (or FcγRIIA), a single-chain transmembrane receptor that is highly expressed on neutrophils (30,000 - 60,000 molecules / cell) and is important for neutrophil activation. Wang & Jonsson (2019), supra; Nemeth et al., Importance of fc receptor γ-chain ITAM Tyrosines in neutrophil activation and in vivo autommune arthritis, Frontiers in Immunology 10 (2019); Role of neutrophil FcγRIIa (CD32) and FcγRIIIb (CD16) polymorphic forms in phagocytosis of human IgG1- and IgG3-opsonized bacteria and erythrocytes, Transfusion Medicine Reviews 9(4): 343 (1995); Tsuboi et al., Human Neutrophil FcγReceptors Initiate and Play Specialized Nonredundant Roles in Antibody-Mediated Inflammatory Diseases, Immunity 28(6): 833-846 (2008).

[0162] CAR #3 and CAR #4 also included the Fc domain γ-chain of CD32a, which expressed and signaled in neutrophils depending on a highly conserved immunoreceptor tyrosine-based activation motif (ITAM). Notably, CAR #3 also contained a combined signaling domain by fusing CD32a-ITAM to the CD3ζ intracellular domain.

[0163] The first neutrophils are short-lived and resistant to genome editing. Therefore, by knocking in the CAR construct into the AAVS1 safe harbor locus via CRISPR / Cas9-mediated homology-directed repair, hPSCs were modified with these CARs to achieve stable and universal immune receptor expression in differentiated neutrophils (Figure 2B). Briefly, the H9 hPSC line was obtained from WiCell and maintained in mTeSR plus medium on Matrigel-coated plates. For neutrophil differentiation, hPSCs were dissociated with 0.5 mM ethylene diamine tetraacetic acid (EDTA) and seeded at a cell density of 10,000 - 80,000 cells / cm 2 in mTeSR plus medium with 5 μM Y27632 in iMatrix 511-coated 24-well plates for 24 hours (day 1).

[0164] On day 0, the cells were treated with 6 μM CHIR99021 (CHIR) in Dulbecco's modified Eagle's medium (DMEM) supplemented with 100 μg / mL ascorbic acid (DMEM / Vc), and then the medium was changed to LaSR basal medium from day 1 to day 4. Vascular endothelial growth factor (VEGF) (50 ng / mL) was added to the medium from day 2 to day 4. On day 4, the medium was changed to Stemline II (Sigma) supplemented with 10 μM SB431542, 25 ng / mL SCF, and FLT3L. On day 6, the SB431542-containing medium was aspirated, and the cells were maintained in Stemline II medium with 50 ng / mL SCF and FLT3L.

[0165] On days 9 and 12, the upper half of the medium was aspirated and replaced with 0.5 ml of fresh Stemline II containing 50 ng / mL SCF, 50 ng / mL FLT3L, and 25 ng / mL GM-CSF. On day 15, for terminal neutrophil differentiation in Stemline II supplemented with 1× GlutaMAX, 150 ng / mL G-CSF, and 2.5 μM retinoic acid agonist AM580, the floating cells were gently harvested and filtered. The medium was replaced by half every 3 days, and mature neutrophils were harvested from day 21.

[0166] To increase cell viability, hPSCs were treated with 10 μM Y27632 for 3 - 4 hours or overnight before nucleofection. Cells were then dissociated with Accutase for 8 - 10 minutes into single cells, at a density of 1 - 2.5×10 6 hPSCs were nucleofected with 6 μg of SpCas9 AAVS1 gRNA T2 (Addgene #79888) and 6 μg of CAR donor plasmid in 100 μl of Human Stem Cell Nucleofection Solution (Lonza #VAPH-5012) using Nucleofector 2b program B-016.

[0167] The nucleofected cells were seeded into one well of a Matrigel-coated 6-well plate with 3 mL of pre-warmed mTeSR plus and 10 μM of Y27632. After 24 hours, the medium was replaced with fresh mTeSR plus containing 5 μM of Y27632, and subsequently, the medium was changed daily. When the cells became more than 80% confluent, drug selection was performed with 1 μg / ml of puromycin (Puro) for about one week until nickel-sized hPSC clones were visualized. Then, individual clones were picked out and expanded in each well of a 96-well plate pre-coated with Matrigel for 2 - 5 days, followed by PCR genotyping. Genomic DNA of single-clone-derived hPSCs was extracted with QuickExtract™ DNA Extraction Solution (Epicentre #QE09050). Genomic DNA PCR was performed using 2×GoTaq Green Master Mix (Promega #7123). For positive genotyping, the following primer pair with an annealing temperature Tm of 65°C was used: CTGTTTCCCCTTCCCAGGCAGGTCC (SEQ ID NO: 5) and TCGTCGCGGGTGGCGAGGCGCACCG (SEQ ID NO: 6). For homozygous screening, the following set of primer sequences with an annealing temperature Tm of 60°C was used: CGGTTAATGTGGCTCTGGTT (SEQ ID NO: 7) and GAGAGAGATGGCTCCAGGAA (SEQ ID NO: 8).

[0168] After nucleofection, single-cell-derived hPSC clones were isolated and screened with puromycin for about two weeks. Genotyping successfully confirmed targeted hPSCs with an average CAR knock-in efficacy of >90%, and the majority of the targeted clones were heterozygous (Figures 9A - 9D). CAR expression of the modified hPSCs was further confirmed by RT-PCR of CLTX-IgG4 and flow cytometry analysis (performed according to the methods described above) (Figures 9E and 9F).

[0169] To generate de novo CAR neutrophils, CAR-expressing hPSCs were first differentiated into multipotent hematopoietic progenitors and then into myeloid progenitors by stage-specific cytokine treatment (Figure 2C). Chang et al., Chemically-defined generation of human hemogenic endothelium and definitive hematopoietic progenitor cells, Biomaterials 285: 121569 (2022). The G-CSF and retinoic acid agonist AM580 used subsequently promoted robust neutrophil production. Brok-Volchanskaya et al., Effective and Rapid Generation of Functional Neutrophils from Induced Pluripotent Stem Cells Using ETV2-Modified mRNA, Stem Cell Reports 13(6): 1099-1110 (2019).

[0170] Similar to their counterparts in peripheral blood (PB), hPSC-derived CLTX-CAR neutrophils exhibited a typical neutrophil morphology and expressed the surface markers CD16, CD11b, MPO, CD15, CD66b, and CD18 (Figure 10).

[0171] The effect of CAR expression by hPSC-derived neutrophils on anti-tumor cytotoxicity was determined by in vitro co-culture with glioblastoma (GBM) U87MG cells, and cell viability was analyzed by flow cytometry. Briefly, 100 μL of tumor cells of GBM U87MG cells (50,000 cells / mL) were mixed with 100 μL of CAR neutrophils at 150,000, 250,000, and 500,000 cells / mL in a 96-well plate and then incubated at 37 °C, 5% CO2 for 24 hours. To harvest all cells, the cell-containing medium was first transferred to a new round-bottom 96-well plate, and 50 μL of trypsin-EDTA was added to the empty wells. After incubation for 5 minutes, the attached cells were dissociated and transferred to the same wells of a round-bottom 96-well plate with suspension culture. The 96-well plate was centrifuged at 300 × g at 4 °C for 4 minutes to pellet all cells and washed with 200 μL of PBS- / - solution containing 0.5% BSA.

[0172] For cytotoxicity analysis, both live / dead cell staining and the CytoTox-Glo™ Cytotoxicity Assay kit (Promega, Madison, WI) were used. CytoTox-Glo™ Cytotoxicity analysis and quantification were determined by a SpectraMax iD3 microplate reader (Molecular Devices, LLC, Sunnyvale, CA).

[0173] As expected, hPSC-derived CLTX-CAR neutrophils exhibited improved tumor killing ability compared to PB neutrophils (Figure 2D), consistent with what was previously observed in CLTX CAR-T cells. Wang et al. (2020), supra.

[0174] Among these different CARs, CAR #1 mediated excellent tumor-killing activity in hPSC neutrophils. Notably, the γ-chain-based CAR #4 had the least efficacy in triggering neutrophil-mediated tumor killing, which may be due to the lower copy number of ITAM in γ compared to the ζ subunit and the low expression of γ-bearing CARs on the cell surface. Roberts et al. (1998), supra. Neutrophils can also release cytotoxic reactive oxygen species (ROS) and tumor necrosis factor α (TNF-α) to kill target cells, and the production of ROS and TNF-α by different neutrophils (Figure 2E and 2F) is well correlated with the increase in lysis, indicating the involvement of ROS and inflammatory cytokines in neutrophil-mediated cytotoxicity against GBM cells.

[0175] In addition, the enhanced anti-tumor cytotoxicity of CAR neutrophils was only observed in co-incubation with GBM cells including U87MG, primary adult GBM43, and pediatric SJ-GBM2 cells (Figure 11A), demonstrating the high specificity of the CLTX-CAR. Notably, CAR neutrophils exhibited high biocompatibility with normal SVG p12 glial cells, hPSCs, or hPSC-derived cells (Figure 11B), consistent with previous observations that primary neutrophils do not kill healthy cells. Yan et al. (2014), supra. In summary, hPSC-derived CAR neutrophils, particularly CD3ζ-bearing CAR neutrophils, exhibit enhanced anti-tumor cytotoxicity, produce more ROS and TNF-α in vitro, highlighting their potential in targeted immunotherapy.

[0176] [Example 2] CAR neutrophils maintained excellent anti-tumor activity in the immunosuppressive tumor microenvironment. Similar to macrophages, the antitumor N1 phenotype and tumor-promoting N2 phenotype of tumor-associated neutrophils were found within the immunosuppressive tumor microenvironment (TME). Jaillon et al. (2020), supra. Tumor-promoting N2 neutrophils play important roles in tumor angiogenesis, metastasis, and immunosuppression, but it is difficult to target this cell type for treatment. Instead of a systemic depletion strategy, the potential of CAR modification to maintain the antitumor phenotype of neutrophils was evaluated. Yee et al. (2020), supra.

[0177] CAR hPSC and PB neutrophils were treated with hypoxia and transforming growth factor β (TGFβ), both of which contribute to immunosuppression in the TME, to assay their persistent tumor-killing activity. Emami Nejad et al., The role of hypoxia in the tumor microenvironment and development of cancer stem cell: a novel approach to developing treatment, Cancer Cell Int' l 21: 63 (2021); Lequeux et al., Impact of hypoxic tumor microenvironment and tumor cell plasticity on the expression of immune checkpoints, Cancer Letters 458: 13-20 (2019).

[0178] PB neutrophils showed significantly reduced lysis against GBM cells under immunosuppression compared to the normal state, while CAR neutrophils maintained high tumor-killing activity under both hypoxic (3% O2) and TGFβ conditions (Figure 3A). Similar observations were made regarding TNFα release and ROS production from PB or CAR neutrophils under immunosuppressive and normal conditions (Figures 3B and 3C).

[0179] To further confirm the neutrophil phenotype under hypoxia and TGFβ conditions, the expression of N1-specific iNOS and N2-specific arginase in isolated neutrophils was examined by flow cytometry (Figures 3D and 3E). Compared with normoxia, immunosuppressive hypoxia and TGFβ significantly decreased the expression level of iNOS and significantly increased the level of arginase in PB neutrophils, while CAR neutrophils maintained a high expression level of iNOS under hypoxia and TGFβ conditions. Collectively, CAR neutrophils maintain an antitumor phenotype and retain high antitumor activity under in vitro TME-mimicking conditions, highlighting their potential in targeted immunotherapy.

[0180] [Example 3] Preparation and Characterization of hPSC CAR Neutrophils Loaded with Tirapazamine (TPZ)-Containing SiO2 Nanoparticles PB neutrophils have been used as cell carriers to deliver imaging agents and therapeutic agents to brain tumors, but the infiltration of targeted neutrophils requires surgery-induced or light-induced inflammation, and off-target drug delivery can occur. Xue et al. (2017), supra; Wu et al. (2018), supra; Chu et al. (2017), supra; Osuka & Van Meir (2017), supra. To further improve the antitumor activity of CAR neutrophils, silica nanoparticles (SiO2-NP) with rough or smooth surfaces were prepared (according to the protocol described in the Materials and Methods section above), and chemotherapeutic drugs or radiation drugs were loaded into neutrophils.

[0181] Transmission electron microscopy (TEM) images demonstrated that both rough and smooth surface SiO2 nanoparticles were well-dispersed and exhibited a spherical morphology with a uniform size (Figures 4A and 12A). Composition distribution analysis via scanning TEM (STEM) with energy-dispersive X-ray spectroscopy (EDS) showed that sulfur (S) was uniformly distributed throughout the rough surface SiO2 nanoparticles (R-SiO2) (Figure 4B). Nitrogen (N2) adsorption–desorption isotherms and corresponding pore size distribution analysis were used to measure the pore sizes of rough (R-) and smooth surface (S-) SiO2 NPs, which were 25 nm and 35 nm, respectively (Figures 4C and 12B). Considering the high surface area and large pore size, therapeutic agents can be effectively loaded onto both R- and S-SiO2 NPs, as exemplified by the hypoxia-responsive prodrug tirapazamine (TPZ) (Figures 4D and 12C).

[0182] Briefly, for tirapazamine (TPZ) loading, 5 mL of 1 mg mL -1 of TPZ in phosphate buffer was mixed with 5 mL of SiO2 suspension (5 mg mL -1 ) in phosphate buffer (20 mM, pH = 7.4), and the resulting solution was continuously stirred at 37 °C at different time points (0.5, 1, 2, 4, 6, 12, and 24 h). Unloaded TPZ was removed by centrifugation at 8,000 rpm for 10 min, and the pellet was washed three times with phosphate buffer. TPZ in the supernatant was determined by UV–Vis spectroscopy. The loading capacity (LC) of TPZ was calculated as follows: LC = (total TPZ - TPZ in supernatant) / (total TPZ) × 100%. For glutathione (GSH) stimulated release analysis, 10 mL of TPZ@SiO2 suspension in phosphate buffer (1 mg mL -1 ) was incubated with 10 mM GSH at different time points (10, 20, 30, 40, 50, and 60 h). 1 mL of the composite dispersion was removed, centrifuged at 8,000 rpm for 10 min, and the released TPZ in the supernatant was quantified by UV–Vis spectroscopy. The same procedure was carried out for loading TMZ and JNJ64619187.

[0183] After loading TPZ, no significant changes in the dispersibility, morphology, and size of R-SiO2-TPZ were observed using TEM and dynamic light scattering analysis (Figures 12D and 12E). The disulfide bonds incorporated into R-SiO2 NPs are sensitive to a reducing environment and can be rapidly degraded by the large amount of glutathione (GSH) present in tumor cells. Liu et al., A Tumor-Microenvironment-Responsive Nanocomposite for Hydrogen Sulfide Gas and Trimodal-Enhanced Enzyme Dynamic Therapy, Advanced Materials 33(30): 2101223 (2021).

[0184] Next, the GSH-responsive degradability of R-SiO2-TPZ NPs (the same in each of cancer cells, normal cells, and the extracellular environment) in the presence of 10 mM, 1 mM, and 10 μM GSH was determined. Liu et al (2021), supra. Treatment with 10 mM GSH caused the initial spherical structure of the R-SiO2-TPZ NPs to be severely disrupted after 24 h (Figures 12F and 12G), and the nanoparticles completely disintegrated into fragments after 48 h, resulting in GSH-responsive TPZ release (Figure 4E).

[0185] To test the feasibility of using SiO2-TPZ NPs to boost therapeutic efficacy by loading therapeutic agents onto CAR neutrophils as a combined chemoimmunotherapy. Briefly, the loading of the nanodrug was prepared by incubating neutrophils with TPZ@SiO2, or with nanoparticles loaded with TMZ or JNJ64619187. (TMZ and JNJ64619187 were loaded onto SiO2 NPs using procedures similar to those described above for TPZ, respectively).

[0186] Briefly, hPSC-derived neutrophils were placed in DNA-low binding tubes and incubated with the nanodrugs for 1 hour. After centrifugation and washing three times with PBS, the nanodrug / neutrophils were resuspended in PBS and prepared for subsequent experiments. The cellular uptake efficiency of SiO2-TPZ NPs by neutrophils was measured by flow cytometry analysis, demonstrating a higher amount of cellular uptake of R-SiO2-TPZ NPs than S-SiO2-TPZ NPs by neutrophils. The location of the nanodrugs within the neutrophils was determined by fluorescence microscopy. The viability of neutrophils after incubation with the nanodrugs for 4 and 8 hours was measured using the Zombie Green Fixable Viability Kit (BioLegend, San Diego, CA) (Figures 4F - 4G).

[0187] To quantify the loading content of SiO2, the nanodrug / neutrophil samples were digested with tetramethylammonium hydroxide and high pressure, and the silicon concentration of the digested samples was measured by inductively coupled plasma optical emission spectrometry (ICP-OES). The cellular Si content in neutrophils was measured and was 11.3 and 19.1 ng Si / μg protein for smooth and rough SiO2NP@TPZ, respectively (Figure 4H). Considering the high loading content in neutrophils, R-SiO2-TPZ NPs were used for subsequent experiments.

[0188] Next, the physiological functions of CAR neutrophils after loading with R-SiO2-TPZ NPs were tested. Primarily, cell viability was analyzed by flow cytometry. Additionally, a Transwell migration assay was performed. Neutrophils were resuspended in HBSS buffer and allowed to migrate towards fMLP (10 nM and 100 nM) over 2 hours. Cells that migrated to the lower chamber were released with 0.5 M EDTA and quantified using an Accuri C6 plus cytometer (Beckton Dickinson & Company, Franklin Lakes, NJ). Live neutrophils were gated and analyzed with FlowJo software. The number of neutrophils was then normalized by the total number of cells added to each well.

[0189] A 2D chemotaxis assay was also performed. Neutrophils were resuspended in HBSS with 20 mM HEPES and 0.5% fetal bovine serum (FBS), placed on a collagen-coated IBIDI chemotaxis μ-slide, and then incubated at 37 °C for 30 minutes to allow the cells to attach. 15 μL of 1,000 nM N-formylmethionyl-leucyl-phenylalanine (fMLP) was placed in the right reservoir, resulting in a final fMLP concentration of 187 nM. Cell migration was recorded using an LSM 710 (equipped with a Ziess EC Plan-NEOFLUAR 10× / 0.3 objective lens) at 37 °C for a total of 120 minutes at 60-second intervals. Cells were tracked using the ImageJ plug-in MTrackJ (which is publicly available).

[0190] No significant changes were observed in the cell viability (Figure 4I), Transwell migration ability (Figure 4J), chemotaxis and corresponding velocity (Figures 4K - 4L) of CAR neutrophils before and after loading with R-SiO2-TPZ NPs, demonstrating high biocompatibility. The expression levels of CD11b, a neutrophil surface protein that mediates adhesion and migration functions upon inflammatory molecule stimulation, did not change in CAR neutrophils with or without R-SiO2-TPZ loading (Figure 13) (determined by flow cytometry).

[0191] Superoxide or reactive oxygen species (ROS) are released from activated neutrophils to kill microorganisms and tumor cells. Nguyen et al., Neutrophils to the ROScue: Mechanisms of NADPH oxidase activation and bacterial resistance, Frontiers in Cellular & Infection Microbiology 7 (2017). Therefore, ROS production was assayed using a protocol known in the art. As expected, ROS production by CAR neutrophils increased significantly after treatment with N-formylmethionyl-leucyl-phenylalanine (fMLP), and no significant difference was observed in ROS production by CAR neutrophils before and after loading with R-SiO2-TPZ (Figure 4M).

[0192] In summary, the data support that CAR neutrophils loaded with R-SiO2-TPZ can maintain the physiological activity of wild-type neutrophils and activate their migration in response to inflammatory stimuli, highlighting their potential in targeted cancer chemoimmunotherapy.

[0193] [Example 4] CAR neutrophils loaded with R-SiO2-TPZ nanoparticles effectively kill GBM cells. The effect of R-SiO2-TPZ on the tumor-killing ability of CAR neutrophils was evaluated. Close effector-target interaction was required for neutrophil-mediated cell lysis.

[0194] To visualize the immunological synapse, 100 μL of U87MG cells (50,000 cells / mL) were seeded into the wells of a 96-well plate and incubated at 37 °C for 12 h to allow cell attachment. Neutrophils (100 μL, 500,00 cells / mL) were then added to the target U87MG cells and incubated for 6 h before fixation with 4% paraformaldehyde (in PBS). Subsequently, cytoskeletal staining was performed using the F-actin Visualization Biochem Kit (Cytoskeleton Inc., Denver, CO). Somatic cells were also used as a control according to a protocol similar to the protocol outlined above.

[0195] As expected, CAR neutrophils@R-SiO2-TPZ formed immune synapses with tumor cells within 2 h and exhibited a number of effector-target interactions similar to those of drug-free CAR neutrophils (Figure 5A and Figure 14). Notably, no observable interaction was formed between CAR neutrophils@R-SiO2-TPZ and normal somatic cells (Figure 14), highlighting the specificity of CLTX-CAR for brain tumors.

[0196] Furthermore, R-SiO2-TPZ NPs were released intact from neutrophils into the culture medium after 12 h of co-culture (Figs. 15A and 15B) and were partially taken up by residual tumor cells (Fig. 5A). After 24 h of co-incubation of CAR neutrophils loaded with SiO2-TPZ NPs with tumor cells, up to 95% of the tumor cells took up R-SiO2-TPZ NPs (Figs. 5A and 15C), indicating successful delivery cascade with carrier neutrophils through rupture, effector cell function, and release and delivery of R-SiO2-TPZ NPs to target tumor cells. To determine the cytotoxicity of CAR neutrophils loaded with R-SiO2-TPZ NPs, an in vitro normoxia-hypoxia tumor rechallenge model was performed (Fig. 5B). After 24 h of normoxic co-culture, CAR neutrophils loaded with or without R-SiO2-TPZ NPs exhibited similar anti-tumor cytotoxicity (Fig. 5C), both higher than that of PB neutrophils loaded with or without R-SiO2-TPZ NPs and that of R-SiO2-TPZ NPs alone. This is mainly due to the enhanced tumor targeting ability of neutrophils after CAR modification.

[0197] After an additional 24 h of hypoxic co-culture with tumor cells, R-SiO2-TPZ NP-loaded CAR neutrophils exhibited superior anti-tumor ability compared to other groups (Fig. 5D). CAR neutrophils loaded with R-SiO2-TPZ NPs also exhibited excellent cytotoxicity against re-seeded tumor cells (Fig. 5E).

[0198] RNA sequencing (RNA-seq) analysis was performed on tumor cells to elucidate the potential molecular mechanisms underlying CAR expression and enhanced anti-tumor cell lysis of neutrophils by R-SiO2-TPZ NPs. Gene expression analysis demonstrated that CAR neutrophils loaded or not loaded with R-SiO2-TPZ NPs significantly reduced the cytoplasmic and membrane fractions of tumor cells compared to controls and R-SiO2-TPZ NPs (Figures 16A and 5F), further supporting phagocytosis of tumor cells by co-culture. All experimental groups increased cellular oxidative stress in tumor cells, but CAR neutrophils loaded with R-SiO2-TPZ outperformed other groups in targeting oxidative stress signaling. Additionally, CAR neutrophils loaded with R-SiO2-TPZ significantly promoted apoptosis and decreased proliferation of tumor cells. To further understand the enhanced anti-tumor activity of CAR neutrophils loaded with R-SiO2-TPZ, the phagocytosis inhibitor cytochalasin D and the reactive oxygen species (ROS) inhibitor N-acetyl-cysteine (NAC) were applied to tumor neutrophil co-cultures. Cytolysis of tumor cells by CAR neutrophils was significantly reduced by 5 μM cytochalasin D (Figure 16B) and 5 mM NAC (Figure 16C), indicating a prominent role for phagocytosis and ROS in CAR neutrophil-mediated tumor cell killing.

[0199] [Example 5] Functional evaluation of CAR neutrophils loaded with nanodrugs using a biomimetic GBM model in vitro To further assess the activity of CAR neutrophils loaded with R-SiO2-TPZ NPs, a Transwell-based blood-brain barrier (BBB) tumor model using human brain microvascular endothelial cells was performed (Figure 6A). The in vitro BBB model was constructed with HBEC-5i cells in a Transwell cell culture plate. Briefly, HBEC-5i cells (1×10 5(Cells / well) were seeded into the upper chamber of a Transwell pre-coated with gelatin (1% w:v) of a 24-well Transwell plate (pore size 8 μm, diameter 6.4 nm, Corning) and maintained in DMEM / F12 medium containing 10% FBS. Then neutrophils (2×10 5 ) were added to the upper chamber, and FBS-free medium with or without 10 nM fMLS was added to the lower chamber. After incubating for 3 hours, the cell culture was collected from the upper or lower chamber to calculate the number of neutrophils. In the cytotoxicity assay, 2×10 5 cells) were added to the upper chamber 12 hours before adding 2×10 4 U87MG cells were seeded into the lower chamber, and then FBS-free medium with 10 nM fMLS was added to the lower chamber. After incubating for 12 hours, the tumor cell viability was determined by flow cytometry analysis. In the secondary migration assay, 2×10 5 neutrophils from the bottom chamber of the primary migration were seeded into the upper chamber of the secondary Transwell BBB model, and the neutrophils migrating towards the target tumor cells in the bottom chamber were quantified.

[0200] As expected, CAR neutrophils loaded with R-SiO2-TPZ NPs exhibited excellent transmigration ability in the in vitro BBB model (Figure 6B), effectively killed targeted tumor cells after transmigration (Figure 6C), and released more inflammatory cytokines that could attract other effector cells to kill tumor cells (Figure 6D). CAR neutrophils loaded with R-SiO2-TPZ NPs retained excellent transmigration ability (Figure 6E) in the secondary migration experiment and excellent antitumor ability (Figure 6F) compared to other groups.

[0201] Next, a three-dimensional (3D) tumor spheroid model was used to evaluate the tumor-presenting ability of CAR neutrophils loaded with R-SiO2-TPZ NPs (Figure 6G). 3D tumor spheroids were generated by the hanging drop method. Briefly, U87MG cells were resuspended in 10% FBS and 0.3% methylcellulose at 2×10 6Suspended in minimum essential medium (MEM) at cells / mL, individual droplets were deposited onto the inverted lid of a 96-well plate using a 20 μL pipette. The cover lid was then replaced onto the PBS-filled bottom chamber, and the entire plate was incubated at 37 °C and 5% CO2. The hanging drops were monitored daily until cell aggregates were formed in 5 - 7 days. Each cell aggregate was transferred to a single well of a 24-well plate for subsequent experiments.

[0202] To assess the tumor infiltration ability of CLTX-CAR neutrophils, 2×10 5 Neutrophils / well were added to the wells of a 24-well plate and incubated with tumor spheroids. After 24 hours of co-incubation, the tumor spheroids were fixed and stained for CD45 and DAPI. For cytotoxicity analysis, both live / dead cell staining and the CytoTox-Glo™ Cytotoxicity Assay kit (Promega Corporation, Madison, WI) were used. The CytoTox-Glo™ Cytotoxicity Assay was quantified by a SpectraMax iD3 microplate reader (Molecular Devices, LLC, Sunnyvale, CA).

[0203] After 8 hours of incubation, CAR neutrophils gradually migrated towards the center of the tumor organoids and were uniformly distributed in the tumor organoids (Figure 6H). A high degree of co-localization was observed between CAR neutrophils and R-SiO2-TPZ NPs, demonstrating that R-SiO2-TPZ NPs were stably encapsulated by CAR neutrophils during tumor infiltration. Without neutrophil-mediated delivery, R-SiO2-TPZ NPs were only found in the outer layer of the tumor spheroids. Compared with R-SiO2-TPZ NPs and CAR neutrophils, CAR neutrophils loaded with R-SiO2-TPZ NPs exhibited excellent anti-tumor cell lysis in the 3D tumor model (Figure 6I). Using CAR neutrophils@R-SiO2 NPs, other drugs including clinical temozolomide (TMZ) and JNJ64619187 can also be delivered to the 3D tumor model to efficiently kill GBM cells (Figures 17A - 17C). In summary, the combination of CAR neutrophils and nanodrugs exhibited excellent anti-tumor activity under biomimetic TME mimicking conditions in vitro, highlighting the therapeutic potential of combinatorial neutrophil-based chemoimmunotherapy.

[0204] [Example 6] In Vitro Distribution of CAR Neutrophil-delivered R-SiO2-TPZ Nanoparticles In addition to the improvement in direct tumor killing activity, a hypothesis was proposed that CAR modification of hPSC neutrophils significantly enhances the targeted delivery of therapeutic drugs without additional surgery-induced or photo-induced inflammation. Osuka et al. (2017), supra. To test this hypothesis, the transport and in vivo distribution of CAR neutrophils loaded with R-SiO2-TPZ NPs were determined using a mouse xenograft model of glioblastoma and an in vitro imaging system. SiO2 NPs were fluorescently labeled with the near-infrared dye cyanine 5 (Cy5), and fluorescence imaging was performed 3 and 24 hours after systemic administration (Figure 7A). Only 3 hours after intravenous injection, R-SiO2-TPZ NPs migrated throughout the body of tumor-bearing mice and emitted strong fluorescence with or without neutrophil-mediated delivery (Figure 7B).

[0205] As expected, CAR neutrophil-delivered R-SiO2-TPZ NPs finally accumulated at the brain tumor site within 24 hours, while non-neutrophil-delivered R-SiO2-TPZ NPs still showed uniform distribution throughout the body (Figure 7B). To further quantify the biodistribution of R-SiO2-TPZ NPs in various organs, inductively coupled plasma optical emission spectroscopy (ICP-OES) analysis of Si content was performed on the organs harvested 24 hours after injection, confirming that CAR neutrophil-delivered R-SiO2-TPZ NPs were significantly concentrated in the mouse brain (Figure 7C), although minimal off-target delivery to the liver and spleen was observed. Targeted delivery of R-SiO2-TPZ NPs by CAR neutrophils across the BBB of the host brain was also confirmed by histological analysis (Figure 7D). In contrast, single R-SiO2-TPZ NPs mainly accumulated in the liver and spleen. In summary, the data demonstrated enhanced targeted delivery of R-SiO2-TPZ NPs by CAR neutrophils without inducing additional inflammation, highlighting the feasibility and safety of neutrophil-based chemoimmunotherapy in cancer treatment.

[0206] [Example 7] The combination chemoimmunotherapy of CAR neutrophils and R-SiO2-TPZ nanoparticles exhibited excellent anti-glioblastoma activity in vivo. To determine the therapeutic efficacy of CAR neutrophils loaded with R-SiO2-TPZ NPs, an orthotopic xenograft model of GBM was established in immunodeficient NOD.Cg-RAG 1tm1Mom IL2rg tm1Wjl / SzJ (NRG) mice. Figure 8A outlines the protocol for this study.

[0207] Briefly, an orthotopic xenograft model was constructed via intracranial injection of 5×10 5 luciferase-expressing GBM cells into the brains of immunodeficient mice. That is, 5×10 5Luciferase (Luci)-expressing U87MG cells were stereotactically implanted into the right frontal region of NRG mice. All mouse experiments were approved by the Purdue Institutional Animal Care and Use Committee (PACUC). Immunodeficient NOD.Cg-RAG1tm1MomIL2rgtm1Wjl / SzJ (NRG) mice were bred and maintained by the Biological Evaluation Core at the Purdue University Institute for Cancer Research. All female mice used in this study were 6-10 weeks old. Mice were housed in pathogen-free, ventilated cages with a 12-h light / dark cycle at room temperature of 21 ± 2 degrees and humidity of 45-65% and provided with autoclaved chow and water ad libitum.

[0208] 5 × 10 in tumor-bearing mice 6 Neutrophils were administered intravenously on days 4, 11, 18, and 25, and blood samples were collected from mice on days 5, 12, 19, and 26. Tumor burden was monitored by a bioluminescence imaging (BLI) system (Spectral Ami Optical Imaging System; Spectral Instruments Imaging, Tucson, AZ) (Figures 8B and 8C), and experimental mice were weighed once a week (Figure 8F). Collected blood cells were stained with CD45 and analyzed by an Accuri C6 plus flow cytometer (Beckton Dickinson & Company, Franklin Lakes, NJ). Blood samples were also subjected to enzyme-linked immunosorbent assay (ELISA) to measure human TNFα and IL-6 cytokine release (Invitrogen, Waltham, MA). At the end of treatment, tumors were collected for H&E staining. For in vivo biodistribution analysis, fluorescent images were captured by a Spectral Ami Optical Imaging System at 3 and 24 h after intravenous injection of Cy5 (Lumiprobe)-labeled neutrophils.

[0209] The endpoints of the experiment were defined as death, luciferase signal intensity higher than 109 a.u. in bioluminescence imaging, or the experience of neurological symptoms (i.e., inactivity, seizures, ataxia, and / or hydrocephalus). Mice bearing tumors exceeding 109 a.u. or experiencing neurological symptoms were euthanized.

[0210] The tumor burden was quantified in Figures 20B and 20C. Compared with PBS or PB neutrophil-treated mice, treatment with CAR neutrophils and CAR neutrophil R-SiO2-TPZ NPs exhibited considerably higher anti-tumor cytotoxicity than any other experimental group. In contrast, PB neutrophils significantly promoted tumor growth in the brain, leading to the death of tumor-bearing mice as early as day 23 (Figure 7D), suggesting that modified neutrophils may impose additional risks.

[0211] Compared with PBS or PB neutrophil-treated mice, treatment with R-SiO2-TPZ NPs, PB neutrophil@R-SiO2-TPZ NPs, CAR neutrophils, and CAR neutrophil@R-SiO2-TPZ NPs effectively slowed tumor growth in the host mice. As expected, CAR neutrophil@R-SiO2-TPZ NPs exhibited considerably higher anti-tumor cytotoxicity than any other experimental group. In contrast, PB neutrophils significantly promoted tumor growth in the host brain, leading to the death of tumor-bearing mice as early as day 23 (Figure 8D), suggesting that unmodified neutrophils may impose additional risks.

[0212] The release of human cytokines in the plasma of different experimental mouse groups was also measured (Figure 8E). All non-PBS experimental groups produced detectable TNFα and IL-6 in the plasma from day 5 to day 26, suggesting the activation of human neutrophils by tumor stimulation. Consistent with the observed high tumor growth rate, unmodified neutrophils gradually released more IL-6 and TNFα, which may cause cytokine release syndrome in patients and may require more thorough safety studies using IL-6 blockers. Morris et al., Cytokine release syndrome and associated neurotoxicity in cancer immunotherapy, Nature Reviews Immunology 22: 85-96 (2022); Liang et al., Neutrophils promote the malignant glioma phenotype through S100A4, Clinical Cancer Research 20: 187-198 (2014). Notably, CAR neutrophils@R-SiO2-TPZ NPs exhibited a decrease in cytokine-producing ability at later time points (days 19 and 26), suggesting a potential reduction in the risk of cytokine release syndrome in patients treated with CAR neutrophil-based chemoimmunotherapy.

[0213] The biocompatibility of the combination of CAR neutrophils and R-SiO2-TPZ NPs was evaluated by weekly measurement of mouse body weight and monitoring of pathological changes in major organs. No detectable difference in body weight was observed between CAR neutrophil@R-SiO2-TPZ NP-treated mice and any other experimental group, indicating minimal systemic toxicity and excellent biocompatibility of CAR neutrophil@R-SiO2-TPZ NPs within the range of 28-day treatment (Figure 8F).

[0214] Histological analysis of major organs thinly sliced from mice on day 30 showed that CAR neutrophil@R-SiO2-TPZ NP-treated mice did not develop recognizable abnormalities or significant organ damage in the heart, liver, spleen, lungs, and kidneys (Figure 18), further confirming the safety of the combination of CAR neutrophils and R-SiO2-TPZ NPs.

[0215] CAR neutrophil@R-SiO2-TPZ NPs significantly slowed tumor growth in xenograft mice, but the difference in animal survival rates among the experimental groups of CAR neutrophils, SiO2-TPZ NPs, and CAR neutrophil@R-SiO2-TPZ NPs was slight (p>0.05), probably due to the death of short-lived neutrophils during cell preparation and injection.

[0216] Next, we evaluated whether reducing the cell preparation time and increasing the dosage of CAR neutrophils and the nanodrug would produce any differences in the animals (focusing on these three groups) (Figure 20G). When administered systemically six times, CAR neutrophil@R-SiO2-TPZ NPs outperformed the other two groups in extending the survival period of tumor-bearing mice (Figure 20H), while the difference in animal survival rates between the CAR neutrophil and SiO2-TPZ NP groups remained slight. Similar survival curves for the R-SiO2-TPZ group were observed in these two independent animal studies, but the reduction in total time from approximately 4 hours to 1 hour in the isolation and preparation of cells for injection of the first 4 doses of neutrophils resulted in an improvement in animal survival rates in the CAR neutrophil group before day 32.

[0217] In summary, the data support the importance of optimizing neutrophil preparation and dosage in the clinical application of neutrophil therapeutics. See Chang et al., CAR-neutrophil mediated delivery of tumor-microenvironment responsive nanodrugs for glioblastoma chemo-immunotherapy, Nature Communications 14: 2266 (2023).

[0218] [Example 8] PSMA CAR neutrophils derived from hPSCs specifically recognize and kill prostate cancer cells. PSMA-CAR was designed as shown in Figure 19A and knocked into the endogenous AAVS1 safe harbor locus via Cas9-mediated homology-directed repair (HDR). PSMA-CAR consists of a signal peptide, anti-PSMA J591 scFV or nanobody, IgG4-Fc(EQ), CD4 transmembrane (tm), and CD3ζ (CD3z). Genotyping of CAR knock-in in hPSCs showed targeting efficiencies of 12 out of 13 clones and 13 out of 15 clones, respectively (Figure 19B). CAR neutrophils were co-cultured with U87MG GBM and LNCaP prostate cancer at the indicated cell ratios for 16 hours, and neutrophil cytotoxicity was calculated (Figure 19C). Anti-PSMA J591 CAR neutrophils were loaded with SiO2-TPZ nanodrugs for enhanced anti-tumor cytotoxicity and tested in an in vitro hypoxic tumor model (Figure 19D).

Claims

**Claim 1** Chimeric antigen receptor (CAR)-expressing neutrophils loaded with nanoparticles containing a drug. **Claim 2** The CAR-expressing neutrophils according to claim 1, which are differentiated from pluripotent stem cells (PSCs) modified to express the CAR. **Claim 3** The CAR-expressing neutrophils according to claim 1, wherein the PSCs are human PSCs (hPSCs). **Claim 4** The CAR-expressing neutrophils according to claim 2 or 3, wherein the hPSCs include human embryonic stem cells (hESCs) and / or induced pluripotent stem cells (iPSCs). **Claim 5** The CAR-expressing neutrophils according to claim 1, wherein the nanoparticles include one or more of rough silica nanoparticles, cytosine arabinoside-based liposomes, polyamidoamine dendrimer albumin nanoparticles, and / or fullerenes. **Claim 6** The CAR-expressing neutrophils according to claim 5, wherein the rough silica nanoparticles are biodegradable mesoporous organic silica. **Claim 7** The CAR-expressing neutrophils according to any one of claims 1 to 3, 5 or 6, wherein the drug is a prodrug, a chemotherapeutic agent, or a radiosensitizer. **Claim 8** The CAR-expressing neutrophils according to claim 1, wherein the drug is a prodrug activated by hypoxia, acidic pH, an enzyme, or irradiation. **Claim 9** The CAR-expressing neutrophils according to claim 1, wherein the drug is tirapazamine, temozolomide, climacostol, or indole-3-acetic acid. **Claim 10** The CAR-expressing neutrophils according to claim 1, wherein the drug is selected from the group consisting of everolimus, bevacizumab, belzutifan, carmustine, naxitamab-gqgk, and romustine. **Claim 11** The CAR-expressing neutrophils according to any one of claims 1 to 3, 5, 6 or 8 to 10, wherein the CAR includes a 36-amino acid glioblastoma (GBM) target chlorotoxin peptide, a CD32a transmembrane domain, and a CD3ζ intracellular domain. **Claim 12** The CAR-expressing neutrophils according to any one of claims 1 to 3, 5, 6 or 8 to 10, wherein the CAR includes a 36-amino acid GBM target chlorotoxin peptide, a CD4 transmembrane domain, and a CD3ζ intracellular domain. **Claim 13** The CAR-expressing neutrophil according to any one of claims 1 to 3, 5, 6, or 8 to 10, wherein the CAR comprises a neutrophil-specific transmembrane domain.

14. The CAR-expressing neutrophil according to any one of claims 1 to 3, 5, 6, or 8 to 10, wherein the CAR comprises any one of a 36-amino acid GBM-targeting chlorotoxin peptide, a CD32a transmembrane domain, or a CD16 transmembrane domain, and a CD3ζ intracellular signaling domain.

15. The CAR is a 36-amino acid GBM-targeting chlorotoxin peptide, any one of a CD32a transmembrane domain or a CD16 transmembrane domain, and any one of a CD32aγ intracellular signaling domain or a CD16 intracellular signaling domain The CAR-expressing neutrophil according to any one of claims 1 to 3, 5, 6, or 8 to 10, which comprises.

16. The CAR is a 36-amino acid GBM-targeting chlorotoxin peptide, any one of a CD32a transmembrane domain or a CD16 transmembrane domain, any one of a CD32aγ intracellular signaling domain or a CD16 intracellular signaling domain, a CD3ζ intracellular signaling domain The CAR-expressing neutrophil according to any one of claims 1 to 3, 5, 6, or 8 to 10, which comprises.

17. The CAR is a 36-amino acid GBM-targeting chlorotoxin peptide, a natural killer group 2D (NKG2D) transmembrane domain, a 2B4 co-stimulatory domain, and a CD3ζ intracellular signaling domain The CAR-expressing neutrophil according to any one of claims 1 to 3, 5, 6, or 8 to 10, which comprises.

18. The CAR is an IL-13 receptor α2 (IL-13Rα2)-targeted quadruple mutant IL-13 (TQM13) T-CAR, a GD2-targeted single-chain variable fragment (scFv), a human epidermal growth factor receptor 2 (HER2)-targeted scFv, a type VIII mutant epidermal growth factor receptor (EGFRvIII)-targeted scFv, or other glioma-targeted scFv, a CD4 transmembrane domain, and a CD3ζ intracellular signaling domain The CAR-expressing neutrophil according to any one of claims 1 to 3, 5, 6, or 8 to 10, which comprises.

19. The CAR-expressing neutrophil according to claim 1, wherein the neutrophil has an anti-tumor N1 phenotype.

20. The CAR-expressing neutrophil according to claim 18, wherein the neutrophil exhibits anti-glioblastoma activity in a hypoxic tumor microenvironment.

21. The CAR-expressing neutrophil according to claim 1, wherein the CAR is encoded by SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or a functional variant of SEQ ID NO: 2, 3, or 4.

22. A neutrophil-specific chimeric antigen receptor (CAR) construct comprising one or more sequences encoding a disease target peptide, a neutrophil-specific transmembrane domain, and an intracellular domain .

23. The neutrophil-specific CAR construct according to claim 22, wherein the neutrophil-specific transmembrane domain is CD32a.

24. The neutrophil-specific CAR construct according to claim 22, wherein the neutrophil-specific transmembrane domain is CD4.

25. The neutrophil-specific CAR construct according to claim 22, wherein the neutrophil-specific transmembrane domain is NKG2D, dectin 1, IL-6 receptor, or CD16.

26. The neutrophil-specific CAR construct according to claim 22, wherein the disease target peptide is the 36-amino acid GBM target chlorotoxin.

27. The neutrophil-specific CAR construct according to claim 22, wherein the intracellular domain is the CD3ζ signaling domain.

28. The neutrophil-specific CAR construct according to claim 22, wherein the intracellular domain is either the CD32aγ intracellular signaling domain or the CD16 intracellular signaling domain.

29. The neutrophil-specific CAR construct according to any one of claims 22 to 26 and 28, further comprising a sequence encoding the CD3ζ intracellular signaling domain.

30. The neutrophil-specific CAR construct according to any one of claims 22 to 26 and 28, wherein the construct further comprises one or more sequences encoding a 2B4 co-stimulatory domain, and the intracellular domain is the CD3ζ intracellular signaling domain.

31. The transmembrane domain is the CD4 transmembrane domain, the intracellular domain is the CD3ζ intracellular signaling domain, and the CAR further comprises one or more sequences encoding an IL-13 receptor α2 (IL-13Rα2)-targeted quadruple mutant IL-13 (TQM13) T-CAR, a GD2-targeted single-chain variable fragment (scFv), a human epidermal growth factor receptor 2 (HER2)-targeted scFv, a type VIII mutant epidermal growth factor receptor (EGFRvIII)-targeted scFv, or other glioma-targeted scFv. The neutrophil-specific CAR construct according to any one of claims 22, 24, and 26 to 28.

32. The neutrophil-specific CAR construct according to claim 22, comprising SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or a functional variant of SEQ ID NO: 2, 3, or 4.

33. A disease target peptide, a neutrophil-specific transmembrane domain, and an intracellular domain A modified neutrophil cell line comprising a CAR comprising.

34. The modified neutrophil cell line according to claim 33, wherein the neutrophil-specific transmembrane domain is CD32a.

35. The modified neutrophil cell line according to claim 33, wherein the disease target peptide is the 36-amino acid GBM target chlorotoxin.

36. The modified neutrophil cell line according to claim 33, wherein the neutrophil-specific transmembrane domain is the CD4 transmembrane domain.

37. The modified neutrophil cell line according to claim 33, wherein the transmembrane domain is NKG2D, dectin 1, the IL-6 receptor, or CD16.

38. The modified neutrophil cell line according to claim 33, wherein the neutrophil-specific transmembrane domain is the CD32a transmembrane domain or the CD16 transmembrane domain.

39. The modified neutrophil cell line according to any one of claims 33 to 38, wherein the intracellular domain is the CD3ζ intracellular signaling domain.

40. The modified neutrophil cell line according to any one of claims 33 to 38, wherein the intracellular domain comprises the CD32aγ intracellular signaling domain or the CD16 intracellular signaling domain.

41. The CAR is either the CD32a transmembrane domain or the CD16 transmembrane domain, and either the CD32aγ intracellular signaling domain or the CD16 intracellular signaling domain The modified neutrophil cell line according to claim 33, comprising.

42. The modified neutrophil cell line according to claim 33 or 41, wherein the CAR further comprises the CD3ζ intracellular signaling domain.

43. The modified neutrophil cell line according to any one of claims 33 to 38 or 41, wherein the CAR further comprises the 2B4 co-stimulatory domain.

44. The disease target peptide is the 36-amino acid GBM target chlorotoxin, the neutrophil-specific transmembrane domain is the CD4 transmembrane domain, the intracellular domain is a CD3ζ intracellular signaling domain, the CAR further comprises an IL-13 receptor α2 (IL-13Rα2)-targeted quadruple mutant IL-13 (TQM13) T-CAR, a GD2-targeted single-chain variable fragment (scFv), a human epidermal growth factor receptor 2 (HER2)-targeted scFv, a type VIII mutant epidermal growth factor receptor (EGFRvIII)-targeted scFv, or other glioma-targeted scFv, the modified neutrophil cell line according to claim 33.

45. Neutrophils from the chimeric antigen receptor (CAR)-expressing neutrophils according to any one of claims 1 to 21, or the modified neutrophil cell line according to any one of claims 33 to 44, and a pharmaceutically acceptable carrier and / or diluent to form a pharmaceutical composition.

46. The pharmaceutical composition according to claim 45, further comprising a pharmaceutically acceptable excipient.

47. Use of the chimeric antigen receptor (CAR)-expressing neutrophils according to any one of claims 1 to 21, the modified neutrophil cell line according to any one of claims 33 to 44, or the pharmaceutical composition according to claim 45 or 46 in the manufacture of a medicament for treating a disease of a subject.

48. The use according to claim 41, wherein the disease is cancer.

49. The use according to claim 41, wherein the disease is neuropathy.

50. A method for treating cancer in a subject, comprising: administering to the subject a primary treatment comprising a therapeutically effective amount of a population of CAR-expressing neutrophils according to any one of claims 1 to 21, a population of neutrophils from a modified neutrophil cell line according to any one of claims 33 to 44, or the pharmaceutical composition according to claim 45 or 46 such that the cancer of the subject is treated.

51. The method according to claim 50, wherein the cancer is brain cancer.

52. The method according to claim 51, wherein the brain cancer is glioblastoma.

53. The method according to claim 50, wherein the cancer is prostate cancer.

54.

55. The method according to any one of claims 50 to 53, wherein the administration of the primary treatment comprises a delivery route selected from the group consisting of intravenous, intraperitoneal, intramuscular, intradermal, subcutaneous, intrathecal, intraosseous, and any combination thereof.

56. The method according to claim 50, further comprising administering a secondary treatment to the subject.

57. The method according to claim 55, wherein the secondary treatment comprises surgical removal of cancerous cells from the subject.

57. The method according to claim 55, wherein the secondary treatment comprises chemotherapy, radiotherapy, or both.

58. The method according to any one of claims 50 to 57, further comprising imaging the subject's cancer before or during administration of the primary and / or secondary treatment.

59. The method according to claim 55, wherein the primary and secondary treatments are administered sequentially and / or alternately.

60. A method of delivering a therapeutic agent to a targeted location in a subject having a disease, comprising: administering to the subject a primary treatment comprising a therapeutically effective amount of a population of CAR-expressing neutrophils according to any one of claims 1 to 21, a population of neutrophils from a modified neutrophil cell line according to any one of claims 33 to 44, or a pharmaceutical composition according to claim 45 or 46, wherein the targeted location traverses the blood-brain barrier of the subject relative to the administration site.

61. The method according to claim 60, wherein the disease is brain cancer.

62. Use according to claim 61, wherein the disease is glioblastoma.

63. Use according to claim 60, wherein the disease is neuropathy.

64. The method according to claim 63, wherein the neuropathy is associated with protein aggregation of a protein having a tendency to aggregate.

65. The method according to claim 63, wherein the neuropathy is tauopathy.

66. The method according to claim 63, wherein the neuropathy is Alzheimer's disease or Parkinson's disease.

67. The method according to claim 60, further comprising administering a secondary treatment to the subject.

68. The method according to claim 67, wherein the secondary treatment comprises surgical removal of cancerous cells from the subject.

69. The method according to claim 67, wherein the secondary treatment comprises chemotherapy, radiotherapy, or both.

70. The method according to any one of claims 60 to 69, further comprising imaging the targeted location of the subject before or during administration of the primary and / or secondary treatment.

71. The method according to any one of claims 60 to 69, wherein the targeted location comprises brain tissue.

72. The method according to any one of claims 63 to 66, wherein the secondary treatment comprises a microtubule stabilizer.

73. ​ The method according to any one of claims 67 to 69, wherein the primary and secondary treatments are administered sequentially and / or alternately.