Transgene cassette

Abstract

A polynucleotide comprising at least one miR-124 target sequence, and / or at least one miR-338-3p target sequence, and / or at least one miR-31 target sequence, wherein the miRNA target sequence is operably linked to a transgene.

Description

Technical Field

[0001] The present invention relates to transgene cassettes and polynucleotides for the treatment of diseases or disorders. The polynucleotides of the present invention can promote cell-specific transgene expression for improved target specificity and safety.

Background Art

[0002] Gene therapy involves the incorporation of genetic material into cells to treat or prevent diseases. The genetic material can complement defective genes with functional copies of those genes, inactivate genes that function inappropriately, silence genes that may be associated with a disease state, or introduce new therapeutic genes into cells.

[0003] A limitation in gene therapy is the ability to selectively determine whether a transgene is expressed within the cells to which it is delivered. There is a continuing need for transgene expression cassettes that provide cell-type specific transgene expression in order to reduce off-target effects associated with transgene expression and thereby improve the specificity and safety of any such gene therapy.

Summary of the Invention

[0004] Herein, the inventors provide polynucleotides (e.g., transgene expression cassettes) that utilize miRNA target sequences to regulate transgene expression. The expression cassette allows transgene expression to be regulated, thereby reducing or eliminating unwanted expression, thereby improving safety and reducing off-target effects. The inventors have demonstrated the effectiveness of their approach using a wide range of transgenes such as GFP and epigenetic silencer factors (ESFs; genetically engineered oncogenic and cancer-related transcription factors that function as epigenetic repressors).

[0005] In a first aspect, there is provided a polynucleotide comprising at least one miR-124 target sequence and / or at least one miR-338-3p target sequence and / or at least one miR-31 target sequence, wherein the miRNA target sequence is operably linked to a transgene.

[0006] In one embodiment, the polynucleotide comprises at least one miR-124 target sequence, wherein the target sequence is operably linked to a transgene.

[0007] In one embodiment, the polynucleotide comprises at least one miR-338-3p target sequence, wherein the target sequence is operably linked to a transgene.

[0008] In one embodiment, the polynucleotide comprises at least one miR-31 target sequence, wherein the target sequence is operably linked to a transgene.

[0009] In one embodiment, the polynucleotide comprises at least one miR-124 target sequence and at least one miR-338-3p target sequence, wherein the target sequences are operably linked to a transgene.

[0010] In one embodiment, the polynucleotide comprises at least one miR-124 target sequence and at least one miR-31 target sequence, wherein the target sequences are operably linked to a transgene.

[0011] In one embodiment, the polynucleotide comprises at least one miR-338-3p target sequence and at least one miR-31 target sequence, wherein the target sequences are operably linked to a transgene.

[0012] In one embodiment, the polynucleotide comprises at least one miR-124 target sequence, at least one miR-338-3p target sequence, and at least one miR-31 target sequence, wherein the target sequences are operably linked to a transgene.

[0013] In one aspect, a polynucleotide is provided that includes at least one miR-124 target sequence, at least one miR-338-3p target sequence, and at least one miR-31 target sequence, wherein the miRNA target sequences are operably linked to a transgene.

[0014] In one embodiment, the copy number of each of the miRNA target sequences is independently selected from the group consisting of 1, 2, 3, and 4.

[0015] In one embodiment, the polynucleotide includes four miR-124 target sequences, four miR-338-3p target sequences, and four miR-31 target sequences, wherein the miRNA target sequences are operably linked to a transgene.

[0016] In one embodiment: (a) the miR-124 target sequence comprises or consists of a nucleotide sequence having at least 90% sequence identity, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 1; (b) the miR-338-3p target sequence comprises or consists of a nucleotide sequence having at least 90% sequence identity, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 2; and / or (c) the miR-31 target sequence comprises or consists of a nucleotide sequence having at least 90% sequence identity, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 3.

[0017] In one embodiment, the miR-124 target sequence comprises or consists of a nucleotide sequence having at least 90% sequence identity, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 1. In one embodiment, the miR-338-3p target sequence comprises or consists of a nucleotide sequence having at least 90% sequence identity, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 2. In one embodiment, the miR-31 target sequence comprises or consists of a nucleotide sequence having at least 90% sequence identity, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 3.

[0018] In one embodiment: (a) the miR-124 target sequence comprises or consists of a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 1; (b) the miR-338-3p target sequence comprises or consists of a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 2; and / or (c) the miR-31 target sequence comprises or consists of a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 3.

[0019] In one embodiment: (a) the miR-124 target sequence comprises or consists of a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 1; (b) the miR-338-3p target sequence comprises or consists of a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 2; and / or (c) the miR-31 target sequence comprises or consists of a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 3.

[0020] In one embodiment: (a) The miR-124 target sequence may comprise or consist of a nucleotide sequence having at least 99% sequence identity to SEQ ID NO: 1; (b) The miR-338-3p target sequence may comprise or consist of a nucleotide sequence having at least 99% sequence identity to SEQ ID NO: 2; and / or (c) The miR-31 target sequence may comprise or consist of a nucleotide sequence having at least 99% sequence identity to SEQ ID NO: 3.

[0021] In one embodiment: (a) The miR-124 target sequence may comprise or consist of a nucleotide sequence having 100% sequence identity to SEQ ID NO: 1; (b) The miR-338-3p target sequence may comprise or consist of a nucleotide sequence having 100% sequence identity to SEQ ID NO: 2; and / or (c) The miR-31 target sequence may comprise or consist of a nucleotide sequence having 100% sequence identity to SEQ ID NO: 3.

[0022] In one embodiment, the miRNA target sequence is downstream of the transgene, i.e., located 3'. In other words, the miRNA target sequence can be located after the transgene in the 5' to 3' direction.

[0023] In one embodiment, the miRNA target sequence is located within the 3'-UTR of the transgene.

[0024] In one embodiment, a cluster of miRNA target sequences or copies of miRNA target sequences is arranged in the order of miR-124 target sequence, miR-338-3p target sequence, and miR-31 target sequence from 5' to 3'. A cluster containing a target sequence or one or more copies thereof can be arranged, for example, from 5' to 3', thereby forming groups according to their target specificities. For example, in one embodiment, the polynucleotide contains 5'-[miR-124 target sequence]4-[miR-338-3p target sequence]4-[miR-31 target sequence]4-3'.

[0025] Both individual target sequences and clusters of target sequences can be contiguous with each other, separated by spacer sequences, or any combination thereof.

[0026] Thus, in one embodiment, miRNA target sequences are separated by spacer sequences.

[0027] In one embodiment, a polynucleotide is provided that contains a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 4. In one embodiment, the polynucleotide contains a nucleotide sequence having at least 90% sequence identity such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% to SEQ ID NO: 4.

[0028] In one embodiment, the miRNA target sequence contains the sequence as shown in SEQ ID NO: 4.

[0029] In one embodiment, the miRNA target sequence consists of the sequence as shown in SEQ ID NO: 4.

[0030] In one embodiment, the polynucleotide further contains a promoter. In one embodiment, the promoter is operably linked to the transgene.

[0031] In one embodiment, the promoter is a constitutive promoter. In some embodiments, the constitutive promoter is the Ef1a promoter.

[0032] In one embodiment, the promoter is a tissue-specific promoter, preferably a cancer cell-specific promoter.

[0033] In one embodiment, the promoter is a proliferating cell-specific promoter.

[0034] In one embodiment, the polynucleotide further comprises a promoter operably linked to the transgene, and optionally at this time, the promoter is a tissue-specific promoter or a constitutive promoter, optionally a cancer cell-specific promoter.

[0035] In one embodiment, the promoter is selected from the group consisting of the Mki67 promoter, Ccnd1 promoter, Ccnb2 promoter, Ccna2 promoter, Cdc25c promoter, Cdc2 promoter, Cks1 promoter, PCNA promoter, CDC6 promoter, POLD1 promoter, CSK1B promoter, MCM2 promoter and PLK1 promoter.

[0036] In one embodiment, the promoter is the Mki67 promoter.

[0037] In one embodiment, the promoter is the Ef1a promoter.

[0038] In one aspect, a vector comprising the polynucleotide according to the invention is provided.

[0039] In one embodiment, the vector is a viral vector.

[0040] In one embodiment, the vector is a lentiviral vector.

[0041] In one embodiment, the vector is an adeno-associated virus (AAV) vector.

[0042] In one embodiment, the AAV vector is of serotype 2, 5, or 9. In a preferred embodiment, the vector is an AAV2 vector. In another preferred embodiment, the vector is an AAV5 vector.

[0043] In one embodiment, the vector is an mRNA vector.

[0044] The order of the miRNA target sequences can vary. In one embodiment, a cluster of miRNA target sequences or copies of the sequences are arranged in the order of miR-124 target sequence, miR-338-3p target sequence, and miR-31 target sequence from 5' to 3'.

[0045] In one embodiment, a cluster of miRNA target sequences or copies of the sequences are arranged in the order of miR-124 target sequence, miR-31 target sequence, and miR-338-3p target sequence from 5' to 3'.

[0046] In another embodiment, a cluster of miRNA target sequences or copies of the sequences are arranged in the order of miR-338-3p target sequence, miR-124 target sequence, and miR-31 target sequence from 5' to 3'.

[0047] In another embodiment, a cluster of miRNA target sequences or copies of the sequences are arranged in the order of miR-338-3p target sequence, miR-31 target sequence, and miR-124 target sequence from 5' to 3'.

[0048] In another embodiment, a cluster of miRNA target sequences or copies of the sequences are arranged in the order of miR-31 target sequence, miR-124 target sequence, and miR-338-3p target sequence from 5' to 3'.

[0049] In another embodiment, the cluster of miRNA target sequences or copies of the sequences is arranged in the order of the miR-31 target sequence, the miR-338-3p target sequence, and the miR-124 target sequence from 5' to 3'.

[0050] Both individual target sequences and clusters of copies of the sequences can be continuous with each other, separated by spacer sequences, or any combination thereof.

[0051] Thus, in one embodiment, the miRNA target sequences are separated by a spacer sequence.

[0052] In one embodiment, a polynucleotide is provided that comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 4. In one embodiment, the polynucleotide comprises a sequence having at least 90% sequence identity to SEQ ID NO: 4, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.

[0053] In one aspect, nanoparticles are provided that comprise a polynucleotide or vector according to the present invention.

[0054] In one embodiment, the nanoparticles are polymeric nanoparticles, inorganic nanoparticles, or lipid nanoparticles. In some embodiments, the nanoparticles are liposomes.

[0055] In one aspect, cells are provided that comprise a polynucleotide, vector, or nanoparticle according to the present invention.

[0056] In one embodiment, the cells are eukaryotic cells such as mammalian cells. In another embodiment, the cells are human cells.

[0057] In one aspect, a composition is provided that comprises a polynucleotide, vector, nanoparticle, or cell according to the present invention.

[0058] The composition can be a hydrogel. In some embodiments, the hydrogel is a poly(ethylene glycol) dimethacrylate (PEG-DMA) hydrogel. In some embodiments, the hydrogel further comprises hydroxyapatite nanoparticles.

[0059] In one aspect, there is provided a pharmaceutical composition comprising a polynucleotide, vector, nanoparticle, or cell according to the present invention, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

[0060] In one aspect, there is provided a polynucleotide, vector, nanoparticle, cell, composition, or pharmaceutical composition according to the present invention for use in therapy.

[0061] In one aspect, there is provided a polynucleotide, vector, nanoparticle, cell, composition, or pharmaceutical composition according to the present invention for use in the treatment of a disease or disorder.

[0062] In one aspect, there is provided a polynucleotide, vector, nanoparticle, cell, composition, or pharmaceutical composition according to the present invention for use in the treatment of cancer.

[0063] In some embodiments, the polynucleotide, vector, cell or composition (e.g., hydrogel) is administered locally.

[0064] In another aspect, the present invention provides the use of a polynucleotide, vector, nanoparticle, cell, composition, or pharmaceutical composition according to the present invention for the manufacture of a medicament for therapy.

[0065] In another aspect, the present invention provides the use of a polynucleotide, vector, nanoparticle, cell, composition, or pharmaceutical composition according to the present invention for the manufacture of a medicament for the treatment of cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0066]

Figure 1

Figure 2

Figure 3a

Figure 3b

Figure 3c

Mode for Carrying Out the Invention

[0067] The terms "comprising," "including," and "consisting of," as used herein, are synonymous with "beginning with" or "including"; or "containing" or "containing," and are inclusive or open-ended and do not exclude additional unrecited members, elements, or steps. The terms "comprising," "including," and "consisting of" also include the term "consisting of."

[0068] When referring to a protein or polypeptide herein, the same may equally apply to the polynucleotide encoding it, and vice versa will be understood to be the case when relevant (i.e., when referring to the coding sequence within the polynucleotide).

[0069] It will be understood that any of the following aspects of the present invention can be suitably combined in the practice of the present invention herein.

[0070] Polynucleotides and Transgenes Cassettes Triplet miRNA Cassette As used herein, the inventors provide a transgene expression cassette containing a target sequence recognized by a microRNA (miRNA) for regulating transgene expression. The expression cassette enables the regulation of transgene expression, thereby reducing or eliminating unwanted expression in cell types containing the miRNA, thereby improving safety and reducing off-target effects.

[0071] In one aspect, a polynucleotide is provided that includes at least one miR-124 target sequence, at least one miR-338-3p target sequence, and at least one miR-31 target sequence, wherein the miRNA target sequences are operably linked to a transgene.

[0072] In one embodiment, the copy number of each of the miRNA target sequences is independently selected from the group consisting of one, two, three, and four.

[0073] In one embodiment, the copy number of each of the miRNA target sequences is one.

[0074] In one embodiment, the copy number of each of the miRNA target sequences is two.

[0075] In one embodiment, the copy number of each of the miRNA target sequences is three.

[0076] In one embodiment, the copy number of each of the miRNA target sequences is four.

[0077] In one embodiment, the copy number of each of the miRNA target sequences is more than four, such as five, six, seven, eight, nine, or ten.

[0078] A preferred miRNA target sequence for miR-124 is

Chemical formula

[0079] In one embodiment, the miRNA target sequence includes the sequence of SEQ ID NO: 1.

[0080] A preferred miRNA target sequence for miR-338-3p is

Chemical formula

[0081] In one embodiment, the miRNA target sequence comprises the sequence of SEQ ID NO: 2.

[0082] A preferred miRNA target sequence for miR-31 is

Chemical formula

[0083] In one embodiment, the miRNA target sequence comprises the sequence of SEQ ID NO: 3.

[0084] In one embodiment, the miRNA target sequence comprises SEQ ID NOs: 1, 2, and 3.

[0085] In one embodiment, the miRNA target sequence is located downstream of the transgene, i.e., at the 3'.

[0086] In one embodiment, the miRNA target sequence is located within the 3'-UTR of the transgene.

[0087] In one embodiment, a cluster of miRNA target sequences or copies of the sequence are arranged in the order of miR-124, miR-338-3p, and miR-31 from 5' to 3'.

[0088] According to the above-described embodiments, a cluster containing the target sequence or one or more copies thereof is arranged from 5' to 3', thereby forming groups according to their target specificities, i.e., 5'-[miR-124 target sequence]4-[miR-338-3p target sequence]4-[miR-31 target sequence]4-3'.

[0089] Both individual target sequences and clusters of copies of the sequence can be contiguous with each other, separated by spacer sequences, or any combination thereof.

[0090] Thus, in one embodiment, the miRNA target sequences are separated by spacer sequences.

[0091] In embodiments where the polynucleotide comprises four target sequences for each of miR-124, miR-338-3p, and miR-31, the polynucleotide can comprise the sequence as set forth in SEQ ID NO: 4.

[0092] Triple miRNA target sequence (Tmir) (SEQ ID NO: 4):

Chemical formula

[0093] In one embodiment, the polynucleotide comprises the sequence as set forth in SEQ ID NO: 4.

[0094] In one embodiment, the polynucleotide consists of the sequence as set forth in SEQ ID NO: 4.

[0095] The polynucleotides and transgene cassettes described herein can be used with any transgene.

[0096] MiR-124 may also be referred to as, for example, miRNA-124 or miR124; miR-338-3p may also be referred to as miR-338-3p or miRNA338-3p; and miR-31 may also be referred to as miRNA-31 or miR31.

[0097] The miRNA target sequence may be represented by one of multiple copies of a sequence of a given identity. The copy number of each target sequence can be independently selected, i.e., the copy number of a given sequence does not necessarily depend on the copy number of another different sequence.

[0098] Thus, in one embodiment, the miRNA target sequence comprises two or more copies of said miRNA target sequence.

[0099] In one embodiment, the miRNA target sequence comprises one copy of said miRNA target sequence.

[0100] In one embodiment, the miRNA target sequence comprises two copies of said miRNA target sequence.

[0101] In one embodiment, the miRNA target sequence comprises three copies of said miRNA target sequence.

[0102] In one embodiment, the miRNA target sequence comprises four copies of said miRNA target sequence.

[0103] In one embodiment, the miRNA target sequence comprises more than four copies, for example, five, six, seven, eight, nine, or ten copies of said miRNA target sequence.

[0104] In a preferred embodiment, the miRNA target sequence comprises four copies of the target sequences for miR-124, miR-338-3p, and miR-31, respectively.

[0105] The order of the miRNA target sequences can vary. In one embodiment, the miRNA target sequence or a cluster of copies of the sequence is arranged in the order of miR-124, miR-338-3p, and miR-31 from 5' to 3'.

[0106] In another embodiment, the miRNA target sequence or a cluster of copies of the sequence is arranged in the order of miR-124, miR-31, and miR-338-3p from 5' to 3'.

[0107] In another embodiment, the miRNA target sequence or a cluster of copies of the sequence is arranged in the order of miR-338-3p, miR-124, and miR-31 from 5' to 3'.

[0108] In another embodiment, the miRNA target sequence or a cluster of copies of the sequence is arranged in the order of miR-338-3p, miR-31, and miR-124 from 5' to 3'.

[0109] In another embodiment, the cluster of miRNA target sequences or copies of the sequences are arranged in the order of miR-31, miR-124, and miR-338-3p from 5' to 3'.

[0110] In another embodiment, the cluster of miRNA target sequences or copies of the sequences are arranged in the order of miR-31, miR-338-3p, and miR-124 from 5' to 3'.

[0111] Both individual target sequences and clusters of copies of the sequences can be contiguous with each other, separated by spacer sequences, or any combination thereof.

[0112] Thus, in one embodiment, miRNA target sequences are separated by spacer sequences.

[0113] In one embodiment, the polynucleotide comprises a sequence according to SEQ ID NO: 4.

[0114] Spacer As used herein, a "spacer" can be a sequence (e.g., a nucleotide or amino acid sequence) that can be used to separate other sequence elements within a relatively large polymer.

[0115] In one embodiment, one or more spacer sequences separate polynucleotide sequences (e.g., miRNA target sequences).

[0116] Individual miRNA target sequences or groups of miRNA target sequences can be separated by one or more spacer sequences. In one embodiment, miRNA target sequences are separated by one or more spacer sequences. The spacer sequence can comprise, for example, at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 20, or at least 30 nucleotide bases.

[0117] As a non-limiting example, in the following triple miRNA target sequences, the miRNA target sequences are separated from each other by sequences that cannot be considered as part of the miRNA target sequences. Such sequences can be considered as spacers separating functional sequence elements.

[0118] Triple miRNA target sequence (Tmir) (SEQ ID NO: 4):

Chemical formula

[0119] The spacer sequences within SEQ ID NO: 4 include (a) at; (b) cgatt; (c) gcatt; (d) tcact; (e) cgatcccggggtttaaaccgat (SEQ ID NO: 5); (f) cgat; (g) tcac; (h) cgatgtttaaaccctgcaggcgat (SEQ ID NO: 6); (i) cgatcctgcaggagatct (SEQ ID NO: 7).

[0120] In one embodiment, the spacer is selected from the group consisting of (a) - (i).

[0121] In one embodiment, the polynucleotide comprises one or more spacers selected from the group consisting of (a) - (i).

[0122] In one embodiment, the spacer sequences separating clusters of miRNA target sequences are longer than the spacer sequences separating miRNA target sequences within the cluster.

[0123] Transgene The polynucleotides according to the present invention can include any suitable transgene. Suitable transgenes can be operably linked to the miRNA target sequences according to the present invention, such that the expression of the transgene is dependent on the presence of the miRNA.

[0124] By "functionally linked", it should be understood that the individual components are linked together in a manner that allows them to perform their functions without substantial interference.

[0125] Expression control sequence The polynucleotide of the present invention can include one or more expression control sequences. Preferably, the transgene is functionally linked to one or more expression control sequences.

[0126] As used herein, an "expression control sequence" is any nucleotide sequence that controls the expression of a transgene, for example, to promote and / or increase expression in some cell types and / or to decrease expression in other cell types.

[0127] The expression control sequence and the transgene can be in any suitable arrangement in the polynucleotide, provided that the expression control sequence is functionally linked to the transgene.

[0128] Promoter In some embodiments, the expression control sequence is a promoter.

[0129] Any suitable promoter can be used, and the selection can be readily made by those skilled in the art. The promoter sequence can be constitutively active (i.e., operable in any host cell background) or alternatively, active only in a specific host cell environment and thus enable targeted expression of the transgene in a specific cell type (e.g., a tissue-specific promoter). The promoter can exhibit inducible expression in response to the presence of another factor, e.g., a factor present in the host cell. In any event where the vector is administered for therapy, the promoter should preferably be functional in the target cell background.

[0130] In some embodiments, the polynucleotide further includes a promoter functionally linked to the transgene.

[0131] In some embodiments, the promoter is a constitutive promoter. In some embodiments, the constitutive promoter is the Ef1a promoter.

[0132] An exemplary sequence of the Ef1a promoter is the following sequence:

Chemical formula

[0133] In some embodiments, the promoter is a tissue-specific promoter, preferably a cancer cell-specific promoter.

[0134] In some embodiments, the promoter is a proliferating cell-specific promoter.

[0135] In some embodiments, the promoter is selected from the group consisting of the Mki67 promoter, Ccnd1 promoter, Ccnb2 promoter, Ccna2 promoter, Cdc25c promoter, Cdc2 promoter, Cks1 promoter, PCNA promoter, CDC6 promoter, POLD1 promoter, CSK1B promoter, MCM2 promoter, and PLK1 promoter.

[0136] In some embodiments, the promoter is the Mki67 promoter.

[0137] An exemplary sequence of the Mki67 promoter is the following sequence:

Chemical formula

[0138] The promoter can comprise or consist of a nucleic acid sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NO: 8 or 9, and preferably, at this time, the promoter substantially retains the natural function of the promoter of SEQ ID NO: 8 or 9, respectively.

[0139] miRNA target sequence In some embodiments, the polynucleotide further comprises one or more miRNA target sequences. Preferably, the nucleic acid sequence encoding the transgene is operably linked to one or more miRNA target sequences.

[0140] MicroRNA (miRNA) genes are scattered across all human chromosomes except the Y chromosome. miRNAs can be located either in the non-coding regions of the genome or within the introns of protein-coding genes. Approximately 50% of miRNAs occur in clusters that are transcribed as polycistronic primary transcripts. Similar to protein-coding genes, miRNAs are usually transcribed from polymerase II promoters, yielding so-called primary miRNA transcripts (pri-miRNAs). These pri-miRNAs are subsequently processed through a series of endonuclease cleavage steps carried out by two enzymes belonging to the RNase III family, Drosha and Dicer. From the pri-miRNA, a stem-loop approximately 60 nucleotides in length, termed the miRNA precursor (pre-miRNA), is excised by a specific nuclear complex composed of Drosha and the DiGeorge syndrome critical region gene (DGCR8), which cleaves both strands near the base of the primary stem-loop, leaving a 5' phosphate and a 2-bp long 3' overhang. Subsequently, the pre-miRNA is actively transported from the nucleus to the cytoplasm by RAN-GTP and exportin. Subsequently, Dicer makes a double-strand cut at the end of the stem-loop not defined by Drosha cleavage, generating a 19-24 bp duplex, which is the mature miRNA and miRNA* It is composed of the opposite strands of the double-stranded molecule called * . According to the thermodynamic asymmetry rule, only one strand of the double-stranded molecule is selectively loaded into the RNA-induced silencing complex (RISC) and accumulates as a mature microRNA. This strand usually has a 5'-end that does not base pair as tightly with its complement, as demonstrated by a single nucleotide mismatch introduced at the 5'-end of each strand of the siRNA double-stranded molecule. However, some miRNAs assist in the accumulation of both double-stranded molecules to a similar extent.

[0141] MicroRNAs (miRNAs) induce RNA interference (RNAi), which is very similar to small interfering RNAs (siRNAs), a widely used tool for experimental gene knockdown. The main difference between miRNAs and siRNAs lies in their biogenesis. Once loaded into RISC, the guide strand of the small RNA molecule interacts with mRNA target sequences predominantly found in the 3'-untranslated region (3'UTR) of protein-coding genes. Nucleotides 2-8 from the 5'-end of the miRNA, so-called the seed sequence, have been shown to be essential for inducing RNAi. As is usually the case for siRNAs and plant miRNAs, when the entire guide strand sequence is perfectly complementary to the mRNA target, the mRNA is endonucleolytically cleaved by the Argonaute (Ago) protein, also known as the "slicer" of the small RNA double-stranded molecule, with the involvement of the RNA-induced silencing complex (RISC). DGCR8 (DiGeorge syndrome critical region gene 8) and TRBP (TAR (HIV) RNA-binding protein 2) are double-stranded RNA-binding proteins that promote the biogenesis of mature miRNAs by the Drosha and Dicer RNase III enzymes, respectively. The guide strand of the miRNA duplex is incorporated into the effector complex RISC, which recognizes specific targets through imperfect base pairing and induces post-transcriptional gene silencing. Several mechanisms have been proposed for this regulatory mode: miRNAs can induce the repression of translation initiation, mark target mRNAs for degradation by deadenylation, or sequester targets into cytoplasmic P-bodies.

[0142] On the one hand, when only the seed is completely complementary to the target mRNA but the remaining residues show imperfect pairing, RNAi acts through multiple mechanisms to bring about translational repression. Eukaryotic mRNA degradation occurs mainly via shortening of the polyA tail at the 3' end of the mRNA and decapping at the 5' end, followed by 5'-3' exonucleolytic digestion and accumulation of miRNAs in so-called P bodies, which are discrete cytoplasmic regions rich in components of the mRNA degradation pathway.

[0143] The expression of a nucleic acid sequence encoding a transgene can be regulated by one or more endogenous miRNAs using one or more corresponding miRNA target sequences. Using this method, one or more miRNAs endogenously expressed in a cell prevent or reduce transgene expression in that cell by binding to their corresponding miRNA target sequences located in a polynucleotide or vector.

[0144] The target sequence can be completely or partially complementary to the miRNA. As used herein, the term "completely complementary" can mean that the target sequence has a nucleic acid sequence that is 100% complementary to the sequence of the miRNA that recognizes it. As used herein, the term "partially complementary" can mean that the target sequence is only partially complementary to the sequence of the miRNA that recognizes it, such that the partially complementary sequence is still recognized by the miRNA. In other words, a partially complementary target sequence in the context of the present invention is effective in the recognition of the corresponding miRNA and the achievement of prevention or reduction of transgene expression in a cell expressing that miRNA. Preferably, a partially complementary miRNA target sequence can be completely complementary to the miRNA seed sequence.

[0145] Increasing the number of miRNA target sequences beyond one copy can enhance the effectiveness of the system. Also, different miRNA target sequences can be included. For example, a protein coding sequence can be operably linked to two or more miRNA target sequences, which can be different or identical. The miRNA target sequences can be in tandem, although other arrangements are envisioned. For example, a polynucleotide can contain 1, 2, 3, 4, 5, 6, 7, or 8 copies of the same or different miRNA target sequences. Preferably, the polynucleotide contains 4 copies of each miRNA target sequence.

[0146] Copies of the miRNA target sequences can be separated by spacer sequences. The spacer sequences can contain, for example, at least 1, at least 2, at least 3, at least 4, or at least 5 nucleotide bases.

[0147] One or more miRNA target sequences can, for example, suppress the expression of a transgene in non-cancer cells. This can, for example, increase the safety of a treatment targeting cancer cells. The expression of a transgene in cancer cells may not be suppressed by one or more miRNA target sequences.

[0148] One or more miRNA target sequences can suppress the expression of a transgene in one or more cell types other than cancer cells, such as neurons, astrocytes, and / or oligodendrocytes. In one embodiment, one or more miRNA target sequences suppress the expression of a transgene in neurons. In one embodiment, one or more miRNA target sequences suppress the expression of a transgene in astrocytes. In one embodiment, one or more miRNA target sequences suppress the expression of a transgene in oligodendrocytes.

[0149] As used herein, the term "suppress expression" can mean a reduction in the expression of a transgene in a relevant cell type in which one or more miRNA target sequences are functionally linked thereto, as compared to the transgene expression under substantially the same conditions except in the absence of one or more miRNA target sequences. In some embodiments, the transgene expression is suppressed by at least 50%. In some embodiments, the transgene expression is suppressed by at least 60%, 70%, 80%, 90% or 95%. In some embodiments, the transgene expression is substantially prevented.

[0150] Protein As used herein, the term "protein" includes single-chain polypeptide molecules as well as multi-polypeptide complexes in which the individual constituent polypeptides are linked by covalent or non-covalent means. As used herein, the terms "polypeptide" and "peptide" mean multimers in which the monomers are amino acids and are linked together via peptide bonds or disulfide bonds.

[0151] Polynucleotide The polynucleotides of the present invention can include DNA or RNA. The polynucleotide can be single-stranded or double-stranded. As a result of the degeneracy of the genetic code, those skilled in the art will understand that a number of different polynucleotides can encode the same polypeptide. In addition, those skilled in the art can make nucleotide substitutions that do not affect the polypeptide sequence encoded by the polynucleotides of the present invention in order to reflect the codon usage frequency of any particular host organism in which the polypeptides of the present invention are intended to be expressed, using conventional techniques.

[0152] The transgenes and coding sequences of the present invention, such as the sequences disclosed herein, can also include a stop codon, such as TGA, at the 3' end of the transgene or coding sequence.

[0153] The polynucleotide can be modified by any method available in the art. Such modifications can be made to enhance the in vivo activity or lifespan of the polynucleotides of the present invention.

[0154] Polynucleotides, such as DNA polynucleotides, can be produced recombinantly, synthetically, or by any means available to those skilled in the art. Polynucleotides can also be cloned by standard techniques.

[0155] Generally, relatively long polynucleotides will be produced using recombinant means, for example, using polymerase chain reaction (PCR) cloning techniques. This technique can include the steps of creating a pair of primers (e.g., about 15-30 nucleotides) adjacent to the target sequence to be cloned, contacting the primers with mRNA or cDNA obtained from animal or human cells, performing a polymerase chain reaction under conditions that result in amplification of the desired region, isolating the amplified fragment (e.g., by purifying the reaction mixture using an agarose gel), and recovering the amplified DNA. The primers can be designed to include suitable restriction enzyme recognition sites so that the amplified DNA can be cloned into a suitable vector.

[0156] Vector A vector is a tool that enables or facilitates the movement of an entity from one environment to another. According to the present invention, and by way of example, some vectors used in recombinant nucleic acid technology enable an entity such as a segment of nucleic acid (e.g., a heterologous DNA segment such as a heterologous cDNA segment) to move into a target cell. A vector can serve the purpose of maintaining a heterologous nucleic acid (DNA or RNA) within a cell, promoting the replication of a vector containing a segment of nucleic acid, or promoting the expression of a protein encoded by a segment of nucleic acid. A vector can be non-viral or viral. Examples of vectors used in recombinant nucleic acid technology include, but are not limited to, plasmids, mRNA molecules (e.g., in vitro transcribed mRNA), chromosomes, artificial chromosomes, and viruses. A vector can also be, for example, naked nucleic acid (e.g., DNA). In its simplest form, a vector can be the nucleotide itself that is of interest.

[0157] The vectors used in the present invention can be, for example, plasmids, mRNA, or viral vectors, and can include a promoter for the expression of a polynucleotide and optionally a regulator of the promoter.

[0158] Vectors containing the polynucleotides used in the present invention can be introduced into cells using various techniques known in the art such as transfection, transformation, and transduction. Several such techniques, for example, infection with recombinant viral vectors such as retroviruses, lentiviruses (e.g., integration-deficient lentiviruses), adenoviruses, adeno-associated viruses, baculoviruses, and herpes simplex virus vectors; direct injection of nucleic acid, and biolistic transformation are known in the art.

[0159] Non-viral delivery systems include, but are not limited to, DNA transfection methods. Here, transfection includes the process of using a non-viral vector to deliver a gene into a target cell. Typical transfection methods include electroporation, DNA biolistic method, lipid-mediated transfection, compressed DNA-mediated transfection, liposomes, immunoliposomes, lipofectins, cationic agent-mediated transfection, cationic facial amphiphiles (CFAs) (Nat. Biotechnol. (1996) 14: 556), and combinations thereof.

[0160] Transfection of cells using an mRNA vector can be achieved, for example, using nanoparticles such as liposomes.

[0161] In some embodiments, the vector (e.g., an mRNA vector) is contained within the nanoparticles. In some embodiments, the nanoparticles are polymeric nanoparticles, inorganic nanoparticles, or lipid nanoparticles. In some embodiments, the nanoparticles are liposomes.

[0162] The nanoparticles can be targeted to specific cell types (e.g., cancer cells) using one or more ligands presented on their surface.

[0163] Viral vector In a preferred embodiment, the vector is a viral vector. The viral vector can be in the form of viral vector particles.

[0164] The viral vector can be, for example, a retrovirus, a lentivirus, an adeno-associated virus (AAV), or an adenovirus vector.

[0165] In some embodiments, the vector is a lentiviral vector. In some embodiments, the vector is an AAV vector. In some embodiments, the vector is an AAV vector particle.

[0166] Retroviruses and Lentiviral Vectors Retroviral vectors can be derived from or can be derivable from any suitable retrovirus. A number of different retroviruses have been identified. Examples include murine leukemia virus (MLV), human T-cell leukemia virus (HTLV), murine mammary tumor virus (MMTV), Rous sarcoma virus (RSV), Fujinami sarcoma virus (FuSV), Moloney murine leukemia virus (Mo-MLV), FBR murine osteosarcoma virus (FBR MSV), Moloney murine sarcoma virus (Mo-MSV), Abelson murine leukemia virus (A-MLV), avian myelocytomatosis virus-29 (MC29), and avian erythroblastosis virus (AEV). A detailed list of retroviruses can be found in Coffin et al. (1997) Retroviruses, Cold Spring Harbour Laboratory Press, 758-63.

[0167] Retroviruses can be broadly classified into two categories, "simple" and "complex". Retroviruses can be further classified into seven groups. Five of these groups represent retroviruses with oncogenic potential. The remaining two groups are lentiviruses and spumaviruses. A review of these retroviruses is presented in Coffin et al. (1997) Retroviruses, Cold Spring Harbour Laboratory Press, 758-63.

[0168] The basic structures of retrovirus and lentivirus genomes share a number of common features such as the 5' LTR and 3' LTR. Between or within these are packaging signals that enable the genome to be packaged, primer binding sites, integration sites that enable integration into the host cell genome, and the gag, pol, and env genes that encode packaging components (which are polypeptides required for the assembly of virus particles). Lentiviruses have additional features such as the rev and RRE sequences in HIV that enable efficient export of the integrated proviral RNA transcripts from the nucleus of the infected target cell to the cytoplasm.

[0169] In the provirus, these genes are flanked at both ends by regions called long terminal repeats (LTRs). The LTRs are responsible for provirus integration and transcription. The LTRs also function as enhancer-promoter sequences and can control the expression of viral genes.

[0170] The LTR itself is the same sequence that can be divided into three elements: U3, R, and U5. U3 is derived from the sequence unique to the 3' end of the RNA. R is derived from the sequence repeated at both ends of the RNA. U5 is derived from the sequence unique to the 5' end of the RNA. The sizes of the three elements can vary significantly between different retroviruses.

[0171] In defective retroviral vector genomes, gag, pol, and env may be absent or non-functional.

[0172] In a typical retroviral vector, at least a portion of one or more protein-coding regions essential for replication can be removed from the virus. This renders the viral vector replication-defective.

[0173] Lentiviral vectors are part of a relatively large group of retroviral vectors. A detailed list of lentiviruses can be found in Coffin et al. (1997) Retroviruses, Cold Spring Harbour Laboratory Press, 758-63. Lentiviruses can be classified into primate and non-primate groups. Examples of primate lentiviruses include, but are not limited to, the human immunodeficiency virus (HIV), the causative agent of human acquired immunodeficiency syndrome (AIDS); and the simian immunodeficiency virus (SIV). Examples of non-primate lentiviruses include the prototype "slow virus" visna / maedi virus (VMV), as well as the closely related caprine arthritis encephalitis virus (CAEV), equine infectious anemia virus (EIAV), and more recently described feline immunodeficiency virus (FIV) and bovine immunodeficiency virus (BIV).

[0174] The lentivirus family differs from retroviruses in that lentiviruses have the ability to infect both dividing and non-dividing cells (Lewis et al. (1992) EMBO J. 11: 3053-8; Lewis et al. (1994) J. Virol. 68: 510-6). In contrast, other retroviruses such as MLV are unable to infect non-dividing or slowly dividing cells, such as those that make up muscle, brain, lung, and liver tissue, for example.

[0175] A lentiviral vector, as used herein, is a vector that contains at least one component derivable from a lentivirus. Preferably, the component is involved in the biological mechanism by which the vector infects cells, expresses genes, or is replicated.

[0176] The lentiviral vector can be a "primate" vector. The lentiviral vector can be a "non - primate" vector (i.e., derived from a virus that does not primarily infect primates, especially humans). Examples of non - primate lentiviruses can be any member of a family of the Lentiviridae that do not naturally infect primates.

[0177] Preferably, the viral vector used in the present invention has a minimal viral genome.

[0178] By "minimal viral genome", it should be understood that the viral vector has been engineered to remove non - essential elements and retain essential elements so as to provide the functionality required to infect, transduce, and deliver the nucleotide sequence of interest to the target host cell. Further details of this strategy can be found in WO 1998 / 017815.

[0179] Preferably, the plasmid vector used to generate the viral genome in the host cell / packaging cell will have sufficient lentiviral genetic information to allow packaging of the RNA genome into virus particles that can infect target cells in the presence of packaging components but are incapable of independent replication to produce infectious virus particles in the final target cell. Preferably, the vector lacks functional gag - pol and / or env genes and / or other genes essential for replication.

[0180] However, the plasmid vector used to generate the viral genome in the host cell / packaging cell will also include transcriptional regulatory control sequences operably linked to the lentiviral genome that direct transcription in the host cell / packaging cell. These regulatory sequences can be native sequences associated with the viral sequences to be transcribed (i.e., the 5' U3 region) or can be heterologous promoters such as another viral promoter (e.g., the CMV promoter).

[0181] The vector can be a self-inactivating (SIN) vector in which viral enhancer and promoter sequences are deleted. The SIN vector can be produced and transduced into non-dividing cells in vivo with efficacy similar to that of wild-type vectors. Transcriptional inactivation of the long terminal repeats (LTRs) in the SIN provirus should prevent mobilization by replication-competent viruses. This should also enable regulated expression of genes from internal promoters by removing any cis-acting effects of the LTRs.

[0182] The vector can be integration-deficient. Integration-deficient lentiviral vectors (IDLVs) can be produced, for example, by packaging vectors having a catalytically inactive integrase (such as HIV integrase carrying the D64V mutation in the catalytic site), by modifying or deleting the essential att sequences from the vector LTR, or by a combination of the above.

[0183] Adeno-associated virus (AAV) vector Adeno-associated virus (AAV) is an attractive vector system for use in the present invention because it has a high integration frequency. Furthermore, AAV can diffuse through brain tissue because of its small size and low binding to cell membranes.

[0184] AAV has a broad host range with respect to infectivity. Details regarding the production and use of AAV vectors are described in U.S. Patent Nos. 5,139,941 and 4,797,368.

[0185] Recombinant AAV vectors have been successfully used for in vitro and in vivo transduction of marker genes and genes involved in human diseases.

[0186] In some embodiments, the vector is an AAV2 vector. In some embodiments, the vector is an AAV5 vector.

[0187] In some embodiments, the vector is an AAV9 vector.

[0188] The viral vector can be a modified or mutant viral vector. Such a vector can be a vector modified to possess certain desirable characteristics. For example, the AAV2 vector HBKO (or AAV2-HBKO) is a modified AAV2 that cannot bind to the heparan sulfate proteoglycan receptor (Naidoo et al. (2018) Mol Ther 26: 2418-2430).

[0189] In one embodiment, the vector is a modified AAV2 vector.

[0190] In one embodiment, the vector is an AAV2-HBKO vector.

[0191] The modified viral vector can include, for example, a protein that confers altered cell tropism, as has been described, for example, in International Publication Nos. 2021155137 and 2015168666.

[0192] In one embodiment, the vector is a modified AAV5 vector.

[0193] In one embodiment, the vector includes a capsid having one or more mutations at one or more positions in one or more capsid proteins.

[0194] In one embodiment, the vector includes a capsid having one or more mutations in VP1.

[0195] In one embodiment, the vector is an AAV vector, preferably an AAV5 vector, comprising a capsid protein (e.g., VP1 protein) comprising (a) G at the position corresponding to amino acid 194; (b) R at the position corresponding to amino acid 474; (c) R at the position corresponding to amino acid 564; and / or (d) R at the position corresponding to amino acid 573, wherein the amino acids are numbered with reference to VP1 of AAV5.

[0196] Variants, derivatives, analogs, homologs, and fragments In addition to the specific proteins and polynucleotides referred to herein, the invention also encompasses the use of their variants, derivatives, analogs, homologs, and fragments.

[0197] In the context of the present invention, a variant of any given sequence is a sequence in which the specific sequence of residues (whether amino acid residues or nucleic acid residues) has been modified in such a way that the polypeptide or polynucleotide in question substantially retains at least one of its endogenous functions. Variant sequences can be obtained by addition, deletion, substitution, modification, replacement, and / or alteration of at least one residue present in a naturally occurring protein.

[0198] As used herein with respect to a protein or polypeptide of the present invention, the term "derivative" includes any substitution, change, modification, replacement, deletion, and / or addition of one or more amino acid residues from or to a sequence, provided that the resulting protein or polypeptide substantially retains at least one of its endogenous functions.

[0199] As used herein with respect to a polypeptide or polynucleotide, the term "analog" includes any mimetic, i.e., a compound, that possesses at least one of the endogenous functions of the polypeptide or polynucleotide that it mimics.

[0200] Typically, amino acid substitutions can be made, for example, from 1, 2, or 3 to 10 or 20 substitutions, provided that the activity or ability that requires the modified array is substantially retained. Amino acid substitutions can include the use of non-naturally occurring analogs.

[0201] The proteins used in the present invention can also have deletions, insertions, or substitutions of amino acid residues that result in silent changes and yield functionally equivalent proteins. Intentional amino acid substitutions can be made based on the similarity of the residues in polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathicity, as long as the endogenous function is retained. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; amino acids with uncharged polar head groups having similar hydrophilicity values include asparagine, glutamine, serine, threonine, and tyrosine.

[0202] Conservative substitutions can be made, for example, according to the following table. Amino acids within the same block in the second column and preferably within the same row in the third column can be substituted for each other:

[0203]

Table 1

[0204] As used herein, the term "homolog" means an entity having a certain homology to a wild-type amino acid sequence or a wild-type nucleotide sequence. The term "homology" can be regarded as the same as "identity".

[0205] Examples of homologous sequences include amino acid sequences that can be at least 50%, 55%, 65%, 75%, 85% or 90% identical, preferably at least 95% or 97% or 99% identical, to the target sequence. Typically, a homolog will contain the same active site etc. as the target amino acid sequence. Homology can also be considered in terms of similarity (i.e., amino acid residues having similar chemical properties / functions), but in the context of the present invention, it is preferred to express homology in terms of sequence identity.

[0206] Examples of homologous sequences include nucleotide sequences that can be at least 50%, 55%, 65%, 75%, 85% or 90% identical, preferably at least 95% or 97% or 99% identical, to the target sequence. Homology can also be considered in terms of similarity, but in the context of the present invention, it is preferred to express homology in terms of sequence identity.

[0207] Preferably, reference to a sequence having percent identity to any one of the SEQ ID NOs. disclosed herein means a sequence having the recited percent identity over the full length of the referenced SEQ ID NO.

[0208] Homology comparisons can be made visually or, more usually, using readily available sequence comparison programs. These commercially available computer programs can calculate the percent homology or identity between two or more sequences.

[0209] Percent homology can be calculated over contiguous sequences, i.e., one sequence is aligned with the other and each amino acid in one sequence is directly compared with the corresponding amino acid in the other sequence, one residue at a time. This is referred to as "gapless" alignment. Typically, such gapless alignment is performed only over relatively short numbers of residues.

[0210] This is a very simple and consistent method, but for example, in pairs of otherwise identical sequences, an insertion or deletion at one position in the nucleotide sequence may shift subsequent codons out of alignment, and thus, when a comprehensive alignment is performed, it is not possible to take into account that this can result in a significant reduction in percent homology. As a result, most sequence comparison methods are designed to generate an optimal alignment that takes into account possible insertions and deletions without unduly penalizing the overall homology score. This is achieved by inserting "gaps" into the sequence alignment in an attempt to maximize local homology.

[0211] However, these more complex methods assign a "gap penalty" to each gap that occurs in the alignment such that, for the same number of identical amino acids, a sequence alignment with as few gaps as possible, reflecting a higher relatedness between the two sequences being compared, will achieve a higher score than one with a large number of gaps. An "affine gap cost" is typically used that imposes a relatively high cost for the presence of a gap and a relatively small penalty for each subsequent residue in the gap. This is the most commonly used gap scoring system. Naturally, a high gap penalty will result in an optimized alignment with fewer gaps. Most alignment programs allow the modification of the gap penalty. However, when using such software for sequence comparison, it is preferable to use the default values. For example, when using the GCG Wisconsin Bestfit package, the default gap penalties for amino acid sequences are -12 for the gap and -4 for each extension.

[0212] Therefore, calculation of the maximum percent identity requires first generating an optimal alignment that takes into account a gap penalty. A suitable computer program for performing such an alignment is the GCG Wisconsin Bestfit package (University of Wisconsin, U.S.A.; Devereux et al. (1984) Nucleic Acids Res. 12: 387). Examples of other software capable of performing sequence comparisons include, but are not limited to, the BLAST package, FASTA (Atschul et al. (1990) J. Mol. Biol. 403-410) and the GENEWORKS suite of comparison tools. Both BLAST and FASTA are available for both offline and online searches. However, for some applications, it is preferred to use the GCG Bestfit program. Another tool, called BLAST 2 Sequences, is also available for comparing protein and nucleotide sequences (see FEMS Microbiol. Lett. (1999) 174: 247-50; FEMS Microbiol. Lett. (1999) 177: 187-8).

[0213] The final percent identity can be measured with respect to identity, but the alignment process itself typically does not rely on all-or-nothing pair comparisons. Instead, an extended similarity score matrix that assigns scores to each pairwise comparison based on chemical similarity or evolutionary distance is generally used. An example of such a commonly used matrix is the BLOSUM62 matrix, which is the default matrix for the BLAST suite of programs. The GCG Wisconsin program generally uses either the published default values or, if supplied, a custom symbol comparison table (see the user manual for further details). For some applications, it is preferred to use the published default values for the GCG package or, in the case of other software, a default matrix such as BLOSUM62.

[0214] Once the software has created an optimal alignment, it is possible to calculate the percent homology, preferably percent sequence identity. The software typically does this as part of the sequence comparison and generates a numerical result.

[0215] A "fragment" is also a variant, and this term typically refers to a selected region of a polypeptide or polynucleotide of interest, functionally or, for example, in an assay. Thus, a "fragment" refers to an amino acid or nucleic acid sequence that is a portion of a full-length polypeptide or polynucleotide.

[0216] Such variants can be made using standard recombinant DNA techniques such as site-directed mutagenesis. When making an insertion, synthetic DNA encoding the insertion can be made along with the 5' and 3' flanking regions corresponding to the naturally occurring sequences on either side of the insertion site. The flanking regions contain convenient restriction sites corresponding to sites in the naturally occurring sequences, such that the sequences can be cut with appropriate enzymes and the synthetic DNA can be ligated into the cut sites. Subsequently, the DNA is expressed according to the invention and the encoded protein is produced. These methods are merely illustrative of the numerous standard techniques known in the art for the manipulation of DNA sequences, and other known techniques can also be used.

[0217] Codon optimization The polynucleotides used in the present invention can be codon-optimized. Codon optimization has been previously described in WO 1999 / 41397 and WO 2001 / 79518. Different cells vary in their usage frequency of specific codons. This codon bias corresponds to the bias in the relative abundance of specific tRNAs in the cell type. By changing the codons in a sequence and thus engineering them to match the relative abundance of the corresponding tRNAs, it is possible to increase expression. Similarly, by deliberately selecting codons known to have rare corresponding tRNAs in a particular cell type, it is possible to decrease expression. Thus, an additional level of translational control is available.

[0218] Compositions The polynucleotides, proteins, vectors, nanoparticles and cells of the present invention can be formulated for administration to a subject together with a pharmaceutically acceptable carrier, diluent or excipient. Suitable carriers and diluents include isotonic saline solutions, such as phosphate buffered saline, which may contain human serum albumin.

[0219] The materials used to formulate the pharmaceutical composition should be non-toxic and should not interfere with the effectiveness of the active ingredient. The exact nature of the carrier or other materials can be determined by those skilled in the art according to the route of administration.

[0220] The pharmaceutical composition is typically in liquid form. Liquid pharmaceutical compositions generally contain a liquid carrier such as water, petroleum, animal or vegetable oils, mineral oil or synthetic oils. It can include physiological saline solutions, magnesium chloride, dextrose or other sugar solutions, or glycols such as ethylene glycol, propylene glycol or polyethylene glycol. In some cases, surfactants such as 0.001% Pluronic® acid (PF68) can be used. In some cases, serum albumin can be used in the composition.

[0221] For injection, the active ingredient can be in the form of an aqueous solution that is pyrogen-free and has a suitable pH, isotonicity and stability. Those skilled in the art can successfully prepare a suitable solution using an isotonic vehicle such as, for example, sodium chloride injection, Ringer's injection or lactated Ringer's injection. If necessary, preservatives, stabilizers, buffers, antioxidants and / or other additives can be included.

[0222] With respect to delayed release, the medicament can be included in a pharmaceutical composition formulated for sustained release according to methods known in the art, for example, in microcapsules formed from a biocompatible polymer or in a liposome carrier system.

[0223] The handling of cell therapy products is preferably carried out in accordance with the FACT-JACIE international standards for cell therapy.

[0224] Treatment method In one aspect, the present invention provides the polynucleotides, vectors, nanoparticles, cells, compositions or pharmaceutical compositions of the present invention for use in therapy.

[0225] In another aspect, the invention provides the polynucleotides, vectors, cells or compositions of the invention for use in the treatment of cancer.

[0226] All references herein to treatment include curative, palliative and prophylactic treatment. Treatment of mammals, particularly humans, is preferred. Both human treatment and veterinary treatment fall within the scope of the invention.

[0227] In some embodiments, the treatment method comprises providing to a tumor the polynucleotide, vector, nanoparticle, cell, composition or pharmaceutical composition of the invention.

[0228] In some embodiments, the treatment method comprises providing to the brain of a subject the polynucleotide, vector, nanoparticle, cell, composition or pharmaceutical composition of the invention.

[0229] Administration In some embodiments, the polynucleotide, vector, nanoparticle, cell, composition or pharmaceutical composition is administered locally to the subject.

[0230] In some embodiments, the polynucleotide, vector, nanoparticle, cell, composition or pharmaceutical composition is administered to the brain of the subject.

[0231] In preferred embodiments, the polynucleotide, vector, nanoparticle, cell, composition or pharmaceutical composition is administered to a tumor.

[0232] In some embodiments, the polynucleotide, vector, nanoparticle, cell, composition or pharmaceutical composition is administered systemically to the subject, for example, intravenously.

[0233] In some embodiments, the polynucleotide, vector, nanoparticle, cell, composition or pharmaceutical composition is administered locally to the subject.

[0234] As used herein, the terms "systemic delivery" or "systemic administration" mean that the agent of the present invention is administered into the circulatory system, for example, to achieve a broad distribution of the agent. In contrast, local or regional administration confines the delivery of the agent to a limited area, such as a tumor.

[0235] Dosage One of ordinary skill in the art can readily determine the appropriate dosage of the agent of the present invention for administration to a subject. Typically, a physician will determine the actual dosage most suitable for an individual patient, and the actual dosage will depend on various factors including the activity of the specific compound utilized, the metabolic stability and length of action of that compound, age, body weight, general health status, sex, diet, mode and time of administration, rate of excretion, drug combination, severity of the particular condition, as well as the individual ongoing therapy. Of course, there may be individual instances where higher or lower dosage ranges are appropriate, and such instances are within the scope of the present invention.

[0236] Subject As used herein, the term "subject" means either a human or a non-human animal.

[0237] Examples of non-human animals include vertebrates, such as mammals, such as non-human primates (especially higher primates), dogs, rodents (e.g., mice, rats or guinea pigs), pigs and cats. Non-human animals can be companion animals.

[0238] Preferably, the subject is a human.

[0239] One of ordinary skill in the art will understand that all features of the present invention disclosed herein can be combined without departing from the scope of the present invention as disclosed.

[0240] Preferred features and embodiments of the present invention are now described by way of non-limiting examples.

[0241] The practice of the present invention, unless otherwise indicated, will employ conventional techniques of chemistry, biochemistry, molecular biology, microbiology, and immunology, which are within the capabilities of those of ordinary skill in the art. Such techniques are explained in the literature. See, for example, Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press; Ausubel, F.M. et al. (1995 and periodic supplements) Current Protocols in Molecular Biology, Ch. 9, 13 and 16, John Wiley & Sons; Roe, B., Crabtree, J. and Kahn, A. (1996) DNA Isolation and Sequencing: Essential Techniques, John Wiley & Sons; Polak, J.M. and McGee, J.O'D. (1990) In Situ Hybridization: Principles and Practice, Oxford University Press; Gait, M.J. (1984) Oligonucleotide Synthesis: A Practical Approach, IRL Press; and Lilley, D.M. and Dahlberg, J.E. (1992) Methods in Enzymology: DNA Structures Part A: Synthesis and Physical Analysis of DNA, Academic Press. Each of these general textbooks is hereby incorporated by reference into this specification.

[0242] All publications mentioned in the above specification are hereby incorporated by reference into this specification. Various modifications and variations of the disclosed polypeptides, polynucleotides, vectors, cells, compositions, uses, and methods of the present invention will be apparent to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been disclosed in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the disclosed modes for carrying out the invention which are obvious to those skilled in the art are intended to fall within the scope of the following claims.

Example

[0243] Example 1 Materials and Methods The triple miRNA target sequence (Tmir) is shown below as SEQ ID NO: 4:

Chemical Formula

[0244] Cell Culture U-251 cells were cultured in DMEM medium (Dulbecco's Modified Eagle Medium - high glucose, Sigma-Aldrich) containing 10% fetal bovine serum (FBS, Sigma-Aldrich), 1% Pen / Strep (Sigma-Aldrich), 2 mM glutamine (Sigma-Aldrich), 1% non-essential amino acids (MEM NEAA, ThermoFisher Scientific), 1% sodium pyruvate solution (Sigma-Aldrich) under plastic adherent conditions and passaged twice a week using trypsin-EDTA solution (Sigma-Aldrich).

[0245] Cancer stem cell (CSC) glioblastoma tumors were maintained under plastic-adherent conditions in DMEM / F12 (Sigma-Aldrich) supplemented with Hormone Mix (DMEM / F12, 0.6% glucose (Sigma-Aldrich) (30% in phosphate-buffered saline (PBS) (Euroclone)), insulin (Sigma-Aldrich) 250 μg / mL, putrescine powder (Sigma-Aldrich) 97 μg / mL, apotransferrin powder (Sigma-Aldrich), sodium selenite 0.3 μM, progesterone 0.2 μM), 1% Pen / Strept, 2 mM glutamine, 0.66% glucose (30% in phosphate-buffered saline (PBS) (Euroclone)), and heparin (4 mg / mL, Sigma-Aldrich); bFGF (20 ng / mL, ThermoFisher Scientific) and EGF (20 ng / mL, ThermoFisher Scientific) were freshly added to the culture medium.

[0246] All cultures were maintained in a humidified atmosphere of 5% CO2 at 37 °C under atmospheric oxygen conditions.

[0247] Immunostaining Cells were seeded onto cover glasses and fixed on ice for 20 minutes in a 4% paraformaldehyde (PFA, Sigma) solution in phosphate-buffered saline (PBS, Euroclone). Subsequently, they were washed twice with PBS, permeabilized for 30 minutes in a blocking solution containing 0.2% Triton X-100 (Sigma Aldrich) and 5% donkey serum (Euroclone), and incubated overnight at 4 °C with the primary antibodies diluted in the blocking solution. The primary antibodies used were as follows: anti-V5 (mouse, 1:500, Thermo Fisher Scientific, R96025), anti-GFP (chicken, 1:1000, Thermo Fisher Scientific, A10262), and anti-MAP2 (chicken, 1:1000, Abcam, ab92434). The next day, the cells were washed three times with PBS for 5 minutes each, and incubated at room temperature for 1 hour in the blocking solution with Hoechst 33342 (Thermo Fischer Scientific) and with the secondary antibodies (Thermo Fisher Scientific). Finally, the slides were washed and mounted in a fluorescence mounting medium (Dako Cytomation). Images were acquired using an epifluorescence microscope Nikon DS-Qi2 and analyzed using Fiji software.

[0248] AAV production and infection Recombinant virus particles without replication ability were generated in 293T cells by polyethyleneimine (PEI) (Polyscience) co-transfection of the following three different plasmids: a transgene-containing plasmid, a packaging plasmid for the rep and cap genes, and pHelper (Agilent) for three adenovirus helper genes. Cells and supernatant were harvested at 120 h. Cells were lysed in a hypertonic buffer (40 mM Tris, 500 mM NaCl, 2 mM MgCl2, pH = 8) containing 100 U / mL salt-active nuclease (SAN, Arcticzymes) at 37 °C for 1 h, and virus particles present in the supernatant were concentrated by precipitation using 8% PEG8000 (polyethylene glycol 8000, Sigma-Aldrich), followed by addition to the supernatant for further incubation at 37 °C for 30 min. Cell debris was separated by centrifugation (4000 g, 30 min) to clarify the lysate. The virus phase in the 40% fraction was isolated by an iodixanol step gradient (15%, 25%, 40%, 60% Optiprep, Sigma-Aldrich) and concentrated in PBS (phosphate-buffered saline) using a 100K cut-off concentrator (Amicon Ultra15, MERCK-Millipore). Virus titers were determined using the AAVpro titer measurement kit Ver2 (TaKaRa).

[0249] 2.5×10 4 CSC L0627 cells (2.5×10 4 per well) were infected with an adenovirus vector expressing GFP (5 μL / well) and seeded onto coverslips pre-coated with Matrigel in a 24-well plate. Four days later, the cells were fixed and used for immunostaining studies.

[0250] Results The inventors, for example, devised a strategy to restrict transgene expression to specific cells after viral inoculation of the brain. The strategy is based on a microRNA (miRNA) off-targeting system, which enables silencing of the transgene by inclusion of the binding / target site (TS) of an miRNA that is endogenously expressed in specific cell types where expression is not desired. For this purpose, cassettes were generated in which the 3'-UTR downstream of the transgene contained a cluster of 4×TS for each of miRNA-124, -338-3p, and -31, which are specifically expressed in neurons, astrocytes, and oligodendrocytes, respectively. Thus, exogenous transgene expression, e.g., GFP expression as demonstrated in Fig. 1, should be silenced in all of the above cell types through miRNA-dependent post-transcriptional silencing and blockade of protein translation (Fig. 1a). It should be noted that miRNA-124, -338-3p, and -31 are not expressed in GBM, as demonstrated by GFP-Tmir lentivirus (LV) that showed transgene expression not affected in cancer cells (Fig. 1b).

[0251] It may be desirable to use a transgene together with a delivery system that allows easy and extensive distribution of the vector across brain regions that may contain residual tumor cells after surgery. This would reduce the likelihood of tumor recurrence, which is a significant problem in GBM. For this purpose, the inventors tested the use of adeno-associated virus (AAV) as a shuttle vector. Recombinant serotypes 2 and 5 showed better performance regarding transgene delivery compared to serotype 9 when evaluated by GFP expression in patient-derived cancer stem cells (Fig. 2).

[0252] Discussion The inventors herein demonstrate that by using miRNA target sequences within the 3'UTR, the expression of exogenous genes can be de-targeted from healthy brain cells, such as neurons, astrocytes, and oligodendrocytes, and thus safety and specificity can be improved. By utilizing target sequences of miRNAs that are highly expressed in brain cells but not in tumor cells, the inventors provide polynucleotides and transgene expression cassettes with high specificity, for example, for use as an anti-GBM therapy.

[0253] The inventors also provide herein alternative therapeutic viruses that can be similarly used to the lentivirus. A viral strain of adeno-associated virus (AAV) that can diffuse through brain tissue due to its small size and exhibits low binding to cell membranes is particularly useful. By maximizing viral diffusion in the brain parenchyma, the targeting efficiency of scattered cancer cells in the tissue will increase and better protection against tumor recurrence will be provided. Here, the inventors demonstrate that AAV2 can diffuse in the brain parenchyma when directly injected into the organ and can infect GBM CSCs with high efficiency in vitro.

[0254] Example 2 The inventors further demonstrated their de-targeting approach using an epigenetic silencer factor (ESF) transgene. ESF is a genetically engineered oncogenic and cancer-related transcription factor that functions as an epigenetic repressor.

[0255] ESF should have no detectable harmful effects on healthy brain cells that do not express the target cancer gene and are not proliferating cells. In such healthy cells, a decrease in some important cell cycle genes induced by ESF can be harmful to the cells. However, ESF-dependent chromatin changes can potentially alter nerve performance in vivo over a relatively long period, for example, when used for treatment in humans. Therefore, the inventors devised an applied off-targeting strategy that restricts ESF expression to cancer cells after viral inoculation of the brain. For this purpose, a cassette was created in which the 3'-UTR downstream of a transgene, for example, ESF cDNA, contained a cluster of 4×TS for each of miRNA-124, -338-3p, and -31.

[0256] SES-Tmir (SEQ ID NO: 10):

Chemical formula

[0257] Therefore, exogenous transgene expression, such as SES (e.g., ESF) expression as demonstrated in Figure 3, should be silenced in all of the above cell types through miRNA-dependent post-transcriptional silencing and blocking of protein translation (Figure 3a). It should be noted that, as demonstrated by GFP-Tmir and SES-Tmir lentiviruses (LVs) that showed transgene expression not affected in cancer cells, miRNAs -124, -338-3p, and -31 are not expressed in GBM (Figure 3b). The data herein further demonstrate that the presence of Tmir did not compromise SES activity as the construct induced significant cell loss in cancer cells transduced in vitro (Figure 3b, lower right). The specificity of the miRNA off-targeting system is demonstrated in Figure 3c, where the data show that, as intended and due to miRNA off-targeting, no cells expressing SES were present when used in primary cortical cultures from mice (Figure 3c).

[0258] It has been demonstrated that by using miRNA target sequences within the 3'UTR, expression of exogenous ESF can be off-targeted from healthy brain cells, such as neurons, astrocytes, and oligodendrocytes, and thus safety and specificity can be improved. By utilizing target sequences of miRNAs that are highly expressed in brain cells but not in tumor cells, the inventors provide polynucleotides and transgene expression cassettes with high specificity, for example, for use as anti-GBM therapy.

Claims

**Claim 1** A polynucleotide comprising at least one miR-124 target sequence, and / or at least one miR-338-3p target sequence, and / or at least one miR-31 target sequence, wherein the miRNA target sequence is operably linked to a transgene. **Claim 2** The polynucleotide according to claim 1, wherein the copy number of each of the miRNA target sequences is independently selected from the group consisting of one, two, three, and four. **Claim 3** The polynucleotide according to claim 1 or claim 2, comprising four miR-124 target sequences, four miR-338-3p target sequences, and four miR-31 target sequences, wherein the miRNA target sequences are operably linked to a transgene. **Claim 4** (a) the miR-124 target sequence comprises or consists of a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 1; (b) the miR-338-3p target sequence comprises or consists of a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 2; and / or (c) the miR-31 target sequence comprises or consists of a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 3, The polynucleotide according to any one of claims 1 to 3. **Claim 5** The polynucleotide according to any one of claims 1 to 4, wherein the miRNA target sequence is located behind the transgene in the 5' to 3' direction. **Claim 6** The polynucleotide according to any one of claims 1 to 5, wherein the miRNA target sequence or a cluster of copies of the miRNA target sequence is arranged in the order of miR-124 target sequence, miR-338-3p target sequence, and miR-31 target sequence from 5' to 3'. **Claim 7** The polynucleotide according to any one of claims 1 to 6, wherein the miRNA target sequences are separated by a spacer sequence. **Claim 8** The polynucleotide according to any one of claims 1 to 7, comprising a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:

4. **Claim 9** The polynucleotide according to any one of claims 1 to 8, further comprising a promoter functionally linked to the introduced gene, and optionally, the promoter is a tissue-specific promoter or a constitutive promoter, optionally a cancer cell-specific promoter or a proliferating cell-specific promoter.

10. The polynucleotide according to claim 9, wherein the promoter is an Ef1a promoter or an Mki67 promoter.

11. A vector comprising the polynucleotide according to any one of claims 1 to 10, optionally a viral vector, optionally a lentiviral vector or an adeno-associated virus (AAV) vector.

12. A nanoparticle comprising the polynucleotide according to any one of claims 1 to 10, or the vector according to claim 11.

13. A cell comprising the polynucleotide according to any one of claims 1 to 10, the vector according to claim 11, or the nanoparticle according to claim 12.

14. A composition comprising the polynucleotide according to any one of claims 1 to 10, the vector according to claim 11, the nanoparticle according to claim 12, or the cell according to claim 13.

15. The polynucleotide according to any one of claims 1 to 10, the vector according to claim 11, the nanoparticle according to claim 12, the cell according to claim 13, or the composition according to claim 14 for use in therapy.

16. The polynucleotide according to any one of claims 1 to 10, the vector according to claim 11, the nanoparticle according to claim 12, the cell according to claim 13, or the composition according to claim 14 for use in the treatment of cancer.

Images