Treatment method for second-line treatment of CD19-targeted CAR T cells

The administration of CD19-directed CAR T cells with optimized CD4+ and CD8+ T cell ratios addresses the need for effective, low-toxicity treatments for refractory LBCL, enhancing treatment efficacy and accessibility.

JP2025521543APending Publication Date: 2025-07-10JUNO THERAPEUTICS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024575207
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-03-30
Filing Date
2023-06-21
Publication Date
2025-07-10

AI Technical Summary

Technical Problem

Current treatments for refractory or relapsed large B-cell lymphoma (LBCL), particularly after first-line chemoimmunotherapy, lack effective options that provide durable responses with minimal toxicity, especially for patients ineligible for hematopoietic stem cell transplantation (HSCT).

Method used

Administration of a dose of autologous CD19-directed genetically modified T cells, comprising CD4+ and CD8+ T cells expressing a chimeric antigen receptor (CAR) at a 1:1 ratio, optimized to minimize toxicity and administered in outpatient settings.

Benefits of technology

Achieves high response rates, including complete responses and durable remissions with low incidence of severe cytokine release syndrome (CRS) and neurological events (NE), expanding treatment access to patients previously excluded.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025521543000001_ABST
    Figure 2025521543000001_ABST
Patent Text Reader

Abstract

Adoptive cell therapy, and related methods, compositions, uses, and articles of manufacture, are provided that include administration of a dose of cells for treating a subject having a particular B cell malignancy. The cells generally express a recombinant receptor, such as a chimeric antigen receptor (CAR). In some embodiments, the disease or condition is large cell type B cell lymphoma (LBCL) that is refractory or relapsed to frontline chemoimmunotherapy.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims priority from U.S. Provisional Application No. 63 / 354,670, filed on June 22, 2022, entitled "TREATMENT METHODS FOR SECOND LINE THERAPY OF CD19 - TARGETED CAR T CELLS", and U.S. Provisional Application No. 63 / 455,920, filed on March 30, 2023, entitled "TREATMENT METHODS FOR SECOND LINE THERAPY OF CD19 - TARGETED CAR T CELLS", the contents of which are hereby incorporated by reference in their entirety.

[0002] Incorporation by Reference of Sequence Listing This application is filed together with an electronic form of the sequence listing. The sequence listing is provided under the file name 735042026440SeqList.xml created on June 19, 2023, and has a size of 76,793 bytes. The electronic form information of the sequence listing is hereby incorporated by reference in its entirety.

[0003] Field In some aspects, the present disclosure relates to adoptive cell therapy involving the administration of a dose of cells for treating a subject having a particular B - cell malignancy, as well as related methods, compositions, uses, and articles of manufacture. The cells generally express a recombinant receptor such as a chimeric antigen receptor (CAR). In some embodiments, the disease or condition is large - cell type B - cell lymphoma (LBCL), such as diffuse large - cell type B - cell lymphoma (DLBCL) (including DLBCL arising from low - grade lymphoma) not otherwise specified, high - grade B - cell lymphoma, primary mediastinal large - cell type B - cell lymphoma, or follicular lymphoma grade 3B, and is refractory or relapsed to first - line chemoimmunotherapy.

Background Art

[0004] A variety of immunotherapy and cell therapy methods are available for the treatment of diseases and conditions. For example, adoptive cell therapy involving the administration of cells expressing a chimeric receptor specific for a target disease or disorder, such as a chimeric antigen receptor (CAR) and / or other recombinant antigen receptors, as well as other adoptive immunocyte therapies and adoptive T cell therapies, can be beneficial in the treatment of cancer or other diseases or disorders. Improved approaches are needed. Methods, uses, and manufactured products that meet such needs are provided.

Summary of the Invention

[0005] Provided herein is a method of treating a subject having large cell type B cell lymphoma (LBCL), comprising administering to the subject a dose of autologous CD19-directed genetically modified T cells, wherein (a) the LBCL is selected from the group consisting of diffuse large cell type B cell lymphoma (DLBCL) not otherwise specified, high grade B cell lymphoma, primary mediastinal large cell type B cell lymphoma, and follicular lymphoma grade 3B; (b) the dose comprises CD4+ T cells positive for the expression of a chimeric antigen receptor (CAR) that binds to CD19, and CD8+ T cells positive for the expression of the CAR; (c) the dose is 44×10 6 ~120×10 6 viable CAR-positive T cells; and (d) the subject is (i) refractory within 12 months of first treatment or (ii) has relapsed within 12 months of first treatment. In some embodiments, the first treatment is first-line chemoimmunotherapy.

[0006] Provided herein is a method of treating a subject having large B-cell lymphoma (LBCL), comprising administering to the subject a dose of autologous CD19-directed genetically modified T cells, wherein (a) the LBCL is selected from the group consisting of diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and follicular lymphoma grade 3B, other than otherwise specified; (b) the dose comprises CD4+ T cells that are positive for the expression of a chimeric antigen receptor (CAR) that binds to CD19, and CD8+ T cells that are positive for the expression of the CAR; (c) the dose is 44×10 6 to 120×10 6 viable CAR-positive T cells; (d) the CAR-positive CD4+ T cells and CAR-positive CD8+ T cells are administered to the subject at a ratio of approximately 1:1 of CAR-positive viable CD4+ T cells to CAR-positive viable CD8+ T cells; (e) the subject is (i) refractory within 12 months of first treatment or (ii) has relapsed within 12 months of first treatment. In some embodiments, the first treatment is first-line chemoimmunotherapy.

[0007] Provided herein is a method of treating a subject having large B-cell lymphoma (LBCL), comprising administering to the subject a dose of autologous CD19-directed genetically modified T cells, wherein (a) the LBCL is selected from the group consisting of diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and follicular lymphoma grade 3B, other than otherwise specified; (b) the dose comprises CD4+ T cells that are positive for the expression of a chimeric antigen receptor (CAR) that binds to CD19, and CD8+ T cells that are positive for the expression of the CAR; (c) the dose is 44×10 6 to 120×10 6individual CAR-positive viable T cells; and (d) the subject has (i) a disease refractory to first-line chemoimmunotherapy, (ii) relapsed within 12 months of first-line chemoimmunotherapy, (iii) a disease refractory to first-line chemoimmunotherapy and not eligible for hematopoietic stem cell transplantation (HSCT), or (iv) relapsed after first-line chemoimmunotherapy and not eligible for hematopoietic stem cell transplantation (HSCT).

[0008] Provided herein is a method of treating a subject having large cell type B-cell lymphoma (LBCL), comprising administering to the subject a dose of autologous CD19-directed genetically modified T cells, wherein (a) the LBCL is selected from the group consisting of diffuse large cell type B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large cell type B-cell lymphoma, and follicular lymphoma grade 3B, where not otherwise specified; (b) the dose comprises CD4+ T cells that are positive for the expression of a chimeric antigen receptor (CAR) that binds to CD19, and CD8+ T cells that are positive for the expression of the CAR; (c) the dose comprises 44×10 6 ~120×10 6 individual CAR-positive viable T cells; and (d) the CAR-positive CD4+ T cells and CAR-positive CD8+ T cells are administered to the subject at a ratio of approximately 1:1 CAR-positive viable CD8+ T cells to CAR-positive viable CD8+ T cells; and (e) the subject has (i) a disease refractory to first-line chemoimmunotherapy, (ii) relapsed within 12 months of first-line chemoimmunotherapy, (iii) a disease refractory to first-line chemoimmunotherapy and not eligible for hematopoietic stem cell transplantation (HSCT), or (iv) relapsed after first-line chemoimmunotherapy and not eligible for hematopoietic stem cell transplantation (HSCT).

[0009] In some embodiments, the subject has a disease refractory to (i) first-line chemoimmunotherapy. In some embodiments, the subject has (ii) relapsed within 12 months of first-line chemoimmunotherapy. In some embodiments, the subject has a disease refractory to (i) first-line chemoimmunotherapy and is not eligible for hematopoietic stem cell transplantation (HSCT). In some embodiments, the subject has relapsed after first-line chemoimmunotherapy and is not eligible for hematopoietic stem cell transplantation (HSCT).

[0010] In some embodiments, the subject belongs to (i) or (iii), and the refractory disease is a primary refractory disease. In some embodiments, the subject belongs to (i), and the refractory disease is a primary refractory disease. In some embodiments, the subject belongs to (iii), and the refractory disease is a primary refractory disease.

[0011] In some embodiments, the subject belongs to (ii) or (iv), and the relapse in the subject occurs after the subject has achieved a complete response (CR) to first-line chemoimmunotherapy. In some embodiments, the subject belongs to (ii), and the relapse in the subject occurs after the subject has achieved a complete response (CR) to first-line chemoimmunotherapy. In some embodiments, the subject belongs to (iv), and the relapse in the subject occurs after the subject has achieved a complete response (CR) to first-line chemoimmunotherapy.

[0012] In some embodiments, the subject belongs to (ii) or (iv), and the relapse in the subject occurs after the subject has achieved a partial response (PR) to first-line chemoimmunotherapy. In some embodiments, the subject belongs to (ii), and the relapse in the subject occurs after the subject has achieved a partial response (PR) to first-line chemoimmunotherapy. In some embodiments, the subject belongs to (iv), and the relapse in the subject occurs after the subject has achieved a partial response (PR) to first-line chemoimmunotherapy.

[0013] In some embodiments, the subject belongs to (iv) and recurrence in the subject is within 12 months of first-line chemoimmunotherapy. In some embodiments, the subject belongs to (iv) and recurrence in the subject is more than 12 months after first-line chemoimmunotherapy.

[0014] Also provided herein is a method of treating a subject having large B-cell lymphoma (LBCL), comprising administering to the subject a dose of autologous CD19-directed genetically modified T cells, wherein (a) the LBCL is selected from the group consisting of diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and follicular lymphoma grade 3B, other than otherwise specified; (b) the dose comprises CD4+ T cells that are positive for the expression of a chimeric antigen receptor (CAR) that binds to CD19, and CD8+ T cells that are positive for the expression of the CAR; (c) the dose is 44×10 6 ~120×10 6 viable CAR-positive T cells; and (d) the subject has a disease refractory to first-line chemoimmunotherapy.

[0015] Also provided herein is a method of treating a subject having large B-cell lymphoma (LBCL), comprising administering to the subject a dose of autologous CD19-directed genetically modified T cells, wherein (a) the LBCL is selected from the group consisting of diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and follicular lymphoma grade 3B, other than otherwise specified; (b) the dose comprises CD4+ T cells that are positive for the expression of a chimeric antigen receptor (CAR) that binds to CD19, and CD8+ T cells that are positive for the expression of the CAR; (c) the dose is 44×10 6 ~120×10 6 viable CAR-positive T cells; (d) the CAR-positive CD4+ T cells and CAR-positive CD8+ T cells are administered to the subject at a ratio of approximately 1:1 CAR-positive viable CD8+ T cells to CAR-positive viable CD8+ T cells; and (e) the subject has a disease refractory to first-line chemoimmunotherapy.

[0016] Also provided herein is a method of treating a subject having large B-cell lymphoma (LBCL), comprising administering to the subject a dose of autologous CD19-directed genetically modified T cells, wherein (a) the LBCL is selected from the group consisting of diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and follicular lymphoma grade 3B, other than otherwise specified; (b) the dose comprises CD4+ T cells that are positive for the expression of a chimeric antigen receptor (CAR) that binds to CD19, and CD8+ T cells that are positive for the expression of the CAR; (c) the dose is 44×10 6 ~120×10 6 viable CAR-positive T cells; and (d) the subject has relapsed within 12 months of first-line chemoimmunotherapy.

[0017] Also provided herein is a method of treating a subject having large B-cell lymphoma (LBCL), comprising administering to the subject a dose of autologous CD19-directed genetically modified T cells, wherein (a) the LBCL is selected from the group consisting of diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and follicular lymphoma grade 3B, other than otherwise specified; (b) the dose comprises CD4+ T cells that are positive for the expression of a chimeric antigen receptor (CAR) that binds to CD19, and CD8+ T cells that are positive for the expression of the CAR; (c) the dose is 44×10 6 ~120×10 6 viable CAR-positive T cells; (d) the CAR-positive CD4+ T cells and CAR-positive CD8+ T cells are administered to the subject at a ratio of approximately 1:1 CAR-positive viable CD8+ T cells to CAR-positive viable CD8+ T cells; and (e) the subject has relapsed within 12 months of first-line chemoimmunotherapy.

[0018] Also provided herein is a method of treating a subject having large B-cell lymphoma (LBCL), comprising administering to the subject a dose of autologous CD19-directed genetically modified T cells, wherein (a) the LBCL is selected from the group consisting of diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and follicular lymphoma grade 3B, where not otherwise specified; (b) the dose comprises CD4+ T cells that are positive for the expression of a chimeric antigen receptor (CAR) that binds to CD19, and CD8+ T cells that are positive for the expression of the CAR; (c) the dose is 44×10 6 ~120×10 6 viable CAR-positive T cells; and (d) the subject has a disease refractory to first-line chemoimmunotherapy and is not eligible for hematopoietic stem cell transplantation (HSCT).

[0019] Also provided herein is a method of treating a subject having large B-cell lymphoma (LBCL), comprising administering to the subject a dose of autologous CD19-directed genetically modified T cells, wherein (a) the LBCL is selected from the group consisting of diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and follicular lymphoma grade 3B, where not otherwise specified; (b) the dose comprises CD4+ T cells that are positive for the expression of a chimeric antigen receptor (CAR) that binds to CD19, and CD8+ T cells that are positive for the expression of the CAR; (c) the dose is 44×10 6 ~120×10 6 viable CAR-positive T cells; (d) the CAR-positive CD4+ T cells and CAR-positive CD8+ T cells are administered to the subject at a ratio of approximately 1:1 CAR-positive viable CD8+ T cells to CAR-positive viable CD8+ T cells; and (e) the subject has a disease refractory to first-line chemoimmunotherapy and is not eligible for hematopoietic stem cell transplantation (HSCT).

[0020] Also provided herein is a method of treating a subject having large B-cell lymphoma (LBCL), comprising administering to the subject a dose of autologous CD19-directed genetically modified T cells, wherein (a) the LBCL is selected from the group consisting of diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and follicular lymphoma grade 3B, other than otherwise specified; (b) the dose comprises CD4+ T cells that are positive for the expression of a chimeric antigen receptor (CAR) that binds to CD19, and CD8+ T cells that are positive for the expression of the CAR; (c) the dose is 44×10 6 ~120×10 6 viable CAR-positive T cells; and (d) the subject has relapsed after first-line chemoimmunotherapy and is ineligible for hematopoietic stem cell transplantation (HSCT).

[0021] Also provided herein is a method of treating a subject having large B-cell lymphoma (LBCL), comprising administering to the subject a dose of autologous CD19-directed genetically modified T cells, wherein (a) the LBCL is selected from the group consisting of diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and follicular lymphoma grade 3B, other than otherwise specified; (b) the dose comprises CD4+ T cells that are positive for the expression of a chimeric antigen receptor (CAR) that binds to CD19, and CD8+ T cells that are positive for the expression of the CAR; (c) the dose is 44×10 6 ~120×10 6 viable CAR-positive T cells; (d) the CAR-positive CD4+ T cells and CAR-positive CD8+ T cells are administered to the subject at a ratio of approximately 1:1 CAR-positive viable CD8+ T cells to CAR-positive viable CD8+ T cells; and (e) the subject has relapsed after first-line chemoimmunotherapy and is ineligible for hematopoietic stem cell transplantation (HSCT).

[0022] In some embodiments, the relapse in the subject is within 12 months from first-line chemoimmunotherapy. In some embodiments, the relapse in the subject is more than 12 months after first-line chemoimmunotherapy.

[0023] In some embodiments, the dose is 90×10 6 ~110×10 6 CAR-positive viable T cells. In some embodiments, the dose is 100×10 6 CAR-positive viable T cells.

[0024] In some embodiments, the LBCL is DLBCL. In some embodiments, the LBCL is DLBCL not otherwise specified. In some embodiments, the DLBCL not otherwise specified is DLBCL arising from low-grade lymphoma. In some embodiments, the LBCL is high-grade B-cell lymphoma. In some embodiments, the LBCL is primary mediastinal large B-cell lymphoma. In some embodiments, the LBCL is follicular lymphoma grade 3B.

[0025] In some embodiments, the subject is not eligible for HSCT due to a coexisting disease or age.

[0026] In some embodiments, the subject is not eligible for HSCT due to a coexisting disease. In some embodiments, the coexisting disease includes pulmonary dysfunction. In some embodiments, the coexisting disease includes a pulmonary diffusing capacity for carbon monoxide (DLCO) of about 60% or less of the adjusted value. In some embodiments, the coexisting disease includes cardiac dysfunction. In some embodiments, the coexisting disease includes a left ventricular ejection fraction (LVEF) of less than about 50%. In some embodiments, the coexisting disease includes renal dysfunction. In some embodiments, the coexisting disease includes a calculated creatinine clearance of less than about 60 milliliters per minute (mL / min). In some embodiments, the coexisting disease includes hepatic dysfunction. In some embodiments, the coexisting disease includes an aspartate aminotransferase (AST) that exceeds about 2 times the upper limit of normal (ULN). In some embodiments, the coexisting disease includes an alanine aminotransferase (ALT) that exceeds about 2 times the upper limit of normal (ULN). In some embodiments, the coexisting disease includes an Eastern Cooperative Oncology Group (ECOG) performance status of 2.

[0027] In some embodiments, the subject is not eligible for HSCT due to age. In some embodiments, the subject is an adult. In some embodiments, the subject is at least 18 years old. In some embodiments, subject I is not over 75 years old. In some embodiments, the subject is not eligible for HSCT because the subject is 70 years old or older.

[0028] In some embodiments, the first-line chemoimmunotherapy is rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP). In some embodiments, R-CHOP was administered to the subject in 14-day cycles (R-CHOP14). In some embodiments, R-CHOP was administered to the subject in 21-day cycles (R-CHOP21). In some embodiments, the first-line chemoimmunotherapy is a modified R-CHOP in which rituximab is replaced with another anti-CD20 monoclonal antibody. In some embodiments, obinutuzumab or vincristine is replaced with polatuzumab vedotin.

[0029] In some embodiments, the first-line chemoimmunotherapy is rituximab, dexamethasone, cytarabine, and cisplatin (R-DHA). In some embodiments, the first-line chemoimmunotherapy is rituximab, ifosfamide, carboplatin, and etoposide (R-ICE). In some embodiments, the first-line chemoimmunotherapy is rituximab, gemcitabine, dexamethasone, and cisplatin (R-GDP). In some embodiments, the first-line chemoimmunotherapy is administered to the subject for 3 cycles.

[0030] In some embodiments, the first-line chemoimmunotherapy was administered to the subject over 3 - 8 cycles. In some embodiments, the first-line chemoimmunotherapy was administered to the subject for more than 4 cycles. In some embodiments, the first-line chemoimmunotherapy was administered to the subject for 6 cycles or about 6 cycles.

[0031] In some embodiments, the first-line chemoimmunotherapy is rituximab, doxorubicin, cyclophosphamide, vindesine, bleomycin, and prednisone (R-ACVBP). In some embodiments, the first-line chemoimmunotherapy is dose-adjusted etoposide, prednisone, vincristine, cyclophosphamide, doxorubicin, and rituximab (DA-EPOCH-R).

[0032] In some embodiments, the subject does not have primary central nervous system (CNS) lymphoma.

[0033] In some embodiments, CAR-positive CD4+ T cells and CAR-positive CD8+ T cells are administered to the subject at a predetermined ratio as separate compositions. In some embodiments, the composition containing CAR-positive CD8+ T cells is administered to the subject before the composition containing CAR-positive CD4+ T cells. In some embodiments, the administration of the composition containing CAR-positive CD8+ T cells and the administration of the composition containing CAR-positive CD4+ T cells are performed at intervals of about 12 hours or less, about 6 hours or less, about 4 hours or less, about 2 hours or less, about 1 hour or less, or about 30 minutes or less. In some embodiments, the administration of the composition containing CAR-positive CD8+ T cells and the administration of the composition containing CAR-positive CD4+ T cells are performed at intervals of about 30 minutes or less. In some embodiments, the administration of the composition containing CAR-positive CD8+ T cells and the administration of the composition containing CAR-positive CD4+ T cells are performed at intervals of about 15 minutes or less.

[0034] In some embodiments, the dose of autologous CD19-directed genetically modified T cells is provided in the form of a formulation containing a cryoprotectant. In some embodiments, the formulation contains Cryostor®. In some embodiments, the formulation contains dimethyl sulfoxide (DMSO). In some embodiments, the formulation contains albumin, which may include human albumin.

[0035] In some embodiments, the dose of autologous CD19-directed genetically modified T cells is cryopreserved prior to administration to a subject. In some embodiments, the cryopreserved dose of autologous CD19-directed genetically modified T cells is thawed prior to administration to a subject. In some embodiments, the dose of autologous CD19-directed genetically modified T cells is administered to the subject within about 2 hours after thawing. In some embodiments, the dose of autologous CD19-directed genetically modified T cells is administered to the subject by intravenous infusion.

[0036] In some embodiments, the CAR comprises an extracellular antigen-binding domain that binds to CD19, a transmembrane domain, and an intracellular signaling domain. In some embodiments, the extracellular antigen-binding domain is a single-chain variable fragment (scFv) derived from the FMC63 monoclonal antibody. In some embodiments, the transmembrane domain is the CD28 transmembrane domain. In some embodiments, the intracellular signaling domain comprises a 4-1BB co-stimulatory domain and a CD3zeta activation domain. In some embodiments, the CAR comprises, in order from the N-terminus to the C-terminus, a single-chain variable fragment (scFv) derived from the FMC63 monoclonal antibody, an IgG4 hinge region, a 47-CD28 transmembrane domain, a 4-1BB (CD137) co-stimulatory domain, and a CD3 zeta activation domain.

[0037] In some embodiments, the extracellular antigen-binding domain comprises the amino acid sequence set forth in SEQ ID NO: 43. In some embodiments, the transmembrane domain comprises the amino acid sequence set forth in SEQ ID NO: 8. In some embodiments, the 4-1BB co-stimulatory domain comprises the amino acid sequence set forth in SEQ ID NO: 12. In some embodiments, the CD3zeta signaling domain comprises the amino acid sequence set forth in SEQ ID NO: 13. In some embodiments, the CAR comprises the amino acid sequence set forth in SEQ ID NO: 59. In some embodiments, the cells of the dose of autologous CD19-directed genetically modified T cells express a non-functional truncated epidermal growth factor receptor (EGFRt).

[0038] In some embodiments, the method includes administering a lymphodepletion regimen of fludarabine and cyclophosphamide to a subject prior to administering a dose of autologous CD19-directed genetically modified T cells to the subject. In some embodiments, the subject has been administered a lymphodepletion regimen of fludarabine and cyclophosphamide prior to administering a dose of autologous CD19-directed genetically modified T cells to the subject. In some embodiments, the lymphodepletion regimen includes 3-day courses of intravenous (IV) administration of fludarabine at 30 mg / m 2 per day and cyclophosphamide at 300 mg / m 2 per day. In some embodiments, the lymphodepletion regimen is administered to the subject for about 2 to about 7 days prior to administering a dose of autologous CD19-directed genetically modified T cells to the subject.

[0039] In some embodiments, the subject has been administered acetaminophen prior to administering a dose of autologous CD19-directed genetically modified T cells to the subject. In some embodiments, the subject has been administered acetaminophen between about 30 minutes and about 60 minutes prior to administering a dose of autologous CD19-directed genetically modified T cells to the subject. In some embodiments, the subject has been administered about 650 mg of acetaminophen. In some embodiments, acetaminophen is administered orally. In some embodiments, acetaminophen is called paracetamol.

[0040] In some embodiments, the subject has been administered an H1 antihistamine prior to administering a dose of autologous CD19-directed genetically modified T cells to the subject. In some embodiments, the subject has been administered an H1 antihistamine between about 30 minutes and about 60 minutes prior to administering a dose of autologous CD19-directed genetically modified T cells to the subject. In some embodiments, the H1 antihistamine is diphenhydramine. In some embodiments, the subject has been administered about 25 mg to about 50 mg of diphenhydramine. In some embodiments, the H1 antihistamine is administered intravenously or orally. In some embodiments, the H1 antihistamine is administered intravenously. In some embodiments, the H1 antihistamine is administered orally.

[0041] In some embodiments, the subject has an ECOG performance status of 0, 1, or 2. In some embodiments, the subject has an ECOG performance status of 0. In some embodiments, the subject has an ECOG performance status of 1. In some embodiments, the subject has an ECOG performance status of 2. In some embodiments, the subject is not a pregnant woman.

[0042] In some embodiments, the cells of the dose of autologous CD19-directed genetically modified T cells are obtained from the subject by leukapheresis. In some embodiments, the subject is administered a bridging therapy for treating LBCL after leukapheresis and before administering the dose of autologous CD19-directed genetically modified T cells.

[0043] In some embodiments, the bridging therapy is chemotherapy or radiation therapy. In some embodiments, the bridging therapy is chemotherapy. In some embodiments, the bridging therapy is radiation therapy.

[0044] In some embodiments, the dose of autologous CD19-directed genetically modified T cells is administered to the subject by inpatient administration. In some embodiments, the dose of autologous CD19-directed genetically modified T cells is administered to the subject by outpatient administration.

[0045] Also provided is the use of a composition comprising CAR-positive CD4+ T cells and CAR-positive CD8+ T cells, or CAR-positive CD4+ T cells and engineered CAR-positive CD8+ T cells, for the manufacture of a medicament for use in any of the treatment methods for treating LBCL. In some aspects, also provided is the dose of a composition of CAR-positive CD4+ T cells and engineered CAR-positive CD8+ T cells, or CAR-positive CD4+ T cells and engineered CAR-positive CD8+ T cells, for use in any of the treatment methods for treating LBCL. BRIEF DESCRIPTION OF THE DRAWINGS

[0046]

Figure 1A

Figure 1B

Mode for Carrying Out the Invention

[0047] Unless otherwise defined, all technical terms, notations, and other technical, scientific, or specialized terms used herein are intended to have the same meaning as commonly understood by those of ordinary skill in the art to which the claimed subject matter pertains. In some cases, terms having commonly understood meanings are defined herein for purposes of clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference from what is commonly understood.

[0048] All publications, including patent documents, scientific papers, and databases, referred to in this application are hereby incorporated by reference in their entirety for all purposes to the same extent as if each individual publication were incorporated by reference separately. If the definitions set forth herein conflict with or are inconsistent with the definitions set forth in patents, applications, published applications, and other publications incorporated by reference herein, the definitions set forth herein shall control.

[0049] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. I. Methods and Uses of Cell Therapy Using Genetically Engineered Cells

[0050] Methods and uses of engineered cells (e.g., T cells) and compositions thereof are provided for the treatment of a subject having generally a large B-cell lymphoma (LBCL), or a disease or condition comprising the same. In certain embodiments of any of the provided methods, the T cells are engineered with a chimeric antigen receptor (CAR) targeting CD19. In some aspects, the LBCL is selected from the group consisting of diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and follicular lymphoma grade 3B, unless otherwise specified. In some embodiments, the large B-cell lymphoma (LBCL) comprises diffuse large cell lymphoma (DLBCL), not otherwise specified (NOS). In some embodiments, the LBCL comprises de novo lymphoma. In some embodiments, the high-grade B-cell lymphoma comprises high-grade B-cell lymphoma having MYC and BCL2. In some embodiments, the high-grade B-cell lymphoma comprises BCL6 rearrangement (double / triple hit lymphoma (DHL / THL)) with respect to DLBCL histology. In some embodiments, the LBCL comprises T-cell / histiocyte-rich large B-cell lymphoma (THRBCL). In some aspects, the methods and uses provide or achieve improved efficacy and / or more sustained efficacy or effectiveness and / or a reduced risk of toxicity or other side effects, e.g., in a particular group of treated subjects, as compared to certain alternative methods. In some embodiments, the method is advantageous by administration of a particular number or relative number of engineered cells, administration of a defined ratio of a particular type of cell, treatment of a particular patient population, such as patients having a particular risk profile, stage classification, and / or pretreatment history, and / or combinations thereof.

[0051] Also provided are articles of manufacture and kits for use, e.g., in the methods provided herein. In some embodiments, the articles of manufacture and kits also contain instructions for use according to the methods provided herein.

[0052] In some embodiments, the method and use generally involve administering to a subject cells that express a genetically engineered (recombinant) cell surface receptor that is a chimeric receptor, such as a chimeric antigen receptor (CAR) that recognizes CD19. The cells are generally administered in a composition formulated for administration; the method generally involves administering to the subject one or more doses of the cells, which doses may include a specific number or relative number of the cells or engineered cells, and / or a defined ratio or composition of two or more subtypes within the composition, such as CD4 to CD8 T cells.

[0053] In some embodiments, the cells, populations, and compositions are administered to a subject having treated LBCL via adoptive cell therapy, such as adoptive T cell therapy. In some embodiments, the method involves treating a subject having LBCL with a dose of antigen receptor-expressing cells (e.g., CAR-expressing cells). In some aspects, the dose includes CD4+ T cells that are positive for the expression of a chimeric antigen receptor (CAR) that binds to CD19, and CD8+ T cells that are positive for the expression of the CAR, and the CAR-positive CD4+ T cells and CAR-positive CD8+ T cells are administered to the subject at a ratio of about 1:1 CAR-positive viable CD4+ T cells to CAR-positive viable CD8+ T cells. In some aspects, the dose is 90×10 6 ~110×10 6 CAR-positive viable T cells.

[0054] In some embodiments, the provided method involves treating a subject identified as having a particular group or subset of subjects, such as large cell type B lymphoma that is refractory or relapsed (R / R) to first line chemoimmunotherapy. In some aspects, the subject has a disease refractory to first line chemoimmunotherapy. In some aspects, the subject has relapsed within 12 months of first line chemoimmunotherapy. In some aspects, the subject has a disease refractory to first line chemoimmunotherapy and is ineligible for hematopoietic stem cell transplantation (HSCT). In some aspects, the subject has relapsed after first line chemoimmunotherapy and is ineligible for hematopoietic stem cell transplantation (HSCT).

[0055] In some embodiments, the subject has relapsed after first-line chemoimmunotherapy, and the relapse in the subject occurs after the subject has achieved a complete response (CR) to the first-line chemoimmunotherapy. In some embodiments, the subject has relapsed after first-line chemoimmunotherapy, and the relapse in the subject occurs after the subject has achieved a partial response (PR) to the first-line chemoimmunotherapy. In some embodiments, the subject is not eligible for HSCT due to a co-existing disease or age. In some embodiments, the subject relapses within 12 months of first-line chemoimmunotherapy, and the relapse in the subject occurs after the subject has achieved a complete response (CR) to the first-line chemoimmunotherapy. In some embodiments, the subject relapses within 12 months of first-line chemoimmunotherapy, and the relapse in the subject occurs after the subject has achieved a partial response (PR) to the first-line chemoimmunotherapy.

[0056] In some cases, the overall response rate (ORR; also known as objective response rate in some cases) to available treatment, standard of care (SOC), or reference treatment for the disease and / or patient population for which the treatment is indicated is less than 40%, and / or the complete response (CR; also known as complete remission in some cases) is less than 20%. In some embodiments, in chemotherapy-resistant LBCL (e.g., DLBCL), the ORR with reference treatment or available treatment or standard of care is approximately 26%, and the CR rate is approximately 8% (Crump et al. Outcomes in refractory aggressive diffuse large B-cell lymphoma (DLBCL): Results from the international SCHOLAR study. ASCO 2016 [Abstract 7516]). As observed herein, the 1-year probability of progression-free survival for SOC is less than approximately 25%, and the 1-year probability of progression-free survival with the methods provided herein is approximately 45%. In some aspects, the methods, compositions, uses, and articles of manufacture provided achieve improved and superior responses relative to available treatments. In some embodiments, the improved or superior response is relative to the current standard of care (SOC). In some embodiments, the current SOC for the treatment of B-cell malignancies such as LBCL includes up to 3 cycles of chemoimmunotherapy followed by high-dose therapy and autologous HSCT in patients who achieve CR or PR.For example, in some embodiments, the current SOC includes up to three cycles of either rituximab, dexamethasone, cytarabine (AraC), and cisplatin (R-DHAP), rituximab, ifosfamide, carboplatin, and etoposide (R-ICE), or rituximab, gemcitabine, dexamethasone, and cisplatin (R-GDP), followed by high-dose chemotherapy with carmustine, etoposide, cytarabine, and melphalan (BEAM), and hematopoietic stem cell transplantation (HSCT) in responders (e.g., Crump et al., J Clin Oncol. 2014; 32(31):3490-6; Gisselbrecht, et al., J Clin Oncol. 2010;28(27):4184-90; van Imhoff et al., J Clin Oncol. 2017;35(5):544-51).

[0057] Large B-cell lymphoma (LBCL) is the most common subtype of non-Hodgkin lymphoma (NHL). Frontline treatment is curative in approximately 60% of patients, but approximately 30% of patients relapse, and approximately 10% are refractory to frontline treatment. Treatment options for patients with relapsed / refractory (R / R) disease, particularly third-line and above (3L+) therapy, mainly include salvage chemotherapy (CT). Two chimeric antigen receptor (CAR) T-cell products and antibody-drug conjugates have been approved as third-line treatment. Unmet medical needs in second-line and above (2L+) or 3L+ therapy for R / R LBCL were identified based on a systematic literature review (SLR) of evidence regarding the clinical outcomes of LBCL patients including the new treatments described above.

[0058] Based on an illustrative SLR conducted in accordance with the requirements of the Cochrane Handbook for Systematic Reviews of Interventions and the European Union Health Technology Assessment, screening 8,683 database records and additional information sources, 103 publications were identified that covered 78 unique studies. In this review, randomized and non-randomized / observational studies in relapsed / refractory large B-cell lymphoma (R / R LBCL) were identified, including diffuse large B-cell lymphoma (DLBCL), follicular lymphoma grade 3B (FL3B), primary mediastinal large B-cell lymphoma (PMBCL), DLBCL transformed from low-grade lymphoma, and R / R DLBCL with secondary central nervous system (SCNS) lesions. Information sources reviewed included EMBASE, MEDLINE, The Cochrane Library, and clinical societies (ASCO, ESMO, EHA, ASH, ICML, AACR, and EORTC). The identified studies were characterized by treatment line and subtype of R / R LBCL. Observed OS, PFS, DOR, OR, and safety were described from the identified studies. Disease subtype, eligibility criteria for subjects, and follow-up period varied widely across studies.

[0059] Based on the exemplary SLR, in the 3L+ cohort, 11 salvage CTs and 2 CAR T cell therapy studies reported survival outcomes. In salvage CTs, the ORR reported across studies ranged from 0% to 54%, while the CR ranged from 5.6% to 31%. The median OS (mOS) ranged from 3 to 9 months, and in one exceptional study, an mOS of 20 months was reported. The median PFS (mPFS) reported in salvage CT studies ranged from 2 to 6 months. Among CAR T cell therapies, subjects treated with anti-CD19 CAR T cell therapy (n = 101) reported a CR rate of 58%, and the median DOR (mDOR) was 11.1 months after a median follow-up period of 27.1 months. The mPFS was 5.9 months, and the mOS was not reached. At the median follow-up of 19.3 months, the CR of subjects treated with another anti-CD19 CAR T cell therapy (n = 115) was 40%, but the mDOR was not reached. The mOS was 11.1 months in all injected patients.

[0060] In the 2L+ transplant-eligible cohort (36 studies), subjects who received high-dose CT + HSCT achieved mOS between 9 months and 5 years. In the transplant-ineligible cohort, 16 studies reported an mOS of 3 to 20 months. The mOS of studies with a mixed transplant-eligible and ineligible cohort (30 studies) was 1 to 17 months.

[0061] A few studies with limited sample sizes reported outcomes for LBCL subtypes (e.g., PMBCL, SCNS lymphoma, DLBCL transformed from non-FL low-grade lymphoma, FL3B). In the 3L+ setting, one study reported not reaching mOS after a median of 6.6 months. In the 2L+ setting, four studies reported mPFS and mOS outcomes in the ranges of 2 to 9 months and 10 to 16 months, respectively.

[0062] Among the studies evaluating the safety of salvage chemotherapy in R / R LBCL, the most commonly reported adverse events (AEs) were neutropenia, leukopenia, thrombocytopenia, and infections, with neutropenia being the most frequently reported. Of the three studies reporting the safety outcomes of CAR T cell therapy, the data showed that hematological AEs (presumably related to lymphodepleting CT), cytokine release syndrome, and neurotoxicity were the most frequently reported.

[0063] Based on exemplary studies, less than 50% of patients with relapsed / refractory large B-cell lymphoma (LBCL) achieve response with treatment after third-line treatment (Van Den Neste et al. Bone Marrow Transplant. 2016;51:51-7; Gonzalez-Barca E et al. Bone Marrow Transplant 2019). High-dose chemotherapy combined with autologous hematopoietic stem cell transplantation (HSCT) is the standard treatment at first relapse in transplant-eligible patients with chemotherapy-sensitive diseases (National Comprehensive Cancer Network Clinical Practice Guidelines in Oncology. March 6, 2019), but most patients are not cured with this approach (Van Den Neste et al. Bone Marrow Transplant. 2016;51:51-7; Gonzalez-Barca E et al. Bone Marrow Transplant 2019, National Comprehensive Cancer Network Clinical Practice Guidelines in Oncology. March 6, 2019, Gisselbrecht C et al. J Clin Oncol. 2010; 28:4184-90). In several studies, the outcomes in subjects with chemotherapy-refractory diseases were poor, with a complete response (CR) rate of 7% and an overall survival (OS) of 6 months to conventional treatments. (Crump et al. Blood. 2017;130:1800-8). Adverse outcomes were associated with older age, central nervous system (CNS) lesions (Thanarajasingam et al. Br J Haematol. 2018;183:149-52; Nabhan et al. J Clin Oncol. 2018; 36:7545) and comorbidities (Pfreundschuh Blood. 2010;116:5103-10).

[0064] Certain CD19-directed CAR-T cell therapies, including axicabtagene ciloleucel (axi-cel) and tisagenlecleucel, are available for the treatment of B cell lymphoma. In one exemplary study, subjects treated with axi-cel achieved a CR rate of 54% (per treating investigator) and 40% achieved durable remission (median follow-up, 15.4 months) (Neelapu et al. N Engl Med. 2017. 377;2531-44). Most subjects developed CRS (93%) and NE (64%), with median times to onset of 2 days and 5 days, respectively, and grade ≥3 CRS (Lee criteria (Lee et al. Blood. 2014;124:188-95)) and NE developed in 13% and 28%, respectively, and 43% received tocilizumab (27% received corticosteroids). In another exemplary study, approximately one-third of patients who received tisagenlecleucel maintained durable remission at 1 year (Schuster et al. N Engl J Med. 2019. 380:45-56). Most subjects (58%) developed CRS, but 21% had NE. Grade ≥3 CRS (Penn criteria, Porter et al. J Hematol Oncol. 2018;11:35) and NE were reported in 22% and 12% of patients, respectively (Schuster et al. N Engl J Med. 2019. 380:45-56). Additionally, these treatments do not include the treatment of certain high-risk patients, including patients with PMBCL, DLBCL transformed from low-grade lymphoma other than FL, patients with FL3B, and secondary CNS lymphoma, certain high-risk features such as moderate renal / heart comorbidities, and patients with requirements for bridging therapy.

[0065] Examination of SLR and current evidence indicates important and high unmet needs for additional treatment options that provide favorable benefit / risk and durable responses, which are not met by the treatments available for subjects with 2L+ and 3L+ LBCL. Furthermore, limited data were available for rare subtypes of LBCL. From these findings, the importance of the treatment gap for R / R LBCL that must be addressed, and the need for improvement of existing treatments have become apparent. Provided herein are embodiments that can meet such needs.

[0066] In some embodiments, the methods, uses, and manufactured articles are involved in, or used for, the treatment of a subject involved in, or responsive to, a treatment of a particular type of disease, diagnostic criteria, pretreatment, and / or pretreatment response. In some embodiments, the method is involved in treating a subject who has relapsed after remission following treatment with one or more prior treatments, or who has become refractory to one or more prior treatments; or a subject who is refractory or relapsed (R / R) to one or more prior treatments, such as one or more lines of standard treatment. In some embodiments, the method is involved in treating a subject having LBCL that is refractory or relapsed to first-line chemoimmunotherapy. In some embodiments, the subject relapsed within 12 months from first-line chemoimmunotherapy. In some embodiments, the subject is not eligible for HSCT due to coexisting disease or age.

[0067] In some embodiments, the subject has a B cell malignancy, such as a large cell type B cell lymphoma, such as relapsed / refractory (R / R) large cell type B cell lymphoma. In some embodiments, the subject has a large cell type B cell lymphoma, such as diffuse large cell type B cell lymphoma (DLBCL) (e.g., DLBCL not otherwise specified (NOS; de novo or transformation from low grade) or other DLBCL). In some embodiments, the subject has DLBCL not otherwise specified. In some embodiments, the subject has DLBCL not otherwise specified (including DLBCL arising from low grade lymphoma). In some embodiments, the subject has DLBCL not otherwise specified (including DLBCL arising from de novo lymphoma). In some embodiments, the subject has a high grade B cell lymphoma. In some embodiments, the subject has a high grade B cell lymphoma having MYC and BCL2. In some embodiments, the subject has a high grade B cell lymphoma (double / triple hit lymphoma (DHL / THL)) including BCL6 rearrangement related to DLBCL histology. In some embodiments, the subject has primary mediastinal large cell type B cell lymphoma (PMBCL). In some embodiments, the subject has follicular lymphoma grade 3B (FL3B). In some embodiments, the subject has an LBCL including T cell / histiocyte rich large cell type B cell lymphoma (THRBCL).

[0068] In certain embodiments, the methods provided herein are based on the administration of a CD19-directed CAR T cell therapy in which the CAR contains a CD19-directed scFv antigen-binding domain (e.g., derived from FMC63). The CAR further contains an intracellular signaling domain containing a signaling domain derived from CD3zeta and incorporates a 4-1BB co-stimulatory domain, which has been associated with a lower incidence of CRS and NE compared to constructs containing CD28 (Lu et al. J Clin Oncol. 2018;36:3041). In some embodiments, the methods provided herein include subsets of CD8+ and CD4+ T cells that are transduced and expanded separately in vitro and administered at equal (about 1:1) target doses. In some embodiments, there is low variability in the total CAR+ T cell dose and the CD8+ CAR+ T cell dose administered, which are two parameters that have been associated with increased toxicity in previous studies (Neelapu et al. N Engl Med. 2017. 377;2531-44;Turtle et al. Sci Transl Med. 2016;8:355ra116;Hay et al. Blood. 2017;130:2295-306).

[0069] In certain embodiments, the provided methods can be used to treat specific LBCL subtypes or high-risk groups, such as elderly patients and patients with co-existing diseases, where the available treatment options remain limited. For example, existing CAR T cell therapies are associated with severe CAR T cell-related toxicities, including cytokine release syndrome (CRS) and neurological events (NE), and administration may be restricted to specialized treatment facilities (Yescarta Risk Evaluation and Mitigation Strategy (REMS). Gilead Pharma September 10, 2019;Kymriah Risk Evaluation and Mitigation Strategy (REMS) Novartis September 10, 2019), affecting their use in difficult-to-treat patients. CAR T cell therapies with favorable benefit / risk profiles, particularly those with high efficacy and low incidence of severe CRS and NE, may enable broader inclusion of subsets of the population, as well as outpatient administration / monitoring.

[0070] In certain embodiments, the provided method results in favorable outcomes in subjects with LBCL, including certain subjects previously excluded from treatment by other therapies, including other anti-CD19 CAR-T cell therapies. In the groups of subjects presented herein, treatment with CD19-directed CAR T cells in subjects with LBCL resulted in durable responses, including responses associated with increased in vivo CAR T cell expansion, and the CAR T cells persisted for long periods after infusion. In some embodiments, the provided method demonstrated favorable outcomes in heavily pre-treated subjects with high-risk aggressive diseases, including patients who are refractory to chemotherapy or who require immediate treatment for disease control with bridging therapy. The observations herein support treating subjects with high-risk aggressive diseases with CD19-directed CAR T cell therapy according to the provided method. For example, patients with certain high-risk features, such as DLBCL transformed from low-grade lymphomas other than PMBCL, FL, subjects with FL3B, and secondary CNS lymphoma, moderate renal / heart co-morbidities, requirements for bridging therapy, etc., can be treated according to the provided method. In some embodiments, the provided method can be used to treat heavily pre-treated subjects (e.g., by two, three, or more prior treatments for treating the disease). Among the subgroups that can be treated by the provided method, there is also an elderly subgroup of 65 years or older, including subgroups over 70 years and over 75 years. Here, the observations demonstrate that the event-free survival (EFS), progression-free survival (PFS), overall response rate (ORR), complete response (CR), and duration of response (DOR), including durable responses, were observed across all subgroups, and the incidence of severe CRS and NE was low.

[0071] In some embodiments, less than one-half of all subjects treated by the methods provided herein develop CRS or NE. In some embodiments, the low overall incidence and severity of CRS and NE, along with the late onset, support outpatient administration / monitoring in selected subjects. In some embodiments, the safety and efficacy outcomes of subjects receiving a CAR T cell composition in an outpatient setting are similar to those of the overall treated population. In some embodiments, although chimeric antigen receptor (CAR) T cell therapy has generally been limited to inpatient treatment at a university medical center, in the United States, most patients with relapsed / refractory (R / R) diffuse large B cell lymphoma (DLBCL) receive therapy at medical centers outside of the university where outpatient cancer delivery is common. In some embodiments of any of the methods provided herein, the infusion and management of CAR T cell therapy in an outpatient setting leads to broader utilization and improved access at non-university / regional centers.

[0072] In some embodiments, treatment by any of the methods provided herein results in high rates of durable EFS, PFS, and CR, as well as a decreased incidence of severe CRS and NE, among subjects with relapsed / refractory LBCL in this study. In some embodiments, clinically meaningful activity is observed across a subgroup of subjects with unmet medical needs, including subjects with histological subtypes of LBCL that are not common and poor prognostic features. In some embodiments, the low incidence and late time to onset of severe CRS and NE enable outpatient administration / monitoring. In some embodiments, the risk / benefit profile specific to any of the methods provided herein may enable the inclusion of more patients and potential sites of cure.

[0073] In some embodiments, the method involves treating subjects with an Eastern Cooperative Oncology Group Performance Status (ECOG) of 0-1 or 0-2. In some embodiments, the method treats DLBCL patients who generally respond poorly to therapy or a specific reference therapy or a population of subjects with a poor prognosis, the population having, for example, one or more, such as two or three chromosomal translocations (such as the so-called "double hit" or "triple hit" lymphomas having the translocated MYC / 8q24 locus in combination with the t(14;18)(q32;q21) bcl-2 gene and / or BCL6 / 3q27 chromosomal translocation; see, for example, Xu et al. (2013) Int J Clin Exp Pathol. 6(4): 788-794), and / or being relapsed, such as relapsed within 12 months after administration of autologous stem cell transplantation (ASCT), and / or having chemotherapy resistance.

[0074] In some aspects, the provided embodiments are based on the observation that the provided method can be used to achieve a high response rate with high persistence compared to certain available methods for cell therapy without increasing the risk of toxicity. In some embodiments, the provided method enables long-term persistence of adoptively transferred cells for cell therapy and / or a low incidence of toxicity expression in the subject. In some embodiments, the method is used to select subjects for whom cell therapy is likely or more likely to be effective for treatment by cell therapy and / or to determine an appropriate dose or dosing regimen for higher response rates and / or more sustained responses while minimizing the risk of toxicity. The provided embodiments and such methods can provide a rational strategy for promoting the safe and effective clinical application of adoptive cell therapies such as CAR-T cell therapy.

[0075] In some embodiments, the subject has transplant-ineligible (TNE) LBCL. For example, the subject is ineligible for high-dose chemotherapy and hematopoietic stem cell transplantation (HSCT). In some embodiments, the subject is not eligible for hematopoietic stem cell transplantation (HSCT) due to a co-existing disease or age. Thus, in some embodiments, the subject has TNE relapsed / refractory (R / R) large cell type B cell NHL. In some embodiments, subjects with relapsed or refractory LBCL who have failed first-line treatment with immunochemotherapy and are ineligible for high-dose chemotherapy and hematopoietic stem cell transplantation (HSCT) have a poor prognosis. In some embodiments, available treatment options for these subjects include platinum / gemcitabine-based or bendamustine-based regimens in combination with rituximab, with or without the addition of radiation therapy. However, in some embodiments, the long-term outcomes of available therapies remain poor due to the lack of curative options. The methods provided offer improved treatment for such subjects.

[0076] In some embodiments, the antigen receptor (e.g., CAR) specifically binds to a target antigen associated with LBCL. In some embodiments, the antigen associated with the disease or disorder is CD19.

[0077] In some embodiments, the method includes administering a cell or a composition containing the cell to a subject who is an adult. In some embodiments, the subject is over 30, 40, 50, 60, or 70 years of age, or is about 30, 40, 50, 60, or 70 years of age. In some embodiments, the subject is over 60 years of age. In some embodiments, the subject is over 70 years of age. In some embodiments, the subject is over 75 years of age. In some embodiments, the subject is not over 75 years of age.

[0078] In some embodiments, the subject has been previously treated with a therapy or therapeutic agent targeting a disease or condition, such as large cell type B-cell lymphoma, prior to administration of cells expressing the recombinant receptor. In some embodiments, the subject has been previously treated with respect to hematopoietic stem cell transplantation (HSCT), such as allogeneic HSCT or autologous HSCT. In some embodiments, the subject has a poor prognosis after treatment with standard therapy and / or has failed one or more lines of prior therapy. In some embodiments, the subject has relapsed after or is refractory to treatment with first-line chemoimmunotherapy. In some embodiments, the subject has relapsed after treatment with first-line chemoimmunotherapy. In some embodiments, the subject has relapsed within 12 months of treatment with first-line chemoimmunotherapy. In some embodiments, the subject is refractory to treatment with first-line chemoimmunotherapy. In some embodiments, first-line chemoimmunotherapy is rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP). In some embodiments, R-CHOP was administered to the subject on a 14-day cycle (R-CHOP14). In some embodiments, R-CHOP was administered to the subject on a 21-day cycle (R-CHOP21). In some embodiments, first-line chemoimmunotherapy is rituximab, doxorubicin, cyclophosphamide, vindesine, bleomycin, and prednisone (R-ACVBP). In some embodiments, first-line chemoimmunotherapy is dose-adjusted etoposide, prednisone, vincristine, cyclophosphamide, doxorubicin, and rituximab (DA-EPOCH-R).

[0079] In some embodiments, first-line chemoimmunotherapy is rituximab, dexamethasone, cytarabine, and cisplatin (R-DHAP). In some embodiments, first-line chemoimmunotherapy is rituximab, ifosfamide, carboplatin, and etoposide (R-ICE). In some embodiments, first-line chemoimmunotherapy is rituximab, gemcitabine, dexamethasone, and cisplatin (R-GDP).

[0080] In some embodiments, the subject has been treated with or has previously received at least about 1, 2, 3, or 4 other therapies or about 1, 2, 3, or 4 other therapies for treating a disease or disorder such as large cell type B cell lymphoma other than lymphodepletion therapy and / or a dose of cells expressing an antigen receptor. In some embodiments, the subject has been treated with or has previously received a therapy comprising anthracycline, a CD20 targeting agent, and / or ibrutinib.

[0081] In some embodiments, the subject has been previously treated with chemotherapy or radiation therapy. In some aspects, the subject is refractory or non-responsive to other therapies or therapeutic agents. In some embodiments, the subject has a persistent or recurrent disease after treatment with another therapy or therapeutic intervention, such as chemotherapy or radiation.

[0082] In some embodiments, the subject is eligible for transplantation, such as hematopoietic stem cell transplantation (HSCT), e.g., allogeneic HSCT. In some embodiments, the subject is eligible for transplantation, such as hematopoietic stem cell transplantation (HSCT), e.g., autologous HSCT. In some such embodiments, the subject has not previously received a transplant, despite being eligible, prior to administration of the engineered cells (e.g., CAR-T cells) or cell-containing compositions to the subject as provided herein.

[0083] In some embodiments, the subject is not eligible for HSCT due to a co-existing disease or age. In some embodiments, the subject is not eligible for HSCT due to a co-existing disease. In some embodiments, the co-existing disease includes pulmonary dysfunction. In some embodiments, the co-existing disease includes a pulmonary diffusing capacity for carbon monoxide (DLCO) of about 60% or less of adjusted. In some embodiments, the co-existing disease includes cardiac dysfunction. In some embodiments, the co-existing disease includes a left ventricular ejection fraction (LVEF) of less than about 50%. In some embodiments, the co-existing disease includes renal dysfunction. In some embodiments, the co-existing disease includes a calculated creatinine clearance of less than about 60 milliliters per minute (mL / min). In some embodiments, the co-existing disease includes hepatic dysfunction. In some embodiments, the co-existing disease includes an aspartate aminotransferase (AST) greater than about 2 times the upper limit of normal (ULN). In some embodiments, the co-existing disease includes an alanine aminotransferase (ALT) greater than about 2 times the upper limit of normal (ULN). In some embodiments, the co-existing disease includes an Eastern Cooperative Oncology Group (ECOG) performance status of 2.

[0084] In some embodiments, the subject is not eligible for HSCT due to age. In some embodiments, the subject is an adult. In some embodiments, the subject is at least 18 years old. In some embodiments, the subject is not eligible for HSCT because the subject is 70 years of age or older.

[0085] In some embodiments, the subject is not eligible for transplantation, such as not eligible for hematopoietic stem cell transplantation (HSCT), e.g., allogeneic HSCT (also known as transplant ineligible, TNE). In some embodiments, such subjects are administered engineered cells (e.g., CAR-T cells) or compositions containing cells according to the embodiments provided herein.

[0086] In some embodiments, at the time of administration of the cell dose or immediately prior thereto, the subject is determined to be ineligible or identified as ineligible for high-dose chemotherapy. In some embodiments, at the time of administration of the cell dose or immediately prior thereto, the subject is determined to be ineligible or identified as ineligible for hematopoietic stem cell transplantation (HSCT). In some embodiments, at the time of administration of the cell dose or immediately prior thereto, the subject is determined to be ineligible or identified as ineligible for both high-dose chemotherapy and hematopoietic stem cell transplantation (HSCT).

[0087] In some embodiments, the subject has relapsed / refractory NHL and at the time of administration of the cell dose or immediately prior thereto, the subject is determined to be ineligible or identified as ineligible for both high-dose chemotherapy and hematopoietic stem cell transplantation (HSCT), and the subject has relapsed or become refractory thereto after remission following treatment with one prior therapy for a disease or condition other than another dose of cells expressing a CAR.

[0088] In some embodiments, at the time of administration of the cell dose or immediately prior thereto, the subject is 70 years of age or older or is identified as being that age. In some embodiments, the subject is identified as having an ECOG performance status of 2 or being so. In some embodiments, the subject has a pulmonary dysfunction and, as appropriate, is identified as having a pulmonary diffusing capacity for carbon monoxide (DLCO) of 60% or less or about 60% or less. In some embodiments, the subject has a cardiac dysfunction and, as appropriate, is identified as having a left ventricular ejection fraction (LVEF) of less than 50% or about 50% or less. In some embodiments, the subject has a renal dysfunction and, as appropriate, is identified as having a calculated creatinine clearance of less than 60 mL / min or about 60 mL / min or less. In some embodiments, the subject has a hepatic dysfunction and, as appropriate, is identified as having aspartate aminotransferase (AST) and alanine aminotransferase (ALT) that exceed or are about 2 times the upper limit of normal (ULN).

[0089] In some embodiments, the subject has a lymphoma associated with or involved in a central nervous system (CNS) lesion and the subject has been previously treated with an anticonvulsant such as levetiracetam.

[0090] In some embodiments, the method comprises administering the cells to a subject selected or identified as having high-risk large B-cell lymphoma or high-risk NHL. In some embodiments, the subject exhibits one or more cytogenetic abnormalities associated with B-cell malignancies such as high-risk B-cell lymphoma or high-risk NHL. In some embodiments, the subject has a high-grade B-cell lymphoma having MYC and BCL2. In some embodiments, the subject has a high-grade B-cell lymphoma (double / triple hit lymphoma (DHL / THL)) comprising BCL6 rearrangement with respect to DLBCL histology. In some embodiments, the subject is selected or identified based on having a disease or condition characterized or determined to be aggressive NHL, diffuse large B-cell lymphoma (DLBCL), primary mediastinal large B-cell lymphoma (PMBCL), T-cell / histiocyte-rich large B-cell lymphoma (TCHRBCL), Burkitt lymphoma (BL), mantle cell lymphoma (MCL), and / or follicular lymphoma (FL). In certain embodiments, subjects treated using the methods provided herein include those having aggressive large B-cell lymphoma or aggressive NHL, particularly diffuse large B-cell lymphoma (DLBCL) not otherwise specified (NOS; de novo or transformation from low-grade), primary mediastinal B-cell lymphoma (PMBCL) or follicular lymphoma grade 3B (FL3B). In some aspects of any of the embodiments, the subject has follicular lymphoma (FL). In certain embodiments, subjects treated using the methods provided herein include those having follicular lymphoma (FL) or DLBCL transformed from another low-grade lymphoma. In certain embodiments, subjects treated using the methods provided herein include those having DLBCL transformed from low-grade histology (tDLBCL). In some embodiments, the subject has DLBCL transformed from marginal zone lymphoma (MZL) or chronic lymphocytic leukemia (CLL) (e.g., Richter's disease).In some embodiments, a subject having transformation from CLL may exhibit Richter syndrome (RS), defined as transformation from CLL to an aggressive lymphoma, most commonly diffuse large B-cell lymphoma (DLBCL) (see, e.g., Parikh et al. Blood 2014 123:1647-1657).

[0091] In some embodiments, the subject has mantle cell lymphoma (MCL). In some embodiments, MCL is characterized by the chromosomal translocation t(11:14)(q13;132) (Vose JM, et al. Am J Hematol. 2017.; 92:806-813). In some embodiments, the subject has poor risk factors including TP53 mutations and / or a high proliferation index (Ki67>30%). In some embodiments, the subject has poor risk factors including a history of bone marrow lesions, a history of pleural effusion, and / or CNS disease. In some embodiments, the subject has poor risk factors including MCL variants. In some embodiments, the subject has a blastoid cell variant of MCL. In some embodiments, the subject has a polymorphic variant of MCL. In some embodiments, the subject has relapsed / refractory (R / R) mantle cell lymphoma (MCL) that has failed after one or more prior lines of therapy. In some embodiments, the subject has relapsed / refractory (R / R) mantle cell lymphoma (MCL) that has failed after one prior line of therapy. In some embodiments, the subject has relapsed / refractory (R / R) mantle cell lymphoma (MCL) that has failed after 1, 2, 3, 4, 5, 6, or 7 prior lines of therapy. In some embodiments, the subject has received ibrutinib and / or venetoclax. In some embodiments, the subject has MCL that has relapsed after receiving ibrutinib and / or venetoclax. In some embodiments, the subject has received one or more prior lines of immunochemotherapy containing anthracyclines and CD20-targeting agents (e.g., R-CHOP).

[0092] In some embodiments, the subject has received one or more prior lines of immunochemotherapy containing rituximab, dexamethasone, cytarabine, and cisplatin (R-DHAP). In some embodiments, the subject has received one or more prior lines of immunochemotherapy containing rituximab, ifosfamide, carboplatin, and etoposide (R-ICE). In some embodiments, the subject has received one or more prior lines of immunochemotherapy containing rituximab, gemcitabine, dexamethasone, and cisplatin (R-GDP).

[0093] In some embodiments, the subject has received prior hematopoietic stem cell therapy (HSCT), such as allogeneic HSCT or autologous HSCT. In some embodiments, the subject has confirmed cyclin D1-expressing MCL with R / R disease.

[0094] In some aspects of any of the embodiments, at or prior to administration of the dose of the cells, the subject is or has been treated with an anthracycline and one or more CD20 targeting agents. In some aspects of any of the embodiments, the one or more CD20 targeting agents include rituximab. In some aspects of any of the embodiments, the one or more CD20 targeting agents include R-CHOP (rituximab, cyclophosphamide, doxorubicin hydrochloride (hydroxydaunomycin), vincristine sulfate (Oncovin), and prednisone).

[0095] In some embodiments, the subject has a poor performance status. In some aspects, the population to be treated includes subjects with an Eastern Cooperative Oncology Group Performance Status (ECOG) of 0 to 2. In any other aspect of the embodiments, the subjects to be treated include those with ECOG 0 to 1, or do not include subjects with ECOG 2. In some aspects of any of the embodiments, the subject to be treated has failed one prior therapy. In some aspects of any of the embodiments, the subject to be treated has failed two or more prior therapies. In some embodiments, the subject does not have DLBCL transformed from marginal zone lymphoma (MZL) or chronic lymphocytic leukemia (CLL) (e.g., Richter's disease). In some embodiments, the subject has characteristics correlated with a poor overall survival. In some embodiments, the subject has not achieved a complete response (CR), has not received autologous stem cell transplantation (ASCT), is refractory to one or more second-line therapies, has a primary refractory disease, and / or has an ECOG performance score of 2 or an ECOG score of 0 to 1. In some embodiments, the subject has an ECOG performance status of 0 or 1, or has been determined to be so.

[0096] In some embodiments, the subject to be treated includes a group of subjects with diffuse large B-cell lymphoma (DLBCL) transformed de novo or from low-grade lymphoma (not otherwise specified, NOS), primary mediastinal large B-cell lymphoma (PMBCL), and follicular lymphoma grade 3b (FL3B) with an ECOG score of 0-2 after failure of two lines of therapy, and the subject may have been previously treated with allogeneic stem cell transplantation (SCT). In some parts of any of the embodiments, the subject to be treated has follicular lymphoma (FL). In some parts of any of the embodiments, at the time of or prior to administration of the cell dose, the subject is identified as having or being likely to have double / triple hit lymphoma. In some parts of any of the embodiments, the subject is identified as having or being chemotherapy-resistant lymphoma, such as chemotherapy-resistant DLBCL, as appropriate. In some parts of any of the embodiments, the subject has not achieved a complete remission (CR) in response to prior therapy. In some parts of any of the embodiments, the subject relapsed within or less than 1 year after receiving autologous stem cell transplantation (ASCT).

[0097] In some embodiments, the subject to be treated includes a group of subjects with diffuse large B-cell lymphoma (DLBCL) transformed de novo or from low-grade lymphoma (not otherwise specified, NOS), primary mediastinal large B-cell lymphoma (PMBCL), and follicular lymphoma grade 3b (FL3B) after failure of one line of therapy.

[0098] In some aspects, provided are compositions, methods, and uses for administering a defined composition of a cell therapy at a specific dose, related to high efficacy and / or high durability of efficacy, and low toxicity levels and / or incidence of toxicity. In some embodiments, the composition or dose administered is a fixed dose and / or a constant dose, such as an exact fixed dose of cells having a particular phenotype and / or one or more cells, e.g., a specific number of such cells, or a number within a particular range and / or degree of variation or dispersion compared to a target number. In some embodiments, the composition or dose administered is CD4 + cells and CD8+ a defined ratio of cells (e.g., CD4 + :CD8 + CAR + T cell ratio of 1:1), and / or a ratio within a certain range of variability from such a ratio, e.g., a ratio with a degree of variation or dispersion of ±10% or less, e.g., ±8% or less, e.g., ±10% or less, e.g., ±8% or less. In some embodiments, the CD4 + cells and CD8 + cells are formulated and administered individually. In some embodiments, the administered cells exhibit consistent activity and / or function, such as cytokine production, apoptosis and / or expansion. In some embodiments, the provided composition is highly consistent, has a defined activity, and exhibits low variability between cells, e.g., in terms of cell number, cell function and / or cell activity, within the composition or between preparations. In some embodiments, the consistency of activity and / or function, e.g., the low variability between preparations of the composition, enables improvement in efficacy and / or safety. In some embodiments, the administration of the defined composition results in lower product variability and lower toxicity, e.g., CRS or neurotoxicity, compared to the administration of a cell composition having high heterogeneity. In some embodiments, the defined consistent composition also exhibits consistent cell expansion. Such consistency can facilitate the identification of factors in a subject that may correlate with dose, therapeutic window, assessment of dose response, safety or toxicity outcome.

[0099] In some embodiments, in certain cohorts of subjects receiving a single injection at a specific dose level, a sustained response rate after 6 months exceeding 60% can be achieved. In some embodiments, subjects in some cohorts can achieve an overall response rate (ORR, also known as objective response rate in some cases) exceeding 80%, a complete response (CR) rate exceeding 60%, and / or a high sustained CR rate at the 6-month time point. In some embodiments, subjects receiving a defined dose exhibit improved safety outcomes, for example, more than two-thirds of the subjects do not exhibit CRS or NT. In some aspects, the proportion of severe CRS or severe NT is low. In some embodiments, the high exposures (e.g., C max and AUC 0~28 ) observed at a specific defined dose are not associated with an increase in toxicity, such as CRS or NT. In some embodiments, specific factors of the subject, such as specific biomarkers, can be used to predict the risk of toxicity. In some embodiments, the provided embodiments have a low risk of toxicity and can be used to achieve a high response rate.

[0100] In some embodiments, 25% or less, 20% or less, 15% or less, 10% or less, or 5% or less of the subjects treated using the provided compositions, articles of manufacture, kits, methods, and uses are administered agents (e.g., tocilizumab and / or dexamethasone) to improve, treat, or prevent toxicity before or after administration of the cell therapy. In some embodiments, the subject is not administered any prophylactic treatment before receiving the engineered cells (e.g., CAR-T cells).

[0101] In some embodiments, the provided embodiments offer the advantage of enabling, for example, the administration of cell therapies based on an outpatient basis. CAR T cell therapy has generally been administered in an inpatient setting, such as a university medical center. However, many of the subjects with R / R diffuse large B cell lymphoma receive therapy at medical centers that perform outpatient delivery of cancer therapies. In some aspects, the infusion and management of CAR T cell therapy in an outpatient setting can improve access to such treatments, including the widespread use of outpatient procedures at non-academic / non-university centers. In some embodiments, the administration of the cell dose and / or lymphodepletion therapy is performed at a non-tertiary medical center. In some embodiments, the administration of a cell therapy, such as a dose of T cells in accordance with the provided embodiments, can be performed on an outpatient basis or without the need for inpatient stays for the subject, such as an overnight stay. In some embodiments, such outpatient administration enables improved access and cost savings while maintaining a high durable response rate with low toxicity. In some aspects, outpatient procedures are advantageous for patients who are already immunocompromised, for example, after lymphodepletion, and have a high risk of exposure in a hospital stay or inpatient setting, due to pretreatment. In some aspects, outpatient procedures also increase the options for treating subjects who do not have access to inpatient facilities, hospital environments, or transplant centers, thereby expanding access to treatment. In some embodiments, after the administration of the cell dose, the subject may be monitored in an outpatient environment and monitored via telephone contact and / or visits by medical professionals.

[0102] In some embodiments, the subject to be treated based on outpatient using the provided compositions, manufactured articles, kits, methods, and uses spends at least 3 days as an outpatient, or a certain percentage of the subjects, such as at least 60%, at least 70%, at least 80%, at least 85%, at least 90% or at least 95% of the subjects so treated spend at least 3 days as an outpatient. In some aspects, the subject remains an outpatient for at least 4 days, 5 days, 6 days, 7 days, 8 days or more. In some embodiments, the subject treated using the provided compositions, manufactured articles, kits, methods, and uses shows a reduction in hospital stay of, for example, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35% or at least 40% compared to a subject treated using other compositions, manufactured articles, kits, methods, and uses.

[0103] In some embodiments, the methods, cells, and compositions can provide a high rate of durable response to a subject across various patient characteristics and / or tumor burdens. In some embodiments, the methods, cells, and compositions can provide a high rate of durable response to patients at high risk of poor prognosis while reducing the risk of adverse effects or toxicity. In some embodiments, the methods and uses provide or achieve a higher response rate and / or a higher durable response or efficacy and / or a reduced risk of toxicity or other side effects associated with cell therapy, such as neurotoxicity (NT) or cytokine release syndrome (CRS). In some aspects, the provided observations showed a low rate of severe NT (sNT) or severe CRS (sCRS) and a high rate of patients with no toxicity, such as NT or CRS.

[0104] In some embodiments, at least 35%, at least 40%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% or more of the subjects treated according to the provided method and / or using the provided manufactured article or composition achieve a complete response (CR). In some embodiments, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the subjects treated according to the provided method and / or using the provided manufactured article or composition achieve an objective response (OR). In some embodiments, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or more of the subjects treated according to the provided method and / or using the provided manufactured article or composition achieve CR or OR by 1 month, 2 months, or 3 months later.

[0105] In some embodiments, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% or more of the subjects treated according to the provided method and / or with the provided product or composition remain in response, for example, remain in CR or OR, starting at 3 months, 4 months, 5 months, 6 months or more after the initiation of administration of the cell therapy. In some embodiments, such responses as CR or OR persist for at least 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, or 9 months, for example, in at least or at least about 60%, at least 70%, at least 80%, at least 90%, at least 95% or more of the subjects treated according to the provided method, or in such subjects who achieve CR by 1 month or 3 months. In some embodiments, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or more of the subjects treated according to the provided method and / or with the provided product or composition, or such subjects who achieve CR by 1 month or 3 months, survive or survive without progression beyond 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, or 9 months, or beyond about 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, or 9 months.

[0106] In some embodiments, the efficacy, as a result observed in such a subject by the provided method and / or treatment according to the provided manufactured product or composition, is associated with or results in a low risk of any toxicity or a low risk of severe toxicity in the majority of the treated subjects. In some embodiments, 30%, 35%, 40%, 50%, 55%, more than 60% or more, or about 30%, 35%, 40%, 50%, 55%, more than 60% or more of the subjects treated according to the provided method and / or with the provided manufactured product or composition do not exhibit any grade of CRS or any grade of neurotoxicity (NT). In some embodiments, 50%, 60%, 70%, more than 80% or more, or about 50%, 60%, 70%, more than 80% or more of the subjects treated according to the provided method and / or with the provided manufactured product or composition do not exhibit severe CRS or CRS of grade 3 or higher. In some embodiments, 50%, 60%, 70%, more than 80% or more, or about 50%, 60%, 70%, more than 80% or more of the subjects treated by the provided method and / or with the provided manufactured product or composition do not exhibit severe neurotoxicity or neurotoxicity of grade 3 or higher, such as grade 4 or 5 neurotoxicity.

[0107] In some embodiments, at least 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or at least about 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the subjects treated according to the method and / or with the manufactured product or composition provided do not exhibit early-onset CRS or neurotoxicity, and / or do not exhibit onset of CRS earlier than 1 day, 2 days, 3 days, or 4 days after the start of administration. In some embodiments, at least 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or at least about 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the subjects treated according to the method and / or with the manufactured product or composition provided do not exhibit onset of neurotoxicity earlier than 3 days, 4 days, 5 days, 6 days, or 7 days after the start of administration. In some aspects, the median onset of neurotoxicity in the subjects treated according to the method and / or with the manufactured product or composition provided is at, after, or after the median peak of CRS or the median time to resolution of CRS in the subjects treated according to the method. In some cases, the median onset of neurotoxicity in the subjects treated according to the method exceeds 8, 9, 10, or 11 days or about 8, 9, 10, or 11 days.

[0108] In some embodiments, such results are obtained with 5×10 7 or about 5×10 7 ~1.5×10 8 or about 1.5×10 8 cells, e.g., 5×10 7 or about 5×10 7 ~1×10 8 or about 1×10 8 total recombinant receptor-expressing T cells (e.g., CAR+ T cells), e.g., at a defined ratio as described herein, e.g., at a ratio of 1:1 or about 1:1, of CD4 + and CD8 + T cells in the T cell dose, and / or CAR +An exact or fixed or constant number of T cells, or a particular type of CAR + T cells, such as, CD4 + CAR + T cells and / or CD8 + CAR + An exact or fixed or constant number of T cells, and / or + or - (plus or minus, sometimes indicated as ±), 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15% or less, such as within a particular degree of dispersion, compared to such an exact or fixed or constant number, is observed after administration of any number of such cells. In some embodiments, such a fixed or constant number of cells is 2.5×10 7 , 5×10 7 , 10×10 7 , 15×10 7 or 20×10 7 cells, or about 2.5×10 7 , 5×10 7 , 10×10 7 , 15×10 7 or 20×10 7 cells of, for example, all CAR + T cells, or CD8 + and / or CD4 + CAR + T cells. In some embodiments, the number of cells in the dose is 5×10 7 cells of CD4 + CAR + T cells (optionally, 2.5×10 7 cells of CD4 + CAR + T cells and 2.5×10 7 cells of CD8 + CAR + T cells) comprises or consists of or consists essentially of; in some embodiments, 10×10 7 cells of CAR + T cells (optionally, 5×10 7 cells of CD4 + CAR + T cells and 5×10 7 cells of CD8 + CAR+ comprising, consisting of, or consisting essentially of T cells. In some embodiments, the dose is 90 - 110×10 6 viable CAR-positive T cells. In some embodiments, the dose is 100×10 6 viable CAR-positive T cells. In some embodiments, the number of cells administered is within a range of some variation of such a number in the foregoing embodiments, e.g., plus or minus (±) 5, 6, 7, 8, 9, or 10% compared to such a number of cells, e.g., within plus or minus 8% of such a number of cells. In some embodiments, the dose is within a range (linear relationship, as appropriate) in which a correlation is observed between such a number of cells (e.g., CAR + T cells, or CD8 + and / or CD4 + CAR + T cell total), and the treatment response, or the duration thereof (e.g., the likelihood of achieving remission, complete remission, and / or a specific remission duration), and / or one or more outcomes indicating any of the foregoing durations. In some embodiments, administering a higher dose of cells can result in a greater therapeutic effect without or substantially without affecting or acting on the incidence or risk of toxicity (e.g., CRS or neurotoxicity) in the subject, or the degree of the incidence or risk of toxicity, e.g., severe CRS or severe neurotoxicity.

[0109] In some embodiments, the provided method can achieve a high response rate or a specific response rate (e.g., the response rate among populations evaluated after a certain period of administration, such as after 3 months or 6 months), e.g., an ORR of 40% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or 80% or 81%, 82%, 83%, 84% or 85% or more (such as the ORR at 6 months or 3 months) and a CR rate of 30% or more, 35% or more, 40% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 71%, 72%, 73% or more or approximately 75% or more, which is persistent, such as for a specific period or at least a specific period, e.g., lasting for 1, 3 or 6 months or more or 9 months or more after the start of treatment. In some embodiments, such response rates and persistence are obtained with only a single administration or dose of such treatment. Treatment of such subjects by the provided method, and / or the provided manufactured product or composition, in some embodiments, also results in the outcome that the subject does not exhibit a high incidence of toxic manifestations such as neurotoxicity or CRS, even at high cell doses while achieving a high response rate. In some embodiments, about 50%, 55% or 60% or a greater proportion of the subjects who have achieved such a response do not develop any grade of toxicity, e.g., any grade of CRS and / or neurotoxicity.

[0110] Thus, in some embodiments, the provided method, manufactured product, and / or composition can provide advantages over other available methods or solutions or approaches for treatments such as adoptive cell therapy. In particular, some of the provided embodiments provide advantages to subjects with LBCL by achieving sustained responses at high rates while reducing the incidence of toxicity or side effects.

[0111] A. Treatment Method Provided herein are treatment methods involving administering engineered cells, or compositions containing engineered cells such as engineered T cells. Also provided are methods, uses of engineered cells (e.g., T cells) and / or their compositions, including methods for treating a subject having a B cell malignancy, such as large cell type B cell lymphoma (LBCL), involving administering the engineered cells and / or their compositions. In some embodiments, the provided methods and uses can achieve improved efficacy and / or more sustained efficacy or effectiveness and / or reduced risk of toxicity or other side effects, compared to certain alternative methods, for example, in a particular group of treated subjects. In some aspects, also provided is a method of administering to a subject, e.g., a subject having a disease or disorder, an engineered cell or a composition containing an engineered cell, such as an engineered T cell. In some aspects, also provided is the use of an engineered cell, or a composition containing an engineered cell, such as an engineered T cell, for treating a disease or disorder. In some aspects, also provided is the use of an engineered cell, or a composition containing an engineered cell, such as an engineered T cell, for the manufacture of a medicament for treating a disease or disorder. In some aspects, also provided is a method of administering an engineered cell, or a composition containing an engineered cell, such as an engineered T cell, for use in treating a disease or disorder or for administration to a subject having a disease or disorder. In some aspects, the use of an engineered cell, or a composition containing an engineered cell, such as an engineered T cell, is consistent with any of the methods described herein. In some embodiments, the disease or disorder is LBCL, including LBCL that is refractory or relapsed to first line chemoimmunotherapy.

[0112] Engineered cells that express recombinant receptors such as chimeric antigen receptors (CARs), or compositions containing the same, are useful in a variety of therapeutic, diagnostic, and prophylactic applications. For example, engineered cells or compositions containing engineered cells are useful for treating a variety of diseases and disorders in a subject. Such methods and uses include, for example, therapeutic methods and uses involving the administration of engineered cells or compositions containing the same to a subject having a B cell malignancy, such as large cell type B cell lymphoma (LBCL). In some embodiments, the engineered cells or compositions containing the same are administered in an effective amount to affect the treatment of a disease or disorder. Uses include the use of engineered cells or compositions in such methods and treatments, and in the preparation of pharmaceuticals for performing such therapeutic methods. In some embodiments, the method is performed by administering an engineered cell or a composition containing the same to a subject having or suspected of having a B cell malignancy (such as LBCL). In some embodiments, the method thereby treats the disorder cell malignancy (such as, LBCL) in the subject.

[0113] General methods for the administration of cells for adoptive cell therapy are known and can be used in connection with the provided methods and compositions. For example, methods of adoptive T cell therapy are described, for example, in US Patent Application Publication No. 2003 / 0170238 to Gruenberg et al.; US Patent No. 4,690,915 to Rosenberg; Rosenberg (2011) Nat Rev Clin Oncol. 8(10):577-85. See, for example, Themeli et al. (2013) Nat Biotechnol. 31(10): 928-933; Tsukahara et al. (2013) Biochem Biophys Res Commun 438(1): 84-9; Davila et al. (2013) PLoS ONE 8(4): e61338.

[0114] In some embodiments, the disease or condition being treated is a B cell malignancy. In some embodiments, the disease or condition being treated is large B cell lymphoma (LBCL). In some embodiments, the LBCL is selected from the group consisting of diffuse large B cell lymphoma (DLBCL) not otherwise specified (including DLBCL arising from low-grade lymphoma), high-grade B cell lymphoma, primary mediastinal large B cell lymphoma, and follicular lymphoma grade 3B.

[0115] In some embodiments, the disease or condition being treated according to the provided method, use, or article of manufacture is DLBCL. In some aspects, the DLBCL is diffuse large B cell lymphoma not otherwise specified (NOS). In some embodiments, the DLBCL NOS arises from low-grade lymphoma.

[0116] In some embodiments, a subject having DLBCL, NOS being treated according to any of the provided methods has DLBCL that is not extranodal-predominant DLBCL, DLBCL that is not a large cell lymphoma of terminally differentiated B cells, or DLBCL that is not a B cell neoplasm having intermediate features between DLBCL and other lymphoid tumors.

[0117] In some embodiments, a subject having DLBCL, NOS being treated according to any of the provided methods has DLBCL that is not T cell / histiocyte-rich large B cell lymphoma (TCHRBCL), DLBCL that is not primary DLBCL of the central nervous system (CNS), cutaneous primary DLBCL, leg-type DLBCL, or Epstein-Barr virus (EBV)-positive DLBCL (e.g., EBV-positive DLBCL in the elderly), and in some cases, DLBCL that is not DLBCL associated with chronic inflammation.

[0118] In some embodiments, a subject having DLBCL, NOS treated according to any of the provided methods has a high-grade B-cell lymphoma that is not B-lymphoblastic leukemia / lymphoma (B-LBL), a high-grade B-cell lymphoma that is not Burkitt lymphoma, or a high-grade B-cell lymphoma that does not have MYC and BCL2 and / or BCL6 rearrangement. In some aspects, the DLBCL is DLBCL, NOS, which can in some cases be characterized as a high-grade B-cell lymphoma that is not B-lymphoblastic leukemia / lymphoma (B-LBL), a high-grade B-cell lymphoma that is not Burkitt lymphoma, or a high-grade B-cell lymphoma that does not have MYC and BCL2 and / or BCL6 rearrangement.

[0119] In some embodiments, a subject having DLBCL, NOS treated according to any of the provided methods has DLBCL that is germinal center B-cell-like (GCB) and activated B-cell-like (ABC) based on the molecular and / or cytogenetic characteristics of the originating cells.

[0120] In some embodiments, the DLBCL is de novo or primary DLBCL. In some embodiments, the disease or condition (e.g., a lymphoma such as DLBCL) is transformed from a different subtype of disease or condition, such as transformation from a low-grade lymphoma such as follicular lymphoma (FL). In some embodiments, such other low-grade lymphomas can include, for example, marginal zone B-cell lymphoma (MZL) and chronic lymphocytic leukemia / small lymphocytic lymphoma (CLL / SLL). In some embodiments, the disease or condition is DLBCL transformed from follicular lymphoma (tFL), and in some aspects, DLBCL transformed from another low-grade lymphoma. In some embodiments, the subject is characterized as having or suspected of having transformed follicular lymphoma (tFL). In some embodiments, the disease or condition is DLBCL transformed from FL. In some aspects, the disease or condition is DLBCL transformed from a low-grade lymphoma other than FL.

[0121] In some embodiments, the disease or condition to be treated according to the provided method, use, or manufactured article is DLBCL transformed from another low-grade lymphoma, e.g., DLBCL transformed from marginal zone lymphoma (tMZL) or DLBCL transformed from chronic lymphocytic leukemia (tCLL; Richter’s). In some cases, the disease or condition is DLBCL tMZL or DLBCL tCLL. In some embodiments, it is a disease or condition transformed from a low-grade lymphoma other than FL. In some embodiments, it is DLBCL or large cell type B-cell lymphoma, e.g., DLBCL or large cell type B-cell lymphoma transformed from FL or other low-grade lymphomas. In some embodiments, the subject is characterized by having DLBCL transformed from another low-grade lymphoma such as DLBCL tMZL or DLBCL tCLL.

[0122] In some embodiments, the disease or condition is high-grade B-cell lymphoma.

[0123] In some embodiments, the disease or condition is primary mediastinal B-cell lymphoma.

[0124] In some embodiments, the disease or condition is follicular lymphoma (FL). In some embodiments, the subject is selected for treatment if the subject has follicular lymphoma (FL). In some embodiments, FL exhibits or is associated with neoplastic follicles showing attenuated mantle zones, loss of polarization, and / or absence of tangible body macrophages. In some embodiments, FL is associated with a mixture of centrocytes and centroblasts. In some embodiments, FL is not associated with centrocytes.

[0125] In some embodiments, the disease or condition is FL grade 3B. In some embodiments, grade 3 FL shows or is associated with more than 15 centroblasts per high power field (HPF). In some embodiments, FL is associated with co-expression of CD10, BCL6, and BCL2 within follicles. In some embodiments, FL is associated with or characterized by t(14;18) / IGH-BCL2 and / or BCL6 rearrangement. In some embodiments, FL is associated with the t(14;18)(q32;q21) translocation. In some aspects, the t(14;18)(q32;q21) translocation places BCL2 expression under the control of the immunoglobulin (Ig) heavy chain (IGH) enhancer. In some aspects, t(14;18) is detected in approximately 90% of grade 1 and 2 FL, 60-70% of grade 3A, and 15-30% of grade 3B FL cases. In some embodiments, FL is associated with the BCL2 translocations t(2;18) and t(18;22). In some embodiments, FL associated with the t(2;18) and t(18;22) translocations is also associated with BCL6 rearrangement. In some parts of any embodiment, FL is associated with co-expression of CD10, BCL6, and BCL2 within follicles, and / or t(14;18) / (q32;q21)(IGH-BCL2) and / or BCL6 rearrangement.

[0126] In some embodiments, FL involves lymph nodes and / or the spleen, bone marrow, peripheral blood, and other extranodal sites. In some embodiments, FL involves lymph nodes. In some aspects, exemplary features associated with FL include those described in Choi et al. (2018) Arch Pathol Lab Med 142:1330-1340; Luminari et al., (2012) Rev. Brad. Hematol. Hemoter., 34:54-59 and Salles (2007) ASH Education Book, 2007:216-25. In some aspects, exemplary parameters used to assess the degree of disease burden in the case of FL include hemoglobin level (e.g., <12 g / dL or <10 g / dL), erythrocyte sedimentation rate (ESR), lactate dehydrogenase (LDH) level, and β2-microglobulin (B2M) value, gene expression, single nucleotide polymorphism (SNP; e.g., in IL-8, IL-2, IL-12B, and IL1RN), miRNA expression, and protein expression (e.g., CD68, STAT1, FOXP3, CD57). (Salles (2007) ASH Education Book, 2007:216-25). In the case of FL, the degree or burden of the disease can be assessed by the Ann Arbor staging system, tumor mass, bulky lesions, the number of lymph node or extranodal disease sites, and / or bone marrow lesions.

[0127] In some embodiments, the survival rate in a subject having FL, such as a subject, is based on a scoring system developed by the Italian Lymphoma Intergroup (ILI) and / or the International Follicular Lymphoma Prognostic Factor Project (IFLPFP). (Luminari et al., (2012) Rev. Brad. Hematol. Hemoter., 34:54-59). In some embodiments, the ILI score is based on the independent prognostic roles of age, gender, B symptoms, number of extranodal sites, erythrocyte sedimentation rate (ESR) and lactate dehydrogenase (LDH). In some embodiments, the IFLPFP score is based on the risk factors of age, Ann Arbor stage, hemoglobin level, number of nodal sites and serum LDH level. In some cases, the IFLPFP score may be used to characterize or predict the overall survival rate of a subject having FL.

[0128] In some embodiments, the dose of T cells comprises a dose of CD4 + and CD8 + T cells, each dose of T cells comprising a recombinant receptor that specifically binds to CD19, and the administration comprises administering a plurality of separate compositions, the plurality of separate compositions comprising a first composition comprising CD8 + T cells and a second composition comprising CD4 + T cells.

[0129] In some embodiments, the disease or condition is extranodal high-grade non-Hodgkin B-cell lymphoma. In some embodiments, the extranodal high-grade non-Hodgkin B-cell lymphoma is primary CNS lymphoma (PCNSL). In some embodiments, PCNSL involves the central nervous system (CNS) in the absence of systemic lymphoma. In some embodiments, PCNSL is restricted to the brain, spine, cerebrospinal fluid (CSF), and eyes. In some embodiments, PCNSL is diffuse large B-cell lymphoma (DLBCL). In some embodiments, PCNSL is Burkitt, low-grade or T-cell lymphoma. In some embodiments, PCNSL includes neurological signs. In some embodiments, the neurological signs include focal neurological deficits, changes in mental status and behavior, symptoms of increased intracranial pressure, and / or seizures. In some embodiments, exemplary features associated with the disease or condition include those described in Grommes et al. (J. Clin Oncol 2017; 35(21):2410-18).

[0130] In some embodiments, the subject to be treated according to the methods provided herein does not have primary central nervous system lymphoma (PCNSL).

[0131] In some embodiments, the disease or condition is secondary CNS lymphoma (SCNSL). In some embodiments, SCNSL is in a patient with systemic lymphoma. In some embodiments, SCNSL is referred to as metastatic lymphoma. In some embodiments, SCNSL is DLBCL. In some embodiments, SCNSL is an aggressive lymphoma that can involve the brain, meninges, spinal cord, and eyes. In some embodiments, SCNSL includes leptomeningeal spread metastases. In some embodiments, SCNSL includes parenchymal brain disease. In some embodiments, exemplary features associated with the disease or condition include those described in Malikova et al. (Neurophychiatric Disease and Treatment 2018; 14:733-40.).

[0132] In some embodiments, the disease or condition is a high-grade B-cell lymphoma having MYC and BCL2 and / or BCL6 rearrangement, and may have DLBCL histology (double / triple-hit lymphoma (DHL / THL)). In some embodiments, the disease or condition is DLBCL NOS (de novo or transformation from low-grade). In some embodiments, the disease or condition is primary mediastinal B-cell lymphoma (PMBCL) or follicular lymphoma grade 3B (FL3B). In some embodiments, the disease or condition is T cell / histiocyte-rich large B-cell lymphoma (THRBCL). In some embodiments, the disease or condition is FL3B. In some embodiments, it is DLBCL having CNS lesions. In some embodiments, the subject has a recurrence of DLBCL in the central nervous system (secondary CNS lymphoma). In some embodiments, the secondary CNS lymphoma involves the brain parenchyma and / or leptomeninges. In some embodiments, the subject has been treated with or has previously received at least or at least about or about 1, 2, 3, 4, or 5 other therapies to treat the disease or disorder. In some embodiments, the subject has previously received methotrexate, thiotepa, and / or cytarabine. In some embodiments, the subject has MCL that recurred after receiving methotrexate, thiotepa, and / or cytarabine. In some embodiments, the subject has previously received prior hematopoietic stem cell therapy (HSCT), such as allogeneic HSCT or autologous HSCT.

[0133] In some embodiments, the subject has, or is identified as having, double / triple hit lymphoma or lymphoma of the double / triple hit molecular subtype. In some embodiments, the lymphoma is double hit lymphoma characterized by the presence of a rearrangement (e.g., translocation) of the MYC (myelocytomatosis oncogene), BCL2 (B-cell lymphoma 2), and / or BCL6 (B-cell lymphoma 6) genes. In some embodiments, the gene rearrangement affects the MYC / 8q24 locus in combination with another gene rearrangement. For example, other gene rearrangements include t(14;18)(q32;q21) in which BCL2 is involved. In some embodiments, the gene rearrangement affects the MYC / 8q24 locus in combination with BCL6 / 3q27. In some embodiments, the lymphoma is triple hit lymphoma characterized by the presence of MYC, BCL2, and BCL6 gene rearrangements; see, for example, Aukema et al., (2011) Blood 117:2319-2331. In some aspects of such embodiments, the subject is ECOG 0-1 and does not have, is not suspected of having, or is not characterized as having DLBCL transformed from MZL or CLL. In aspects, the present therapy is indicated for such subjects and / or the instructions indicate administration to subjects within such populations. In some embodiments, based on the 2016 WHO criteria (Swerdlow et al., (2016) Blood 127(20):2375-2390), double / triple hit lymphoma may be considered high grade B-cell lymphoma (double / triple hit) with MYC and BCL2 and / or BCL6 rearrangements by DLBCL histology.

[0134] In some embodiments, NHL can be staged based on the Lugano classification (see, e.g., Cheson et al., (2014) JCO 32(27):3059-3067; Cheson, B.D. (2015) Chin Clin Oncol 4(1):5). In some cases, the stage is described by Roman numerals I-IV (1-4), and limited-stage (I or II) lymphoma affecting organs outside the lymphatic system (extranodal organs) is denoted by E. Stage I represents a lesion in one lymph node or adjacent group of lymph nodes, or a single extranodal lesion (IE) without lymph node involvement. Stage 2 represents stage I or II by the extent of lymph nodes, limited to lesions in two or more groups of lymph nodes on the same side of the diaphragm, or contiguous extranodal lesions (IIE). Stage III represents lesions in lymph nodes on both sides of the diaphragm or above the diaphragm and lesions of the spleen. Stage IV indicates additional non-contiguous extranodal lesions. Additionally, "bulky tumor lesions" can be used to describe large chest tumors, particularly in stage II. The extent of the disease is determined by positron emission tomography (PET)-computed tomography (CT) in avid lymphomas and by CT in non-avid lymphomas. In some parts of any of the embodiments, at the time of or prior to administration of the cell dose, the subject to be treated according to the provided embodiments has a positron emission tomography (PET)-positive disease.

[0135] In some parts of any of the embodiments, at the time of or prior to administration of the cell dose, if the subject has received CD19-targeted pre-treatment, a biological sample obtained from the subject after CD19-targeted pre-treatment contains cells expressing CD19.

[0136] In some embodiments, the Eastern Cooperative Oncology Group (ECOG) Performance Status metric can be used to evaluate or select subjects for treatment, e.g., subjects with poor performance from prior therapy (see, e.g., Oken et al. (1982) Am J Clin Oncol. 5:649-655). The ECOG Scale of Performance Status describes the functional level of a patient with respect to the patient's ability to care for self, perform daily activities, and physical capabilities (e.g., walking, working, etc.). In some embodiments, an ECOG Performance Status of 0 indicates that the subject is able to perform normal activities. In some aspects, a subject with an ECOG Performance Status of 1 demonstrates some limitation in physical activity but is fully ambulatory. In some aspects, a patient with an ECOG Performance Status of 2 is more than 50% ambulatory. In some cases, a subject with an ECOG Performance Status of 2 may be able to perform self-care; see, e.g., Sorensen et al., (1993) Br J Cancer 67(4) 773-775. The criteria reflecting the ECOG Performance Status are set forth in Table 1 below: [Table 1]

[0137] In some embodiments, at the time of administration of the dose of cells or immediately prior thereto, the subject has relapsed after remission following treatment with one or more prior therapies for the disease or condition other than another dose of cells expressing a CAR, or has become refractory thereto. In some embodiments, the subject has relapsed after remission following treatment with one, two, or more than two prior therapies (other than another dose of cells expressing a CAR), or has become refractory thereto. In some embodiments, the subject has relapsed after remission following treatment with one prior therapy (other than another dose of cells expressing a CAR), or has become refractory thereto, such that, for example, the dose of cells is a second-line therapy. In some embodiments, the subject has relapsed after remission following treatment with more than two prior therapies (other than another dose of cells expressing a CAR), or has become refractory thereto, such that, for example, the dose of cells is a third-line therapy or later therapy, such as a fourth-line therapy.

[0138] In some embodiments, the subject has a disease refractory to first-line chemoimmunotherapy or has relapsed within 12 months of first-line chemoimmunotherapy. In some embodiments, the subject has a disease refractory to first-line chemoimmunotherapy. In some embodiments, the subject has relapsed within 12 months of first-line chemoimmunotherapy. In some embodiments, the subject has primary refractory disease or relapse within 12 months of a complete response (CR) to first-line chemoimmunotherapy. In some embodiments, the subject has primary refractory disease within 12 months of a complete response (CR) to first-line chemoimmunotherapy. In some embodiments, the subject has relapsed within 12 months of a complete response (CR) to first-line chemoimmunotherapy.

[0139] In some embodiments, the subject has a disease refractory to first-line chemoimmunotherapy or has relapsed after first-line chemoimmunotherapy and is not eligible for hematopoietic stem cell transplantation (HSCT) due to a coexisting disease or age. In some embodiments, the subject has a disease refractory to first-line chemoimmunotherapy and is not eligible for hematopoietic stem cell transplantation (HSCT) due to a coexisting disease or age. In some embodiments, the subject has relapsed after first-line chemoimmunotherapy and is not eligible for hematopoietic stem cell transplantation (HSCT) due to a coexisting disease or age. In some embodiments, the subject is not eligible for HSCT due to a coexisting disease. In some embodiments, the subject is not eligible for HSCT due to age.

[0140] In some embodiments, the subject has a recurrent or refractory disease after second-line or greater systemic therapy. In some embodiments, the subject relapses after second-line or greater systemic therapy. In some embodiments, the subject has a refractory disease after second-line or greater systemic therapy.

[0141] In some embodiments, the subjects to be treated according to the provided embodiments include adult subjects having large B-cell lymphoma (LBCL), including diffuse large B-cell lymphoma (DLBCL) (including DLBCL arising from low-grade lymphoma) not otherwise specified, high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and follicular lymphoma grade 3B, where these subjects have a disease refractory to first-line chemoimmunotherapy or have relapsed within 12 months of first-line chemoimmunotherapy; have a disease refractory to first-line chemoimmunotherapy or have relapsed after first-line chemoimmunotherapy and are not eligible for hematopoietic stem cell transplantation (HSCT) due to coexisting disease or age; or have relapsed after second-line or greater systemic therapy or have a refractory disease. In some embodiments, the subjects to be treated according to the provided embodiments include adult subjects having large B-cell lymphoma, including diffuse large B-cell lymphoma (DLBCL) (including DLBCL arising from low-grade lymphoma) not otherwise specified, high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and follicular lymphoma grade 3B, where these subjects have a disease refractory to first-line chemoimmunotherapy or have relapsed within 12 months of first-line chemoimmunotherapy; or have a disease refractory to first-line chemoimmunotherapy or have relapsed after first-line chemoimmunotherapy and are not eligible for hematopoietic stem cell transplantation (HSCT) due to coexisting disease or age. In some embodiments, the subjects to be treated according to the provided embodiments include adult subjects having large B-cell lymphoma, including diffuse large B-cell lymphoma (DLBCL) (including DLBCL arising from low-grade lymphoma) not otherwise specified, high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and follicular lymphoma grade 3B, where these subjects have a disease refractory to first-line chemoimmunotherapy or relapse within 12 months of first-line chemoimmunotherapy.In some embodiments, the subjects to be treated according to the provided embodiments include, among others, diffuse large B-cell lymphoma (DLBCL) (including DLBCL arising from low-grade lymphoma) not otherwise specified, large B-cell lymphoma, high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and adult subjects with follicular lymphoma grade 3B, and these subjects have a disease refractory to first-line chemoimmunotherapy or relapse after first-line chemoimmunotherapy and are not eligible for hematopoietic stem cell transplantation (HSCT) due to comorbidities or age.

[0142] In some embodiments, the first-line chemoimmunotherapy is rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP). In some embodiments, R-CHOP was administered to the subject on a 14-day cycle (R-CHOP14). In some embodiments, R-CHOP was administered to the subject on a 21-day cycle (R-CHOP21). In some embodiments, the first-line chemoimmunotherapy is a modified R-CHOP in which rituximab is replaced with another anti-CD20 monoclonal antibody. In some embodiments, obinutuzumab or vincristine is replaced with polatuzumab vedotin. In some embodiments, the first-line chemoimmunotherapy was administered to the subject over 3 to 8 cycles. In some embodiments, the first-line chemoimmunotherapy was administered to the subject for more than 4 cycles. In some embodiments, the first-line chemoimmunotherapy was administered to the subject at 6 cycles or about 6 cycles.

[0143] In some embodiments, the first-line chemoimmunotherapy is rituximab, dexamethasone, cytarabine, and cisplatin (R-DHAP). In some embodiments, the first-line chemoimmunotherapy is rituximab, ifosfamide, carboplatin, and etoposide (R-ICE). In some embodiments, the first-line chemoimmunotherapy is rituximab, gemcitabine, dexamethasone, and cisplatin (R-GDP). In some embodiments, the first-line chemoimmunotherapy was administered to the subject for 3 cycles.

[0144] In some embodiments, the first-line chemoimmunotherapy is rituximab, doxorubicin, cyclophosphamide, vindesine, bleomycin, and prednisone (R-ACVBP). In some embodiments, the first-line chemoimmunotherapy is dose-adjusted etoposide, prednisone, vincristine, cyclophosphamide, doxorubicin, and rituximab (DA-EPOCH-R).

[0145] In some embodiments, a subject having secondary CNS lymphoma can be treated according to the provided embodiments. In some aspects, a subject who achieved a complete response after infusion of an anti-CD19 CAR but relapsed can be treated according to the provided embodiments. In some embodiments, a subject who has previously received engineered T cells expressing the same CAR+T cells, which is a CAR-expressing T cell therapy, and achieved stable disease (SD) as the best response after the first infusion can be treated according to the provided embodiments, for example, as a second infusion or cycle of CAR-expressing T cell therapy.

[0146] In some embodiments, the subject has not yet received treatment for relapsed or refractory lymphoma. In some embodiments, the subject is a potential candidate for autologous HSCT. In some embodiments, the subject has not yet received treatment for relapsed or refractory lymphoma and is a potential candidate for autologous HSCT.

[0147] In some embodiments, the subject is not eligible for high-dose therapy and autologous HSCT due to organ function or age, but has appropriate organ function for CAR-T cell therapy. In some embodiments, the subject has a left ventricular ejection fraction (LVEF) ≥ 40%, appropriate oxygen saturation in room air with dyspnea of grade 1 or less, AST and ALT ≤ 5 × ULN, total bilirubin < 2.0 mg / dL, creatinine clearance > 30 mL / min, bone marrow function appropriate for receiving lymphodepleting chemotherapy, or a combination thereof. In some embodiments, the subject is 70 years of age or older and has an adjusted carbon monoxide diffusing capacity of the lung (DLCO) ≤ 60%, LVEF < 50%, creatinine clearance < 60 mL / min, AST or ALT greater than 2 × ULN, an ECOG performance status of 2, or a combination thereof.

[0148] In some embodiments, the subject has an ECOG performance status ≤ 2, a history of autologous HSCT, a history of allogeneic HSCT, secondary CNS lymphoma lesions, or a combination thereof.

[0149] In some embodiments, the subject had bone marrow function appropriate for receiving lymphodepleting chemotherapy.

[0150] In some embodiments, if the subject is not eligible for transplantation, is over 75 years of age, has an ECOG performance status greater than 1, has a history of central nervous system (CNS) disorders (such as seizures or cerebrovascular ischemia), has an uncontrolled infection, has a creatinine clearance rate (CrCl) of less than 45 mL / min, has alanine aminotransferase (ALT) greater than 5 times the upper limit of normal (ULN), has a left ventricular ejection fraction (LVEF) of less than 40%, or in the absence of bone marrow lesions, has an absolute neutrophil count (ANC) of less than 1.0 × 10 9 cells / L or platelets of less than 50 × 10 9 cells / L, then the subject is excluded.

[0151] In some embodiments, the subject is excluded if they have a history of CNS disorders (such as seizures or cerebrovascular ischemia) or autoimmune diseases that require systemic immunosuppression.

[0152] In some embodiments, the subject is excluded if they have a creatinine clearance of less than 30 mL / min, an ALT above 5 times the upper limit of normal, or an LVEF of <40%.

[0153] In some embodiments, the subject is excluded if they have a history of a relevant CNS disorder (such as seizures or cerebrovascular ischemia), an ECOG performance status greater than 2, or an uncontrolled infection.

[0154] In some embodiments, at the time of or prior to administration of the cell dose, the subject is identified as having or having had relapsed or refractory large B-cell lymphoma; and / or the subject has been treated or has been treated with an anthracycline and one or more CD20-targeted agents; and / or the subject is or has been a relapsed or refractory disease after second-line or greater treatment or after autologous HSCT; and / or the ECOG performance status of the subject has been confirmed or has been confirmed to be 1 or 2; and / or, if the subject has previously received CD19-targeted therapy, a biological sample obtained from the subject after previous CD19-targeted therapy contains cells expressing CD19. In some embodiments, administration of the cell dose is by an external delivery.

[0155] In some embodiments, for example, in an outpatient setting, such as a non-tertiary center, subjects to be treated according to the provided embodiments include adult patients with relapsed / refractory LBCL. In some embodiments, for example, in an outpatient setting, subjects to be treated according to the provided embodiments include, among others, diffuse large B-cell lymphoma (DLBCL) (including DLBCL arising from low-grade lymphoma), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, or subjects having follicular lymphoma grade 3B that are not otherwise specified. In some embodiments, for example, in an outpatient setting, subjects to be treated according to the provided embodiments are either refractory to first-line chemoimmunotherapy or relapse within 12 months of first-line chemoimmunotherapy; are either refractory to first-line chemoimmunotherapy or relapse after first-line chemoimmunotherapy and are not eligible for hematopoietic stem cell transplantation (HSCT) due to coexisting disease or age; or are relapsed or refractory diseases after second-line or greater systemic therapy.

[0156] In some embodiments, subjects to be treated according to the provided embodiments include adult subjects who have relapsed from or are refractory to a single line of chemoimmunochemotherapy for LBCL. In some embodiments, subjects to be treated according to the provided embodiments include, among others, diffuse large B-cell lymphoma (DLBCL) (including DLBCL arising from low-grade lymphoma), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and subjects having follicular lymphoma grade 3B that are not otherwise specified. In some embodiments, the subject is not eligible for HSCT due to coexisting disease or age. In some embodiments, the subject has a disease refractory to first-line chemoimmunotherapy or relapses after first-line chemoimmunotherapy and is not eligible for hematopoietic stem cell transplantation (HSCT) due to coexisting disease or age.

[0157] In some embodiments, the disease or condition is large B-cell lymphoma (e.g., DLBCL) and the antigen is CD19.

[0158] In some embodiments, cell therapy, such as adoptive T cell therapy, is performed by autologous transfer, where the cells are isolated and / or otherwise prepared from a subject to receive the cell therapy, or a sample derived from such a subject. Thus, in some aspects, the cells are derived from a subject in need of treatment, such as a patient, and the isolated and processed cells are administered to the same subject.

[0159] In some embodiments, cell therapy, such as adoptive T cell therapy, is performed by allogeneic transfer, where the cells are isolated and / or otherwise prepared from a subject other than the subject to receive or ultimately receive the cell therapy, such as a first subject. In such embodiments, the cells are then administered to a different subject of the same species, such as a second subject. In some embodiments, the first subject and the second subject are genetically identical. In some embodiments, the first subject and the second subject are genetically similar. In some embodiments, the second subject expresses the same HLA class or supertype as the first subject.

[0160] The cells can be administered by any suitable means, such as bolus injection, injection, for example, intravenous injection or subcutaneous injection, intraocular injection, periocular injection, subretinal injection, intravitreal injection, transseptal injection, subtenon injection, subconjunctival injection, sub-Tenon's injection, posterior chamber injection, periorbital injection, or posterior uveal delivery. In some embodiments, the cells are administered by parenteral, intranasal, and intratracheal, and, if desired for local treatment, intralesional administration. Parenteral infusions include intramuscular, intravenous, arterial, intraperitoneal, or subcutaneous administration. In some embodiments, a given dose is administered as a single bolus dose of the cells. In some embodiments, a given dose is administered by multiple bolus doses of the cells, or by continuous infusion of the cells, over a period, for example, of up to 3 days. In some embodiments, administration of the cell dose or any additional therapy, such as lymphodepletion therapy, intervention therapy, and / or combination therapy, is by an outpatient delivery.

[0161] In some embodiments, administration of the cell dose or any additional therapy, such as lymphodepletion therapy, intervention therapy, and / or combination therapy, is by an inpatient delivery. In some aspects, administration of the cell dose or any additional therapy, such as lymphodepletion therapy, intervention therapy, and / or combination therapy, is performed in an inpatient setting, such as a university medical center. In some aspects, the treatment is received in an outpatient setting, such as a medical center other than a university. In some aspects, outpatient delivery of cell therapy, or administration and management of additional therapies, such as lymphodepletion therapy, intervention therapy, and / or combination therapy, can result in wider availability and improved access at centers other than regional / university centers.

[0162] In the case of preventing or treating a disease, the appropriate dosage may vary depending on the type of disease being treated, the type of cell or recombinant receptor, the severity and course of the disease, and the cells are administered with respect to the prevention or treatment purpose, pre-therapy, the subject's clinical history and response to the cells, and the discretion of the attending physician. The compositions and cells are preferably administered to the subject, in some embodiments, once or over a series of treatments.

[0163] In some embodiments, the cells are administered as part of a combination treatment, simultaneously or sequentially, in any order, with another therapeutic intervention or additional therapeutic intervention, such as an antibody or engineered cell or receptor or agent, e.g., a cytotoxic or therapeutic agent. The cells are co-administered with one or more additional therapeutic agents, or in association with another therapeutic intervention, simultaneously or sequentially, in any order, in some embodiments. In some embodiments, the additional therapeutic agent is any intervention or agent described herein, e.g., any intervention or agent capable of ameliorating the symptoms of toxicity described herein, e.g., in section ID. In some contexts, the cells are co-administered with another therapy at a time close enough such that the cell population enhances the effect of one or more additional therapeutic agents, or vice versa. In some embodiments, the cells are administered prior to one or more additional therapeutic agents. In some embodiments, the cells are administered after one or more additional therapeutic agents. In some embodiments, the one or more additional agents include a cytokine, e.g., IL-2, for example to enhance persistence. In some embodiments, the method includes the administration of a chemotherapeutic agent.

[0164] In some embodiments, the method includes the administration of a chemotherapeutic agent, e.g., a conditioning chemotherapeutic agent, to reduce tumor burden prior to administration, for example.

[0165] In some aspects, the effect of adoptive cell therapy (ACT) can be improved by pre-conditioning the subject with an immune depletion (e.g., lymphodepletion) therapy.

[0166] Thus, in some embodiments, the method includes administering to the subject a lymphodepleting agent or chemotherapeutic agent, such as cyclophosphamide, fludarabine, or a combination thereof, as a preconditioning agent prior to initiation of cell therapy. For example, the subject may be administered the preconditioning agent at least 2 days, such as at least 3, 4, 5, 6, or 7 days, prior to initiation of cell therapy. In some embodiments, the subject is administered the preconditioning agent up to 7 days, such as 6, 5, 4, 3, or 2 days, prior to initiation of cell therapy. In some embodiments, if there is a delay of more than 2 weeks between completion of lymphodepleting chemotherapy and CAR T cell infusion, the subject should be re-treated with lymphodepleting chemotherapy prior to receiving the infusion.

[0167] In some embodiments, the subject is preconditioned with cyclophosphamide at a dose of 20 mg to 100 mg or about 20 mg to 100 mg per kg of the subject's body weight, such as 40 mg / kg to 80 mg / kg or about 40 mg / kg to about 80 mg / kg. In some aspects, the subject is preconditioned or administered with cyclophosphamide at 60 mg / kg or about 60 mg / kg. In some embodiments, cyclophosphamide can be administered as a single dose or in multiple doses, such as daily, every other day, or every 3 days. In some embodiments, cyclophosphamide is administered once a day for 1 or 2 days. In some embodiments, when the lymphodepleting agent includes cyclophosphamide, the subject is administered cyclophosphamide at a dose of 100 mg to 500 mg or about 100 mg to 500 mg per square meter of the subject's body surface area, such as 200 mg / m 2 to 400 mg / m 2 or about 200 mg / m 2 to 400 mg / m 2 or 250 mg / m 2 to 350 mg / m 2 or about 250 mg / m 2 to 350 mg / m 2 or about 100 mg / m 2 (inclusive). In some embodiments, the subject is about 100 mg / m 2Cyclophosphamide is administered. In some embodiments, the subject is administered about 150 mg / m 2 of cyclophosphamide. In some embodiments, the subject is administered about 200 mg / m 2 of cyclophosphamide. In some embodiments, the subject is administered about 250 mg / m 2 of cyclophosphamide. In some embodiments, the subject is administered about 300 mg / m 2 of cyclophosphamide. In some embodiments, cyclophosphamide can be administered as a single dose or in multiple doses, for example, daily, every other day, or every three days. In some embodiments, cyclophosphamide is administered daily for, for example, 1 to 5 days, for example, 3 to 5 days. In some embodiments, the subject is administered about 300 mg of cyclophosphamide per square meter of body surface area of the subject daily for 3 days prior to the start of cell therapy. In some embodiments, the subject is a total of 300 mg / m 2 , 400 mg / m 2 , 500 mg / m 2 , 600 mg / m 2 , 700 mg / m 2 , 800 mg / m 2 , 900 mg / m 2 , 1000 mg / m 2 , 1200 mg / m 2 , 1500 mg / m 2 , 1800 mg / m 2 , 2000 mg / m 2 , 2500 mg / m 2 , 2700 mg / m 2 , 3000 mg / m 2 , 3300 mg / m 2 , 3600 mg / m 2 , 4000 mg / m 2 , 4000 mg / m 2 , or 5000 mg / m 2 or a total of about 300 mg / m 2 , 400 mg / m 2 , 500 mg / m 2 , 600 mg / m 2 , 700 mg / m 2 , 800 mg / m 2 , 900 mg / m 2, 1000 mg / m 2 , 1200 mg / m 2 , 1500 mg / m 2 , 1800 mg / m 2 , 2000 mg / m 2 , 2500 mg / m 2 , 2700 mg / m 2 , 3000 mg / m 2 , 3300 mg / m 2 , 3600 mg / m 2 , 4000 mg / m 2 , or 5000 mg / m 2 of cyclophosphamide, or cyclophosphamide in the range defined by any of the foregoing, is administered prior to the initiation of cell therapy.

[0168] In some embodiments, when the lymphodepleting agent includes fludarabine, the subject is administered 1 mg / m 2 ~ 100 mg / m 2 or about 1 mg / m 2 ~ 100 mg / m 2 , for example, 10 mg / m 2 ~ 75 mg / m 2 or about 10 mg / m 2 ~ about 75 mg / m 2 , 15 mg / m 2 ~ 50 mg / m 2 or about 15 mg / m 2 ~ about 50 mg / m 2 , 20 mg / m 2 ~ 40 mg / m 2 or about 20 mg / m 2 ~ about 40 mg / m 2 , 24 mg / m 2 ~ 35 mg / m 2 or about 24 mg / m 2 ~ about 35 mg / m 2 (inclusive) doses of fludarabine. In some cases, the subject is administered 10 mg / m 2 or about 10 mg / m 2 of fludarabine. In some cases, the subject is administered 15 mg / m 2 or about 15 mg / m 2is administered with fludarabine. In some cases, the subject is administered 20 mg / m 2 or approximately 20 mg / m 2 of fludarabine. In some cases, the subject is administered 25 mg / m 2 or approximately 25 mg / m 2 of fludarabine. In some cases, the subject is administered 30 mg / m 2 or approximately 30 mg / m 2 of fludarabine. In some embodiments, fludarabine can be administered as a single dose or in multiple doses, for example, daily, every other day, or every three days. In some embodiments, fludarabine is administered daily for, for example, 1 to 5 days, for example, 3 to 5 days. In some embodiments, the subject is administered 30 mg or approximately 30 mg of fludarabine per square meter of the subject's body surface area daily for 3 days prior to the initiation of cell therapy. In some embodiments, the subject receives a total of 10 mg / m 2 , 20 mg / m 2 , 20 mg / m 2 , 25 mg / m 2 , 30 mg / m 2 , 40 mg / m 2 , 50 mg / m 2 , 60 mg / m 2 , 70 mg / m 2 , 80 mg / m 2 , 90 mg / m 2 , 100 mg / m 2 , 120 mg / m 2 , 150 mg / m 2 , 180 mg / m 2 , 200 mg / m 2 , 250 mg / m 2 , 270 mg / m 2 , 300 mg / m 2 , 330 mg / m 2 , 360 mg / m 2 , 400 mg / m 2 , or 500 mg / m 2 or a total of approximately 10 mg / m 2 , 20 mg / m 2 , 25 mg / m 2 , 30 mg / m 2 , 40 mg / m 2 , 50 mg / m2 , 60 mg / m 2 , 70 mg / m 2 , 80 mg / m 2 , 90 mg / m 2 , 100 mg / m 2 , 120 mg / m 2 , 150 mg / m 2 , 180 mg / m 2 , 200 mg / m 2 , 250 mg / m 2 , 270 mg / m 2 , 300 mg / m 2 , 330 mg / m 2 , 360 mg / m 2 , 400 mg / m 2 , or 500 mg / m 2 of cyclophosphamide, or cyclophosphamide in the range defined by any of the foregoing, is administered prior to the initiation of cell therapy.

[0169] In some embodiments, the lymphodepleting agent comprises a single agent such as cyclophosphamide or fludarabine. In some embodiments, the subject is administered only cyclophosphamide without using fludarabine or other lymphodepleting agents. In some embodiments, prior to administration, the subject undergoes lymphodepletion therapy comprising administration of 200 - 400 mg or about 200 - 400 mg, optionally 300 mg / m 2 per body surface area of the subject for 2 - 4 days, daily. In some embodiments, the subject is administered only fludarabine without using cyclophosphamide or other lymphodepleting agents. In some embodiments, prior to administration, the subject undergoes lymphodepletion therapy comprising administration of 20 - 40 mg or about 20 - 40 mg, optionally 30 mg / m 2 or about 30 mg / m 2 of fludarabine for 2 - 4 days, daily. 2 per body surface area of the subject. 2 or about 30 mg / m 2

[0170] In some embodiments, the lymphodepleting agent comprises a combination of agents such as a combination of cyclophosphamide and fludarabine. Thus, the combination of agents can include cyclophosphamide at any dosage or dosing schedule such as those described above, and fludarabine at any dosage or dosing schedule such as those described above. For example, in some aspects, the subject is given 60 mg / kg or about 60 mg / kg (about 2 g / m 2 ) of cyclophosphamide and 3 - 5 doses of 25 mg / m 2 of fludarabine. In some, the subject is given fludarabine (30 mg / m 2 / day for 3 days) and cyclophosphamide (300 mg / m 2 / day for 3 days) (flu / cy) intravenously in parallel prior to cell administration. In some embodiments, the subject is given one or more doses of the lymphodepleting agent at a reduced, delayed, or removed dosage.

[0171] In some embodiments, after collecting cells from a subject (e.g., by leukapheresis) for engineering cells for cell therapy with a recombinant receptor (e.g., a CAR), and before lymphodepletion therapy, the subject can receive bridging therapy. In some embodiments, the bridging therapy is chemotherapy. In some embodiments, the bridging therapy is radiation therapy. In some embodiments, the bridging therapy is for disease control. The bridging therapy can be any anti-cancer therapy for controlling the disease prior to receiving a dose of engineered (e.g., CAR+) T cells. Depending on the age of the patient, the severity or extent of the disease, the potential for side effects, the timing of administration before lymphodepletion therapy, previous therapies, and other factors, among others, any of a variety of therapies can be administered as the bridging therapy based on the judgment of one of ordinary skill in the art for treating a particular disease or condition. The bridging therapy can include radiation therapy or systemic therapy. Exemplary therapies that can be given as a bridge prior to lymphodepletion therapy include, but are not limited to, rituximab, dexamethasone, prednisone, lenalidomide, gemcitabine, oxaliplatin, brentuximab vedotin, ibrutinib, or bendamustine, or any combination of the foregoing. In some cases, the bridging therapy is gemcitabine and oxaliplatin. In some cases, the bridging therapy is gemcitabine and rituximab. In some embodiments, the bridging therapy is rituximab and gemcitabine and oxaliplatin. Before receiving lymphodepletion therapy, the subject is evaluated for the status of the disease, such as by positron emission tomography (PET). In some embodiments, lymphodepletion therapy and administration of a dose of engineered (e.g., CAR+) T cells are performed only on subjects who show a PET-positive disease after the bridging therapy. In other embodiments, if the subject achieves a CR after the bridging therapy, the subject does not receive lymphodepletion therapy or a dose of engineered (e.g., CAR+) T cells.

[0172] After administration of the cells, in some embodiments, the biological activity of the engineered cell population is measured by any of several known methods, for example. In vivo, for example, by imaging, and ex vivo, for example, by ELISA or flow cytometry. Parameters to be evaluated include specific binding of engineered or native T cells, or other immune cells, to an antigen. In certain embodiments, the ability of the engineered cells to destroy target cells can be measured using any suitable known method, such as the cytotoxicity assays described in Kochenderfer et al., J. Immunotherapy, 32(7): 689-702 (2009), and Herman et al. J. Immunological Methods, 285(1): 25-40 (2004). In certain embodiments, the biological activity of the cells is measured by assaying the expression and / or secretion of one or more cytokines such as CD107a, IFNγ, IL-2, TNF. In some aspects, the biological activity is measured by evaluating clinical outcomes such as reduction of tumor burden or tumor mass.

[0173] In certain embodiments, the engineered cells are further modified in any manner such that their therapeutic or prophylactic efficacy is increased. For example, the engineered CAR or TCR expressed by the population can be conjugated directly or indirectly via a linker to a targeting moiety. Methods of conjugating compounds, such as CARs or TCRs, to a target site are known. See, for example, Wadwa et al., J. Drug Targeting 3:111 (1995), and U.S. Patent No. 5,087,616. In some embodiments, the cells are administered as part of a combination therapy, either simultaneously or sequentially, in any order, with another therapeutic intervention, such as an antibody or an engineered cell or a receptor or an agent, such as a cytotoxic or therapeutic agent. The cells are, in some embodiments, co-administered with one or more additional therapeutic agents or in association with another therapeutic intervention, simultaneously or sequentially, in any order. In some contexts, the cells are co-administered with another therapy at a time close enough such that the cell population enhances the effect of one or more additional therapeutic agents or vice versa. In some embodiments, the cells are administered prior to one or more additional therapeutic agents. In some embodiments, the cells are administered after one or more additional therapeutic agents. In some embodiments, the one or more additional agents include cytokines, such as IL-2, for example, to enhance persistence.

[0174] In some embodiments, the subject receives a pre-medication, for example, to minimize the risk of an infusion reaction. In some aspects, the pre-medication includes administering an analgesic and / or an antihistamine. In some embodiments, the pre-medication includes administering acetaminophen and / or diphenhydramine, or another H1-antihistamine. In some embodiments, the subject is administered acetaminophen (e.g., 650 mg orally) 30 to 60 minutes before, or about 30 to 60 minutes before, a treatment by cell therapy. In some embodiments, the subject is administered diphenhydramine (e.g., 25 to 50 mg IV or orally), or another H1-antihistamine, 30 to 60 minutes before, or about 30 to 60 minutes before, a treatment by cell therapy. In some embodiments, the subject is administered diphenhydramine (e.g., 25 to 50 mg IV or orally) 30 to 60 minutes before, or about 30 to 60 minutes before, a treatment by cell therapy. In some embodiments, the subject is administered acetaminophen (e.g., 650 mg orally) and diphenhydramine (e.g., 25 to 50 mg IV or orally), or another H1-antihistamine, 30 to 60 minutes before, or about 30 to 60 minutes before, a treatment by cell therapy. In some embodiments, the subject is administered acetaminophen (e.g., 650 mg orally) and diphenhydramine (e.g., 25 to 50 mg IV or orally) separately 30 to 60 minutes before, or about 30 to 60 minutes before, a treatment by cell therapy. In some embodiments, acetaminophen is called paracetamol.

[0175] B. Medication In some embodiments, a dose of cells is administered to a subject according to the provided method, and / or the provided manufactured product or composition. In some embodiments, the size or timing of the dose is determined as a function of a particular disease or condition in the subject. Optionally, the size or timing of the dose for a particular disease may be determined empirically in light of the provided instructions.

[0176] In some aspects of any of the provided embodiments, the dose of T cells, such as engineered T cells that express a recombinant receptor, includes, consists essentially of, or comprises a cell composition or cell population in which CD3+ T cells, CD4+ T cells, CD8+ T cells, or CD4+ T cells and CD8+ T cells are enriched. In some aspects of any such embodiment, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, or more than 98%, or about more than 70%, about more than 75%, about more than 80%, about more than 85%, about more than 90%, about more than 95%, or about more than 98% of the cells in the T cell dose are CD3+ T cells, CD4+ T cells, CD8+ T cells, or CD4+ T cells and CD8+ T cells. In some aspects of any embodiment, the T cell dose comprises CD4 + cells to CD8 + T cells that express the receptor, and / or CD4 + T cells to CD8 + T cells, and this ratio is about 1:1, or about 1:3 to about 3:1. In some aspects of any embodiment, the defined ratio is 1:1, or about 1:1. In some embodiments of any of the provided methods, CAR-positive CD4+ T cells and CAR-positive CD8+ T cells are administered to a subject at a ratio of about 1:1 CAR-positive viable CD8+ T cells to CAR-positive viable CD8+ T cells.

[0177] In some aspects of the provided embodiments, the T cell dose comprises CD4 + and CD8 + T cell doses, and each dose of T cells specifically binds to a target antigen expressed by a disease or disorder, such as any of those described herein, or its cells or tissues, and / or comprises a recombinant receptor associated with the disease or disorder. In some aspects, administration includes administering a plurality of separate compositions, the plurality of separate compositions comprising a first composition comprising CD8 + T cells and a second composition comprising CD4 + T cells.

[0178] In some embodiments, the cell dosage is 2×10 5 cells / kg or about 2×10 5 cells / kg to 2×10 6 cells / kg or about 2×10 5 cells / kg, for example, 4×10 5 cells / kg or about 4×10 5 cells / kg to 1×10 6 cells / kg or about 1×10 6 cells / kg, or 6×10 5 cells / kg or about 6×10 5 cells / kg to 8×10 5 cells / kg or about 8×10 5 cells / kg. In some embodiments, the cell dosage is 2×10 5 cells or less per kilogram of the subject's body weight (e.g., antigen-expressing cells such as CAR-expressing cells) (cells / kg), for example, 3×10 5 cells / kg or less or about 3×10 5 cells / kg or less, 4×10 5 cells / kg or less or about 4×10 5 cells / kg or less, 5×10 5 cells / kg or less or about 5×10 5 cells / kg or less, 6×10 5 cells / kg or less or about 6×10 5 cells / kg or less, 7×10 5 cells / kg or less or about 7×10 5 cells / kg or less, 8×10 5 cells / kg or less or about 8×10 5 cells / kg or less, 9×10 5 cells / kg or less or about 9×10 5 cells / kg or less, 1×10 6 cells / kg or less or about 1×10 6 cells / kg or less, or 2×10 6 cells / kg or less or about 2×10 6contains less than or equal to a certain number of cells / kg. In some embodiments, the cell dosage is at least or at least about or 2×10 5 cells or about 2×10 5 cells (e.g., antigen-expressing cells such as CAR-expressing cells) (cells / kg), for example, at least or at least about or 3×10 5 cells or about 3×10 5 cells / kg, at least or at least about or 4×10 5 cells or about 4×10 5 cells / kg, at least or at least about or 5×10 5 cells or about 5×10 5 cells / kg, at least or at least about or 6×10 5 cells or about 6×10 5 cells / kg, at least or at least about or 7×10 5 cells or about 7×10 5 cells / kg, at least or at least about or 8×10 5 cells or about 8×10 5 cells / kg, at least or at least about or 9×10 5 cells or about 9×10 5 cells / kg, at least or at least about or 1×10 6 cells or about 1×10 6 cells / kg, or at least or at least about or 2×10 6 cells or about 2×10 6 cells / kg. In some embodiments, the number of cells is the number of viable cells, such as viable T cells.

[0179] In certain embodiments, an individual population of cells, or a subtype of cells, ranges from 100,000 or about 100,000 to 100 billion or about 100 billion cells, and / or for example, from 100,000 or about 100,000 to 50 billion or about 50 billion cells (e.g., 5 million or about 5 million cells, 25 million or about 25 million cells, 500 million or about 500 million cells, 1 billion or about 1 billion cells, 5 billion or about 5 billion cells, 10 billion or about 10 billion cells, 50 billion or about 50 billion cells, 20 billion or about 20 billion cells, 30 billion or about 30 billion cells, 40 billion or about 40 billion cells, or a range defined by any two of the foregoing values), from 1 million or about 1 million cells to 50 billion or about 50 billion cells (e.g., 5 million or about 5 million cells, 25 million or about 25 million cells, 500 million or about 500 million cells, 1 billion or about 1 billion cells, 5 billion or about 5 billion cells, 10 billion or about 10 billion cells, 50 billion or about 50 billion cells, 20 billion or about 20 billion cells, 30 billion or about 30 billion cells, 40 billion or about 40 billion cells, or a range defined by any two of the foregoing values), for example, from 10 million or about 10 million cells to 100 billion or about 100 billion cells (e.g., 20 million or about 20 million cells, 30 million or about 30 million cells, 40 million or about 40 million cells, 60 million or about 60 million cells, 70 million or about 70 million cells, 80 million or about 80 million cells, 90 million or about 90 million cells, 10 billion or about 10 billion cells, 25 billion or about 25 billion cells, 50 billion or about 50 billion cells, 75 billion or about 75 billion cells, 90 billion or about 90 billion cells, or a range defined by any two of the foregoing values), and in some cases, from 100 million or about 100 million cells to 50 billion or about 50 billion cells (e.g., 120 million or about 120 million cells, 250 million or about 250 million cells, 350 million or about 350 million cells, 650 million or about 650 million cells,administered to a subject in terms of the amount of cells per kilogram body weight of the subject such as 10 million cells, 800 million or about 800 million cells, 900 million or about 900 million cells, 3 billion or about 3 billion cells, 30 billion or about 30 billion cells, 45 billion or about 45 billion cells), or at any value between these ranges and / or values per kilogram body weight of the subject. The dosage may vary depending on the disease or disorder and / or patient and / or attributes specific to other treatments. In some embodiments, such a value refers to the number of recombinant receptor-expressing cells; in other embodiments, it refers to the number of T cells or PBMCs or total cells administered. In some embodiments, the cell number is the number of such cells that are viable cells.,

[0180] In some embodiments, the dosage of the cells is a flat or fixed dosage of the cells such that the dosage of the cells is not tied to or based on the body surface area or body weight of the subject.

[0181] In some embodiments, the dosage of the genetically engineered cells is 1×10 5 or about 1×10 5 ~5×10 8 or about 5×10 8 total CAR-expressing T cells, 1×10 5 or about 1×10 5 ~2.5×10 8 or about 2.5×10 8 total CAR-expressing T cells, 1×10 5 or about 1×10 5 ~1×10 8 or about 1×10 8 total CAR-expressing T cells, or 1×10 5 or about 1×10 5 ~5×10 7 or about 5×10 7 total CAR-expressing T cells, or 1×10 5 or about 1×10 5 ~2.5×10 7 or about 2.5×10 7 total CAR-expressing T cells, or 1×10 5or about 1×10 5 ~1×10 7 or about 1×10 7 total CAR-expressing T cells, or 1×10 5 or about 1×10 5 ~5×10 6 or about 5×10 6 total CAR-expressing T cells, or 1×10 5 or about 1×10 5 ~2.5×10 6 or about 2.5×10 6 total CAR-expressing T cells, or 1×10 5 or about 1×10 5 ~1×10 6 or about 1×10 6 total CAR-expressing T cells, or 1×10 6 or about 1×10 6 ~5×10 8 or about 5×10 8 total CAR-expressing T cells, or 1×10 6 or about 1×10 6 ~2.5×10 8 or about 2.5×10 8 total CAR-expressing T cells, or 1×10 6 or about 1×10 6 ~1×10 8 or about 1×10 8 total CAR-expressing T cells, or 1×10 6 or about 1×10 6 ~5×10 7 or about 5×10 7 total CAR-expressing T cells, or 1×10 6 or about 1×10 6 ~2.5×10 7 or about 2.5×10 7 total CAR-expressing T cells, or 1×10 6 or about 1×10 6 ~1×10 7 or about 1×10 7 total CAR-expressing T cells, or 1×10 6 or about 1×10 6 ~5×10 6 or about 5×106 individual total CAR-expressing T cells, or 1×10 6 or approximately 1×10 6 ~2.5×10 6 or approximately 2.5×10 6 individual total CAR-expressing T cells, or 2.5×10 6 or approximately 2.5×10 6 ~5×10 8 or approximately 5×10 8 individual total CAR-expressing T cells, or 2.5×10 6 or approximately 2.5×10 6 ~2.5×10 8 or approximately 2.5×10 8 individual total CAR-expressing T cells, or 2.5×10 6 or approximately 2.5×10 6 ~1×10 8 or approximately 1×10 8 individual total CAR-expressing T cells, or 2.5×10 6 or approximately 2.5×10 6 ~5×10 7 or approximately 5×10 7 individual total CAR-expressing T cells, or 2.5×10 6 or approximately 2.5×10 6 ~2.5×10 7 or approximately 2.5×10 7 individual total CAR-expressing T cells, or 2.5×10 6 or approximately 2.5×10 6 ~1×10 7 or approximately 1×10 7 individual total CAR-expressing T cells, or 2.5×10 6 or approximately 2.5×10 6 ~5×10 6 or approximately 5×10 6 individual total CAR-expressing T cells, or 5×10 6 or approximately 5×10 6 ~5×10 8 or approximately 5×10 8 individual total CAR-expressing T cells, or 5×10 6 or approximately 5×10 6 ~2.5×10 8 or approximately 2.5×10 8Total CAR-expressing T cells, or 5×10 6 or approximately 5×10 6 ~1×10 8 or approximately 1×10 8 Total CAR-expressing T cells, or 5×10 6 or approximately 5×10 6 ~5×10 7 or approximately 5×10 7 Total CAR-expressing T cells, or 5×10 6 or approximately 5×10 6 ~2.5×10 7 or approximately 2.5×10 7 Total CAR-expressing T cells, or 5×10 6 or approximately 5×10 6 ~1×10 7 or approximately 1×10 7 Total CAR-expressing T cells, or 1×10 7 or approximately 1×10 7 ~5×10 8 or approximately 5×10 8 Total CAR-expressing T cells, or 1×10 7 or approximately 1×10 7 ~2.5×10 8 or approximately 2.5×10 8 Total CAR-expressing T cells, or 1×10 7 or approximately 1×10 7 ~1×10 8 or approximately 1×10 8 Total CAR-expressing T cells, or 1×10 7 or approximately 1×10 7 ~5×10 7 or approximately 5×10 7 Total CAR-expressing T cells, or 1×10 7 or approximately 1×10 7 ~2.5×10 7 or approximately 2.5×10 7 Total CAR-expressing T cells, or 2.5×10 7 or approximately 2.5×10 7 ~5×10 8 or approximately 5×10 8 Total CAR-expressing T cells, or 2.5×10 7 or approximately 2.5×107 ~2.5×10 8 or about 2.5×10 8 total CAR-expressing T cells, or 2.5×10 7 or about 2.5×10 7 ~1×10 8 or about 1×10 8 total CAR-expressing T cells, or 2.5×10 7 or about 2.5×10 7 ~5×10 7 or about 5×10 7 total CAR-expressing T cells, or 5×10 7 or about 5×10 7 ~5×10 8 or about 5×10 8 total CAR-expressing T cells, or 5×10 7 or about 5×10 7 ~2.5×10 8 or about 2.5×10 8 total CAR-expressing T cells, or 5×10 7 or about 5×10 7 ~1×10 8 or about 1×10 8 total CAR-expressing T cells, or 1×10 8 or about 1×10 8 ~5×10 8 or about 5×10 8 total CAR-expressing T cells, 1×10 8 or about 1×10 8 ~2.5×10 8 or about 2.5×10 8 total CAR-expressing T cells, or 2.5×10 8 or about 2.5×10 8 ~5×10 8 or about 5×10 8 total CAR-expressing T cells. In some embodiments, the dose of the genetically engineered cells is 2.5×10 7 or about 2.5×10 7 ~1.5×10 8 or about 1.5×10 8 total CAR-expressing T cells, e.g., 5×10 7 or about 5×10 7~1×10 8 or about 1×10 8 total CAR-expressing T cells. In some embodiments, the number of cells is the number of such viable cells, such as viable T cells.

[0182] In some embodiments, the dose of genetically engineered cells is at least or at least about 1×10 5 CAR-expressing cells, at least or at least about 2.5×10 5 CAR-expressing cells, at least or at least about 5×10 5 CAR-expressing cells, at least or at least about 1×10 6 CAR-expressing cells, at least or at least about 2.5×10 6 CAR-expressing cells, at least or at least about 5×10 6 CAR-expressing cells, at least or at least about 1×10 7 CAR-expressing cells, at least or at least about 2.5×10 7 CAR-expressing cells, at least or at least about 5×10 7 CAR-expressing cells, at least or at least about 1×10 8 CAR-expressing cells, at least or at least about 1.5×10 8 CAR-expressing cells, at least or at least about 2.5×10 8 CAR-expressing cells, or at least or at least about 5×10 8 CAR-expressing cells. In some embodiments, the number of cells is the number of such viable cells, such as viable T cells.

[0183] In some embodiments, the cell therapy is 1×10 5 or about 1×10 5 ~5×10 8 or about 5×10 8 total recombinant receptor-expressing cells, total T cells, or total peripheral blood mononuclear cell (PBMC) cell number, 5×10 5 or about 5×10 5 ~1×107 or about 1×10 7 the number of total recombinant receptor-expressing cells, total T cells, or total peripheral blood mononuclear cells (PBMCs), or 1×10 6 or about 1×10 6 ~1×10 7 or about 1×10 7 the number of total recombinant receptor-expressing cells, total T cells, or total peripheral blood mononuclear cells (PBMCs), respectively, including a dose administration that inclusively includes. In some embodiments, the cell therapy is at least or at least about 1×10 5 the number of total recombinant receptor-expressing cells, total T cells, or total peripheral blood mononuclear cells (PBMCs), for example, at least or at least 1×10 6 cells, at least or at least about 1×10 7 cells, at least or at least about 1×10 8 cells, including the administration of a dose of cells containing the number of such cells. In some embodiments, the number of cells is the number of such viable cells, such as viable T cells.

[0184] In some embodiments, the number is based on the total number of CD3 + , CD8 + , or CD4+ and CD8+, optionally also recombinant receptor expression (e.g., CAR + ). In some embodiments, the number of cells is the number of such viable cells.

[0185] In some embodiments, the cell therapy is 1×10 5 or about 1×10 5 ~5×10 8 or about 5×10 8 the total T cells of CD3 + , CD8 + or CD4 + and CD8 + , or the recombinant receptor (e.g., CAR) expressing cells of CD3 + , CD8 + or CD4 + and CD8 + , 5×10 5 or about 5×105 ~1×10 7 or approximately 1×10 7 CD3 + , CD8 + or CD4 + and CD8 + total T cells or CD3 + , CD8 + or CD4 + and CD8 + recombinant receptor (e.g., CAR) - expressing cells, or 1×10 6 or approximately 1×10 6 ~1×10 7 or approximately 1×10 7 CD3 + , CD8 + or CD4 + and CD8 + total T cells or CD3 + , CD8 + or CD4 + and CD8 + administering a dose that inclusively includes the number of recombinant receptor (e.g., CAR) - expressing cells. In some embodiments, the cell therapy is 1×10 5 or approximately 1×10 5 ~5×10 8 or approximately 5×10 8 CD3 + / CAR + , CD8 + / CAR + or CD4 + / CD8 + / CAR + total cells of, 5×10 5 or approximately 5×10 5 ~1×10 7 or approximately 1×10 7 CD3 + / CAR + , CD8 + / CAR + or CD4 + / CD8 + / CAR + total cells of, or 1×10 6 or approximately 1×10 6 ~1×10 7 or approximately 1×107 Individual CD3 + / CAR + , CD8 + / CAR + or CD4 + / CD8 + / CAR + The dosage includes the administration of a dosage that comprehensively includes the total number of cells of CD3 / CAR, CD8 / CAR, or CD4 / CD8 / CAR, respectively. In some embodiments, the cell count is the number of such cells that are viable cells.

[0186] In some embodiments, the dosage of the genetically engineered cells is at least or at least about 2.5×10 7 Individual CD3+ / CAR + , CD8 + / CAR + , or CD4 + / CD8 + / CAR + T cells, at least or at least about 5×10 7 Individual CD3+ / CAR + , CD8 + / CAR + , or CD4 + / CD8 + / CAR + T cells, or at least or at least about 1×10 8 Individual CD3+ / CAR + , CD8 + / CAR + , or CD4 + / CD8 + / CAR + T cells. In some embodiments, the dosage of the genetically engineered cells is 2.5×10 7 or about 2.5×10 7 Individual CD3+ / CAR + , CD8 + / CAR + , or CD4 + / CD8 + / CAR + T cells, 5×10 7 or about 5×10 7 Individual CD3+ / CAR + , CD8 + / CAR + , or CD4+ / CD8 + / CAR + T cells, or 1 × 10 8 or about 1 × 10 8 cells of CD3+ / CAR + , CD8 + / CAR + , or CD4 + / CD8 + / CAR + including T cells. In some embodiments, the cell number is the number of such cells that are viable cells.

[0187] In some embodiments, the dose of T cells is 5 × 10 7 or about 5 × 10 7 cells of recombinant receptor (e.g., CAR)-expressing T cells, or 2.5 × 10 7 or about 2.5 × 10 7 cells of recombinant receptor (e.g., CAR)-expressing CD8 + T cells. In some embodiments, the dose of T cells is 1 × 10 8 or about 1 × 10 8 cells of recombinant receptor (e.g., CAR)-expressing T cells, or 5 × 10 7 or about 5 × 10 7 cells of recombinant receptor (e.g., CAR)-expressing CD8 + T cells. In some embodiments, the dose of T cells is 1.5 × 10 8 or about 1.5 × 10 8 cells of recombinant receptor (e.g., CAR)-expressing T cells, or 0.75 × 10 8 or about 0.75 × 10 8 cells of recombinant receptor (e.g., CAR)-expressing CD8 + T cells. In some embodiments, the cell number is the number of such cells that are viable cells.

[0188] In some embodiments, the dose of T cells includes about 90 to about 110 × 10 6 cells of CAR-positive viable T cells. In some embodiments, the dose of T cells is about 100 × 10 6It contains individual CAR-positive viable T cells. In some embodiments, the dose of T cells is about 50 to about 110×10 6 It contains individual CAR-positive viable T cells.

[0189] In some embodiments, the T cells in the dose are CD4 + T cells, CD8 + T cells, or CD4 + and CD8 + It contains T cells.

[0190] In some embodiments, the T cells in the dose contain CAR-positive viable T cells with a CD8 component to CD4 component ratio of 1:1. Thus, in some embodiments, the dose of T cells is about 45 to about 55×10 6 individual CD4+CAR-positive viable T cells, and about 45 to about 55×10 6 individual CD8+CAR-positive viable T cells. In some embodiments, the dose of T cells is about 25 to about 55×10 6 individual CD4+CAR-positive viable T cells, and about 25 to about 55×10 6 individual CD8+CAR-positive viable T cells.

[0191] In some embodiments, for example, when the subject is human, in a dose containing CD4+ and CD8+ T cells, the CD8+ T cells in the dose are 1×10 6 or about 1×10 6 ~5×10 8 or about 5×10 8 total recombinant receptor (e.g., CAR) expressing CD8+ cells, e.g., 5×10 6 or about 5×10 6 ~1×10 8 or about 1×10 8 such cells, e.g., 1×10 7 , 2.5×10 7 , 5×10 7 , 7.5×10 7 , 1×10 8 , 1.5×10 8 , or 5×10 8comprises such total cells in an amount of, or in the range between any two of the aforementioned values. In some embodiments, the patient is administered multiple doses, and each dose or total dose may be included in any of the aforementioned values. In some embodiments, the dose of cells is 1×10 7 or about 1×10 7 to 0.75×10 8 or about 0.75×10 8 total recombinant receptor-expressing CD8+ T cells, 1×10 7 or about 1×10 7 to 5×10 7 or about 5×10 7 total recombinant receptor-expressing CD8+ T cells, 1×10 7 or about 1×10 7 to 0.25×10 8 or about 0.25×10 8 total recombinant receptor-expressing CD8+ T cells, respectively. In some embodiments, the dose of cells is 1×10 7 , 2.5×10 7 , 5×10 7 , 7.5×10 7 , 1×10 8 , 1.5×10 8 , 2.5×10 8 , or 5×10 8 cells or about 1×10 7 , 2.5×10 7 , 5×10 7 , 7.5×10 7 , 1×10 8 , 1.5×10 8 , 2.5×10 8 , or 5×10 8 total recombinant receptor-expressing CD8+ T cells. In some embodiments, the cell count is the number of such cells that are viable cells.

[0192] In some embodiments, for example, when the subject is human, the dose is less than about 5×10 8 total recombinant receptor (e.g., CAR)-expressing cells, T cells, or peripheral blood mononuclear cells (PBMCs), e.g., 1×10 6 or about 1×10 6 to 5×10 8or about 5×10 8 such cells in the range of, for example, 2×10 6 , 5×10 6 , 1×10 7 , 5×10 7 , 1×10 8 , 1.5×10 8 , or 5×10 8 cells, or about 2×10 6 , 5×10 6 , 1×10 7 , 5×10 7 , 1×10 8 , 1.5×10 8 , or 5×10 8 cells, or total cells in the range between any two of the aforementioned values. In some embodiments, the cell number is the number of such cells that are viable cells.

[0193] In some embodiments, the patient is administered multiple doses, and each dose or the total dose may be included in any of the aforementioned values. In some embodiments, the cell dose is 1×10 5 or about 1×10 5 ~5×10 8 or about 5×10 8 total recombinant receptor (e.g., CAR) expressing T cells or total T cells, 1×10 5 or about 1×10 5 ~1.5×10 8 or about 1.5×10 8 total recombinant receptor (e.g., CAR) expressing T cells or total T cells, 1×10 5 or about 1×10 5 ~1×10 8 or about 1×10 8 total recombinant receptor (e.g., CAR) expressing T cells or total T cells, 5×10 5 or about 5×10 5 ~1×10 7 or about 1×10 7 total recombinant receptor (e.g., CAR) expressing T cells or total T cells, or 1×10 6 or about 1×10 6 ~1×10 7 or about 1×107 Comprises the administration of individual recombinant receptor (e.g., CAR) expressing T cells or total T cells, respectively, inclusively.

[0194] In some embodiments, the T cells of the dose are CD4 + T cells, CD8 + T cells, or CD4 + And CD8 + Of T cells.

[0195] In some embodiments, the dose of cells, such as recombinant receptor expressing T cells, is administered to the subject as a single dose or administered only once within a period of 2 weeks, 1 month, 3 months, 6 months, 1 year or longer.

[0196] In the context of adoptive cell therapy, the administration of a given "dose" includes administering a given amount or number of cells as a single composition and / or a single uninterrupted administration, such as a single injection or continuous infusion, and also includes administering a given amount or number of cells as a divided dose or multiple compositions, in multiple individual compositions or infusions, over a specific period such as within 3 days. Thus, depending on the context, the dose is a single administration or continuous administration of the specified number of cells, given or initiated all at once. However, depending on the context, the dose is administered by multiple injections or infusions within a period of 3 days such as once a day for 3 days or 2 days, or by multiple infusions within a period of 1 day.

[0197] Thus, in some aspects, the dose of cells is administered in a single pharmaceutical composition. In some embodiments, the dose of cells is administered in multiple compositions that collectively contain the dose of cells.

[0198] In some embodiments, the term "divided dose" refers to a dose that is divided to be administered over more than 1 day. Such types of administration are encompassed by the methods of the invention and are considered single doses.

[0199] Therefore, the cell dosage may be a divided dosage, for example, a divided dosage administered over time. For example, in some embodiments, the dosage may be administered to the subject over 2 or 3 days. Exemplary methods of divided administration include administering 25% of the dosage on the first day and the remaining 75% of the dosage on the second day. In other embodiments, 33% of the dosage may be administered on the first day and the remaining 67% on the second day. In some aspects, 10% of the dosage is administered on the first day, 30% of the dosage is administered on the second day, and 60% of the dosage is administered on the third day. In some embodiments, the divided dosage does not exceed 3 days.

[0200] In some embodiments, the cells of the dosage may be administered by administration of a plurality of compositions or solutions, such as a first and a second, and optionally more than that, each containing a portion of the cells of the dosage. In some aspects, a plurality of compositions containing different populations and / or subtypes of cells, respectively, are administered separately or independently, optionally within a certain period of time. For example, the populations or subtypes of cells may be CD8 + and CD4 + T cells, and / or populations enriched in CD8 + and CD4 + respectively, for example, each individually, including cells genetically engineered to express a recombinant receptor, CD4 + and / or CD8 + T cells. In some embodiments, the administration of the dosage includes administration of a first composition containing a dosage of CD8 + T cells or a dosage of CD4 + T cells, and administration of a second composition containing the other dosage of CD4 + T cells and CD8 + T cells.

[0201] In some embodiments, the administration of the composition or dosage, such as the administration of a plurality of cell compositions, includes administering the cell compositions separately. In some aspects, the separate administrations are performed simultaneously or sequentially, in any order. In certain embodiments, the separate administrations are CD8 + a dosage of T cells or CD4 +A first composition comprising a dose of T cells, and CD4 + T cells and CD8 + A second composition comprising the other dose of T cells is administered sequentially by administering the first and second compositions in any order. In some embodiments, the doses comprise a first composition and a second composition, and the first composition and the second composition are administered within 48 hours of each other, for example, within 36 hours of each other or within 24 hours of each other. In some embodiments, the first composition and the second composition are administered at intervals of 0-12 hours, 0-6 hours, or 0-2 hours. In some embodiments, the start of administration of the first composition and the start of administration of the second composition are at intervals of within 2 hours, within 1 hour, or within 30 minutes, within 15 minutes, within 10 minutes, or within 5 minutes. In some embodiments, the start and / or completion of administration of the first composition and the completion and / or start of administration of the second composition are at intervals of within 2 hours, within 1 hour, or within 30 minutes, within 15 minutes, within 10 minutes, or within 5 minutes. In some embodiments, the first composition and the second composition are administered at intervals of within 2 hours. In some embodiments, the first composition and the second composition are administered at intervals of within 1 hour. In some embodiments, the first composition and the second composition are administered at intervals of within 30 minutes. In some embodiments, the first composition and the second composition are administered at intervals of within 15 minutes.

[0202] In some compositions, the first composition, for example, the first composition of the dose, comprises CD4 + T cells. In some compositions, the first composition, for example, the first composition of the dose, comprises CD8 + T cells. In some embodiments, the first composition is administered before the second composition. In certain embodiments, CD8+ T cells are administered before CD4+ T cells.

[0203] In some embodiments, the dose of cells or composition comprises CD4 expressing a defined ratio or target ratio of recombinant receptor (e.g., CAR) + cells to CD8 expressing a recombinant receptor (e.g., CAR) +cells and / or CD4 + cells to CD8 + cells, and this ratio is approximately 1:1, or between approximately 1:3 and approximately 3:1, for example, it may be approximately 1:1. In some embodiments, the administration of a composition or dose containing different cell populations at a target ratio or desired ratio (e.g., the ratio of CD4 + :CD8 + or the ratio of CAR + CD4 + :CAR + CD8 + is, for example, 1:1) includes the administration of a cell composition containing one of the populations and the subsequent administration of a separate cell composition containing the other of the populations, and the administration is carried out at the target or desired ratio or approximately that ratio. In some embodiments, administering a dose or composition of cells at a defined ratio improves the expansion, persistence, and / or antitumor activity of T cell therapy.

[0204] In some embodiments, the dose of genetically engineered cells is 5×10 7 or about 5×10 7 viable CD3+CAR+ cells, and another dose contains 2.5×10 7 or about 2.5×10 7 viable CD4+CAR+ cells and 2.5×10 7 or about 2.5×10 7 viable CD8+CAR+ cells. In some embodiments, the dose of genetically engineered cells is 1×10 8 or about 1×10 8 viable CD3+CAR+ cells, and another dose contains 5×10 7 or about 5×10 7 viable CD4+CAR+ cells and 5×10 7 or about 5×10 7 viable CD8+CAR+ cells. In some embodiments, the dose of genetically engineered cells is 1.5×10 8 or about 1.5×10 8 viable CD3+CAR+ cells, and another dose contains 0.75×10 8 or about 0.75×10 8individual CD4+ CAR+ live cells and 0.75×10 8 or about 0.75×10 8 individual CD8+ CAR+ live cells.

[0205] In some embodiments, the subject receives cells in multiple doses, such as two or more doses or multiple consecutive doses. In some embodiments, two doses are administered to the subject. In some embodiments, the subject receives a consecutive dose, such as a second dose, approximately 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 days after the first dose. In some embodiments, multiple consecutive doses are administered after the first dose such that additional dose(s) are administered after the administration of the consecutive doses. In some aspects, the number of cells administered to the subject in the additional dose is the same as or similar to the first dose and / or the consecutive doses. In some embodiments, the additional dose(s) are more than the previous dose.

[0206] In some aspects, the size of the first dose and / or the consecutive doses is determined based on one or more criteria such as the subject's response to a pretreatment, such as chemotherapy, the disease burden in the subject, such as tumor burden, bulk, size, or degree, or the extent or type of metastasis, stage, and / or the toxic outcome, such as CRS, macrophage activation syndrome, tumor lysis syndrome, neurotoxicity, and / or the likelihood or incidence of a host immune response to the administered cells and / or the recombinant receptor that the subject may develop.

[0207] In some embodiments, the time between administration of the first dose and the continuous dose is about 9 to about 35 days, about 14 to about 28 days, or 15 to 27 days. In some embodiments, administration of the continuous dose occurs at a point greater than about 14 days and less than about 28 days after administration of the first dose. In some embodiments, the time between the first dose and the continuous dose is about 21 days. In some embodiments, an additional dose(s), e.g., the continuous dose, is administered after administration of the continuous dose. In some embodiments, an additional continuous dose(s) is administered at least about 14 days and less than about 28 days after administration of the previous dose. In some embodiments, the additional dose is administered less than about 14 days after the previous dose, e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 days after the previous dose. In some embodiments, no dose is administered less than about 14 days after the previous dose and / or no dose is administered greater than about 28 days after the previous dose.

[0208] In some embodiments, the dose of cells, e.g., recombinant receptor-expressing cells, comprises two doses (e.g., a double dose) comprising a first dose of T cells and a continuous dose of T cells, wherein one or both of the first dose and the second dose comprises administration of a split dose of T cells.

[0209] In some embodiments, the dose of cells is generally of a magnitude sufficient to be effective in reducing disease burden.

[0210] In some embodiments, the cells are administered at a desired dosage, which in some embodiments includes a desired dose or number of cells or cell types, and / or a desired ratio of cell types. Thus, the dosage of cells is, in some embodiments, based on the total number of cells (or number per kg body weight), and the ratio of CD4 + to CD8 + for example, of desired ratios of individual populations or subtypes. In some embodiments, the dosage of cells is based on the desired total number of cells (or number per kg body weight) of an individual population or individual cell type. In some embodiments, the dosage is based on a combination of such characteristics, such as the desired total number of cells, the desired ratio, and the desired total number of cells in an individual population.

[0211] In some embodiments, CD8 + and CD4 + populations or subtypes of cells, such as T cells, are administered with a tolerance of, or within a tolerance of, a desired dose of total cells, such as a desired dose of T cells. In some aspects, the desired dose is a desired number of cells, or a desired number of cells per unit body weight of the subject to which the cells are administered, e.g., number of cells / kg. In some aspects, the desired dose is at least a minimum number of cells or a minimum number of cells per unit body weight. In some aspects, among the total cells administered at the desired dose, individual populations or subtypes are present at a desired output ratio (e.g., the ratio of CD4 + to CD8 + ), or an approximation thereof, e.g., within a certain tolerance or range of error of such ratio.

[0212] + In some embodiments, cells are administered with a tolerance of, or within a tolerance of, a desired dose of one or more individual populations or subtypes of cells, such as a desired dose of CD4 + cells and / or a desired dose of CD8

[0213] cells. In some aspects, the desired dose is a desired number of cells of a subtype or population, or a desired number of such cells per unit body weight of the subject to which the cells are administered, e.g., number of cells / kg. In some aspects, the desired dose is at least a minimum number of cells of a population or subtype, or a minimum number of cells of a population or subtype per unit body weight. + Thus, in some embodiments, the dose is based on a desired fixed dose of total cells and a desired ratio, and / or on one or more of the individual subtypes or subpopulations, e.g., their respective desired fixed doses. Thus, in some embodiments, the dose is based on a desired fixed or minimum dose of T cells, and the desired ratio of CD4 + cells to CD8 + cells, and / or on the desired fixed or minimum dose of CD4 + and / or CD8

[0214] cells. In some embodiments, the cells are CD4 + and CD8 + cells or are administered at a desired output ratio of multiple cell populations or subtypes, such as cell subtypes, or within an acceptable range thereof. In some aspects, the desired ratio may be a specific ratio or a range of ratios. For example, in some embodiments, the desired ratio (e.g., the ratio of CD4 + cells to CD8 + cells) is 5:1 or about 5:1 to 5:1 or about 5:1 (or greater than 1:5 or about 1:5 and less than 5:1 or about 5:1), or 1:3 or about 1:3 to 3:1 or about 3:1 (or greater than 1:3 or about 1:3 and less than 3:1 or about 3:1), e.g., 2:1 or about 2:1 to 1:5 or about 1:5 (or greater than 1:5 or about 1:5 and less than 2:1 or about 2:1), e.g., 5:1, 4.5:1, 4:1, 3.5:1, 3:1, 2.5:1, 2:1, 1.9:1, 1.8:1, 1.7:1, 1.6:1, 1.5:1, 1.4:1, 1.3:1, 1.2:1, 1.1:1, 1:1, 1:1.1, 1:1.2, 1:1.3, 1:1.4, 1:1.5, 1:1.6, 1:1.7, 1:1.8, 1:1.9, 1:2, 1:2.5, 1:3, 1:3.5, 1:4, 1:4.5, or 1:5, or about 5:1, 4.5:1, 4:1, 3.5:1, 3:1, 2.5:1, 2:1, 1.9:1, 1.8:1, 1.7:1, 1.6:1, 1.5:1, 1.4:1, 1.3:1, 1.2:1, 1.1:1, 1:1, 1:1.1, 1:1.2, 1:1.3, 1:1.4, 1:1.5, 1:1.6, 1:1.7, 1:1.8, 1:1.9, 1:2, 1:2.5, 1:3, 1:3.5, 1:4, 1:4.5, or 1:5. In some aspects, the tolerance is within about 1%, about 2%, about 3%, about 4%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50% of the desired ratio (including any value between these ranges).

[0215] In certain embodiments, the number and / or concentration of cells refers to the number of recombinant receptor (e.g., CAR) - expressing cells. In other embodiments, the number and / or concentration of cells refers to the number or concentration of total cells, T cells, or peripheral blood mononuclear cells (PBMCs) administered.

[0216] In some aspects, the size of the dose is determined based on one or more criteria such as the subject's response to a pretreatment, e.g., chemotherapy, the disease burden in the subject such as the tumor load, bulk, size, or degree, or the extent or type of metastasis, stage of disease, and / or the toxic outcome, e.g., CRS, macrophage activation syndrome, tumor lysis syndrome, neurotoxicity, and / or the likelihood or incidence that the subject will develop a host immune response to the administered cells and / or recombinant receptor.

[0217] In some embodiments, the method also includes administering one or more additional doses of the cells expressing the chimeric antigen receptor (CAR) and / or lymphodepletion therapy, and / or one or more steps of the method are repeated. In some embodiments, the one or more additional doses are the same as the initial dose. In some embodiments, one or more of the additional doses are different from the initial dose, for example, more than the initial dose, for example, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold or 10-fold or more than the initial dose, or about 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold or 10-fold or more than the initial dose, or less than the initial dose, for example, 1 / 2, 1 / 3, 1 / 4, 1 / 5, 1 / 6, 1 / 7, 1 / 8, 1 / 9 or 1 / 10 less than the initial dose, or about 1 / 2, 1 / 3, 1 / 4, 1 / 5, 1 / 6, 1 / 7, 1 / 8, 1 / 9 or 1 / 10 less than the initial dose. In some embodiments, the administration of one or more additional doses is determined based on the subject's response to the initial treatment or any prior treatment, the disease burden in the subject, for example, tumor burden, bulk, size, or degree, extent, or type of metastasis, stage of disease, and / or toxic outcomes, for example, CRS, macrophage activation syndrome, tumor lysis syndrome, neurotoxicity, and / or the likelihood or incidence of the host immune response to the administered cells and / or recombinant receptor.

[0218] C. Efficacy, effectiveness and survival In some embodiments, administration effectively treats a subject, even though the subject is refractory or relapsed to first-line chemoimmunotherapy. In some embodiments, at least 30%, at least 35%, at least 40% or at least 50% of the subjects treated according to the method achieve a complete remission (CR); and / or at least about 40%, at least about 50%, at least about 60% or at least about 70% of the subjects treated according to the method achieve an objective response (OR). In some embodiments, at least or at least about 50%, at least or at least about 60%, at least or at least about 70%, at least or at least about 80%, or at least or at least about 90% of the subjects treated according to the method achieve a CR and / or an objective response (OR). In some embodiments, the criteria evaluated for effective treatment include overall response rate (ORR; also known as objective response rate in some cases), complete response (CR; also known as complete remission in some cases), duration of response (DOR), progression-free survival (PFS), and / or overall survival (OS).

[0219] In some embodiments, at least 40% or at least 50% of the subjects treated according to the methods provided herein achieve a complete remission (CR; also known as complete response in some cases) and exhibit a progression-free survival (PFS) and / or an overall survival (OS) of more than 3 months, 6 months or 12 months, or about 3 months, about 6 months or about 12 months, or more than 13 months, or approximately 14 months; on average, the subjects treated according to the method exhibit a median PFS or OS of more than 6 months, 12 months, or 18 months, or about 6 months, about 12 months, or about 18 months; and / or the subjects exhibit a PFS or OS of at least 6 months, 12 months, 18 months or more months, or about 6 months, 12 months, 18 months or more months after treatment.

[0220] In some embodiments, the response rate in a subject such as a subject having NHL is based on the Lugano criteria (Cheson et al., (2014) JCO 32(27):3059-3067; Johnson et al., (2015) Radiology 2:323-338; Cheson, B.D. (2015) Chin Clin Oncol 4(1):5). In some embodiments, response assessment utilizes any of clinical, hematological, and / or molecular methods. In some embodiments, the response evaluated using the Lugano criteria includes the use of positron emission tomography (PET)-computed tomography (CT) and / or CT as appropriate. The PET-CT assessment may further include the use of fluorodeoxyglucose (FDG) for FDG-positive lymphoma. In some embodiments, when PET-CT is used to evaluate response in FDG-positive tissue, a 5-point scale may be used. In some embodiments, the 5-point scale includes the following criteria: 1, no uptake above background; 2, uptake ≤ mediastinum; 3, uptake > mediastinum but ≤ liver; 4, uptake moderately > liver; 5, uptake significantly higher than liver and / or new lesions; X, new uptake areas not likely related to lymphoma.

[0221] In some embodiments, complete response as described using the Lugano criteria includes complete metabolic response and complete radiographic response at various measurable sites. In some embodiments, these sites include lymph nodes and extranodal sites, and when PET-CT is used, CR is described as score 1, 2, or 3 on a 5-point scale regardless of the presence or absence of residual tumor. In some embodiments, in Waldeyer's ring or extranodal sites with high physiological uptake or activation within the spleen or bone marrow (e.g., due to chemotherapy or myeloid colony-stimulating factors), the uptake may be higher than that of normal mediastinum and / or liver. In such situations, if the uptake at the initial lesion site is not greater than that of the surrounding normal tissue, even if that tissue has high physiological uptake, a complete metabolic response may be presumed. In some embodiments, response is evaluated in lymph nodes using CT, and CR is described as the absence of extranodal disease sites and the target lymph node / nodular tumor having regressed to less than 1.5 cm in the longest transverse diameter (LDi) of the lesion. Additional sites of evaluation include the bone marrow, where the evaluation based on PET-CT should show no FDG-positive disease in the bone marrow, the evaluation based on CT should show a normal morphology, and in case of indetermination, it should be IHC-negative. Further sites may include evaluation of organomegaly, which should return to normal. In some embodiments, unmeasurable lesions and new lesions are evaluated, but there should be none in the case of CR (Cheson et al., (2014) JCO 32(27):3059-3067; Johnson et al., (2015) Radiology 2:323-338; Cheson, B.D. (2015) Chin Clin Oncol 4(1):5).

[0222] In some embodiments, partial response (PR; also known as partial remission in some cases) as described using the Lugano criteria includes partial metabolic and / or radiological response at various measurable sites. In some embodiments, these sites include lymph nodes and extranodal sites, and when PET-CT is used, PR is described as a score of 4 or 5 with decreased uptake compared to baseline and residual tumor regardless of size. Tentatively, such findings may indicate a disease that is responding. At the end of treatment, such findings may indicate residual disease. In some embodiments, response is evaluated in lymph nodes using CT, and PR is described as a ≥50% decrease in the sum of the products of the diameters (SPD) of up to six measurable target lymph nodes and extranodal sites. If the lesion is too small to be measured by CT, a default value of 5 mm × 5 mm is assigned; if the lesion is no longer visible, the value is 0 mm × 0 mm; and for lymph nodes that are larger than 5 mm × 5 mm but smaller than normal, the measured value is used in the calculation. Additional sites for evaluation include bone marrow, where PET-CT-based evaluation should show residual uptake that is higher than normal bone marrow uptake but decreased from baseline (diffuse uptake consistent with treatment-related reactive changes is seen). In some embodiments, if there are persistent focal changes in the bone marrow related to response in nodules, further evaluation by MRI or biopsy, or interval scans should be considered. In some embodiments, additional sites include evaluation of organomegaly, and the spleen should have regressed by >50% in length compared to normal. In some embodiments, non-measurable lesions and new lesions are evaluated, and in the case of PR, there should be no lesions / normal, regressing, or not increasing. Lack of response / stable disease (SD) or progressive disease (PD) can also be measured using PET-CT and / or CT-based evaluation. (Cheson et al., (2014) JCO 32(27):3059-3067; Johnson et al., (2015) Radiology 2:323-338; Cheson, B.D. (2015) Chin Clin Oncol 4(1):5).

[0223] In some embodiments, progression-free survival (PFS) is described as the length of time during and after treatment of a disease such as cancer that a subject coexists with the disease without worsening. In some embodiments, objective response (OR) is described as a measurable response. In some embodiments, objective response rate (ORR; sometimes also referred to as overall response rate) is described as the percentage of patients who achieve CR or PR. In some embodiments, overall survival (OS) is described as the length of time from either the date of diagnosis or the start of treatment of a disease such as cancer that a subject diagnosed with that disease remains alive. In some embodiments, event-free survival (EFS) is described as the period of time after completion of cancer treatment during which a subject does not have a particular complication or event that the treatment was intended to prevent or delay. These events can include cancer recurrence, the occurrence of certain symptoms such as pain in the bones due to cancer that has spread to the bones, or death.

[0224] In some embodiments, the measure of duration of response (DOR) includes the time from when the tumor response is recorded until the disease progresses. In some embodiments, the parameters for evaluating a response can include a durable response, for example, a response that persists after a certain period of time from the start of treatment. In some embodiments, a durable response is indicated by the response rate at approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 18, or 24 months after the start of treatment. In some embodiments, the response can be durable for more than 3 months or more than 6 months.

[0225] In some embodiments, the RECIST criteria are used to determine objective tumor response; in some embodiments, in solid tumors. (Eisenhauer et al., European Journal of Cancer 45 (2009) 228-247). In some embodiments, the RECIST criteria are used to determine the objective tumor response of target lesions. In some respects, a complete response determined using the RECIST criteria is described as the disappearance of all target lesions, and any pathological lymph nodes (whether target or non-target) must have a short axis reduced to <10 mm. In other embodiments, a partial response determined using the RECIST criteria is described as a decrease of at least 30% in the sum of the diameters of the target lesions, based on the sum of the baseline diameters. In other embodiments, progressive disease (PD) is described as an increase of at least 20% in the sum of the diameters of the target lesions, based on the minimum sum in the study (which includes the baseline sum if it is the minimum in the study). In addition to the 20% relative increase, the sum must also show an absolute increase of at least 5 mm (in some embodiments, the appearance of one or more new lesions is also considered progression). In other embodiments, stable disease (SD) is a state in which there is neither sufficient shrinkage to qualify for PR nor sufficient increase to qualify for PD, based on the minimum sum of diameters during the trial period.

[0226] In some embodiments, the survival rate in subjects with follicular lymphoma (FL) is based on a scoring system developed by the Italian Lymphoma Intergroup (ILI) and / or the International Follicular Lymphoma Prognostic Factor Project (IFLPFP), generally as described above. (Luminari et al., (2012) Rev. Brad. Hematol. Hemoter., 34:54-59). In some embodiments, the extent of a disease such as FL can be evaluated by the Ann Arbor staging system, tumor burden, bulky tumor lesions, the number of lymph nodes or extranodal sites of the disease, and / or bone marrow lesions, generally as described above.

[0227] In some embodiments, administration according to the provided method and / or administration using the provided manufactured article or composition generally reduces or prevents the progression or burden of a disease or condition in a subject. For example, if the disease or condition is a tumor, the method generally reduces the size, bulk, metastasis, percentage of blast cells in the bone marrow, or molecularly detectable cancer of the tumor and / or improves prognosis or survival, or other symptoms related to tumor burden.

[0228] Disease burden can include the total number of diseased cells in a subject, or an organ, tissue, or body fluid of the subject, such as a tumor or an organ or tissue in another location that exhibits metastasis. For example, in the context of certain hematologic malignancies, tumor cells can be detected and / or quantified in the blood or bone marrow. Disease burden can, in some embodiments, include the mass of a tumor, the number or extent of metastases, and / or the percentage of blast cells present in the bone marrow.

[0229] In some embodiments, the subject has leukemia. The degree of disease burden can be determined by assessment of residual leukemia in the blood or bone marrow.

[0230] In some embodiments, the response rate in a subject such as a subject having CLL is based on the response criteria of the International Workshop on Chronic Lymphocytic Leukemia (IWCLL) (Hallek, et al., Blood 2008, Jun 15; 111(12): 5446-5456). In some embodiments, these criteria are described as follows: Complete remission (CR; also known as complete response in some cases) requires, in some embodiments, no peripheral blood clonal lymphocytes by immunophenotypic classification, no lymph node enlargement, no hepatomegaly or splenomegaly, no constitutional symptoms, and good blood cell counts; Complete remission with incomplete marrow recovery (CRi) is described, in some embodiments, similarly to the above CR, but with non-normal blood cell counts; Partial remission (PR; also known as partial response in some cases) is described, in some embodiments, as a reduction of ≧50% in lymphocyte count, a reduction of ≧50% in lymph node enlargement, or a reduction of ≧50% in liver or spleen size, along with improvement in peripheral blood cell counts; Progressive disease (PD) is described, in some embodiments, as an increase of ≧50% in lymphocyte count to >5×10 9 / L, an increase of ≧50% in lymph node enlargement, an increase of ≧50% in the size of the liver or spleen, Richter's transformation, or new cytopenia due to CLL; Stable disease is described, in some embodiments, as not meeting the criteria for CR, CRi, PR, or PD.

[0231] In some embodiments, the subject exhibits CR or OR if, within one month from the administration of the dose of the cells, the size of the subject's lymph nodes is 20 mm or less than about 20 mm, 10 mm or less than about 10 mm, or 10 mm or less than about 10 mm.

[0232] In some embodiments, the CLL index clone is not detected in the subject's bone marrow (or is not detected in more than 50%, 60%, 70%, 80%, 90% or more of the bone marrow of subjects treated according to the method). In some embodiments, the CLL index clone is evaluated by IgH deep sequencing. In some embodiments, the index clone is not detected at 1, 2, 3, 4, 5, 6, 12, 18, or 24 months after cell administration, or at about 1, 2, 3, 4, 5, 6, 12, 18, or 24 months, or at least 1, 2, 3, 4, 5, 6, 12, 18, or 24 months, or at least about 1, 2, 3, 4, 5, 6, 12, 18, or 24 months.

[0233] In some embodiments, a subject exhibits a morphological disease when, for example, detected by light microscopy, there are 5% or more blasts in the bone marrow, for example, 10% or more blasts in the bone marrow, 20% or more blasts in the bone marrow, 30% or more blasts in the bone marrow, 40% or more blasts in the bone marrow, or 50% or more blasts in the bone marrow. In some embodiments, if the blasts in the bone marrow are less than 5%, the subject exhibits a complete remission or a clinical remission.

[0234] In some embodiments, the subject has leukemia. The degree of disease burden can be determined by evaluation of residual leukemia in the blood or bone marrow.

[0235] In some embodiments, a subject exhibits a morphological disease when, for example, detected by light microscopy, there are 5% or more blasts in the bone marrow, for example, 10% or more blasts in the bone marrow, 20% or more blasts in the bone marrow, 30% or more blasts in the bone marrow, 40% or more blasts in the bone marrow, or 50% or more blasts in the bone marrow. In some embodiments, if the blasts in the bone marrow are less than 5%, the subject exhibits a complete remission or a clinical remission.

[0236] In some embodiments, the subject shows complete remission, but there may be a small percentage of residual leukemia cells that are morphologically undetectable (by light microscopy techniques). If the subject shows less than 5% blasts in the bone marrow and shows molecularly detectable cancer, the subject is said to have minimal residual disease (MRD). In some embodiments, the molecularly detectable cancer can be evaluated using any of a variety of molecular techniques that enable the sensitive detection of a small number of cells. In some aspects, such techniques include PCR assays, by which the rearrangement or fusion transcript of a specific Ig / T cell receptor gene resulting from chromosomal translocation can be determined. In some embodiments, flow cytometry can be used to identify cancer cells based on leukemia-specific immunophenotypes. In some embodiments, molecular detection of cancer can detect one leukemia cell out of about 100,000 normal cells. In some embodiments, a subject shows molecularly detectable MRD when at least one or more than one leukemia cell is detected in 100,000 cells, such as by PCR or flow cytometry. In some embodiments, the disease burden of the subject is molecularly undetectable or MRD - and as a result, in some cases, leukemia cells cannot be detected in the subject using PCR or flow cytometry techniques.

[0237] In some embodiments, the index clone of leukemia, such as CLL, is not detected in the bone marrow of the subject (or is not detected in the bone marrow of more than 50%, 60%, 70%, 80%, 90% or more of the subjects treated according to the method). In some embodiments, the index clone of leukemia, such as CLL, is evaluated by IGH deep sequencing. In some embodiments, the index clone is not detected at 1, 2, 3, 4, 5, 6, 12, 18, or 24 months after cell administration, or at about 1, 2, 3, 4, 5, 6, 12, 18, or 24 months, or at least 1, 2, 3, 4, 5, 6, 12, 18, or 24 months, or at least about 1, 2, 3, 4, 5, 6, 12, 18, or 24 months.

[0238] In some embodiments, MRD is detected by flow cytometry. Flow cytometry can be used to monitor bone marrow and peripheral blood samples for cancer cells. In certain embodiments, flow cytometry is used to detect or monitor the presence of cancer cells in bone marrow. In some embodiments, multi-parameter immunological detection by flow cytometry is used to detect cancer cells (see, e.g., Coustan-Smith et al., (1998) Lancet 351:550-554). In some embodiments, multi-parameter immunological detection by mass cytometry is used to detect cancer cells. In some examples, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, or 50 parameters can be used to detect cancer cells. The antigens used for detection are selected based on the cancer being detected (Foon and Todd (1986) Blood 68:1-31).

[0239] In some examples, bone marrow is recovered by bone marrow aspiration or bone marrow biopsy, and lymphocytes are isolated for analysis. Monoclonal and / or polyclonal antibodies conjugated to fluorochromes (e.g., fluorescein isothiocyanate (FITC), phycoerythrin, peridinin chlorophyll protein, or biotin) can be used to detect epitopes on the isolated lymphocytes, such as terminal deoxynucleotidyl transferase (TdT), CD3, CD10, CD11c, CD13, CD14, CD33, CD19, CD20, CD21, CD22, CD23, CD34, CD45, CD56, CD79b, IgM, and / or KORSA3544. The labeled cells can then be detected using flow cytometry, e.g., multi-parameter flow cytometry, or mass cytometry, to detect multiple epitopes.

[0240] Lymphocytes are identified and gated based on a light scatter dot plot and can then be secondarily gated to identify a population of cells that express the characteristics of the desired immunophenotype. Exemplary epitopes are shown in Table 2 below. Other immunological classifications for leukemia and lymphoma are provided by Foon and Todd (Blood (1986) 68(1): 1-31). In some embodiments, flow cytometric evaluation of MRD can be accomplished by quantifying viable lymphocytes having one or more CLL immunophenotypes (e.g., low forward scatter / side scatter; CD3 neg ; CD5 + ; CD14 neg ; CD19 + ; CD23 + ; CD45 + ; CD56 neg ).

Table 2

[0241] In some embodiments, deep sequencing of the immunoglobulin heavy chain (IGH) locus of the recovered B cells can be used to detect minimal residual disease (MRD). The presence of clonality of a particular IgG rearrangement can provide a marker for the presence of a B cell malignancy such as CLL or NHL, and / or the persistence of its malignant cells. In some embodiments, cells such as a population that contains or is suspected of containing B cells are recovered and isolated from blood. In some embodiments, the cells are recovered and isolated from bone marrow, such as from a bone marrow aspirate or a bone marrow biopsy, and / or from other biological samples. In some embodiments, polymerase chain reaction (PCR) amplification of complementarity determining region 3 (CDR3) is achieved using primers against highly conserved sequences within the V and J regions of the locus, and this is used to identify clonal populations of cells for the purpose of assessing minimal residual disease. Other methods for detecting clonal populations may be used, such as single cell sequencing approaches, including those that provide information regarding the number of clonal populations, e.g., cells expressing a particular lineage of cells and / or a particular variable chain such as a variable heavy chain or its binding site. In some embodiments, IGH DNA is amplified using degenerate primers or primers that recognize regions of the variable chain that are shared between different cell clones, such as primers that recognize the consensus V and degenerate consensus J regions of the IGH sequence. An exemplary sequence of the V region is ACACGGCCTCGTGTATTACTGT (SEQ ID NO: 57). An exemplary degenerate consensus sequence of the J region is ACCTGAGGAGACGGTGACC (SEQ ID NO: 58).

[0242] PCR products or sequencing results are, in some embodiments, specific for the rearranged alleles and function as clonal markers for MRD detection. After PCR amplification of the CDR3 region, the PCR products can be sequenced to obtain patient-specific oligonucleotides constructed as probes for allele-specific PCR for highly sensitive detection of MRD after treatment of B cell malignancies with CAR-T cell therapy, such as CD19 CAR-T cell therapy. In examples where PCR products cannot be obtained using consensus primers, V region family-specific primers for framework region 1 can instead be used.

[0243] In some embodiments, the persistence of PCR-detectable tumor cells, such as cells of B cell malignancies such as NHL or CLL, e.g., detectable IGH sequences corresponding to malignant or clonal IGH sequences, after treatment is associated with an increased risk of recurrence. In some embodiments, patients who are negative for malignant IGH sequences after treatment (in some embodiments, even if there are other criteria indicative of disease progression or partial response, such as persistence of lymphadenopathy, or other criteria that may be associated with disease or lack of complete response in some situations) may be considered to have a higher likelihood of PFS, or a higher likelihood of entering CR or durable CR, or a higher likelihood of extended survival compared to patients in which malignant IGH sequences persist. In some embodiments, such prognostic or staging determinations are particularly relevant to treatments in which disappearance of malignant cells is observed in the short term after treatment administration, as compared to resolution of other clinical signs, such as lymph node size or other staging criteria. For example, in some such embodiments, the absence of detectable IGH or minimal residual disease in a sample such as bone marrow can be a favorable readout for response or likelihood of response, or its persistence, as compared to other available staging or prognostic approaches. In some embodiments, results of MRD, such as IGH deep sequencing information, may inform further intervention or its absence. For example, the methods and other provided embodiments may, in some contexts, result in a subject determined to be negative for malignant IGH being not further treated in some embodiments, or not further administered the dosage of the provided treatment, or the subject being administered a lower or reduced dosage. Conversely, a subject shown to have MRD by IGH deep sequencing may be provided or designated to be further treated, e.g., at a dosage equal to or more than the initially administered therapy, or with additional treatment. In some embodiments, the disease or condition persists after administration of the first dosage, and / or the first dosage of administration is insufficient to eradicate the disease or condition in the subject.

[0244] In some embodiments, the method reduces the burden of a disease or condition, such as the number of tumor cells, tumor size, patient survival or progression-free survival, to a greater extent and / or for a longer period compared to a reduction observed with an alternative dosing regimen, e.g., one in which the subject receives one or more alternative therapeutic agents, and / or a method provided to the subject, and / or an equivalent method that does not receive a dose of a cell and / or lymphodepleting agent provided to the subject or the manufactured product or composition. In some embodiments, the burden of the disease or condition in the subject is detected, evaluated, or measured. The disease burden can be detected, in some aspects, by detecting the total number of disease or disease-related cells, such as tumor cells, in the subject, or in an organ, tissue, or body fluid of the subject, such as blood or serum. In some aspects, the survival of the subject, survival within a certain period, degree of survival, presence or duration of progression-free or symptom-free survival, or recurrence-free survival is evaluated. In some embodiments, any symptoms of the disease or condition are evaluated. In some embodiments, a measure of the burden of the disease or condition is specified.

[0245] In some embodiments, the progression-free survival or overall survival of a subject is improved by the present method as compared to other methods, such as methods in which the subject receives one or more alternative therapeutic agents, and / or methods in which the subject is provided, and / or methods in which the subject does not receive a dose of a cell and / or lymphocyte-depleting agent that corresponds to a manufactured product or composition provided. For example, in some embodiments, the progression-free survival or probability of a subject treated by the method for 6 months of dosing is greater than about 40%, greater than about 50%, greater than about 60%, greater than about 70%, greater than about 80%, greater than about 90%, or greater than about 95%. In some aspects, the overall survival is greater than about 40%, greater than about 50%, greater than about 60%, greater than about 70%, greater than about 80%, greater than about 90%, or greater than about 95%. In some embodiments, a subject treated by the present method exhibits progression-free survival, relapse-free survival, or survival for at least 6 months, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 years. In some embodiments, the time to progression is improved, for example, the time to progression is greater than 6 months or about 6 months or more, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 years.

[0246] In some embodiments, after treatment by the present method, the probability of relapse is reduced as compared to other methods, such as methods in which the subject receives one or more alternative therapeutic agents, and / or methods in which the subject is provided, and / or methods in which the subject does not receive a dose of a cell and / or lymphocyte-depleting agent that corresponds to a manufactured product or composition provided. For example, in some embodiments, the probability of relapse 6 months after the first dose is less than about 80%, less than about 70%, less than about 60%, less than about 50%, less than about 40%, less than about 30%, less than about 20%, or less than about 10%.

[0247] In some cases, the pharmacokinetics of administered cells, such as adoptively transferred cells, are determined to evaluate the availability, such as bioavailability, of the administered cells. A method for determining the pharmacokinetics of adoptively transferred cells can include collecting peripheral blood from the subject to whom the engineered cells were administered and determining the number or ratio of engineered cells in the peripheral blood. Approaches for selecting and / or isolating cells can include the use of chimeric antigen receptor (CAR) - specific antibodies (e.g., Brentjens et al., Sci. Transl. Med. 2013 Mar; 5(177): 177ra38), Protein L (Zheng et al., J. Transl. Med. 2012 Feb; 10:29), epitope tags such as Strep - Tag sequences directly introduced into specific sites of the CAR, by which a Strep - Tag binding reagent is used to directly evaluate the CAR (Liu et al. (2016) Nature Biotechnology, 34:430; International Patent Application Publication No. WO 2015095895), and monoclonal antibodies that specifically bind to the CAR polypeptide (see International Patent Application Publication No. WO 2014190273). In some cases, foreign marker genes may be utilized in connection with artificial cell therapies to enable the detection or selection of cells and, in some cases, to promote the suicide of cells. In some cases, a truncated epidermal growth factor receptor (EGFRt) can be co - expressed with the transgene of interest (CAR or TCR) in the transduced cells (see, e.g., U.S. Patent No. 8,802,374). EGFRt may contain an epitope recognized by the antibody cetuximab (Erbitux®) or other therapeutic anti - EGFR antibodies or binding molecules and can be used to identify or select engineered cells using the EGFRt construct and another recombinant receptor such as a chimeric antigen receptor (CAR), and / or to eliminate or separate cells expressing the receptor. See U.S. Patent No. 8,802,374 and Liu et al., Nature Biotech. 2016 April; 34(4): 430 - 434.

[0248] In some embodiments, the number of CAR + T cells in a biological sample obtained from a patient, such as blood, can be determined at a certain time after administration of the cell therapy, for example, to determine the pharmacokinetics of the cells. In some embodiments, the number of CAR + T cells, optionally CAR + CD8 + T cells and / or CAR + CD4 + T cells in the blood of a subject is greater than 1 cell per μL, greater than 5 cells per μL, or greater than 10 cells per μL.

[0249] D. Toxicity In some embodiments, the provided method has a lower rate and / or a lower degree of toxicity, toxicity outcome or symptoms, a profile, factor, or characteristic that promotes toxicity, such as cytokine release syndrome (CRS) or neurotoxicity (NT), compared to the administration of alternative cell therapies, such as the administration of alternative CAR + T cell compositions and / or alternative cells, for example, the administration of cells that are not administered at a defined ratio, or is designed to result in symptoms or outcomes associated with or indicative of such features, or includes such features.

[0250] In some embodiments, the provided method does not result in a high rate or likelihood of toxicity or toxic outcome, or reduces the rate or likelihood of toxicity or toxic outcome such as neurotoxicity (NT) or cytokine release syndrome (CRS), as compared to, for example, certain other cell therapies. In some embodiments, the method does not result in or increase the risk of severe NT (sNT), severe CRS (sCRS), macrophage activation syndrome, tumor lysis syndrome, fever of at least 38 degrees Celsius or at least about 38 degrees Celsius for more than three days, and plasma CRP levels of at least 20 mg / dL or at least about 20 mg / dL. In some embodiments, 30%, 35%, 40%, 50%, 55%, more than 60% or more, or about 30%, 35%, 40%, 50%, 55%, more than 60% or more of the subjects treated according to the provided method do not exhibit a grade of CRS or a grade of neurotoxicity. In some embodiments, 50% or less of the treated subjects (e.g., at least 60%, at least 70%, at least 80%, at least 90%, or more of the treated subjects) exhibit cytokine release syndrome (CRS) higher than grade 2 and / or neurotoxicity higher than grade 2. In some embodiments, at least 50% of the subjects treated according to the method (e.g., at least 60%, at least 70%, at least 80%, at least 90% or more of the treated subjects) do not exhibit neurotoxicity of grade 3 or higher, and / or do not exhibit severe toxicity outcomes such as severe CRS, i.e., do not exhibit severe CRS or severe neurotoxicity, or do not do so within a certain period after treatment, such as within one week, two weeks, or one month from the administration of the cells. In some embodiments, the parameters evaluated to determine a particular toxicity include adverse events (AE), dose-limiting toxicity (DLT), CRS, and NT.

[0251] Administration of adoptive T cell therapies, such as treatment with T cells expressing chimeric antigen receptors, can induce toxic effects or outcomes such as cytokine release syndrome and neurotoxicity. In some instances, such effects or outcomes are correlated with high levels of circulating cytokines that may underlie the observed toxicities.

[0252] In some embodiments, the toxic outcome is, is related to, or indicative of cytokine release syndrome (CRS) or severe CRS (sCRS). CRS, e.g., sCRS, can occur in some cases following administration of adoptive T cell therapies and other biologics to a subject. See Davila et al., Sci Transl Med 6, 224ra25 (2014); Brentjens et al., Sci. Transl. Med. 5, 177ra38 (2013); Grupp et al., N. Engl. J. Med. 368, 1509-1518 (2013); and Kochenderfer et al., Blood 119, 2709-2720 (2012); Xu et al., Cancer Letters 343 (2014) 172-78.

[0253] Typically, CRS is caused by an overactivation of the systemic immune response mediated, for example, by T cells, B cells, NK cells, monocytes, and / or macrophages. Such cells can release large amounts of inflammatory mediators such as cytokines and chemokines. Cytokines can induce an acute inflammatory response and / or induce endothelial organ damage, leading to microvascular leakage, heart failure, and potentially death. Severe and life-threatening CRS can cause lung infiltration and lung injury, kidney failure, or disseminated intravascular coagulation. Other life-threatening severe toxicities can include cardiotoxicity, respiratory distress, neurotoxicity, and / or liver failure. In some embodiments, fever, particularly high fever (≥38.5°C or ≥101.3°F), is associated with CRS or the risk thereof. In some cases, the characteristics or symptoms of CRS resemble those of an infectious disease. In some embodiments, in a subject presenting with CRS symptoms, an infectious disease is also considered, and culture monitoring and empirical antibiotic therapy may be performed. Other symptoms associated with CRS can include cardiac dysfunction, adult respiratory distress syndrome, kidney failure and / or liver failure, coagulation disorders, disseminated intravascular coagulation, and capillary leak syndrome.

[0254] CRS may be treated using anti-IL-6 therapy, such as anti-IL-6 antibodies, such as tocilizumab, or anti-inflammatory therapy such as antibiotics or other agents described herein. The outcomes, signs, and symptoms of CRS are known and include those described herein. In some embodiments, where a particular dosing regimen or administration affects or does not affect the outcome, signs, or symptoms associated with a given CRS, a particular outcome, sign, and symptom, and / or the amount or degree thereof may be specified.

[0255] In connection with the administration of cells expressing a CAR, CRS typically occurs 6 - 20 days after infusion of the cells expressing the CAR. See Xu et al., Cancer Letters 343 (2014) 172-78. In some cases, CRS occurs less than 6 days or more than 20 days after CAR T cell infusion. The incidence and timing of CRS may be related to baseline cytokine levels or tumor burden at the time of infusion. Generally, CRS is associated with elevated serum levels of interferon (IFN)-γ, tumor necrosis factor (TNF)-α, and / or interleukin (IL)-2. Other cytokines that can be rapidly induced in CRS are IL-1β, IL-6, IL-8, and IL-10.

[0256] Exemplary outcomes associated with CRS include fever, rigors, chills, hypotension, dyspnea, acute respiratory distress syndrome (ARDS), encephalopathy, elevated ALT / AST, renal failure, cardiac impairment, hypoxia, neuropathy, and death. Neurological complications include delirium, seizure-like activity, confusion, word finding difficulty, aphasia, and / or loss of consciousness. Other outcomes associated with CRS include fatigue, nausea, headache, seizures, tachycardia, myalgia, rash, acute vascular leak syndrome, liver dysfunction, and renal failure. In some embodiments, CRS is associated with an increase in one or more factors such as serum ferritin, d-dimer, aminotransferase, lactate dehydrogenase and triglycerides, or hypofibrinogenemia or hepatosplenomegaly. Other exemplary signs or symptoms associated with CRS include hemodynamic instability, febrile neutropenia, increased serum C-reactive protein (CRP), changes in coagulation parameters (e.g., international normalized ratio (INR), prothrombin time (PTI) and / or fibrinogen), changes in cardiac and other organ function, and / or absolute neutrophil count (ANC).

[0257] In some embodiments, the outcomes associated with CRS include one or more of the following: persistent fever, e.g., for 2 days or more, e.g., for 3 days or more, e.g., for 4 days or more or a temperature specified for at least 3 consecutive days, e.g., a fever above 38 degrees Celsius or above about 38 degrees Celsius; a fever of 38 degrees Celsius or above about 38 degrees Celsius; an increase in cytokines, e.g., at least two cytokines (e.g., at least two of the group consisting of interferon gamma (IFNγ), GM-CSF, IL-6, IL-10, Flt-3L, fractalkine, and IL-5, and / or tumor necrosis factor alpha (TNFα)), or at least or at least about 250-fold maximum fold change of at least one such cytokine; and / or at least one clinical sign of toxicity, e.g., hypotension (e.g., as measured by at least one intravenous vasoactive pressor); hypoxemia (e.g., a plasma oxygen (PO2) level of 90% or less than about 90%); and / or one or more neuropathies (including changes in mental status, loss of consciousness, and seizures). In some embodiments, neurotoxicity (NT) may be observed in parallel with CRS.

[0258] Exemplary outcomes associated with CRS include an increase or elevation in the serum levels of one or more factors, including cytokines and chemokines, and other factors associated with CRS. Exemplary outcomes further include an increase in the synthesis or secretion of one or more such factors. Such synthesis or secretion may be by cells that interact with T cells, such as T cells, or innate immune cells or B cells.

[0259] In some embodiments, the serum factors associated with CRS or the outcomes associated with CRS include inflammatory cytokines and / or chemokines, including interferon gamma (IFN-γ), TNF-a, IL-1β, IL-2, IL-6, IL-7, IL-8, IL-10, IL-12, sIL-2Ra, granulocyte macrophage colony stimulating factor (GM-CSF), macrophage inflammatory protein (MIP)-1, tumor necrosis factor alpha (TNFα), IL-6, and IL-10, IL-1β, IL-8, IL-2, MIP-1, Flt-3L, fractalkine, and / or IL-5. In some embodiments, the factor or outcome includes C-reactive protein (CRP). In addition to being an early and easily measurable risk factor for CRS, CRP is also a marker of cell expansion. In some embodiments, subjects having a measured high level of CRP, such as ≧15 mg / dL, have CRS. In some embodiments, subjects having a measured high level of CRP do not have CRS. In some embodiments, the measure of CRS includes a measure of CRP and another factor indicative of CRS.

[0260] In some embodiments, one or more inflammatory cytokines or chemokines are monitored before, during, or after CAR treatment. In some aspects, the one or more cytokines or chemokines include IFN-γ, TNF-α, IL-2, IL-1β, IL-6, IL-7, IL-8, IL-10, IL-12, sIL-2Rα, granulocyte macrophage colony stimulating factor (GM-CSF), or macrophage inflammatory protein (MIP). In some embodiments, IFN-γ, TNF-α, and IL-6 are monitored.

[0261] To predict which patients are at higher risk of developing sCRS, CRS criteria that are thought to be correlated with the development of CRS have been developed (see Davilla et al. Science translational medicine. 2014;6(224):224ra25). Factors include elevated serum levels of inflammatory cytokines such as fever, hypoxia, hypotension, neurological changes, a set of seven cytokines (IFNγ, IL-5, IL-6, IL-10, Flt-3L, fractalkine, and GM-CSF), and the increases induced by its treatment can be well correlated with both pre-treatment tumor burden and sCRS symptoms. Other guidelines regarding the diagnosis and management of CRS are also known (see, for example, Lee et al, Blood. 2014;124(2):188-95). In some embodiments, the criteria reflecting the grade of CRS are those detailed in Table 3 below. [Table 3]

[0262] In some embodiments, the criteria reflecting the grade of CRS are those detailed in Table 4 below. [Table 4]

[0263] In some embodiments, high-dose vasopressor therapy includes those described in Table 5 below. [Table 5]

[0264] In some embodiments, the toxicity outcome is severe CRS. In some embodiments, the toxicity outcome is the absence of severe CRS (e.g., moderate or mild CRS). In some embodiments, after administration, a subject is considered to have developed "severe CRS" ("sCRS") in response to or secondarily to the administration of a cell therapy or a dose of its cells if the subject exhibits the following: (1) a fever of at least 38 degrees Celsius for at least 3 days; (2) (a) a maximum fold change of at least 75 for at least 2 of the following 7 cytokine groups compared to the level immediately after administration: interferon gamma (IFNγ), GM-CSF, IL-6, IL-10, Flt-3L, fractalkine, and IL-5, and / or (b) a maximum fold change of at least 250 for at least 1 of the following 7 cytokine groups compared to the level immediately after administration: interferon gamma (IFNγ), GM-CSF, IL-6, IL-10, Flt-3L, fractalkine, and IL-5; and (c) a cytokine elevation including any of at least one clinical sign of toxicity such as hypotension (requiring at least one intravenous vasoactive pressor) or hypoxemia (PO2 < 90%) or one or more neuropathies (including changes in mental status, syncope, and / or seizures). In some embodiments, severe CRS includes grade 3 or higher CRS as described in Tables 3 and 4.

[0265] In some embodiments, the outcome of toxicity, e.g., the level of the outcome related to CRS, e.g., the serum level of the indicator of CRS, is measured by ELISA. In some embodiments, the levels of fever and / or C-reactive protein (CRP) can be measured. In some embodiments, a subject having fever and CRP ≥ 15 mg / dL may be considered to have a high risk of developing severe CRS. In some embodiments, the serum factors related to CRS or the outcomes related to CRS include an increase in the levels and / or concentrations of inflammatory cytokines and / or chemokines including Flt-3L, fractalkine granulocyte macrophage colony-stimulating factor (GM-CSF), interleukin-1 beta (IL-1β), IL-2, IL-5, IL-6, IL-7, IL-8, IL-10, IL-12, interferon gamma (IFN-γ), macrophage inflammatory protein (MIP)-1, MIP-1, sIL-2Rα, or tumor necrosis factor alpha (TNFα). In some embodiments, the factor or outcome includes C-reactive protein (CRP). In addition to being an early and easily measurable risk factor for CRS, CRP is also a marker of cell expansion. In some embodiments, a subject measured to have a high level of CRP, such as ≥ 15 mg / dL, has CRS. In some embodiments, a subject measured to have a high level of CRP does not have CRS. In some embodiments, the measure of CRS includes the measure of CRP and another factor indicating CRS.

[0266] In some embodiments, the outcomes associated with severe CRS or CRS of grade 3 or higher, such as grade 4 or higher CRS, include one or more of the following: persistent fever, such as a fever for 2 days or more, such as 3 days or more, such as 4 days or more, or a designated temperature for at least 3 consecutive days, such as a fever of 38 degrees Celsius or higher or about 38 degrees Celsius or higher; an increase in cytokines, such as at least 2 cytokines (e.g., at least 2 selected from the group consisting of interferon gamma (IFNγ), GM-CSF, IL-6, IL-10, Flt-3L, fractalkine, and IL-5), and / or at least one maximum fold change of such a cytokine, such as at least or at least about 250-fold; and / or at least one clinical sign of toxicity, such as hypotension (e.g., measured by at least one intravenous vasoactive pressor); hypoxemia (e.g., a plasma oxygen (PO2) level of less than about 90% or about 90%); and / or one or more neuropathies (including changes in mental status, loss of consciousness, and seizures). In some embodiments, severe CRS includes CRS that requires management or care in an intensive care unit (ICU).

[0267] In some embodiments, CRS, such as severe CRS, includes the combination of (1) persistent fever (a fever of at least 3 days, at least 38 degrees Celsius) and (2) a serum level of CRP of at least or at least about 20 mg / dL. In some embodiments, CRS includes hypotension that requires the use of two or more vasopressors, or respiratory failure that requires mechanical ventilation. In some embodiments, the dosage of the vasopressor is increased in subsequent administrations.

[0268] In some embodiments, severe CRS or grade 3 CRS includes an increase in alanine aminotransferase, an increase in aspartate aminotransferase, chills, febrile neutropenia, headache, left ventricular dysfunction, encephalopathy, hydrocephalus, and / or tremors.

[0269] Methods for measuring or detecting various outcomes may be specified.

[0270] In some embodiments, the toxicity outcome is neurotoxicity or is associated with neurotoxicity. In some embodiments, symptoms associated with the clinical risk of neurotoxicity include confusion, delirium, aphasia, expressive aphasia, loss of consciousness, myoclonus, somnolence, changes in mental state, seizures, seizure-like activity, seizures (which may be confirmed by electroencephalogram (EEG)), elevated beta amyloid (Aβ) levels, elevated glutamate levels, and elevated oxygen radical levels. In some embodiments, neurotoxicity is rated based on severity (e.g., using a scale of grades 1-5 (see, e.g., Guido Cavaletti & Paola Marmiroli Nature Reviews Neurology 6, 657-666 (December 2010); National Cancer Institute-Common Toxicity Criteria version 4.03 (refer to NCI-CTCAE v4.03).

[0271] In some cases, neurological symptoms may be the initial symptoms of sCRS. In some embodiments, neurological symptoms appear to begin 5 to 7 days after cell therapy infusion. In some embodiments, the duration of neurological changes may range from 3 to 19 days. In some cases, neurological changes resolve after other symptoms of sCRS have resolved. In some embodiments, the time or degree of resolution of neurological changes is not accelerated by treatment with anti-IL-6 and / or steroids (plural possible).

[0272] In some embodiments, after administration, if the subject exhibits symptoms that restrict the subject's self-care (e.g., bathing, dressing and undressing, eating, using the toilet, taking medications) from the following, the subject is considered to develop "severe neurotoxicity" in response to or secondarily to the cell therapy or the dose of the cells: 1) symptoms of peripheral motor neuropathy including inflammation or degeneration of the peripheral motor nerves; 2) symptoms of peripheral sensory neuropathy including inflammation or degeneration of the peripheral sensory nerves, paresthesia such as distortion of sensory perception that results in abnormal and unpleasant sensations, neuralgia such as intense pain along a nerve or nerve group, and / or dysfunction of sensory nerve cells that results in abnormal skin sensations of tingling, numbness, pressure, cold, and warmth in the absence of stimuli. In some embodiments, severe neurotoxicity includes grade 3 or higher neurotoxicity as described in Table 6.

Table 6

[0273] In some embodiments, the method reduces symptoms associated with CRS or neurotoxicity as compared to other methods. In some aspects, the provided method reduces symptoms, outcomes, or factors associated with CRS, including symptoms, outcomes, or factors associated with severe CRS or grade 3 or higher CRS, as compared to other methods. For example, in a subject treated according to the method, symptoms, outcomes, or factors of CRS, such as severe CRS or grade 3 or higher CRS, as described, for example, in any of Tables 3 and 4, are not detectable and / or may be reduced. In some embodiments, a subject treated according to the method may have reduced symptoms of neurotoxicity including limb weakness or numbness, loss of memory, vision, and / or intellect, uncontrollable compulsive behaviors and / or compulsions, delusions, headache, loss of motor control, reduced cognitive function, and problems of cognition and behavior including autonomic nervous system dysfunction, as well as sexual dysfunction, as compared to a subject treated according to other methods. In some embodiments, a subject treated according to the method may have reduced symptoms associated with peripheral motor neuropathy, peripheral sensory neuropathy, paresthesia, neuralgia, or sensory paralysis.

[0274] In some embodiments, the method reduces outcomes associated with neurotoxicity, including damage to the nervous system and / or brain, such as neuronal cell death. In some aspects, the method reduces the levels of factors associated with neurotoxicity, such as beta amyloid (Aβ), glutamate, and oxygen radicals.

[0275] In some embodiments, the toxic outcome is dose-limiting toxicity (DLT). In some embodiments, the toxic outcome is dose-limiting toxicity. In some embodiments, the toxic outcome is the absence of dose-limiting toxicity. In some embodiments, dose-limiting toxicity (DLT) is defined as any toxicity of grade 3 or higher evaluated according to any known or published guidelines for assessing a particular toxicity, such as those described above and including, for example, the National Cancer Institute (NCI)'s Common Terminology Criteria for Adverse Events (CTCAE) version 4.0.

[0276] In some embodiments, the low rate, risk or likelihood of developing toxicity, such as CRS or neurotoxicity, or severe CRS or neurotoxicity, such as grade 3 or higher CRS or neurotoxicity, observed upon administration of a dose of T cells according to the provided method and / or the provided manufactured product or composition, enables the administration of the cell therapy ex vivo. In some embodiments, administration of a dose of a cell therapy, such as a T cell (e.g., a CAR + T cell), according to the provided method and / or the provided manufactured product or composition, is performed ex vivo or does not require hospitalization of the subject, such as an overnight stay in the hospital.

[0277] In some aspects, a cell therapy, such as a T cell (e.g., a CAR +Subjects administered a dose of T cells (e.g., CAR T cells) include subjects treated exogenously, and no intervention for treating toxicity is administered before or with the administration of the cell dose unless or until the subject exhibits signs or symptoms of toxicity such as neurotoxicity or CRS.

[0278] In some embodiments, subjects treated exogenously, including subjects administered a dose of a cell therapy, e.g., T cells (e.g., CAR + If a subject administered a dose of T cells (e.g., CAR T cells) exhibits fever, the subject is given or instructed to receive or administer a treatment to reduce the fever. In some embodiments, the subject's fever is characterized as the subject's body temperature at or above a certain threshold temperature or level. In some aspects, the threshold temperature is a temperature associated with at least low-grade fever, at least moderate fever, and / or at least high-grade fever. In some embodiments, the threshold temperature is a specific temperature or range. For example, the threshold temperature can be 38 °C, 39 °C, 40 °C, 41 °C, or 42 °C or about 38 °C, 39 °C, 40 °C, 41 °C, or 42 °C or at least 38 °C, 39 °C, 40 °C, 41 °C, or 42 °C or at least about 38 °C, 39 °C, 40 °C, 41 °C, or 42 °C, and / or a range of 38 °C or about 38 °C to 39 °C or about 39 °C, 39 °C or about 39 °C to 40 °C or about 40 °C, 40 °C or about 40 °C to 41 °C or about 41 °C, or 41 °C or about 41 °C to 42 °C or about 42 °C.

[0279] In some embodiments, treatments designed to reduce heat include treatment with an antipyretic. An antipyretic can include any agent that reduces heat, such as a compound, composition, or component, such as one of any number of agents known to have an antipyretic effect, such as NSAIDs (e.g., ibuprofen, naproxen, ketoprofen, and nimesulide), aspirin, choline salicylate, magnesium salicylate, and sodium salicylate, such as salicylates, paracetamol, acetaminophen, metamizole, nabumetone, phenaxone, antipyrine, febrifuge. In some embodiments, the antipyretic is acetaminophen. In some embodiments, acetaminophen can be administered orally or intravenously at a dose of 12.5 mg / kg, up to every 4 hours. In some embodiments, acetaminophen is called paracetamol. In some embodiments, acetaminophen is or includes ibuprofen or aspirin.

[0280] In some embodiments, if the fever is a persistent fever, an alternative treatment for treating toxicity is administered to the subject. In an outpatient subject, if the subject has a persistent fever and / or it is determined that the subject has a persistent fever, the subject is instructed to return to the hospital. In some embodiments, if the subject exhibits a fever above a relevant threshold temperature and, after a specified treatment, for example, a treatment designed to reduce heat such as with an antipyretic, such as an NSAID or a salicylate, such as ibuprofen, acetaminophen, or aspirin, the subject's fever or body temperature does not decrease or does not decrease by more than a predetermined amount (e.g., more than 1°C, generally no variation greater than about 0.5°C, 0.4°C, 0.3°C, or 0.2°C), the subject is considered to have and / or be determined to have or be thought to have a persistent fever. For example, if the subject exhibits or is determined to exhibit a body temperature of at least 38°C or 39°C or about 38°C or 39°C, and even after treatment with an antipyretic, such as acetaminophen, does not decrease by more than 0.5°C, 0.4°C, 0.3°C, or 0.2°C, or about 0.5°C, 0.4°C, 0.3°C, or 0.2°C, or does not decrease by 1%, 2%, 3%, 4%, or 5%, or about 1%, 2%, 3%, 4%, or 5% over a period of 6 hours, over a period of 8 hours, or over a period of 12 hours, or over a period of 24 hours, the subject is considered to have a persistent fever. In some embodiments, the dosage of the antipyretic is the dosage normally effective in such a subject for reducing a particular type of fever, such as a fever associated with a fever, or a bacterial or viral infection, such as a local or systemic infection. In some embodiments, acetaminophen is called paracetamol.

[0281] In some embodiments, if the subject exhibits fever above a threshold temperature associated therewith, and there is no more than about 1°C fluctuation in the subject's fever or body temperature, generally no more than about 0.5°C, 0.4°C, 0.3°C, or 0.2°C, or no more fluctuation than about 0.5°C, 0.4°C, 0.3°C, or 0.2°C, the subject has, and / or is determined to have, or is considered to have, persistent fever. Such lack of more than a certain amount of fluctuation is generally measured over a predetermined period (e.g., measured over a period of 24 hours, 12 hours, 8 hours, 6 hours, 3 hours, or 1 hour, and can be measured from the first sign of fever or the first body temperature exceeding the indicated threshold). For example, in some embodiments, if the subject shows a fever with a body temperature of at least 38 degrees Celsius or 39 degrees Celsius, or about at least 38 degrees Celsius or 39 degrees Celsius, and does not exceed 0.5°C, 0.4°C, 0.3°C, or 0.2°C, or does not fluctuate more than about 0.5°C, 0.4°C, 0.3°C, or 0.2°C over a period of 6 hours, over a period of 8 hours, over a period of 12 hours, or over a period of 24 hours, the subject is considered to show, or is determined to show, persistent fever.

[0282] In some embodiments, the fever is persistent fever; in some aspects, the subject is treated within 1, 2, 3, 4, 5, 6 hours or less, such as from the time the subject is determined to have persistent fever, e.g., from such determination, or from the first such determination after a first treatment that has the potential to induce toxicity, such as the dose of CAR + T cells, etc.

[0283] In some embodiments, one or more interventions or agents for treating toxicity, such as toxicity-targeted therapy, are administered at or immediately after the time when the subject is determined or confirmed (such as first determined or confirmed) to show persistent fever, as measured, for example, according to any of the foregoing embodiments. In some embodiments, one or more toxicity-targeted therapies are administered within a certain time period from such confirmation or determination, such as within 30 minutes, within 1 hour, within 2 hours, within 3 hours, within 4 hours, within 6 hours, or within 8 hours.

[0284] II. Recombinant antigen receptor In some embodiments, the cells used in or administered in connection with the provided methods contain, or are engineered to contain, an engineered receptor, such as an engineered antigen receptor, e.g., a chimeric antigen receptor (CAR). Also, a population of such cells, a composition containing such cells, and / or a composition enriched for a particular type of cell, such as a T cell or a CD8 + or CD4 + cell, are provided. Compositions include pharmaceutical compositions and formulations for administration, such as adoptive cell therapy. Also provided are methods of treating a subject, e.g., a patient, by administering cells and compositions according to the provided methods and / or provided products or compositions.

[0285] In some embodiments, the cells contain one or more nucleic acids introduced by genetic engineering, thereby expressing a recombinant or genetically engineered product of such nucleic acids. In some embodiments, gene transfer is achieved by first stimulating the cells, e.g., in combination with a stimulus that induces a response such as proliferation, survival, and / or activation as measured by, e.g., expression of a cytokine or activation marker, then transducing the activated cells, and then expanding in culture to a number sufficient for clinical application.

[0286] A. Chimeric antigen receptor (e.g., CD19-targeted CAR) In some embodiments of the methods and uses provided, a chimeric receptor, such as a chimeric antigen receptor, contains one or more domains that combine a ligand-binding domain (such as an antibody or antibody fragment) that confers specificity for a desired antigen (such as a tumor antigen) and an intracellular signaling domain. In some embodiments, the intracellular signaling domain is a stimulatory or activating intracellular domain portion, such as a T cell stimulatory or activating domain, that provides a primary activation signal or primary signal. In some embodiments, the intracellular signaling domain contains or further contains a co-stimulatory signaling domain to facilitate effector function. In some embodiments, genetic engineering of the chimeric receptor within immune cells can regulate T cell activity and, in some cases, modulate T cell differentiation or homeostasis, thereby resulting in genetically engineered cells with improved in vivo lifespan, survival and / or persistence, such as for use in methods by adoptive cell therapy.

[0287] Exemplary antigen receptors that include a CAR, and methods for engineering and introducing such receptors into cells include, for example, those described in International Patent Application Publication Nos. WO200014257, WO2013126726, WO2012 / 129514, WO2014031687, WO2013 / 166321, WO2013 / 071154, WO2013 / 123061, U.S. Patent Application Publication Nos. US2002131960, US2013287748, US20130149337, U.S. Patents Nos. 6,451,995, 7,446,190, 8,252,592, 8,339,645, 8,398,282, 7,446,179, 6,410,319, 7,070,995, 7,265,209, 7,354,762, 7,446,191, 8,324,353, and 8,479,118, and European Patent Application No. EP2537416, and / or Sadelaín et al., Cancer Discov. 2013 April; 3(4): 388-398; Davila et al. (2013) PLoS ONE 8(4): e61338; Turtle et al., Curr. Opin. Immunol., 2012 October; 24(5): 633-39; Wu et al., Cancer, 2012 March 18(2): 160-75. In some embodiments, the antigen receptor includes the CAR described in U.S. Patent No. 7,446,190 and the CAR described in International Patent Application Publication No. 2014055668 A1.Examples of CARs include those disclosed in any of the aforementioned publications such as WO2014031687, US8,339,645, US7,446,179, US2013 / 0149337, U.S. Patent No. 7,446,190, U.S. Patent No. 8,389,282, Kochenderfer et al., 2013, Nature Reviews Clinical Oncology, 10, 267-276 (2013); Wang et al. (2012) J. Immunother. 35(9): 689-701; and Brentjens et al., Sci Transl Med. 2013 5(177). See also WO2014031687, US8,339,645, US7,446,179, US2013 / 0149337, U.S. Patent No. 7,446,190, and U.S. Patent No. 8,389,282.

[0288] Chimeric receptors such as CARs generally include an extracellular antigen-binding domain, for example, a portion of an antibody molecule, generally the variable heavy chain (V H ) region and / or variable light chain (V L ) region of an antibody, such as an scFv antibody fragment.

[0289] In some embodiments, the antigen targeted by the receptor is a polypeptide. In certain embodiments, the antigen target is CD19. In some embodiments, the antigen is selectively expressed or overexpressed on cells of a disease or condition, such as tumor or pathogenic cells, compared to normal or non-target cells or tissues.

[0290] In some embodiments, the CAR is engineered to have specificity for a particular antigen, such as an antigen that elicits a reduced response, for example a cancer marker, and / or an antigen expressed on a normal or non-diseased cell type, such as an antigen expressed in a particular cell type targeted by adoptive therapy. Thus, the CAR typically includes one or more antigen-binding molecules, such as one or more antigen-binding fragments, domains, or moieties, and / or one or more antibody variable domains, and / or antibody molecules, in its extracellular portion. In some embodiments, the CAR includes the antigen-binding portion(s) of an antibody molecule, such as a single-chain antibody fragment (scFv) derived from the variable heavy chain (V H ) and variable light chain (V L ) of a monoclonal antibody (mAb).

[0291] In some embodiments, the antibody or its antigen-binding portion is expressed on the cell surface as part of a recombinant receptor, such as a chimeric receptor (e.g., CAR), that binds, e.g., specifically binds, to an antigen (e.g., CD19). Among the antigens targeted by chimeric receptors are those that are expressed in relation to a disease, condition, or cell type targeted by adoptive cell therapy. Among the diseases and conditions are proliferative, neoplastic, and malignant diseases and disorders, including tumors and cancers, including hematologic cancers, cancers of the immune system, such as lymphomas, leukemias, and / or myelomas, such as B, T, and myeloid leukemias, lymphomas, and multiple myelomas.

[0292] In some embodiments, the CAR contains an antibody or antigen-binding fragment (e.g., scFv) that specifically recognizes an antigen, such as an intact antigen, expressed on the surface of a cell.

[0293] In some embodiments, the disease or condition is a B cell malignancy, such as large cell type B cell lymphoma (e.g., DLBCL), and the antigen is CD19.

[0294] As used herein, the term "antibody" is used in the broadest sense and includes polyclonal and monoclonal antibodies, including intact antibodies and functional (antigen-binding) antibody fragments, which are fragment antigen-binding (Fab) fragments, F(ab’)2 fragments, Fab’ fragments, Fv fragments, recombinant IgG (rIgG) fragments, variable heavy chain (V H ) regions capable of specifically binding to an antigen, single-chain antibody fragments including single-chain variable fragments (scFv), and single-domain antibody (e.g., sdAb, sdFv, nanobody) fragments. The term includes intrabodies, peptibodies, chimeric antibodies, fully human antibodies, humanized antibodies, and heteroconjugate antibodies, multispecific antibodies such as bispecific antibodies, diabodies, tribodies, and tetrabodies, tandem di-scFv, tandem tri-scFv, etc., immunoglobulin in genetically engineered and / or otherwise modified forms. Unless otherwise stated, the term "antibody" should be understood to include its functional antibody fragments. The term also includes intact antibodies or full-length antibodies, including any class or subclass of antibodies, including IgG and its subclasses, IgM, IgE, IgA, and IgD.

[0295] In some embodiments, the antigen-binding protein, antibody, and its antigen-binding fragment specifically recognize the antigen of the full-length antibody. In some embodiments, the heavy and light chains of the antibody may be full-length or antigen-binding portions (Fab, F(ab’)2, Fv, or single-chain Fv fragment (scFv)). In other embodiments, the antibody heavy chain constant region is selected from, for example, IgG1, IgG2, IgG3, IgG4, IgM, IgA1, IgA2, IgD, and IgE, particularly, for example, selected from IgG1, IgG2, IgG3, and IgG4, and more particularly, IgG1 (e.g., human IgG1). In another embodiment, the antibody light chain constant region is selected from, for example, kappa or lambda, particularly kappa.

[0296] Some of the antibodies provided are antibody fragments. An "antibody fragment" refers to a molecule other than an intact antibody that includes a part of an intact antibody that binds to an antigen to which the intact antibody binds. Examples of antibody fragments include Fv, Fab, Fab’, Fab’-SH, F(ab’)2; diabodies; linear antibodies; variable heavy chain (V H ) regions, scFv, and single-domain V H single-chain antibody molecules such as single antibodies; and multispecific antibodies formed from antibody fragments, but are not limited thereto. In certain embodiments, the antibody is a single-chain antibody fragment that includes a variable heavy chain region and / or a variable light chain region such as scFv.

[0297] The terms "complementary determining region" and "CDR" are synonymous with "hypervariable region" or "HVR" and are known to sometimes refer to discontinuous sequences of amino acids within the antibody variable region that confer antigen specificity and / or binding affinity. Generally, each heavy chain variable region has three CDRs (CDR-H1, CDR-H2, CDR-H3), and each light chain variable region has three CDRs (CDR-L1, CDR-L2, CDR-L3). The terms "framework region" and "FR" are known to sometimes refer to the non-CDR portions of the variable regions of the heavy and light chains. Generally, each full-length heavy chain variable region has four FRs (FR-H1, FR-H2, FR-H3, and FR-H4), and each full-length light chain variable region has four FRs (FR-L1, FR-L2, FR-L3, and FR-L4).

[0298] The exact amino acid sequence boundaries of a given CDR or FR can be readily determined using any of several well-known schemes, including those described below: Kabat et al. (1991), “Sequences of Proteins of Immunological Interest,” 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD (“Kabat” numbering scheme); Al-Lazikani et al., (1997) JMB 273,927-948 (“Chothia” numbering scheme); MacCallum et al., J. Mol. Biol. 262:732-745 (1996), “Antibody-antigen interactions: Contact analysis and binding site topography,” J. Mol. Biol. 262, 732-745.” (“Contact” numbering scheme); Lefranc MP et al., “IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains,” Dev Comp Immunol, 2003 Jan;27(1):55-77 (“IMGT” numbering scheme); Honegger A and Plueckthun A, “Yet another numbering scheme for immunoglobulin variable domains: an automatic modeling and analysis tool,” J Mol Biol, 2001 Jun 8;309(3):657-70, (“Aho” numbering scheme); and Martin et al., “Modeling antibody hypervariable loops: a combined algorithm,” PNAS, 1989, 86(23):9268-9272, (“AbM” numbering scheme).

[0299] The defined CDR or FR boundaries may vary depending on the scheme specifically used. For example, the Kabat scheme is based on a structural alignment, while the Chothia scheme is based on structural information. The numbering in both the Kabat and Chothia schemes is based on the sequence lengths of the most common antibody regions, insertions are handled with insertion characters such as “30a,” and deletions occur in some antibodies. In these two schemes, there are differences in numbering because certain insertions and deletions (“indels”) are placed at different positions. The Contact scheme is based on the analysis of complex crystal structures and is similar to the Chothia numbering scheme in many respects. The AbM scheme is a compromise between Kabat and Chothia definitions, based on what is used in Oxford Molecular's AbM antibody modeling software.

[0300] Table 7 below lists exemplary position boundaries for CDR-L1, CDR-L2, CDR-L3, and CDR-H1, CDR-H2, CDR-H3, respectively, as defined by the Kabat, Chothia, AbM, and Contact schemes. For CDR-H1, residue numbering is listed using both the Kabat and Chothia numbering schemes. The FRs are located between the CDRs; for example, FR-L1 is before CDR-L1, FR-L2 is between CDR-L1 and CDR-L2, FR-L3 is between CDR-L2 and CDR-L3, etc. Note that in the shown Kabat numbering scheme, insertions are placed at H35A and H35B, so the end of the Chothia CDR-H1 loop varies between H32 and H34 depending on the loop length when numbered using the shown Kabat numbering convention.

Table 7

[0301] Thus, unless otherwise specified, a given antibody or region thereof, such as the "CDR" or "complementary determining region" of its variable region, or an individually specified CDR (e.g., CDR-H1, CDR-H2, CDR-H3), should be understood to encompass the complementary determining region (or a particular complementary determining region) defined by either the aforementioned scheme or any other known scheme. For example, if a particular CDR (e.g., CDR-H3) is described as containing the amino acid sequence of the corresponding CDR in the amino acid sequence of a given V H or V L region, such a CDR is understood to have the sequence of the corresponding CDR (e.g., CDR-H3) within the variable region, as defined by either the aforementioned scheme or any other known scheme. In some embodiments, a particular CDR sequence is specified. Exemplary CDR sequences of the provided antibodies are described using various numbering schemes, but it is understood that the provided antibodies may include CDRs described according to any of the other numbering schemes mentioned above or other numbering schemes known to those of skill in the art.

[0302] Similarly, unless otherwise specified, a given antibody or region thereof, such as the FR of its variable region or an individually specified FR (e.g., FR-H1, FR-H2, FR-H3, FR-H4), should be understood to encompass the framework region (or a particular framework region) defined by any of the known schemes. In some cases, a particular CDR, FR, or scheme for specifying an FR or CDR, such as a CDR defined by the Kabat, Chothia, AbM, or Contact methods, or any other known scheme, is specified. In other cases, a particular amino acid sequence of a CDR or FR is given.

[0303] The term "variable region" or "variable domain" refers to the domain of the antibody heavy or light chain that is involved in binding of the antibody to an antigen. The variable domains of the heavy and light chains of a native antibody (V H and V L ), respectively) generally have similar structures, and each domain contains four conserved framework regions (FRs) and three CDRs. (See, e.g., Kindt et al. Kuby Immunology, 6th ed., W.H. Freeman and Co., page 91 (2007)). A single V H or V L domain may be sufficient to confer antigen-binding specificity. Further, antibodies that bind a particular antigen can be isolated using the V L or V H domain from an antibody that binds the antigen to screen a library of complementary V H or V L domains. See, e.g., Portolano et al., J. Immunol. 150:880-887 (1993); Clarkson et al., Nature 352:624-628 (1991).

[0304] A single-domain antibody is an antibody fragment that comprises all or part of the heavy-chain variable domain of an antibody, or all or part of the light-chain variable domain of an antibody. In certain embodiments, the single-domain antibody is a human single-domain antibody. In some embodiments, the CAR comprises an antibody heavy-chain domain that specifically binds an antigen, such as a target cell or a cancer marker or cell-surface antigen of a disease such as a tumor cell or cancer cell, e.g., any of the target antigens described herein or known in the art.

[0305] Antibody fragments can be produced by a variety of techniques including, but not limited to, proteolytic digestion of intact antibodies and production by recombinant host cells. In some embodiments, the antibody is a fragment that contains an arrangement that is not naturally occurring and / or is not likely to be produced by enzymatic digestion of a naturally occurring intact antibody, such as a recombinantly produced fragment having two or more antibody regions or chains joined by a synthetic linker, such as a peptide linker. In some embodiments, the antibody fragment is an scFv.

[0306] A "humanized" antibody is an antibody in which all or substantially all of the CDR amino acid residues are derived from non-human CDRs and all or substantially all of the FR amino acid residues are derived from human FRs. A humanized antibody may optionally include at least a portion of an antibody constant region derived from a human antibody. The "humanized form" of a non-human antibody refers to a variant of the non-human antibody that has been humanized to typically reduce its immunogenicity in humans while retaining the specificity and affinity of the parental non-human antibody. In some embodiments, some of the FR residues in the humanized antibody are substituted with the corresponding residues of a non-human antibody (e.g., the antibody from which the CDR residues are derived) to, for example, restore or improve the specificity or affinity of the antibody.

[0307] In some embodiments, the antigen or antigen-binding domain is CD19. In some embodiments, the scFv contains a V H and a V L derived from an antibody or antibody fragment specific for CD19. In some embodiments, the antibody or antibody fragment that binds CD19 is a mouse-derived antibody such as FMC63 and SJ25C1. In some embodiments, the antibody or antibody fragment is a human antibody as described, for example, in U.S. Patent Publication No. US2016 / 0152723.

[0308] In some embodiments, the scFv is derived from FMC63. FMC63 generally refers to a murine monoclonal IgG1 antibody that has been enhanced against Nalm-1 and Nalm-16 cells expressing human-derived CD19 (Ling, N. R., et al. (1987). Leucocyte typing III. 302). In some embodiments, the FMC63 antibody comprises CDR-H1 and CDR-H2 described in SEQ ID NOs: 38 and 39, respectively, and CDR-H3 described in SEQ ID NO: 40 or 54; and CDR-L1 described in SEQ ID NO: 35, CDR-L2 described in SEQ ID NO: 36 or 55, and CDR-L3 described in SEQ ID NO: 37 or 56. In some embodiments, the FMC63 antibody comprises a heavy chain variable region (V H ) comprising the amino acid sequence of SEQ ID NO: 41 and a light chain variable region (V L ) comprising the amino acid sequence of SEQ ID NO: 42.

[0309] In some embodiments, the scFv comprises a variable light chain containing the CDR-L1 sequence of SEQ ID NO: 35, the CDR-L2 sequence of SEQ ID NO: 36, and the CDR-L3 sequence of SEQ ID NO: 37, and / or a variable heavy chain containing the CDR-H1 sequence of SEQ ID NO: 38, the CDR-H2 sequence of SEQ ID NO: 39, and the CDR-H3 sequence of SEQ ID NO: 40. In some embodiments, the scFv comprises the variable heavy chain region described in SEQ ID NO: 41 and the variable light chain region described in SEQ ID NO: 42. In some embodiments, the variable heavy chain and the variable light chain are connected by a linker. In some embodiments, the linker is described in SEQ ID NOs: 22-24 or 52. In some embodiments, the scFv comprises, in order, V H , a linker, and V L . In some embodiments, the scFv comprises, in order, V L , a linker, and V HIt includes. In some embodiments, the scFv is encoded by the nucleotide sequence set forth in SEQ ID NO: 25, or a sequence showing at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 25. In some embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 43, or a sequence showing at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 43.

[0310] In some embodiments, the scFv is derived from SJ25C1. SJ25C1 is a murine monoclonal IgG1 antibody raised against Nalm-1 and Nalm-16 cells expressing human CD19 (Ling, N. R., et al. (1987). Leucocyte typing III. 302). In some embodiments, the SJ25C1 antibody comprises CDR-H1, CDR-H2, and CDR-H3 set forth in SEQ ID NOs: 47-49, respectively, and CDR-L1, CDR-L2, and CDR-L3 sequences set forth in SEQ ID NOs: 44-46, respectively. In some embodiments, the SJ25C1 antibody comprises a heavy chain variable region (V H ) comprising the amino acid sequence of SEQ ID NO: 50 and a light chain variable region (V L ) comprising the amino acid sequence of SEQ ID NO: 51.

[0311] In some embodiments, the scFv comprises a variable light chain containing the CDR-L1 sequence of SEQ ID NO: 44, the CDR-L2 sequence of SEQ ID NO: 45, and the CDR-L3 sequence of SEQ ID NO: 46, and / or a variable heavy chain containing the CDR-H1 sequence of SEQ ID NO: 47, the CDR-H2 sequence of SEQ ID NO: 48, and the CDR-H3 sequence of SEQ ID NO: 49. In some embodiments, the scFv comprises the variable heavy chain region described in SEQ ID NO: 50 and the variable light chain region described in SEQ ID NO: 51. In some embodiments, the variable heavy chain and the variable light chain are connected by a linker. In some embodiments, the linker is described in SEQ ID NO: 52. In some embodiments, the scFv comprises, in order, V H , a linker, and V L . In some embodiments, the scFv comprises, in order, V L , a linker, and V H . In some embodiments, the scFv comprises the amino acid sequence described in SEQ ID NO: 53, or a sequence showing at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 53.

[0312] In some embodiments, the chimeric antigen receptor comprises an extracellular portion containing an antibody or antibody fragment. In some aspects, the chimeric antigen receptor comprises an extracellular portion containing an antibody or fragment and an intracellular signaling domain. In some embodiments, the antibody or fragment comprises an scFv. In some aspects, the chimeric antigen receptor comprises an extracellular portion containing an antibody or fragment and an intracellular signaling region. In some embodiments, the intracellular signaling region comprises an intracellular signaling domain. In some embodiments, the intracellular signaling domain is a primary signaling domain, a signaling domain capable of inducing a primary activation signal in T cells, a signaling domain of a T cell receptor (TCR) component, and / or a signaling domain containing an immunoreceptor tyrosine-based activation motif (ITAM), or comprises the same.

[0313] In some embodiments, the antibody portion of the recombinant receptor, e.g., a CAR, further comprises at least a portion of an immunoglobulin constant region, such as a hinge region, e.g., an IgG4 hinge region, and / or an Fc region. In some embodiments, the constant region or portion is that of a human IgG such as IgG4 or IgG1. In some aspects, the portion of the constant region functions as a spacer region between the antigen recognition component, e.g., an scFv, and the transmembrane domain. The spacer can be of a length that enhances the responsiveness of the cell after antigen binding as compared to the case where there is no spacer. Exemplary spacers include, but are not limited to, those described in Hudecek et al. (2013) Clin. Cancer Res., 19:3153, International Patent Application Publication No. WO2014031687, U.S. Patent No. 8,822,647 or U.S. Patent Application Publication No. US2014 / 0271635. H 1 / C L

[0314] In some embodiments, the constant region or portion is of a human IgG such as IgG4 or IgG1. In some embodiments, the spacer has the sequence ESKYGPPCPPCP (set forth in SEQ ID NO: 1) and is encoded by the sequence set forth in SEQ ID NO: 2. In some embodiments, the spacer has the sequence set forth in SEQ ID NO: 3. In some embodiments, the spacer has the sequence set forth in SEQ ID NO: 4. In some embodiments, the constant region or portion is of IgD. In some embodiments, the spacer has the sequence set forth in SEQ ID NO: 5. In some embodiments, the spacer has an amino acid sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any of SEQ ID NOs: 1, 3, 4 or 5. In some embodiments, the spacer is encoded by the nucleotide sequence set forth in SEQ ID NO: 2. In some embodiments, the spacer has the sequences set forth in SEQ ID NOs: 26-34. In some embodiments, the spacer has an amino acid sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any of SEQ ID NOs: 26-34.

[0315] In some embodiments, the antigen receptor comprises an intracellular domain directly or indirectly linked to the extracellular domain. In some embodiments, the chimeric antigen receptor comprises a transmembrane domain that links the extracellular domain and the intracellular signaling domain. In some embodiments, the intracellular signaling domain comprises an ITAM. For example, in some aspects, the antigen recognition domain (e.g., the extracellular domain) generally mimics activation via an antigen receptor complex such as the TCR complex in the case of a CAR, and / or signals via another cell surface receptor, and is linked to one or more intracellular signaling components such as signaling components. In some embodiments, the chimeric receptor comprises a transmembrane domain linked or fused between the extracellular domain (e.g., scFv) and the intracellular signaling domain. Thus, in some embodiments, the antigen binding component (e.g., an antibody) is linked to one or more transmembrane domains and an intracellular signaling domain.

[0316] In one embodiment, one of the domains of the receptor is used, such as a transmembrane domain that naturally associates with the CAR. In some cases, the transmembrane domain is selected or modified by amino acid substitution to avoid the binding of such domains to the transmembrane domains of the same or different surface membrane proteins in order to minimize the interaction with other members of the receptor complex.

[0317] The transmembrane domain is, in some embodiments, derived from either a natural or synthetic source. When the source is natural, the domain is, in some aspects, derived from a membrane-bound protein or transmembrane protein. Transmembrane regions include those derived from the alpha, beta, or zeta chains of the T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154 (i.e., at least their transmembrane regions are included). Alternatively, the transmembrane domain is, in some embodiments, synthetic. In some aspects, synthetic transmembrane domains primarily contain hydrophobic residues such as leucine and valine. In some aspects, triplets of phenylalanine, tryptophan, and valine are seen at both ends of the synthetic transmembrane domain. In some embodiments, the linkage is by a linker, spacer, and / or transmembrane domain(s). In some aspects, the transmembrane domain contains the transmembrane portion of CD28.

[0318] In some embodiments, the extracellular domain and the transmembrane domain can be linked directly or indirectly. In some embodiments, the extracellular domain and the transmembrane body are linked by a spacer such as any of those described herein. In some embodiments, the receptor contains the extracellular portion of the molecule from which the transmembrane domain is derived, e.g., the CD28 extracellular portion.

[0319] Among the intracellular signaling domains are those that mimic or approximate signals through natural antigen receptors, signals through such receptors in combination with co-stimulatory receptors, and / or signals through co-stimulatory receptors alone. In some embodiments, there are short oligopeptide linkers or polypeptide linkers, e.g., linkers that are 2 - 10 amino acids in length, e.g., those containing glycine and serine, e.g., glycine-serine doublets, that form a linkage between the transmembrane domain and the cytoplasmic signaling domain of the CAR.

[0320] T cell activation has been described in some embodiments to be mediated by two classes of cytoplasmic signaling sequences: those that initiate antigen-dependent primary activation via the TCR (primary cytoplasmic signaling sequences) and those that act antigen-independently to provide a secondary or co-stimulatory signal (secondary cytoplasmic signaling sequences). In some embodiments, a CAR includes one or both of such signaling components.

[0321] A receptor, such as a CAR, generally includes at least one intracellular signaling component(s). In some embodiments, the CAR includes a primary cytoplasmic signaling sequence that regulates primary activation of the TCR complex. The primary cytoplasmic signaling sequence that acts upon stimulation can contain an immunoreceptor tyrosine-based activation motif or signaling motif known as an ITAM. Examples of ITAMs containing a primary cytoplasmic signaling sequence include those derived from the CD3 zeta chain, FcR gamma, CD3 gamma, CD3 delta, and CD3 epsilon. In some embodiments, the cytoplasmic signaling molecule in the CAR contains a cytoplasmic signaling domain, a portion thereof, or a sequence derived from CD3 zeta.

[0322] In some embodiments, the receptor includes an intracellular component of the TCR complex, such as the TCR CD3 chains, e.g., the CD3 zeta chain, that mediate T cell activation and cytotoxicity. Thus, in some embodiments, the antigen-binding portion is linked to one or more cell signaling modules. In some embodiments, the cell signaling module includes a CD3 transmembrane domain, a CD3 intracellular signaling domain, and / or another CD transmembrane domain. In some embodiments, the receptor, such as a CAR, further includes a portion of one or more additional molecules such as Fc receptor gamma, CD8, CD4, CD25, or CD16. For example, in some embodiments, a CAR or other chimeric receptor includes a chimeric molecule between CD3-zeta (CD3-ζ) or Fc receptor gamma and CD8, CD4, CD25, or CD16.

[0323] In some embodiments, upon ligation of a CAR or other chimeric receptor, the cytoplasmic domain or intracellular signaling domain of the receptor activates at least one of the normal effector functions or responses of immune cells, such as T cells engineered to express the CAR. For example, in some contexts, the CAR induces functions of T cells, such as cytolytic activity or helper T activity, such as secretion of cytokines or other factors. In some embodiments, a truncated portion of the intracellular signaling domain of an antigen receptor component or costimulatory molecule is used in place of an intact immunoreceptor stimulatory chain, for example, when transmitting an effector function signal. In some embodiments, the intracellular signaling domain(s) include the cytoplasmic sequence of a T cell receptor (TCR) and, in some aspects, also include the sequence of a coreceptor that functions in concert with such a receptor in its native context to initiate signaling following engagement with an antigen receptor.

[0324] In the context of the native TCR, full activation generally requires not only signaling through the TCR but also a costimulatory signal. Thus, in some embodiments, components for generating a secondary or costimulatory signal are also included in the CAR to facilitate full activation. In other embodiments, the CAR does not include components for generating a costimulatory signal. In some aspects, additional CARs are expressed within the same cell to provide components for generating a secondary or costimulatory signal.

[0325] In some embodiments, the chimeric antigen receptor contains the intracellular domain of a T cell costimulatory molecule. In some embodiments, the CAR includes the signaling domain and / or transmembrane portion of a costimulatory receptor such as CD28, 4-1BB, OX40, DAP10, and ICOS. In some aspects, the same CAR includes both an activation component and a costimulatory component. In some embodiments, the chimeric antigen receptor contains the intracellular domain of a T cell costimulatory molecule or a functional variant thereof, such as between the transmembrane domain and the intracellular signaling domain. In some aspects, the T cell costimulatory molecule is CD28 or 41BB.

[0326] In certain embodiments, the intracellular signaling domain comprises a CD28 transmembrane domain and a signaling domain linked to a CD3 (e.g., CD3-zeta) intracellular domain. In some embodiments, the intracellular signaling domain comprises a chimeric CD28 and CD137 (4-1BB, TNFRSF9) co-stimulatory domain linked to the CD3 zeta intracellular domain.

[0327] In some embodiments, the CAR comprises one or more, e.g., two or more, co-stimulatory domains and activation domains, e.g., primary activation domains, in the cytoplasmic portion. Exemplary CARs include the intracellular components of CD3-zeta, CD28, and 4-1BB.

[0328] In some embodiments, the antigen receptor further comprises a marker, and / or cells expressing the CAR or other antigen receptor further comprise a surrogate marker such as a cell surface marker, which can be used to confirm cell transduction or manipulation and to express the receptor. In some aspects, the marker comprises all or part (e.g., a cleaved form) of CD34, NGFR, or an epidermal growth factor receptor, e.g., a cleaved version of such a cell surface receptor (e.g., tEGFR). In some embodiments, the nucleic acid encoding the marker is operably linked to a polynucleotide encoding a cleavable linker sequence, e.g., a linker sequence such as T2A. For example, the marker, and optionally the linker sequence, can be any of those disclosed in published patent application No. WO2014031687. For example, the marker is cleaved EGFR (tEGFR), which may be linked to a linker sequence such as a T2A cleavage linker sequence.

[0329] Exemplary polypeptides of truncated EGFR (e.g., tEGFR) include the amino acid sequences set forth in SEQ ID NO: 7 or 16, or amino acid sequences having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 7 or 16. Exemplary T2A linker sequences include the amino acid sequences set forth in SEQ ID NO: 6 or 17, or amino acid sequences having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 6 or 17.

[0330] In some embodiments, the marker is a molecule that is not naturally present on T cells or a molecule that is not naturally present on the surface of T cells, such as a cell surface protein or a portion thereof. In some embodiments, the molecule is a non-self molecule, such as a non-self protein, i.e., a molecule that is not recognized as "self" by the immune system of the host into which the cell is transplanted.

[0331] In some embodiments, the marker does not perform a therapeutic function and / or has no effect other than being used as a marker for genetic manipulation, e.g., being used to select cells that have been successfully manipulated. In other embodiments, the marker is a therapeutic molecule or otherwise a molecule that exerts some desired effect, such as a ligand for cells encountered in vivo, e.g., a co-stimulatory molecule or an immune checkpoint molecule that enhances and / or attenuates the response of the cell upon transplantation and encounter with the ligand.

[0332] In some cases, CARs are referred to as first-generation, second-generation, and / or third-generation CARs. In some embodiments, a first-generation CAR provides only a CD3-chain-induced signal upon antigen binding; in some embodiments, a second-generation CAR provides such a signal and a co-stimulatory signal, e.g., comprising an intracellular signaling domain from a co-stimulatory receptor such as CD28 or CD137; in some embodiments, a third-generation CAR comprises multiple co-stimulatory domains of different co-stimulatory receptors.

[0333] For example, in some embodiments, a CAR comprises a transmembrane domain that is or contains a transmembrane portion of an antibody, e.g., an antibody fragment, CD28 or a functional variant thereof, and an intracellular signaling domain that contains a signaling portion of CD28 or a functional variant thereof and a signaling portion of CD3 zeta or a functional variant thereof. In some embodiments, a CAR comprises a transmembrane domain that is or contains a transmembrane portion of an antibody, e.g., an antibody fragment, CD28 or a functional variant thereof, and an intracellular signaling domain that contains a signaling portion of 4-1BB or a functional variant thereof and a signaling portion of CD3 zeta or a functional variant thereof. In some such embodiments, the receptor further comprises a spacer that contains a portion of an Ig molecule, e.g., a human Ig molecule, e.g., an Ig hinge, e.g., an IgG4 hinge, e.g., a hinge-only spacer.

[0334] In some embodiments, the transmembrane domain of a recombinant receptor, such as a CAR, is the transmembrane domain of human CD28 (e.g., accession number P01747.1) or a variant thereof, such as a transmembrane domain comprising the amino acid sequence set forth in SEQ ID NO: 8, or a transmembrane domain comprising an amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 8; in some embodiments, the transmembrane domain-containing portion of the recombinant receptor comprises the amino acid sequence set forth in SEQ ID NO: 9, or an amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more, or about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity thereto.

[0335] In some embodiments, the intracellular signaling component of a recombinant receptor, such as a CAR, is the intracellular co-stimulatory signaling domain of human CD28, or a functional variant or portion thereof, such as a domain having a substitution of LL to GG at positions 186-187 of the native CD28 protein. For example, the intracellular signaling domain can comprise the amino acid sequence set forth in SEQ ID NO: 10 or 11, or an amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 10 or 11. In some embodiments, the intracellular domain is the intracellular co-stimulatory signaling domain of 4-1BB (e.g., accession number Q07011.1) or a functional variant or portion thereof, such as the amino acid sequence set forth in SEQ ID NO: 12, or an amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 12.

[0336] In some embodiments, the intracellular signaling domain of a recombinant receptor, such as a CAR, is a human CD3 zeta stimulatory signaling domain or a functional variant thereof, e.g., the 112AA cytoplasmic domain of isoform 3 of human CD3ζ (Accession No.: P20963.2), or a CD3 zeta signaling domain as described in U.S. Patent No. 7,446,190 or U.S. Patent No. 8,911,993. For example, in some embodiments, the intracellular signaling domain comprises the amino acid sequence set forth in SEQ ID NO: 13, 14, or 15, or an amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 13, 14, or 15.

[0337] In some aspects, the spacer contains only the hinge region of IgG, e.g., only the hinge of IgG4 or IgG1, e.g., only the hinge set forth in SEQ ID NO: 1. In other embodiments, the spacer is an Ig hinge that may be linked to the C H 2 and / or C H 3 domain, e.g., a hinge derived from IgG4 or containing the same. In some embodiments, the spacer is an Ig hinge linked to the C H 2 and C H 3 domains, e.g., an IgG4 hinge. In some embodiments, the spacer is an Ig hinge linked only to the C H 3 domain, e.g., an IgG4 hinge. In some embodiments, the spacer is a glycine-serine rich sequence or other flexible linker such as a known flexible linker, or includes the same.

[0338] For example, in some embodiments, the CAR comprises an antibody such as an antibody fragment including an scFv, a spacer, such as a spacer containing an Ig - hinge region and / or a portion of an immunoglobulin molecule such as one or more constant regions, a transmembrane domain containing all or a portion of the transmembrane domain derived from CD28, an intracellular signaling domain derived from CD28, and a CD3 zeta signaling domain. In some embodiments, the CAR comprises an antibody or fragment such as an scFv, a spacer such as either an Ig - hinge containing spacer, a transmembrane domain derived from CD28, an intracellular signaling domain derived from 4 - 1BB, and a signaling domain derived from CD3 zeta.

[0339] In certain embodiments, the CAR is a CD19-directed CAR containing an scFv antigen-binding domain derived from FMC63; an intracellular signaling domain containing a co-stimulatory signaling region that is an immunoglobulin hinge spacer, a transmembrane domain, and a signaling domain of 4-1BB, and a signaling domain of the CD3-zeta (CD3ζ) chain. In some embodiments, the scFv contains the sequence set forth in SEQ ID NO: 43. In some embodiments, the scFv has a VL having CDRs with the amino acid sequences of RASQDISKYLN (SEQ ID NO: 35), SRLHSGV (SEQ ID NO: 36), and GNTLPYTFG (SEQ ID NO: 37); and a VH having CDRs with the amino acid sequences of DYGVS (SEQ ID NO: 38), VIWGSETTYYNSALKS (SEQ ID NO: 39), and YAMDYWG (SEQ ID NO: 40). In some embodiments, the transmembrane domain has the sequence set forth in SEQ ID NO: 8. In some embodiments, the transmembrane domain has a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 8. In some embodiments, the 4-1BB co-stimulatory signaling domain has the sequence set forth in SEQ ID NO: 12. In some embodiments, the 4-1BB co-stimulatory signaling domain has a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 12. In some embodiments, the CD3-zeta domain has the sequence set forth in SEQ ID NO: 13. In some embodiments, the CD3 zeta signaling domain has a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity thereto. In some embodiments, the CD19-directed CAR binds to CD19, is expressed in T cells, and mediates cytokine production and / or cytotoxic activity against CD19+ target cells when stimulated via the CAR, such as by binding to CD19.

[0340] In some embodiments, a nucleic acid molecule encoding such a CAR construct further comprises a sequence encoding a T2A ribosome skip element and / or a tEGFR sequence, for example, downstream of the sequence encoding the CAR. In some embodiments, the sequence is the T2A ribosome skip element set forth in SEQ ID NO: 6 or 17, or an amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 6 or 17. In some embodiments, a T cell expressing an antigen receptor (e.g., a CAR) can be generated to express truncated EGFR (EGFRt) as a non-immunogenic selection epitope (e.g., by separating and introducing constructs encoding the CAR and EGFRt with a T2A ribosome switch and expressing two proteins from the same construct), and then such cells can be used as a marker for detecting such cells (see, e.g., U.S. Patent No. 8,802,374). In some embodiments, the sequence is the tEGFR sequence set forth in SEQ ID NO: 7 or 16, or an amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 7 or 16. Optionally, a peptide such as T2A skips the synthesis of a peptide bond at the C-terminus of the 2A element by the ribosome (ribosome skipping), separating between the end of the 2A sequence and the next peptide downstream (see, e.g., de Felipe. Genetic Vaccines and Ther. 2:13 (2004) and deFelipe et al. Traffic 5:616-626 (2004)). Many 2A elements are known.Examples of 2A sequences that can be used in the methods and nucleic acids disclosed herein include, but are not limited to, foot-and-mouth disease virus (F2A, e.g., SEQ ID NO: 21), equine rhinitis A virus (E2A, e.g., SEQ ID NO: 20), Thosea asigna virus (T2A, e.g., SEQ ID NO: 6 or 17), and porcine teschovirus-1 (P2A, e.g., SEQ ID NO: 18 or 19) 2A sequences described in U.S. Patent Publication No. 20070116690.

[0341] Recombinant receptors such as CARs expressed by cells administered to a subject generally recognize, or specifically bind to, a molecule expressed in, associated with, and / or specific to the disease or condition being treated or its cells. When specifically binding to a molecule, e.g., an antigen, the receptor generally delivers an immune-stimulatory signal, such as a signal transduced by an ITAM, into the cell, thereby promoting an immune response targeted at the disease or condition. For example, in some embodiments, the cells express a CAR that specifically binds to an antigen expressed by the cells or tissue of the disease or condition or associated with the disease or condition.

[0342] B. Methods of Manipulating Cells In certain embodiments, the engineered cells are generated by a process that produces an output composition of enriched T cells from one or more input compositions and / or from a single biological sample. In certain embodiments, the output composition contains cells that express a recombinant receptor, e.g., a CAR such as an anti-CD19 CAR. In certain embodiments, the cells of the output composition are suitable for administration to a subject as a treatment, e.g., an autologous cell therapy. In some embodiments, the output composition is a composition of enriched CD4+ or CD8+ T cells.

[0343] In some embodiments, the process for generating or producing engineered cells is by a process that includes some or all of the following steps: obtaining or acquiring a biological sample; isolating, selecting, or enriching input cells from the biological sample; cryopreserving and storing the input cells; thawing and / or incubating the input cells under stimulating conditions; engineering the stimulated cells to express or contain a recombinant polynucleotide, such as a polynucleotide encoding a recombinant receptor, e.g., a CAR; growing the engineered cells, e.g., to a threshold amount, density, or expansion; formulating the grown cells into an output composition; and / or cryopreserving and storing the formulated output cells until the cells are released for infusion and / or until suitable for administration to a subject. In certain embodiments, the process is performed using two or more input compositions of enriched T cells, e.g., separate CD4+ compositions and separate CD8+ compositions, which are separately processed and engineered from the same starting sample or initial biological sample and are reinfused into a subject at a defined ratio, e.g., a ratio of CD4+ T cells to CD8+ T cells of 1:1. In some embodiments, the enriched T cells are or include engineered T cells, e.g., T cells transduced to express a recombinant receptor.

[0344] In certain embodiments, an output composition of engineered cells that express a recombinant receptor (e.g., an anti-CD19 CAR) is generated from an initial composition and / or an input composition of the cells. In some embodiments, the input composition is a composition of enriched T cells, enriched CD4+ T cells, and / or enriched CD8+ T cells (hereinafter also referred to as a composition of enriched T cells, a composition of enriched CD4+ T cells, and a composition of enriched CD8+ T cells, respectively). In some embodiments, a composition enriched in CD4+ T cells contains at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 99.9% CD4+ T cells. In certain embodiments, a composition of enriched CD4+ T cells contains 100% CD4+ T cells and contains approximately 100% CD4+ T cells. In certain embodiments, a composition of enriched T cells may contain or contain less than 20%, less than 10%, less than 5%, less than 1%, less than 0.1%, or less than 0.01% CD8+ T cells and / or does not contain CD8+ T cells and / or does not contain or substantially does not contain CD8+ T cells. In some embodiments, a population of cells consists essentially of CD4+ T cells. In some embodiments, a composition enriched in CD8+ T cells contains at least 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 99.9% CD8+ T cells or contains 100% or approximately 100% CD8+ T cells. In certain embodiments, a composition of enriched CD8+ T cells may contain or contain less than 20%, less than 10%, less than 5%, less than 1%, less than 0.1%, or less than 0.01% CD4+ T cells and / or does not contain CD4+ T cells and / or does not contain or substantially does not contain CD4+ T cells. In some embodiments, a population of cells consists essentially of CD8+ T cells.

[0345] In certain embodiments, the process for generating engineered cells can further include one or more of the following: activating and / or stimulating cells, such as cells of the input composition; genetically engineering the activated and / or stimulated cells, for example, introducing a polynucleotide encoding a recombinant protein by transduction or transfection; and / or culturing the engineered cells under conditions that promote, for example, proliferation and / or expansion. In certain embodiments, the provided method can be used in relation to the recovery, collection, and / or formulation of an output composition produced after the cells have been incubated, activated, stimulated, engineered, transduced, transfected, and / or cultured.

[0346] In some embodiments, engineered cells, such as those expressing an anti-CD19 CAR as described, that are used in accordance with the provided methods and uses are produced or generated by a process for selecting, isolating, activating, stimulating, expanding, culturing, and / or formulating the cells. In some embodiments, such methods include any of those described.

[0347] In some embodiments, engineered cells, such as those expressing the anti-CD19 CAR described, that are used in accordance with the provided methods and uses are produced or generated by exemplary processes such as those described in WO2019 / 089855 and WO2015 / 164675.

[0348] In some embodiments, exemplary processes for generating, producing, or manufacturing engineered cells, such as those expressing the described anti-CD19 CAR, or compositions comprising such cells, e.g., compositions comprising engineered CD4+ T cells and engineered CD8+ T cells each expressing the same anti-CD19 chimeric antigen receptor (CAR), include subjecting a CD4+ cell population and a CD8+ cell population separately to process steps. In some aspects of an exemplary process for generating or manufacturing engineered cells, the CD4+ cells and CD8+ cells are separately selected, e.g., from human peripheral blood mononuclear cells (PBMCs) obtained by apheresis, to generate separate enriched CD4+ cell compositions and enriched CD8+ cell compositions. In some aspects, such cells can be cryopreserved. In some aspects, the CD4+ composition and the CD8+ composition are then thawed and separately subjected to steps of stimulation, transduction, and expansion.

[0349] In some aspects of an exemplary process for generating or manufacturing engineered cells, the thawed CD4+ cells and CD8+ cells are separately stimulated, e.g., in the presence of paramagnetic polystyrene-coated beads conjugated to anti-CD3 antibody and anti-CD28 antibody (e.g., at a bead-to-cell ratio of 1:1). In some aspects, the stimulation is performed in a medium containing human recombinant IL-2, human recombinant IL-15, and N-acetylcysteine (NAC). In some aspects, the cell culture medium for CD4+ cells can also include human recombinant IL-7.

[0350] In some aspects of an exemplary process for generating or manufacturing engineered cells, following the introduction of beads, CD4+ cells and CD8+ cells are separately transduced with a lentiviral vector encoding the same CAR, such as the same anti-CD19 CAR. In some aspects, the CAR can contain an anti-CD19 scFv derived from a murine antibody, an immunoglobulin spacer, a transmembrane domain derived from CD28, a co-stimulatory region derived from 4-1BB, and a CD3-zeta intracellular signaling domain. In some aspects, the vector can encode a truncated receptor that functions as a surrogate marker for CAR expression, connected to the CAR construct by a T2A sequence. In some aspects of the exemplary process, cells are transduced in the presence of 10 μg / ml protamine sulfate.

[0351] In some aspects of an exemplary process for generating or manufacturing engineered cells, after transduction, the beads are removed from the cell composition by exposure to a magnetic field. In some aspects, the CD4+ cell composition and the CD8+ cell composition are grown separately for expansion by continuous mixing and oxygen transfer by a bioreactor (e.g., Xuri W25 Bioreactor). Optionally, a poloxamer is added to the medium. In some aspects, both the CD4+ cell composition and the CD8+ cell composition are grown in the presence of IL-2 and IL-15. In some aspects, the CD4+ cell medium also contained IL-7. Optionally, the CD4+ cells and CD8+ cells are each grown until they are expanded four-fold prior to harvesting. In some aspects, one day after reaching the threshold, cells can be separately harvested, formulated, and cryopreserved from each composition. In some aspects, an exemplary process for generating, producing, or manufacturing engineered cells, such as those expressing the described anti-CD19 CAR, or compositions containing such cells, e.g., a composition containing engineered CD4+ T cells and engineered CD8+ T cells each expressing the same anti-CD19 chimeric antigen receptor (CAR), includes those described in Table 8 below. [Table 8]

[0352] In other aspects, different exemplary processes for generating, producing or manufacturing the engineered cells or compositions containing such cells include processes that differ from the above exemplary processes in the following respects: NAC is not added to the medium during stimulation; the CD4+ cell medium does not contain IL-2; the cells are stimulated at a bead-to-cell ratio of 3:1; the cells are transduced with a higher concentration of protamine sulfate; bead removal is performed on approximately day 7; and expansion is performed in a static setting, i.e., without continuous mixing or perfusion (e.g., semi-continuous and / or stepwise perfusion), and without poloxamer.

[0353] In some embodiments, at least one separate composition of enriched CD4+ T cells and at least one separate composition of enriched CD8+ T cells are isolated, selected, enriched, or obtained from a single biological sample, such as a sample of PBMCs or other white blood cells from the same donor, such as a patient or a healthy individual. In some embodiments, the separate compositions of enriched CD4+ T cells and enriched CD8+ T cells are initially isolated, selected, and / or enriched from the same biological sample, such as a single biological sample obtained, harvested, and / or retrieved from a single subject. In some embodiments, the biological sample is first subjected to selection for CD4+ T cells, both the negative and positive fractions are retained, and the negative fraction is further subjected to selection for CD8+ T cells. In other embodiments, the biological sample is first subjected to selection for CD8+ T cells, both the negative and positive fractions are retained, and the negative fraction is further subjected to selection for CD4+ T cells. In some embodiments, the selection method is performed as described in International PCT Publication No. WO2015 / 164675. In some embodiments, the method of selection is performed as described in International PCT Publication No. WO2019 / 089855. In some aspects, the biological sample is first positively selected for CD8+ T cells to generate at least one composition of enriched CD8+ T cells, and then the negative fraction is positively selected for CD4+ T cells to generate at least one composition of enriched CD4+ T cells, such that at least one composition of enriched CD8+ T cells and at least one composition of enriched CD4+ T cells are separate compositions from the same biological sample, such as from the same donor patient or healthy individual. In some aspects, two or more separate compositions of enriched T cells, such as at least one is a composition of enriched CD4+ T cells and at least one is a separate composition of enriched CD8+ T cells from the same donor, are separately frozen, such as cryoprotected or cryopreserved in a cryopreservation medium.

[0354] In some embodiments, two or more separate compositions of enriched T cells, for example, at least one is a composition of enriched CD4+ T cells and at least one is a separate composition of enriched CD8+ T cells from the same biological sample, are activated and / or stimulated by contact with a stimulating reagent (e.g., by incubation with CD3 / CD28 conjugate magnetic beads for T cell activation). In some embodiments, each of the activated / stimulated cell compositions is engineered, transduced, and / or transfected to express the same recombinant protein in the CD4+ T cells and CD8+ T cells of each cell composition, for example using a viral vector encoding a recombinant protein (e.g., a CAR). In some embodiments, the method includes removing the stimulating reagent, e.g., magnetic beads, from the cell composition. In some embodiments, the cell composition containing engineered CD4+ T cells and the cell composition containing engineered CD8+ T cells are grown separately, for example, to separately expand the CD4+ T cell population and CD8+ T cell population therein. In certain embodiments, the cell composition from growth is recovered and / or harvested and / or formulated, for example, by washing the cell composition in a formulation buffer. In certain embodiments, the formulated cell composition containing CD4+ T cells and the formulated cell composition containing CD8+ T cells are frozen, e.g., cryoprotected or cryopreserved in a cryopreservation medium. In some embodiments, the engineered CD4+ T cells and CD8+ T cells in each formulation are derived from the same donor or biological sample and express the same recombinant protein (e.g., a CAR such as anti-CD19 CAR). In some embodiments, the separate engineered CD4+ formulation and the separate engineered CD8+ formulation are administered to a subject in need thereof, such as the same donor, at a defined ratio, e.g., 1:1.

[0355] 1. Cells and Preparation of Cells for Genetic Engineering In some embodiments, cells such as T cells used in connection with the provided methods, uses, manufactured articles or compositions are cells that have been genetically engineered to express a recombinant receptor described herein, such as a CAR or a TCR. In some embodiments, the engineered cells are used in the context of cell therapy, such as adoptive cell therapy. In some embodiments, the engineered cells are immune cells. In some embodiments, the engineered cells are T cells, such as CD4+ T cells or CD8+ T cells.

[0356] In some embodiments, a nucleic acid, such as a nucleic acid encoding a recombinant receptor, is heterologous, i.e., not normally present in the cell or sample obtained from the cell, e.g., obtained from another organism or cell, and these are not normally present in, for example, the cell being engineered and / or the organism from which such cells are derived. In some embodiments, the nucleic acid is a nucleic acid not found in nature, including, for example, a chimeric combination of nucleic acids encoding various domains from multiple different cell types.

[0357] The cells are generally eukaryotic cells, such as mammalian cells, and typically human cells. In some embodiments, the cells are derived from blood, bone marrow, lymph, or lymphoid organs, and are myeloid or lymphoid cells of the immune system, such as cells of innate or adaptive immunity, such as lymphocytes, typically T cells and / or NK cells. Other exemplary cells include stem cells such as multipotent stem cells and pluripotent stem cells, including induced pluripotent stem cells (iPSCs). The cells are typically primary cells, e.g., directly isolated from a subject and / or isolated from a subject and frozen. In some embodiments, the cells are one or more subsets of T cells or other cell types, such as the entire T cell population, CD4 + cells, CD8 +Cells, and subpopulations thereof, such as those defined by function, activation state, maturity, differentiation, expansion, recirculation, potential for localization and / or persistence, antigen specificity, type of antigen receptor, presence of a particular organ or compartment, marker or cytokine secretion profile, and / or degree of differentiation are included. With respect to the subject being treated, the cells can be allogeneic and / or autologous. These methods include off-the-shelf methods. In some aspects, such as those related to off-the-shelf technology, the cells are pluripotent and / or multipotent, such as stem cells, such as induced pluripotent stem cells (iPSCs). In some embodiments, the method includes isolating cells from a subject, preparing, treating, culturing, and / or manipulating them, and reintroducing them into the same subject before or after cryopreservation.

[0358] T cells and / or CD4 + T cells and / or CD8 + Among the subtypes and subpopulations of T cells are naive T (T N ) cells, effector T cells (T EFF ), memory T cells and subtypes thereof, such as stem cell memory T (T SCM ), central memory T (T CM ), effector memory T (T EM ), or terminally differentiated effector memory T cells, tumor infiltrating lymphocytes (TIL), immature T cells, mature T cells, helper T cells, cytotoxic T cells, mucosal associated invariant T (MAIT) cells, naturally occurring, adaptive regulatory T (Treg) cells, helper T cells,...

Claims

**Claim 1** A method of treating a subject having large B-cell lymphoma (LBCL), comprising administering to the subject a dose of autologous CD19-directed genetically modified T cells, wherein (a) the LBCL is selected from the group consisting of diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and follicular lymphoma grade 3B, unless otherwise specified; wherein (b) the dose comprises CD4+ T cells that are positive for the expression of a chimeric antigen receptor (CAR) that binds to CD19, and CD8+ T cells that are positive for the expression of the CAR; (c) the dosage is 44 × 10 6 to 120 × 10 6 CAR-positive surviving T cells; and wherein (d) the subject is either (i) refractory within 12 months from the first treatment; or (ii) has relapsed within 12 months from the first treatment. **Claim 2** The method of claim 1, wherein the first treatment is first-line chemoimmunotherapy. **Claim 3** A method of treating a subject having large B-cell lymphoma (LBCL), comprising administering to the subject a dose of autologous CD19-directed genetically modified T cells, wherein (a) the LBCL is selected from the group consisting of diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and follicular lymphoma grade 3B, unless otherwise specified; wherein (b) the dose comprises CD4+ T cells that are positive for the expression of a chimeric antigen receptor (CAR) that binds to CD19, and CD8+ T cells that are positive for the expression of the CAR; (c) the dosage is 40 × 10 6 to 120 × 10 6 CAR-positive surviving T cells; and wherein (d) the subject is either (i) has a disease refractory to first-line chemoimmunotherapy; (ii) has relapsed within 12 months from first-line chemoimmunotherapy; (iii) has a disease refractory to first-line chemoimmunotherapy and is not eligible for hematopoietic stem cell transplantation (HSCT); or (iv) has relapsed after first-line chemoimmunotherapy and is not eligible for hematopoietic stem cell transplantation (HSCT). **Claim 4** The method of claim 3, wherein the subject (i) has a disease refractory to first-line chemoimmunotherapy. **Claim 5** The method of claim 3, wherein the subject (ii) has relapsed within 12 months from first-line chemoimmunotherapy. **Claim 6** The method according to claim 3, wherein the subject has a disease refractory to (iii) first-line chemoimmunotherapy and is not eligible for hematopoietic stem cell transplantation (HSCT).

7. The method according to claim 3, wherein the subject has relapsed after (iv) first-line chemoimmunotherapy and is not eligible for hematopoietic stem cell transplantation (HSCT).

8. The method according to any one of claims 3, 6, and 7, wherein the subject is not eligible for HSCT due to a coexisting disease or age.

9. The method according to claim 8, wherein the coexisting disease includes pulmonary dysfunction.

10. The method according to claim 8 or 9, wherein the coexisting disease includes a pulmonary adjusted diffusing capacity for carbon monoxide (DLCO) of about 60% or less.

11. The method according to any one of claims 8 to 10, wherein the coexisting disease includes cardiac dysfunction.

12. The method according to any one of claims 8 to 11, wherein the coexisting disease includes a left ventricular ejection fraction (LVEF) of less than about 50%.

13. The method according to any one of claims 8 to 12, wherein the coexisting disease includes renal dysfunction.

14. The method according to any one of claims 8 to 13, wherein the coexisting disease includes a calculated creatinine clearance of less than about 60 milliliters per minute (mL / min).

15. The method according to any one of claims 8 to 14, wherein the coexisting disease includes liver dysfunction.

16. The method according to any one of claims 8 to 15, wherein the coexisting disease includes an aspartate aminotransferase (AST) that exceeds about 2 times the upper limit of normal (ULN).

17. The method according to any one of claims 8 to 16, wherein the coexisting disease includes an alanine aminotransferase (ALT) that exceeds about 2 times the upper limit of normal (ULN).

18. The method according to any one of claims 8 to 17, wherein the coexisting disease includes an Eastern Cooperative Oncology Group (ECOG) performance status of 2.

19. The method according to any one of claims 1 to 18, wherein the subject is an adult and may be at least 18 years old.

20. The method according to any one of claims 1 to 19, wherein the subject is not over 75 years old.

21. The method according to any one of claims 8 to 19, wherein the subject is not eligible for HSCT because the subject is 70 years old or older.

22. The method according to any one of claims 3, 4, 6, and 8 to 21, wherein the subject belongs to (i) or (iii) and the refractory disease is a primary refractory disease.

23. The method according to any one of claims 3, 5, and 7 to 22, wherein the subject belongs to (ii) or (iv) and the recurrence in the subject occurs after the subject has achieved a complete response (CR) to first-line chemoimmunotherapy.

24. The method according to any one of claims 3, 5, and 7 to 23, wherein the subject belongs to (ii) or (iv) and the recurrence in the subject occurs after the subject has achieved a partial response (PR) to first-line chemoimmunotherapy.

25. The method according to any one of claims 3 and 7 to 24, wherein the subject belongs to (iv) and the recurrence in the subject occurs within 12 months from first-line chemoimmunotherapy.

26. The method according to any one of claims 3 and 7 to 24, wherein the subject belongs to (iv) and the recurrence in the subject occurs more than 12 months after first-line chemoimmunotherapy.

27. A method of treating a subject having large cell type B-cell lymphoma (LBCL), comprising administering to the subject a dose of autologous CD19-directed genetically modified T cells: (a) the LBCL is selected from the group consisting of diffuse large cell type B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large cell type B-cell lymphoma, and follicular lymphoma grade 3B, unless otherwise specified; (b) the dose comprises CD4+ T cells that are positive for the expression of a chimeric antigen receptor (CAR) that binds to CD19, and CD8+ T cells that are positive for the expression of the CAR; (c) the dosage is 44 × 10 6 to 120 × 10 6 CAR-positive viable T cells; and (d) the subject has a disease refractory to first-line chemoimmunotherapy.

28. A method of treating a subject having large cell type B-cell lymphoma (LBCL), comprising administering to the subject a dose of autologous CD19-directed genetically modified T cells: (a) the LBCL is selected from the group consisting of diffuse large cell type B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large cell type B-cell lymphoma, and follicular lymphoma grade 3B, unless otherwise specified; (b) the dosage comprises CD4+ T cells that are positive for the expression of a chimeric antigen receptor (CAR) that binds to CD19, and CD8+ T cells that are positive for the expression of said CAR; (c) the dosage is 44×10 6 to 120×10 6 CAR-positive surviving T cells; and (d) the method, wherein the subject has relapsed within 12 months after first-line chemoimmunotherapy. **Claim 29** A method of treating a subject having large cell type B-cell lymphoma (LBCL), comprising administering to the subject a dosage of autologous CD19-directed genetically modified T cells: (a) the LBCL is selected from the group consisting of diffuse large cell type B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large cell type B-cell lymphoma, and follicular lymphoma grade 3B, unless otherwise specified; (b) the dosage comprises CD4+ T cells that are positive for the expression of a chimeric antigen receptor (CAR) that binds to CD19, and CD8+ T cells that are positive for the expression of said CAR; (c) the dosage is 44×10 6 to 120×10 6 CAR-positive surviving T cells; and (d) the method, wherein the subject has a disease refractory to first-line chemoimmunotherapy and is not eligible for hematopoietic stem cell transplantation (HSCT). **Claim 30** A method of treating a subject having large cell type B-cell lymphoma (LBCL), comprising administering to the subject a dosage of autologous CD19-directed genetically modified T cells, (a) the LBCL is selected from the group consisting of diffuse large cell type B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large cell type B-cell lymphoma, and follicular lymphoma grade 3B, unless otherwise specified; (b) the dosage comprises CD4+ T cells that are positive for the expression of a chimeric antigen receptor (CAR) that binds to CD19, and CD8+ T cells that are positive for the expression of said CAR; (c) the dosage is 44 × 10 6 to 120 × 10 6 CAR-positive viable T cells; and (d) the method, wherein the subject has relapsed after first-line chemoimmunotherapy and is not eligible for hematopoietic stem cell transplantation (HSCT). **Claim 31** The method according to claim 30, wherein the relapse in the subject is within 12 months from first-line chemoimmunotherapy. **Claim 32** The method according to claim 30, wherein the relapse in the subject exceeds 12 months after first-line chemoimmunotherapy. **Claim 33** The dosage is 90×10 6 to 110×10 6 CAR-positive viable T cells, and the dosage may be 100×10 6 CAR-positive viable T cells. The method according to any one of claims 1 to 32. **Claim 34** The method according to any one of claims 1 to 33, wherein the CAR-positive CD4+ T cells and the CAR-positive CD8+ T cells are administered to the subject at a ratio of CAR-positive viable CD8+ T cells to CAR-positive viable CD8+ T cells of about 1:

1.

35. The method according to any one of claims 1 to 34, wherein the DLBCL, unless otherwise specified, is DLBCL arising from low-grade lymphoma.

36. The method according to any one of claims 1 to 35, wherein the first-line chemoimmunotherapy is rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP).

37. The method according to claim 36, wherein R-CHOP is administered to the subject in a 14-day cycle (R-CHOP14).

38. The method according to claim 36, wherein R-CHOP is administered to the subject in a 21-day cycle (R-CHOP21).

39. The method according to any one of claims 1 to 35, wherein the first-line chemoimmunotherapy is modified R-CHOP, in which rituximab is replaced by another anti-CD20 monoclonal antibody, and obinutuzumab or vincristine may be replaced by polatuzumab vedotin.

40. The method according to any one of claims 1 to 35, wherein the first-line chemoimmunotherapy is rituximab, dexamethasone, cytarabine, and cisplatin (R-DHA).

41. The method according to any one of claims 1 to 35, wherein the first-line chemoimmunotherapy is rituximab, ifosfamide, carboplatin, and etoposide (R-ICE).

42. The method according to any one of claims 1 to 35, wherein the first-line chemoimmunotherapy is rituximab, gemcitabine, dexamethasone, and cisplatin (R-GDP).

43. The method according to any one of claims 40 to 42, wherein the first-line immunotherapy is administered to the subject for 3 cycles.

44. The method according to any one of claims 1 to 39, wherein the first-line chemoimmunotherapy is administered to the subject for 3 to 8 cycles.

45. The method according to any one of claims 1 to 39 and 44, wherein the first-line chemoimmunotherapy is administered to the subject for more than 4 cycles.

46. The method according to any one of claims 1 to 39 and 44 to 45, wherein the first-line chemoimmunotherapy is administered to the subject for 6 cycles or about 6 cycles.

47. The method according to any one of claims 1 to 35, wherein the first-line chemoimmunotherapy is rituximab, doxorubicin, cyclophosphamide, vindesine, bleomycin, and prednisone (R-ACVB).

48. The method according to any one of claims 1 to 35, wherein the first-line chemoimmunotherapy is dose-adjusted etoposide, prednisone, vincristine, cyclophosphamide, doxorubicin and rituximab (DA-EPOCH-R).

49. The method according to any one of claims 1 to 48, wherein the subject does not have primary central nervous system (CNS) lymphoma.

50. The method according to any one of claims 1 to 49, wherein the CAR-positive CD4+ T cells and the CAR-positive CD8+ T cells are administered to the subject in a predetermined ratio as separate compositions.

51. The method according to claim 50, wherein the composition containing the CAR-positive CD8+ T cells is administered to the subject before the composition containing the CAR-positive CD4+ T cells.

52. The method according to claim 50 or claim 51, wherein the administration of the composition containing the CAR-positive CD8+ T cells and the administration of the composition containing the CAR-positive CD4+ T cells are performed at intervals of about 12 hours or less, about 6 hours or less, about 4 hours or less, about 2 hours or less, about 1 hour or less, or about 30 minutes or less.

53. The method according to any one of claims 50 to 52, wherein the administration of the composition containing the CAR-positive CD8+ T cells and the administration of the composition containing the CAR-positive CD4+ T cells are performed at intervals of about 30 minutes or less.

54. The method according to any one of claims 50 to 53, wherein the administration of the composition containing the CAR-positive CD8+ T cells and the administration of the composition containing the CAR-positive CD4+ T cells are performed at intervals of within about 15 minutes.

55. The method according to any one of claims 1 to 54, wherein the dose of autologous CD19-directed genetically modified T cells is provided in the form of a formulation containing a cryoprotectant.

56. The method according to claim 55, wherein the formulation contains dimethyl sulfoxide (DMSO).

57. The method according to claim 55 or claim 56, wherein the preparation contains albumin, which may contain human albumin.

58. The method according to any one of claims 1 to 57, wherein the dose of the autologous CD19-directed genetically modified T cells is cryopreserved before administration to the subject.

59. The method according to claim 58, wherein the cryopreserved dose of the autologous CD19-directed genetically modified T cells is thawed before administration to the subject.

60. The method according to claim 59, wherein the dose of the autologous CD19-directed genetically modified T cells is administered to the subject within about 2 hours after thawing.

61. The method according to any one of claims 1 to 60, wherein the dose of the autologous CD19-directed genetically modified T cells is administered to the subject by intravenous injection.

62. The method according to any one of claims 1 to 61, wherein the CAR comprises an extracellular antigen-binding domain that binds to CD19, a transmembrane domain, and an intracellular signaling domain.

63. The method according to claim 62, wherein the extracellular antigen-binding domain is a single-chain variable fragment (scFv) derived from the FMC63 monoclonal antibody.

64. The method according to claim 62 or claim 63, wherein the transmembrane domain is the CD28 transmembrane domain.

65. The method according to any one of claims 62 to 64, wherein the intracellular signaling domain comprises a 4-1BB co-stimulatory domain and a CD3 zeta activation domain.

66. The method according to any one of claims 62 to 65, wherein the CAR comprises, in order from the N-terminus to the C-terminus, a single-chain variable fragment (scFv) derived from the FMC63 monoclonal antibody, an IgG4 hinge region, a 47-CD28 transmembrane domain, a 4-1BB (CD137) co-stimulatory domain, and a CD3 zeta activation domain.

67. The method according to any one of claims 62 to 66, wherein the extracellular antigen-binding domain comprises the amino acid sequence set forth in SEQ ID NO:

43.

68. The method according to any one of claims 62 to 67, wherein the transmembrane domain comprises the amino acid sequence set forth in SEQ ID NO:

8.

69. The method according to any one of claims 65 to 68, wherein the 4-1BB co-stimulatory domain comprises the amino acid sequence set forth in SEQ ID NO:

12.

70. The method according to any one of claims 65 to 69, wherein the CD3 zeta signaling domain comprises the amino acid sequence set forth in SEQ ID NO:

13.

71. The method according to any one of claims 1 to 70, wherein the CAR comprises the amino acid sequence set forth in SEQ ID NO:

59.

72. The method according to any one of claims 1 to 71, wherein the cells of the dose of autologous CD19-directed genetically modified T cells express a non-functional truncated epidermal growth factor receptor (EGFRt).

73. The method according to any one of claims 1 to 72, further comprising administering to the subject a lymphodepletion regimen of fludarabine and cyclophosphamide prior to administration of the dose of autologous CD19-directed genetically modified T cells to the subject.

74. The method according to any one of claims 1 to 73, wherein the subject is administered a lymphodepletion regimen of fludarabine and cyclophosphamide prior to administration of the dose of autologous CD19-directed genetically modified T cells to the subject.

75. The lymphocyte depletion regimen is 3 days each of fludarabine 30 mg / m 2 / day intravenous (IV) administration and cyclophosphamide 300 mg / m 2 / day IV administration, the method according to claim 73 or claim 74.

76. The method according to any one of claims 73 to 75, wherein the lymphodepletion regimen is administered to the subject about 2 to about 7 days prior to administering the dose of autologous CD19-directed genetically modified T cells to the subject.

77. The method according to any one of claims 1 to 76, wherein the subject is administered acetaminophen, as appropriate, about 30 minutes to about 60 minutes prior to administration of the dose of autologous CD19-directed genetically modified T cells, prior to administration of the dose of autologous CD19-directed genetically modified T cells.

78. The method according to claim 77, wherein the subject is administered about 650 mg of acetaminophen.

79. The method according to claim 77 or claim 78, wherein the acetaminophen is administered orally.

80. Before administering the dose of the autologous CD19-directed genetically modified T cells, the subject is appropriately administered an antihistamine about 30 to about 60 minutes before administering the dose of the autologous CD19-directed genetically modified T cells, H 1 The method according to claim 79, wherein the subject has been administered an antihistamine.

81. Said H 1 The method according to claim 80, wherein the antihistamine is diphenhydramine and the subject may be administered from about 25 mg to about 50 mg of diphenhydramine.

82. Said H 1 The method according to claim 80 or claim 81, wherein the antihistamine is administered intravenously or orally.

83. The method according to any one of claims 1 to 82, wherein the subject is not pregnant.

84. The method according to any one of claims 1 to 83, wherein the cells of the dose of autologous CD19-directed genetically modified T cells are obtained from the subject by leukapheresis.

85. The method according to claim 84, wherein the subject is after leukapheresis and is administered a bridging therapy for treating the LBCl prior to administration of the dose of autologous CD19-directed genetically modified T cells.

86. The method according to claim 85, wherein the bridging therapy is chemotherapy or radiotherapy.

87. The method according to any one of claims 1 to 86, wherein the dose of autologous CD19-directed genetically modified T cells is administered to the subject by inpatient administration.

88. The method according to any one of claims 1 to 86, wherein the dose of the autologous CD19-directed genetically modified T cells is administered to the subject by exogenous administration.

89. The method according to any one of claims 1 to 88, wherein the subject has an ECOG performance status of 0, 1, or 2.

90. The method according to any one of claims 1 to 89, wherein the subject has an ECOG performance status of 0.

91. The method according to any one of claims 1 to 89, wherein the subject has an ECOG performance status of 1.

92. The method according to any one of claims 1 to 89, wherein the subject has an ECOG performance status of 2.