Oligonucleotide

Abstract

The present invention relates to a splice-switching oligonucleotide (SSO) capable of altering the splicing of a pre-mRNA encoding a variant of the SLC25A13 gene, and to the use of the same SSO for the treatment of citrin deficiency. In one embodiment, the SSO binds to a site within a target region present on the pre-mRNA transcript of the SLC25A13 gene, and binding of the SSO results in the exclusion of SLC25A13-PE5 from the mature mRNA transcript of the SLC25A13 gene. In another embodiment, the target region has at least 95% sequence identity with SEQ ID NO: 28.

Description

Technical Field

[0001] The present invention generally relates to the field of RNA splicing. In particular, the present invention relates to splice-switching oligonucleotides (SSOs) that can alter the splicing of pre-mRNAs encoding variants of the SLC25A13 gene. The present invention also relates to the use of SSOs as therapeutic candidates for citrin deficiency.

Background Art

[0002] Citrin deficiency is an autosomal recessive disorder of urea cycle metabolism caused by pathogenic mutations in the SLC25A13 gene, which encodes citrin, a mitochondrial aspartate-glutamate carrier. This disease may present as neonatal intrahepatic cholestasis (NICCD) in infancy and adult-onset recurrent hyperammonemia and type II citrullinemia (CTLN2) characterized by mental status changes that do not respond to conventional hyperammonemia treatment. NICCD usually has the potential to resolve spontaneously, followed by a relatively asymptomatic period in childhood. During the so-called "asymptomatic period", some patients with citrin deficiency exhibit recurrence of hypoglycemia, eating disorders, and growth retardation. Affected individuals generally have a unique eating habit (preferring high-fat / high-protein foods and avoiding high-carbohydrate diets) before the onset of CTLN2 and typically have a thin body type. Identifying at-risk individuals during this period is difficult because there are no specific clinical findings or biochemical markers to address the progression of the disease. Undiagnosed individuals are at risk of significant growth retardation, hypoglycemia, and sudden onset of life-threatening hyperammonemia. Therefore, it is important to establish a timely diagnosis of citrin deficiency and develop effective treatment methods. The detailed mechanism of this disease remains unclear.

Summary of the Invention

Problems to be Solved by the Invention

[0003] Currently, the only treatment for citrullinemia is to improve the diet with a high-protein / high-fat diet and, in some cases, add medium-chain triglycerides to the diet. Additionally, a high-carbohydrate diet and alcohol intake are not recommended as they can cause metabolic disorders such as hyperammonemia and may lead to nerve damage. However, while dietary improvements may be used to manage the symptoms of citrullinemia, they do not cure the underlying genetic cause of the disease. Recent studies have suggested that the carrier frequency of citrullinemia is relatively high (close to 1 in 30 - 40 people), particularly in East Asian countries such as Singapore and Japan. So far, there is no treatment for citrullinemia other than liver transplantation. However, liver transplantation is a major surgery with risks such as bleeding and infections. Liver transplantation also involves risks such as immune rejection, biliary complications, transplanted liver failure, and the need for lifelong immunosuppressive drugs. Therefore, there is a need for a new treatment strategy that overcomes the drawbacks of the prior art and corrects the underlying pathogenic gene mutations of the SLC25A13 gene. Further, other desirable features and characteristics will become apparent from the following detailed description and the appended claims in conjunction with the accompanying drawings and the background of the present disclosure. **Means for Solving the Problem**

[0004] In one aspect, an exon skipping method is provided that includes providing a splice-switching oligonucleotide (SSO) that binds to a site within a target region present on the pre-mRNA transcript of the SLC25A13 gene, where binding of the SSO induces the exclusion of SLC25A13-PE5 from the mature mRNA transcript of the SLC25A13 gene.

[0005] In one embodiment, the target region has at least 95% sequence identity with SEQ ID NO: 28.

[0006] In one embodiment, SLC25A13-PE5 includes the sequence of SEQ ID NO: 29.

[0007] In one embodiment, the method described herein includes providing an SSO having a binding site present within SLC25A13-PE5.

[0008] In one embodiment, the method described herein includes providing an SSO having an acceptor splice site of SLC25A13-PE5 and a binding site that overlaps with SLC25A13-PE5 or a part thereof.

[0009] In one embodiment, the method described herein includes providing an SSO having a binding site that overlaps with SLC25A13-PE5 or a part thereof and that overlaps with the donor splice site of SLC25A13-PE5.

[0010] In one embodiment, the method described herein includes providing an SSO having a sequence selected from the group consisting of SEQ ID NOs: 1 to 12.

[0011] In one embodiment, the method described herein includes providing an SSO having a sequence selected from the group consisting of SEQ ID NOs: 13 to 27.

[0012] In one aspect, a splice-switching oligonucleotide (SSO) is provided that binds to a site within a target region present on the pre-mRNA transcript of the SLC25A13 gene, the target region having at least 95% sequence identity with SEQ ID NO: 28, and binding of the SSO induces the exclusion of SLC25A13-PE5 from the mature mRNA transcript of the SLC25A13 gene.

[0013] In one embodiment, the SSO described herein has a binding site present within SLC25A13-PE5, and SLC25A13-PE5 includes the sequence of SEQ ID NO: 29.

[0014] In one embodiment, the SSO described herein has an acceptor splice site of SLC25A13-PE5 and a binding site that overlaps with SLC25A13-PE5 or a part thereof, and SLC25A13-PE5 includes the sequence of SEQ ID NO: 29.

[0015] In one embodiment, the SSO described herein has a binding site that overlaps with SLC25A13-PE5 or a part thereof, and a binding site that overlaps with the donor splice site of SLC25A13-PE5, and SLC25A13-PE5 contains the sequence of SEQ ID NO: 29.

[0016] In one embodiment, the SSO described herein contains a sequence selected from the group consisting of SEQ ID NOs: 1 to 12.

[0017] In one embodiment, the SSO described herein contains a sequence selected from the group consisting of SEQ ID NOs: 13 to 27.

[0018] In one aspect, there is provided an SSO described herein for use in the treatment of citrullinemia.

[0019] In one aspect, there is provided the use of the SSO described herein in the manufacture of a medicament for the treatment of citrullinemia.

[0020] In one aspect, there is provided a method for treating citrullinemia, which includes administering to a subject a composition containing the SSO described herein.

[0021] In one embodiment, the SSO described herein is 15 to 40 nucleotides in length.

[0022] In one embodiment, at least one of the nucleotides of the SSO is chemically modified, and the chemical modification is 2'-O-methyl RNA modification, 2'-O-methoxyethyl RNA modification, locked nucleic acid substitution, or phosphorothioate bond.

[0023] In one embodiment, the SSO described herein contains phosphorothioate bonds between all nucleotides of the SSO.

[0024] In one embodiment, each nucleotide of the SSO described herein contains either 2'-O-methyl RNA modification, 2'-O-methoxyethyl RNA modification, or locked nucleic acid substitution.

[0025] In one aspect, there is provided a pharmaceutical composition comprising (a) a therapeutically effective amount of an SSO as described herein, and (b) one or more pharmaceutically acceptable carriers and / or diluents.

[0026] Only the preferred embodiments of the present invention will be described by way of non-limiting examples with reference to the accompanying exemplary drawings, so that the present invention can be fully understood and easily put into practice.

Brief Description of the Drawings

[0027]

Figure 1

Figure 2-1

Figure 2-2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

BRIEF DESCRIPTION OF THE INVENTION

[0028] In one aspect of the invention, there is provided an exon skipping method comprising providing a splice-switching oligonucleotide (SSO) that binds to a site within a target region present on the pre-mRNA transcript of the SLC25A13 gene, wherein binding of the SSO induces the exclusion of SLC25A13-PE5 from the mature mRNA transcript of the SLC25A13 gene.

[0029] "Oligonucleotide" refers to any polynucleotide. A "polynucleotide" is an oligomer composed of nucleotides. A polynucleotide may be composed of DNA, its RNA modifications, or combinations thereof. As used herein, the term "nucleotide" or its plural form is interchangeable with modified forms as described herein or as known in the art. In certain cases, in the art, the term "nucleobase" is used to include not only naturally occurring nucleotides but also modifications of polymerizable nucleotides. Thus, a nucleotide or nucleobase refers to not only the naturally occurring nucleobases adenine (A), guanine (G), cytosine (C), thymine (T), uracil (U), but also non-naturally occurring nucleobases (e.g., xanthine, diaminopurine, 8-oxo-N6-methyladenine, 7-deazaxanthine, 7-deazaguanine, N4,N4-ethanocytosine, N’,N’-ethano-2,6-diaminopurine, 5-methylcytosine (mC), 5-(C[3]-C6)-alkynylcytosine, 5-fluorouracil, 5-bromouracil, pseudoisocytosine, 2-hydroxy-5-methyl-4-triazolopyridine, isocytosine, isoguanine, inosine, and the "non-natural" nucleobases described in Benner et al., U.S. Pat. No. 5,432,272 and Susan M. Freier and Karl-Heinz Altmann, 1997, Nucleic Acids Research, vol. 25: pp 4429-4443). The term "nucleobase" includes not only known purine and pyrimidine heterocycles, but also their heterocyclic analogs and tautomers.Furthermore, natural and non-natural nucleobases include those disclosed in U.S. Patent No. 3,687,808 (Merigan et al.), Chapter 15 by Sanghvi, Antisense Research and Application, Ed. S. T. Crooke and B. Lebleu, CRC Press, 1993, Englisch et al., 1991, Angewandte Chemie, International Edition, 30: 613-722 (especially pages 622 and 623), the Concise Encyclopedia of Polymer Science and Engineering, J. I. Kroschwitz Ed., John Wiley & Sons, 1990, pages 858-859, Cook, Anti-Cancer Drug Design 1991, 6, 585-607 (each of which is incorporated herein by reference in its entirety). In various embodiments, the polynucleotide also includes one or more "nucleobases" or "base units" including compounds such as heterocyclic compounds that can function like nucleobases, which includes certain "universal bases" that are not nucleobases in the most classical sense but function as nucleobases. Universal bases include 3-nitropyrrole, optionally substituted indoles (e.g., 5-nitroindole), and optionally substituted hypoxanthine. Other desirable universal bases include pyrrole and diazole or triazole derivatives containing universal bases known in the art.

[0030] Polynucleotides can also include modified nucleobases. As used in the art, the term "modified base" is understood to refer to a base that can pair with a natural base (e.g., adenine, guanine, cytosine, uracil, and / or thymine) and / or a base that can pair with a non-natural base. Exemplary modified bases are described in EP1072679 and WO97 / 12896, the disclosures of which are incorporated herein by reference. Modified nucleobases include, but are not limited to: 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-aminoadenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, 3-deazaguanine and 3-deazaadenine. Further modified bases include tricyclic pyrimidines such as phenoxazine cytidine (H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-ciamps such as substituted phenoxazine cytidine (e.g., 9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H-pyrido[3’,2’:4,5]pyrrolo[2,3-d]pyrimidin-2-one).Modified bases include those in which a purine or pyrimidine base is replaced by another heterocycle, for example, 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone. Additional nucleobases include those disclosed in U.S. Patent No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, those disclosed in Englisch et al, 1991, Angewandte Chemie, International Edition, 30: 613, and those disclosed in Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., ed., CRC Press, 1993. Among these bases, some are useful for enhancing the binding affinity of polynucleotides and include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines (including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine). 5-Methylcytosine substitution has been shown to increase the stability of nucleic acid duplexes by 0.6 to 1.2 °C and, in certain embodiments, is combined with 2'-O-methoxyethyl sugar modification.See U.S. Patent Nos. 3,687,808; 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121; 5,596,091; 5,614,617; 5,645,985; 5,830,653; 5,763,588; 6,005,096; 5,750,692, and 5,681,941 (the disclosures of which are incorporated herein by reference).

[0031] As used herein, the term "splice-switching oligonucleotide" (SSO) or "splice-switching oligomer" is intended to include synthetic antisense nucleic acids that form base pairs with pre-mRNA and disrupt the splicing process by sterically blocking RNA-RNA base pair formation or protein-RNA binding interactions that occur between components of the splicing machinery and pre-mRNA. SSOs are also known as "antisense nucleotides," "steric blockers," or "steric-hindrance antisense nucleotides" that can regulate splicing. SSOs can regulate splicing through steric blocking. In some embodiments, the SSO can be a mixmer. The term "mixmer" includes oligomers to which different types of chemical modifications are applied to the sugar moiety, backbone linkage, or both. Examples of chemical modifications include phosphorothioate linkages, 2'-O-methyl RNA modifications, 2'-O-methoxyethyl RNA modifications, locked nucleic acid substitutions, and the like. The terms "phosphorothioate linkage" and "phosphorothioate bond" are used interchangeably. Chemical modifications may improve efficacy, selectivity, and stability while expressing an excellent toxicity profile of the SSO.

[0032] The term "splicing" refers to the RNA processing mechanism that converts pre-mRNA into mature mRNA. During splicing, introns are removed and exons are joined. Splicing is catalyzed by the spliceosome complex. As used herein, the term "alternative splicing" refers to the process by which a gene can encode multiple mRNA and protein products by differentially selecting the exons included in the mature mRNA transcript. For example, alternative splicing can take the form of skipping of one or more exons, variable positions of intron splicing, or retention of introns.

[0033] As used herein, the term "intron" refers to a segment of non-coding nucleic acid sequence that is transcribed and present in pre-mRNA but is excised by the splicing machinery and thus does not exist in the mature mRNA transcript.

[0034] As used herein, the term "exon" refers to a segment of nucleic acid sequence that is transcribed into mRNA and is present in mature mRNA after splicing. The term "exon skipping" refers to the process by which an entire exon or a portion thereof is removed from a particular pre-mRNA and is not present in the mature mRNA. For example, the portion of the protein encoded by the skipped exon is not present in the expressed form of the protein.

[0035] In one embodiment, the target region has at least 95% sequence identity with SEQ ID NO: 28. In various embodiments, the target region can include a variant sequence of SEQ ID NO: 28. The target region can include, consist of, or consist essentially or substantially of a sequence having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO: 28.

[0036] As used herein, the term "splice site" means a specific nucleic acid sequence that can be recognized by a splicing mechanism as being suitable for excision and / or ligation of the corresponding splice site. A splice site defines the precise exon-intron boundary that allows for excision of an intron present in a pre-mRNA transcript. As used herein, the term "5' splice site" (also referred to as the donor splice site) refers to the nucleic acid sequence surrounding the exon-intron boundary at the 5' end of an intron and indicates the boundary between the start of the intron and the preceding exon sequence. As used herein, the term "3' splice site" (also referred to as the acceptor splice site) refers to the nucleic acid sequence surrounding the intron-exon boundary at the 3' end of an intron and indicates the boundary between the end of the intron and the next exon sequence.

[0037] As used herein, the term "pre-mRNA" or "precursor mRNA" refers to a strand of messenger ribonucleic acid (mRNA) synthesized from a DNA template by transcription. Pre-mRNA is composed of exons, introns, and untranslated sequences (before the first exon and after the last exon, respectively). Generally, eukaryotic pre-mRNA exists for only a short time before being fully processed into mature mRNA.

[0038] As used in the context of SSO, the term "binding" means hybridization of the SSO to a site within a target region on a pre-mRNA transcript. The terms "hybridize" or "hybridization" may include the binding of a locally single-stranded region of a single-stranded nucleic acid or double-stranded nucleic acid to a locally single-stranded region of another single-stranded nucleic acid or double-stranded nucleic acid having a complementary sequence through the pairing of complementary nucleic acids. It is generally known to those skilled in the art that complete complementarity of sequences is not required for the binding or hybridization of one sequence to another. For example, the sequence of an SSO may be fully or partially complementary to the target region to which it binds.

[0039] The term "site" refers to a location where the SSO is substantially or completely complementary. The SSO can bind to this site. In the context of a "site within the target region on the pre-mRNA transcript", the site is within the target region, and the target region forms part of the pre-mRNA transcript.

[0040] The "mutation" of a related gene means any change or modification of the sequence of that gene such that the sequence of the gene is different from the sequence found naturally or in most people. Similarly, "non-mutated" may include any sequence of a gene considered to be "wild-type", i.e., a sequence considered normal or typical for that gene. Thus, a "mutation" of a gene means one or more changes, i.e., substitutions, duplications, inversions, insertions, and / or deletions, at one or more positions of the polynucleotide of the gene. Substitution includes replacing one or more nucleotides occupying a position with one or more different nucleotides. Deletion means removing one or more nucleotides occupying a position, and insertion means adding one or more nucleotides immediately adjacent to the nucleotide occupying a position. The term "mutation" may also refer to any mutation or change in the sequence of a gene that results in a loss of expression and / or function of the wild-type protein, or a gain of function.

[0041] In one embodiment, the pre-mRNA transcript of the SLC25A13 gene is a pre-mRNA transcript of a variant of the SLC25A13 gene. The variant of the SLC25A13 gene may include the c.469-2922G>T mutation. In one embodiment, the binding site of the SSO described herein is 5'-CCUCCCAUUGUUCAAUAGCUCACGAUUUGUUCAUUCA UIt is present within the target region of 5’-UUGGUUUUACAGAAUACUUUUCACUGAUGAGAAUGCCUGUCAUUUAUUGAGCACCUACUAUACAUCUAAAGCAUUCUGCUGAGCUGCAUGUAUAAAUGUAAGUAGAUGCUUACAGGACUUCAAAAGGUUAUACUGUCUUUUCCUUGG-3’ (SEQ ID NO: 28). The cDNA sequence encoding SEQ ID NO: 28 is 5’-CCTCCCATTGTTCAATAGCTCACGATTTGTTCATTCA T TTGGTTTTACAGAATACTTTTCACTGATGAGAATGCCTGTCATTTATTGAGCACCTACTATACATCTAAAGCATTCTGCTGAGCTGCATGTATAAATGTAAGTAGATGCTTACAGGACTTCAAAAGGTTATACTGTCTTTTCCTTGG-3’ (SEQ ID NO: 44). Those skilled in the art given SEQ ID NO: 44 are generally understood to know how to derive the RNA sequence of the target region, i.e., SEQ ID NO: 28. SEQ ID NO: 28 includes the sequence of SLC25A13-PE5 (SEQ ID NO: 29) and the sequence of a partial intron adjacent to SLC25A13-PE5. The sequence of the partial intron adjacent to SLC25A13-PE5 includes the acceptor splice site and the donor splice site of SLC25A13-PE5. The c.469-2922G>T mutation of SEQ ID NO: 44 and the corresponding G>U mutation of SEQ ID NO: 28 are indicated in bold and underlined above. In one embodiment, the binding site of the SSO may overlap with the SLC25A13-PE5 acceptor splice site and SLC25A13-PE5 or a part thereof. In another embodiment, the entire binding site of the SSO may be present within SLC25A13-PE5. In yet another embodiment, the binding site of the SSO may overlap with or a part thereof overlap with the SLC25A13-PE5 and the SLC25A13-PE5 donor splice site.

[0042] In one embodiment, SLC25A13-PE5 includes the sequence of SEQ ID NO: 29.

[0043] The term "pseudoexon" refers to a potential exon that contains appropriate 5' and 3' splice sites but is not normally spliced into mature mRNA by the splicing mechanism. If a pseudoexon is included in the mature mRNA, for example, a splicing motif or splice site is created / activated, or mutations that are removed / reduced, or the splicing mechanism is dysregulated due to the lack or overproduction of a specific RNA-binding protein that functions as one or more components of the spliceosome complex or a splicing enhancer or splicing silencer, resulting in a shift in the codon reading frame, premature stop codons within the frame, or the addition of new amino acid residues, and the protein expression / function may be lost. Specifically, gene mutations that affect the creation of pseudoexons do not have to be present within the pseudoexons.

[0044] In one embodiment, the term "pseudoexon" as used herein refers to SLC25A13-PE5 having the RNA sequence 5'-AAUACUUUUCACUGAUGAGAAUGCCUGUCAUUUAUUGAGCACCUACUAUACAUCUAAAGCAUUCUGCUGAGCUGCAUGUAUAAAU-3' (SEQ ID NO: 29). The cDNA sequence encoding SLC25A13-PE5 is 5'-AATACTTTTCACTGATGAGAATGCCTGTCATTTATTGAGCACCTACTATACATCTAAAGCATTCTGCTGAGCTGCATGTATAAAT-3' (SEQ ID NO: 45). Those skilled in the art given SEQ ID NO: 45 generally understand the method of deriving the RNA sequence of SLC25A13-PE5 (i.e., SEQ ID NO: 29). The terms "SLC25A13-PE5", "SLC25A13-PE", "PE", and "exon 5*" may be used interchangeably.

[0045] In one embodiment, the method described herein includes providing an SSO having a binding site present within SLC25A13-PE5.

[0046] In one embodiment, the method described herein includes providing an SSO having an acceptor splice site of SLC25A13-PE5 and a binding site that overlaps SLC25A13-PE5 or a portion thereof.

[0047] In one embodiment, the method described herein includes providing an SSO having a binding site that overlaps SLC25A13-PE5 or a portion thereof and that overlaps a donor splice site of SLC25A13-PE5.

[0048] In various embodiments, the method described herein includes providing an SSO having a sequence selected from the group consisting of SEQ ID NOs: 1 to 12.

[0049] In various embodiments, the method described herein includes providing an SSO having a sequence selected from the group consisting of SEQ ID NOs: 13 to 27.

[0050] In one aspect of the invention, there is provided a splice-switching oligonucleotide (SSO) that binds to a site within a target region present in a pre-mRNA transcript of the SLC25A13 gene, the target region having at least 95% sequence identity with SEQ ID NO: 28, and binding of the SSO induces exclusion of SLC25A13-PE5 from the mature mRNA transcript of the SLC25A13 gene.

[0051] In various embodiments, the SSO has a binding site present within SLC25A13-PE5, and SLC25A13-PE5 includes the sequence of SEQ ID NO: 29.

[0052] In various embodiments, the SSO has an acceptor splice site of SLC25A13-PE5 and a binding site that overlaps SLC25A13-PE5 or a portion thereof, and SLC25A13-PE5 includes the sequence of SEQ ID NO: 29.

[0053] In various embodiments, the SSO has a binding site that overlaps with SLC25A13-PE5 or a part thereof, and a binding site that overlaps with the donor splice site of SLC25A13-PE5, and SLC25A13-PE5 contains the sequence of SEQ ID NO: 29.

[0054] In various embodiments, the SSO of the present invention contains a sequence selected from the group consisting of SEQ ID NOs: 1 to 12. In various embodiments, the SSO contains a sequence selected from the group consisting of SEQ ID NOs: 13 to 27. The length of the SSO may be between 15 and 40 nucleotides.

[0055] In addition to c.469-2922G>T, other mutations may cause the production of SLC25A13-PE5. Examples of other mutations that may be included in SLC25A13-PE5 are c.469-2922G>C, c.469-2922G>A, c.469-2923A>T, c.469-2923A>G, c.469-2923A>C, c.469-2923_469-2920del, c.469-2922_469-2921del, c.469-2923_469-2921del, c.469-2924_469-2921del, c.469-2922del, c.469-2923_469-2922del, c.469-2924_469-2922del, c.469-2924_469-2921del, c.469-2923_469-2922insT, c.469-2923_469-2922insC, c.469-2923del, c.469-2924_469-2923del, c.469-2925_469-2923del, etc. It is generally understood by those skilled in the art that complete complementarity of sequences is not required for the binding or hybridization of one sequence to another. Therefore, SSOs having sequences that are not completely complementary to the target region of SEQ ID NO: 28 can also bind to the target region. For example, SSOs complementary to pre-mRNAs resulting from mutations selected from the group consisting of c.469-2922G>C, c.469-2922G>A, c.469-2923A>T, c.469-2923A>G, c.469-2923A>C, c.469-2923_469-2920del, c.469-2922_469-2921del, c.469-2923_469-2921del, c.469-2924_469-2921del, c.469-2922del, c.469-2923_469-2922del, c.469-2924_469-2922del, c.469-2924_469-2921del, c.469-2923_469-2922insT, c.469-2923_469-2922insC, c.469-2923del, c.469-2924_469-2923del, and c.469-2925_469-2923del can also bind to SEQ ID NO: 28.

[0056] Advantageously, the SSO of the present embodiment can competitively bind to each binding site on the target region depending on the favorable binding thermodynamics and the degree of cotranscriptional local single-stranded binding sites on the target region. The selection of the target region includes considering the presence of RNA binding protein motifs on the target region. The SSO of the present embodiment can induce the desired splicing correction by competitively binding to target sites that include or overlap the sequence motifs used in appropriate RNA binding proteins, snRNPs (small nuclear ribonucleoproteins), or both. Advantageously, the shortened SSO reduces the tendency of the immune response and may have an excellent uptake rate by cells as shown in FIG. 6.

[0057] In various embodiments, at least one of the nucleotides of the SSO is chemically modified, and the chemical modification is a 2'-O-methyl RNA modification, a 2'-O-methoxyethyl RNA modification, a locked nucleic acid substitution, or a phosphorothioate bond. The term "locked nucleic acid" (LNA) generally refers to a modified RNA nucleotide in which the ribose ring is "locked" by a methylene bridge connecting the 2'-O atom and the 4'-C atom.

[0058] A modified polynucleotide is one in which one or more sugars of the nucleotide units in the polynucleotide and / or both of one or more internucleotide linkages are each replaced with a "non-natural" sugar (i.e., a sugar other than ribose or deoxyribose) or an internucleotide linkage and is intended for use in that state. In one embodiment, this embodiment contemplates peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of the polynucleotide is replaced with an amide-containing backbone (e.g., a peptide bond between N-(2-aminoethyl)glycine units). See, for example, U.S. Patent Nos. 5,539,082, 5,714,331, and 5,719,262, and Nielsen et al., Science, 1991, 254, 1497-1500 (the disclosures of which are incorporated herein by reference). Modified polynucleotides may also contain one or more substituted sugar groups. In one embodiment, the modification of the sugar includes locked nucleic acid (LNA) in which a 2'-hydroxyl group is attached to the 3' or 4' carbon atom of the sugar ring, thereby forming a bicyclic sugar group. In certain embodiments, the linkage is a methylene (-CH [2]- ) [n] group, where n is 1 or 2. LNA and its preparation are described in International Publication Nos. 98 / 39352 and 99 / 14226, the disclosures of which are incorporated herein by reference. In the present invention, preferably, the antisense oligonucleotide comprises a modified polynucleotide backbone. The modified polynucleotide backbone can include a modified moiety substituted in place of the sugar of at least one polynucleotide. The modified moiety can be selected from the group consisting of phosphorodiamidate morpholino oligomers (PMO), peptide bond phosphorodiamidate morpholino oligomers (PPMO), and non-peptide dendrimer octaguanidine moiety-tagged morpholino oligomers.

[0059] In various embodiments, the modified polynucleotide backbone comprises at least one modified internucleotide linkage. The modified internucleotide linkage comprises a modified phosphate. More preferably, the modified phosphate is any selected from the group consisting of a non-bridging oxygen atom substituting a sulfur atom, a phosphonate, a phosphorothioate, a phosphodiester, a phosphoromorpholidate, a phosphoropiperazidate, and a phosphoramidate.

[0060] In various embodiments of the present invention, the SSO comprises a backbone selected from the following group: ribonucleic acid, deoxyribonucleic acid, DNA phosphorothioate, RNA phosphorothioate, 2'-O-methyl oligoribonucleotide and 2'-O-methyl oligodeoxyribonucleotide, 2'-O-hydrocarbyl ribonucleic acid, 2'-O-hydrocarbyl DNA, 2'-O-hydrocarbyl RNA phosphorothioate, 2'-O-hydrocarbyl DNA phosphorothioate, 2'-F-phosphorothioate, 2'-F-phosphodiester, 2'-methoxyethyl phosphorothioate, 2-methoxyethyl phosphodiester, deoxymethylene(16 ole 16 amino)(deoxyMMI), 2'-O-hydrocarbyl MMI, deoxymethyl phosphonate, 2'-O-hydrocarbyl methyl phosphonate, morpholino, 4'-thio DNA, 4'-thio RNA, peptide nucleic acid, 3'-amidate, deoxy 3'-amidate, 2'-O-hydrocarbyl 3'-amidate, locked nucleic acid, cyclohexane nucleic acid, tricyclic DNA, 2'-fluoroarabinonucleic acid, N3'-P5' phosphoramidate, carbamate linkage, phosphotriester linkage, nylon backbone modification, and mixtures of the foregoing backbones.

[0061] In various embodiments, the oligonucleotide is chemically conjugated to one or more conjugates that enhance the activity, cellular distribution, or cellular uptake of the SSO.

[0062] In various embodiments, the SSO comprises phosphorothioate linkages between all nucleotides of the SSO.

[0063] In various embodiments, each nucleotide of the SSO comprises either a 2'-O-methyl RNA modification, a 2'-O-methoxyethyl RNA modification, or a locked nucleic acid substitution.

[0064] In another aspect of the invention, the SSOs of the invention are used for the treatment of a medical condition or citrullinemia. As used herein, the term "treating" or "treatment" in the context of treating a disease such as citrullinemia is meant to include improving the clinical outcome of a patient having the disease. This includes improving the survival rate of a patient having the disease. The term "treating" or "treatment" may refer to prophylactic and / or therapeutic treatment.

[0065] In one aspect, the use of the SSOs described herein is provided for the manufacture of a medicament for the treatment of citrullinemia. In another aspect, a method of treating citrullinemia is provided, comprising administering to a subject a composition comprising the SSOs described herein. These SSOs can be used in a composition that is suitable for treatment, for example, as a pharmaceutical composition comprising the SSOs of the invention and a pharmaceutically acceptable carrier. This composition is suitable for parenteral administration to a patient, either as such or in combination with a delivery agent. The carrier is selected from the group consisting of nanoparticles such as polymeric nanoparticles, liposomes such as pH-sensitive liposomes, antibody-conjugated liposomes, viral vectors, cationic lipids, polymers, UsnRNAs such as U7snRNA, and cell-penetrating peptides. The SSOs are administered orally, rectally, transmucosally, enterally, intramuscularly, subcutaneously, intramedullary, intrathecal, directly into the ventricles of the brain, intravenously, intravitreally, intraperitoneally, intranasally, or intravitreally.

[0066] A pharmaceutically acceptable carrier generally refers to a substance suitable for administration to a subject, which carrier is not biologically harmful or does not cause undesirable effects. Such a carrier is typically an inert ingredient of a pharmaceutical. Usually, the carrier is administered to the subject together with the active ingredient without causing undesirable biological effects or interacting in a harmful way with any of the other ingredients of the pharmaceutical composition containing the carrier. Suitable pharmaceutical carriers are described in Martin, Remington’s Pharmaceutical Sciences, 18th Ed., Mack Publishing Co., Easton, Pa., (1990), the entire text of which is incorporated herein by reference.

[0067] In a more specific form of the present disclosure, a pharmaceutical composition is provided that includes a therapeutically effective amount of SSO together with a pharmaceutically acceptable diluent, preservative, solubilizer, emulsifier, adjuvant, and / or carrier. Such compositions include various buffer contents (e.g., phosphate, Tris-HCl, acetate), pH, ionic strength diluents, detergents, solubilizers (e.g., Tween80, polysorbate 80), antioxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g., thimerosal, benzyl alcohol), bulking agents (e.g., lactose, mannitol), and other additives. This material can be incorporated, for example, into particulate formulations of polymer compounds such as polylactic acid, polyglycolic acid, or liposomes. Hyaluronic acid can also be used. Such compositions can affect the physical state, stability, in vivo release rate, and in vivo clearance rate of the disclosed compositions. The composition may be prepared in liquid form or in the form of a dry powder such as a lyophilized form.

[0068] It is understood that the pharmaceutical composition provided according to the present invention can be administered by any means known in the art. Preferably, the pharmaceutical composition for administration is administered by injection, orally, or via the pulmonary or nasal route. The antisense polynucleotide is delivered by intravenous, intraarterial, intraperitoneal, intramuscular, or subcutaneous routes of administration in various embodiments.

[0069] The oligonucleotides of the present invention include pharmaceutically acceptable salts, esters, or salts of such esters, or other compounds that can provide (directly or indirectly) biologically active metabolites or residues thereof when administered to animals including humans. Thus, for example, the present invention also relates to prodrugs and pharmaceutically acceptable salts of the compounds of the present invention, pharmaceutically acceptable salts of such prodrugs, and other biological equivalents.

[0070] The term "pharmaceutically acceptable salt" refers to physiologically and pharmaceutically acceptable salts of the compounds of the present invention, i.e., salts that retain the desired biological activity of the parent compound and do not impart undesirable toxic effects thereto.

[0071] In the case of polynucleotides, preferred examples of pharmaceutically acceptable salts include, but are not limited to: (a) salts formed with cations such as polyamines such as sodium, potassium, ammonium, magnesium, calcium, spermine and spermidine; (b) acid addition salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid; (c) salts formed with organic acids such as acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid; and (d) salts formed from elemental anions such as chlorine, bromine, iodine. The pharmaceutical compositions of the present invention can be administered in a variety of ways depending on whether local or systemic treatment is desired and on the area to be treated. Administration can be local (including administration to mucous membranes including ophthalmic and rectal administration), pulmonary (such as by inhalation of powder or aerosol), (including administration by nebulizer, intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion, or intracranial (intrathecal or intraventricular) administration.

[0072] The pharmaceutical formulations of the present disclosure can be conveniently provided in unit dosage form and can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of combining the active ingredient with a pharmaceutical carrier or excipient. In general, the formulations are prepared by uniformly combining the active ingredient with a liquid carrier or a finely divided solid carrier, or both, and then shaping the product, if necessary.

[0073] Combination therapies with additional therapeutic agents may also be contemplated by the present disclosure. As used throughout this specification, the terms "combination" or "combination therapy" mean administering the recited therapeutic agent(s) to a subject suffering from a disease, disorder or medical condition with the same or different pharmaceutical formulations, either simultaneously or at different times. When administering the therapeutic agents at different times, they need to be administered close enough in time to produce a potentiating or synergistic effect. In such cases, it is typically contemplated that both therapeutic agents will be administered to each other within about 12 to 24 hours, more preferably within about 6 to 12 hours of each other. However, depending on the circumstances, when several days (2, 3, 4, 5, 6, or 7) to several weeks (1, 2, 3, 4, 5, 6, 7, or 8) elapse between each administration, it may be desirable to significantly extend the treatment period. In other circumstances, it may be desirable to shorten the time between administrations and administer both therapeutic agents within seconds or minutes to within a few hours, preferably within about 6 hours, more preferably within about 1 hour or 3 hours.

[0074] The term "therapeutically effective amount" refers to the amount of SSO necessary to provide the intended therapeutic effect to a subject, and that amount varies depending on the route of administration, the state of the disease, age, gender, weight, and the potential inclusion of other therapeutic agents or excipients. The methods and uses of the present invention are for patients in need thereof. The compositions and methods of the present invention are for subjects or patients in need thereof. The term "patient in need thereof" refers to a person suffering from or suspected of suffering from or developing citrulline deficiency, as well as a person who is predisposed to citrulline deficiency but has not yet developed it.

[0075] To practice the method of the present invention, the SSO can be administered via oral, parenteral, inhalant spray, topical, rectal, nasal, buccal, vaginal, or implantable reservoir. As used herein, the term "parenteral" includes subcutaneous, intradermal, intravenous, intramuscular, intra-articular, intra-arterial, intra-synovial, intrasternal, intramedullary, intralesional, and intracranial injection or infusion techniques. Sterile injectable compositions, such as sterile aqueous or oleaginous suspensions, can be formulated according to techniques known in the art using suitable dispersing or wetting agents (such as Tween80) and suspending agents. Sterile injectable formulations can be sterile injectable solutions or suspensions in a non-toxic parenterally acceptable diluent or solvent, such as a 1,3-butanediol solution. Suitable media and solvents that can be used include mannitol, water, Ringer's solution, isotonic sodium chloride solution, etc. Additionally, sterile fixed oils are conventionally used as solvents or suspending media (e.g., synthetic monoglycerides or diglycerides). Fatty acids such as oleic acid and its glyceride derivatives are useful in the preparation of injectables, as are natural pharmaceutically acceptable oils such as olive oil and castor oil, particularly their polyoxyethylated versions. These oil solutions or suspensions may also contain long-chain alcohol diluents or dispersing agents, or carboxymethyl cellulose or similar dispersing agents. Other commonly used surfactants such as Tweens or Spans, or other similar emulsifying or bioavailability enhancing agents commonly used in the manufacture of pharmaceutically acceptable solid, liquid, or other dosage forms can also be used for formulation purposes.

[0076] The composition for oral administration can be in any orally acceptable dosage form including, but not limited to, capsules, tablets, emulsions, aqueous suspensions, dispersions, solutions, etc. In the case of oral tablets, commonly used carriers include lactose, corn starch, etc. Also, lubricants such as magnesium stearate are usually added. When orally administered in the form of capsules, useful diluents include lactose, dried corn starch, etc. When an aqueous suspension or emulsion is orally administered, the active ingredient can be suspended or dissolved in an oil phase combined with an emulsifier or a suspending agent. Optionally, specific sweeteners, flavorings, or colorants can be added. Nasal aerosols or inhalation compositions can be prepared according to techniques well known in the pharmaceutical formulation art. The SSO-containing composition can also be administered in the form of suppositories for rectal administration. The carrier in the pharmaceutical composition must be "acceptable" in the sense that it is compatible with the active ingredient of the formulation (and preferably can stabilize the active ingredient) and is not harmful to the subject being treated. For example, one or more solubilizing agents that form a more soluble complex with SSO, or more solubilizing agents, can be utilized as a pharmaceutical carrier for delivering the active compound. Other examples of carriers include colloidal silicon dioxide, magnesium stearate, sodium lauryl sulfate, and D&C Yellow #10. In various embodiments, the methods described herein include providing an SSO that is 15 to 40 nucleotides in length.

[0077] In various embodiments, the methods described herein include providing an SSO in which at least one nucleotide is chemically modified, and the chemical modification is a 2'-O-methyl RNA modification, a 2'-O-methoxyethyl RNA modification, a locked nucleic acid substitution, or a phosphorothioate linkage.

[0078] In various embodiments, the methods described herein include providing an SSO that has phosphorothioate linkages between all nucleotides of the SSO.

[0079] In various embodiments, the methods described herein include providing an SSO in which each nucleotide has either a 2'-O-methyl RNA modification, a 2'-O-methoxyethyl RNA modification, or a locked nucleic acid substitution.

[0080] In one aspect of the invention, there is provided a pharmaceutical composition comprising (a) a therapeutically effective amount of an SSO as described herein, and (b) one or more pharmaceutically acceptable carriers and / or diluents.

[0081] Just because a document is listed or described herein as having been previously publicly available does not necessarily mean that the document is part of the state of the art or common general knowledge.

[0082] The documents referred to in this specification are hereby incorporated by reference in their entirety.

Examples

[0083] The present invention will be described in further detail below.

[0084] Materials and Methods Cell Culture HEK293T, Huh7, and HepG2 cells were maintained in high-glucose Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum and were maintained in a cell culture incubator set at 37 °C and 5% carbon dioxide. Embryonic stem cells (ES cells) were maintained in mTeSRPlus medium (STEMCELL Technologies) on ES cell-qualified Matrigel (Corning). For the differentiation of hepatocytes into induced hepatocytes (iHeps), ES cells seeded at a confluence density of 50% were cultured in definitive endoderm medium 1 (RPMI 1640 medium supplemented with B-27 supplement, 100 ng / mL activin A, 3 μM CHIR99021) for 2 days, definitive endoderm medium 2 (RPMI 1640 medium supplemented with B-27 supplement) for 3 days, hepatic endoderm medium (definitive endoderm medium 2 supplemented with 20 ng / mL BMP4 and 10 ng / mL FGF2) for 5 days, and Lonza hepatocyte culture medium for 14 days. The CRISPR knock-in of the c.469-2922G>T variant into ES cells was commissioned to the Duke-NUS Stem Cell and Gene Editing (SCAGE) Core Facility.

[0085] The co-transfection of 500 ng of the mini-gene plasmid and various amounts of SSO into cells was performed using Opti-MEM (ThermoFisher) and Lipofectamine 3000 reagent (Invitrogen) according to the manufacturer's instructions. Cells were harvested 24 hours after transfection for RNA analysis and were treated with 50 μg / mL cycloheximide approximately 17 hours before cell harvesting to block NMD.

[0086] To establish Huh7 and HepG2 cells stably expressing the mini-gene, the mini-gene was subcloned into a Piggybac-based transfer vector and co-transfected with the Piggybac transposon expression plasmid at a ratio of 5:1 to a total of 500 ng using Lipofectamine 3000 as described above, and then the cells were selected with 1 μg / mL puromycin for 2 weeks.

[0087] Free uptake of SSO by Huh7 and HepG2 under CEM was carried out by treating the cells with SSO in calcium - enhanced medium (the above - mentioned cell - culture medium supplemented with 9 mM calcium chloride). The cells were collected 72 hours after treatment for RNA analysis and were treated with 50 μg / mL cycloheximide approximately 17 hours before cell harvesting. For SSO treatment of iHeps, the cells were treated with GalNAc - conjugated SSO in Lonza hepatocyte - culture medium for 72 hours. The SSO - treated iHeps were not treated with cycloheximide.

[0088] Splicing Assay RNA was extracted from the cells using TRIzol reagent (Invitrogen), and messenger RNA (mRNA) was converted to complementary DNA (cDNA) using the Maxima First Strand cDNA Synthesis Kit (ThermoFisher). PCR was performed on the cDNA, and the PCR products were separated by standard gel electrophoresis on an agarose gel for qualitative analysis and by capillary electrophoresis on a Qsep100 Bio - Fragment Analyzer (BiOptic Inc) for quantitative analysis. To analyze the sequence of the PCR products, a specific PCR band was excised from the agarose gel and extracted using the QIAquick Gel Extraction Kit (QIAgen), and Sanger sequencing was commissioned to Macrogen Inc.

[0089] Quantitative Real-Time PCR For quantification of SLC25A13 and the acute toxicity markers CDKN1A, BAX, PUMA mRNAs and the hepatocyte differentiation markers ALB and ASGR1, quantitative real-time PCR was performed on cDNA using PowerUp SYBR Green Master Mix (Applied Biosystems) and detected using a CFX Touch Real-Time PCR Detection System (Bio-Rad). The primers used were as follows: CDKN1A forward 5’-AGCAGAGGAAGACCATGTGGA-3’ (SEQ ID NO: 30), reverse 5’-AATCTGTCATGCTGGTCTGCC-3’ (SEQ ID NO: 31); BAX forward 5’-CCCGAGAGGTCTTTTTCCGAG-3’ (SEQ ID NO: 32), reverse 5’-CCAGCCCATGATGGTTCTGAT-3’ (SEQ ID NO: 33); PUMA forward 5’-GACCTCAACGCACAGTACGAG-3’ (SEQ ID NO: 34), reverse 5’-AGGAGTCCCATGATGAGATTGT-3’ (SEQ ID NO: 35); ALB forward 5’-GTTGCATGAGAAAACGCCAGT-3’ (SEQ ID NO: 36), reverse 5’-GTCGCCTGTTCACCAAGGAT-3’ (SEQ ID NO: 37); ASGR1 forward 5’-GAGACAGAGCTGGACAAG-3’ (SEQ ID NO: 38), reverse 5’-CCCCTTCCCTTAAAATCCT-3’ (SEQ ID NO: 39); SLC25A13 forward 5’-TGGACTGTATAGAGGTCTGTTGC-3’ (SEQ ID NO: 40), reverse 5’-CCCTCACAAAATCGTTCACTGT-3’ (SEQ ID NO: 41); CAPN10 forward 5’-CTTCTGCGACTTGTCTACGCC-3’ (SEQ ID NO: 42), reverse 5’-GTGTGGCACAAATCTCCTGG-3’ (SEQ ID NO: 43). Relative quantification was calculated using the 2 -ΔΔCt method using CAPN10 as a loading control.

[0090] Immunoblot Proteins were extracted with radioimmunoprecipitation buffer (50 mM sodium chloride, 50 mM Tris buffer pH 6.8, 1 mM ethylenediaminetetraacetic acid, 1% Triton X-100, 0.1% sodium deoxycholate) supplemented with protease and phosphatase inhibitors, and quantified using Bradford reagent (Bio-Rad). 30 μg of the lysate was denatured with SDS loading dye (1% β-mercaptoethanol, 0.004% bromophenol blue, 6% glycerol, 2% sodium dodecyl sulfate, 50 mM Tris buffer pH 6.8), separated by polyacrylamide gel, and transferred to a PVDF membrane using the Bio-Rad Mini-Protean System. Subsequently, the membrane was probed with an anti-SLC25A13 antibody (ab96303, Abcam) and detected with an iBright FL1500 (Invitrogen).

[0091] Analysis of Urea and Ammonia After treating iHeps with GalNAc-conjugated SSO for 72 h, the medium was refreshed with HCM supplemented with 2 mM ammonium chloride, and urea was collected for 48 h. Urea in the medium was quantified using the QuantiChrom Urea Assay Kit (BioAssay Systems), and signals were detected using a Tecan Spark10M plate reader. The amount of ammonia remaining in the medium was quantified using the EnzyChrom Ammonia / Ammonium Assay Kit (BioAssay Systems), and signals were detected as described above. Ammonia clearance was calculated by subtracting the amount of ammonia remaining in the medium from the amount of ammonia measured in cell-free control wells.

[0092] MTT Assay Huh7 cells that stably express the mutant mini-gene were treated with 10 nM, 50 nM, or 100 nM of SSO in calcium-enriched medium for 72 hours. Subsequently, an MTT assay was performed using an MTT assay kit (Abcam) according to the manufacturer's instructions. Briefly, after treating the cells with the MTT solution at 37 °C for 3 hours, an MTT solvent was added to the cells to release and dissolve the reduced formazan crystals. Then, signals were measured using a Tecan Spark10M plate reader.

[0093] Example 1 The sequences of the SSOs are shown in Table 1 below. All sugar moieties within the SSOs are linked via phosphorothioate backbones. All sugar moieties within the SSOs are modified with 2'-O-methyl or 2'-O-methoxyethyl, except for nucleotides substituted with locked nucleic acids as indicated in bold.

[0094] [Table 1]

[0095] The SSO containing the sequence of SEQ ID NO: 12 has the same target sequence as the SSO containing any one of the sequences of SEQ ID NOs: 13 to 27.

[0096] In some embodiments, the SSO contains multiple chemical modifications. The sequences of the chemically modified SSOs are shown in Table 2 below.

[0097] Nucleotides containing 2'-O-methyl RNA (2'OMe) are denoted by "m". Nucleotides containing 2'-O-methoxyethyl (2'MOE) RNA are denoted by " / MOEr / ". 2'-MOE modified thymidine is used instead of 2'-MOE modified uridine. Nucleotides containing locked nucleic acid (LNA) are denoted by "+". 2'-MOE modified thymidine is used instead of 2'-MOE modified uridine. The nucleotide linked to the next nucleotide by a phosphorothioate (PS) bond is " *It is shown by 「」. It is generally known to those skilled in the art that the number of phosphorothioate bonds is one less than the number of bases. 「2OM」 indicates that SSO is modified with 2'-O-methyl RNA. 「2MOE」 indicates that SSO is modified with 2'-O-methoxyethyl RNA. 「2OML」 indicates that the SSO contains a nucleic acid modification locked with 2'-O-methyl RNA. 「2MOL」 indicates that the SSO contains a nucleic acid modification locked with 2'-O-methoxyethyl RNA.

[0098]

Table 2

[0099] Example 2 To facilitate the verification of rationally designed SSOs, a mini-gene system carrying a specific genomic mutation of the SLC25A13 gene, c.469-2922G>T, was constructed. As shown in Figure 1, the mini-gene contains the entire sequence of exon 5, the first 2,000 bases and the last 4,923 bases of intron 5, and the entire sequence of exon 6, and the relative locus of the G>T substitution is shown in the figure. In the wild-type mini-gene, proper splicing from exon 5 to exon 6 was performed, but when the c.469-2922G>T mutation was introduced, it was confirmed that pseudo-exons (exon 5 * or SLC25A13-PE5) were included when the mutant mini-gene was expressed in several human cell lines (Figure 2). This suggests that the c.469-2922G>T mutation is the cause of the retention of SLC25A13-PE5 in the mature SLC25A13 transcript. The pathogenic effect was confirmed by the loss of citrin protein expression in iHeps with the c.469-2922G>T mutation and the subsequent loss of urea production ability and ammonia removal ability (Figure 2B, 2C, 2D).

[0100] Example 3 Since the pseudo-exon is 85 bases long, including it shifts the codon reading frame of the SLC25A13 transcript, resulting in the loss of expression and protein function (Figure 2). As a therapeutic strategy to restore the expression of the wild-type protein, nine SSOs were designed to induce the exclusion of the pseudo-exon, thereby correcting the reading frame. As shown in Figure 3, each SSO was very efficient in inducing SLC25A13-PE5 exon skipping. Seven of the most efficient SSOs were selected, and titration experiments were performed to obtain the concentration response for each (Figure 4), allowing further discrimination of the SSOs that exhibited the best performance. Each SSO was observed to completely exclude the pseudo-exon at a concentration of less than 10 nM, i.e., IC 100 <10 nM. SSO#2005, #2007, and #2008 showed the top three performances at IC 50 <0.1 nM and IC 75 ~0.1 nM.

[0101] Example 4 For the purpose of reducing the molecular size of lead SSO to facilitate cellular uptake and lowering the cGMP manufacturing cost, a shortened version of SSO#2008 in which nucleic acids locked with specific riboses (LNA) were replaced was rationally designed. Figure 5 shows that the shortened SSOs, #2032, #2033, #2034, are 40% shorter than the parental #2008 and the efficiency of inducing pseudoexon exclusion is significantly reduced. #2034 was selected for further optimization by a combination of 15 mixed chemical modifications labeled from #2034.1 to #2034.15. All sugar moieties within the mixmer are either modified with 2'-O-methyl or replaced with locked nucleic acids linked via a phosphorothioate backbone. Recovery of the efficiency of inducing pseudoexon exclusion was observed in some mixmers of #2034. In both experimental sets, SSO was co-transfected into Huh7 at 1 nM with 500 ng of pCIT2mut. PCR was performed on complementary DNA generated from RNA extracted from the transfected cells. Capillary electrophoresis was used on the PCR products to quantify the amounts of products containing pseudoexons and products not containing pseudoexons. The efficiency is reflected as the ratio of PCR products not containing pseudoexons to the total amount of PCR products (splicing correction rate).

[0102] Example 5 The efficiency of inducing the elimination of SLC25A13-PE5 by each mixmer of #2034 labeled from #2034.1 to #2034.15 was determined by the free uptake of mutant minigenes stably expressed in Huh7 cells or HepG2 cells into calcium-enriched medium (CEM) when treated with 20 nM or 200 nM SSO respectively. The use of CEM stimulates the in vitro uptake by cells and better reflects the in vivo efficacy compared to transfection. The parental molecule #2008 is 40% longer than #2034 and almost all of its efficiency was lost (Figure 6A). In contrast, the efficiency of most #2034 mixmers was retained, suggesting that the SSO molecular size may be an important factor affecting the kinetics of free uptake by cells (Figure 6A). Subsequently, the dose responses of the two most efficient mixmers, #2034.5 and #2034.15, were obtained and compared with their parental #2008 and the version modified with only 2'-O-methyl (#2034). Both the #2034.5 and #2034.15 mixmers showed similar dose responses and were 10-fold more potent than either #2008 or #2034 (Figure 6B). The EC 50 (<10 1.5 nM) of both was approximately 10-fold lower than that of #2008 and #2034. Figure 6C shows that no obvious toxic effects were seen in cells treated with any of the SSOs.

[0103] Example 6 To demonstrate the application to therapy, the lead mixmer was conjugated to three GalNAc molecules (GN * 3) to simulate the functional uptake via the asialoglycoprotein receptor by homozygous iHeps of SLC25A13-PE5 (in the absence of CEM and transfection agents). GN *The three parts are chemically linked in a trivalent configuration to the 5' of each SSO, enabling receptor-mediated uptake of the SSO via the asialoglycoprotein receptor that is specifically expressed in hepatocytes. Either the 2'-O-methyl + LNA (2OML) or 2'-O-methoxyethyl + LNA (2MOL) chemical combination, 4 μM of GalNAc * 3 (GN * 3)-binding non-target control (NC2g1.1), 2034.5 (2034.5g1.1), or 2034.15 (2034.15g1.1) were incubated on cultured iHeps. Figure 7A reveals that GalNAc-binding SSOs 2034.5 and 2034.15 can regulate the splicing out of SLC25A13-PE5 from the endogenous SLC25A13 transcript, rather than NC2. This restores the SLC25A13 transcript levels that should have been reduced by nonsense-mediated decay in mutant iHeps (Figure 7B). When the expression of full-length wild-type SLC25A13 in mutant iHeps is restored by either 2034.5g1.1 or 2034.15g1.1, urea production is restored (Figure 7C), leading to the restoration of ammonia clearance (Figure 7D). The restoration of functional protein activity is supported by the restoration of the full-length citrin protein expression level by immunoblotting in mutant iHeps treated with 2034.15g1.1 modified with the 2OML chemical combination (Figure 7F). No significant increase was observed in the expression of the acute toxicity markers CDKN1A, BAX, and PUMA. Thus, no acute toxicity was observed in iHeps derived from 2034.5g1.1 and 2034.15g1.1 treated with the 2OML or 2MOL chemical combination (Figure 7E). Table 3 shows the sequences of the primers used for quantitative real-time PCR for the quantification of the acute toxicity markers CDKN1A, BAX, PUMA, the hepatocyte differentiation markers ALB and ASGR1, SLC25A13, and the loading control CAPN10 mRNA.

[0104]

Table 3

[0105] In the foregoing description, preferred embodiments of the present invention have been described. However, it will be understood by those skilled in the art that many variations or modifications can be made to the details of the design or structure without departing from the present invention.

Claims

1. An exon skipping method comprising providing a splice-switching oligonucleotide (SSO) that binds to a site within a target region present on the premRNA transcript of the SLC25A13 gene, wherein the binding of the SSO induces the exclusion of SLC25A13-PE5 from the mature mRNA transcript of the SLC25A13 gene.

2. The method according to claim 1, wherein the target region has at least 95% sequence identity with respect to sequence number 28.

3. The method according to claim 1, wherein SLC25A13-PE5 contains the sequence of sequence number 29.

4. The method according to any one of claims 1 to 3, comprising providing an SSO having a binding site located within SLC25A13-PE5.

5. The method according to any one of claims 1 to 3, comprising providing an SSO having an acceptor splice portion of SLC25A13-PE5 and a binding portion that overlaps with SLC25A13-PE5 or a part thereof.

6. The method according to any one of claims 1 to 3, comprising providing an SSO having a binding site that overlaps with SLC25A13-PE5 or a part thereof and overlaps with the donor splice site of SLC25A13-PE5.

7. The method according to any one of claims 1 to 3, comprising providing an SSO having a sequence selected from the group consisting of sequence numbers 1 to 12.

8. The method according to any one of claims 1 to 3, comprising providing an SSO having a sequence selected from the group consisting of sequence numbers 13 to 27.

9. A splice-switching oligonucleotide (SSO) that binds to a site within a target region present on the premRNA transcript of the SLC25A13 gene, wherein the target region has at least 95% sequence identity with SEQ ID NO: 28, and the binding of the SSO induces the exclusion of SLC25A13-PE5 from the mature mRNA transcript of the SLC25A13 gene.

10. The SSO according to claim 9, wherein the SSO has a binding site located within SLC25A13-PE5, and SLC25A13-PE5 includes the sequence of Sequence ID No.

29.

11. The SSO according to claim 9, wherein the SSO has an acceptor splice portion of SLC25A13-PE5 and a binding portion that overlaps with SLC25A13-PE5 or a part thereof, and SLC25A13-PE5 includes the sequence of Sequence ID No.

29.

12. The SSO according to claim 9, wherein the SSO has a binding site that overlaps with SLC25A13-PE5 or a part thereof, and a binding site that overlaps with the donor splice site of SLC25A13-PE5, and SLC25A13-PE5 includes the sequence of Sequence ID No.

29.

13. The SSO according to claim 9, comprising a sequence selected from the group consisting of sequence numbers 1 to 12.

14. The SSO according to claim 9, comprising a sequence selected from the group consisting of sequence numbers 13 to 27.

15. An SSO according to any one of claims 9 to 14, for use in the treatment of citrin deficiency.

16. Use of SSO according to any one of claims 9 to 14 in the manufacture of a pharmaceutical product for the treatment of citrin deficiency.

17. A method for treating citrin deficiency, comprising administering a composition containing SSO as described in any one of claims 9 to 14 to the target.

18. The SSO according to any one of claims 9 to 14, wherein the length of the SSO is 15 to 40 nucleotides.

19. The SSO according to any one of claims 9 to 14, wherein at least one nucleotide of the SSO is chemically modified, the chemical modification being a 2'-O-methylRNA modification, a 2'-O-methoxyethylRNA modification, a locked nucleic acid substitution, or a phosphorothioate bond.

20. The SSO according to any one of claims 9 to 14, wherein the SSO comprises phosphorothioate bonds between all nucleotides of the SSO.

21. The SSO according to any one of claims 9 to 14, wherein each nucleotide of the SSO comprises either a 2'-O-methyl RNA modification, a 2'-O-methoxyethyl RNA modification, or a locked nucleic acid substitution.

22. A pharmaceutical composition comprising (a) a therapeutically effective amount of SSO as described in any one of claims 9 to 14, and (b) one or more pharmaceutically acceptable carriers and / or diluents.

23. The method according to any one of claims 1 to 3, wherein the length of the SSO is 15 to 40 nucleotides.

Images