Chimeric antigen receptor comprising a BCMA nanobody linked to an intracellular signaling domain in a chimeric cell
The third-generation BCMA-CAR with ICOS and CD137 signaling domains addresses the reduced expression issue of dual-costimulatory CARs, achieving superior T cell activation and cancer cell killing with reduced cytokine production and PD-1 expression.
Patent Information
- Application Number
- JP2024577010
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-07-05
- Filing Date
- 2023-07-05
- Publication Date
- 2025-07-17
AI Technical Summary
Current chimeric antigen receptors (CARs) combining two costimulatory signaling domains for T cell activation have reduced cell surface expression, limiting their functional potential in cancer therapies like multiple myeloma.
A third-generation BCMA-CAR is developed, incorporating a BCMA nanobody with a chimeric intracellular domain comprising ICOS, truncated CD137, and CD3ζ signaling domains, enhancing T cell proliferation and cytotoxicity while reducing adverse events.
The BCMA-CAR exhibits improved surface expression, increased T cell proliferation, enhanced target cell killing, and decreased cytokine production, outperforming existing CAR therapies in efficacy and reducing PD-1 expression.
Smart Images

Figure 2025522815000001_ABST
Abstract
Description
Technical Field
[0001] Cross - Reference to Related Applications This application claims the benefit and priority of U.S. Provisional Patent Application No. 63 / 358,399, filed on July 5, 2022, the content of which is hereby incorporated by reference in its entirety.
[0002] Reference to Electronic Sequence Listing The content of the electronic sequence listing (NEOM_005_001WO_SeqList_ST26.xml; size 38,729 bytes; and creation date: July 5, 2023) is hereby incorporated by reference in its entirety.
[0003] Technical Field The present disclosure provides a third - generation chimeric antigen receptor (CAR) that binds to B - cell maturation antigen (BCMA). Such BCMA - CARs are effective in inducing T - cell activation and proliferation, resulting in enhanced cytotoxic effects in response to target cells.
Background Art
[0004] Adoptive immunotherapy has shown efficacy in cancer treatment, but the efficacy of these therapies can be further improved through genetic engineering of T cells for better proliferation and persistence. Development of genetically modified T cells for such adoptive immunotherapy requires the introduction of chimeric T cell costimulatory molecules that can locally activate T cells upon engagement with pathological antigens to potently enhance T cell activation and increase therapeutic efficacy. Second-generation chimeric costimulatory molecules incorporating one costimulatory signaling domain from a CD28 or TNFR family protein may not be optimal for inducing sustained tumor remission. Third-generation chimeric molecules combine two costimulatory signaling domains from CD28 and TNFR family members to further enhance the therapeutic potential of T cells, taking advantage of the non-redundant functions of these two costimulatory molecule families, but chimeric proteins combining two costimulatory signaling domains often have reduced cell surface expression, preventing these chimeric proteins from achieving their functional potential.
[0005] This application discloses chimeric antigen receptors (CARs) (BCMA-CARs) that bind to B cell maturation antigen (BCMA), comprising a BCMA nanobody and a third generation chimeric T cell costimulatory molecule that incorporates CD28 family signaling domains and TNFR family signaling domains to enhance T cell function. These enhanced functions include enhanced proliferation, target cell killing, and reduced adverse events associated with current leading clinical CARs. This application discloses exemplary BCMA-CAR proteins, as well as methods of making and using these BCMA-CARs, for use in the treatment of cancers, including but not limited to multiple myeloma. Summary of the Invention
[0006] The present disclosure relates to (a) an extracellular domain comprising the amino acid sequence set forth in SEQ ID NO:8; (b) The transmembrane domain of ICOS; and, (c) A chimeric intracellular domain comprising a first signaling domain, a second signaling domain, and at least a third signaling domain, wherein the first signaling domain comprises the intracellular domain of ICOS, the second signaling domain comprises the truncated intracellular domain of CD137 (4-1BB), and at least the third signaling domain comprises the truncated CD3ζ domain, to provide a chimeric antigen receptor (BCMA-CAR) that binds to B cell maturation antigen.
[0007] In some embodiments, the BCMA-CAR is (a) An extracellular domain comprising the amino acid sequence set forth in SEQ ID NO: 8; (b) The transmembrane domain of ICOS; and, (c) A chimeric intracellular domain comprising a first signaling domain, a second signaling domain, and a third signaling domain, wherein the first signaling domain comprises the intracellular domain of ICOS, the second signaling domain comprises the truncated intracellular domain of CD137 (4-1BB), and the third signaling domain comprises the truncated CD3ζ domain, comprising.
[0008] The present disclosure provides (a) An extracellular domain comprising the amino acid sequence set forth in SEQ ID NO: 1; (b) A transmembrane domain; and, (c) A chimeric intracellular domain comprising a first signaling domain, a second signaling domain, and at least a third signaling domain, wherein the first signaling domain comprises the intracellular domain of ICOS set forth in SEQ ID NO: 2, the second signaling domain comprises the truncated intracellular domain of CD137 (4-1BB) set forth in SEQ ID NO: 3, and at least the third signaling domain comprises the truncated CD3ζ domain set forth in SEQ ID NO: 4, to provide a BCMA-CAR comprising.
[0009] In some embodiments, the BCMA-CAR is (a) An extracellular domain comprising the amino acid sequence set forth in SEQ ID NO: 1; (b) A transmembrane domain; and, (c) A chimeric intracellular domain comprising a first signaling domain, a second signaling domain, and a third signaling domain, wherein the first signaling domain comprises the ICOS intracellular domain set forth in SEQ ID NO: 2, the second signaling domain comprises the truncated CD137 (4-1BB) intracellular domain set forth in SEQ ID NO: 3, and the third signaling domain comprises the truncated CD3ζ domain set forth in SEQ ID NO: 4, comprising.
[0010] In some embodiments, the extracellular domain further comprises a signal peptide, a hinge, or an ICOS extracellular stalk, or a combination thereof. In some embodiments, the extracellular domain further comprises a CD8a signal peptide, a CD8a hinge, an ICOS extracellular stalk, or a combination thereof. In some embodiments, the extracellular domain further comprises the CD8a signal peptide set forth in SEQ ID NO: 6, the CD8a hinge set forth in SEQ ID NO: 7, the ICOS extracellular stalk set forth in SEQ ID NO: 9, or a combination thereof.
[0011] In some embodiments, the extracellular domain comprises the amino acid sequence of SEQ ID NO: 1.
[0012] In some embodiments, the transmembrane domain comprises the amino acid sequence of SEQ ID NO: 10.
[0013] The present disclosure also provides a BCMA-CAR comprising the amino acid sequence of SEQ ID NO: 5. The present disclosure also provides a nucleic acid encoding the BCMA-CAR of the present disclosure. The present disclosure also provides a vector comprising the nucleic acid of the present disclosure. The present disclosure also provides a cell comprising the nucleic acid or vector of the present disclosure. Also provided herein are compositions comprising the BCMA-CAR, nucleic acid, vector, and / or cell of the present disclosure, such as pharmaceutical compositions.
[0014] The present disclosure also provides a modified T cell comprising: (a) a modification of an endogenous sequence encoding a T cell receptor (TCR), wherein the modification reduces or eliminates the level of expression or activity of the TCR; and (b) a BCMA-CAR disclosed herein.
[0015] The present disclosure also provides a method for producing a plurality of modified T cells, comprising: a) preparing a plurality of primary T cells; b) preparing a composition comprising a BCMA-CAR, a nucleic acid, or a vector of the present disclosure; and c) introducing the composition of b) into the plurality of primary T cells of a) to produce a plurality of modified T cells under conditions that stably express the BCMA-CAR in the plurality of modified T cells.
[0016] The present disclosure also provides a composition comprising any one of a BCMA-CAR, a nucleic acid, a vector, a cell, or a modified T cell of the present disclosure.
[0017] The present disclosure also provides a method for treating a disease or disorder, comprising administering to a subject in need of treatment of the disease or disorder a therapeutically effective number of cells of the present disclosure, a therapeutically effective number of modified T cells of the present disclosure, a therapeutically effective amount of the composition of the present disclosure, or a therapeutically effective number of a plurality of modified T cells produced by the method of the present disclosure.
[0018] In some embodiments, the disease or disorder is cancer, an autoimmune disease or disorder, or an inflammatory disease. In some embodiments, the cancer is a blood cancer. In some embodiments, the blood cancer is leukemia, lymphoma, or myeloma. In some embodiments, the cancer is acute leukemia, acute lymphoblastic leukemia (ALL), acute lymphocytic leukemia, B-cell ALL, T-cell ALL, or FAB ALL, acute myeloid leukemia (AML), acute myelogenous leukemia, chronic myeloid leukemia (CML), chronic lymphocytic leukemia (CLL), hairy cell leukemia, myelodysplastic syndrome (MDS), Hodgkin lymphoma, Hodgkin disease, non-Hodgkin lymphoma, and multiple myeloma. In some embodiments, the cancer is multiple myeloma. In some embodiments, the cancer expresses BCMA. In some embodiments, the subject is a mammal. In some embodiments, the mammal is a human.
Brief Description of the Drawings
[0019]
Figure 1
Figure 2A
Figure 2B
Figure 2C
Figure 2D
Figure 3A
Figure 3B
Figure 3C
Figure 4A
Figure 4B
Figure 4C
Figure 5A
Figure 5B
Figure 5C
Figure 6A
Figure 6B
Figure 6C
Figure 7A
Figure 7B
Figure 8A
Figure 8B
Figure 8C
Figure 8D
Figure 9A
Figure 9B
Figure 10A
Figure 10B
Figure 10C
Figure 11A
Figure 11B
Figure 11C
Figure 11D
[0020] In certain drawings and examples described herein, the following abbreviations are used to describe each domain of BCMA-CAR, where CD28 is "CD28" or "28"; CD2 is "2"; CD3 is "3"; CD4 is "4"; CD8a is "CD8"; 4-1BB is "BB"; truncated 4-1BB is "BBt"; CD3ζ is "Z"; truncated CD3ζ is "Zt"; OX-40 is "OX40" or "40", and truncated OX-40 is "40t" or "OX40t". The domains are arranged in the order of the BCMA binding domain, extracellular domain, and intracellular domain.
Mode for Carrying Out the Invention
[0021] Provided herein is a chimeric antigen receptor (BCMA-CAR) that binds to improved B cell maturation antigen and comprises (a) an extracellular domain; (b) a transmembrane domain; and (c) a chimeric intracellular domain comprising a first signaling domain, a second signaling domain, and at least a third signaling domain, wherein the first signaling domain is based on the intracellular signaling domain of a CD28 family protein (e.g., ICOS), the second signaling domain comprises a mutant intracellular signaling domain of a tumor necrosis factor receptor (TNFR) family protein (e.g., 4-1BB), and at least the third intracellular signaling domain is derived from a CD3 signaling domain (e.g., CD3ζ).
[0022] As used herein, provided is a BCMA-CAR (e.g., NPB5005-ICOSBBtZt) that has high on-target potency and low levels of adverse phenotypic events. The BCMA-CARs (e.g., NPB5005-ICOSBBtZt) of the present disclosure enhance the function and proliferation of effector cells (e.g., T cells) and maintain such phenotypes over multiple stimulations. Further, the BCMA-CARs (e.g., NPB5005-ICOSBBtZt) of the present disclosure reduce cytokine levels and decrease PD-1 expression on the surface. Such properties of the BCMA-CARs (e.g., NPB5005-ICOSBBtZt) of the present disclosure provide numerous technical advantages over the control BCMA-CARs tested.
[0023] In some embodiments, the BCMA-CARs (e.g., NPB5005-ICOSBBtZt) of the present disclosure maintain enhanced effector cell function (e.g., T cell proliferation) over multiple stimulations (e.g., 2, 3, 4 times) by target cells (e.g., cancer cells). In one embodiment, the enhancement of effector cell function (e.g., T cell proliferation) is at least 2-fold, at least 3-fold, at least 4-fold, or at least 5-fold relative to the control BCMA-CAR. In some embodiments, the BCMA-CARs (e.g., NPB5005-ICOSBBtZt) of the present disclosure maintain enhanced effector cell function (e.g., lysis of target cells, e.g., lysis of cancer cells) over multiple stimulations (e.g., 2, 3, 4 times) by target cells (e.g., cancer cells). In one embodiment, the enhancement of effector cell function (e.g., lysis of target cells, e.g., lysis of cancer cells) is at least 2-fold, at least 3-fold, at least 4-fold, or at least 5-fold relative to the control BCMA-CAR.
[0024] In some embodiments, the BCMA-CAR of the present disclosure (e.g., NPB5005-ICOSBBtZt) maintains a decrease in deleterious phenotype events (e.g., surface PD-1 expression) over multiple stimulations (e.g., 2, 3, or 4 times) by target cells (e.g., cancer cells). In certain embodiments, the decrease in deleterious phenotype events (e.g., surface PD-1 expression) is at least 2-fold, at least 3-fold, at least 4-fold, or at least 5-fold relative to a control BCMA-CAR. In some embodiments, the BCMA-CAR of the present disclosure (e.g., NPB5005-ICOSBBtZt) maintains a decrease in deleterious phenotype events (e.g., persistent cytokine production, e.g., IL-2, IFNγ, or TNFα) over multiple stimulations (e.g., 2, 3, or 4 times) by target cells (e.g., cancer cells). In certain embodiments, the decrease in deleterious phenotype events (e.g., persistent cytokine production, e.g., IL-2, IFNγ, or TNFα) is at least 2-fold, at least 3-fold, at least 4-fold, or at least 5-fold relative to a control BCMA-CAR.
[0025] In some aspects, the chimeric intracellular domain of the BCMA-CAR of the present disclosure enhances the activity and efficacy of the BCMA-CAR. For example, when expressed in T cells, the BCMA-CAR of the present disclosure enhances T cell stimulation, proliferation, persistence, and the killing of target myeloma cells expressing BCMA. BCMA-CAR T cells can eliminate BCMA-positive multiple myeloma cells with potency equal to and efficacy superior to major clinical CAR T cell therapies targeting BCMA (e.g., bb2121, FHVH33, and LCARB38M), while producing significantly less cytokine. Thus, in some embodiments, the combination of improved T cell proliferation, persistence, tumor cell killing, decreased inflammatory cytokine production, and decreased surface expression of PD-1 results in the BCMA-CAR protein of the present disclosure being superior to major BCMA-CAR T cell therapies.
[0026] Tumor-associated antigens and tumor-specific antigens allow for immunologically targeting tumors with a relatively low risk of on-target / off-tumor side effects. Tumor cells may have increased expression of these antigens, which can be targeted by the human immune response. In this disclosure, the present disclosure provides a chimeric intracellular domain that confers a costimulatory molecule that exhibits superior functionality over other CD28-based receptors or 4-1BB-based receptors by combining the ICOS intracellular domain and the 4-1BB intracellular domain for generating a BCMA-CAR product that contributes to the proliferation, killing efficacy, and enhanced resistance to the suppressive functions of the tumor microenvironment of T cells.
[0027] In some aspects, the present disclosure also provides a nucleic acid encoding the BCMA-CAR disclosed herein. In some embodiments, the nucleic acid encoding the BCMA-CAR disclosed herein comprises the nucleotide sequence set forth in SEQ ID NO: 11.
[0028] In some embodiments, the nucleic acid disclosed herein comprises a nucleic acid sequence encoding a chimeric intracellular domain. In some embodiments, the BCMA-CAR disclosed herein is for expression in T cells, which co-express at least one of the endogenous costimulatory molecules CD28, CD2, OX-40, ICOS, CD28, CD3, CD4, CD8, and CD40L, or combinations thereof.
[0029] In some aspects, the present disclosure also provides a vector comprising the nucleic acid disclosed herein. In some embodiments, the vector disclosed herein is any one of a viral vector, plasmid, minicircle DNA, cosmid, yeast artificial chromosome, bacterial artificial chromosome, or transposon / transposase system. In some embodiments, the viral vector is an adenoviral vector or a lentiviral vector. In some embodiments, the vector is a lentiviral vector.
[0030] In some embodiments, the disclosure also provides a cell comprising a nucleic acid or vector disclosed herein. In some embodiments, the cell disclosed herein is a modified T cell. In some embodiments, the modified T cell is an allogeneic T cell. In some embodiments, the modified T cell is an autologous T cell. In some embodiments, the modified T cell is any one of a naive T cell, an early memory T cell, a stem cell-like T cell, a stem memory T cell (TSCM), a central memory T cell (TCM), and a regulatory T cell (Treg).
[0031] In some embodiments, the BCMA-CAR comprises the extracellular domain of SEQ ID NO: 1. In some embodiments, the BCMA-CAR comprises the first signaling domain of SEQ ID NO: 2, the second signaling domain of SEQ ID NO: 3, and the third signaling domain of SEQ ID NO: 4. In some embodiments, the BCMA-CAR comprises the sequence of SEQ ID NO: 5.
[0032] Definitions Unless otherwise specified, “B cell maturation antigen,” “recombinant B cell maturation antigen,” and “BCMA” are used interchangeably. B cell maturation antigen, also known as CD269, is a member of the tumor necrosis factor receptor superfamily 17 and is highly selectively expressed on the surface of multiple myeloma (MM) cells (Guo, R et al. Front Immunol vol. 13:839097). Under physiological conditions, BCMA is mainly expressed on plasmablasts and highly differentiated plasma cells (PCs). In pathological cases, BCMA is expressed on almost all MM cancer cell lines (80% - 100%), and the amount of BCMA on the surface of malignant PCs is much higher than that on regulatory PCs (Lee L, et al. Br J Haematol (2016) 174:911 - 22). Its expression is limited to the B cell lineage and has been shown to be important for B cell development and autoimmune responses.
[0033] As used herein, "BCMA-specific" (e.g., BCMA-specific T cell receptor or BCMA-specific chimeric antigen receptor) refers to binding that selectively, e.g., with high affinity, binds to an antigen or epitope of BCMA and binds little to other unrelated antigens or epitopes.
[0034] "CD137" as described herein is a member of the tumor necrosis factor (TNF) receptor family, also referred to as 4-1BB, CD137, tumor necrosis factor receptor superfamily member 9 (TNFRSF9), and is induced by lymphocyte activation (ILA). As described herein, the terms "CD137", "4-1BB", "4-1BB wt", "4-1BB wild type", "BB", "BB wt", and "BB wild type" are used synonymously throughout, e.g., when describing constructs or costimulatory molecules of the present application, unless otherwise specified.
[0035] The truncated CD137 intracellular domain as described herein is referred to synonymously throughout, e.g., when describing constructs or costimulatory molecules of the present application, as "truncated CD137", "CD137t", "truncated 4-1BB", "4-1BBt", "truncated BB", or "BBt", unless otherwise specified. In some embodiments, the mutant CD137 intracellular domain comprises a deletion of 1, 2, 3, or 4 lysine residues from amino acid position 1 to amino acid position 12 at the N-terminus of the CD137 intracellular domain of the present disclosure. In some embodiments, the mutant CD137 intracellular domain comprises one or more lysine mutations from amino acid position 1 to amino acid position 12 at the N-terminus of the CD137 intracellular domain of the present disclosure. In some embodiments, the mutant CD137 intracellular domain comprises one or more lysine mutations at amino acid positions selected from amino acid positions 1, 5, 6, and 12 at the N-terminus of the CD137 intracellular domain of the present disclosure. In some embodiments, the one or more lysine mutations are mutations from lysine to alanine. In some embodiments, the CD137 intracellular domain comprises the amino acid sequence set forth in SEQ ID NO: 3.
[0036] Unless otherwise indicated, the terms "co-stimulatory molecule", "costimulatory molecule", "co stimulatory molecule", "co-stimulatory protein", "costimulatory protein", "co stimulatory protein", "co-stimulatory receptor", "costimulatory receptor", "co stimulatory receptor", and "switch receptor" are used interchangeably and refer to a recombinant T cell co-stimulatory receptor (RTCR) that includes the novel chimeric co-stimulatory intracellular domain of the present application. These terms may be used in combination with terms such as "recombinant T cell", "recombinant", "chimeric T cell", and "chimeric" to refer to the RTCR of the present application.
[0037] As described herein, the "recombinant T cell co-stimulatory receptor" or "switch receptor" of the present disclosure is a "co-stimulatory molecule", "co-stimulatory receptor", or "co-stimulatory protein" generated by operably linking an extracellular domain to an intracellular chimeric intracellular protein of the present disclosure.
[0038] The terms T cell, T-cell, t cell, t-cell, and T lymphocyte may be used interchangeably in the present disclosure.
[0039] The terms "NPB5005-ICOSBBtZt", "BCMA-ICOSBBtZt", "NPB5005-BCMA-ICOSBBtZt", "Receptor 1", "receptor 1", "Construct 1", "construct 1", and "V283" are used interchangeably in the present disclosure and refer to an exemplary BCMA CAR of the present disclosure or a T cell expressing an exemplary BCMA CAR of the present disclosure.
[0040] The terms "subject" and "patient" refer to an organism to be treated with the methods and compositions described herein.
[0041] The term "about" or "approximately" may be understood to be within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the recited value. In some embodiments, "about" or "approximately" may be understood to be within 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the recited value. In some embodiments, "about" or "approximately" may be understood to be within 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the recited value. In some embodiments, "about" or "approximately" may be understood to be within 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the recited value.
[0042] Throughout the present disclosure, when a composition is described as having, comprising, or including a particular component, or when a process and method are described as having, comprising, or including a particular step, it is also contemplated that there are compositions of the present disclosure consisting essentially of, or consisting of, the recited components, as well as processes and methods according to the present disclosure consisting essentially of, or consisting of, the recited steps.
[0043] Extracellular domain Provided herein is a BCMA-CAR comprising an extracellular domain.
[0044] In some embodiments, the extracellular domain comprises a protein, peptide, glycoprotein, antibody or fragment thereof, such as an antigen-binding fragment, that binds to BCMA. In some embodiments, the antibody or fragment thereof is a Fab fragment, F(ab)2 fragment, diabody, nanobody, sdAb, Fv, V H H fragment, or single-chain Fv fragment. In some embodiments, the antibody or fragment thereof is a nanobody. In some embodiments, the nanobody comprises an amino acid sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 99% identity to the amino acid sequence of SEQ ID NO: 8. In some embodiments, the nanobody comprises the amino acid sequence of SEQ ID NO: 8.
[0045] In some embodiments, the extracellular domain is a B cell maturation antigen (BCMA)-binding protein. In some embodiments, the BCMA-binding protein is a BCMA-specific T cell receptor (TCR). In some embodiments, the BCMA-binding protein is a nanobody. In some embodiments, the BCMA-binding protein is a BCMA-specific chimeric antigen receptor (CAR).
[0046] In some embodiments, the extracellular domain comprises two or more binding sites for targeting two or more non-identical target antigens. In some embodiments, the extracellular domain comprises two or more binding sites for targeting two or more non-identical sites on a target antigen. In some embodiments, the extracellular domain comprises two antigen-binding regions or a fragment of a bispecific antibody. In some embodiments, the extracellular domain comprises an F(ab)2 fragment of a bispecific antibody. In some embodiments, the extracellular domain comprises two or more antigen-binding regions or a fragment of a multispecific antibody.
[0047] Signal peptide In some embodiments, the extracellular domain comprises a signal peptide, for example, at the N-terminus. In some embodiments, the signal peptide may be derived from a surface-expressed protein or a secreted protein. In some embodiments, the signal peptide may be derived from a prolactin precursor, an HIV envelope precursor (HIV pre-Env), an HCV polyprotein, a CB virus polyprotein, a pestivirus polyprotein, a calreticulin precursor, a VSV-G precursor, an HLA class I histocompatibility antigen, or a PD-1 signal peptide (PD-1 SP), interleukin 12 (IL12), GM-CSF, or a signal peptide of CD8α chain (CD8a).
[0048] In some embodiments, the signal peptide is derived from a CD8a signal peptide. In some embodiments, the CD8a signal peptide comprises an amino acid sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 99% identity to the amino acid sequence of SEQ ID NO: 6. In some embodiments, the CD8a signal peptide comprises the amino acid sequence of SEQ ID NO: 6.
[0049] Hinge In some embodiments, the extracellular domain comprises a hinge region. In some embodiments, the hinge region is derived from the hinge domain of CD8, PD-1, CD28, ICOS, or IgG. In some embodiments, the hinge region is derived from the hinge of CD8α chain (CD8a). In some embodiments, the CD8a hinge region comprises an amino acid sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 99% identity to the amino acid sequence of SEQ ID NO: 7. In some embodiments, the CD8a hinge region comprises the amino acid sequence of SEQ ID NO: 7.
[0050] Stalk In some embodiments, the extracellular domain includes a stalk region. In some embodiments, the stalk region is derived from CD8, PD-1, CD28, ICOS, or IgG. In some embodiments, the hinge region is derived from ICOS. In some embodiments, the ICOS stalk region includes an amino acid sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 99% identity to the amino acid sequence of SEQ ID NO: 9. In some embodiments, the ICOS stalk region includes the amino acid sequence of SEQ ID NO: 9.
[0051] In some embodiments, the extracellular domain further includes one or more of a signal peptide, a hinge, and an ICOS extracellular stalk, or a combination thereof. In some embodiments, the extracellular domain further includes one or more of a CD8a signal peptide, a CD8a hinge, and an ICOS extracellular stalk, or a combination thereof.
[0052] In some embodiments, the CD8a signal peptide includes the amino acid sequence set forth in SEQ ID NO: 6. In some embodiments, the CD8a hinge includes the amino acid sequence set forth in SEQ ID NO: 7. In some embodiments, the ICOS extracellular stalk includes the amino acid sequence set forth in SEQ ID NO: 9. In some embodiments, the extracellular domain further includes one or more of the CD8a signal peptide set forth in SEQ ID NO: 6, the CD8a hinge set forth in SEQ ID NO: 7, and the ICOS extracellular stalk set forth in SEQ ID NO: 9, or a combination thereof.
[0053] In some embodiments, the extracellular domain includes the amino acid sequence of SEQ ID NO: 1.
[0054] Transmembrane domain In some embodiments, the transmembrane domain of the BCMA-CAR disclosed herein is derived from the transmembrane domain of CD8, PD1, CD28, ICOS, or IgG. In some embodiments, the transmembrane domain is located between the extracellular domain and the first signaling domain. In some embodiments, the transmembrane domain is derived from the transmembrane domain of ICOS. In some embodiments, the ICOS transmembrane domain comprises an amino acid sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 99% identity to the amino acid sequence of SEQ ID NO: 10. In some embodiments, the ICOS transmembrane domain comprises the amino acid sequence of SEQ ID NO: 10.
[0055] Intracellular signaling domain ICOS domain In some embodiments, the BCMA-CAR of the present disclosure comprises a first signaling domain derived from the ICOS protein.
[0056] CD28 family proteins have a single extracellular immunoglobulin variable-like (IgV) domain followed by a short cytoplasmic tail. Members of the CD28 family proteins include CD28, CD28H, inducible costimulator (ICOS), cytotoxic T lymphocyte-associated antigen 4 (CTLA-4, CD152), programmed death-1 (PD-1), and B- and T-lymphocyte attenuator (BTLA). CD28, CD28H, and ICOS are expressed on T cells and are co-stimulatory proteins that, for example, promote T cell activation, high levels of cytokine / chemokine expression, apoptosis resistance, and T cell proliferation. In some embodiments, the first signaling domain based on the intracellular signaling domain of the CD28 family protein is the ICOS protein.
[0057] An "ICOS protein" as described herein is an inducible T cell co-stimulatory protein, also referred to as AILIM, CD278, CCLP, CRP-1, H4, Ly115, CVID1. In some embodiments, the ICOS intracellular domain can be derived from mammalian ICOS. In some embodiments, the mammalian ICOS can be human ICOS, mouse ICOS, rat ICOS, or monkey ICOS. In some embodiments, the ICOS intracellular domain may be derived from human ICOS or an isoform or variant thereof, and may include, for example, an amino acid sequence identical to any one of the human ICOS amino acid sequences described in the following GenBank accession numbers: AAH28006.1, NP_036224.1, AIC51287.1, AIC60036.1, NP_036224.1, Q9Y6W8.1, EAW70357.1, EAW70356.1, EAW70355.1, AAL40934.1, AAL40933.1, CAC06612.1, AAX93073.1, AAM00909.1, AAH28210.1, and CAD59742.1. In some embodiments, the ICOS intracellular domain may be derived from mouse ICOS or an isoform or variant thereof, and may include, for example, an amino acid sequence identical to any one of the mouse ICOS amino acid sequences described in the following GenBank accession numbers: NP_059508.2, Q9WVS0.2, EDL00161.1, CAM13242.1, CAM13241.1, CAB71153.1, AAG48732.1, AAH34852.1, XP_006496203.1, XP_006496202.1, XP_006496201.1, ACX50464.1, ACX50463.1, AAH28006.1, XP_021052880.1, XP_029334968.1, and XP_021030282.1.In some embodiments, the ICOS intracellular domain may be derived from rat ICOS, or an isoform or variant thereof, and may include, for example, an amino acid sequence identical to any one of the rat ICOS amino acid sequences described in the following GenBank accession numbers: NP_072132.1, Q9R1T7.1, XP_008765358.1, XP_006245100.1, XP_006245099.1, EDL98922.1, EDL98921.1, XP_038940099.1, XP_032755449.1, XP_017457364.1, XP_006256324.1, XP_006256323.1, XP_006256322.1, XP_029425757.1, XP_029425757.1, XP_021119236.1, XP_012929934.1, XP_012867370.1, and XP_012867363.1. In some embodiments, the ICOS intracellular domain may be derived from non-human primate ICOS, or an isoform or variant thereof, and may include, for example, an amino acid sequence identical to any one of the monkey ICOS amino acid sequences described in the following GenBank accession numbers: XP_007964137.1, NP_001253918.1, XP_010350939.1, XP_012301785.1, XP_012301784.1, XP_017739861.1, XP_010334714.1, XP_003925677.1, AFH29328.1, XP_008997520.1, XP_023075107.1, XP_023075099.1, XP_021779593.1, XP_003907887.1, XP_025260988.1, XP_025260987.1, XP_025260986.1, XP_011716287.1, XP_011716285.1, XP_005574075.1, XP_011903009.1, XP_011805288.1, XP_011805287.1, XP_011847867.1, XP_011847866.1, XP_017392362.1, XP_033086489.1, XP_032134414.1, XP_032134413.1, and XP_017802331.1.
[0058] In some embodiments, the chimeric intracellular domain comprises a first signaling domain derived from a protein of the CD28 family. In some embodiments, the first signaling domain is derived from any one of CD28, CD28H, ICOS, or a combination thereof.
[0059] In some embodiments, the first signaling domain derived from ICOS comprises the amino acid sequence set forth in SEQ ID NO: 2. In some embodiments, the first signaling domain derived from ICOS comprises an amino acid sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 99% identity to the amino acid sequence of SEQ ID NO: 2.
[0060] 4-1BB intracellular domain Examples of tumor necrosis factor receptor (TNFR) family proteins include TNFR1 (tumor necrosis factor receptor 1 / TNFRSF1A), TNFR2 (tumor necrosis factor receptor 2 / TNFRSF1B), lymphotoxin β receptor / TNFRSF3, OX40 / TNFRSF4, CD40 / TNFRSF5, Fas / TNFRSF6, decoy receptor 3 / TNFRSF6B, CD27 / TNFRSF7, CD30 / TNFRSF8, 4-1BB / TNFRSF9, DR4 (death receptor 4 / TNFRSF10A), DR5 (death receptor 5 / TNFRSF10B), decoy receptor 1 / TNFRSF10C, decoy receptor 2 / TNFRSF10D, RANK (nuclear factor-κB receptor activator / TNFRSF11A), OPG (osteoprotegerin / TNFRSF11B), DR3 (death receptor 3 / TNFRSF25), TWEAK receptor / TNFRSF12A, TACI / TNFRSF13B, BAFF-R (BAFF receptor / TNFRSF13C), HVEM (herpesvirus entry mediator / TNFRSF14), nerve growth factor receptor / TNFRSF16, BCMA (B-cell maturation antigen / TNFRSF17, GITR (glucocorticoid-induced TNF receptor / TNFRSF18), TAJ (toxicity and JNK inducer / TNFRSF19), RELT / TNFRSF19L, DR6 (death receptor 6 / TNFRSF21), TNFRSF22, TNFRSF23, ectodysplasin A2 isoform receptor / TNFRS27, and ectodysplasin 1-anhidrotic receptor. Interaction between tumor necrosis factor superfamily (TNFSF) ligands and TNF receptor superfamily (TNFRSF) receptors provides co-stimulatory signals that control the survival, proliferation, differentiation, and effector functions of immune cells. Depending on the specific intracellular signals induced by TNFRSF members, TNFRSF members can be classified into the following three groups: death domain (DD)-containing receptors, decoy receptors, and TNF receptor-associated factor (TRAF)-binding receptors. Some TNFRSFs, such as TNFR-1, Fas, DR3, DR4, DR5, and DR6, contain their own DDs and / or interact with other cytoplasmic DD-containing adapter molecules.Several other TNFRSF, such as TNFR-2, CD27, CD30, CD40, glucocorticoid-induced TNFR family-related gene (GITR), Fn1, lymphotoxin β receptor (LTβR), OX40, receptor activator of NF-κB (RANK), and XEDAR, do not have a DD and contain a motif that includes four to six amino acids called a TRAF interaction motif (TIM) that recruits TRAF proteins. TRAF proteins are adapter molecules that activate multiple downstream signaling pathways, such as NF-κB, Janus kinase (JNK), ERK, p38 MAPK, and PI3K, which aid in cell survival, proliferation, and cytokine production. In some embodiments, the second signaling domain is based on a variant of the intracellular signaling domain of a TNFR family protein and is CD137 (4-1BB).
[0061] In some embodiments, the CD137 intracellular domain can be derived from mammalian CD137. In some embodiments, the mammalian CD137 can be human CD137, mouse CD137, rat CD137, or non-human primate CD137. In some embodiments, the CD137 intracellular domain can be derived from human CD137, or an isoform or variant thereof, and can include, for example, an amino acid sequence identical to any one of the human CD137 amino acid sequences described in the following GenBank accession numbers: U03397, AAA62478, NP_001552, Q07011, AAH06196, and XP_006710681. In some embodiments, the CD137 intracellular domain can be derived from mouse CD137, or an isoform or variant thereof, and can include, for example, an amino acid sequence identical to any one of the mouse CD137 amino acid sequences described in the following GenBank accession numbers: NP_001070977.1, NP_001070976.1, NP_035742.1, NP_033430.1, P20334.1, XP_011248530.1, XP_011248530.1, ABI30213.1, BAE32724.1, and AAH28507.1. In some embodiments, the CD137 intracellular domain can be derived from rat CD137, or an isoform or variant thereof, and can include, for example, an amino acid sequence identical to any one of the rat CD137 amino acid sequences described in the following GenBank accession numbers: NP_852049.1, NP_001020944.1, BAD99404.1, XP_008762504.1, XP_006239534.1, EDL81196.1, AAH97483.1, EHB16663.1, EHB16663.1, KFO38282.1, XP_010618177.1, XP_029414155.1, XP_029414154.1, XP_021099219.1, and XP_012888584.1.In some embodiments, the CD137 intracellular domain may be derived from non-human primate CD137, or an isoform or variant thereof, and may include, for example, an amino acid sequence identical to any one of the non-human primate CD137 amino acid sequences described in the following GenBank accession numbers: ABY47575.1, ABI30212.1, ABY47577.1, ABY47576.1, and ABY47578.1.
[0062] In some embodiments, as described herein, the CD137 intracellular domain includes the amino acid sequence starting from the amino acid at position 214 to the last amino acid at the C-terminus of the amino acid sequence of the human CD137 protein as described herein.
[0063] In some embodiments, as described herein, the CD137 intracellular domain includes the amino acid sequence starting from the amino acid at position 215 to the last amino acid at the C-terminus of the amino acid sequence of the mouse CD137 protein as described herein.
[0064] In some embodiments, the mutant CD137 intracellular domain described herein comprises one or more mutations, where the mutations can be additions / insertions, deletions / truncations, or substitutions / exchanges of one or more amino acids within the amino acid sequence of the CD137 protein, and is derived from any one of the CD137 proteins as described herein. In some embodiments, the mutant CD137 intracellular domain described herein comprises one or more mutations, where the mutations can be additions / insertions, deletions / truncations, or substitutions / exchanges of one or more amino acids within the amino acid sequence of the CD137 intracellular domain, and is derived from any one of the CD137 intracellular domain sequences as described herein. In some embodiments, the mutant CD137 intracellular domain described herein is a CD137 intracellular domain as described herein that comprises deletions or substitutions of one or more amino acids within the amino acid sequence of the CD137 intracellular domain that can be targets for ubiquitination. In some embodiments, the mutant CD137 intracellular domain described herein is a CD137 intracellular domain as described herein that comprises deletions or substitutions of one or more lysine residues within the amino acid sequence of the CD137 protein that can be targets for ubiquitination. In some embodiments, the mutant CD137 intracellular domain described herein is a CD137 intracellular domain as described herein that comprises deletions or substitutions of 1, 2, 3, or 4 lysine residues within the amino acid sequence of the CD137 protein that can be targets for ubiquitination. In some embodiments, the lysine residues within the amino acid sequence of the CD137 intracellular domain that can potentially be deleted or substituted as described herein are the amino acids at positions 214, 218, 219, and / or 225 of the CD137 intracellular domain. In some embodiments, the mutant CD137 intracellular domain described herein is a CD137 protein as described herein that comprises a deletion or substitution of K214. In some embodiments, the mutant CD137 intracellular domain described herein is a CD137 protein as described herein that comprises a deletion or substitution of K218.In some embodiments, the variant CD137 intracellular domain described herein is a CD137 protein as described herein, including a deletion or substitution of K219. In some embodiments, the variant CD137 intracellular domain described herein is a CD137 protein as described herein, including a deletion or substitution of K225.
[0065] In some embodiments, the variant CD137 intracellular domain can be a truncated CD137 intracellular domain. A truncated CD137 intracellular domain as described herein can be any one of the CD137 proteins described herein, in which 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 50, 100, more than 200, or more amino acids are deleted from the N-terminus of the CD137 protein as described herein. A truncated CD137 intracellular domain as described herein can be any one of the CD137 intracellular domain sequences described herein, in which 1, 2, 3, 4, 5, 6, 7, 8, 9, more than 10, or more amino acids are deleted from the N-terminus of the CD137 intracellular domain as described herein. In some embodiments, the amino acids deleted from the N-terminus of the CD137 intracellular domain include one or more proximal polybasic amino acids of the CD137 intracellular domain.
[0066] In some embodiments, the variant CD137 intracellular domain can be a truncated CD137 intracellular domain. In some embodiments, the truncated CD137 intracellular domain comprises the amino acid sequence from amino acid 13 to amino acid 42 of the CD137 intracellular domain of the present disclosure. In some embodiments, the truncated CD137 intracellular domain comprises a deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more consecutive amino acids from the N-terminus of the CD137 intracellular domain of the present disclosure. In some embodiments, the truncated CD137 intracellular domain comprises a deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more amino acids from amino acid 1 to amino acid 12 at the N-terminus of the CD137 intracellular domain of the present disclosure. In some embodiments, the truncated CD137 intracellular domain comprises a deletion from amino acid 1 to amino acid 12 at the N-terminus of the CD137 intracellular domain of the present disclosure. In some embodiments, the CD137 intracellular domain comprises the amino acid sequence set forth in SEQ ID NO: 3.
[0067] In some embodiments, the mutant CD137 intracellular domain comprises a deletion of one or more proximal basic amino acids from amino acid position 1 to amino acid position 12 at the N-terminus of the CD137 intracellular domain of the present disclosure. In some embodiments, the mutant CD137 intracellular domain comprises a mutation of one or more proximal basic amino acids from amino acid position 1 to amino acid position 12 at the N-terminus of the CD137 intracellular domain of the present disclosure. In some embodiments, the mutant CD137 intracellular domain comprises a mutation of one or more proximal basic amino acids at amino acid positions selected from amino acid positions 1, 2, 3, 4, 5, and 6 at the N-terminus of the CD137 intracellular domain of the present disclosure. In some embodiments, the mutant CD137 intracellular domain comprising a mutation of one or more proximal basic amino acids of the present disclosure further comprises a lysine mutation at amino acid position 12 at the N-terminus of the CD137 intracellular domain of the present disclosure. In some embodiments, the lysine mutation is a mutation from lysine to alanine (e.g., K12A). In some embodiments, the CD137 intracellular domain comprises the amino acid sequence set forth in SEQ ID NO: 3. In some embodiments, the truncated CD137 intracellular domain comprises the amino acid sequence set forth in SEQ ID NO: 3. In some embodiments, the truncated CD137 intracellular domain comprises an amino acid sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 99% identity to SEQ ID NO: 3.
[0068] In some embodiments, the second signaling domain of the BCMA-CAR disclosed herein comprises a truncated CD137 intracellular domain comprising the amino acid sequence set forth in SEQ ID NO: 3. In some embodiments, the second signaling domain of the BCMA-CAR disclosed herein is a truncated CD137 intracellular domain comprising an amino acid sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 99% identity to SEQ ID NO: 3.
[0069] CD3ζ domain In some embodiments of the BCMA-CAR disclosed herein, the third signaling domain is derived from the CD3ζ domain.
[0070] In some embodiments, the third signaling domain of the BCMA-CAR disclosed herein is a truncated CD3ζ domain comprising the amino acid sequence set forth in SEQ ID NO: 4. In some embodiments, the third signaling domain of the BCMA-CAR disclosed herein, the third signaling domain of the BCMA-CAR disclosed herein comprises a truncated CD3ζ domain comprising an amino acid sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 99% identity to that set forth in SEQ ID NO: 4.
[0071] Ribosome skipping sequence In some embodiments, the BCMA-CAR of the present disclosure is multicistronic, i.e., it comprises two or more different polypeptides produced from a single mRNA transcript. The sequences may be made multicistronic by using various linkers, e.g., a polynucleotide sequence encoding a first molecule may be linked to a nucleotide sequence encoding a second molecule (e.g., 5' first gene: linker: second gene 3'). The linker may encode a 2A ribosome skipping element such as P2A. In some embodiments, the P2A linker comprises the amino acid sequence of SEQ ID NO: 16. In one embodiment, the P2A linker is encoded by a nucleotide sequence comprising SEQ ID NO: 18. Other 2A ribosome skipping elements include, but are not limited to, E2A, T2A, and F2A. Such 2A ribosome skipping elements make it possible to produce separate polypeptides encoded by the first and second genes produced during translation.
[0072] Exemplary BCMA-CAR The amino acid sequences of the exemplary BCMA-CAR of the present disclosure and each domain are shown in Table 1. [Table 1-1] [Table 1-2]
[0073] In some embodiments, the BCMA-CAR of the present disclosure is encoded by the following nucleotide sequence ("clinical vector format").
Table 2-1
Table 2-2
Table 2-3
Table 2-4
Table 2-5
Table 2-6
[0074] In some embodiments, provided herein is a BCMA-CAR comprising (a) an extracellular domain comprising the amino acid sequence of SEQ ID NO: 1; (b) a transmembrane domain; and (c) a chimeric intracellular domain comprising a first signaling domain, a second signaling domain, and at least a third signaling domain, wherein the first signaling domain comprises the ICOS intracellular domain set forth in SEQ ID NO: 2, the second signaling domain comprises the truncated CD137 (4-1BB) intracellular domain set forth in SEQ ID NO: 3, and at least the third signaling domain comprises the truncated CD3ζ domain set forth in SEQ ID NO: 4.
[0075] In some embodiments, the BCMA-CAR comprises (a) an extracellular domain comprising the amino acid sequence of SEQ ID NO: 1; (b) a transmembrane domain; and (c) a chimeric intracellular domain comprising a first signaling domain, a second signaling domain, and a third signaling domain, wherein the first signaling domain comprises the ICOS intracellular domain set forth in SEQ ID NO: 2, the second signaling domain comprises the truncated CD137 (4-1BB) intracellular domain set forth in SEQ ID NO: 3, and the third signaling domain comprises the truncated CD3ζ domain set forth in SEQ ID NO: 4.
[0076] In some embodiments, the BCMA-CAR comprises: (a) an extracellular domain comprising the amino acid sequence of SEQ ID NO: 1; (b) a transmembrane domain comprising the amino acid sequence of SEQ ID NO: 10; and (c) a chimeric intracellular domain comprising a first signaling domain, a second signaling domain, and at least a third signaling domain, wherein the first signaling domain comprises the ICOS intracellular domain described in SEQ ID NO: 2, the second signaling domain comprises the truncated CD137 (4-1BB) intracellular domain described in SEQ ID NO: 3, and at least the third signaling domain comprises the truncated CD3ζ domain described in SEQ ID NO: 4.
[0077] In some embodiments, the BCMA-CAR comprises: (a) an extracellular domain comprising the amino acid sequence of SEQ ID NO: 1; (b) a transmembrane domain comprising the amino acid sequence of SEQ ID NO: 10; and (c) a chimeric intracellular domain comprising a first signaling domain, a second signaling domain, and a third signaling domain, wherein the first signaling domain comprises the ICOS intracellular domain described in SEQ ID NO: 2, the second signaling domain comprises the truncated CD137 (4-1BB) intracellular domain described in SEQ ID NO: 3, and the third signaling domain comprises the truncated CD3ζ domain described in SEQ ID NO: 4.
[0078] In some embodiments, the BCMA-CAR comprises an extracellular domain comprising the amino acid sequence of SEQ ID NO: 1. In some embodiments, the BCMA-CAR comprises a transmembrane domain comprising the amino acid sequence of SEQ ID NO: 10. In some embodiments, the BCMA-CAR comprises a first signaling domain comprising the amino acid sequence of SEQ ID NO: 2, a second signaling domain comprising the amino acid sequence of SEQ ID NO: 3, and a third signaling domain comprising the amino acid sequence of SEQ ID NO: 4.
[0079] In some embodiments, the BCMA-CAR extracellular domain comprises a signal peptide domain comprising the amino acid sequence of SEQ ID NO: 6. In some embodiments, the extracellular domain comprises a hinge domain comprising the amino acid sequence of SEQ ID NO: 7. In some embodiments, the extracellular domain comprises a BCMA binding domain comprising the amino acid sequence of SEQ ID NO: 8. In some embodiments, the extracellular domain comprises an ICOS stalk comprising the amino acid sequence of SEQ ID NO: 9. In some embodiments, the BCMA-CAR extracellular domain comprises a signal peptide domain of the amino acid sequence of SEQ ID NO: 6. In some embodiments, the extracellular domain comprises a hinge domain of the amino acid sequence of SEQ ID NO: 7. In some embodiments, the extracellular domain comprises a BCMA binding domain of the amino acid sequence of SEQ ID NO: 8. In some embodiments, the extracellular domain comprises an ICOS stalk of the amino acid sequence of SEQ ID NO: 9. In some embodiments, the BCMA-CAR comprises an extracellular domain comprising the amino acid sequence of SEQ ID NO: 1. In some embodiments, the BCMA-CAR comprises the extracellular domain of SEQ ID NO: 1.
[0080] In some embodiments, the BCMA-CAR comprises the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the BCMA-CAR comprises an amino acid sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 99% identity to SEQ ID NO: 1.
[0081] In some embodiments, the BCMA-CAR comprises the amino acid sequence of SEQ ID NO:5. In some embodiments, the BCMA-CAR comprises an amino acid sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 99% identity to that set forth in SEQ ID NO:5. In some embodiments, the BCMA-CAR comprises an amino acid sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 99% identity to that set forth in SEQ ID NO:5, and the BCMA binding domain comprises the amino acid sequence of SEQ ID NO:8.
[0082] Therapeutic use Also provided herein are methods of using the BCMA-CARs of the disclosure. The treatment methods can be characterized by the disease or condition being treated, for example, can be characterized by the cancer being treated. The BCMA-CARs of the disclosure are suitable for use in cancer, for example, cancers that express BCMA.
[0083] In some embodiments, the cancer is a soft tissue sarcoma or a bone sarcoma (osteosarcoma). In some embodiments, the cancer is a vesicular rhabdomyosarcoma, vesicular soft tissue sarcoma, ameloblastoma, angiosarcoma, chondrosarcoma, chordoma, bright tissue sarcoma, dedifferentiated liposarcoma, hyperplastic small round cell tumor of connective tissue, fetal rhabdomyosarcoma, epitheloid fibrosarcoma, epitheloid hemangioendothelioma, epitheloid sarcoma; sensitive neuroblastoma (sensory neuroblastoma), Ewing's sarcoma, extra-renal rhabdomyosarcoma, extraosseous myxoid chondrosarcoma, extraosseous osteosarcoma, fibrosarcoma, giant cell tumor, perivascular cell tumor, infantile fibrosarcoma, inflammatory myofibroblastic tumor, Kaposi's sarcoma, bone smooth muscle sarcoma, liposarcoma, osteosarcoma, malignant fibrous histiocytoma (MFH), malignant fibrous histiocytoma (MFH), malignant mesenchymoma, malignant peripheral nerve sheath tumor, mesenchymal chondrosarcoma, myxoid liposarcoma, myxoinflammatory myofibroblastic sarcoma, multiple tumors with perivascular epitheloid cell differentiation, osteosarcoma, extraperiosteal osteosarcoma, tumors with perivascular epithelial cell differentiation, periosteum osteosarcoma, polymorphic liposarcoma, polymorphic rhabdomyosarcoma, PNET / extraosseous Ewing's tumor, rhabdomyosarcoma, small cell osteosarcoma, single fibroids, synovial sarcoma, or capillary dilated osteosarcoma.
[0084] In some embodiments, the cancer is a carcinoma selected from basal cell carcinoma, squamous cell carcinoma, renal cell carcinoma, ductal carcinoma in situ (DCIS), invasive ductal carcinoma, or adenocarcinoma. In some embodiments, the cancer is a carcinoma selected from adenosquamous carcinoma, undifferentiated carcinoma, large cell carcinoma, colorectal cancer, pancreatic cancer, nasopharyngeal cancer, or small cell carcinoma.
[0085] In some embodiments, the cancer is selected from anal cancer, appendiceal cancer; cholangiocarcinoma (i.e., bile duct cancer), breast cancer, bladder cancer, brain tumor, breast cancer, cervical cancer, colon cancer, colorectal cancer, colon polyp, cancer of unknown primary origin (CUP), esophageal cancer, eye cancer, fallopian tube cancer, kidney cancer, liver cancer, lung cancer, medulloblastoma, melanoma, oral cancer, ovarian cancer, prostate cancer, pancreatic cancer, stomach cancer, testicular cancer, laryngeal cancer, thyroid cancer, uterine cancer, vaginal cancer, or vulvar cancer.
[0086] In some embodiments, the breast cancer is invasive ductal carcinoma, non-invasive ductal carcinoma, invasive lobular carcinoma, or non-invasive lobular carcinoma. In some embodiments, the pancreatic cancer is adenocarcinoma or islet cell carcinoma. In some embodiments, the colorectal cancer is adenocarcinoma. In some embodiments, the colon polyp is associated with familial adenomatous polyposis. In some embodiments, the bladder cancer is transitional cell bladder cancer, squamous cell bladder cancer, or adenocarcinoma. In some embodiments, the lung cancer is non-small cell lung cancer. In some embodiments, the non-small cell lung cancer is adenocarcinoma, squamous cell lung cancer, or large cell lung cancer. In some embodiments, the non-small cell lung cancer is large cell lung cancer. In some embodiments, the lung cancer is small cell lung cancer. In some embodiments, the prostate cancer is adenocarcinoma or small cell carcinoma. In some embodiments, the ovarian cancer is epithelial ovarian cancer. In some embodiments, the cholangiocarcinoma is proximal cholangiocarcinoma or distal cholangiocarcinoma.
[0087] In some embodiments, the cancer is any one of hematological cancers selected from leukemia, myeloma, or lymphoma. In some embodiments, the cancer is leukemia, such as acute leukemia, acute lymphoblastic leukemia (ALL), acute lymphocytic leukemia, B-cell ALL, T-cell ALL, or FAB ALL, acute myeloid leukemia (AML), acute myelogenous leukemia, chronic myeloid leukemia (CML), chronic lymphocytic leukemia (CLL), hairy cell leukemia, acute promyelocytic leukemia (APL), mixed lineage leukemia (MLL), or myelodysplastic syndrome (MDS).
[0088] In some embodiments, the cancer is myeloma, such as multiple myeloma. In some embodiments, the cancer is multiple myeloma selected from hyperdiploid multiple myeloma (HMM), non-hyperdiploid or hypodiploid multiple myeloma. In some embodiments, the multiple myeloma is selected from light chain myeloma, non-secretory myeloma, solitary plasmacytoma, extramedullary plasmacytoma, monoclonal gammopathy of undetermined significance (MGUS), smoldering multiple myeloma (SMM), immunoglobulin D (IgD) myeloma, or immunoglobulin E (IgE) myeloma.
[0089] In some embodiments, the cancer is lymphoma, such as Hodgkin lymphoma or non-Hodgkin lymphoma. In some embodiments, the cancer is non-Hodgkin lymphoma. In some embodiments, the cancer is a non-Hodgkin lymphoma selected from small lymphocytic lymphoma (SLL), lymphoplasmacytic lymphoma, diffuse large B-cell lymphoma, follicle center cell lymphoma, Burkitt lymphoma, Burkitt-like lymphoma, mantle cell lymphoma, or marginal zone B-cell lymphoma. In some embodiments, the cancer is lymphoma, such as Hodgkin lymphoma. In some embodiments, the cancer is a Hodgkin lymphoma selected from nodular sclerosis classical Hodgkin lymphoma, lymphocyte-rich classical Hodgkin lymphoma, or lymphocyte-depleted classical Hodgkin lymphoma.
[0090] In some embodiments, the cancer is any one of acute leukemia, acute lymphoblastic leukemia (ALL), acute lymphocytic leukemia, B-cell ALL, T-cell ALL, or FAB ALL, acute myeloid leukemia (AML), acute myelogenous leukemia, chronic myelogenous leukemia (CML), chronic lymphocytic leukemia (CLL), hairy cell leukemia, myelodysplastic syndrome (MDS), Hodgkin lymphoma, Hodgkin disease, non-Hodgkin lymphoma, multiple myeloma, colorectal cancer, pancreatic cancer, hypopharyngeal cancer, malignant histiocytosis, paraneoplastic syndrome / hypercalcemia associated with malignancy, bladder cancer, breast cancer, colorectal cancer, endometrial cancer, head cancer, neck cancer, hereditary nonpolyposis cancer, liver cancer, lung cancer, non-small cell lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, renal cell carcinoma, testicular cancer, adenocarcinoma, sarcoma, malignant melanoma, and angioma.
[0091] In some embodiments, the extracellular domain of the B cell maturation antigen (BCMA) chimeric antigen receptor (BCMA-CAR) described herein binds to the target with a binding affinity of 1 fM to 100 μM. In some embodiments, the extracellular domain binds to the target with a binding affinity of 1 pM to 100 μM. In some embodiments, the extracellular domain binds to the target with a binding affinity of 1 pM to 10 pM. In some embodiments, the extracellular domain binds to the target with a binding affinity of 10 pM to 50 pM. In some embodiments, the extracellular domain binds to the target with a binding affinity of 10 pM to 100 pM. In some embodiments, the extracellular domain binds to the target with a binding affinity of 100 pM to 500 pM. In some embodiments, the extracellular domain binds to the target with a binding affinity of 500 pM to 1 nM. In some embodiments, the extracellular domain binds to the target with a binding affinity of 1 nM to 10 nM. In some embodiments, the extracellular domain binds to the target with a binding affinity of 10 nM to 100 nM. In some embodiments, the extracellular domain binds to the target with a binding affinity of 100 nM to 500 nM. In some embodiments, the extracellular domain binds to the target with a binding affinity of 500 nM to 1 μM. In some embodiments, the extracellular domain binds to the target with a binding affinity of 1 μM to 10 μM. In some embodiments, the extracellular domain binds to the target with a binding affinity of 1 μM to 5 μM. In some embodiments, the extracellular domain binds to the target with a binding affinity of 5 μM to 7.5 μM. In some embodiments, the extracellular domain binds to the target with a binding affinity of 7.5 μM to 10 μM.
[0092] In some embodiments, provided herein is a chimeric antigen receptor (CAR) specific for B cell maturation antigen (BCMA), comprising: (a) an extracellular domain having the amino acid sequence set forth in SEQ ID NO: 1; (b) a transmembrane domain; and (c) a chimeric intracellular domain comprising a first signaling domain, a second signaling domain, and at least a third signaling domain, wherein the first signaling domain comprises the intracellular domain of inducible costimulatory molecule (ICOS) set forth in SEQ ID NO: 2, the second signaling domain comprises the truncated intracellular domain of CD137 (4-1BB) set forth in SEQ ID NO: 3, and the at least third signaling domain comprises the truncated CD3ζ domain set forth in SEQ ID NO: 4. In some embodiments, the BCMA CAR comprises the amino acid sequence set forth in SEQ ID NO: 5.
[0093] In some embodiments, the disclosure also provides a nucleic acid encoding the BCMA CAR of the disclosure. The disclosure also provides a vector, such as an expression vector, comprising the nucleic acid of the disclosure. In some embodiments, the nucleic acid or vector comprises SEQ ID NO: 11. The disclosure also provides a cell, such as an isolated cell, comprising the nucleic acid or vector of the disclosure. In some embodiments, the cell comprises a nucleic acid or vector comprising SEQ ID NO: 11.
[0094] Expression on T cells In some embodiments, the BCMA CAR disclosed herein is for expression in T cells that co-express at least one of the endogenous costimulatory molecules CD28, CD2, OX-40, ICOS, CD28, CD3, CD4, CD8, CD40L, or combinations thereof.
[0095] In some embodiments, the BCMA-CAR disclosed herein is co-expressed with a T cell receptor (TCR) in T cells. In some embodiments, the TCR is an endogenous TCR. In some embodiments, the TCR is an artificial TCR. In some embodiments, the artificial TCR is an affinity-enhanced TCR. In some embodiments, when the BCMA-CAR is co-expressed with a TCR in T cells, it provides a second activation signal for inducing activation and proliferation of the T cells, and the first activation signal is provided by antigen binding of the TCR.
[0096] In some embodiments, the BCMA-CAR disclosed herein is expressed in T cells as a component of an artificial receptor for a target. In some embodiments, the artificial receptor is a chimeric antigen receptor (CAR), a receptor for a ligand or a component thereof, an antibody or a fragment thereof. In some embodiments, the BCMA-CAR disclosed herein is expressed as a component of a CAR. In some embodiments, the BCMA-CAR disclosed herein is expressed as a component of an antibody or an antigen-binding fragment thereof. In some embodiments, the antibody or an antigen-binding fragment thereof is a Fab fragment, an F(ab)2 fragment, a diabody, a nanobody, an sdAb, an Fv, a VH fragment, or a single-chain Fv fragment. In some embodiments, the BCMA-CAR is expressed as a component of an artificial receptor in T cells as disclosed herein, and induces activation and / or proliferation of the T cells when the artificial receptor binds to the target. H In some embodiments, the modified T cells disclosed herein co-express at least one of the endogenous co-stimulatory molecules CD28, CD2, OX-40, ICOS, CD28, CD3, CD4, CD8, CD40L, or a combination thereof.
[0097]
[0098] In some embodiments, the methods disclosed herein further comprise a modification of an endogenous sequence encoding a component of the major histocompatibility complex (MHC) class I (MHC-I), wherein the modification reduces or eliminates the level of expression or activity of the MHC-I. In some embodiments, the modification reduces or eliminates the expression or activity of β2-microglobulin.
[0099] The present disclosure also provides a composition comprising the BCMA-CAR disclosed herein. The present disclosure also provides a composition comprising a nucleic acid encoding the BCMA-CAR disclosed herein. The present disclosure also provides a composition comprising a vector comprising the nucleic acid disclosed herein. The present disclosure also provides a composition comprising a cell disclosed herein. The present disclosure also provides a composition comprising a T cell disclosed herein, such as a modified T cell.
[0100] The present disclosure also provides a composition comprising a cell population, wherein the population comprises a plurality of the cells comprising a nucleic acid encoding the BCMA-CAR disclosed herein or a vector comprising a nucleic acid encoding the BCMA-CAR disclosed herein. The present disclosure also provides a composition comprising a cell population, wherein the population comprises a plurality of modified T cells disclosed herein.
[0101] The present disclosure also provides a method for producing a plurality of modified T cells, comprising: a) preparing a plurality of primary T cells disclosed herein; b) preparing a composition comprising the BCMA-CAR disclosed herein, a nucleic acid encoding the BCMA-CAR disclosed herein, or a vector comprising the nucleic acid encoding the BCMA-CAR disclosed herein; and c) introducing the composition of (b) into the plurality of primary T cells of (a) to produce a plurality of modified T cells under conditions that stably express BCMA-CAR in the plurality of modified T cells. In some embodiments, the method for producing a plurality of modified T cells disclosed herein further comprises modifying an endogenous sequence encoding an endogenous T cell receptor (TCR), wherein the modification reduces or eliminates the level of expression or activity of the endogenous TCR. In some embodiments, the method for producing a plurality of modified T cells disclosed herein further comprises modifying an endogenous sequence, wherein the modification reduces or eliminates the level of expression or activity of major histocompatibility complex (MHC) class I (MHC-I).
[0102] In some embodiments, modification of the endogenous sequence encoding the T cell receptor (TCR) uses a system for modifying nucleic acids. In some embodiments, modification of the endogenous sequence to reduce or eliminate the level of expression or activity uses a system for modifying nucleic acids. In some embodiments, the system for modifying nucleic acids includes one or more of CRISPR / Cas proteins, transcription activator-like effector nucleases (TALENs), zinc finger nucleases (ZFNs), and endonucleases. In some embodiments, modification of the endogenous sequence is performed by repair by non-homologous end joining. In some embodiments, repair by non-homologous end joining is generated by zinc finger nucleases introduced into cells by physical means, viral vectors, or non-viral vectors, etc. In some embodiments, repair by non-homologous end joining is generated by TALE nucleases (i.e., TALENs) introduced into cells by physical means, viral vectors, or non-viral vectors. In some embodiments, modification of the endogenous sequence encoding the T cell receptor (TCR) reduces or eliminates the expression level of the α-chain of the TCR. In some embodiments, modification of the endogenous sequence encoding the T cell receptor (TCR) reduces or eliminates the expression level of the β-chain of the TCR. In some embodiments, modification of the endogenous sequence encoding the T cell receptor (TCR) reduces or eliminates the expression levels of both the α-chain and the β-chain of the TCR α-chain.
[0103] In some embodiments, it is a modification of the endogenous sequence that reduces or eliminates the level of expression or activity of the major histocompatibility complex (MHC) class I (MHC-I), and this modification of the endogenous sequence reduces or eliminates the level of expression or activity of the MHC-I. In some embodiments, the modification of the endogenous sequence reduces or eliminates the expression or activity of β2-microglobulin.
[0104] In some embodiments, the method of manufacturing a plurality of modified T cells disclosed herein comprises: d) maintaining or expanding the plurality of modified T cells in a suitable cell culture medium; and e) either i) cryopreserving the plurality of modified T cells in a suitable cryopreservation medium for cells; or ii) preparing the plurality of modified T cells for administration to a subject suffering from a disease or disorder.
[0105] Compositions comprising the cells or modified T cells of the present disclosure, intended for administration to a subject, and compositions comprising a plurality of modified T cells produced by the methods of the present disclosure may need to meet one or more "release criteria" indicating that the composition is safe and effective in formulation as a pharmaceutical and / or in administration to a subject. Release criteria may include the requirement that the composition of the present disclosure (e.g., the cells or modified T cells of the present disclosure) contains cells or modified T cells comprising the BCMA-CAR of the present disclosure on the cell surface at a specific ratio. The expansion process should continue until certain criteria are met (e.g., achieving a certain total number of the cells or modified T cells of the present disclosure, or a certain percentage of the total number of cells or modified T cells expressing the BCMA-CAR of the present disclosure).
[0106] Certain criteria may indicate the point at which the expansion process should end. For example, cells should be formulated, reactivated, or cryopreserved when they reach a cell size of 300 fL (otherwise, cells that exceed this threshold size may begin to die). Cryopreserving the cell population as soon as it reaches an average cell size of less than 300 fL may result in a better cell recovery rate after thawing and culturing, because the cells have not yet reached a fully quiescent state before cryopreservation (the fully quiescent state size is approximately 180 fL). Prior to expansion, the T cells of the present disclosure may have a cell size of approximately 180 fL, but on the third day of expansion, the cell size may increase more than fourfold (e.g., to approximately 900 fL). During the next 6 - 12 days of culture, the T cell population may slowly decrease in cell size and become fully quiescent at 180 fL.
[0107] The process for preparing a cell population for formulation may include, but is not limited to, a step of concentrating the cells of the cell population, a step of washing the cells, and / or a step of further selecting the cells via magnetic bead sorting against drug resistance or specific surface expression markers. The process for preparing a cell population for formulation may further include a selection step to ensure the safety and purity of the final product. For example, when patient-derived tumor cells are used to stimulate the modified T cells of the present disclosure, or when they are modified for the purpose of stimulating the modified T cells of the present disclosure being prepared for formulation, it is essential that the patient-derived tumor cells are not included in the final product.
[0108] In some embodiments, the cells disclosed herein, or the modified T cells disclosed herein, each express a BCMA-CAR comprising the mutant CD137 intracellular signaling domain disclosed herein on the cell surface at a level that is at least about 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, or 20-fold higher compared to the expression level of a costimulatory molecule comprising the wild-type CD137 intracellular domain.
[0109] In some embodiments, the cells disclosed herein further comprise a sequence encoding an artificial antigen receptor, a therapeutic polypeptide, an immune cell regulatory protein, or a combination thereof. In some embodiments, the artificial antigen receptor comprises a chimeric antigen receptor (CAR). In some embodiments, the artificial antigen receptor comprises a recombinant T cell receptor (rTCR). In some embodiments, the artificial antigen receptor comprises an affinity-enhanced TCR. In some embodiments, the artificial antigen receptor binds to a tumor-associated antigen (TAA), a pathogen-associated protein, or an antigen associated with a disease or disorder, and the disease or disorder is cancer, an autoimmune disease or disorder, an infectious disease, an inflammatory disease, a renal disease or disorder, a pulmonary disease or disorder, a hepatic disease or disorder, a neurodegenerative disease or disorder, or a metabolic disease or disorder.
[0110] In some embodiments, the artificial antigen receptor binds to a TAA associated with solid tumors or blood cancers. In some embodiments, the artificial antigen receptor is associated with leukemia, acute leukemia, acute lymphoblastic leukemia (ALL), acute lymphocytic leukemia, B-cell ALL, T-cell ALL, or FAB ALL, acute myeloid leukemia (AML), acute myelogenous leukemia, chronic myeloid leukemia (CML), chronic lymphocytic leukemia (CLL), hairy cell leukemia, myelodysplastic syndrome (MDS), lymphoma, Hodgkin's disease, malignant lymphoma, non-Hodgkin lymphoma, Burkitt lymphoma, multiple myeloma, Kaposi sarcoma, colorectal cancer, pancreatic cancer, nasopharyngeal cancer, malignant histiocytosis, paraneoplastic syndrome / hypercalcemia associated with malignancy, solid tumors, bladder cancer, breast cancer, colorectal cancer, endometrial cancer, head cancer, neck cancer, hereditary nonpolyposis cancer, Hodgkin lymphoma, liver cancer, lung cancer, non-small cell lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, renal cell carcinoma, testicular cancer, adenocarcinoma, sarcoma, malignant melanoma, and angioma, and binds to a TAA associated with any one of the cancers selected therefrom.
[0111] In some embodiments, the artificial antigen receptor is kallikrein 4, papillomavirus binding factor (PBF), preferentially expressed antigen of melanoma (PRAME), Wilms’ tumor-I (WTI), Hydroxysteroid Dehydrogenase Like I (HSDLI), mesothelin, cancer-testis antigen (NY-ESO-1), carcinoembryonic antigen (CEA), p53, human epidermal growth factor receptor 2 / neuro receptor tyrosine kinase (Her2 / Neu), carcinoma-associated epithelial cell adhesion molecule (EpCAM), ovarian and uterine carcinoma antigen (CA125), folate receptor a, sperm protein 17, tumor-associated differentially expressed gene-12 (TADG-12), mucin-16 (MUC-16), L1 cell adhesion molecule (L1CAM), mannan-MUC-1, Human endogenous retrovirus K (HERV-K-MEL), Kita-kyushu lung cancer antigen-I (KK-LC-1), human cancer / testis antigen (KM-HN-1), cancer-testis antigen (LAGE-1), melanoma antigen-A1 (MAGE-A1), sperm surface zona pellucida bindingprotein: Spl7), Synovial Sarcoma, X Breakpoint 4 (SSX-4), Transient axonal glycoprotein-1 (TAG-I), Transient axonal glycoprotein-2 (TAG-2), Enabled Homolog (ENAH), mammoglobin-A, NY-BR-I, breast cancer antigen, (BAGE-1), B melanoma antigen, melanoma antigen-Al (MAGE-Al), melanoma antigen-A2 (MAGE-A2), mucin k, synovial sarcoma, X breakpoint 2 (SSX-2), Taxol-resistance-associated gene-3 (TRAG-3), Avian Myelocytomatosis Viral Oncogene (c-myc), Cyclin B1, MUC1, p62, survivin, lymphocyte common antigen (CD45), DickkopfWNT Signaling Pathway Inhibitor I (DKKI), telomerase, Kirsten rat sarcoma viral oncogene homolog (K-ras), G250, intestinal carboxyl esterase, alpha-fetoprotein, Macrophage Colony-Stimulating Factor (M-CSF), Prostate-specific membrane antigen (PSMA), caspase 5 (caspase5: CASP-5), Cytochrome C Oxidase Assembly Factor I Homolog (COA-1), 0-linked β-N-acetylglucosamine transferase (OGT), Osteosarcoma Amplified 9, Endoplasmic Reticulum Lectin (OS-9), Transforming Growth Factor Beta Receptor 2 (TGF-betaRII), murine leukemia glycoprotein 70 (gp70), Calcitonin Related Polypeptide Alpha (CALCA), Programmed cell death 1 ligand 1 (CD274), Mouse Double Minute 2 Homolog (mdm-2), alpha-actinin-4, elongation factor 2, Malic Enzyme 1 (MEI), Nuclear Transcription Factor Y Subunit C (NFYC), G Antigen 1,3 (GAGE-1,3), melanoma antigen-A6 (MAGE-A6), cancer testis antigen XAGE-lb, six transmembrane epithelial antigen of the prostate 1 (STEAPl), PAP, prostate specific antigen (PSA), Fibroblast Growth Factor 5 (FGF5), heat shock protein hsp70-2, melanoma antigen-A9 (melanomaantigen-A9:MAGE-A9), arginine-specific ADP-ribosyltransferase family C (ARTCl), B-Raf Proto-Oncogene (B-RAF), serine / threonine kinase, β-catenin, Cell Division Cycle 27 homolog (Cdc27), Cyclin-dependent kinase 4 (CDK4), Cyclin-dependent kinase 12 (CDK12), Cyclin-dependent kinase inhibitor 2A (CDKN2A), Casein kinase 1α1 (CSNKlAl), Fibronectin 1 (FNl), Gruwih Anest Specific 7 (GAS7), Glycoprotein nonmetastatic melanoma protein B (GPNMB), HAUS Augmin Like Complex Subunit 3 (HAUS3), LDLR-fucosyltransferase, Melanoma Antigen Recognized By T cells 2 (MART2), Myostatin (MSTN), Melanoma Associated Antigen (Mutated) 1 (MUM-1-2-3), Poly(A) polymerase gamma (neo-PAP), myosin class I, Protein phosphatase 1 regulatory subunit 3B (PPP1R3B), Peroxiredoxin-5 (PRDX5), Receptor-type tyrosine-protein phosphatase kappa (PTPRK), Transforming protein N-RasN-Ras: N-ras), retinoblastoma-associated factor 600 (RBAF600), sirtuin-2 (SIRT2), SNRPD1, triosephosphate isomerase, Ocular Albinism Type 1 Protein (OAl), member RAS oncogene family (RAB38), Tyrosinase related protein 1-2 (TRP-1-2), Melanoma Antigen Gp75 (gp75), tyrosinase, Melan-A (MART-1), Glycoprotein 100 melanoma antigen (gplOO), N-acetylglucosaminyltransferase V gene (GnTVf), Lymphocyte Antigen 6 Complex Locus K (LY6K), melanoma antigen-AlO (MAGE-AlO), melanoma antigen-Al2 (MAGE-Al2), melanoma antigen-C2 (MAGE-C2), melanoma antigen NA88-A, Taxol-resistant-associated protein 3 (TRAG-3), BDZ binding kinase (pbk), caspase 8 (CASP-8), sarcoma antigen 1 (SAGE), Breakpoint Cluster Region-Abelson oncogene (BCR-ABL), fusion protein in leukemialeukemia), dek-can, Elongation Factor Tu GTP Binding Domain Containing 2 (EFTUD2), ETS Variant gene 6 / acute myeloid leukemia fusion protein (ETV6-AML1), FMS-like tyrosine kinase-3 internal tandem duplications (FLT3-ITD), cyclin-A1, Fibronectin Type III Domain Containing 3B (FDNC3B), promyelocytic leukemia / retinoic acid receptor alpha fusion protein (pml-RARalpha), melanoma antigen-C1 (MAGE-C1), membrane protein alternative spliced isoform (D393-CD20), melanoma antigen-A4 (MAGE-A4), and melanoma antigen-A3 (MAGE-A3). It binds to the TAA and is selected from ,
[0112] , .
[0112] In some embodiments, the artificial antigen receptor binds to an antigen associated with an autoimmune condition or disorder selected from any one of type 1 diabetes, rheumatoid arthritis (RA), systemic lupus erythematosis (SLE), or multiple sclerosis (MS). In some embodiments, the artificial antigen receptor binds to an antigen associated with an autoimmune condition or disorder selected from any one of carboxypeptidase H, chromogranin A, glutamate decarboxylase, Imogen-38, insulin, insulinoma antigen-2 and 2β, Islet-specific glucose-6-phosphatase catalytic subunit related protein (IGRP), proinsulin, α-enolase, aquaporin 4, β-arrestin, myelin basic protein, myelin oligodendrocyte glycoprotein, proteolipid protein, S100-β, citrullinated protein, collagen II, heat shock protein, human cartilage glycoprotein, double-stranded DNA, La antigen, Nucleosomal histones and ribonucleoproteins (snRNP), Phospholipid-β-2 glycoprotein I complex, poly ADP ribose polymerase, Sm antigens of U-1 small ribonucleoprotein complex.
[0113] In some embodiments, the artificial antigen receptor binds to a pathogen-associated antigen from a bacterial protein, a fungal protein, or a parasitic protein, or a fragment thereof. In some embodiments, the artificial antigen receptor binds to an antigen associated with HIV infection, human cytomegalovirus infection, hepatitis B infection, hepatitis C infection, Ebola virus infection, dengue fever, yellow fever, listeriosis, tuberculosis, cholera, malaria, leishmaniasis, or trypanosome infection, or a combination thereof.
[0114] In some embodiments, the artificial antigen receptor binds to an antigen associated with a neurodegenerative disorder or condition selected from dementia such as Alzheimer's disease (AD), Parkinson's disease (PD) and PD-related disorders, prion disease, motor neuron disease (MND), Huntington's disease (HD), spinocerebellar ataxia (SCA), or spinal muscular atrophy (SMA). In some embodiments, the antigen associated with a neurodegenerative disorder or condition is any one of amyloid-β (Aβ), tau, α-synuclein (α-syn), mHTT, or prion PrPsc, or a combination thereof.
[0115] In some embodiments, the therapeutic polypeptide is a cytokine, a cytokine receptor, a chemokine, a chemokine receptor, an immunogenic polypeptide, or a cell surface protein that binds to a target on the surface of another cell. In some embodiments, the immunocyte regulatory protein is a cytokine, a chemokine, a transcription factor, a protein kinase, a protease, a factor, or an adaptor protein of a cell signaling pathway.
[0116] In some embodiments, the cells disclosed herein express the BCMA-CAR disclosed herein. In some embodiments, the cells disclosed herein stably or transiently express the BCMA-CAR disclosed herein. In some embodiments, the cells disclosed herein stably express the BCMA-CAR disclosed herein. In some embodiments, the cells disclosed herein transiently express the BCMA-CAR disclosed herein.
[0117] In some embodiments, the cells disclosed herein co-express at least one of the endogenous costimulatory molecules CD28, CD2, OX-40, ICOS, CD28, CD3, CD4, CD8, CD40L, or a combination thereof.
[0118] The present disclosure also provides modified T lymphocytes (T cells) comprising: (a) a modification of an endogenous sequence encoding a T cell receptor (TCR), wherein the modification reduces or eliminates the level of expression or activity of the TCR; and / or (b) a recombinant T cell co-stimulatory receptor (RTCR) disclosed herein. In some embodiments, the modification of the endogenous sequence encoding a T cell receptor (TCR) is performed using a system for modifying nucleic acids. In some embodiments, the system for modifying nucleic acids is one or more of a CRISPR / Cas protein, a transcription activator-like effector nuclease (TALEN), a zinc finger nuclease (ZFN), and an endonuclease. In some embodiments, the modification of the endogenous sequence encoding a T cell receptor (TCR) is performed by repair by non-homologous end joining. In some embodiments, repair by non-homologous end joining is generated by a zinc finger nuclease introduced into the cell by physical means, a viral vector, or a non-viral vector. In some embodiments, repair by non-homologous end joining is generated by a TALE nuclease introduced into the cell by physical means, a viral vector, or a non-viral vector. In some embodiments, the modification of the endogenous sequence encoding a T cell receptor (TCR) reduces or eliminates the expression level of the α-chain of the TCR. In some embodiments, the modification of the endogenous sequence encoding a T cell receptor (TCR) reduces or eliminates the expression level of the β-chain of the TCR. In some embodiments, the modification of the endogenous sequence encoding a T cell receptor (TCR) reduces or eliminates the expression level of both the α-chain and the β-chain of the TCR.
[0119] Pharmaceutical composition or formulation In some embodiments, the compositions disclosed herein and modified T cell populations produced using the methods disclosed herein are in the form of a pharmaceutical formulation (or composition). In some embodiments, the pharmaceutical formulations disclosed herein comprise a pharmaceutically acceptable carrier. The pharmaceutical formulations of the present disclosure can be dispensed into bags for infusion, cryopreservation, and / or storage.
[0120] The pharmaceutical formulations of the present disclosure may be cryopreserved using standard protocols and, optionally, a non-fusible cryopreservation medium. For example, a DMSO-free cryopreservant (e.g., CryoSOfree™ DMSO-free Cryopreservation Medium) may be used to reduce toxicity associated with freezing. The cryopreserved pharmaceutical formulations of the present disclosure may be stored for later intravenous administration to patients. Effective treatment may require repeated administration of the pharmaceutical formulations of the present disclosure, and thus the pharmaceutical formulations may be packaged in pre-dispensed "single doses", which are cryopreserved and separated for thawing of individual single doses.
[0121] The pharmaceutical formulations of the present disclosure may be stored at room temperature. Effective treatment may require repeated administration of the pharmaceutical formulations of the present disclosure, and thus the pharmaceutical formulations may be packaged in pre-dispensed "single doses", which are stored together and separated for administration of individual single doses.
[0122] The pharmaceutical formulations of the present disclosure may be stored for later regrowth and / or selection, for example, in the case of allogenic therapies that may require administration at a future time point after remission and relapse of the condition, to generate additional doses for the same patient.
[0123] As mentioned above, according to the present disclosure, there are provided stable formulations that may include a phosphate buffer containing physiological saline or a selected salt and containing at least one modified cell in a pharmaceutically acceptable formulation, as well as a storage solution and a storage formulation containing a preservative, or a multi-purpose storage formulation suitable for pharmaceutical and / or veterinary use. The storage formulation contains at least one known preservative or, optionally, at least one phenol, m-cresol, p-cresol, o-cresol, chlorocresol, benzyl alcohol, phenylmercuric nitrite, phenoxyethanol, formaldehyde, chlorobutanol, magnesium chloride (e.g., hexahydrate), alkyl parabens (methyl, ethyl, propyl, butyl, etc.), benzalkonium chloride, benzethonium chloride, sodium dehydroacetate, and thimerosal, polymers, or mixtures thereof selected from the group consisting of. Any suitable concentration or mixture, such as about 0.0015%, or any range, value therein, or fraction therein, can be used as known in the art. By way of non-limiting example, without preservative, about 0.1 to 2% m-cresol (e.g., 0.2, 0.3, 0.4, 0.5, 0.9, 1.0%), about 0.1 to 3% benzyl alcohol (e.g., 0.5, 0.9, 1.1, 1.5, 1.9, 2.0, 2.5%), about 0.001 to 0.5% thimerosal (e.g., 0.005, 0.01), about 0.001 to 2.0% phenol (e.g., 0.05, 0.25, 0.28, 0.5, 0.9, 1.0%), 0.0005 to 1.0% alkyl parabens (e.g., 0.00075, 0.0009, 0.001, 0.002, 0.005, 0.0075, 0.009, 0.01, 0.02, 0.05, 0.075, 0.09, 0.1, 0.2, 0.3, 0.5, 0.75, 0.9, 1.0%) and the like can be mentioned.
[0124] As mentioned above, in some embodiments, the present disclosure includes a packaging material and, optionally, at least one vial containing a solution of at least one modified cell, a predetermined buffer, and / or a preservative in an aqueous diluent, and the packaging material includes a label indicating that such solution can be retained for a period of 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 9 hours, 12 hours, 18 hours, 20 hours, 24 hours, 30 hours, 36 hours, 40 hours, 48 hours, 54 hours, 60 hours, 66 hours, 72 hours or more. A manufactured article is provided.
[0125] The products of the present disclosure are useful for administration over a range of immediate to 24 hours or more. Thus, the claimed products provide a significant benefit to patients. The formulations of the present disclosure can be stably stored, optionally, at a temperature of about 2°C to about 40°C and can maintain the biological activity of the protein for an extended period of time, so that the packaging label can indicate that the solution can be retained and / or used for a period of 6 hours, 12 hours, 18 hours, 24 hours, 36 hours, 48 hours, 72 hours, or 96 hours, or more.
[0126] The products of the present disclosure may include a packaging material. The packaging material provides the conditions under which the product can be used, in addition to the information required by the regulatory authorities.
[0127] In another aspect, the present disclosure also provides a method of treating a disease or disorder, the method comprising administering to a subject in need of treatment of the disease or disorder, a number of nucleic acids encoding a CAR disclosed herein that is therapeutically effective, or a cell comprising a vector comprising a nucleic acid encoding a CAR disclosed herein, any one of a number of modified T cells disclosed herein that is therapeutically effective, any one of a number of compositions disclosed herein that is therapeutically effective, or a plurality of modified T cells produced by a method disclosed herein that is therapeutically effective. A BCMA-CAR as provided herein can be used in a method of treating a disease or disorder that expresses BCMA, such as cancer-expressing BCMA.
[0128] In some embodiments, the subject is a mammal. In some embodiments, the mammal is any one of a human, a primate, a rodent, a dog, a cat, an ungulate, a horse, and a pig. In some embodiments, the mammal is a human. In some embodiments, the mammal is a non-human primate. In some embodiments, the disease or disorder is any one of cancer, an autoimmune disorder, an infectious disease, an inflammatory disease or condition, a kidney disease or disorder, a lung disease or disorder, a liver disease or disorder, a cardiovascular disease or disorder, a neurodegenerative disorder or disorder, or a metabolic disorder or condition. In some embodiments, the cancer is a solid tumor or a hematologic cancer. In some embodiments, the infectious disease is caused by a bacterium, a virus, a fungus, a protozoan, or a parasite. In some embodiments, the neurodegenerative disorder or condition is any one of a dementia such as Alzheimer's disease (AD), Parkinson's disease (PD) and PD-related disorders, a prion disease, a motor neuron disease (MND), Huntington's disease (HD), spinocerebellar ataxia (SCA), or spinal muscular atrophy (SMA).
[0129] The following examples are provided to better illustrate the present disclosure and should not be construed as limiting the scope of the present disclosure. When specific materials are mentioned, they are for illustrative purposes only and are not intended to limit the present disclosure. Those skilled in the art can develop equivalent means or reactants without exerting inventive capabilities and without departing from the scope of the present disclosure.
Example
[0130] Example 1: Materials and Methods Media and Cell Lines Penicillin / streptomycin / glutamine, 20 mM HEPES, 10 μg / mL gentamicin, and 10% FBS were added to DMEM to prepare complete DMEM. Penicillin / streptomycin / glutamine, 20 mM HEPES, 10 μg / mL gentamicin, 10% FBS, and 50 μM 2-ME were added to RPMI to prepare complete RPMI. 50 ng / ml IL2, 10 ng / ml IL7, and 10 ng / mL IL15 (Peprotech) were added to complete RPMI to prepare a T cell growth medium. 1% human serum, 20 mM HEPES, penicillin / streptomycin / glutamine, and 10 μg / mL gentamicin were added to X-Vivo 15 (trademark) (Lonza (registered trademark)) to prepare a cytokine medium. Human peripheral blood mononuclear cells (PBMC) were purchased from iSpecimen (registered trademark) and cultured in complete RPMI. 293FT was purchased from Invitrogen (registered trademark). K562 cells and A375 cells were purchased from ATCC (registered trademark) and cultured in complete DMEM.
[0131] Plasmids and Cloning An lentiviral plasmid containing a PGK promoter-driven truncated human EGFR receptor (huEGFRt), then an MSCV promoter-driven GFP, and then a WPRE sequence was ordered from VectorBuilder. Those with a P2A sequence following the co-stimulatory molecule were ordered as a single gene block (Invitrogen) and placed in-frame with the huEGFRt sequence using homology-based recombination by NEB® builder (NEB®). The CAR sequence was constructed from gene block fragments (Invitrogen®) and cloned downstream of the MSCV promoter after GFP removal using NEB® builder. PD-L1_P2A and HLA-A2 were cloned in-frame with huEGFRt and in the place of GFP, respectively.
[0132] P2A amino acid sequence GSGATNFSLLKQAGDVEENPGP (SEQ ID NO: 16)
[0133] Human EGFRt amino acid sequence (alias: huEGFRt (AA112)) MLLLVTSLLLCELPHPAFLLIPRKVCNGIGIGEFKDSLSINATNIKHFKNCTSISGDLHILPVAFRGDSFTHTPPLDPQELDILKTVKEITGFLLIQAWPENRTDLHAFENLEIIRGRTKQHGQFSLAVVSLNITSLGLRSLKEISDGDVIISGNKNLCYANTINWKKLFGTSGQKTKIISNRGENSCKATGQVCHALCSPEGCWGPEPRDCVSCRNVSRGRECVDKCNLLEGEPREFVENSECIQCHPECLPQAMNITCTGRGPDNCIQCAHYIDGPHCVKTCPAGVMGENNTLVWKYADAGHVCHLCHPNCTYGCTGPGLEGCPTNGPKIPSIATGMVGALLLLLVVALGIGLFM (SEQ ID NO: 17)
[0134] P2A nucleic acid sequence GGATCCGGCGCCACCAATTTCAGCCTGCTGAAACAGGCTGGCGACGTGGAAGAGAACCCTGGACCT(SEQ ID NO: 18)
[0135] Human EGFRt nucleic acid sequence
[0136] HLA-A2 signal peptide nucleic acid sequence ATGGCTGTGATGGCCCCTAGAACACTGGTGCTGCTGCTGTCTGGTGCCCTGGCTCTGACTCAGACATGGGCC (SEQ ID NO: 20)
[0137] huGMCSF signal peptide, nucleic acid sequence ATGCTGCTGCTGGTTACATCTCTGCTGCTGTGCGAGCTGCCCCATCCTGCCTTTCTGCTGATCCCC (SEQ ID NO: 21)
[0138] Production of lentivirus and preparation of RetroNectin plates VSV pseudotyped lentivirus was produced in 6-well plates. Briefly, 293FT cells were seeded at 0.9x10 6 or 1.4x10 6Cells / wells were seeded on the eve or on the day of. Once the cells adhered and reached at least 80% confluence, a mixture of lentiviral plasmid, packaging vector (psPAX2), and VSV-G envelope expression plasmid (PMD2.G) was transfected using Lipofectamine 3000 (Invitrogen®) according to the manufacturer's protocol. After 18 hours, the medium was replaced with 3 mL of fresh DMEM. The viral supernatant was harvested 48 hours after the medium change and spun down at 1500 RPM to remove 293FT cells / debris. RetroNectin was coated on 24-well non-tissue culture treated plates at 20 μg / well in PBS- / - at 37 °C for 2 hours or at 4 °C overnight. After removing RetroNectin and washing once with PBS, lentiviral supernatant (2 mL) was added. The plate was spun at 1500 G at 32 °C for 90 minutes to concentrate the viral particles onto RetroNectin. The lentiviral supernatant was removed and immediately followed by transduction of primary T cells or tumor cells. Alternatively, T cells were transduced by spinfection at 800 G at 32 °C for 2 hours using 8 μg / mL of polybrene.
[0139] T Cell Culture, Transduction, and Isolation Human PBMCs were in T cell growth medium with CD3 / CD28 microbeads (Invitrogen®) in complete RPMI (100 μl beads / 50x10 6They were activated with PBMC. 48 hours after activation, the activated PBMC were transferred to RetroNectin plates coated with lentivirus, and 48 hours later, they were transferred to 6-well plates containing fresh T cell growth medium. After culturing for an additional 24 hours, the transduction efficiency was determined by flow cytometry, and the transduced cells were enriched based on huEGFRt expression. To isolate cells based on EGFR expression, the T cell cultures were collected and the activation beads were removed. Next, the cells were stained in 1:100 anti-EGFR-APC antibody / MACS buffer at 4°C for 30 minutes. Next, the cells were washed and incubated with Anti-APC MicroBeads (Miltenyi Biotec®) at 4°C for 15 - 30 minutes. Next, the unbound microbeads were removed by centrifugation, and the huEGFRT cells were isolated by positive selection on a mini-MACS column. The cells were eluted from the mini-MACS column and returned to culture in T cell growth medium and used in experiments within 2 weeks. To generate stable cell lines, the cells were collected and transduced in the same manner as primary T cells. EGFR selection was performed twice at 2-week intervals.
[0140] T cell stimulation When stimulating T cells with an antibody bound to a plate, Maxisorp (trademark) flat-bottom plates (Invitrogen (trademark)) were coated with the indicated amount of anti-human CD3 antibody (HIT3a - BioLegend (registered trademark)) in PBS- / - at 37 °C for 2 hours. The plates were washed twice with basic RPMI before use. In the stimulation of myeloma cell lines, RPMI18226 cell line and U266 cell line were collected, resuspended in cytokine medium, and dispensed into U-bottom plates. Similarly, A375 cells were seeded in 96-well flat-bottom plates in DMEM one day before adding T cells. After changing the medium, T cells of the same origin were added. After EGFR+ sorting, T cells were collected, counted, resuspended in cytokine medium at an appropriate concentration, and dispensed into antibody or APC-bearing wells. In the RPMI18226 experiment and U266 experiment, after 1 - 2 hours of RPMI18226 and U266 / T cell interaction at 37 °C, anti-CD3 (HIT3a / BioLegend (trademark)) was added at the indicated amount. When tracking T cell proliferation, T cells were labeled with a Violet tracking dye (CTV) according to the protocol of BioLegend (trademark), and then added to the stimulation plates. The supernatant was collected 18 - 36 hours after stimulation to evaluate cytokine secretion and proliferation, and the death of T cells was evaluated 96 hours after stimulation.
[0141] Cytokine multiplex assay After collecting the T cell supernatant, cytokines were measured using the Legendplex (trademark) Multi-Analyte Flow Assay Kit (BioLegend (trademark)) for human Th or Th1 cytokines. The following were excluded and the manufacturer's protocol was followed: 75 μL of T cell supernatant was used to measure cytokines, and 2 μL of each reagent was used per well. Secreted cytokines were measured by flow cytometry, and multiple experiments were combined and analyzed by normalizing each value to the maximum response of the control group to normalize the variation between experiments and donors.
[0142] Production of lentiviral vectors Produce a 10 mg GMP-compliant transfer plasmid. This transfer plasmid is used for virus production in adherent or suspension HEK293 cells in conjunction with a third-generation packaging system. Produce 20 - 30 liters of GMP lentiviral vector at a titer of 10 7 / ml and concentrate it to 10 9 / ml.
[0143] Mouse experiments Inject 3×10 6 MM.1S cells stably expressing Gaussia luciferase-GFP into NSG mice (8 - 10 weeks old) via intravenous (tail vein) injection. 18 - 20 days later, randomly assign the mice to groups with approximately equal mean luciferase counts and inject T cells at the indicated cell numbers into the tail vein. Starting from the time of tumor cell injection, collect blood samples once a week and determine the Gaussia luciferase levels in the serum using an in vitro luciferase assay. Briefly, add 5 μL of clarified plasma in duplicate to a 96-well plate. Mix the samples with the Gaussia substrate (coelenterazine, GoldBio #CZ25) according to the manufacturer's protocol and measure immediately. For in vivo imaging, perform imaging on the animals after IP administration of coelenterazine. Normalize the in vitro luciferase measurements to the measurements obtained on day 0 of T cell injection. The animal study was completed at the Institute of Human Virology at the University of Maryland.
[0144] Example 2: Construction of BCMA-CAR The present disclosure provides the design of a BCMA-CAR (modified third-generation BCMA-CAR) that includes a potent BCMA nanobody (Kd = 1 nM) driven by a third-generation ICOS co-stimulatory signaling domain and a modified 4-1BB co-stimulatory signaling domain, both of which are protected by patents herein, and a modified CD3ζ domain. Figure 1 shows a schematic diagram of the structure of an exemplary chimeric antigen receptor that includes a BCMA nanobody linked to a chimeric intracellular signaling domain as described herein.
[0145] Example 3: Target elimination of BCMA-positive multiple myeloma cell lines using modified third-generation BCMA-CAR-T cells results in decreased cytokine production Described herein are T cells expressing an exemplary BCMA-CAR of the present disclosure. The present disclosure provides herein the design of BCMA CAR molecules and the verification of their function against the killing of cancer cell lines by CAR T cells in vitro.
[0146] The BCMA-CAR (referred to as "receptor 1" or "NPB5005 BCMA-ICOSBBtZt" or "modified third-generation BCMA-CAR") as depicted in FIG. 1 was introduced into T cells via transduction. As shown in FIGS. 2A-2C, cleavage of the CD3ζ intracellular signaling domain in the BCMA-CAR of the present disclosure increases the surface expression of the CAR receptor and improves the increased surface expression achieved by using the modified third-generation CAR receptor (FIG. 2A shows a bar graph of the expression, and FIG. 2B shows the corresponding flow plot). FIG. 2C shows the MFI of BCMA, revealing that the surface expression of both the second-generation receptor and the third-generation receptor benefits from the cleavage of CD3ζ, and FIG. 2D shows the corresponding flow plot.
[0147] Next, cytokine production was evaluated. As shown in FIGS. 3A-3C, ζ-chain cleavage results in a decrease in the production of pro-inflammatory cytokines. All of the IL2 level (FIG. 3A), TNFα level (FIG. 3B), and IFNγ level (FIG. 3C) decreased, and the NPB5005-ICOSBBtZt CAR receptor was shown to produce less of the key inflammatory cytokines compared to constructs containing the full-length ζ intracellular signaling domain and reference constructs.
[0148] In an overnight killing assay, T cells expressing "receptor 1" were co-cultured with multiple myeloma cell lines expressing BCMA, RPMI-8226, and U266 to evaluate the efficacy of modified third-generation BCMA-CAR T cells against target tumor cell death compared to exemplary clinical BCMA CAR T cell therapies (bb2121, FHVH33, and LCARB38M) and GFP control known in the art. Target tumor cells included myeloma cell lines expressing BCMA. NPB5005 and control CAR T effector cells (E) were co-cultured with target cancer cells (T) at multiple ratios (E:T) from 1:01 to 1:32. The results disclosed herein show that at all tested ratios from 1:01 to 1:32, the modified third-generation BCMA-CAR T cells killed similar proportions of MM.1S, U266, and RPMI-8225 target cells compared to T cells expressing clinical control CAR (Figures 4A - 4C, respectively).
[0149] An exemplary "Receptor 1" or "NPB5005 BCMA-ICOSBBtZt" as described in FIG. 1 was compared with the reference second-generation CAR FHVH33, and the same CD8 leader peptide (SEQ ID NO: 6), BCMA-binding nanobody domain (SEQ ID NO: 8), and CD8 hinge (SEQ ID NO: 7) driven by various second-generation or third-generation signaling domains and the CD3ζ domain, including CARs (NPB5005-28Z (SEQ ID NO: 12), NPB5005-BBZ (SEQ ID NO: 13), NPB5005-ICOSBBZ (SEQ ID NO: 14), NPB5005-ICOSBBtZ (SEQ ID NO: 15)) in cytokine production (IL-2, IFNγ, and TNF). BCMA-CAR T cells were co-cultured with the BCMA-positive cell line, RPMI-8226, at various E:T ratios (1:32, 1:16, 1:08, 1:04, 1:02, 1:01, and 2:01). The amounts of IL-2, IFNγ, and TNFα released when T cells expressing "NPB5005-ICOSBBtZ" were co-cultured with target cells were less than the cytokine levels released by T cells expressing second-generation BCMA-CARs with the same or different BCMA-binding nanobodies (FIGS. 3A-3C). When comparing third-generation BCMA-CARs with the same extracellular domain (SEQ ID NO: 1), T cells expressing "NPB5005-ICOSBBtZ" produced similar or slightly more cytokines compared to the GFP control, but significantly less cytokines than T cells expressing the control CAR (FIGS. 3A-3C).
[0150] The results of the studies described herein indicate that the exemplary BCMA-CAR T cells of the present disclosure remove multiple BCMA-positive cancer cells with comparable efficacy compared to major clinical CAR T cells (FIGS. 4A-4C), while resulting in significantly less cytokine expression (see FIGS. 3A-3C), reducing toxicity and unwanted side effects in patients.
[0151] Example 4: BCMA-CAR eliminates BCMA-positive myeloma cell lines with excellent efficacy during long-term repeated co-culture In the in vitro studies described herein, increased proliferation and persistence of T cells were shown by T cells transduced with a modified third-generation BCMA-CAR (“Receptor 1” or “NPB5005-ICOSBBtZt”) compared to T cells with a control clinical CAR (based on an exemplary long-term repeated co-culture assay (Figure 5A), when co-cultured with the BCMA-expressing myeloma cell line, RPMI-8226. 100,000 CAR T cells were cultured with 500,000 RPMI-8266 cell targets. The cultures were stimulated every 4 days (days 4, 8, and 12) with 250,000 additional fresh RPMI-8226 target cells and cultured for a total of 16 days. Figures 5B and 5C show the number of T cells and target cells, respectively, at the end of each stimulation, indicating enhanced long-term functional cytolytic ability of the NPB5005-ICOSBBtZt CAR construct compared to the reference CAR.
[0152] As shown in Figures 6A-6C, NPB5005-ICOSBBtZt resulted in reduced PD-1 expression in antigen-stimulated CAR-Ts. Reduction of PD-1 expression on the T cell surface was observed in both the RPMI-8226 cell line (Figure 6B) and the U266 cell line (Figure 6C). Furthermore, as shown by the comparison of IL2 production in Figure 7A and by CAR-positive cells in Figure 7B, it was also recognized that third-generation co-stimulation is required for full functionality of the truncated CD3ζ-chain-based CAR receptor of the present disclosure.
[0153] The BCMA-CAR of the present disclosure was cloned into a clinical vector format without a eukaryotic selection marker. From this novel vector, the functionality of BCMA-CAR, including the phenotypes of proliferation and cell lysis (Figures 8A - 8D) and the decrease in cytokine production and PD1 expression (Figures 9A - 9B), was evaluated. Measurement of the tonic signaling specific to the intermediate CAR (Figures 10A - 10C) was also performed, and NPB5005-ICOSBBtZt showed a tonic signaling level intermediate between those of two reference CAR-T cells; cell survival in the absence of IL2 or the CAR ligand was comparable to that of LCAR-B38M (Figures 10A - 10B), but the persistent cytokine production was significantly decreased (Figure 10C).
[0154] Example 5: BCMA-CAR exhibits dose-dependent efficacy in an in vivo xenograft mouse model To evaluate the efficacy in vivo, 1×10 6 , 3×10 6 , and 5×10 6 of MM.1S cells were injected into mice via tail vein injection. In the in vivo imaging of tumor volume on days 4, 10, and 18 (Figure 11A), and the quantification of secreted Gaussia luciferase (Figure 11B), a significant decrease in tumor volume and a dose-dependent effect were shown at all doses tested. In the survival curves of female mice (Figure 11C) and male mice (Figure 11D), enhanced survival of the treated subjects was shown, and the mice administered with NPB5005-ICOSBBtZt showed a survival rate of approximately 100% over 90 days after administration.
[0155] In summary, the results described in this specification indicate that T cells expressing the modified third-generation BCMA-CAR of the present disclosure (e.g., NPB5005-ICOSBBtZt) can be used to treat cancer with high efficacy and significantly fewer adverse events. Specifically, expression of NPB5005-ICOSBBtZt increases effector function, proliferation, and persistence, while cytokine release is minimal. As described above, NPB5005-ICOSBBtZt kills multiple myeloma cell lines expressing BCMA with efficacy comparable to that of major BMCA-CAR T cell therapies, reduces the production of toxic cytokines, and lowers the expression level of surface PD-1. Thus, NPB5005-ICOSBBtZt is more resistant to negative signaling from cells within the tumor microenvironment. After repeated stimulation with target cells, NPB5005-ICOSBBtZt grows to a greater number than other BCMA-CAR T cells.
Claims
1. A chimeric antigen receptor (BCMA-CAR) that binds to B cell maturation antigen, comprising: (a) an extracellular domain comprising the amino acid sequence of SEQ ID NO: 8; (b) a transmembrane domain; and (c) a chimeric intracellular domain comprising a first signaling domain, a second signaling domain, and at least a third signaling domain, wherein the first signaling domain comprises the ICOS intracellular domain described in SEQ ID NO: 2, the second signaling domain comprises the truncated CD137 (4-1BB) intracellular domain described in SEQ ID NO: 3, and the at least third signaling domain comprises the truncated CD3ζ domain described in SEQ ID NO:
4. A chimeric antigen receptor.
2. The BCMA-CAR according to claim 1, wherein the extracellular domain further comprises a signal peptide, a hinge, an ICOS extracellular stalk, or a combination thereof.
3. The BCMA-CAR according to claim 1 or 2, wherein the extracellular domain further comprises a CD8a signal peptide, a CD8a hinge, an ICOS extracellular stalk, or a combination thereof.
4. The BCMA-CAR according to any one of claims 1 to 3, wherein the extracellular domain further comprises the CD8a signal peptide described in SEQ ID NO: 6, the CD8a hinge described in SEQ ID NO: 7, the ICOS extracellular stalk described in SEQ ID NO: 9, or a combination thereof.
5. The BCMA-CAR according to any one of claims 1 to 4, wherein the extracellular domain comprises the amino acid sequence of SEQ ID NO:
1.
6. The BCMA-CAR according to any one of claims 1 to 5, wherein the transmembrane domain comprises the amino acid sequence of SEQ ID NO:
10.
7. The BCMA-CAR according to claim 1, comprising the amino acid sequence of SEQ ID NO:
5.
8. A chimeric antigen receptor (BCMA-CAR) that binds to B cell maturation antigen, comprising: (a) an extracellular domain comprising the amino acid sequence of SEQ ID NO: 1; (b) a transmembrane domain comprising the amino acid sequence of SEQ ID NO: 10; and (c) a chimeric intracellular domain comprising a first signaling domain, a second signaling domain, and at least a third signaling domain, wherein The first signal transduction domain includes the intracellular domain of ICOS described in SEQ ID NO: 2, the second signal transduction domain includes the truncated CD137 (4-1BB) intracellular domain described in SEQ ID NO: 3, and the at least third signal transduction domain includes the truncated CD3ζ domain described in SEQ ID NO:
4. Chimeric antigen receptor. **Claim 9** A chimeric antigen receptor (BCMA-CAR) that binds to B cell maturation antigen and includes the amino acid sequence of SEQ ID NO:
5. **Claim 10** A nucleic acid encoding the BCMA-CAR according to any one of claims 1 to 9. **Claim 11** A vector containing the nucleic acid according to claim 10. **Claim 12** The vector according to claim 11, wherein the vector is a lentiviral vector. **Claim 13** A cell containing the nucleic acid according to claim 10 or the vector according to claim 11 or claim 12. **Claim 14** The cell according to claim 13, which is a modified T cell or a modified NK-T cell. **Claim 15** The cell according to claim 13, which is an allogeneic T cell. **Claim 16** The cell according to claim 13, which is an autologous T cell. **Claim 17** The cell according to claim 14, wherein the modified T cell is a naive T cell, an early memory T cell, a stem cell-like T cell, a stem memory T cell (TSCM), a central memory T cell (TCM), or a regulatory T cell (Treg). **Claim 18** The cell according to any one of claims 13 to 17, which transiently or stably expresses the BCMA-CAR according to any one of claims 1 to 7. **Claim 19** The cell according to any one of claims 13 to 18, which co-expresses the BCMA-CAR and at least one endogenous costimulatory molecule selected from CD28, CD2, OX-40, ICOS, CD28, CD3, CD4, CD8, CD40L, and combinations thereof. **Claim 20** (a) A modification of an endogenous sequence encoding a T cell receptor (TCR), wherein the modification reduces or eliminates the level of expression or activity of the TCR; and (b) The BCMA-CAR according to any one of claims 1 to 9, A modified T cell comprising. **Claim 21** The modified T cell according to claim 20, further comprising a modification of an endogenous sequence encoding a component of the major histocompatibility complex (MHC) class I (MHC-I), wherein the modification reduces or eliminates the level of expression or activity of the MHC-I. **Claim 22** The modified T cell according to claim 20 or 21, which co-expresses at least one endogenous costimulatory molecule selected from CD28, CD2, OX-40, ICOS, CD28, CD3, CD4, CD8, CD40L, and combinations thereof.
23. A composition comprising the BCMA-CAR according to any one of claims 1 to 9, the nucleic acid according to claim 10, the vector according to claim 11 or 12, the cell according to any one of claims 13 to 19, or the modified T cell according to any one of claims 20 to 22.
24. A method for producing a plurality of modified T cells, comprising: a) preparing a plurality of primary T cells; b) preparing a composition comprising the BCMA-CAR according to any one of claims 1 to 9, the nucleic acid according to claim 10, or the vector according to claim 11 or 12; and c) introducing the composition of (b) into the plurality of primary T cells of (a) to produce a plurality of modified T cells under conditions that stably express the BCMA-CAR in the plurality of modified T cells. The method comprising the above steps.
25. The method according to claim 24, further comprising a step of modifying an endogenous sequence encoding an endogenous T cell receptor (TCR), wherein the modification reduces or eliminates the level of expression or activity of the endogenous TCR.
26. The method according to claim 24 or 25, further comprising a step of modifying the endogenous sequence of the plurality of primary T cells, wherein the modification reduces or eliminates the level of expression or activity of major histocompatibility complex (MHC) class I (MHC-I).
27. d) maintaining or proliferating the plurality of modified T cells in a suitable cell culture medium; and e) any of the following: i) cryopreserving the plurality of modified T cells in a suitable cryopreservation medium for cells; or ii) preparing the plurality of modified T cells for administration to a subject in need thereof. The method according to any one of claims 24 to 26, further comprising the above steps.
28. A method of treating a disease or disorder, comprising administering to a subject in need of treatment for said disease or disorder a therapeutically effective number of the cells according to any one of claims 13 to 19, a therapeutically effective number of the modified T cells according to any one of claims 20 to 22, a therapeutically effective amount of the composition according to claim 21, or a therapeutically effective number of a plurality of modified T cells produced by the method according to any one of claims 24 to 27.
29. The method according to claim 28, wherein the disease or disorder is cancer, an autoimmune disease or disorder, or an inflammatory disease.
30. The method according to claim 29, wherein the cancer is a hematological cancer.
31. The method according to claim 30, wherein the hematological cancer is leukemia, lymphoma, or myeloma.
32. The method according to any one of claims 29 to 31, wherein the cancer is selected from acute leukemia, acute lymphoblastic leukemia (ALL), acute lymphocytic leukemia, B-cell ALL, T-cell ALL, or FAB ALL, acute myeloid leukemia (AML), acute myelogenous leukemia, chronic myeloid leukemia (CML), chronic lymphocytic leukemia (CLL), hairy cell leukemia, myelodysplastic syndrome (MDS), Hodgkin lymphoma, Hodgkin disease, non-Hodgkin lymphoma, and multiple myeloma.
33. The method according to any one of claims 29 to 31, wherein the cancer is multiple myeloma.
34. The method according to any one of claims 29 to 33, wherein the cancer expresses BCMA.
35. The method according to any one of claims 29 to 34, wherein the subject is a mammal.
36. The method according to claim 35, wherein the mammal is a human.