Compositions and methods for epigenetic regulation of CIITA expression

Abstract

The present disclosure relates to compositions and methods comprising epigenetic editors for epigenetic modification of CIITA, as well as nucleic acids and vectors encoding the same. Also disclosed are cells epigenetically modified by the epigenetic editors.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit under 35 U.S.C. § 119(e) of U.S. Provisional Patent Application No. 63 / 355,063, filed June 23, 2023, entitled "COMPOSITIONS AND METHODS FOR EPIGENETIC REGULATION OF CIITA EXPRESSION," the entire disclosure of which is incorporated herein by reference in its entirety.

[0002] Reference to Electronic Sequence Listing The contents of the electronic sequence listing (C169870010WO00-SEQ-AXW.xml; size: 2,284,448 bytes; and creation date: June 23, 2023) are incorporated herein by reference in their entirety. [Background technology]

[0003] Adoptive cell therapy using genetically engineered immune cells has emerged as a promising approach for treating cancer, infection, autoimmune diseases, and other disorders. However, traditional genetic engineering strategies typically rely on permanent manipulation of cells at the genome level, which is associated with certain risks, including, for example, chromosomal translocations, unwanted insertions and deletions of nucleotides at target sites, and off-target mutations. There remains a need for efficient and safe methods for genetically engineering immune cells. Summary of the Invention

[0004] The present disclosure provides systems and compositions for epigenetic modifications (herein "epigenetic editors" or "epigenetic editing systems") and methods of use thereof for generating epigenetic modifications in CIITA, including host cells and organisms.

[0005] In some aspects, the present disclosure provides a system for inhibiting transcription of the human CIITA gene in a human cell, optionally a human T lymphocyte or a human NK cell, comprising: a) collectively, optionally, the DNMT domain and / or recruiter domain comprises a DNMT3A domain and / or a DNMT3L domain, and optionally, the recruited DNMT is DNMT3A; and containing a transcriptional repressor domain, one or more fusion proteins, each of which is linked to a DNA-binding domain that binds to a target region in the human CIITA gene; or b) one or more nucleic acid molecules encoding said one or more fusion proteins The present invention provides a system including:

[0006] In some embodiments, the system comprises: a) a single fusion protein comprising the DNMT3A domain, the DNMT3L domain, the transcriptional repressor domain, and the DNA binding domain; or b) a nucleic acid molecule encoding said single fusion protein Includes.

[0007] In some embodiments, the DNA-binding domain comprises a dead CRISPR Cas (dCas) domain, a ZFP domain, or a TALE domain. For example, the DNA-binding domain may comprise a dCas9 domain, and the system may further comprise (i) one or more guide RNAs comprising any one of SEQ ID NOs: 1034-1312, or (ii) a nucleic acid molecule encoding the one or more guide RNAs.

[0008] In certain embodiments, the dCas domain comprises a dCas9 sequence, such as a sequence having at least 90% identity to SEQ ID NO: 12 or 13.

[0009] In some embodiments, the DNA binding domain binds to a target sequence in SEQ ID NO: 1313 or 1314.

[0010] In some embodiments, the DNA binding domain comprises a ZFP domain that targets a nucleotide sequence selected from SEQ ID NOs: 700-754.

[0011] In some embodiments, the DNMT3A domain comprises a sequence having at least 90% identity to SEQ ID NO: 574 or 575.

[0012] The DNMT3L domain can comprise, for example, a sequence having at least 90% identity to a sequence selected from SEQ ID NOs: 578-581. In some embodiments, the DNMT3L domain comprises a sequence having at least 90% identity to a sequence selected from SEQ ID NOs: 582-603. In some embodiments, the DNMT3L domain comprises a sequence having at least 90% identity to a sequence selected from SEQ ID NOs: 601-603.

[0013] In some embodiments, the transcriptional repressor domain comprises a sequence having at least 90% identity to a sequence selected from SEQ ID NOs: 33-570. In certain embodiments, the transcriptional repressor domain is a KRAB domain derived from KOX1, ZIM3, ZFP28, or ZN627. The KRAB domain can comprise, for example, a sequence having at least 90% identity to a sequence selected from SEQ ID NOs: 89, 116, 245, and 255. In some embodiments, the transcriptional repressor domain comprises a fusion of the N- and C-terminal regions of ZIM3 and KOX1 KRAB, optionally comprising the amino acid sequence of SEQ ID NO: 571 or 572. In certain embodiments, the transcriptional repressor domain is derived from KAP1, MECP2, HP1a / CBX5, HP1b, CBX8, CDYL2, TOX, TOX3, TOX4, EED, EZH2, RBBP4, RCOR1, or SCML2.

[0014] In some embodiments, the system comprises: a) comprising a DNMT3A domain, a DNMT3L domain, a transcriptional repressor domain, and a DNA binding domain; optionally, one or both of the DNMT3A domain and the DNMT3L domain are human; Optionally, the DNA binding domain is a dead CRISPR Cas domain or a ZFP domain. a fusion protein, or b) a nucleic acid molecule encoding said fusion protein Includes.

[0015] In certain embodiments, the fusion protein comprises, from N-terminus to C-terminus, a DNMT3A domain, a first peptide linker, a DNMT3L domain, a second peptide linker, a DNA-binding domain, a third peptide linker, and a transcriptional repressor domain. For example, the fusion protein may comprise, from N-terminus to C-terminus, a DNMT3A domain, a first peptide linker, a DNMT3L domain, a second peptide linker, a first nuclear localization signal (NLS), a DNA-binding domain, a second NLS, a third peptide linker, and a transcriptional repressor domain. The fusion protein may comprise, from N-terminus to C-terminus, a first NLS, a DNMT3A domain, a first peptide linker, a DNMT3L domain, a second peptide linker, a DNA-binding domain, a third peptide linker, a transcriptional repressor domain, and a second NLS. The fusion protein may comprise, from N-terminus to C-terminus, a first and second NLS, a DNMT3A domain, a first peptide linker, a DNMT3L domain, a second peptide linker, a DNA-binding domain, a third peptide linker, a transcriptional repressor domain, and a third and fourth NLS. In certain embodiments, the transcriptional repressor domain is a KRAB domain, e.g., a human KOX1, ZFP28, ZN627, or ZIM3 KRAB domain. In certain embodiments, one or both of the second and third peptide linkers is an XTEN linker, which may be selected from XTEN80 (e.g., SEQ ID NO: 643) and XTEN16 (e.g., SEQ ID NO: 638), e.g., the second peptide linker is XTEN80 and the third peptide linker is XTEN16.

[0016] In some embodiments, the fusion protein can comprise, from N- to C-terminus, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a first NLS, a dSpCas9 domain, a second NLS, an XTEN16 peptide linker, and a human KOX1 KRAB domain. In certain embodiments, the fusion protein comprises SEQ ID NO: 658, or a sequence at least 90% identical thereto.

[0017] In some embodiments, the fusion protein comprises, from N-terminus to C-terminus, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a first NLS, a ZFP domain, a second NLS, an XTEN16 linker, and a human KOX1 KRAB domain. In certain embodiments, the fusion protein comprises SEQ ID NO: 659, or a sequence at least 90% identical thereto.

[0018] In some embodiments, the fusion protein comprises, from N- to C-terminus, a first and second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a dSpCas9 domain, an XTEN16 peptide linker, a human KOX1 KRAB domain, and a third and fourth NLS. In certain embodiments, the fusion protein may comprise the amino acid sequence of SEQ ID NO: 660, or a sequence at least 90% identical thereto.

[0019] In some embodiments, the fusion protein comprises, from N-terminus to C-terminus, a first and second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a ZFP domain, an XTEN16 peptide linker, a human KOX1 KRAB domain, and a third and fourth NLS.

[0020] In some embodiments, the fusion protein comprises, from N- to C-terminus, a first and second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a dSpCas9 domain, an XTEN16 peptide linker, a human ZFP28 KRAB domain, and a third and fourth NLS. In certain embodiments, the fusion protein may comprise the amino acid sequence of SEQ ID NO: 661, or a sequence at least 90% identical thereto.

[0021] In some embodiments, the fusion protein comprises, from N-terminus to C-terminus, a first and second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a ZFP domain, an XTEN16 peptide linker, a human ZFP28 KRAB domain, and a third and fourth NLS.

[0022] In some embodiments, the fusion protein comprises, from N-terminus to C-terminus, a first and second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a dSpCas9 domain, an XTEN16 peptide linker, a human ZN627 KRAB domain, and a third and fourth NLS. In certain embodiments, the fusion protein may comprise the amino acid sequence of SEQ ID NO: 662, or a sequence at least 90% identical thereto.

[0023] In some embodiments, the fusion protein comprises, from N-terminus to C-terminus, a first and second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a ZFP domain, an XTEN16 peptide linker, a human ZN627 KRAB domain, and a third and fourth NLS.

[0024] In some embodiments, the fusion protein comprises, from N- to C-terminus, a first and second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a dSpCas9 domain, an XTEN16 peptide linker, a human ZIM3 KRAB domain, and a third and fourth NLS. In certain embodiments, the fusion protein may comprise the amino acid sequence of SEQ ID NO: 663, or a sequence at least 90% identical thereto.

[0025] In some embodiments, the fusion protein comprises, from N-terminus to C-terminus, a first and second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a ZFP domain, an XTEN16 peptide linker, a human ZIM3 KRAB domain, and a third and fourth NLS.

[0026] In some embodiments, at least one of the NLSs in the fusion proteins described herein is an SV40 NLS (eg, SEQ ID NO: 644).

[0027] In some embodiments, the system comprises: a) a first fusion protein comprising a first DNA-binding domain and comprising or recruiting a DNMT3A domain; a second fusion protein that includes a second DNA-binding domain and that includes or recruits a DNMT3L domain; and a third fusion protein that includes a third DNA-binding domain and that includes or recruits a transcriptional repressor domain; or b) one or more nucleic acid molecules encoding said multiple fusion proteins Includes.

[0028] The present disclosure also provides a human cell comprising the system described herein, or a progeny of the cell. In some embodiments, the cell is a T lymphocyte or an NK cell.

[0029] The present disclosure also provides human cells, or progeny of such cells, modified (optionally ex vivo) by the systems described herein. In some embodiments, the cells are T lymphocytes or NK cells.

[0030] The present disclosure also provides pharmaceutical compositions comprising the system described herein and a pharmaceutically acceptable excipient. In some embodiments, the composition comprises a lipid nanoparticle (LNP) comprising the system, and / or the DNA-binding domain is a dCas domain, and the LNP further comprises one or more gRNAs.

[0031] The present disclosure also provides a pharmaceutical composition comprising the human cells described herein and a pharmaceutically acceptable excipient.

[0032] The present disclosure also provides methods of treating a patient in need thereof, comprising administering (e.g., intravenously) to the patient a system, human cell, or pharmaceutical composition described herein. In some embodiments, the patient has cancer or an autoimmune disease.

[0033] The present disclosure also provides a system, human cell, or pharmaceutical composition described herein for use in treating a patient in need of treatment, e.g., in the methods described herein.

[0034] The present disclosure also provides for the use of the systems or human cells described herein in the manufacture of a medicament for treating a patient in need thereof, for example, in the methods described herein.

[0035] The present disclosure also provides articles of manufacture and kits that include the systems or human cells described herein.

[0036] Other features, objects, and advantages of the present invention will become apparent in the following detailed description. It should be understood, however, that the detailed description, while indicating embodiments and aspects of the invention, is given by way of example only, and not by way of limitation. Various changes and modifications within the scope of the invention will become apparent to those skilled in the art from the detailed description. [Brief explanation of the drawings]

[0037] [Figure 1A]Figures 1A-1D are scatter plots showing relative HLA-DR (MHC class II) expression at day 6 (Figures 1A and 1C) and day 20 (Figures 1B and 1D) in cells treated with the CRISPR-off epigenetic editing system (DNMT3A-3L-dCas9-KRAB+gRNA) versus cells not treated with gRNA. The distance from the gRNA target site to the CIITA transcription start site (TSS) is shown on the x-axis. An alternative TSS containing an annotation-rich CpG island (CGI) is also shown (approximately 2 kb downstream of the canonical TSS). [Figure 1B] Figures 1A-1D are scatter plots showing relative HLA-DR (MHC class II) expression at day 6 (Figures 1A and 1C) and day 20 (Figures 1B and 1D) in cells treated with the CRISPR-off epigenetic editing system (DNMT3A-3L-dCas9-KRAB+gRNA) versus cells not treated with gRNA. The distance from the gRNA target site to the CIITA transcription start site (TSS) is shown on the x-axis. An alternative TSS containing an annotation-rich CpG island (CGI) is also shown (approximately 2 kb downstream of the canonical TSS). [Figure 1C] Figures 1A-1D are scatter plots showing relative HLA-DR (MHC class II) expression at day 6 (Figures 1A and 1C) and day 20 (Figures 1B and 1D) in cells treated with the CRISPR-off epigenetic editing system (DNMT3A-3L-dCas9-KRAB+gRNA) versus cells not treated with gRNA. The distance from the gRNA target site to the CIITA transcription start site (TSS) is shown on the x-axis. An alternative TSS containing an annotation-rich CpG island (CGI) is also shown (approximately 2 kb downstream of the canonical TSS). [Figure 1D]Figures 1A-1D are scatter plots showing relative HLA-DR (MHC class II) expression at day 6 (Figures 1A and 1C) and day 20 (Figures 1B and 1D) in cells treated with the CRISPR-off epigenetic editing system (DNMT3A-3L-dCas9-KRAB+gRNA) versus cells not treated with gRNA. The distance from the gRNA target site to the CIITA transcription start site (TSS) is shown on the x-axis. An alternative TSS containing an annotation-rich CpG island (CGI) is also shown (approximately 2 kb downstream of the canonical TSS). [Figure 2-1] Figure 2 shows the silencing of CIITA observed for non-limiting guide RNAs at day 6 post-administration, broken down by donor. [Figure 2-2] This is a continuation of Figure 2. [Figure 3A] Figures 3A-3B show the results of a CIITA gRNA screen using a pair of gRNAs targeting CIITA ("dual" CIITA targeting). Results are shown over time. The left-hand panel is non-normalized; the right-hand panel is normalized. [Figure 3B] Figures 3A-3B show the results of a CIITA gRNA screen using a pair of gRNAs targeting CIITA ("dual" CIITA targeting). Results are shown over time. The left-hand panel is non-normalized; the right-hand panel is normalized. [Figure 4] Figure 4 shows the gating strategy for a dose-response experiment performed using a dual CIITA-targeting gRNA pair. [Figure 5] Figure 5 shows the results of dose-response experiments using specific gRNAs. [Figure 6] Figure 6 shows the results of dose-response experiments using specific gRNAs. [Figure 7] Figure 7 shows the results of dose-response experiments using specific gRNAs. [Figure 8] Figure 8 shows the results of dose-response experiments using specific gRNAs. [Figure 9]FIG. 9 shows the time course of screening zinc finger (ZF) domains targeting CIITA. [Figure 10] FIG. 10 shows silencing by ZF constructs binding at various distances from the CIITA TSS. [Figure 11A] Figures 11A-11B show the performance of epigenetic editors and guides in the two donors represented in frozen cells. [Figure 11B] Figures 11A-11B show the performance of epigenetic editors and guides in the two donors represented in frozen cells. [Figure 12] Figure 12 shows the silencing of CIITA using the depicted CRISPR-Off variants. Figure 12 shows the gating strategy used. [Figure 13] Figure 13 shows silencing of CIITA using the depicted CRISPR-Off variants. Figure 13 (not normalized) shows CIITA silencing over time. [Figure 14] Figure 14 shows silencing of CIITA using the depicted CRISPR-Off variants. Figure 14 (normalized) shows CIITA silencing over time. [Figure 15] Figure 15 shows silencing of CIITA using the depicted CRISPR-Off variants. Figure 15 shows the results of a transduction timing experiment. Figure 15 compares the results at day 6 for cells nucleofected on day 2 or day 3. [Figure 16] Figure 16 shows the results of a transduction timing experiment. Figure 16 shows the transduction efficiency. [Figure 17] Figure 17 shows the results of a transduction timing experiment. Figure 17 shows the results for CAR+ and CAR- cells. [Figure 18A]Figures 18A-18B show the results of an RNAseq experiment, including a CIITA mRNA / FACS comparison (Figure 18A) and a summary of differentially expressed genes (DEGs) (Figure 18B). Figure 18A shows the differential expression of CIITA and the presence of cell surface CIITA in cells treated with WTCas9, effector only, or effector + gRNA. Figure 18B shows the number of differentially expressed genes under the relevant conditions indicated in the legend. [Figure 18B] Figures 18A-18B show the results of an RNAseq experiment, including a CIITA mRNA / FACS comparison (Figure 18A) and a summary of differentially expressed genes (DEGs) (Figure 18B). Figure 18A shows the differential expression of CIITA and the presence of cell surface CIITA in cells treated with WTCas9, effector only, or effector + gRNA. Figure 18B shows the number of differentially expressed genes under the relevant conditions indicated in the legend. [Figure 19A] Figures 19A-19B show the exon-level difference in CIITA expression between WTCas9 and CRISPR-Off. The results show that CRISPR-Off reduces CIITA isoform / exon expression more robustly than WTCas9. [Figure 19B] Figures 19A-19B show the exon-level difference in CIITA expression between WTCas9 and CRISPR-Off. The results show that CRISPR-Off reduces CIITA isoform / exon expression more robustly than WTCas9. [Figure 20A] Figures 20A-20C show differential expression of genes in cells epigenetically edited with RNA_232_269 compared to effector-only controls (Figure 8B) or WTCas9 (Figure 8C). [Figure 20B] Figures 20A-20C show differential expression of genes in cells epigenetically edited with RNA_232_269 compared to effector-only controls (Figure 8B) or WTCas9 (Figure 8C). [Figure 20C]Figures 20A-20C show differential expression of genes in cells epigenetically edited with RNA_232_269 compared to effector-only controls (Figure 8B) or WTCas9 (Figure 8C). [Figure 21A] Figures 21A-21C show differential expression of genes in cells epigenetically edited with RNA_236_269 compared to effector-only controls (Figure 9B) or WTCas9 (Figure 9C). [Figure 21B] Figures 21A-21C show differential expression of genes in cells epigenetically edited with RNA_236_269 compared to effector-only controls (Figure 9B) or WTCas9 (Figure 9C). [Figure 21C] Figures 21A-21C show differential expression of genes in cells epigenetically edited with RNA_236_269 compared to effector-only controls (Figure 9B) or WTCas9 (Figure 9C). [Figure 22A] Figures 22A-22C show differential expression of genes in cells epigenetically edited with RNA_268_241 compared to effector-only controls (Figure 10B) or WTCas9 (Figure 10C). [Figure 22B] Figures 22A-22C show differential expression of genes in cells epigenetically edited with RNA_268_241 compared to effector-only controls (Figure 10B) or WTCas9 (Figure 10C). [Figure 22C] Figures 22A-22C show differential expression of genes in cells epigenetically edited with RNA_268_241 compared to effector-only controls (Figure 10B) or WTCas9 (Figure 10C). [Figure 23A] Figures 23A-23C show differential expression of genes in cells epigenetically edited with RNA_265_268 compared to effector-only controls (Figure 11B) or WTCas9 (Figure 11C). [Figure 23B]Figures 23A-23C show differential expression of genes in cells epigenetically edited with RNA_265_268 compared to effector-only controls (Figure 11B) or WTCas9 (Figure 11C). [Figure 23C] Figures 23A-23C show differential expression of genes in cells epigenetically edited with RNA_265_268 compared to effector-only controls (Figure 11B) or WTCas9 (Figure 11C). [Figure 24A] Figures 24A-24C show differential expression of genes in cells epigenetically edited with RNA_268_339 compared to effector-only controls (Figure 12B) or WTCas9 (Figure 12C). [Figure 24B] Figures 24A-24C show differential expression of genes in cells epigenetically edited with RNA_268_339 compared to effector-only controls (Figure 12B) or WTCas9 (Figure 12C). [Figure 24C] Figures 24A-24C show differential expression of genes in cells epigenetically edited with RNA_268_339 compared to effector-only controls (Figure 12B) or WTCas9 (Figure 12C). [Figure 25A] Figures 25A-25C show differential expression of genes in cells epigenetically edited with RNA_269_339 compared to effector-only controls (Figure 12B) or WTCas9 (Figure 12C). [Figure 25B] Figures 25A-25C show differential expression of genes in cells epigenetically edited with RNA_269_339 compared to effector-only controls (Figure 12B) or WTCas9 (Figure 12C). [Figure 25C] Figures 25A-25C show differential expression of genes in cells epigenetically edited with RNA_269_339 compared to effector-only controls (Figure 12B) or WTCas9 (Figure 12C). [Figure 26A]Figures 26A-26B show the interaction maps of down-regulated differentially expressed genes (relative to effector controls) and some DEGs shared between guide RNA pairs. Figure 26B shows the details of the CIITA pathway. [Figure 26B] Figures 26A-26B show the interaction maps of down-regulated differentially expressed genes (relative to effector controls) and some DEGs shared between guide RNA pairs. Figure 26B shows the details of the CIITA pathway. [Figure 27A] Figures 27A-27B show the performance of the ZF constructs (measured by % HLA-DR+), both normalized (Figure 27A) and normalized to off-targets (Figure 27B). [Figure 27B] Figures 27A-27B show the performance of the ZF constructs (measured by % HLA-DR+), both normalized (Figure 27A) and normalized to off-targets (Figure 27B). DETAILED DESCRIPTION OF THE INVENTION

[0038] The present disclosure provides epigenetic editors for suppressing expression of the human CIITA gene. By altering the expression of CIITA, the editors herein can be used to generate allogeneic cells (e.g., T cells, NK cells, etc.) with reduced alloreactivity. Unless otherwise noted, "CIITA" (italics) herein refers to the human CIITA gene. The human CIITA gene sequence can be found in Ensembl Accession No. ENSG00000179583.21. The epigenetic editors of the present invention have several advantages over other genome manipulation methods, including reversibility, reduced risk of chromosomal translocations, and permanent, heritable silencing.

[0039] In some embodiments, the region of the human CIITA gene targeted for epigenetic modulation is about 2 kb long, approximately + / - 1 kb from the CIITA transcription start site (TSS). In certain embodiments, the region has the nucleotide sequence of SEQ ID NO: 1314 (shown below). In some embodiments, the targeted CIITA region is about 1000 bps long, approximately + / - 500 bps from the CIITA TSS. In certain embodiments, the targeted region has the nucleotide sequence of SEQ ID NO: 1313 (shown below). TSS1 of CIITA is located at #chr16:10877202 of genome GRCh38:CM000678.2, and TSS2 (an alternative TSS) of CIITA is located at #chr16:10878968.

[0040] TCCAATGTCTTGGGATGAAAATGACAGGTGGGCCACTTATGATCTCCAGAGAAATTCAGG GCAATTTGGTGTGGGAGTAGGCATGGTAGAGGAGAGCAGCATCTAAGAAGTCCCCAGCAG AGGCTCTCAGCTTGTCTTGAGGCATCTGGGCGGAGGGCTATGATACTGGCCCCATCCTGC AGAAGGTGGCAGATATTGGCAGCTGGCACCAGTGCGGTTCCATTGTGATCATCATTTCTG AACGTCAGACTGTTGAAGGTTCCCCCAACAGACTTTCTGTGCAACTTTCTGTCTTCACCA AATTCAGTCCACAGTAAGGAAGTGAAATTAATTTCAGAGGTGTGGGGAGGGCTTAAGGGA GTGTGGTAAAATTAGAGGGTGTTCAGAAACAGAAATCTGACCGCTTGGGGCCACCTTGCA GGGAGAGTTTTTTTGATGATCCCTCACTTGTTTCTTTGCATGTTGGCTTAGCTTGGCGGG CTCCCAACTGGTGACTGGTTAGTGATGAGGCTAGTGATGAGGCTGTGTGCTTCTGAGCTG GGCATCCGAAGGCATCCTTGGGGAAGCTGAGGGCACGAGGAGGGGCTGCCAGACTCCGGG AGCTGCTGCCTGGCTGGGATTCCTACACAATGCGTTGCCTGGCTCCACGCCCTGCTGGGT CCTACCTGTCAGAGCCCCAAGGTAAAAAGGCCGGGAAAGCATCTTAATTTAGCGTGCAGT CTCAGCTGGTCCTGCCATTCCAGATAAACAGAGAAACCATTCTGAATTGGGGATGGGGGT GAGGATGGGAACAGGAGTCTGTGTCCTGCTGGGGCAGGCCATTGGAAGATGTGAAAGAGT TGTCTATTTCCTTCCACCGGAGGGAGACTTCAGGTCAGCCAGGTGTCTGGAGTATGAACC ATGTATCAGCACCGAAAGGTTCTAGAAGTCAGACTTTCGGGCAGTGTGTCACTAACTCTC AGCATGCTGGCCTGGCTCGGCCCACAGCAAGGTCTTCTCGC (SEQ ID NO: 1313)

[0041] ATAGGGTGTCACTATGTTGCCCAGGCTAGCCTCCAACTCCCGGCTTCAAGCAATCCTCCT GCTTCGGCCTCCCAAAATGTTGGAATTACAGGCACAAGCCACCTGGCCCAGCCATCTACT TTATATTCAAATAAAACTTTACGTCCCATTATAAAGGGAAAAAATGGCAAAAACAGGAGG TAACCATTTAACAAGAAAGCAGAGTGATGTTAGATTATAGCAAGATACTGTTGACTGTAG AAGGCTCTGAGGCTAGAGAGCTGCTTTCTATAAAACAGAGTGATCATATATTAGAAGAGG TGTTAAAGACATGTTCACACCAAGCTGAGACTTCCTCCTTGATACCACCAGGAGGATGGG CAGAGACTGGAAAAGACACTAACTTTCTCCCTATGGGAGTCAGTATTATTTAGCATCACT TTGGCGGGTCACCCCAAACCATCTGACTACAAGGGTACCATATTTGGGTTAACACTCTTT TGGTATAATTTATGTTTTAGTCCAATGTCTTGGGATGAAAATGACAGGTGGGCCACTTAT GATCTCCAGAGAAATTCAGGGCAATTTGGTGTGGGAGTAGGCATGGTAGAGGAGAGCAGC ATCTAAGAAGTCCCCAGCAGAGGCTCTCAGCTTGTCTTGAGGCATCTGGGCGGAGGGCTA TGATACTGGCCCCATCCTGCAGAAGGTGGCAGATATTGGCAGCTGGCACCAGTGCGGTTC CATTGTGATCATCATTTCTGAACGTCAGACTGTTGAAGGTTCCCCCAACAGACTTTCTGT GCAACTTTCTGTCTTCACCAAATTCAGTCCACAGTAAGGAAGTGAAATTAATTTCAGAGG TGTGGGGAGGGCTTAAGGGAGTGTGGTAAAATTAGAGGGTGTTCAGAAACAGAAATCTGA CCGCTTGGGGCCACCTTGCAGGGAGAGTTTTTTTGATGATCCCTCACTTGTTTCTTTGCA TGTTGGCTTAGCTTGGCGGGCTCCCAACTGGTGACTGGTTAGTGATGAGGCTAGTGATGA GGCTGTGTGCTTCTGAGCTGGGCATCCGAAGGCATCCTTGGGGAAGCTGAGGGCACGAGG AGGGGCTGCCAGACTCCGGGAGCTGCTGCCTGGCTGGGATTCCTACACAATGCGTTGCCT GGCTCCACGCCCTGCTGGGTCCTACCTGTCAGAGCCCCAAGGTAAAAAGGCCGGGAAAGC ATCTTAATTTAGCGTGCAGTCTCAGCTGGTCCTGCCATTCCAGATAAACAGAGAAACCAT TCTGAATTGGGGATGGGGGTGAGGATGGGAACAGGAGTCTGTGTCCTGCTGGGGCAGGCC ATTGGAAGATGTGAAAGAGTTGTCTATTTCCTTCCACCGGAGGGAGACTTCAGGTCAGCC AGGTGTCTGGAGTATGAACCATGTATCAGCACCGAAAGGTTCTAGAAGTCAGACTTTCGG GCAGTGTGTCACTAACTCTCAGCATGCTGGCCTGGCTCGGCCCACAGCAAGGTCTTCTCG CCTCCCTTTGGGTAAATACTGAGGGGTGCCTCTGCAGGACGGGACCTCTGCCAGACTCCA CTCCATACCCAGAGAAGCAGGGAAACCAAAATTGGAGTCAGCCTTGAGGTGTAGCTGTTG AGCCCTCAGCAGCTGGGGAGAGCTGGCGGATGCTGCCCTCCCCCCAGTTTCCTAATGGTG TTGTTTAAAAAGGGTCAGGGGACGGGGGAACAGATGGTGGGAAGAGCACAGTGCAGACAC CTGGCACCGGCTCTGAAGGCAGCATGGCAGCTACACCGTTGGCTGGGAAGGGTGTGCCCC TGAAGAAGTCGTTTACATTCTCGAGTCAATTTTCCTGGAGTGTACAATGGACCTGTGGGA AAGCCTGTATGAAAGGGTAATGATGAGGGACCTAGCACAGTGTCCAATATTTTATAGGAA CTGGAATTGAGCTCATAGGAGCTCAATTTTATTGGCATTGCTGTTGTTGGATGGTTAAAG GGGTGGTATCCCTTTTCTCAG (SEQ ID NO: 1314)

[0042] In some embodiments, the target site may be 10-50 bps (e.g., 10-40, 10-30, 10-20, 15-30, 15-25, or 15-20 bps) in length. In some embodiments, the target strand in the target region is the sense strand of the gene. In other embodiments, the target strand in the target region is the antisense strand of the gene.

[0043] In some embodiments, the epigenetic editors described herein may comprise one or more fusion proteins, each comprising a DNA-binding domain linked to one or more effector domains for epigenetic modification. In certain embodiments, the DNA-binding domain is a polynucleotide-guided DNA-binding domain, and the epigenetic editor may further comprise one or more guide polynucleotides. The DNA-binding domains, effector domains, and guide polynucleotides of the epigenetic editors described herein can be selected in any functional combination, for example, from those described below.

[0044] The epigenetic editors described herein can be transiently expressed in a host cell or integrated into the genome of the host cell; such cells and their progeny are also contemplated by the present disclosure. Both transiently expressed epigenetic editors or components thereof and integrated epigenetic editors or components thereof can result in stable epigenetic modifications. For example, after introducing an epigenetic editor described herein into a host cell, the target gene in the host cell may be stably or permanently suppressed or silenced. In some embodiments, the expression of the target gene is reduced or silenced for at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 7 weeks, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 1 year, at least 2 years, or for the entire lifespan of the cell or a subject carrying the cell, compared to the level of expression in the absence of the epigenetic editor. The epigenetic modification may be inherited by the progeny of the host cell into which the epigenetic editor was introduced.

[0045] The epigenetic editors of the invention can be introduced into cells (e.g., human T lymphocytes or human NK cells) and then introduced into a patient (e.g., a human patient) in need thereof.

[0046] I. DNA binding domain The epigenetic editors described herein may include one or more DNA-binding domains that direct the effector domain of the epigenetic editor to a target sequence within or near the CIITA locus. The DNA-binding domains described herein may be, for example, a polynucleotide-guided DNA-binding domain, a zinc finger protein (ZFP) domain, a transcription activator-like effector (TALE) domain, a meganuclease DNA-binding domain, or the like. Examples of DNA-binding domains can be found in U.S. Patent No. 11,162,114, which is incorporated herein by reference in its entirety.

[0047] In some embodiments, the DNA-binding domains described herein are encoded by their native coding sequences, while in other embodiments, the DNA-binding domains are encoded by nucleotide sequences that have been codon-optimized for optimal expression in human cells.

[0048] A. Polynucleotide-guided DNA-binding domain In some embodiments, the DNA-binding domain herein may be a protein domain that is directed to a target site in the CIITA locus by a guide nucleic acid sequence (e.g., a guide RNA sequence). In certain embodiments, the protein domain may be derived from a CRISPR-associated nuclease, such as a class I or II CRISPR-associated nuclease. In some embodiments, the protein domain may be derived from a Cas nuclease, such as a type II, type IIA, type IIB, type IIC, type V, or type VI Cas nuclease. In certain embodiments, the protein domain is selected from the group consisting of Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Cas14a, Cas14b, Cas14c, CasX, CasY, CasPhi, C2c4, C2c8, C2c9, C2c10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, C The Cas nuclease may be derived from a Class II Cas nuclease selected from sn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx1S, Csf1, Csf2, CsO, Csf4, and homologs and modified versions thereof. "Derived from" is used to mean that the protein domain comprises the full-length polypeptide sequence of the parent protein or a variant thereof (e.g., having deletions, insertions, and / or substitutions of amino acid residues). The variant retains the desired function of the parent protein (e.g., the ability to form a complex with a guide nucleic acid sequence and target DNA).

[0049] In some embodiments, the CRISPR-associated protein domain can be a Cas9 domain described herein. Cas9 can refer to, for example, a polypeptide having at least about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity and / or sequence similarity to a wild-type Cas9 polypeptide described herein. In some embodiments, the wild-type polypeptide is Cas9 from Streptococcus pyogenes (NCBI Reference No. NC_002737.2 (SEQ ID NO: 1)) and / or UniProt Reference No. Q99ZW2 (SEQ ID NO: 2). In some embodiments, the wild-type polypeptide is Cas9 from Staphylococcus aureus (SEQ ID NO: 3). In some embodiments, the CRISPR-associated protein domain is a Cpf1 domain or protein, or a polypeptide having at least about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity and / or sequence similarity to a wild-type Cpf1 polypeptide described herein (e.g., Cpf1 from Francisella novicida (UniProt Reference No. U2UMQ6 or SEQ ID NO: 4)). In certain embodiments, the CRISPR-associated protein domain can be a modified form, fusion, or chimera of the wild-type protein, or any combination thereof, that includes an alteration, e.g., deletion, insertion, or substitution, of one or more amino acid residues.

[0050] Cas9 sequences and structures of variant Cas9 orthologs have been described for a variety of organisms. Exemplary organisms from which the Cas9 domains herein may be derived include Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Listeria innocua, Lactobacillus gasseri, Francisella novicida, Wolinella succinogenes, Sutterella wadsworthensis, Gamma proteobacterium, Neisseria meningitidis, Campylobacter jejuni, Pasteurella multocida, and the like. multocida, Fibrobacter succinogenes, Rhodospirillum rubrum, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum sibiricum), Lactobacillus delbrueckii (Lactobacillusdelbrueckii, Lactobacillus salivarius, Lactobacillus buchneri, Treponema denticola, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp., Acetohalobium laveraticum arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionium, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus wassoniiwatsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp. Examples of suitable Cas9 sequences include, but are not limited to, Bacillus sp., Petrotoga mobilis, Thermosipho africanus, Streptococcus pasteurianus, Neisseria cinerea, Campylobacter lari, Parvibaculum lavamentivorans, Corynebacterium diphtheria, and Acaryochloris marina. Cas9 sequences also include those derived from the organisms and loci disclosed by Chylinski et al., RNA Biol. (2013) 10(5):726-37.

[0051] In some embodiments, the Cas9 domain is derived from Streptococcus pyogenes. In some embodiments, the Cas9 domain is derived from Staphylococcus aureus.

[0052] Other Cas domains are also contemplated for use in the epigenetic editors herein, including, for example, those derived from CasX (Cas12E) (e.g., SEQ ID NO: 5), CasY (Cas12d) (e.g., SEQ ID NO: 6), Casφ (CasPhi) (e.g., SEQ ID NO: 7), Cas12f1 (Cas14a) (e.g., SEQ ID NO: 8), Cas12f2 (Cas14b) (e.g., SEQ ID NO: 9), Cas12f3 (Cas14c) (e.g., SEQ ID NO: 10), and C2c8 (e.g., SEQ ID NO: 11).

[0053] With respect to epigenetic editing, a protein domain derived from a nuclease (e.g., a Cas9 or Cpfl domain) may or may not have reduced nuclease activity through mutation, such that the protein domain does not cleave DNA or has reduced DNA cleavage activity, while retaining the ability to form a complex with a guide nucleic acid sequence (e.g., a guide RNA) and target DNA. For example, the nuclease activity may be reduced by at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% compared to the wild-type domain. In some embodiments, the CRISPR-associated protein domains described herein are catalytically inactive ("dead"). Examples of such domains include dCas9 ("dead" Cas9), dCpf1, ddCpf1, dCasPhi, ddCas12a, dLbCpf1, and dFnCpf1. The dCas9 protein domain can contain one, two, or more mutations that abrogate its nuclease activity, for example, compared to wild-type Cas9. The DNA cleavage domain of Cas9 is known to contain two subdomains: the HNH nuclease subdomain and the RuvC1 subdomain. The HNH subdomain cleaves the strand complementary to the gRNA, while the RuvC1 subdomain cleaves the non-complementary strand. Mutations within these subdomains can silence the nuclease activity of Cas9. For example, the mutations D10A (in the case of RuvC1) and H840A (in the case of HNH) completely inactivate the nuclease activity of SpCas9. SaCas9 can also be inactivated by the mutations D10A and N580A. In some embodiments, dCas9 contains at least one mutation in the HNH subdomain and / or RuvC1 subdomain that reduces or abolishes nuclease activity. In some embodiments, dCas9 contains only the RuvC1 subdomain or only the HNH subdomain.It should be understood that any mutation that inactivates the RuvC1 and / or HNH domain, for example, an insertion, deletion, or single or multiple amino acid substitution in the RuvC1 domain and / or HNH domain, can be included in the dCas9 herein.

[0054] In some embodiments, the dCas9 protein herein comprises a mutation at a position corresponding to position D10 (e.g., D10A), position H840 (e.g., H840A), or both, of the wild-type SpCas9 sequence, as numbered in the sequence provided in UniProt Accession No. Q99ZW2 (SEQ ID NO: 2). In certain embodiments, the dCas9 comprises the amino acid sequence of dSpCas9 (D10A and H840A) (SEQ ID NO: 12).

[0055] In some embodiments, the dCas9 proteins described herein comprise mutations at positions corresponding to positions D10 (e.g., D10A), N580 (e.g., N580A), or both, of the wild-type SaCas9 sequence (e.g., SEQ ID NO: 3). In certain embodiments, the dCas9 comprises the amino acid sequence of dSaCas9 (D10A and N580A) (SEQ ID NO: 13).

[0056] Additional suitable mutations that inactivate Cas9 will be apparent to those of skill in the art based on this disclosure and knowledge in the art and are within the scope of this disclosure. Such mutations may include, but are not limited to, D839A, N863A, and / or K603R in SpCas9. The present disclosure contemplates any mutation that reduces or abolishes the nuclease activity of any Cas9 described herein (e.g., a mutation corresponding to any of the Cas9 mutations described herein).

[0057] The dCpf1 protein domain can contain one, two, or more mutations that reduce or abolish its nuclease activity compared to wild-type Cpf1. The Cpf1 protein has a RuvC-like endonuclease domain similar to the RuvC domain of Cas9, but does not have the HNH endonuclease domain, and the N-terminus of Cpf1 does not have the alpha-helical recognition lobe of Cas9. In some embodiments, dCpf1 contains one or more mutations corresponding to D917A, E1006A, or D1255A numbered in the sequence of the Francisella novicida Cpf1 protein (FnCpf1, SEQ ID NO: 4). In certain embodiments, the dCpfl protein comprises a mutation corresponding to positions D917A, E1006A, D1255A, D917A / E1006A, D917A / D1255A, E1006A / D1255A, or D917A / E1006A / D1255A, or a corresponding mutation in any of the Cpfl amino acid sequences described herein. In some embodiments, dCpfl comprises a D917A mutation. In certain embodiments, dCpfl comprises the amino acid sequence of dFnCpfl (SEQ ID NO: 14).

[0058] Additional nuclease-inactive CRISPR-associated protein domains contemplated herein include, for example, those derived from dNmeCas9 (e.g., SEQ ID NO: 15), dCjCas9 (e.g., SEQ ID NO: 16), dSt1Cas9 (e.g., SEQ ID NO: 17), dSt3Cas9 (e.g., SEQ ID NO: 18), dLbCpf1 (e.g., SEQ ID NO: 19), dAsCpf1 (e.g., SEQ ID NO: 20), denAsCpf1 (e.g., SEQ ID NO: 21), dHFAsCpf1 (e.g., SEQ ID NO: 22), dRVRAsCpf1 (e.g., SEQ ID NO: 23), dRRAsCpf1 (e.g., SEQ ID NO: 24), dCasX (e.g., SEQ ID NO: 25), and dCasPhi (e.g., SEQ ID NO: 26).

[0059] In some embodiments, the Cas9 domains described herein can be high-fidelity Cas9 domains that contain one or more mutations that reduce electrostatic interactions between the Cas9 domain and the sugar-phosphate backbone of DNA, e.g., to confer increased target binding specificity. In certain embodiments, the high-fidelity Cas9 domains can be nuclease-inactive, as described herein.

[0060] The CRISPR-associated protein domains described herein can recognize protospacer adjacent motif (PAM) sequences in target genes. A "PAM" sequence is typically a 2-6 bp DNA sequence immediately following the sequence targeted by the CRISPR-associated protein domain. The PAM sequence is required for CRISPR protein binding and cleavage, but is not part of the target sequence. CRISPR-associated protein domains can recognize either naturally occurring or canonical PAM sequences, or can have altered PAM specificity. CRISPR-associated protein domains that bind to non-canonical PAM sequences have been described in the art. For example, Cas9 domains that bind to non-canonical PAM sequences are described in Kleinstiver et al., Nature (2015) 523(7561):481-5 and Kleinstiver et al., Nat Biotechnol. (2015) 33:1293-8. Such Cas9 domains include those derived from, for example, "VRER" SpCas9, "EQR" SpCas9, "VQR" SpCas9, "SpG Cas9," "SpRYCas9," and "KKH" SaCas9. Nuclease-inactive versions of these Cas9 domains are also contemplated, such as nuclease-inactive VRER SpCas9 (e.g., SEQ ID NO: 27), nuclease-inactive EQR SpCas9 (e.g., SEQ ID NO: 28), nuclease-inactive VQR SpCas9 (e.g., SEQ ID NO: 29), nuclease-inactive SpG Cas9 (e.g., SEQ ID NO: 30), nuclease-inactive SpRY Cas9 (e.g., SEQ ID NO: 31), and nuclease-inactive KKH SaCas9 (e.g., SEQ ID NO: 32). Another example is Francisella novicida Cas9 engineered to recognize 5'-YG-3' (where "Y" is a pyrimidine).

[0061] Additional suitable CRISPR-associated proteins, orthologs, and variants, including nuclease-inactive variants and sequences, will be apparent to those of skill in the art based on this disclosure.

[0062] Guide RNAs that can be used with the CRISPR-associated protein domains herein are further described in Section II below.

[0063] B. Zinc finger protein domain In some embodiments, the DNA-binding domain of the epigenetic editors described herein comprises a zinc finger protein (ZFP) domain (or "ZF domain" as used herein). ZFPs are proteins with at least one zinc finger that bind to DNA in a sequence-specific manner. A "zinc finger" (ZF) or "zinc finger motif" (ZF motif) refers to a polypeptide domain containing a beta-beta-alpha (ββα) protein fold stabilized by zinc ions. A ZF binds two to four nucleotide base pairs, typically three or four base pairs (contiguous or non-contiguous). Each ZF typically contains approximately 30 amino acids. A ZFP domain can contain multiple ZFs that make tandem contacts with their target nucleic acid sequence. Tandem arrays of ZFs can be engineered to generate artificial ZFPs that bind to desired nucleic acid targets. ZFPs can be rationally designed using databases containing triplet (or quadruplet) nucleotide sequences and individual ZF amino acid sequences, where each triplet or quadruplet nucleotide sequence is associated with one or more amino acid sequences of a ZF that binds to a particular triplet or quadruplet sequence. See, e.g., U.S. Patent Nos. 6,453,242, 6,534,261, and 8,772,453.

[0064] ZFPs are widespread in eukaryotic cells and can belong to, for example, the C2H2 class, CCHC class, PHD class, or RING class. An exemplary motif that characterizes one class of these proteins (the C2H2 class) is -Cys-(X) 2-4 -Cys-(EAAAKX) 12 -His-(X) 3-5-His- (SEQ ID NO: 657), where X is any independently selected amino acid. In some embodiments, the ZFP domains herein can comprise a ZF array comprising consecutive C2H2-ZFs, each of which contacts three or more consecutive nucleotides.

[0065] The ZFP domains of the epigenetic editors described herein can comprise 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more ZFs. The ZFP domains can comprise an array of two-finger or three-finger units, e.g., 3, 4, 5, 6, 7, 8, 9, or 10 or more units, where each unit binds to a subsite in the target sequence. In some embodiments, a ZFP domain comprising at least three ZFs recognizes a target DNA sequence of 9 or 10 nucleotides. In some embodiments, a ZFP domain comprising at least four ZFs recognizes a target DNA sequence of 12-14 nucleotides. In some embodiments, a ZFP domain comprising at least six ZFs recognizes a target DNA sequence of 18-21 nucleotides.

[0066] In some embodiments, the ZFs in the ZFP domains described herein are connected via a peptide linker. The peptide linker can be 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more amino acids in length. In some embodiments, the linker comprises 5 or more amino acids. In some embodiments, the linker comprises 7 to 17 amino acids. The linker can be flexible or rigid.

[0067] In some embodiments, the zinc finger array comprises the sequence: SRPGERPFQCRICMRNFSXXXXXXXHXXTHTGEKPFQCRICMRNFSXXXXXXXHXXTH [linker] FQCRICMRNFSXXXXXXXHXXTHTGEKPFQCRICMRNFSXXXXXXXHXXTH [linker] PFQCRICMRNFSXXXXXXXHXXTHTGEKPFQCRICMRNFSXXXXXXXHXXTHLRGS (SEQ ID NO: 650) or a sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto, where "XXXXXXX" represents amino acids of the ZF recognition helix that confer DNA-binding specificity to the zinc finger, and each X may be independently selected. In the above sequences, the italicized "XX" can be TR, LR, or LK, and "[linker]" represents a linker sequence. In some embodiments, the linker sequence is TGSQKP (SEQ ID NO: 651), which can be used when the subsites targeted by the ZFs are adjacent. In some embodiments, the linker sequence is TGGGGSQKP (SEQ ID NO: 652), which can be used when there are bases between the subsites targeted by the zinc fingers. The two shown linkers can be the same or different. In some embodiments, the linker sequence is a minimum of five amino acids in length. In some embodiments, the linker sequence is up to 250 amino acids in length.

[0068] A ZFP domain herein can comprise an array of two or more adjacent ZFs that are directly adjacent to each other (e.g., separated by a short (canonical) linker sequence) or separated by a long flexible or structured polypeptide sequence. In some embodiments, directly adjacent fingers bind to contiguous nucleic acid sequences, i.e., adjacent trinucleotides / triplets. In some embodiments, adjacent fingers cross-link with each other between their respective target triplets, which can serve to strengthen or enhance target sequence recognition and result in binding of overlapping sequences. In some embodiments, distal ZFs within a ZFP domain can recognize (or bind to) non-contiguous nucleotide sequences.

[0069] Exemplary CIITA target genomic sequences are shown in Table 1 below.

[0070] [Table 1] TIFF2025525389000002.tif111161

[0071] In some embodiments, the ZFP domain of the epigenetic editor binds to a target sequence selected from any one of SEQ ID NOs: 700-754. The ZF can comprise the ZF framework sequence of SEQ ID NO: 650, or any other ZF framework known in the art.

[0072] C.TALE In some embodiments, the DNA-binding domain of the epigenetic editors described herein comprises a transcription activator-like effector (TALE) domain. TALE DNA-binding domains contain a highly conserved sequence of approximately 33-34 amino acids, with a repeat variable di-residue (RVD) at positions 12 and 13 that is central to the recognition of specific nucleotides. TALEs can be engineered to bind to virtually any desired DNA sequence. Methods for programming TALEs are known in the art. For example, such methods are described in Carroll et al., Genet Soc Amer. (2011) 188(4):773-82, Miller et al., Nat Biotechnol. (2007) 25(7):778-85, Christian et al., Genetics (2008) 186(2):757-61, Li et al., Nucl Acids Res. (2010) 39(1):359-72, and Moscou et al., Science (2009) 326(5959):1501.

[0073] D. Other DNA-binding domains Other DNA-binding domains are contemplated for the epigenetic editors described herein. In some embodiments, the DNA-binding domain comprises an Argonaute protein domain, such as that derived from Natronobacterium gregoryi (NgAgo). NgAgo is a 5'-phosphorylated ssDNA-guided endonuclease that is guided to its target site by gDNA, creating a double-strand break there. In contrast to Cas9, the NgAgo-gDNA system does not require a protospacer adjacent motif (PAM). Therefore, by using nuclease-inactive NgAgo (dNgAgo), the range of bases that can be targeted can be greatly expanded. The characterization and use of NgAgo is described, for example, in Gao et al., Nat Biotechnol. (2016) 34(7):768-73, Swarts et al., Nature (2014) 507(7491):258-61, and Swarts et al., Nucl Acids Res. (2015) 43(10):5120-9.

[0074] In some embodiments, the DNA-binding domain comprises an inactivated nuclease, e.g., an inactivated meganuclease. Additional non-limiting examples of DNA-binding domains include a tetracycline-controlled repressor (tetR) DNA-binding domain, a leucine zipper, a helix-loop-helix (HLH) domain, a helix-turn-helix domain, a β-sheet motif, a steroid receptor motif, a bZIP domain, a homeodomain, and an AT hook.

[0075] II. Guide Polynucleotide The epigenetic editors described herein that include a polynucleotide-guided DNA-binding domain can also include a guide polynucleotide that can form a complex with the DNA-binding domain. The guide polynucleotide can include RNA, DNA, or a mixture of both. For example, if the polynucleotide-guided DNA-binding domain is a CRISPR-associated protein domain, the guide polynucleotide can be a guide RNA (gRNA). "Guide RNA" or "gRNA" refers to a nucleic acid that can hybridize to a target sequence and guide the binding of a CRISPR-Cas complex to the target sequence. Methods for using guide polynucleotide sequences in conjunction with programmable DNA-binding proteins (e.g., CRISPR-associated protein domains) for site-specific DNA targeting (e.g., to modify a genome) are known in the art.

[0076] A guide polynucleotide sequence (e.g., a gRNA sequence) may comprise two portions: 1) a nucleotide sequence comprising a "targeting sequence" that is complementary to a target nucleic acid sequence ("target sequence"), e.g., a nucleic acid sequence contained in a genomic target site, and 2) a nucleotide sequence that binds to a polynucleotide-guided DNA-binding domain (e.g., a CRISPR-Cas protein domain). The nucleotide sequence of 1) may comprise a targeting sequence that is 100% complementary to a genomic nucleic acid sequence, e.g., a nucleic acid sequence contained in a genomic target site, and thus may hybridize to the target nucleic acid sequence. The nucleotide sequence of 1) may be referred to, for example, as a crispr RNA or crRNA. The nucleotide sequence of 2) may be referred to as a scaffold sequence of the guide nucleic acid, e.g., a tracrRNA, or an activation region of the guide nucleic acid, and may comprise a stem-loop structure. The above portions 1) and 2) may be fused to form one single guide (e.g., a single guide RNA or sgRNA) or may be on two separate nucleic acid molecules. In some embodiments, the guide polynucleotide comprises portions 1) and 2) connected by a linker. In some embodiments, the guide polynucleotide comprises portions 1) and 2) connected by a non-nucleic acid linker, e.g., a peptide linker or a chemical linker.

[0077] Portion 2 (the scaffold sequence) of the guide polynucleotide described herein can be, for example, that described in Jinek et al., Science (2012) 337:816-21, U.S. Patent Application Publication No. 2016 / 0208288, or U.S. Patent Application Publication No. 2016 / 0200779. Variants of portion 2) are also contemplated by the present disclosure. For example, the tetraloop and stem-loop of the gRNA scaffold (tracrRNA) sequence may be modified to include an RNA aptamer that can be bound by a specific protein domain. In some embodiments, such modified gRNAs can be used to promote the recruitment of repression or activation domains fused to RNA aptamers that interact with proteins.

[0078] The gRNAs provided herein typically comprise a targeting domain and a binding domain. The targeting domain (also referred to as a "targeting sequence") may comprise a nucleic acid sequence that binds to a target site, e.g., a genomic nucleic acid molecule within a cell. The target site may be a double-stranded DNA sequence comprising a PAM sequence and a target sequence located on the same strand as the PAM sequence and directly adjacent to it. The targeting domain of a gRNA may comprise an RNA sequence corresponding to the target sequence, i.e., it is similar to the sequence of the target domain and may have one or more mismatches, but typically comprises an RNA sequence instead of a DNA sequence. The targeting domain of a gRNA may therefore base-pair (with full or partial complementarity) with the sequence of the double-stranded target site that is complementary to the target sequence and, therefore, with the strand complementary to the strand containing the PAM sequence. It will be understood that the targeting domain of a gRNA typically does not comprise a sequence similar to the PAM sequence. It will further be understood that the location of the PAM may be 5' or 3' of the target sequence, depending on the nuclease utilized. For example, the PAM is typically located 3' of the target sequence for Cas9 nucleases and 5' of the target sequence for Cas12a nucleases. For examples of PAM locations and mechanisms by which gRNAs bind to target sites, see, e.g., Figure 1 in Vanegas et al., Fungal Biol Biotechnol. (2019) 6:6, which is incorporated herein by reference. For additional examples and explanations of mechanisms of gRNA targeting to RNA-guided nuclease target sites, see Fu et al., Nat Biotechnol (2014) 32(3):279-84 and Sternberg et al., Nature (2014) 507(7490):62-7, each of which is incorporated herein by reference.

[0079] In some embodiments, the targeting domain sequence comprises 17-30 nucleotides and corresponds perfectly to the target sequence (i.e., does not have any mismatched nucleotides). In some embodiments, however, the targeting domain sequence may contain one or more, typically four or fewer, mismatches, e.g., one, two, three, or four mismatches. Because the targeting domain is part of a gRNA, which is an RNA molecule, it will typically contain ribonucleotides, whereas a DNA-targeting domain will contain deoxyribonucleotides.

[0080] An exemplary illustration of a Cas9 target site comprising a 22-nucleotide targeting domain and an NGG PAM sequence, and a gRNA comprising a targeting domain that corresponds perfectly to the target sequence (and thus base-pairs with perfect complementarity to the DNA strand complementary to the strand containing the target sequence and PAM), is provided below. TIFF2025525389000003.tif43162

[0081] An exemplary illustration of a Casl2a target site containing a 22-nucleotide targeting domain and a TTN PAM sequence, as well as a gRNA containing a targeting domain that corresponds perfectly to the target sequence (and thus base-pairs with perfect complementarity to the DNA strand complementary to the strand containing the target sequence and PAM), is provided below. TIFF2025525389000004.tif43162

[0082] Without wishing to be bound by theory, it is believed that, at least in some embodiments, the length of the targeting domain and its complementarity with the target sequence contribute to the specificity of the interaction between the gRNA / Cas9 molecular complex and the target nucleic acid. In some embodiments, the targeting domain of a gRNA provided herein is 5-50 nucleotides in length. In some embodiments, the targeting domain is 15-25 nucleotides in length. In some embodiments, the targeting domain is 18-22 nucleotides in length. In some embodiments, the targeting domain is 19-21 nucleotides in length. In some embodiments, the targeting domain is 15 nucleotides in length. In some embodiments, the targeting domain is 16 nucleotides in length. In some embodiments, the targeting domain is 17 nucleotides in length. In some embodiments, the targeting domain is 18 nucleotides in length. In some embodiments, the targeting domain is 19 nucleotides in length. In some embodiments, the targeting domain is 20 nucleotides in length. In some embodiments, the targeting domain is 21 nucleotides in length. In some embodiments, the targeting domain is 22 nucleotides in length. In some embodiments, the targeting domain is 23 nucleotides in length. In some embodiments, the targeting domain is 24 nucleotides in length. In some embodiments, the targeting domain is 25 nucleotides in length. In certain embodiments, the targeting domain completely corresponds to a target sequence provided herein or a portion thereof without any mismatches. In some embodiments, the targeting domain of a gRNA provided herein contains one mismatch to a target sequence provided herein. In some embodiments, the targeting domain contains two mismatches to the target sequence. In some embodiments, the targeting domain contains three mismatches to the target sequence.

[0083] Methods for designing, selecting, and validating gRNA are described herein and are known in the art.Software tools can be used to optimize the gRNA corresponding to target DNA sequence, for example, to minimize the total off-target activity throughout the genome.For example, DNA sequence search algorithms can be used to identify the target sequence in the crRNA of the gRNA for use with Cas9.Exemplary gRNA design tools include those described in Bae et al., Bioinformatics (2014) 30:1473-5.

[0084] The guide polynucleotides (e.g., gRNAs) described herein can be of various lengths. In some embodiments, the length of the spacer or targeting sequence depends on the CRISPR-associated protein component of the epigenetic editor system used. For example, Cas proteins from different bacterial species have different optimal targeting sequence lengths. Thus, the spacer sequence can comprise, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more than 50 nucleotides in length. In some embodiments, the spacer comprises 10-24, 11-20, 11-16, 18-24, 19-21, or 20 nucleotides in length. In some embodiments, the guide polynucleotide (e.g., gRNA) comprises 15-100 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) nucleotides. A guide polynucleotide is a nucleotide sequence of at least 10 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) consecutive nucleotides complementary to the target sequence. In some embodiments, the guide polynucleotides described herein can be truncated by, for example, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 40, 50, or more nucleotides.

[0085] In certain embodiments, the 3' end of the CIITA target sequence is immediately adjacent to a PAM sequence (e.g., a canonical PAM sequence, e.g., NGG for SpCas9). The degree of complementarity between the targeting sequence of the guide polynucleotide (e.g., the spacer sequence of the gRNA) and the target sequence can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In certain embodiments, the targeting sequence and the target sequence can be 100% complementary. In other embodiments, the targeting sequence and the target sequence can contain, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches.

[0086] A guide polynucleotide (e.g., gRNA) may be modified, for example, by chemical and synthetic modifications. Modified gRNAs can include, for example, modification or replacement of one or both of the non-linked phosphate oxygens and / or one or more of the linking phosphate oxygens in the phosphodiester backbone linkage, modification of the ribose sugar (e.g., the 2' hydroxyl of the ribose sugar), modification of a phosphate moiety, modification or replacement of a naturally occurring nucleobase, modification or replacement of the ribose-phosphate backbone, modification of the 3' and / or 5' end of the oligonucleotide, replacement of a terminal phosphate group, or conjugation of a moiety, cap, or linker, or any combination thereof.

[0087] In some embodiments, one or more ribose groups of the gRNA may be modified. Examples of chemical modifications to the ribose group include, but are not limited to, 2'-O-methyl (2'-OMe), 2'-fluoro (2'-F), 2'-deoxy, 2'-O-(2-methoxyethyl) (2'-MOE), 2'-NH2, 2'-O-allyl, 2'-O-ethylamine, 2'-O-cyanoethyl, 2'-O-acetal ester, or bicyclic nucleotides, such as locked nucleic acids (LNA), 2'-(5-constrained ethyl (S-cEt)), constrained MOE, or 2'-O,4'-C-aminomethylene bridged nucleic acid (2',4'-BNANC). 2'-O-methyl and / or 2'-fluoro modifications may increase the binding affinity and / or nuclease stability of the gRNA oligonucleotide.

[0088] In some embodiments, one or more phosphate groups of a gRNA may be chemically modified. Examples of chemical modifications to phosphate groups include, but are not limited to, phosphorothioate (PS), phosphonoacetate (PACE), thiophosphonoacetate (thioPACE), amide, triazole, phosphonate, and phosphotriester modifications. In some embodiments, a guide polynucleotide described herein may contain one, two, three, or more PS linkages at or near the 5' and / or 3' ends, and the PS linkages may be contiguous or non-contiguous.

[0089] In some embodiments, the gRNAs herein comprise a mixture of ribonucleotides and deoxyribonucleotides and / or one or more PS linkages.

[0090] In some embodiments, one or more nucleobases of the gRNA may be chemically modified. Examples of chemically modified nucleobases include, but are not limited to, 2-thiouridine, 4-thiouridine, N6-methyladenosine, pseudouridine, 2,6-diaminopurine, inosine, thymidine, 5-methylcytosine, 5-substituted pyrimidines, isoguanine, isocytosine, and nucleobases with halogenated aromatic groups. Chemical modifications may be made to the spacer region, the tracr RNA region, the stem-loop, or any combination thereof.

[0091] The following Table 2 lists exemplary gRNA target sequences for epigenetic modification of human CIITA, as well as the coordinates of the start position of the targeted site on human chromosome 16 (SEQ: SEQ ID NO:). This table also shows the distance from the start coordinate to the TSS coordinate of the CIITA gene. Table 3 lists exemplary target sequences for gRNA.

[0092] [Table 2] TIFF2025525389000006.tif251161TIFF2025525389000007.tif251161TIFF2025525389000008.tif25116 1TIFF2025525389000009.tif251161TIFF2025525389000010.tif251161TIFF2025525389000011.tif77162

[0093] [Table 3] TIFF2025525389000013.tif250159TIFF2025525389000014.tif250159TIFF2025525389000015.tif250159 TIFF2025525389000016.tif250159TIFF2025525389000017.tif250159TIFF2025525389000018.tif138160

[0094] Any tracr sequence known in the art is contemplated for the gRNAs described herein. In some embodiments, the gRNAs described herein have a tracr sequence set forth in Table 4 below, or a tracr sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the tracr sequences set forth below (SEQ: SEQ ID NO:).

[0095] [Table 4]

[0096] In some embodiments, the gRNA herein is provided to a cell directly (e.g., through an RNP complex together with a CRISPR-associated protein domain). In some embodiments, the gRNA is provided to a cell through an expression vector (e.g., a plasmid vector or a viral vector) that is introduced into the cell, and the cell then expresses the gRNA from the expression vector. Methods for introducing gRNAs and expression vectors into cells are well known in the art.

[0097] III. Effector Domain The epigenetic editors described herein include one or more effector protein domains (also referred to herein as "epigenetic effector domains" or "effector domains") that effect epigenetic modifications of a target gene. Epigenetic editors with one or more effector domains can modulate the expression of a target gene without altering the nucleic acid sequence of the target gene. In some embodiments, the effector domains described herein can provide suppression or silencing of expression of a target gene, such as CIITA, by, for example, repressing transcription or modifying or remodeling chromatin. Such effector domains are also referred to herein as "repression domains," "repressor domains," or "epigenetic repressor domains." Non-limiting examples of chemical modifications that can be mediated by effector domains include methylation, demethylation, acetylation, deacetylation, phosphorylation, sumoylation, and / or ubiquitination of DNA or histone residues.

[0098] In some embodiments, the effector domain of an epigenetic editor described herein can effect histone tail modification, for example, by adding or removing an activity mark to the histone tail.

[0099] In some embodiments, the effector domain of an epigenetic editor described herein may comprise or recruit a transcription-associated protein, e.g., a transcription repressor. The transcription-associated protein may be endogenous or exogenous.

[0100] In some embodiments, the effector domain of an epigenetic editor described herein can include, for example, a protein that directly or indirectly blocks access of a transcription factor to a gene of interest having a target sequence.

[0101] The effector domain can be a full-length protein or a fragment thereof ("functional domain") that retains epigenetic effector function. Functional domains capable of modulating (e.g., suppressing) gene expression can be derived from larger proteins. For example, functional domains capable of reducing target gene expression can be identified based on the sequence of a repressor protein. The amino acid sequence of a protein that modulates gene expression can be obtained from available genome browsers, such as the UCSD genome browser or the Ensembl genome browser. Protein annotation databases, such as UniProt or Pfam, can be used to identify functional domains within a full-length protein sequence. As a starting point, the largest sequence encompassing all regions identified by different databases can be tested for gene expression modulation activity. Various truncated forms can then be tested to identify a minimal functional unit.

[0102] Variants of the effector domains described herein are also contemplated by the present disclosure. A variant refers to, for example, a polypeptide having at least about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity and / or sequence similarity to a wild-type effector domain described herein. In certain embodiments, a variant retains at least about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the epigenetic effector function of the wild-type effector domain.

[0103] In some embodiments, an effector domain described herein can comprise a fusion of two or more effector domains (e.g., KOX1 KRAB and ZIM3). An effector domain can comprise, for example, a fusion of 2, 3, 4, 5, 6, 7, 8, 9, or 10 effector domains, e.g., an effector domain described herein. In certain embodiments, an effector domain comprises a fusion of a truncated form of one effector domain and a second effector domain. In certain embodiments, an effector domain comprises a fusion of truncated forms of two effector domains (e.g., a fusion of the N-terminal and C-terminal portions of two effector domains).

[0104] In some embodiments, the epigenetic editors described herein can include one effector domain, two effector domains, three effector domains, four effector domains, five effector domains, six effector domains, seven effector domains, eight effector domains, nine effector domains, ten effector domains, or more. In certain embodiments, the epigenetic editors include one or more fusion proteins (e.g., one, two, or three fusion proteins), each having one or more effector domains (e.g., one, two, or three effector domains) linked to a DNA-binding domain. In some embodiments, the effector domains can induce a combination of epigenetic modifications, such as transcriptional repression and DNA methylation, DNA methylation and histone deacetylation, DNA methylation and histone demethylation, DNA methylation and histone methylation, DNA methylation and histone phosphorylation, DNA methylation and histone ubiquitination, or DNA methylation and histone sumoylation.

[0105] In certain embodiments, the effector domains described herein (e.g., DNMT3A and / or DNMT3L) are encoded by the nucleotide sequence found in the native genome (e.g., human or mouse) for that effector domain. In other embodiments, the effector domains described herein are encoded by nucleotide sequences that have been codon-optimized for optimal expression in human cells.

[0106] Effector domains described herein can include, for example, transcriptional repressors, DNA methyltransferases, and / or histone modifiers, as further detailed below.

[0107] A. Transcriptional repressors In some embodiments, the epigenetic effector domains described herein mediate the suppression of target gene expression (e.g., transcription). The effector domain may include, for example, a Kruppel-associated box (KRAB) repressor domain, a repressor element silencing transcription factor (REST) repressor domain, a KRAB-associated protein 1 (KAP1) domain, a MAD domain, an FKHR (forkhead gene in rhabdosarcoma) repressor domain, an EGR-1 (early growth response gene product-1) repressor domain, an ets2 repressor factor repressor domain (ERD), a MAD smSIN3-interacting domain (SID), a WRPW motif of a hairy-related basic helix-loop-helix (bHLH) repressor protein, an HP1 alpha chromoshadow repressor domain, an HP1 beta repressor domain, or any combination thereof. The effector domain may recruit, for example, through a scaffold protein, one or more protein domains that repress expression of a target gene. In some embodiments, the effector domain may recruit or interact with a scaffold protein domain that recruits a PRMT protein, an HDAC protein, a SETDB1 protein, or a NuRD protein domain.

[0108] In some embodiments, the effector domain comprises a functional domain derived from a zinc finger repressor protein, such as a KRAB domain. KRAB domains are found in approximately 400 human ZFP-based transcription factors. Descriptions of KRAB domains can be found, for example, in Ecco et al., Development (2017) 144(15):2719-29 and Lambert et al., Cell (2018) 172:650-65.

[0109] In certain embodiments, the effector domain comprises a repressor domain (e.g., KRAB) from KOX1 / ZNF10, KOX8 / ZNF708, ZNF43, ZNF184, ZNF91, HPF4, HTF10, or HTF34. In some embodiments, the effector domain is selected from the group consisting of ZIM3, ZNF436, ZNF257, ZNF675, ZNF490, ZNF320, ZNF331, ZNF816, ZNF680, ZNF41, ZNF189, ZNF528, ZNF543, ZNF554, ZNF140, ZNF610, ZNF264, ZNF350, ZNF8, ZNF582, ZNF30, ZNF324, ZNF98, ZNF669, ZNF677, ZNF596, ZNF214, ZNF37, ZNF34, ZNF556, ZNF558, ZNF559 ... The repressor domain may comprise a repressor domain (e.g., KRAB) derived from ZNF250, ZNF547, ZNF273, ZNF354, ZFP82, ZNF224, ZNF33, ZNF45, ZNF175, ZNF595, ZNF184, ZNF419, ZFP28-1, ZFP28-2, ZNF18, ZNF213, ZNF394, ZFP1, ZFP14, ZNF416, ZNF557, ZNF566, ZNF729, ZIM2, ZNF254, ZNF764, ZNF785, or any combination thereof. For example, the repressor domain may be a KRAB domain derived from KOX1, ZIM3, ZFP28, or ZN627. In certain embodiments, the repressor domain is a ZIM3 KRAB domain. In further embodiments, the effector domain is derived from a human protein, such as human ZIM3, human KOX1, human ZFP28, or human ZN627.

[0110] Exemplary effector domain sequences, or protein sequences containing them, that can reduce or silence target gene expression are provided in Table 5 below (SEQ: SEQ ID NO:). Further examples of repressors and transcriptional repressor domains can be found, for example, in PCT Patent Application Publication No. 2021 / 226077 and Tycko et al., Cell (2020) 183(7):2020-35, each of which is incorporated herein by reference in its entirety.

[0111] [Table 5] TIFF2025525389000021.tif250167TIFF2025525389000022.tif250167TIFF2025525389000023.tif250167TIFF20255253890 00024.tif250167TIFF2025525389000025.tif250167TIFF2025525389000026.tif250167TIFF2025525389000027.tif146166

[0112] Functional analogs of any one of the above-listed proteins, i.e., molecules that retain the same or substantially the same biological function (e.g., 70% or more, 80% or more, 90% or more, 95% or more, or 98% or more of the protein's transcription factor function), are encompassed by the present disclosure. For example, functional analogs can be isoforms or variants of the above-listed proteins, including, for example, portions of the above proteins with or without additional amino acid residues and / or including mutations to the above proteins. In some embodiments, functional analogs have at least 75, 80, 85, 90, 95, 98, or 99% sequence identity to one of the sequences listed in Table 5. Homologs, orthologs, and mutants of the above-listed proteins are also contemplated.

[0113] In certain embodiments, the epigenetic editors described herein include a KRAB domain derived from KOX1, ZIM3, ZFP28, or ZN627, and / or an effector domain derived from KAP1, MECP2, HP1a, HP1b, CBX8, CDYL2, TOX, TOX3, TOX4, EED, EZH2, RBBP4, RCOR1, or SCML2, whereby the parent protein is a human protein. In certain embodiments, the epigenetic editors described herein include a domain derived from KOX1, ZIM3, ZFP28, and / or ZN627, whereby the parent protein is a human protein. In certain embodiments, the epigenetic editor may include a KRAB domain derived from KOX1 (ZNF10), e.g., human KOX1. In certain embodiments, the epigenetic editor may include a KRAB domain derived from ZIM3 (ZNF657 or ZNF264), e.g., human ZIM3. In certain embodiments, an epigenetic editor can include a KRAB domain from ZFP28, e.g., human ZFP28. In certain embodiments, an epigenetic editor can include a KRAB domain from ZN627, e.g., human ZN627. In certain embodiments, an epigenetic editor described herein can include a CDYL2, e.g., human CDYL2, and / or a TOX domain (e.g., a human TOX domain), in combination with a KOX1 KRAB domain (e.g., a human KOX1 KRAB domain).

[0114] In certain embodiments, an epigenetic effector described herein comprises a repressor domain derived from KOX1 / ZNF10 (SEQ ID NO: 89). For example, the repressor domain can comprise the sequence of SEQ ID NO: 89, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 89.

[0115] In certain embodiments, the epigenetic effectors described herein comprise a repressor domain derived from KOX1 / ZNF10, as shown in Table 6 below.

[0116] [Table 6]

[0117] In certain embodiments, the repressor domain may comprise the amino acid sequence of SEQ ID NO:565, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:565.

[0118] In certain embodiments, the repressor domain may comprise the amino acid sequence of SEQ ID NO:566, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:566.

[0119] In certain embodiments, the repressor domain may comprise the amino acid sequence of SEQ ID NO:567, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:567.

[0120] In certain embodiments, the repressor domain may comprise the amino acid sequence of SEQ ID NO:568, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:568.

[0121] In certain embodiments, the repressor domain may comprise the amino acid sequence of SEQ ID NO:569, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:569.

[0122] In certain embodiments, the repressor domain may comprise the amino acid sequence of SEQ ID NO:570, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:570.

[0123] In certain embodiments, the repressor domain may comprise the amino acid sequence of SEQ ID NO:571, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:571.

[0124] In certain embodiments, the repressor domain may comprise the amino acid sequence of SEQ ID NO:572, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:572.

[0125] B. DNA methyltransferase In some embodiments, the effector domain of the epigenetic editor described herein alters target gene expression through DNA modification, e.g., methylation. Highly methylated areas of DNA tend to be less transcriptionally active than less methylated areas. DNA methylation occurs primarily at CpG sites (truncated forms of "C-phosphate-G-" or "cytosine-phosphate-guanine" sites). Many mammalian genes have promoter regions near or containing CpG islands (nucleic acid regions with a high frequency of CpG dinucleotides).

[0126] The effector domain described herein may be, for example, a DNA methyltransferase (DNMT) or its catalytic domain, or may be capable of recruiting a DNA methyltransferase. DNMTs include enzymes that catalyze the transfer of methyl groups to DNA nucleotides, such as canonical cytosine-5 DNMTs (e.g., DNMT1, DNMT3A, DNMT3B, and DNMT3C), which catalyze the addition of methyl groups to genomic DNA. The term also encompasses non-canonical family members that do not themselves catalyze methylation but recruit (including activate) catalytically active DNMTs; a non-limiting example of such a DNMT is DNMT3L. See, e.g., Lyko, Nat Review (2018) 19:81-92. Unless otherwise indicated, a DNMT domain may refer to a polypeptide domain derived from a catalytically active DNMT (e.g., DNMT1, DNMT3A, and DNMT3B) or a catalytically inactive DNMT (e.g., DNMT3L). DNMTs can suppress the expression of target genes through the recruitment of inhibitory regulatory proteins. In some embodiments, the methylation is at a CG (or CpG) dinucleotide sequence. In some embodiments, the methylation is at a CHG or CHH sequence, where H is any one of A, T, or C.

[0127] In some embodiments, the DNMTs described herein can be animal DNMTs (eg, mammalian DNMTs), plant DNMTs, fungal DNMTs, or bacterial DNMTs. Bacterial DNMTs can be obtained from bacterial species (e.g., cocci, bacilli, spiral bacteria, or intracellular Gram-positive or Gram-negative bacteria). In certain embodiments, the bacterial species is Mycoplasmatales bacterium, Mycoplasma marinum, or Spiroplasma chinense. In certain embodiments, the bacterial species is M. penetrans, S. monbiae, H. parainfluenzae, A. luteus, H. aegyptius, H. haemolyticus, Moraxella, E. coli, T. aquaticus, C. crescentus, In certain embodiments, the epigenetic editor described herein is not C. crescentus or C. difficile. In certain embodiments, the epigenetic editor described herein comprises a DNMT domain comprising SEQ ID NO: 601, or a sequence at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 601. In certain embodiments, the epigenetic editor described herein comprises SEQ ID NO: 602, or a sequence at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 602. In certain embodiments, the epigenetic editor described herein comprises a DNMT domain comprising SEQ ID NO:603, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:603.

[0128] In certain embodiments, the DNMT in the epigenetic editors described herein can include, for example, DNMT1, DNMT3A, DNMT3B, and / or DNMT3C. In some embodiments, the DNMT is a mammalian (e.g., human or mouse) DNMT. In certain embodiments, the DNMT is DNMT3A (e.g., human DNMT3A). In certain embodiments, the epigenetic editors described herein include a DNMT3A domain comprising SEQ ID NO:574, or a sequence at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:574. In certain embodiments, an epigenetic editor described herein comprises a DNMT3A domain comprising SEQ ID NO: 575, or a sequence at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 575. In some embodiments, the DNMT3A domain can have a mutation at, for example, position H739 (e.g., H739A or H739E), position R771 (e.g., R771L), and / or position R836 (e.g., R836A or R836Q), or any combination thereof (numbering according to SEQ ID NO: 574).

[0129] In some embodiments, the effector domain described herein can be a DNMT-like domain. As used herein, a "DNMT-like domain" refers to a regulator of DNMTs that can activate or recruit other DNMT domains but does not itself have methylation activity. In some embodiments, the DNMT-like domain is a mammalian (e.g., human or mouse) DNMT-like domain. In certain embodiments, the DNMT-like domain is DNMT3L, which can be, for example, human DNMT3L or mouse DNMT3L. In certain embodiments, the epigenetic editor described herein comprises a DNMT3L domain comprising SEQ ID NO:578, or a sequence at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:578. In certain embodiments, an epigenetic editor herein comprises a DNMT3L domain comprising SEQ ID NO: 579, or a sequence at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 579. In certain embodiments, an epigenetic editor described herein comprises a DNMT3L domain comprising SEQ ID NO: 580, or a sequence at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 580. In certain embodiments, an epigenetic editor described herein comprises a DNMT3L domain comprising SEQ ID NO: 581, or a sequence at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 581. In some embodiments, the DNMT3L domain can have a corresponding mutation, e.g., at position D226 (e.g., D226V), position Q268 (e.g., Q268K), or both (numbering according to SEQ ID NO: 578).

[0130] In certain embodiments, the epigenetic editors described herein may include both DNMT and DNMT-like effector domains. For example, the epigenetic editor may include a DNMT3A-3L domain, where DNMT3A and DNMT3L may be covalently linked. In other embodiments, the epigenetic editors described herein may include an effector domain that includes only a DNMT3A domain (e.g., human DNMT3A) or only a DNMT-like domain (e.g., DNMT3L, which may be human or mouse DNMT3L).

[0131] Table 7 below provides exemplary DNMTs that may be part of the epigenetic effector domains described herein, or from which the effector domains of the epigenetic editors described herein may be derived.

[0132] [Table 7] TIFF2025525389000030.tif247165

[0133] Functional analogs of any one of the above-listed proteins, i.e., molecules that retain the same or substantially the same biological function (e.g., 70% or more, 80% or more, 90% or more, 95% or more, or 98% or more of the protein's DNA methylation or recruitment function), are encompassed by the present disclosure. For example, a functional analog can be an isoform or variant of the above-listed proteins, e.g., including a portion of the above proteins with or without additional amino acid residues and / or including mutations to the above proteins. In some embodiments, a functional analog has at least 75, 80, 85, 90, 95, 98, or 99% sequence identity to one of the sequences listed in Table 7. In some embodiments, an effector domain herein comprises only a functional domain (or a functional analog thereof) of a protein listed above, e.g., a catalytic domain or a recruitment domain. In some embodiments, an effector domain herein comprises one or more epigenetic effector domains selected from Table 7, or functional homologs, orthologs, or variants thereof.

[0134] As used herein, a DNMT domain (e.g., a DNMT3A domain or a DNMT3L domain) refers to a protein domain that is identical to a parent protein (e.g., human or mouse DNMT3A or DNMT3L) or a functional analog thereof (e.g., having a functional fragment of the parent protein, e.g., a catalytic fragment or a recruitment fragment, and / or having a mutation that improves the activity of the DNMT protein).

[0135] The epigenetic editors herein can effect methylation at, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 or more CpG dinucleotide sequences within a target gene or chromosome. The CpG dinucleotide sequences may be located within or near the target gene in a CpG island, or may be located in a region that is not a CpG island. A CpG island generally refers to a nucleic acid sequence or chromosomal region that contains a high frequency of CpG dinucleotides. For example, a CpG island may contain at least 50% GC content. A CpG island may have a high observed-to-expected CpG ratio, for example, an observed-to-expected CpG ratio of at least 60%. As used herein, the observed-to-expected CpG ratio is determined by the number of CpGs x (length of sequence) / (number of Cs x number of Gs). In some embodiments, a CpG island has an observed-to-expected CpG ratio of at least 60%, 70%, 80%, 90%, or more. A CpG island may be, for example, a sequence or region of at least 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or 800 nucleotides. In some embodiments, only 1, or fewer than 2, fewer than 3, fewer than 4, fewer than 5, fewer than 6, fewer than 7, fewer than 8, fewer than 9, fewer than 10, fewer than 11, fewer than 12, fewer than 13, fewer than 14, fewer than 15, fewer than 16, fewer than 17, fewer than 18, fewer than 19, fewer than 20, fewer than 30, fewer than 40, or fewer than 50 CpG dinucleotides are methylated by the epigenetic editor.

[0136] In some embodiments, the epigenetic editors herein effect methylation in hypomethylated nucleic acid sequences, i.e., sequences that may lack a methyl group on a 5-methylcytosine nucleotide (e.g., in a CpG) compared to a standard control. Hypomethylation can occur, for example, in aged cells or cancer (e.g., early stages of neoplasia) compared to young cells or non-cancerous cells, respectively.

[0137] In some embodiments, the epigenetic editors described herein induce methylation in hypermethylated nucleic acid sequences.

[0138] In some embodiments, methylation can be introduced by an epigenetic editor at sites other than CpG dinucleotides. For example, a target gene sequence can be methylated at the C nucleotide of a CpA, CpT, or CpC sequence. In some embodiments, the epigenetic editor includes a DNMT3A domain, resulting in methylation at CpG, CpA, CpT, CpC sequences, or any combination thereof. In some embodiments, the epigenetic editor includes a DNMT3A domain that lacks the regulatory subdomain and retains only the catalytic domain. In some embodiments, an epigenetic editor including a DNMT3A catalytic domain results in methylation exclusively at CpG sequences. In some embodiments, an epigenetic editor including a DNMT3A domain containing a mutation, e.g., an R836A or R836Q mutation (numbering according to SEQ ID NO: 574), has higher methylation activity at CpA, CpC, and / or CpT sequences compared to an epigenetic editor including a wild-type DNMT3A domain.

[0139] C. Histone Modification Factors In some embodiments, the effector domain of the epigenetic editor herein mediates histone modification. Histone modifications play a structural and biochemical role in gene transcription, for example, by forming or disrupting nucleosome structures that bind to histones and prevent gene transcription. Histone modifications can include, for example, acetylation, deacetylation, methylation, phosphorylation, ubiquitination, sumoylation, and the like, at their N-termini ("histone tails"). These modifications maintain or specifically transform chromatin structure, thereby controlling responses occurring on chromosomal DNA, such as gene expression, DNA replication, and DNA repair. Post-translational modifications of histones are an epigenetic regulatory mechanism and are believed to be essential for gene regulation in eukaryotic cells. Recent studies have revealed that chromatin remodeling factors, such as SWI / SNF, RSC, NURF, and NRD, which modify nucleosome structure to facilitate the access of transcription factors to DNA, histone acetyltransferases (HATs) that regulate the acetylation status of histones, and histone deacetylases (HDACs) act as key regulators.

[0140] In particular, the unstructured N-terminus of histones can be modified by acetylation, deacetylation, methylation, ubiquitination, phosphorylation, sumoylation, ribosylation, citrullination, O-GlcNAcylation, or crotonylation, or any combination thereof. For example, histone acetyltransferases (HATs) use acetyl-CoA as a cofactor to catalyze the transfer of an acetyl group to the epsilon-amino group of a lysine side chain. This neutralizes the positive charge of the lysine, weakening the interaction between the histone and DNA, thereby opening the chromosome for transcription factor binding and initiating transcription. Acetylation of the K14 and K9 lysines of histone H3 by histone acetyltransferase enzymes may be associated with transcriptional competence in humans. Lysine acetylation may directly or indirectly create binding sites for chromatin-modifying enzymes that regulate transcriptional activation. On the other hand, histone methylation of lysine 9 of histone H3 can be associated with heterochromatin, or transcriptionally silent chromatin.

[0141] In certain embodiments, the effector domain of an epigenetic editor described herein comprises a histone methyltransferase domain. The effector domain may comprise, for example, a DOT1L domain, a SET domain, a SUV39H1 domain, a G9a / EHMT2 protein domain, an EZH1 domain, an EZH2 domain, a SETDB1 domain, or any combination thereof. In certain embodiments, the effector domain comprises a histone-lysine-N-methyltransferase SETDB1 domain.

[0142] In some embodiments, the effector domain comprises a histone deacetylase protein domain. In certain embodiments, the effector domain comprises an HDAC family protein domain, such as an HDAC1, HDAC3, HDAC5, HDAC7, or HDAC9 protein domain. In certain embodiments, the effector domain comprises a nucleosome remodeling and deacetylase complex (NURD), which removes acetyl groups from histones.

[0143] D. Other Effector Domains In some embodiments, the effector domain comprises a tripartite motif-containing protein (TRIM28, TIF1-beta, or KAP1). In certain embodiments, the effector domain comprises one or more KAP1 proteins. The KAP1 protein in the epigenetic editors herein forms a complex with one or more other effector domains of the epigenetic editor or one or more proteins involved in modulating gene expression in the cellular environment. For example, KAP1 can be recruited by the KRAB domain of a transcriptional repressor. The KAP1 protein domain can interact with or recruit one or more protein complexes that reduce or silence gene expression. In some embodiments, KAP1 interacts with or recruits histone deacetylase proteins, histone-lysine methyltransferase proteins, chromatin remodeling proteins, and / or heterochromatin proteins. For example, the KAP1 protein domain may interact with or recruit heterochromatin protein 1 (HP1) protein, SETDB1 protein, HDAC protein, and / or NuRD protein complex components. In some embodiments, the KAP1 protein domain interacts with or recruits ZFP90 protein (e.g., ZFP90 isoform 2) and / or FOXP3 protein. An exemplary KAP1 amino acid sequence is set forth in SEQ ID NO:629.

[0144] In some embodiments, the effector domain comprises a protein domain that interacts with or is recruited by one or more DNA epigenetic marks. For example, the effector domain may comprise a methyl-CpG-binding protein 2 (MECP2) protein that interacts with methylated DNA nucleotides within a target gene (which may or may not be in a CpG island of the target gene). The MECP2 protein domain in the epigenetic editors described herein may induce a condensed chromatin structure, thereby reducing or silencing expression of the target gene. In some embodiments, the MECP2 protein domain in the epigenetic editors described herein may interact with histone deacetylases (e.g., HDACs), thereby repressing or silencing expression of the target gene. In some embodiments, the MECP2 protein domain in the epigenetic editors described herein may block access of transcription factors or transcriptional activators to a target sequence, thereby repressing or silencing expression of the target gene. An exemplary MECP2 amino acid sequence is set forth in SEQ ID NO: 630.

[0145] Effector domains of the epigenetic editors described herein include, for example, a chromoshadow domain, a ubiquitin-2-like Rad60 SUMO-like (Rad60-SLD / SUMO) domain, a chromatin organization modifier domain (Chromo) domain, and Yaf2 / RYBP. C-terminal binding motif domain (YAF2_RYBP), CBX family C-terminal motif domain (CBX7_C), zinc finger C3HC4 type (RING finger) domain (ZF-C3HC4_2), cytochrome b5 domain (Cyt-b5), helix-loop-helix domain (HLH), helix-heparin-helix motif domain (e.g., HHH_3), high mobility group box domain (HMG-box), basic leucine zipper domain (e.g., bZIP_1 or bZIP_2), Myb_DNA binding domain, homeodomain, MYM-type zinc finger domain with FCS sequence domain (ZF-FCS), interferon regulatory factor 2-binding protein Protein zinc finger domain (IRF-2BP1_2), SSX repressor domain (SSXRD), B-box type zinc finger domain (ZF-B_box), CXXC zinc finger domain (ZF-CXXC), regulator of chromosome condensation 1 domain (RCC1), SRC homology 3 domain (SH3_9), sterile alpha motif domain (SAM_1), sterile alpha motif domain (SAM_2), sterile alpha motif / pointed domain (SAM_PNT), vestibulial / Tondu family domain (Vg_Tdu), LIM domain, RNA recognition motif domain (RRM_1), paired amphipathic helix domain (PAH), proteasome ATPase OB C-terminal domain (Prot_ATP_ID_OB), nerve homology 2 domain (NHR2), hinge domain of cleavage stimulatory factor subunit 2 (CSTF2_hinge), PPAR gamma N-terminal region domain (PPARgamma_N), CDC48 N-terminal domain (CDC48_2), WD40 repeat domain (WD40), Fip1 motif domain (Fip1), PDZ domain (PDZ_6), von Willebrand factor type C domain (VWC), NAB conserved region 1 domain (NCD1), S1RNA binding domain (S1), HNF3 C-terminal domain (HNF_C), Tudor domain (Tudor_2), histone-like transcription factor (CBF / NF-Y) and archaeal histone domain (CBFD_NFYB_HMF), zinc finger protein domain (DUF3669), EGF-like domain (cEGF), GATA zinc finger domain (GATA), TEA / ATTS domain (TEA), phorbol ester / diacylglycerol binding domain (C1-1), polycomb-like MTF2 factor 2 domain (Mtf2_C), transactivation domain of the FOXO protein family (FOXO-TAD), homeobox KN domain (Homeobox_KN), BED zinc finger domain (ZF-BED), zinc finger of C3HC4-type RING domain (ZF-C3HC4_4), RAD51 interaction motif domain (RAD51_interact), p55 binding region of methyl-CpG-binding domain protein MBD (MBDa), Notch domain, Raf-like Ras binding domain (RBD), Spin / Ssty family domain (Spin-Ssty), PHD finger domain (PHD_3), low density lipoprotein receptor domain class A (Ldl_recept_a), CS domain, DM DNA binding domain, and QLQ domain are also contemplated.

[0146] In some embodiments, the effector domain is a protein domain comprising a YAF2_RYBP domain, or its homeodomain, or any combination thereof. In certain embodiments, the homeodomain of the YAF2_RYBP domain is a PRD domain, an NKL domain, a HOXL domain, or a LIM domain. In certain embodiments, the YAF2_RYBP domain may comprise a 32-amino acid Yaf2 / RYBP C-terminal binding motif domain (32 aa RYBP).

[0147] In some embodiments, the effector domain comprises a protein domain selected from the group consisting of a SUMO3 domain, a chromodomain derived from M-phase phosphoprotein 8 (MPP8), a chromoshadow domain derived from chromobox 1 (CBX1), and a SAM_1 / SPM domain derived from Scm polycomb group protein homolog 1 (SCMH1).

[0148] In some embodiments, the effector domain comprises the HNF3 C-terminal domain (HNF_C). The HNF_C domain can be derived from FOXA1 or FOXA2. In certain embodiments, the HNF_C domain comprises an EH1 (engrailed homology 1) motif.

[0149] In some embodiments, the effector domain may comprise an interferon regulatory factor 2-binding protein zinc finger domain (IRF-2BP1_2), a Cyt-b5 domain from the DNA repair factor HERC2 E3 ligase, a variant SH3 domain (SH3_9) from Bridging Integrator 1 (BIN1), an HMG box domain from the transcription factor TOX, or a ZF-C3HC4_2 RING finger domain from the polycomb component PCGF2, a chromodomain-helicase-DNA binding protein 3 (CHD3) domain, or a ZNF783 domain.

[0150] IV. Epigenetic Editor For example, provided herein are epigenetic editors (i.e., epigenetic editing systems) that use any combination of one or more DNA-binding domains described herein and one or more effector domains (e.g., epigenetic repressor domains) described herein to direct epigenetic modifications to a target sequence in a gene of interest. The DNA-binding domain (in cooperation with a guide polynucleotide, e.g., one described herein, where the DNA-binding domain is a DNA-binding domain guided by the polynucleotide) directs the effector domain to epigenetically modify the target sequence, resulting in persistent gene suppression or silencing that can be inherited across generations of cells. In some embodiments, the epigenetic editors described herein can reversibly or irreversibly suppress or silence genes in cells.

[0151] In certain embodiments, the epigenetic editors described herein comprise one or more fusion proteins, each comprising (1) a DNA-binding domain and (2) an effector domain. The effector domains may be present on one or more fusion proteins comprised by the epigenetic editor. For example, a single fusion protein may comprise all effector domains with a DNA-binding domain. Alternatively, the effector domains, or subsets thereof, may be present on separate fusion proteins (which may be the same or different), each with a DNA-binding domain. The fusion proteins described herein may further comprise one or more linkers (e.g., peptide linkers), detectable tags, nuclear localization signals (NLSs), or any combination thereof. As used herein, "fusion protein" refers to a chimeric protein in which two or more coding sequences (e.g., for DNA-binding domains and / or effector domains) are joined directly or indirectly by covalent or non-covalent bonds.

[0152] In some embodiments, the epigenetic editors described herein include two, three, four, five, six, seven, eight, nine, ten, or more effector (e.g., repressor) domains, which may be the same or different. In certain embodiments, two or more of the effector domains function synergistically. Combinations of effector domains may include a DNA methylation domain, a histone deacetylation domain, a histone methylation domain, and / or a scaffold domain that recruits any of the above. For example, the epigenetic editors described herein may include one or more transcriptional repressor domains (e.g., KRAB domains, e.g., KOX1, ZIM3, ZFP28, or ZN627 KRAB) in combination with one or more DNA methylation domains (e.g., DNMT domains) and / or recruiter domains (e.g., DNMT3L domains). Such epigenetic editors can include, for example, a KRAB domain, a DNMT3A domain, and a DNMT3L domain. In some embodiments, the epigenetic editor further includes an additional effector domain (e.g., a KAP1, MECP2, HP1b, CBX8, CDYL2, TOX, TOX3, TOX4, EED, RBBP4, RCOR1, or SCML2 domain). In some embodiments, the additional effector domain is a CDYL2, TOX, TOX3, TOX4, or HP1a domain. For example, the epigenetic editors described herein can include a CDYL2 and / or TOX domain in combination with a KRAB domain (e.g., a KOX1 KRAB domain).

[0153] A. Linker The fusion proteins described herein can include one or more linkers connecting the components of the epigenetic editor. The linkers can be peptide or non-peptide linkers.

[0154] In some embodiments, one or more linkers utilized in the epigenetic editors provided herein are peptide linkers, i.e., linkers that include a peptide moiety. Peptide linkers can be of any length applicable to the epigenetic editor fusion proteins described herein. In some embodiments, a linker can include a peptide of 1 to 200 (e.g., 1 to 80) amino acids. In some embodiments, the linker is 1 to 5, 1 to 10, 1 to 20, 1 to 30, 1 to 40, 1 to 50, 1 to 60, 1 to 80, 1 to 100, 1 to 150, 1 to 200, 5 to 10, 5 to 20, 5 to 30, 5 to 40, 5 to 60, 5 to 80, 5 to 100, 5 to 150, 5 to 200, 10 to 20, 10 to 30, 10 to 40, 10 to 50, 10 to 60, 10 to 80, 10 to 100, 10 to 150, 10 to 200, 20 to 30, 20 to 40, 20 to 50, 20 to 60, 20 to 80, 20 to 1 00, 20-150, 20-200, 30-40, 30-50, 30-60, 30-80, 30-100, 30-150, 30-200, 40-50, 40-60, 40-80, 40-100, 40-150, 40-200, 50-60, 50-80, 50-100, 50-150, 50-200, 60-80, 60-100, 60-150, 60-200, 80-100, 80-150, 80-200, 100-150, 100-200, or 150-200 amino acids in length. Longer or shorter linkers are also contemplated. In some embodiments, the peptide linker is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 25, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 amino acids in length. For example, the peptide linker can be 4, 5, 16, 20, 24, 27, 32, 40, 64, 92, or 104 amino acids in length. The peptide linker can be a flexible or rigid linker.In certain embodiments, the peptide linker comprises the amino acid sequence of any one of SEQ ID NOs: 631-637 and 664-666, or a sequence at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical thereto.

[0155] In certain embodiments, the peptide linker is an XTEN linker. Such a linker can comprise a portion of the XTEN sequence, an unstructured hydrophilic polypeptide consisting only of the residues G, S, P, T, E, and A (Schellenberger et al., Nat Biotechnol (2009) 27(1):1186-90). As used herein, the term "XTEN" refers to a recombinant peptide or polypeptide lacking hydrophobic amino acid residues. XTEN linkers are typically unstructured and contain a limited set of naturally occurring amino acids. Fusion of XTEN to a protein alters its hydrodynamic properties and reduces the clearance and degradation rate of the fusion protein. These XTEN fusion proteins are produced using recombinant technology and are degraded by natural pathways without the need for chemical modification. XTEN linkers can be, for example, 5, 10, 16, 20, 26, or 80 amino acids in length. In some embodiments, the XTEN linker is 16 amino acids in length. In some embodiments, the XTEN linker is 80 amino acids in length. In certain embodiments, the XTEN linker can be XTEN10, XTEN16, XTEN20, or XTEN80. In certain embodiments, the XTEN linker can comprise the amino acid sequence of any one of SEQ ID NOs: 638-643, or a sequence at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical thereto. In certain embodiments, the XTEN linker comprises the amino acid sequence of SEQ ID NO: 638. In certain embodiments, the XTEN linker comprises the amino acid sequence of SEQ ID NO: 643.

[0156] In some embodiments, one or more linkers utilized in the epigenetic editors provided herein are non-peptide linkers. For example, the linker can be a carbon bond, a disulfide bond, or a carbon-heteroatom bond. In certain embodiments, the linker is a carbon-nitrogen bond of an amide linkage. In certain embodiments, the linker is a cyclic or acyclic, substituted or unsubstituted, or branched or unbranched aliphatic or heteroaliphatic linker.

[0157] In some embodiments, one or more linkers utilized in the epigenetic editors provided herein are polymers (e.g., polyethylene, polyethylene glycol, polyamide, polyester, etc.). The linker may include, for example, a monomer, dimer, or polymer of an aminoalkanoic acid, a monomer, dimer, or polymer of an aminoalkanoic acid (e.g., glycine, ethanoic acid, alanine, beta-alanine, 3-aminopropanoic acid, 4-aminobutanoic acid, 5-pentanoic acid, etc.), an aminohexanoic acid (Ahx), a polyethylene glycol moiety (PEG), or an aryl or heteroaryl moiety. In certain embodiments, the linker may be based on a carbocyclic moiety (e.g., cyclopentane or cyclohexane) or a phenyl ring. The linker may include a functionalized moiety that facilitates attachment of a nucleophile (e.g., thiol, amino) from the peptide to the linker. Any electrophile may be used as part of the linker. Exemplary electrophiles include, but are not limited to, activated esters, activated amides, alkyl halides, aryl halides, acyl halides, and isothiocyanates.

[0158] A variety of linker lengths and flexibilities can be utilized between any two components of an epigenetic editor (e.g., between an effector domain (e.g., a repressor domain) and a DNA-binding domain (e.g., a Cas9 domain), between a first effector domain and a second effector domain, etc.). Linkers can range from very flexible linkers, e.g., glycine / serine-rich linkers, to more rigid linkers to achieve an optimal length for effector domain activity for a particular application. In some embodiments, a more flexible linker is a glycine / serine-rich linker (GS-rich linker), in which more than 45% (e.g., more than 48%, more than 50%, more than 55%, more than 60%, more than 70%, more than 80%, or more than 90%) of the residues are glycine or serine residues. Non-limiting examples of GS-rich linkers are (GGGGS)n (SEQ ID NO: 664), (G)n, and the W linker (SEQ ID NO: 637). In some embodiments, more rigid linkers are of the form (EAAAK)n (SEQ ID NO: 665), (SGGS)n (SEQ ID NO: 666), and (XP)n). In the above formulas for flexible and rigid linkers, n can be any integer from 1 to 30. In some embodiments, n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15. In some embodiments, the linker comprises a (GGS)n motif, where n is 1, 3, or 7. In some embodiments, the linker comprises a (GGGGS)n motif, where n is 4 (SEQ ID NO: 636).

[0159] In some embodiments, the linker in an epigenetic editor described herein comprises a nuclear localization signal, e.g., having the amino acid sequence of any one of SEQ ID NOs: 644 to 649. In some embodiments, the linker in an epigenetic editor described herein comprises an expression tag, e.g., a detectable tag, e.g., green fluorescent protein.

[0160] B. Nuclear localization signal The fusion proteins described herein may contain one or more nuclear localization signals, and in certain embodiments, may contain two or more nuclear localization signals. For example, a fusion protein may contain one, two, three, four, five, six, seven, eight, nine, ten, or more nuclear localization signals. As used herein, a "nuclear localization signal" (NLS) is an amino acid sequence that directs a protein to the nucleus. In certain embodiments, the NLS may be an SV40 NLS (e.g., having the amino acid sequence of SEQ ID NO: 644). A fusion protein may contain an NLS at its N-terminus, C-terminus, or both, and / or the NLS may be embedded in the center of the fusion protein (e.g., at the N-terminus or C-terminus of the DNA-binding domain or effector domain).

[0161] In some embodiments, the fusion protein may contain two NLSs. The fusion protein may contain two NLSs at its N-terminus or C-terminus. The fusion protein may contain one NLS located at its N-terminus and one NLS embedded in the center of the fusion protein, or one NLS located at its C-terminus and one NLS embedded in the center of the fusion protein. The fusion protein may contain two NLSs embedded in the center of the fusion protein.

[0162] In some embodiments, the fusion protein may comprise four NLSs. The fusion protein may comprise at least two (e.g., two, three, or four) NLSs at its N-terminus or C-terminus. The fusion protein may comprise at least one (e.g., one, two, three, or four) NLS embedded in the center of the fusion protein. In certain embodiments, the fusion protein may comprise two NLSs at its N-terminus and two NLSs at its C-terminus.

[0163] The NLS described herein can be an endogenous NLS sequence. In certain embodiments, the NLS described herein comprises the amino acid sequence of any one of SEQ ID NOs: 644-649, or a sequence that is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the selected sequence. In certain embodiments, the NLS comprises the amino acid sequence of SEQ ID NO: 644. Additional NLSs are known in the art.

[0164] In some embodiments, an epigenetic editor comprising a fusion protein comprising at least one NLS at the N-terminus and at least one NLS at the C-terminus may increase the efficiency of the epigenetic editor by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 200%, at least 300%, at least 400%, at least 500%, at least 600%, at least 700%, at least 800%, at least 900%, at least 1,000%, at least 5,000%, at least 10,000%, at least 50,000%, at least 100,000%, or more, compared to an epigenetic editor having a corresponding fusion protein that does not have at least one NLS at the N-terminus and at least one NLS at the C-terminus.

[0165] In some embodiments, an epigenetic editor comprising a fusion protein comprising two NLSs at the N-terminus and two NLSs at the C-terminus may increase the efficiency of the epigenetic editor by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 200%, at least 300%, at least 400%, at least 500%, at least 600%, at least 700%, at least 800%, at least 900%, at least 1,000%, at least 5,000%, at least 10,000%, at least 50,000%, at least 100,000%, or more, compared to an epigenetic editor having a corresponding fusion protein that does not have two NLSs at the N-terminus and two NLSs at the C-terminus.

[0166] C. Tag The epigenetic editors provided herein can include one or more additional sequences (tags) for tracking, detecting, and localizing the editor. In some embodiments, the epigenetic editor includes one, two, three, four, five, six, seven, eight, nine, ten, or more detectable tags. Each of the detectable tags can be the same or different.

[0167] For example, epigenetic editor fusion proteins can include a cytoplasmic localization sequence, an external export sequence, e.g., a nuclear export sequence, or other localization sequence, as well as a sequence tag useful for solubilizing, purifying, or detecting the fusion protein. Suitable protein tags provided herein include, but are not limited to, a biotin carboxylase carrier protein (BCCP) tag, a myc tag, a calmodulin tag, a FLAG tag, a hemagglutinin (HA) tag, a polyhistidine tag (also referred to as a histidine tag or His tag), a maltose-binding protein (MBP) tag, a nus tag, a glutathione-S-transferase (GST) tag, a green fluorescent protein (GFP) tag, a thioredoxin tag, an S tag, a Softag (e.g., Softag 1 or Softag 3), a strep tag, a biotin ligase tag, a FlAsH tag, a V5 tag, and an SBP tag. Additional suitable sequences will be apparent to those skilled in the art.

[0168] D. Fusion Protein Construction The components of the epigenetic editor fusion proteins described herein may be structured in different configurations. For example, the DNA binding domain may be at the C-terminus, the N-terminus, or between two or more epigenetic effector domains or additional domains. In some embodiments, the DNA binding domain is at the C-terminus of the epigenetic editor. In some embodiments, the DNA binding domain is at the N-terminus of the epigenetic editor. In some embodiments, the DNA binding domain is linked to one or more nuclear localization signals. In some embodiments, the DNA binding domain is flanked on both sides by epigenetic effector domains or additional domains. In some embodiments, where "DBD" represents the DNA binding domain and "ED" represents the effector domain, the epigenetic editor may be -N']-[ED1]-[DBD]-[ED2]-[C' -N']-[ED1]-[DBD]-[ED2]-[ED3]-[C' -N']-[ED1]-[ED2]-[DBD]-[ED3]-[C' or -N']-[ED1]-[ED2]-DBD]-[ED3]-[ED4]-[C' Includes the configuration of.

[0169] In some embodiments, the epigenetic editor comprises a DNA binding domain (DBD), a DNA methyltransferase (DNMT) domain, and a transcriptional repressor ("repressor") domain that represses or silences expression of a target gene. The DBD, DNMT, and transcriptional repressor domains can be any of those described herein in any combination. The DBD, DNMT, and repressor domains can be in any configuration with any of said domains at the N-terminus, C-terminus, or center of the fusion protein. In some embodiments, the epigenetic editor comprises: N']-[DNMT domain]-[DBD]-[repressor domain]-[C' N']-[repressor domain]-[DBD]-[DNMT domain]-[C' N']-[DNMT domain]-[repressor domain]-[DBD]-[C' or N']-[repressor domain]-[DNMT domain]-[DBD]-[C' The present invention also includes fusion proteins having the following structure:

[0170] In some embodiments, the connecting structure "]-[" in any one of the epigenetic editor structures is a linker, e.g., a peptide linker, a detectable tag, a peptide bond, a nuclear localization signal, and / or a promoter or regulatory sequence. In an epigenetic editor structure, multiple connecting structures "]-[" may be the same, or each may be a different linker, tag, NLS, or peptide bond. In some embodiments, the DNMT domain may comprise any one of the domains in Table 7, or any combination or homolog thereof. In certain embodiments, the DNMT domain comprises DNMT3A or a truncated version thereof, DNMT3L or a truncated version thereof, or both. In certain embodiments, the DBD is a catalytically inactive polynucleotide-guided DNA binding domain (e.g., dCas9) or a ZFP domain. In certain embodiments, the repressor domain comprises any one of the domains shown in Tables 5 or 6, or any combination or homolog thereof. For example, the repressor domain may be a KRAB domain. In certain embodiments, the repressor domain is a ZFP28, ZN627, KAP1, MeCP2, HP1b, CBX8, CDYL2, TOX, Tox3, Tox4, EED, RBBP4, RCOR1, or SCML2 domain, or a fusion of two of said domains (e.g., a fusion of the N- and C-terminal regions of ZIM3 and KOX1 KRAB). In certain embodiments, the repressor domain is a KRAB domain from ZFP28, ZN627, ZIM3, or KOX1.

[0171] In some embodiments, the epigenetic editor comprises: N']-[DNMT3A-DNMT3L]-[DBD]-[repressor]-[C' N']-[repressor]-[DBD]-[DNMT3A-DNMT3L]-[C' N']-[repressor]-[DBD]-[DNMT3A]-[C' N']-[DNMT3A]-[DBD]-[repressor]-[C' N']-[repressor]-[DBD]-[DNMT3A]-[DNMT3L]-[C' N']-[DNMT3A]-[DNMT3L]-[DBD]-[repressor]-[C' N']-[DNMT3A]-[DBD]-[C' N']-[DBD]-[DNMT3A]-[C' N']-[DNMT3L]-[DBD]-[C' N']-[DBD]-[DNMT3L]-[C' wherein [DNMT3A-DNMT3L] indicates that the DNMT3A and DNMT3L domains are directly fused via a peptide bond, and the connecting structure]-[ is any one of the linkers described herein, a detectable tag, an affinity domain, a peptide bond, a nuclear localization signal, a promoter, and / or a regulatory sequence. The DBD, KRAB, repressor, DNMT3A, and DNMT3L domains can be any of those described herein in any combination. For example, the DNMT3A and DNMT3L domains can be selected from those in Table 7. In certain embodiments, the DBD is a CRISPR-associated protein domain (e.g., dCas9) or a ZFP domain, the repressor domain is a KRAB domain from KOX1, ZIM3, ZFP28, or ZN627, the DNMT3A domain is a human DNMT3A domain, and the DNMT3L domain is a human or mouse DNMT3L domain; any combination of these components is also contemplated by the present disclosure.

[0172] In some embodiments, the epigenetic editor comprises: N']-[DNMT3A]-[DBD]-[SETDB1]-[C' N']-[DNMT3A]-[DNMT3L]-[DBD]-[SETDB1]-[C' N']-[DNMT3A-DNMT3L]-[DBD]-[SETDB1]-[C' N']-[SETDB1]-[DBD]-[DNMT3A]-[DNMT3L]-[C' N']-[SETDB1]-[DBD]-[DNMT3A]-[C' and wherein [DNMT3A-DNMT3L] indicates that the DNMT3A and DNMT3L domains are directly fused via a peptide bond, and the connecting structure]-[ is any one of the linkers described herein, a detectable tag, an affinity domain, a peptide bond, a nuclear localization signal, a promoter, and / or a regulatory sequence. The DBD, SETDB1, DNMT3A, and DNMT3L domains can be any of those described herein in any combination. In certain embodiments, the DBD is a CRISPR-associated protein domain (e.g., dCas9) or a ZFP domain, the SETDB1 domain is derived from human SETDB1, ZIM3, ZFP28, or ZN627, the DNMT3A domain is a human DNMT3A domain, and the DNMT3L domain is a human or mouse DNMT3L domain; any combination of these components is also contemplated by the present disclosure.

[0173] Specific constructs contemplated herein include: TIFF2025525389000031.tif34160 is an example. DNMT3L and DNMT3A can be derived from human parent proteins, mouse parent proteins, or any combination thereof. In certain embodiments, DNMT3L and DNMT3A are derived from mouse and human parent proteins (mDNMT3L and hDNMT3A), respectively. In certain embodiments, DNMT3L and DNMT3A are both derived from human parent proteins (hDNMT3L and hDNMT3A). In some embodiments, dCas9 is dSpCas9. In some embodiments, KOX1 is human KOX1. Any of configurations 1-6 in which the KOX1 KRAB domain is replaced by a ZFP28, ZN627, or ZIM3 KRAB domain are also contemplated. In some embodiments, ZFP28, ZN627, and ZIM3 are human ZFP28, ZN627, and ZIM3, respectively. In certain embodiments, the fusion construct comprises the configuration: TIFF2025525389000032.tif42159.

[0174] In certain embodiments, the fusion constructs described herein may have configuration 1 and may include SEQ ID NO:658, or a sequence at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical thereto. In SEQ ID NO:658 below, the XTEN linker is underlined, the W linker is bold, underlined, and italicized, the NLS sequence is bolded, the DNMT3A sequence is italicized, the DNMT3L sequence is underlined and italicized, the dCas9 domain is bolded and italicized, and the KOX1 KRAB domain is underlined and bolded. TIFF2025525389000033.tif187161 (sequence number 658)

[0175] In certain embodiments, the fusion construct described herein may have configuration 2 and include SEQ ID NO:659, or a sequence at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical thereto. In SEQ ID NO:659 below, the XTEN linker is underlined, the W linker is bold, underlined, and italicized, the NLS sequence is bold and underlined, the DNMT3A sequence is italicized, the DNMT3L sequence is underlined and italicized, the ZFP domain is bold, and the KOX1 KRAB domain is underlined and bold. The variable amino acids represented by X are amino acids in the DNA recognition helix of the zinc finger, and the italicized XX may be either TR, LR, or LK. TIFF2025525389000034.tif68165

[0176] In certain embodiments, the six "XXXXXXX" regions in SEQ ID NO: 659 comprise amino acid sequences that form zinc fingers. In the above sequences, [linker] represents a linker sequence. In some embodiments, one or both linker sequences may be TGSQKP (SEQ ID NO: 651). In some embodiments, one or both linker sequences may be TGGGGSQKP (SEQ ID NO: 652). In some embodiments, one linker sequence may have the amino acid sequence of SEQ ID NO: 651 and the other linker sequence may have the amino acid sequence of SEQ ID NO: 652. In some embodiments, the linker sequence is a minimum of 5 amino acids in length. In some embodiments, the linker sequence is a maximum of 250 amino acids in length.

[0177] In certain embodiments, the fusion construct described herein may have configuration 7 and include SEQ ID NO: 660, or a sequence at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical thereto.

[0178] In certain embodiments, the fusion construct described herein may have configuration 9 and include SEQ ID NO: 661, or a sequence at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical thereto.

[0179] In certain embodiments, the fusion construct described herein may have configuration 11 and include SEQ ID NO: 662, or a sequence at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical thereto.

[0180] In certain embodiments, the fusion construct described herein may have configuration 13 and include SEQ ID NO: 663, or a sequence at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical thereto.

[0181] In some embodiments, a fusion construct described herein (e.g., a fusion construct of any one of constructs 1-14) is within an expression construct that includes a WPRE sequence, a polyadenylation site, or both. In certain embodiments, the WPRE sequence is in the 3' non-coding region. In certain embodiments, the WPRE sequence is upstream from the polyadenylation site. In certain embodiments, an expression construct includes a fusion construct (e.g., of any one of constructs 1-14) and a WPRE sequence in the 3' non-coding region upstream from the polyadenylation site.

[0182] Multiple fusion proteins can be used to activate or suppress a target gene or multiple target genes. For example, an epigenetic editor fusion protein containing a DNA-binding domain (e.g., a dCas9 domain) and an effector domain can be co-delivered with two or more guide polynucleotides (e.g., gRNAs), each targeting a different target DNA sequence. The target sites for the two DNA-binding domains can be the same or close to each other, or can be separated by, for example, about 100 base pairs, about 200 base pairs, about 300 base pairs, about 400 base pairs, about 500 base pairs, or about 600 base pairs or more. Furthermore, when targeting double-stranded DNA, such as an endogenous locus, the guide polynucleotides can target the same or different strands (one or more plus strands and / or one or more minus strands).

[0183] In some embodiments, an epigenetic editor targeting CIITA is used in conjunction with an epigenetic editor targeting TRAC, TRBC, B2M, PDCD1, TIM-3, TIGIT, LAG3, CTLA4, AAVS1, CCR5, TET2, TGFBR2, A2AR, CISH, PTPN11, PTPN6, PTPA, PTPN2, JUNB, TOX, TOX2, NR4A1, NR4A2, NR4A3, MAP4K1, REL, IRF4, DGKA, PIK3CD, HLA-A, USP16, DCK, FAS, or any combination thereof.

[0184] V. Target Sequence The epigenetic editor herein can be directed to a target sequence in CIITA to result in epigenetic modification of the CIITA gene.

[0185] As used herein, a "target sequence," "target site," or "target region" is a nucleic acid sequence present in a gene of interest; in some instances, the target sequence may be external to, but near, the gene of interest where methylation or binding of the target sequence by a repressor represses expression of the gene. In some embodiments, the target sequence may be a hypomethylated or hypermethylated nucleic acid sequence.

[0186] The target sequence may be in any part of the target gene. In some embodiments, the target sequence is part of or near a non-coding sequence of the gene. In some embodiments, the target sequence is part of an exon of the gene. In some embodiments, the target sequence is part of or near a transcriptional regulatory sequence of the gene, such as a promoter or enhancer. In some embodiments, the target sequence is adjacent to, overlaps with, or encompasses a CpG island. In certain embodiments, the target sequence is within about 3000, 2900, 2800, 2700, 2600, 2500, 2400, 2300, 2200, 2100, 2000, 1900, 1800, 1700, 1600, 1500, 1400, 1300, 1200, 1100, 1000, 900, 800, 700, 600, 500, 400, 300, 200, or 100 base pairs (bp) flanking the CIITA TSS. In certain embodiments, the target sequence is within 500 bp flanking the CIITA TSS. In certain embodiments, the target sequence is within 1000 bp flanking the CIITA TSS.

[0187] In some embodiments, the target sequence can hybridize to a guide polynucleotide sequence (e.g., gRNA) complexed with a fusion protein comprising a polynucleotide-guided DNA-binding domain (e.g., a CRISPR protein such as dCas9) and an effector domain. The guide polynucleotide sequence can be designed to have complementarity to the target sequence or identity to the opposite strand of the target sequence. In some embodiments, the guide polynucleotide comprises a spacer sequence that is about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the protospacer sequence in the target sequence. In certain embodiments, the guide polynucleotide comprises a spacer sequence that is 100% identical to the protospacer sequence in the target sequence.

[0188] In some embodiments, the DNA binding domain of the epigenetic editors described herein is a zinc finger array, and the target sequence can be recognized by said zinc finger array.

[0189] In some embodiments, the DNA binding domain of the epigenetic editor described herein is a TALE, and the target sequence can be recognized by said TALE.

[0190] The target sequence described herein may be specific to one copy of the target gene or one allele of the target gene. Thus, the epigenetic modification and modulation of its expression may be specific to one copy or one allele of the target gene. For example, the epigenetic editor can suppress the expression of a specific copy (e.g., a copy associated with a disease or condition, or a copy carrying a mutation associated with a disease or condition) that carries the target sequence recognized by the DNA binding domain.

[0191] In some embodiments, the target CIITA genomic region may be within the sequence set forth in SEQ ID NO: 1313 or 1314.

[0192] VI. Epigenetic Modifications The epigenetic editors described herein can make sequence-specific epigenetic modifications (e.g., chemically altered modifications) of a target gene having a target sequence. Such epigenetic modulation can be safer and more easily reversible than modulation resulting from gene editing, for example, using the generation of DNA double-strand breaks. In some embodiments, the epigenetic modulation can reduce or silence the target gene. In some embodiments, the modification is at a specific site in the target sequence. In some embodiments, the modification is at a specific allele of the target gene. Thus, the epigenetic modification can result in modulation (e.g., reduction) of expression of one copy of the target gene having a specific allele, but not other copies of the target gene. In some embodiments, the specific allele is associated with a disease, condition, or disorder.

[0193] In some embodiments, the epigenetic modification reduces or stops transcription of a target gene having a target sequence. In some embodiments, the epigenetic modification reduces or stops transcription of a copy of the target gene having a specific allele recognized by the epigenetic editor. In some embodiments, the epigenetic editor reduces or eliminates the expression of a protein encoded by the target gene. In some embodiments, the epigenetic editor reduces or eliminates the expression of a protein encoded by a copy of the target gene having a specific allele recognized by the epigenetic editor. The target CIITA gene can be epigenetically modified in vitro, ex vivo, or in vivo.

[0194] The effector domain of the epigenetic editors described herein can alter (e.g., install or remove) chemical modifications in nucleotides of a target gene or in histones associated with the target gene. The chemical modifications can be at a single nucleotide or a single histone, or at 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, or more nucleotides.

[0195] In some embodiments, the effector domain of an epigenetic editor described herein can alter CpG dinucleotides within a target gene, in some embodiments, all CpG dinucleotides within 2000 bp, 1500 bp, 1000 bp, 500 bp, or 200 bp flanking the target sequence (e.g., within a modification site described herein) are altered according to a modification type described herein, compared to the original state of the gene or the gene in a comparable cell not contacted with the epigenetic editor. In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, or more of the CpG dinucleotides are altered compared to the original state of the gene or the gene in a comparable cell not contacted with an epigenetic editor. In some embodiments, at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the CpG dinucleotides are altered compared to the original state of the gene or the gene in a comparable cell not contacted with an epigenetic editor, in some embodiments, one single CpG dinucleotide is altered compared to the original state of the gene or the gene in a comparable cell not contacted with an epigenetic editor.

[0196] The effector domain of the epigenetic editors described herein can alter the histone modification state of histones associated with or bound to a target gene. For example, the effector domain can place a modification at one or more lysine residues in the histone tails of the histones associated with the target gene. In some embodiments, the effector domain can cause deacetylation of one or more histone tails of the histones associated with the target gene, thereby reducing or silencing expression of the target gene. In some embodiments, the histone modification state is a methylation state. For example, the effector domain can cause H3K9, H3K27, or H4K20 methylation (e.g., one or more of H3K9me2, H3K9me3, H3K27me2, H3K27me3, and H4K20me3 methylation) in one or more histone tails associated with the target gene, thereby reducing or silencing expression of the target gene.

[0197] In some embodiments, all histone tails of histones bound to DNA nucleotides within 2000 bp, 1500 bp, 1000 bp, 500 bp, or 200 bp flanking the target sequence are altered according to a modification type described herein, compared to the original state of the chromosome or a chromosome in a comparable cell not contacted with an epigenetic editor. In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120 or more histone tails of the bound histones are altered compared to the original state of the chromosome or compared to a chromosome in a comparable cell not contacted with an epigenetic editor. In some embodiments, at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the histone tails of the bound histones are altered compared to the original state of the chromosome or a chromosome in a comparable cell not contacted with an epigenetic editor. For example, one single histone tail of the bound histones can be altered compared to the original state of the chromosome or a chromosome in a comparable cell not contacted with an epigenetic editor. As another example, one single bound histone octamer can be altered compared to the original state of the chromosome or a chromosome in a comparable cell not contacted with an epigenetic editor.

[0198] The chemical modification placed at a target gene DNA nucleotide or histone residue can be at or near a target sequence in the target gene. In some embodiments, the effector domain of the epigenetic editor described herein changes the chemical modification state of a nucleotide or histone tail bound to a nucleotide 100-200, 200-300, 300-400, 400-55, 500-600, 600-700, or 700-800 nucleotides 5' or 3' to a target sequence in the target gene. In some embodiments, the effector domain alters the chemical modification state of a nucleotide or a histone tail attached to a nucleotide that is within 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, or 2000 nucleotides adjacent to the target sequence. As used herein, "adjacent to" refers to nucleotide positions 5' to the 5' end and 3' to the 3' end of a particular sequence, eg, a target sequence.

[0199] In some embodiments, the effector domain mediates or induces a change in the chemical modification of a nucleotide or histone tail attached to a nucleotide distal to the target sequence. Such modification can be initiated near the target sequence and then extend to one or more nucleotides distal to the target sequence in the target gene. For example, the effector domain can initiate a change in the chemical modification state of one or more nucleotides or one or more histone residues attached to one or more nucleotides within 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, or 500 nucleotides adjacent to the target sequence, and the change in the chemical modification state can be extended to the target sequence in the target gene. for one or more nucleotides either upstream or downstream of the target sequence, for at least 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2500, 3000, or more nucleotides. In certain embodiments, chemical modifications may begin at less than 2, 3, 5, 10, 20, 30, 40, 50, or 100 nucleotides in the target gene and may extend to at least 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, or more nucleotides in the target gene. In some embodiments, chemical modifications extend to the entire nucleotides of the target gene. Additional proteins or transcription factors, such as transcription repressors, methyltransferases, or transcriptional regulatory scaffold proteins, may be involved in the extension of the chemical modifications. Alternatively, an epigenetic editor alone may be involved.

[0200] In some embodiments, the epigenetic editors described herein reduce expression of a target gene by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or more relative to a control cell, control tissue, or control subject (e.g., in the absence of the epigenetic editor), as measured by transcription of the target gene copy in a cell, tissue, or subject. In some embodiments, the epigenetic editors described herein reduce expression of a target gene copy by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or more relative to a control cell, control tissue, or control subject, as measured by transcription of the target gene copy in a cell, tissue, or subject. In certain embodiments, the copy of the target gene has a specific sequence or allele that is recognized by the epigenetic editor. In certain embodiments, the epigenetically modified copy encodes a functional protein, and thus, the epigenetic editors disclosed herein can reduce or abolish the expression and / or function of the protein.For example, the epigenetic editors described herein may reduce the expression and / or function of a protein encoded by a target gene in a cell, tissue, or subject by at least 3 fold, at least 4 fold, at least 5 fold, at least 6 fold, at least 7 fold, at least 8 fold, at least 9 fold, at least 10 fold, at least 11 fold, at least 12 fold, at least 13 fold, at least 14 fold, at least 15 fold, at least 20 fold, at least 25 fold, at least 30 fold, at least 35 fold, at least 40 fold, at least 45 fold, at least 50 fold, at least 60 fold, at least 70 fold, at least 80 fold, at least 90 fold, or at least 100 fold in comparison to a control cell, control tissue, or control subject.

[0201] Modulation of target gene expression can be assayed by determining any parameter that is indirectly or directly affected by expression of the target gene, such as changes in RNA or protein levels, changes in protein activity, changes in product levels, changes in downstream gene expression, changes in transcription or activity of reporter genes such as luciferase, CAT, beta-galactosidase, or GFP, changes in signal transduction, changes in phosphorylation and dephosphorylation, changes in receptor-ligand interactions, changes in second messengers such as cGMP, cAMP, IP3, and Ca2 +These include changes in the concentration of ATP, changes in cell growth, changes in angiogenesis, and / or changes in any functional effect of gene expression. Measurements can be made in vitro, in vivo, and / or ex vivo and can be made by conventional methods, such as measuring RNA or protein levels, measuring RNA stability, and / or determining downstream or reporter gene expression. Readouts can be, for example, by chemiluminescence, fluorescence, colorimetric reactions, antibody binding, inducible markers, ligand binding assays, changes in intracellular second messengers such as cGMP and inositol triphosphate (IP3), changes in intracellular calcium levels, cytokine release, etc.

[0202] Methods for determining the expression level of a gene, e.g., a target of an epigenetic editor, can include determining the transcript level of the gene by, for example, reverse transcription PCR, quantitative RT-PCR, droplet digital PCR (ddPCR), Northern blot, RNA sequencing, DNA sequencing (e.g., sequencing of complementary deoxyribonucleic acid (cDNA) obtained from RNA), next-generation (Next-Gen) sequencing, nanopore sequencing, pyrosequencing, or nanostring sequencing. The level of protein expressed from the gene can be determined by, for example, Western blotting, enzyme-linked immunosorbent assay, mass spectrometry, immunohistochemistry, or flow cytometry analysis. The level of gene expression product may be normalized to an internal standard, e.g., total messenger ribonucleic acid (mRNA), or the expression level of a particular gene, e.g., a housekeeping gene.

[0203] In some embodiments, the effect of an epigenetic editor in modulating target gene expression can be tested using a reporter system. For example, an epigenetic editor may be designed to target a reporter gene encoding a reporter protein, e.g., a fluorescent protein. Expression of the reporter gene in such a model system can be monitored, for example, by flow cytometry, fluorescence-activated cell sorting (FACS), or fluorescence microscopy. In some embodiments, a cell population can be transfected with a vector carrying a reporter gene. The vector can be constructed such that the reporter gene is expressed when the vector is transfected into cells. Suitable reporter genes include genes encoding fluorescent proteins, e.g., green, yellow, cherry, cyan, or orange fluorescent proteins. A cell population carrying a reporter system can be transfected with DNA, mRNA, or a vector encoding an epigenetic editor targeted to the reporter gene.

[0204] VII. Epigenetically modified cells In one aspect, the present disclosure provides cells modified using one or more epigenetic editors described herein. In some embodiments, nucleic acid molecule(s) encoding the epigenetic editor or components thereof are administered to the cells. Any type of cell can be modified as described herein. Cells can be modified in vitro, in vivo, or ex vivo. Cells suitable for modification can be sourced from a patient or a healthy donor.

[0205] In some embodiments, the cell is an immune cell. Immune cells can include T cells, B cells, natural killer (NK) cells, dendritic cells, and monocytes / macrophages. In some embodiments, the cell is an alpha / beta T cell. In some embodiments, the cell is a gamma / delta T cell. In some embodiments, the cell is a cytotoxic T cell, e.g., CD8 + In some embodiments, the cells are helper T cells, e.g., CD4 + In some embodiments, the cell is a helper T cell. In some embodiments, the cell is a regulatory T cell. In some embodiments, the cell is a NK cell. In some embodiments, the cell is a dendritic cell. In some embodiments, the cell is a macrophage.

[0206] In some embodiments, the cell is a stem cell. "Stem cell" refers to an undifferentiated cell that can give rise indefinitely to more stem cells of the same type, from which other specialized cells can arise by differentiation. Adult stem cells are usually multipotent, while induced or embryo-derived stem cells are pluripotent.

[0207] In some embodiments, the cells are progenitor cells. "Progenitor cells" refer to cells that can differentiate to form one or more types of cells, but have limited self-renewal capacity in vitro and in vivo.

[0208] In some embodiments, the cells are capable of differentiating into immune cells as described above. The cells may be, for example, embryonic stem cells (ESCs), hematopoietic stem cells (HSCs), hematopoietic progenitor cells (HPCs), or hematopoietic stem and progenitor cells (HSPCs). "Hematopoietic stem and progenitor cells" or "HSPCs" are cells that express the antigen marker CD34 (CD34 + In certain embodiments, the term "HSPC" refers to cells that express the antigen marker CD34 (CD34 + ) and the absence of lineage (lin) markers. + and / or Lin- The population of cells that are hematopoietic stem cells and hematopoietic progenitor cells.

[0209] In some embodiments, the cells are induced pluripotent stem cells (iPSCs) reprogrammed from somatic cells, such as T cells.

[0210] In some embodiments, the cells are obtained from the umbilical cord blood of a healthy donor, hi some embodiments, the cells are obtained from the mature peripheral blood of a healthy donor, or are mobilized from the bone marrow of a healthy donor.

[0211] In some embodiments, the cells described above are modified by a method comprising transfecting the cells with (a) one or more epigenetic editors described herein, or (b) a system comprising a nucleic acid molecule encoding the epigenetic editor. In certain embodiments, the modified cells are T cells. In some embodiments, the modified T cells express one or more epigenetic editors that can selectively reduce or silence expression of one or more target genes in the cells. In certain embodiments, the target gene is CIITA. In some embodiments, the T cells are modified ex vivo. The modified T cells, in some embodiments, can further express an engineered TCR or CAR against at least one antigen expressed on the surface of a target cell (e.g., a malignant or infected cell). In some embodiments, the modified T cells do not express at least one gene encoding an endogenous TCR component. In certain embodiments, the modified T cells are non-alloreactive. In certain embodiments, the modified T cells are particularly suitable for allogeneic transplantation.

[0212] VII. Pharmaceutical Compositions In one aspect, the disclosure provides pharmaceutical compositions comprising as an active ingredient (or as the only active ingredient) one or more epigenetic editors or components thereof (e.g., fusion proteins and / or guide polynucleotides) described herein, or nucleic acid molecules encoding said epigenetic editors or components thereof. For example, a pharmaceutical composition may comprise a nucleic acid molecule encoding a fusion protein (and, if applicable, a guide polynucleotide) of an epigenetic editor described herein. In some embodiments, separate pharmaceutical compositions comprise the fusion protein and the guide polynucleotide.

[0213] In one aspect, the disclosure provides a pharmaceutical composition comprising as an active ingredient (or as the only active ingredient): (a) a cell that has undergone an epigenetic modification mediated or induced by one or more epigenetic editors provided herein, e.g., wherein a nucleic acid molecule encoding the epigenetic editor has been administered to the cell ex vivo.

[0214] Generally, an epigenetic editor or a component thereof described herein, or a nucleic acid molecule encoding said epigenetic editor or a component thereof, or a cell modified by an epigenetic editor of the present disclosure, is suitable for administration as a formulation in combination with one or more pharmaceutically acceptable excipients, e.g., as described below.

[0215] The term "excipient" as used herein describes any ingredient other than the compound of the present disclosure. The choice of excipient will largely depend on factors such as the specific mode of administration, the effect of the excipient on solubility and stability, and the nature of the dosage form. As used herein, "pharmaceutically acceptable excipient" includes any and all physiologically compatible solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonicity agents and absorption delaying agents, etc. Some examples of pharmaceutically acceptable excipients are water, saline, phosphate buffered saline, dextrose, glycerol, ethanol, etc., and combinations thereof. In many cases, it is preferable to include an isotonicity agent, for example, a sugar, a polyalcohol such as mannitol or sorbitol, or sodium chloride in the composition. Further examples of pharmaceutically acceptable substances are wetting agents or minor amounts of auxiliary substances such as wetting agents or emulsifying agents, preservatives, or buffers that enhance the shelf life or effectiveness of the antibody.

[0216] Pharmaceutical compositions suitable for parenteral administration typically contain an active ingredient combined with a pharmaceutically acceptable carrier, such as sterile water or sterile isotonic saline. Such formulations can be prepared, packaged, or sold in a form suitable for bolus administration or continuous administration. The pharmaceutical compositions described herein can be administered to a subject, for example, subcutaneously, intradermally, intratumorally, intranodally, intramuscularly, intravenously, intralymphatically, or intraperitoneally. In certain embodiments, the pharmaceutical compositions of the present disclosure are administered to a subject intravenously.

[0217] IX. Delivery method In some embodiments, the epigenetic editor or a component thereof is introduced into a target cell in the form of a nucleic acid molecule encoding the epigenetic editor or a component thereof; thus, the pharmaceutical compositions herein comprise the nucleic acid molecule. Such nucleic acid molecules may be, for example, DNA, RNA, or mRNA, and / or modified nucleic acid sequences (e.g., having a chemical modification, a 5' cap, or one or more 3' modifications). In some embodiments, the nucleic acid molecule can be delivered as naked DNA or RNA, for example, by transfection or electroporation, or conjugated to a molecule (e.g., N-acetylgalactosamine) that facilitates uptake by the target cell. In some embodiments, the nucleic acid molecule may be in a nucleic acid expression vector, which may include expression control sequences such as a promoter, an enhancer, a transcription signal sequence, a transcription termination sequence, an intron, a polyadenylation signal, a Kozak consensus sequence, an internal ribosome entry site (IRES), and the like. Such expression control sequences are well known in the art. The vector may also include a sequence encoding a signal peptide (e.g., for nuclear, nucleolar, or mitochondrial localization) linked to (e.g., inserted into or fused to) the protein-encoding sequence.

[0218] Examples of vectors include, but are not limited to, plasmid vectors; viral vectors based on vaccinia virus, poliovirus, adenovirus, adeno-associated virus, SV40, herpes simplex virus, human immunodeficiency virus, retrovirus (e.g., murine leukemia virus, or spleen necrosis virus, Rous sarcoma virus, Harvey sarcoma virus, avian leukosis virus, lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary carcinoma virus); and other recombinant vectors. In certain embodiments, the vector is a plasmid or viral vector. Viral particles or virus-like particles (VLPs) can also be used to deliver nucleic acid molecules encoding the epigenetic editors described herein or components thereof. For example, "empty" viral particles can be assembled to contain any suitable cargo. Viral vectors and viral particles can also be engineered to incorporate targeting ligands to alter target tissue specificity.

[0219] In certain embodiments, the epigenetic editors described herein or components thereof are encoded by nucleic acid sequences present in one or more viral vectors, or suitable capsid proteins of any viral vector. Examples of viral vectors include adeno-associated viral vectors (e.g., derived from AAV3, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAV10, and / or variants thereof), retroviral vectors (e.g., Moloney murine leukemia virus, MML-V), adenoviral vectors (e.g., AD100), lentiviral vectors (e.g., vectors based on HIV and FIV), and herpesviral vectors (e.g., HSV-2).

[0220] In some embodiments, delivery comprises an adeno-associated virus (AAV) vector. AAV vector delivery can be particularly useful, where the DNA binding domain of the epigenetic editor fusion protein is a zinc finger array. Without wishing to be bound by any theory, the smaller size of the zinc finger array compared to the larger DNA binding domain, such as the Cas protein domain, allows such fusion proteins to be conveniently packaged in a viral vector, such as an AAV vector.

[0221] Any AAV serotype, e.g., a human AAV serotype, can be used for the AAV vectors described herein, including, but not limited to, AAV serotype 1 (AAV1), AAV serotype 2 (AAV2), AAV serotype 3 (AAV3), AAV serotype 4 (AAV4), AAV serotype 5 (AAV5), AAV serotype 6 (AAV6), AAV serotype 7 (AAV7), AAV serotype 8 (AAV8), AAV serotype 9 (AAV9), AAV serotype 10 (AAV10), and AAV serotype (AAV11), and variants thereof. In some embodiments, the AAV variant has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity to wild-type AAV. In certain embodiments, AAV variants can be engineered so that their capsid proteins are less immunogenic in humans or have enhanced transduction capabilities. In some instances, one or more regions of at least two different AAV serotypes are shuffled and reassembled to generate chimeric variants. For example, a chimeric AAV may contain inverted terminal repeats (ITRs) of a heterologous serotype compared to the capsid serotype. The resulting chimeric AAV may have different antigenic reactivity or recognition compared to its parent serotype. In some embodiments, a chimeric AAV variant contains amino acid sequences derived from two, three, four, five, or more different AAV serotypes.

[0222] As described herein, non-viral systems are also contemplated for delivery. Non-viral systems include, but are not limited to, nucleic acid transfection methods including electroporation, sonoporation, calcium phosphate transfection, microinjection, DNA biolistics, lipid-mediated transfection, heat shock transfection, compact DNA-mediated transfection, lipofection, cationic drug-mediated transfection, and transfection using liposomes, immunoliposomes, exosomes, or cationic facial amphiphiles (CFAs). In certain embodiments, one or more mRNAs encoding the epigenetic editor fusion proteins described herein can be co-electroporated with one or more guide polynucleotides (e.g., gRNAs) described herein. One important category of non-viral nucleic acid vectors are nanoparticles, which may be organic (e.g., lipid) or inorganic (e.g., gold). For example, organic (e.g., lipid and / or polymer) nanoparticles may be suitable for use as delivery vehicles in certain embodiments of the present disclosure.

[0223] In some embodiments, delivery is achieved using lipid nanoparticles (LNPs). LNP compositions are typically on the order of micrometers or smaller in size and may comprise a lipid bilayer. In some embodiments, LNPs refer to any particle having a diameter smaller than 1000 nm, 500 nm, 250 nm, 200 nm, 150 nm, 100 nm, 75 nm, 50 nm, or 25 nm. In some embodiments, nanoparticles may be in the size range of 1-1000 nm, 1-500 nm, 1-250 nm, 25-200 nm, 25-100 nm, 35-75 nm, or 25-60 nm. Nanoparticle compositions include lipid nanoparticles (LNPs), liposomes (e.g., lipid vesicles), and lipoplexes.

[0224] The LNPs described herein can be made from cationic, anionic, or neutral lipids. In some embodiments, LNPs may include a neutral lipid, such as the fusogenic phospholipid 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), or the membrane component cholesterol as a helper lipid to enhance transfection activity and nanoparticle stability. In some embodiments, LNPs may include hydrophobic lipids, hydrophilic lipids, or both hydrophobic and hydrophilic lipids. Any lipid or combination of lipids known in the art can be used to produce LNPs. Lipids can be mixed in any molar ratio to produce LNPs. In some embodiments, the LNPs are T cell-targeting LNPs (e.g., selectively or specifically targeting T cells).

[0225] X. Therapeutic Uses of Epigenetic Editors and Modified Cells The present disclosure also provides methods for treating or preventing a condition in a subject, the method comprising administering to the subject: a) one or more epigenetic editors described herein; b) a nucleic acid molecule encoding the epigenetic editor; c) a cell modified by the epigenetic editor; or d) a pharmaceutical composition comprising any of a)-c).

[0226] In one aspect, an epigenetic editor can modulate expression of a target gene associated with a disease, condition, or disorder in a subject by effecting epigenetic modification of a target polynucleotide sequence in the target gene to treat or prevent the disease, condition, or disorder. In some embodiments, the epigenetic editor reduces expression of the target gene sufficiently to achieve a desired effect, e.g., a therapeutically relevant effect, such as prevention or treatment of the disease, condition, or disorder.

[0227] In one aspect, a disease, condition, or disorder can be treated by administering cells (e.g., allogeneic cells) modified with one or more epigenetic editors of the present disclosure as a pharmaceutical to a subject having the disease, condition, or disorder. In some embodiments, the subject is administered allogeneic T cells that have been epigenetically modified as described herein, e.g., to have reduced or silenced CIITA expression. In some embodiments, the modified T cells further express an engineered TCR or CAR against at least one antigen expressed on the surface of a target cell (e.g., a malignant or infected cell). In some embodiments, the modified T cells do not express at least one gene encoding an endogenous TCR component.

[0228] In some embodiments, the subject may be a mammal, e.g., a human, hi some embodiments, the subject is selected from non-human primates, such as chimpanzees, cynomolgus monkeys, or macaques, and other ape and monkey species.

[0229] X.Definition As used herein, the term "nucleic acid" refers to any oligonucleotide or polynucleotide containing nucleotides (e.g., deoxyribonucleotides or ribonucleotides) in either single- or double-stranded form, including DNA and RNA. A "nucleotide" comprises the sugar deoxyribose (DNA) or ribose (RNA), a base, and a phosphate group, linked through the phosphate group. "Base" includes naturally occurring compounds, e.g., adenine, thymine, guanine, cytosine, uracil, inosine, and purines and pyrimidines, including natural analogs, as well as synthetic derivatives of purines and pyrimidines, including, but not limited to, modified versions incorporating new reactive groups, e.g., amines, alcohols, thiols, carboxylic acids, alkyl halides, and the like. Nucleic acids can contain known nucleotide analogs and / or modified backbone residues or linkages, which may be synthetic, naturally occurring, or non-naturally occurring. Such nucleotide analogs, modified residues, and modified linkages are well known in the art and can result in nucleic acid molecules with enhanced cellular uptake, reduced immunogenicity, and / or increased stability in the presence of nucleases.

[0230] As used herein, an "isolated" or "purified" nucleic acid molecule is a nucleic acid molecule that exists away from its native environment. For example, an "isolated" or "purified" nucleic acid molecule (1) is separated from the nucleic acid of its source, genomic DNA or cellular RNA, and / or (2) is not found in nature. In some embodiments, an "isolated" or "purified" nucleic acid molecule is a recombinant nucleic acid molecule.

[0231] It will be understood that in addition to the specific proteins and nucleic acid molecules referred to herein, the present disclosure also contemplates the use of variants, derivatives, homologs, and fragments thereof. A variant of any given sequence can have a specific sequence of residues (whether amino acid or nucleic acid residues) that have been altered in such a way that the polypeptide or polynucleotide in question substantially retains at least one of its intrinsic functions. A variant sequence can be obtained by adding, deleting, substituting, modifying, replacing, and / or varying at least one residue (in some embodiments, 1 or less, 2 or less, 3 or less, 4 or less, 5 or less, 6 or less, 7 or less, 8 or less, 9 or less, 10 or less, 15 or less, or 20 or less residues) present in the naturally occurring sequence. For certain proteins described herein (e.g., the KRAB, dCas9, DNMT3A, and DNMT3L proteins described herein), the present disclosure also contemplates either naturally occurring forms of the proteins or variants or homologs that retain at least one of their endogenous functions (e.g., at least 50%, 60%, 70%, 80%, 90%, 85%, 96%, 97%, 98%, or 99% of that function compared to the particular protein described).

[0232] As used herein, a homolog of any polypeptide or nucleic acid sequence contemplated herein includes a sequence having a certain homology with the wild-type amino acid and nucleic acid sequence. Homologous sequences can include sequences, e.g., amino acid sequences, that may be at least 50%, 55%, 65%, 75%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the subject sequence. The term "percent identical" in the context of amino acid or nucleotide sequences refers to the percentage of residues that are the same in two sequences when aligned for maximum correspondence. In some embodiments, the length of the reference sequence aligned for comparison purposes is at least 30% (e.g., at least 40, 50, 60, 70, 80, or 90%, or 100%) of the reference sequence. Sequence identity can be measured using sequence analysis software (e.g., the Genetics Computer Group's Sequence Analysis Software Package, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705, BLAST, BESTFIT, GAP, or PILEUP / PRETTYBOX programs). Such software matches identical or similar sequences by assigning degrees of homology to various substitutions, deletions, and / or other modifications. In an exemplary approach to determining the degree of identity, the BLAST program can be used, with a probability score of e-3 to e-100 indicating closely related sequences.

[0233] The percent identity of two nucleotide or polypeptide sequences is determined, for example, using BLAST® with default parameters (available at the website of the U.S. National Library of Medicine's National Center for Biotechnology Information). In some embodiments, the length of a reference sequence aligned for comparison purposes is at least 30% (e.g., at least 40, 50, 60, 70, 80, or 90%) of the reference sequence.

[0234] It will be understood that the numbering of specific positions or residues in a polypeptide sequence will depend on the particular protein and numbering scheme used. Numbering may differ, for example, between precursors of the mature protein and the mature protein itself, and sequence differences between species may affect numbering. One of skill in the art will be able to identify any homologous proteins and their respective residues in their respective encoding nucleic acids by methods well known in the art, such as sequence alignment and determination of homologous residues.

[0235] The terms "modulate" or "alter" refer to a change in the amount, degree, or extent of a function. For example, the epigenetic editors described herein can modulate the activity of a promoter sequence by binding to a motif within the promoter, thereby inducing, enhancing, or repressing transcription of a gene operably linked to the promoter sequence. As another example, the epigenetic editors described herein can block RNA polymerase from transcribing a gene or inhibit translation of an mRNA transcript. The terms "inhibit," "suppress," "repress," "silencing," and the like, when used in reference to the epigenetic editors described herein or components thereof, refer to reducing or preventing the activity (e.g., transcription) of a nucleic acid sequence (e.g., a target gene) or protein compared to the activity of the nucleic acid sequence or protein in the absence of the epigenetic editor or components thereof. The terms can include partially or completely blocking activity, or preventing or delaying activity. Inhibited activity can be, for example, 10% less, 20% less, 30% less, 40% less, 50% less, 60% less, 70% less, 75% less, 80% less, 85% less, 90% less, 91% less, 92% less, 93% less, 94% less, 95% less, 96% less, 97% less, 98% less, or 99% less than that of the control, or can be, for example, at least 1.5-, 2-, 3-, 4-, 5-, or 10-fold less than that of the control.

[0236] The term "about" or "approximately" means within an acceptable range of error for a particular value, as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, e.g., the limitations of the measurement system. For example, "about" can mean within one or more standard deviations, as is customary for a given value. When a particular value is described in this application and claims, unless otherwise indicated, the term "about" should be assumed to mean within an acceptable range of error for that particular value.

[0237] It is understood that the ranges provided herein include all truncated forms of values within the range. For example, a range of 1 to 50 is understood to include any number, combination of numbers, or subrange from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50, as well as all intervening decimal values between the foregoing integers, such as 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, and 1.9. With respect to subranges, "nested sub-ranges" extending from either endpoint of the range are specifically contemplated. For example, nested sub-ranges of the exemplary range of 1 to 50 could include 1 to 10, 1 to 20, 1 to 30, and 1 to 40 in one direction, or 50 to 40, 50 to 30, 50 to 20, and 50 to 10 in the other direction.

[0238] Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure shall have the meanings commonly understood by those of ordinary skill in the art. Exemplary methods and materials are described below, although methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure. In the case of conflict, the present specification, including definitions, will control. Furthermore, unless otherwise required by context, singular terms shall include plural terms and plural terms shall include the singular. Throughout this specification and embodiments, the words "have" and "comprise," or variations such as "has," "having," "comprises," or "comprising," will be understood to imply the inclusion of the stated integer or group of integers, but not the exclusion of any other integer or group of integers. Unless otherwise indicated, the recitation of a list of elements herein includes any of the elements, alone or in any combination. The description of an embodiment herein includes that embodiment as a single embodiment or in combination with any other embodiment herein. All publications, patents, patent applications, and other references mentioned herein are incorporated by reference in their entirety. To the extent that a reference incorporated by reference conflicts with the present disclosure contained herein, it is intended that the present specification take precedence and / or supersede any such conflicting material. Although several documents are cited herein, this citation does not constitute an acknowledgment that any of these documents form part of the common general knowledge in the art.

[0239] According to this disclosure, a backward reference in a dependent claim is intended as a shorthand for a direct and clear disclosure of the respective individual claim combination indicated by the backward reference. Furthermore, the headings herein are made for ease of organization and are not intended in any way to limit the scope of the claimed invention.

[0240] In order that this disclosure may be better understood, the following examples are set forth. These examples are for illustrative purposes only and are not to be construed as limiting the scope of the disclosure in any way. [Example]

[0241] Example 1 Fusion protein design and synthesis A fusion protein ("CRISPR-off") containing dCas9, DNMT3A, DNMT3L, and KOX1 KRAB was produced. From N- to C-terminus, the protein had the following functional domains and linker: NMT3A-linker-huDNMT3L-XTEN80-NLS-dSpCas9-NLS-XTEN16-huKOX1 KRAB (SEQ ID NO: 658). The CRISPR-off plasmid construct is described in Nunez et al., Cell (2021) 184(9):2503-19.

[0242] ZF fusion proteins containing DNMT3A, 3L, and KOX1 KRAB ("ZF-off") were also produced. These fusion proteins had the following general structure: huDNMT3A-linker-huDNMT3L-XTEN80-NLS-ZFP domain-NLS-XTEN16-huKOX1 KRAB (SEQ ID NO: 659).

[0243] Example 2 Selection of the CIITA region for gRNA targeting gRNA targeting genomic regions within + / - 750 bp of the primary canonical CIITA transcription start site (TSS1) (chr16:10877202) and within -50 / +280 bp of the alternative downstream transcription start site (TSS2) (chr16:10878968) were computationally designed using the Benchling gRNA platform for human (GRCh38). gRNAs containing poly-TTTT sequences were first discarded. gRNA off-target analysis was performed using CasOFFinder (Bae et al., Bioinformatics (2014) 30(10):1473-5). If gRNAs matched multiple locations across the target genome, they were discarded.

[0244] A final set of 239 gRNA sequences targeting TSS1 and 40 gRNA sequences targeting TSS2 was selected for primary screening in primary human T cells (Table 8; see Tables 2 and 3 for gRNA target and targeting domain sequences, respectively). DNA plasmids containing coding sequences for gRNAs under the control of a U6 promoter were ordered from a supplier.

[0245] [Table 8] TIFF2025525389000036.tif250161TIFF2025525389000037.tif250161TIFF2025525389000038.tif250161 TIFF2025525389000039.tif250161TIFF2025525389000040.tif250161TIFF2025525389000041.tif147159

[0246] Example 3 Selection of ZF target sites and design of ZFPs A library of two-finger ZFPs (2F units), each recognizing a 6-bp DNA site, was used to design a larger six-finger ZFP array targeting an 18-bp DNA binding site. The source of the 2F units was a set of three-finger zinc finger proteins selected to bind specific target sites using the bacterial two-hybrid (B2H) selection system (Hurt et al., PNAS (2003) 100:12271-6; Maeder et al., Mol Cell (2008) 31(2):294-301). A list of targetable DNA sites was created by generating all possible triplet combinations of the 6-bp binding sites represented in the library, allowing 0 or 1 bp between the 6-bp target sites. To identify ZF target sites within human CIITA, sequences within 1 kb of TSS1 (human (GRCh38)) were examined against this list.

[0247] For each identified ZF target site, multiple ZF proteins can be designed. The six recognition helices used to generate all proteins were designed by selecting 2F units and taking into account factors such as the known binding selectivity of zinc finger proteins, the frequency with which amino acids at positions -1, 2, 3, and 6 were selected in the B2H selection system to bind to the desired target base, avoidance of amino acids at positions -1, 2, 3, and 6 selected to bind multiple different bases in B2H, and maintaining context-dependence by matching flanking bases where possible. The complete ZF sequence was derived from the naturally occurring Zif268 protein, maintaining the selected recognition helices in the sequence context in which they were selected in B2H (either fingers 1-2 or fingers 2-3 from Zif268).

[0248] The 2F units were linked by the linker TGSQKP (SEQ ID NO: 651), which separated the 6-bp binding sites by a contiguous linker, and by the linker TGGGGSQKP (SEQ ID NO: 652), which separated the 6-bp binding sites by a single linker. A final set of 237 ZFPs targeting 55 distinct DNA binding sites within 1 kb of CIITA TSS1 (chr16:10877202) with no other exact matches to the genome (GRCh38) were selected for the primary screen (Table 1).

[0249] Example 4 Screening for guide RNAs in primary human T cells This example describes a study in which gRNAs were screened for efficacy in targeting CIITA in primary human T cells.

[0250] T cells were isolated from human leukapheresis transfusion products (StemCell Technologies, catalog number 70500) using the EasySep™ Human T Cell Isolation Kit (StemCell Technologies, catalog number 17951). Prior to nucleofection, T cells were thawed, washed, and stimulated using Dynabeads Human T Cell Activator CD3 / CD28 (Thermo Fisher, Catalog No. 11131D) for T cell expansion and activation at a 3:1 bead:cell ratio in T cell medium (X-VIVO15 medium (Lonza®, Catalog No. BEBP04-744Q)) supplemented with 5% human AB serum (Gemini Bio-Product, Catalog No. 100-512), 2 mM L-alanyl-L-glutamine, 100 U / ml IL-2, 10 ng / ml IL-7, and 10 ng / ml IL-15 for approximately 72 hours at 37°C with 5% CO. The beads were then removed from the culture with a magnet, and the T cells were cultured in fresh complete T cell medium for approximately 24 hours. T cells were then nucleofected at 2E5 cells / well with 5 μg of CRISPR-off mRNA (TriLink) + 2.5 μg of sg RNA (IDT) using a P3 Primary Cell 96-well Nucleofector Kit (Lonza®, catalog number V4SP-3960) and an Amaxa 4D nucleofector® (Lonza) with pulse code EO115.

[0251] After nucleofection, T cells were resuspended in complete T cell medium and maintained by medium changes and passage twice weekly as needed. Cells were restimulated with ImmunoCult™ Human CD3 / CD28 T cell activator (StemCell Technologies, catalog no. 10991) on day 13 after nucleofection.

[0252] Cell surface HLA-DR protein expression on live T cells was assessed by flow cytometry at days 6 and 20 after nucleofection. Controls of no mRNA, CRISPR-off mRNA + non-CIITA-targeting sgRNA, CRISPR-off mRNA without gRNA, WT Cas9 mRNA + exon-targeting sgRNA, staining only (no mRNA or gRNA), isotype (no mRNA or gRNA), and no staining (no mRNA or gRNA) were also run on each screening plate.

[0253] HLA-DR flow cytometry On days 6 and 20 after nucleofection, aliquots of T cells were evaluated by flow cytometry staining, while the remaining aliquots of cells were continuously maintained in culture. The medium was aspirated from the cells to be stained, washed once with PBS containing 2% PBS, and stained for 20 minutes at 4°C with a PE-conjugated anti-human HLA-DR antibody (BioLegend, catalog number 327008) diluted 1:300 and Zombie Violet™ Fixable Viability Dye (BioLegend, catalog number 423113) prepared according to the manufacturer's recommendations at a dilution of 1:1000 in PBS containing 2% FBS. The stained cells were washed and incubated for 20 minutes in fixation buffer (BioLegend, catalog number 420801). The cells were then washed prior to acquisition on an Agilent Novocyte Penteon flow cytometer, which can collect up to 20,000 live cell events per well. Screening conditions were compared to negative (CRISPR-Off mRNA without sgRNA) control expression levels to assess % silencing.

[0254] result The relative HLA-DR expression levels measured in two separate experiments at days 6 and 20 in cells nucleofected with one of the 279 tested gRNAs, and the corresponding genomic distance of each gRNA relative to the CIITA TSS1, are shown in Figures 1A-1D and Table 9. The best-performing CIITA gRNAs are shown in bold in Table 9.

[0255] Silencing of the CIITA gene was observed after treatment with several gRNA candidates, resulting in only 30-40% HLA-DR expression compared to the negative control without gRNA. The sequences and efficacy of the gRNAs tested are listed in Table 9. The relative efficiency of CIITA silencing is measured by the reduction in HLA-DR cell surface expression.

[0256] Relative HLA-DR expression represents the averaged frequency of HLA-DR-positive cells in treated samples expressed as a percentage of the mean over the negative control condition without gRNA. The top 40 gRNAs showing significant CIITA silencing, as evidenced by low HLA-DR cell surface protein expression, were selected for secondary screening.

[0257] [Table 9] TIFF2025525389000043.tif241170TIFF2025525389000044.tif241170TIFF2025525389000045.tif241170TIFF202 5525389000046.tif241170TIFF2025525389000047.tif241170TIFF2025525389000048.tif241170TIFF20255253890 00049.tif241170TIFF2025525389000050.tif241170TIFF2025525389000051.tif241170TIFF2025525389000052.t if241170TIFF2025525389000053.tif241170TIFF2025525389000054.tif241170TIFF2025525389000055.tif111170

[0258] Example 5 Screening of ZFs in primary T cells This example describes a study in which ZFP domains targeting different genomic regions of the CIITA gene were screened in human primary T cells.

[0259] T cells are isolated from human leukapheresis transfusion products and cryopreserved. Prior to nucleofection, T cells are thawed and stimulated with CD3 / CD28 in complete T cell medium at 37°C with 5% CO2 for approximately 48 hours. The beads are then removed from the culture with a magnet, and the T cells are cultured in fresh complete T cell medium. T cells are nucleofected with ZF-off mRNA using a Lonza Amaxa 4D nucleofector®. After nucleofection, T cells are resuspended in complete T cell medium and maintained by changing the medium and splitting the cells twice a week as needed. Cells are restimulated with soluble CD3 / CD28 T cell activator on day 13 after nucleofection. Cell surface HLA-DR protein expression on live T cells is assessed by flow cytometry on days 6, 13, and 20 after nucleofection. No mRNA, non-CIITA-targeting ZF-off mRNA, WT Cas9 mRNA + exon-targeting gRNA, staining only, isotype, and no staining controls are also run on each screening plate.

[0260] On days 6, 13, and 20 after nucleofection, aliquots of T cells are assessed by flow cytometry staining, while the remaining aliquots of cells are continuously maintained in culture. Cells are stained with PE-conjugated anti-human HLA-DR antibody and Fixable Viability Dye and acquired on a flow cytometer that collects up to 20,000 live cell events per well. Screening conditions are compared to negative (CRISPR-off mRNA without sgRNA) control expression levels to assess % silencing.

[0261] Example 6 Screening of constructs for full specificity in primary human T cells The specificity of CRISPR-off and ZF-off constructs for silencing CIITA was tested in primary human T cells. RNA-seq, methylation arrays, and whole-genome bisulfite sequencing assays were used to assess specificity. Genome-wide expression and methylation changes following epigenetic editing were profiled compared to negative controls.

[0262] Example 7 CpG methylation patterns CpG methylation patterns in primary human T cells treated with CRISPR-off or ZF-off will be examined. Hybrid capture assays will be performed on bisulfite-treated DNA to examine the methylation patterns at CpG sites induced by CRISPR-off or ZF-off in a 1 kb region surrounding the CIITA TSS.

[0263] Example 8 Screening follow-up and hit validation The top hits from the gRNA and ZF-off screening are reconfirmed by repeating the screening experimental conditions and adjusting the dose of CRISPR-off mRNA + gRNA or ZF-off mRNA up and down as needed by several half logs to establish a dose-response profile. The gRNA and ZF-off mRNA that show the best potency and long-term persistence profile are selected for downstream candidate development.

[0264] Example 9 Allogeneic functional assay in primary T cells Allogeneic healthy donor CD4+ T cell responses to mock-modified or CIITA-silenced T cells will be assessed by mixed lymphocyte coculture assays and / or cytotoxicity assays.

[0265] CD4 counts of allogeneic healthy donors measured by flow cytometry for cell dye dilution and cell surface expression of activation markers, respectively.+ T cell proliferation and / or activation is assessed after co-culture with mock-modified or CIITA-silenced T cells. Responses to mock-modified cells are compared to those of allogeneic healthy donors. + A reduced response to CIITA-silenced cells is expected, indicating reduced T cell proliferation and activation.

[0266] Example 10 Additional Primary Screening

[0267] [Table 10] TIFF2025525389000057.tif249159TIFF2025525389000058.tif250160TIFF20255253890 00059.tif250160TIFF2025525389000060.tif250160TIFF2025525389000061.tif125159

[0268] Example 11 CIITA Secondary Screening The top gRNAs from the previously described primary screen were selected for secondary screening. Primary human T cells from donors DON006, DON007, and DON008 were nucleofected with 2.5 mg of gRNA and 2.5 mg of effector. Results are shown by donor in Figure 2.

[0269] Example 12 CIITA Dual Guide Screening This example describes a pairwise screening study of gRNAs for efficacy in targeting CIITA in primary human T cells.

[0270] T cells were isolated from human leukapheresis transfusion products (StemCell Technologies, catalog number 70500) using the EasySep™ Human T Cell Isolation Kit (StemCell Technologies, catalog number 17951). Prior to nucleofection, T cells were thawed, washed, and stimulated using Dynabeads Human T Cell Activator CD3 / CD28 (Thermo Fisher, Catalog No. 11131D) for T cell expansion and activation at a 3:1 bead:cell ratio in T cell medium (X-VIVO15 medium (Lonza®, Catalog No. BEBP04-744Q)) supplemented with 5% human AB serum (Gemini Bio-Product, Catalog No. 100-512), 2 mM L-alanyl-L-glutamine, 100 U / ml IL-2, 10 ng / ml IL-7, and 10 ng / ml IL-15 for approximately 72 hours at 37°C with 5% CO. The beads were then removed from the culture with a magnet, and the T cells were cultured in fresh complete T cell medium for approximately 24 hours. T cells were then nucleofected at 2E5 cells / well with 5 μg of CRISPR-off mRNA (TriLink) + 2.5 μg of sg RNA (IDT) using a P3 Primary Cell 96-well Nucleofector Kit (Lonza®, catalog number V4SP-3960) and an Amaxa 4D nucleofector® (Lonza) with pulse code EO115.

[0271] After nucleofection, T cells were resuspended in complete T cell medium and maintained by medium changes and passage twice weekly as needed. Cells were restimulated with ImmunoCult™ Human CD3 / CD28 T cell activator (StemCell Technologies, catalog no. 10991) on day 13 after nucleofection.

[0272] Cell surface HLA-DR protein expression on live T cells was assessed by flow cytometry at days 6 and 20 after nucleofection. Controls of no mRNA, CRISPR-off mRNA + non-CIITA-targeting sgRNA, CRISPR-off mRNA without gRNA, WT Cas9 mRNA + exon-targeting sgRNA, staining only (no mRNA or gRNA), isotype (no mRNA or gRNA), and no staining (no mRNA or gRNA) were also run on each screening plate.

[0273] HLA-DR flow cytometry On days 6 and 20 after nucleofection, aliquots of T cells were evaluated by flow cytometry staining while the remaining aliquots of cells were continuously maintained in culture. The medium was aspirated from the cells to be stained, washed once with PBS containing 2% FBS, and stained for 20 minutes at 4°C with a PE-conjugated anti-human HLA-DR antibody (BioLegend, catalog no. 327008) diluted 1:300 and Zombie Violet™ Fixable Viability Dye (BioLegend, catalog no. 423113) prepared according to the manufacturer's recommendations at a dilution of 1:1000 in PBS containing 2% FBS. The stained cells were washed and incubated in fixation buffer (BioLegend, catalog no. 420801) for 20 minutes. The cells were then washed prior to acquisition on an Agilent Novocyte Penteon flow cytometer, which can collect up to 20,000 live cell events per well. Screening conditions were compared to negative (CRISPR-Off mRNA without sgRNA) control expression levels to assess % silencing.

[0274] result The time courses of individual pairs are shown in Figure 3A (non-normalized) and Figure 3B (normalized). Many pairs showed silencing profiles similar to WT Cas9 (as indicated).

[0275] Example 13 Dose response for dual guides The dose response of 15 guide pairs was assayed at two points. A starting dose of 2.5 micrograms of fusion protein 11a and 2.5 micrograms of each sgRNA was used. Responses were observed on day 6. The gating strategy and results are shown in Figures 4-8.

[0276] Example 14 Screening of ZFs in primary T cells This example describes a study in which ZFP domains targeting different genomic regions of the CIITA gene were screened in human primary T cells.

[0277] T cells were isolated from human leukapheresis transfusion products and cryopreserved. Prior to nucleofection, T cells were thawed and stimulated with CD3 / CD28 beads in complete T cell medium at 37°C with 5% CO2 for approximately 48 hours. The beads were then removed from the culture using a magnet, and the T cells were cultured in fresh complete T cell medium. T cells were nucleofected with one of 233 ZF-off mRNAs (2.5 micrograms per well of 200k cells) using a Viaflo. After nucleofection, T cells were resuspended in complete T cell medium and maintained by changing the medium and splitting the cells twice weekly as needed. On day 13 after nucleofection, cells were restimulated with soluble CD3 / CD28 T cell activator. Cell surface HLA-DR protein expression on live T cells was assessed by flow cytometry on days 6, 13, and 20 after nucleofection. No mRNA, non-CIITA-targeting ZF-off mRNA, WT Cas9 mRNA + exon-targeting gRNA, staining only, isotype, and no staining controls were also run on each screening plate.

[0278] At days 6, 13, and 20 after nucleofection, aliquots of T cells were assessed by flow cytometry staining, while the remaining aliquots of cells were continuously maintained in culture. Cells were stained with a PE-conjugated anti-human HLA-DR antibody and Fixable Viability Dye and acquired on a flow cytometer collecting up to 20,000 live cell events per well. Screening conditions were compared to negative (CRISPR-off mRNA without sgRNA) control expression levels to assess percent silencing. The time course of the screening is shown in Figure 9, and the distance of the tested ZFPs from the CIITA TSS is shown in Figure 10.

[0279] Ten ZFs were identified in this screen that showed HLA-DR expression below 5%, with many more in the 5-10% range. Note that ZFPs are often referred to as "ZF###" in this application.

[0280] [Table 11] TIFF2025525389000063.tif240170TIFF2025525389000064.tif244170TIFF2025525389 000065.tif250170TIFF2025525389000066.tif246170TIFF2025525389000067.tif24917 0TIFF2025525389000068.tif245170TIFF2025525389000069.tif252170TIFF2025525389 000070.tif252170TIFF2025525389000071.tif245170TIFF2025525389000072.tif56170

[0281] [Table 12] TIFF2025525389000074.tif244169TIFF2025525389000075.tif246170TIFF2025525389000076.tif246168TIFF F2025525389000077.tif246168TIFF2025525389000078.tif246168TIFF2025525389000079.tif246168TIFF202 5525389000080.tif246168TIFF2025525389000081.tif246168TIFF2025525389000082.tif246168TIFF2025525 389000083.tif246168TIFF2025525389000084.tif246168TIFF2025525389000085.tif246168TIFF20255253890 00086.tif246168TIFF2025525389000087.tif246168TIFF2025525389000088.tif246168TIFF20255253890000 89.tif246168TIFF2025525389000090.tif246168TIFF2025525389000091.tif246168TIFF2025525389000092.t if246168TIFF2025525389000093.tif246168TIFF2025525389000094.tif246168TIFF2025525389000095.tif24 6168TIFF2025525389000096.tif246168TIFF2025525389000097.tif246168TIFF2025525389000098.tif246168

[0282] Example 15 Silencing of CIITA in frozen cells from different donors Frozen primary human T cells were transfected with various combinations 6 days after transfection, and the percentage of T cells expressing CIITA was measured. Silencing was achieved when the effector and guide were combined, but not when either the effector or guide were used alone (Figures 11A and 11B).

[0283] Example 16 Silencing CIITA using CRISPR-Off variants To determine the efficiency of the effectors, the top 10 plasmids were used to transfect human primary T cells derived from donor DON23 with the same gRNAs in each condition. Cells were transfected with 2.5 μg of gRNAs 269 and 270 and 1 microgram of effector. After transfection, the percentage of human T cells expressing B2M, CD3, and HLA-DR was assessed. An exemplary flow cytometry gating strategy used to identify transfected cells and measure their B2M, CD3, and HLA-DR expression is shown in Figure 12. Transfection of gRNAs with all effectors showed a decrease in HLA-DR expression (Figures 13-14).

[0284] Example 17 Silencing of CIITA under multiple transduction timings Transduction of chimeric antigen receptor (CAR) into T cells treated with silencing gRNAs may affect gRNA silencing efficiency, CAR expression, or both. To determine whether this was true for the above gRNAs, primary human T cells from donors DON001, DON006, DON020, and DON023 were nucleofected on days 2 or 3 post-thaw. T cells were also transduced with a B-cell maturation antigen (BCMA) CAR on days 1, 2, or 3 post-thaw. T cells were transfected with pairs of six different gRNAs along with 2.5 μg of FP11a. Nucleofection of gRNAs on day 3 post-thaw resulted in more robust CIITA silencing when combined with BCMA CAR transduction, as indicated by reduced B2M, HLA-DR, and CD3 expression. Furthermore, B2M, HLA-DR, and CD3 expression remained lower when the BCMA CAR was transduced on day 1 or 2 post-thaw compared to day 3. Different pairs of gRNAs showed varying B2M silencing abilities. The results are shown in Figures 15-17.

[0285] Example 18 Screening of constructs for full specificity in primary human T cells The specificity of CRISPR-off and ZF-off constructs for silencing CIITA was tested in primary human T cells. RNA sequencing was used as a readout to assess specificity. Genome-wide expression was profiled after epigenetic editing compared to a negative control. Six non-limiting CIITA duplex gRNA pairs were used and compared with an effector-only negative control and a WTCas9 positive control for silencing. Two replicates per condition were performed using T cells derived from a single donor.

[0286] A graph of CIITA mRNA expression (measured by FACS) plotted against the % of HLA-DR-positive cells at day 14 is shown in Figure 18A. On average, CIITA expression was reduced by more than 2-fold after epigenetic editing compared to conditions using effector-only or WTCas9-treated cells. Figure 18B shows the levels of genes that were differentially expressed (up- or down-regulated DEGs) after epigenetic editing compared to conditions treated with WTCas9 or the effector-only control.

[0287] The effects of epigenetic editing, treatment with WTCas9, or effector-only controls on CIITA exon or isoform expression are shown in Figures 19A-19B. Briefly, CRISPR-Off epigenetic editing reduced CIITA isoform / exon expression more robustly than WTCas9.

[0288] The results of RNAseq analysis of cells treated with CRISPR-off compared to effector-only controls or WTCas9 are shown in Figures 20A-25C. A summary of differentially expressed genes that are downregulated compared to effector-only controls is shown in Figure 26A. Figure 26B shows the interaction map between differentially expressed genes in the 5 / 6 or 6 / 6 conditions.

[0289] 27A-27B show the effect of ZFs on HLA-DR levels normalized and normalized for off-target effects.

[0290] array The SEQ ID NOs (SEQ) for the nucleotide (nt) and amino acid (aa) sequences described in this disclosure are listed below. TIFF2025525389000099.tif240170TIFF2025525389000100.tif248170TIFF2025525389000101.tif248169TIFF2025525389000102.tif248169TIFF2025525389000103.tif248169TIFF2025525389000104.tif248169TIFF2025525389000105.tif250170TIFF2025525389000106.tif250170TIFF2025525389000107.tif250170TIFF2025525389000108.tif250170TIFF2025525389000109.tif250170TIFF2025525389000110.tif250170TIFF2025525389000111.tif250170TIFF2025525389000112.tif250170TIFF2025525389000113.tif250170TIFF2025525389000114.tif250170TIFF2025525389000115.tif250170TIFF2025525389000116.tif250170TIFF2025525389000117.tif250170TIFF2025525389000118.tif250170TIFF2025525389000119.tif249170TIFF2025525389000120.tif249170TIFF2025525389000121.tif249170TIFF2025525389000122.tif249170TIFF2025525389000123.tif249170TIFF2025525389000124.tif249170TIFF2025525389000125.tif249170TIFF2025525389000126.tif249170TIFF2025525389000127.tif249170TIFF2025525389000128.tif249170TIFF2025525389000129.tif249170TIFF2025525389000130.tif249170TIFF2025525389000131.tif249170TIFF2025525389000132.tif249170TIFF2025525389000133.tif249170TIFF2025525389000134.tif249170TIFF2025525389000135.tif249170TIFF2025525389000136.tif249170TIFF2025525389000137.tif249170TIFF2025525389000138.tif244169TIFF2025525389000139.tif244169TIFF2025525389000140.tif244169TIFF2025525389000141.tif244169TIFF2025525389000142.tif244169TIFF2025525389000143.tif244169TIFF2025525389000144.tif244169TIFF2025525389000145.tif244169TIFF2025525389000146.tif244169TIFF2025525389000147.tif244169TIFF2025525389000148.tif244169TIFF2025525389000149.tif244169TIFF2025525389000150.tif244169TIFF2025525389000151.tif244169TIFF2025525389000152.tif244169TIFF2025525389000153.tif244169TIFF2025525389000154.tif250169TIFF2025525389000155.tif250169TIFF2025525389000156.tif250169TIFF2025525389000157.tif250169TIFF2025525389000158.tif250169TIFF2025525389000159.tif250169TIFF2025525389000160.tif250169TIFF2025525389000161.tif250169TIFF2025525389000162.tif250169TIFF2025525389000163.tif250169TIFF2025525389000164.tif250169TIFF2025525389000165.tif250169TIFF2025525389000166.tif250169TIFF2025525389000167.tif250169TIFF2025525389000168.tif250169TIFF2025525389000169.tif250169TIFF2025525389000170.tif250169TIFF2025525389000171.tif250169TIFF2025525389000172.tif250169TIFF2025525389000173.tif250169TIFF2025525389000174.tif250169TIFF2025525389000175.tif250169TIFF2025525389000176.tif250169TIFF2025525389000177.tif250169TIFF2025525389000178.tif250169TIFF2025525389000179.tif250169TIFF2025525389000180.tif250169TIFF2025525389000181.tif250169TIFF2025525389000182.tif250169TIFF2025525389000183.tif250169TIFF2025525389000184.tif250169TIFF2025525389000185.tif250169TIFF2025525389000186.tif250169TIFF2025525389000187.tif250169TIFF2025525389000188.tif250169TIFF2025525389000189.tif250169TIFF2025525389000190.tif250169TIFF2025525389000191.tif250169TIFF2025525389000192.tif250169TIFF2025525389000193.tif250169TIFF2025525389000194.tif250169TIFF2025525389000195.tif250169TIFF2025525389000196.tif250169TIFF2025525389000197.tif250169TIFF2025525389000198.tif250169TIFF2025525389000199.tif250169TIFF2025525389000200.tif250169TIFF2025525389000201.tif250169TIFF2025525389000202.tif250169TIFF2025525389000203.tif250169TIFF2025525389000204.tif250169TIFF2025525389000205.tif250169TIFF2025525389000206.tif250169TIFF2025525389000207.tif250169TIFF2025525389000208.tif250169TIFF2025525389000209.tif250169TIFF2025525389000210.tif250169TIFF2025525389000211.tif250169TIFF2025525389000212.tif250169TIFF2025525389000213.tif250169TIFF2025525389000214.tif250169TIFF2025525389000215.tif250169TIFF2025525389000216.tif250169TIFF2025525389000217.tif250169TIFF2025525389000218.tif250169TIFF2025525389000219.tif250169TIFF2025525389000220.tif250169TIFF2025525389000221.tif250169TIFF2025525389000222.tif250169TIFF2025525389000223.tif250169TIFF2025525389000224.tif250169TIFF2025525389000225.tif250169TIFF2025525389000226.tif250169TIFF2025525389000227.tif250169TIFF2025525389000228.tif250169TIFF2025525389000229.tif250169TIFF2025525389000230.tif250169TIFF2025525389000231.tif250169TIFF2025525389000232.tif250169TIFF2025525389000233.tif250169TIFF2025525389000234.tif250169TIFF2025525389000235.tif250169TIFF2025525389000236.tif250169TIFF2025525389000237.tif250169TIFF2025525389000238.tif250169TIFF2025525389000239.tif250169TIFF2025525389000240.tif250169TIFF2025525389000241.tif250169TIFF2025525389000242.tif250169TIFF2025525389000243.tif250169TIFF2025525389000244.tif250169TIFF2025525389000245.tif250169TIFF2025525389000246.tif250169TIFF2025525389000247.tif250169TIFF2025525389000248.tif250169TIFF2025525389000249.tif250169TIFF2025525389000250.tif250169TIFF2025525389000251.tif250169TIFF2025525389000252.tif250169TIFF2025525389000253.tif240170TIFF2025525389000254.tif250170TIFF2025525389000255.tif250169TIFF2025525389000256.tif250169TIFF2025525389000257.tif225168.

Claims

1. A system for inhibiting transcription of the human CIITA gene in human cells, optionally human T lymphocytes or human NK cells, comprising: a) a DNA methyltransferase (DNMT) domain and / or a domain that recruits DNMTs, optionally wherein the DNMT domain and / or recruiter domain comprises a DNMT3A domain and / or a DNMT3L domain, and optionally wherein the recruited DNMT is DNMT3A; and Transcriptional repressor domain collectively including, one or more fusion proteins, each of which is linked to a DNA-binding domain that binds to a target region in the human CIITA gene; or b) one or more nucleic acid molecules encoding said one or more fusion proteins Including, the system.

2. The system, a) a single fusion protein comprising the DNMT3A domain, the DNMT3L domain, the transcriptional repressor domain, and the DNA binding domain; or b) a nucleic acid molecule encoding said single fusion protein The system of claim 1 , comprising:

3. The system of claim 1 or 2, wherein the DNA binding domain comprises a dead CRISPR Cas (dCas) domain, a ZFP domain, or a TALE domain.

4. 4. The system of claim 3, wherein the DNA-binding domain comprises a dCas9 domain, and the system further comprises: (i) one or more guide RNAs comprising any one of SEQ ID NOs: 1034-1312; or (ii) a nucleic acid molecule encoding the one or more guide RNAs.

5. 5. The system of claim 3 or 4, wherein the dCas domain comprises a dCas9 sequence, optionally a sequence having at least 90% identity to SEQ ID NO: 12 or 13.

6. 6. The system of any one of claims 1 to 5, wherein the DNA binding domain binds to the target sequence in SEQ ID NO: 1313 or 1314.

7. The system of claim 3, wherein the ZFP domain targets a nucleotide sequence selected from SEQ ID NOs: 700-754.

8. 8. The system of any one of claims 1 to 7, wherein the DNMT3A domain comprises a sequence having at least 90% identity to SEQ ID NO: 574 or 575.

9. The system of any one of claims 1 to 8, wherein the DNMT3L domain comprises a sequence having at least 90% identity to a sequence selected from SEQ ID NOs: 578 to 581.

10. The system of any one of claims 1 to 8, wherein the DNMT3L domain comprises a sequence having at least 90% identity to a sequence selected from SEQ ID NOs: 582 to 603.

11. The system of any one of claims 1 to 7, wherein the DNMT domain comprises a sequence having at least 90% identity to a sequence selected from SEQ ID NOs: 601 to 603.

12. 12. The system of any one of claims 1 to 11, wherein the transcriptional repressor domain comprises a sequence having at least 90% identity to a sequence selected from SEQ ID NOs: 33 to 570.

13. 12. The system of claim 1, wherein the transcriptional repressor domain comprises a KRAB domain derived from KOX1, ZIM3, ZFP28, or ZN627.

14. The system of claim 13, wherein the KRAB domain comprises a sequence having at least 90% identity to a sequence selected from SEQ ID NOs: 89, 116, 245, and 255.

15. 12. The system of claim 1, wherein the transcriptional repressor domain comprises a fusion of the N-terminal and C-terminal regions of ZIM3 and KOX1 KRAB, and optionally comprises the amino acid sequence of SEQ ID NO: 571 or 572.

16. 12. The system of any one of claims 1 to 11, wherein the transcriptional repressor domain is derived from KAP1, MECP2, HP1a / CBX5, HP1b, CBX8, CDYL2, TOX, TOX3, TOX4, EED, EZH2, RBBP4, RCOR1, or SCML2.

17. The system, a) comprising a DNMT3A domain, a DNMT3L domain, a transcriptional repressor domain, and a DNA binding domain; optionally, one or both of the DNMT3A domain and the DNMT3L domain are human; Optionally, a fusion protein wherein the DNA binding domain is a dead CRISPR Cas domain or a ZFP domain; or b) a nucleic acid molecule encoding said fusion protein 17. The system of any one of claims 1 to 16, comprising:

18. The system of claim 17, wherein the fusion protein comprises, from N-terminus to C-terminus, a DNMT3A domain, a first peptide linker, a DNMT3L domain, a second peptide linker, a DNA binding domain, a third peptide linker, and a transcriptional repressor domain.

19. The system of claim 17, wherein the fusion protein comprises, from N-terminus to C-terminus, a DNMT3A domain, a first peptide linker, a DNMT3L domain, a second peptide linker, a first nuclear localization signal (NLS), a DNA binding domain, a second NLS, a third peptide linker, and a transcriptional repressor domain.

20. The system of claim 17, wherein the fusion protein comprises, from N-terminus to C-terminus, a first nuclear localization signal (NLS), a DNMT3A domain, a first peptide linker, a DNMT3L domain, a second peptide linker, a DNA binding domain, a third peptide linker, a transcriptional repressor domain, and a second NLS.

21. The system of claim 17, wherein the fusion protein comprises, from N-terminus to C-terminus, a first and second nuclear localization signal (NLS), a DNMT3A domain, a first peptide linker, a DNMT3L domain, a second peptide linker, a DNA binding domain, a third peptide linker, a transcriptional repressor domain, and a third and fourth NLS.

22. 22. The system of any one of claims 17 to 21, wherein the transcriptional repressor domain is a KRAB domain, optionally a human KOX1, ZFP28, ZN627, or ZIM3 KRAB domain.

23. 23. The system of any one of claims 18-22, wherein one or both of the second and third peptide linkers are XTEN linkers, optionally XTEN linkers selected from XTEN80 and XTEN16, and further optionally, wherein the second peptide linker is XTEN80 and the third peptide linker is XTEN16.

24. 18. The system of claim 17, wherein the fusion protein comprises, from N-terminus to C-terminus, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a first NLS, a dSpCas9 domain, a second NLS, an XTEN16 peptide linker, and a human KOX1 KRAB domain.

25. 25. The system of claim 24, wherein the fusion protein comprises SEQ ID NO: 658 or a sequence at least 90% identical thereto.

26. 18. The system of claim 17, wherein the fusion protein comprises, from N-terminus to C-terminus, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a first NLS, a ZFP domain, a second NLS, an XTEN16 linker, and a human KOX1 KRAB domain.

27. 27. The system of claim 26, wherein the fusion protein comprises SEQ ID NO: 659 or a sequence at least 90% identical thereto.

28. 18. The system of claim 17, wherein the fusion protein comprises, from N-terminus to C-terminus, a first and second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a dSpCas9 domain, an XTEN16 peptide linker, a human KOX1 KRAB domain, and a third and fourth NLS.

29. 29. The system of claim 28, wherein the fusion protein comprises SEQ ID NO: 660 or a sequence at least 90% identical thereto.

30. 18. The system of claim 17, wherein the fusion protein comprises, from N-terminus to C-terminus, a first and second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a ZFP domain, an XTEN16 peptide linker, a human KOX1 KRAB domain, and a third and fourth NLS.

31. 18. The system of claim 17, wherein the fusion protein comprises, from N-terminus to C-terminus, a first and second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a dSpCas9 domain, an XTEN16 peptide linker, a human ZFP28 KRAB domain, and a third and fourth NLS.

32. 32. The system of claim 31, wherein the fusion protein comprises SEQ ID NO: 661 or a sequence at least 90% identical thereto.

33. 18. The system of claim 17, wherein the fusion protein comprises, from N-terminus to C-terminus, a first and second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a ZFP domain, an XTEN16 peptide linker, a human ZFP28 KRAB domain, and a third and fourth NLS.

34. 18. The system of claim 17, wherein the fusion protein comprises, from N-terminus to C-terminus, a first and second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a dSpCas9 domain, an XTEN16 peptide linker, a human ZN627 KRAB domain, and a third and fourth NLS.

35. 35. The system of claim 34, wherein the fusion protein comprises SEQ ID NO: 662 or a sequence at least 90% identical thereto.

36. 18. The system of claim 17, wherein the fusion protein comprises, from N-terminus to C-terminus, a first and second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a ZFP domain, an XTEN16 peptide linker, a human ZN627 KRAB domain, and a third and fourth NLS.

37. 18. The system of claim 17, wherein the fusion protein comprises, from N-terminus to C-terminus, a first and second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a dSpCas9 domain, an XTEN16 peptide linker, a human ZIM3 KRAB domain, and a third and fourth NLS.

38. 38. The system of claim 37, wherein the fusion protein comprises SEQ ID NO: 663 or a sequence at least 90% identical thereto.

39. 18. The system of claim 17, wherein the fusion protein comprises, from N-terminus to C-terminus, a first and second NLS, a human DNMT3A domain, a first peptide linker, a human DNMT3L domain, an XTEN80 peptide linker, a ZFP domain, an XTEN16 peptide linker, a human ZIM3 KRAB domain, and a third and fourth NLS.

40. 40. The system of any one of claims 19 to 39, wherein at least one of the NLSs is an SV40 NLS.

41. The system, a) a first fusion protein comprising a first DNA-binding domain and comprising or recruiting a DNMT3A domain; a second fusion protein that includes a second DNA-binding domain and that includes or recruits a DNMT3L domain; and a third fusion protein that includes a third DNA-binding domain and that includes or recruits a transcriptional repressor domain; or b) one or more nucleic acid molecules encoding said multiple fusion proteins 17. The system of any one of claims 1 and 3 to 16, comprising:

42. 42. A human cell or progeny of the cell comprising the system of any one of claims 1 to 41, wherein the cell is optionally a T lymphocyte or an NK cell.

43. 42. A human cell or progeny of the cell modified by the system of any one of claims 1 to 41, optionally wherein the cell is a T lymphocyte or an NK cell, and optionally wherein the cell is modified ex vivo.

44. 42. A pharmaceutical composition comprising the system according to any one of claims 1 to 41 and a pharmaceutically acceptable excipient, optionally the composition comprises a lipid nanoparticle (LNP) containing system; and / or the DNA-binding domain is a dCas domain and the LNP further comprises one or more gRNAs; Pharmaceutical compositions.

45. 44. A pharmaceutical composition comprising the human cells of claim 42 or 43 and a pharmaceutically acceptable excipient.

46. 46. A method of treating a patient in need thereof, comprising administering to the patient a system according to any one of claims 1 to 41, a human cell according to claim 42 or 43, or a pharmaceutical composition according to claim 44 or 45.

47. 47. The method of claim 46, wherein the patient has cancer or an autoimmune disease.

48. 48. A system according to any one of claims 1 to 41, a human cell according to claim 42 or 43, or a pharmaceutical composition according to claim 44 or 45, for use in treating a patient in need thereof, optionally in a method according to claim 46 or 47.

49. 48. Use of a system according to any one of claims 1 to 41 or a human cell according to claim 42 or 43 in the manufacture of a medicament for treating a patient in need thereof, optionally in the method of claim 46 or 47.

Images