Compositions and methods for preparing capped mRNA
The method for in vitro transcription using a DNA template with specific promoter sequences and a cap analog improves mRNA production efficiency, yield, and stability, addressing inefficiencies in existing methods.
Patent Information
- Application Number
- JP2025507739
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-12-20
- Filing Date
- 2023-08-09
- Publication Date
- 2025-08-15
AI Technical Summary
Existing in vitro methods for producing capped mRNA are inefficient, time-consuming, and costly, limiting the production of mRNA with high expression levels and stability.
A method for in vitro transcription that includes a DNA template with specific promoter sequences and a cap analog attached to the -1 and/or +1 nucleotides, combined with a reaction mixture containing ribonucleoside triphosphates, magnesium salts, and RNA polymerase, incubated at controlled temperatures to produce capped mRNA.
Enhances mRNA yield, purity, capping efficiency, and uniformity of poly-A tail length, offering improved synthesis efficiency and cost-effectiveness.
Smart Images

Figure 2025526813000025 
Figure 2025526813000026 
Figure 2025526813000027
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Application No. 18 / 069,123, filed December 20, 2022, U.S. Provisional Application No. 63 / 371,132, filed August 11, 2022, and U.S. Provisional Application No. 63 / 396,904, filed August 10, 2022. Each of these applications is incorporated by reference in its entirety for all purposes. Reference to sequence listing submitted in compatible XML file (.xml)
[0002] In accordance with the EFS-Web legal framework and 37 CFR § 1.821-825 (see MPEP § 2442.03(a)), a sequence listing (titled "3000076-005977") in a compatible XML file format is _Supp-SL _ST26.xml" and 2023 September 29 It is created in and has a size of 73,234 bytes ) was filed concurrently with the present application, and the entire contents of the sequence listing are incorporated herein by reference. [Background technology]
[0003] The present disclosure relates generally to methods and compositions for in vitro transcription.
[0004] mRNA is a well-defined molecule whose structure includes a 5' cap, a 5' untranslated region (UTR), an open reading frame sequence encoding one or more genes of interest, a 3' UTR, and a poly(A) tail. The preparation of capped mRNA by in vitro synthesis may be of great significance for both basic science research and the development of new therapeutics. Several factors facilitate the production of mRNA that can have high expression levels, stability, and functionality.
[0005] An mRNA molecule may be flanked by 5'- and 3'-untranslated regions (UTRs). The 5'-UTR serves as the entry site for ribosome translation initiation, and the 3'-UTR plays an important role in translation termination and post-translational modification, which may affect mRNA expression and half-life. The poly(A) tail of an mRNA can make the RNA molecule more stable and prevent mRNA degradation. The poly(A) tail can also allow the mature messenger RNA to be exported from the cell nucleus and translated into protein by ribosomes in the cytoplasm. See, for example, Sachs A and Wahle E, "Poly(A) tail metabolism and function in eucaryotes," J Biol Chem, (November 5, 1993), 268(31):22955-8, incorporated herein by reference in its entirety.
[0006] The mRNA cap is a highly methylated modification at the 5' end of mRNA that can protect mRNA from degradation, recruit complexes involved in mRNA processing, and mark cellular mRNA to avoid recognition by the immune system. In mammals, the predominant 5' cap structure is an inverted 7-methylguanosine nucleotide linked to the first transcribed nucleotide via a 5'-5' triphosphate bond. The 7-methylguanosine is methylated at its seventh carbon position, and m7 G or 7m The cap structure may be referred to as 5' G. m7 GpppN1(pN) x where N is any nucleotide and x is 0 or any number. In the Cap 0 structure, the first nucleotide has a 2' hydroxy group on its ribose, while in the Cap 1 structure, the first nucleotide has a 2'-o-methyl modification on the ribose, and the structure has a 2'-o-methyl modification on the ribose from the 5' end to the 3' end. m7 G 5’ pppN1 2’-OMe (pN) xwhere N is any nucleotide and x is any integer. m7 The 2' hydroxy groups of the first and second riboses linked to G are methylated. The structure is m7 G 5’ pppN1 2’-OMe pN2 2’-OMe (pN) x where N is any nucleotide and x is any integer. See, e.g., Perry RP, "RNA processing comes of age," J Cell Biol. (December 1981), 91(3 Pt 2):28s-38s, which is incorporated herein by reference in its entirety.
[0007] Capping can improve properties of mRNA, such as, but not limited to, its stability and its translation efficiency. See, e.g., Banerjee AK, "5'-terminal cap structure in eucaryotic messenger ribonucleic acids," Microbiol Rev. (June 1980), 44(2):175-205, incorporated herein by reference in its entirety. In vivo, each capping process can be carried out enzymatically. See, e.g., Perry. These processes can be time-consuming, inefficient, and expensive when performed in vitro.
[0008] The preparation of capped mRNA by in vitro synthesis may be of great significance to both basic science research, pharmacological development, and therapeutic development. Several factors may facilitate the production of mRNA that can have high expression levels, stability, and functionality. There is a need for effective in vitro transcription methods that allow for more efficient production of capped mRNA that can have high expression levels, stability, functionality, or a combination thereof. Summary of the Invention
[0009] In one aspect, the disclosure relates to a method for in vitro transcribing a DNA template into RNA, the method comprising: (1) a DNA template, the DNA template comprising a promoter operably linked to a nucleic acid, the nucleic acid comprising a 5' untranslated region (5' UTR), an open reading frame (ORF) encoding an RNA of interest, a 3' UTR, and a polyA region; and (2) a cap analog, the cap analog comprising: [ka] It includes the structure wherein R1 and R2 may each be CH3 or H, and B1 and B2 may each be A, U, G, or C; wherein the promoter may contain the sequence TAATACGACTCACTATAX1X2X3 (SEQ ID NO: 16); wherein A at position 17 is the −1 nucleotide and X1 at position 18 is the +1 nucleotide; When X1 is G, and X2 and X3 are each A, T, G, or C, B1 is A and B2 is G; When X1 is A, and X2 and X3 are each A, T, G, or C, B1 is A and B2 is A; When X1 is C, and X2 and X3 are each A, T, G, or C, then B1 is A and B2 is C; and When X1 is T and X2 and X3 are each A, T, G or C, B1 is A and B2 is U; wherein the method includes providing a cap analog attached to the -1 and +1 nucleotides of the promoter, and incubating the DNA template and the cap analog in a reaction mixture, wherein the incubation may include producing RNA by incubating the reaction mixture at about 15°C to about 35°C for about 1 hour to about 12 hours.
[0010] In another embodiment, the promoter may contain a sequence selected from SEQ ID NOs: 10, 11, 13 and 14.
[0011] In another embodiment, the 5' UTR and the 3' UTR may be SEQ ID NOs: 1 and 2, 1 and 4, 1 and 6, 3 and 2, 3 and 4, 3 and 6, 3 and 8, 5 and 2, 5 and 4, 5 and 6, 7 and 2, 7 and 4, 7 and 6, 7 and 8, 9 and 2, 9 and 4, 9 and 6, or 9 and 8, respectively.
[0012] In another embodiment, the 5' UTR and the 3' UTR may be SEQ ID NOs: 1 and 2, 1 and 4, 3 and 2, 1 and 6, 7 and 4, 9 and 2, or 3 and 6, respectively.
[0013] In another embodiment, the poly A region is from about 60 to about 200 A, from about 60 to about 190 A, from about 60 to about 180 A, from about 60 to about 170 A, from about 60 to about 160 A, from about 60 to about 150 A, from about 60 to about 140 A, from about 60 to about 130 A, from about 60 to about 120 A, from about 60 to about 110 A, from about 60 to about 100 A, from about 70 The amino acid sequence may contain from about 1 to about 190 A, from about 80 to about 180 A, from about 90 to about 170 A, from about 100 to about 160 A, from about 100 to about 150 A, from about 100 to about 140 A, from about 100 to about 130 A, from about 100 to about 120 A, about 100 A, about 110 A, about 120 A, about 130 A, about 140 A, or about 150 A.
[0014] In another embodiment, the cap analog is m 7 GpppApA, m 7 GpppApC, m 7 GpppApG, m 7 GpppApU, m 7 G 3’Ome pppApA, m 7 G 3’Ome pppApC, m 7 G 3’Ome pppApG, m7 G 3’Ome pppApU, m 7 G 3’Ome pppA 2’Ome pA, m 7 G 3’Ome pppA 2’Ome pC, m 7 G 3’Ome pppA 2’Ome pG, m 7 G 3’Ome pppA 2’Ome pU, m 7 GpppA 2’Ome pA, m 7 GpppA 2’Ome pC, m 7 GpppA 2’Ome pG and m 7 GpppA 2’Ome pU.
[0015] In another embodiment, the reaction mixture may contain a buffer substance at a concentration of about 45 mM to about 55 mM, an RNase inhibitor at a concentration of about 0.01 U / μl to about 0.03 U / μl, an NTP at a concentration of about 3 mM to about 5 mM, a cap analog at a concentration of about 6 mM to about 8 mM, one or more magnesium salts at a concentration of about 20 mM to about 30 mM, a polyamine at a concentration of about 1.5 mM to about 2.5 mM, a DNA template at a concentration of about 0.01 μg / μl to about 0.05 μg / μl, a pyrophosphatase at a concentration of about 0.1 mU / μl to about 0.5 mU / μl, and an RNA polymerase at a concentration of about 0.01 μg / μl to about 0.05 μg / μl.
[0016] In another embodiment, the RNA polymerase may be selected from wild-type T7 RNA polymerase or a mutant thereof.
[0017] In another embodiment, the incubating may comprise incubating the reaction mixture at about 18°C to about 31°C.
[0018] In another embodiment, the incubating may comprise incubating the reaction mixture at about 30° C. for about 4 hours.
[0019] In another embodiment, the DNA template may further contain at least one transcription terminator located upstream and / or downstream of the open reading frame (ORF).
[0020] In one aspect, the present disclosure relates to a method for in vitro transcription of a DNA template into RNA, the method comprising providing a mixture comprising ribonucleoside triphosphates (NTPs), a DNA template, and an RNA polymerase (e.g., a recombinant RNA polymerase), and incubating the reaction mixture at about 15°C to about 35°C, optionally at about 18°C to about 31°C, for a suitable period of time, preferably about 1 hour to about 12 hours, to produce RNA. Preferably, the mixture further comprises a buffer and one or more magnesium salts. Optionally, the mixture may further comprise a cap analog.
[0021] In one aspect, the disclosure relates to a method for in vitro transcription of a DNA template into RNA, the method comprising providing a mixture comprising a buffer, ribonucleoside triphosphates (NTPs), one or more magnesium salts at a concentration of about 2 mM to about 60 mM, the DNA template, and a recombinant RNA polymerase, and incubating the reaction mixture at about 15° C. to about 35° C., optionally at about 18° C. to about 31° C., for about 1 hour to about 12 hours, thereby producing RNA.
[0022] In another embodiment, the buffer may be Tris base, HEPES, or Tris-HCl.
[0023] In another embodiment, the concentration of the buffering agent is from about 1 mM to about 100 mM, from about 1 mM to about 90 mM, from about 1 mM to about 80 mM, from about 1 mM to about 70 mM, from about 1 mM to about 60 mM, from about 1 mM to about 50 mM, from about 1 mM to about 40 mM, from about 1 mM to about 30 mM, from about 1 mM to about 20 mM, from about 1 mM to about 10 mM, from about 1 mM to about 5 mM, from about 10 mM to about 20 mM, It may be about 10 mM to about 30 mM, about 10 mM to about 40 mM, about 10 mM to about 50 mM, about 20 mM to about 50 mM, about 30 mM to about 50 mM, about 40 mM to about 50 mM, about 45 mM to about 50 mM, about 45 mM to about 55 mM, about 15 mM to about 45 mM, about 15 mM to about 35 mM, about 15 mM to about 30 mM, or about 15 mM to about 25 mM.
[0024] In another embodiment, the concentration of these NTPs may be from about 1 mM to about 50 mM, from about 1 mM to about 40 mM, from about 1 mM to about 30 mM, from about 1 mM to about 20 mM, from about 1 mM to about 10 mM, from about 1 mM to about 5 mM, from about 2 mM to about 10 mM, from about 3 mM to about 10 mM, from about 3 mM to about 9 mM, from about 3 mM to about 8 mM, from about 3 mM to about 7 mM, from about 3 mM to about 6 mM, from about 3 mM to about 5 mM, from about 3 mM to about 4 mM, from about 4 mM to about 10 mM, from about 5 mM to about 10 mM, from about 6 mM to about 10 mM, from about 7 mM to about 10 mM, from about 8 mM to about 10 mM, or from about 9 mM to about 10 mM.
[0025] In another embodiment, the concentration of the one or more magnesium salts can be from about 2 mM to about 50 mM, from about 2 mM to about 40 mM, from about 2 mM to about 30 mM, from about 2 mM to about 40 mM, from about 2 mM to about 30 mM, from about 2 mM to about 20 mM, from about 2 mM to about 10 mM, from about 2 mM to about 5 mM, from about 5 mM to about 50 mM, from about 10 mM to about 45 mM, from about 15 mM to about 40 mM, from about 20 mM to about 35 mM, from about 20 mM to about 30 mM, from about 20 mM to about 25 mM, from about 22 mM to about 28 mM, or from about 25 mM to about 30 mM.
[0026] In another embodiment, the concentration of the DNA template is from about 0.001 μg / μl to about 2 μg / μl, from about 0.001 μg / μl to about 1.5 μg / μl, from about 0.001 μg / μl to about 1 μg / μl, from about 0.01 μg / μl to about 2 μg / μl, from about 0.01 μg / μl to about 1.5 μg / μl, from about 0.01 μg / μl to about 1 μg / μl, from about 0.01 μg / μl to about 0.5 μg / μl, from about 0.01 μg / μl to about 0.1 μg / μl, from about 0.01 μg / μl to about 0.05 μg / μl μl, about 0.02 μg / μl to about 0.04 μg / μl, about 0.02 μg / μl to about 0.1 μg / μl, about 0.03 μg / μl to about 0.1 μg / μl, about 0.04 μg / μl to about 0.1 μg / μl, about 0.05 μg / μl to about 0.1 μg / μl, about 0.06 μg / μl to about 0.1 μg / μl, about 0.07 μg / μl to about 0.1 μg / μl, about 0.08 μg / μl to about 0.1 μg / μl, or about 0.09 μg / μl to about 0.1 μg / μl.
[0027] In another embodiment, the concentration of the recombinant RNA polymerase is from about 0.001 μg / μl to about 2 μg / μl, from about 0.001 μg / μl to about 1.5 μg / μl, from about 0.001 μg / μl to about 1 μg / μl, from about 0.01 μg / μl to about 1 μg / μl, from about 0.01 μg / μl to about 0.5 μg / μl, from about 0.01 μg / μl to about 0.3 μg / μl, from about 0.01 μg / μl to about 0.1 μg / μl, from about 0.01 μg / μl to about 0.05 μg / μl μl, about 0.1 μg / μl to about 1 μg / μl, about 0.1 μg / μl to about 0.9 μg / μl, about 0.1 μg / μl to about 0.8 μg / μl, about 0.1 μg / μl to about 0.7 μg / μl, about 0.1 μg / μl to about 0.6 μg / μl, about 0.1 μg / μl to about 0.5 μg / μl, about 0.1 μg / μl to about 0.4 μg / μl, about 0.1 μg / μl to about 0.3 μg / μl, or about 0.1 μg / μl to about 0.2 μg / μl.
[0028] In another embodiment, the mixture may further contain an antioxidant.
[0029] In another embodiment, the antioxidant can be dithiothreitol (DTT) and the concentration of dithiothreitol is from about 1 mM to about 50 mM, from about 2 mM to about 50 mM, from about 3 mM to about 50 mM, from about 4 mM to about 50 mM, from about 5 mM to about 50 mM, from about 6 mM to about 50 mM, from about 7 mM to about 50 mM, from about 8 mM to about 50 mM, from about 9 mM to about 50 mM, from about 10 mM to about 50 mM, from about 10 mM to about 40 mM, from about 15 mM to about 30 mM, from about 15 mM to about 25 mM, from about 15 mM to about 20 mM, from about 20 mM to about 50 mM, from about 30 mM to about 50 mM, or from about 40 mM to about 50 mM.
[0030] In another embodiment, the mixture may further comprise an RNase inhibitor, wherein the concentration of the RNase inhibitor is from about 0.001 U / μl to about 5 U / μl, from about 0.001 U / μl to about 4 U / μl, from about 0.001 U / μl to about 3 U / μl, from about 0.001 U / μl to about 2 U / μl, from about 0.001 U / μl to about 1 U / μl, from about 0.0 1 U / μl to about 5 U / μl, about 0.01 U / μl to about 4 U / μl, about 0.01 U / μl to about 3 U / μl, about 0.01 U / μl to about 2 U / μl, about 0.01 U / μl to about 1 U / μl, about 0.01 U / μl to about 0.5 U / μl, about 0.01 U / μl to about 0.1 U / μl, about 0.01 U / μl to about 0.05 U / μl, about 0.01U / μl to about 0.04U / μl, about 0.01U / μl to about 0.03U / μl, about 0.01U / μl to about 0.02U / μl, about 0.1U / μl to about 5U / μl, about 0.1U / μl to about 4U / μl, about 0.1U / μl to about 3U / μl, about 0.1U / μl to about 2U / μl, about 0.1U / μl to about 1U / μl, about 0.5 U / μl to about 5 U / μl, about 0.5 U / μl to about 4 U / μl, about 0.5 U / μl to about 3 U / μl, about 0.5 U / μl to about 2 U / μl, about 0.5 U / μl to about 1 U / μl, about 1 U / μl to about 5 U / μl, about 2 U / μl to about 5 U / μl, about 3 U / μl to about 5 U / μl, or about 4 U / μl to about 5 U / μl.
[0031] In another embodiment, the mixture may contain a cap analog, wherein the concentration of the cap analog is from about 0.5 mM to about 50 mM, from about 0.5 mM to about 40 mM, from about 0.5 mM to about 30 mM, from about 0.5 mM to about 20 mM, from about 0.5 mM to about 10 mM, from about 0.5 mM to about 5 mM, from about 1 mM to about 10 mM, from about 2 mM to about 10 mM, from about 3 mM to about 10 mM, from about 3 mM to about 10 mM, to about 9 mM, about 3 mM to about 8 mM, about 3 mM to about 7 mM, about 3 mM to about 6 mM, about 3 mM to about 5 mM, about 3 mM to about 4 mM, about 4 mM to about 10 mM, about 5 mM to about 10 mM, about 6 mM to about 10 mM, about 6 mM to about 9 mM, about 6 mM to about 8 mM, about 6 mM to about 7 mM, about 7 mM to about 10 mM, about 8 mM to about 10 mM, or about 9 mM to about 10 mM.
[0032] In another embodiment, the mixture may further contain a polyamine.
[0033] In another embodiment, the polyamine may be spermine, spermidine, or a combination thereof.
[0034] In another embodiment, the concentration of the polyamine is from about 0.1 mM to about 5 mM, from about 0.2 mM to about 4.9 mM, from about 0.2 mM to about 4.8 mM, from about 0.2 mM to about 4.7 mM, from about 0.2 mM to about 4.6 mM, from about 0.2 mM to about 4.5 mM, from about 0.2 mM to about 4.4 mM, from about 0.2 mM to about 4.3 mM, from about 0.2 mM to about 4.2 mM, from about 0.2 mM to about 4.1 mM, from about 0.2 mM to about 4 mM, from about 0.2 mM to about 3.5 mM, from about 0.2 mM to about 3 mM, from about 0. It may be 2 mM to about 2.5 mM, about 0.5 mM to about 2.5 mM, about 1.0 mM to about 2.5 mM, about 1.5 mM to about 2.5 mM, about 0.2 mM to about 2 mM, about 0.2 mM to about 1.5 mM, about 0.2 mM to about 1 mM, about 0.2 mM to about 0.9 mM, about 0.2 mM to about 0.8 mM, about 0.2 mM to about 0.7 mM, about 0.2 mM to about 0.6 mM, about 0.2 mM to about 0.5 mM, about 0.2 mM to about 0.4 mM, or about 0.2 mM to about 0.3 mM.
[0035] In another embodiment, the mixture may further contain a pyrophosphatase, wherein the concentration of the pyrophosphatase is from about 0.01 mU / μl to about 2 mU / μl, from about 0.01 mU / μl to about 1.5 mU / μl, from about 0.01 mU / μl to about 1 mU / μl, from about 0.1 mU / μl to about 2 mU / μl, from about 0.1 mU / μl to about 1.5 mU / μl, from about 0.1 mU / μl to about 1 mU / μl, about 0.1 mU / μl to about 0.9 mU / μl, about 0.1 mU / μl to about 0.8 mU / μl, about 0.1 mU / μl to about 0.7 mU / μl, about 0.1 mU / μl to about 0.6 mU / μl, about 0.1 mU / μl to about 0.5 mU / μl, about 0.1 mU / μl to about 0.4 mU / μl, about 0.1 mU / μl to about 0.3 mU / μl, or about 0.1 mU / μl to about 0.2 mU / μl.
[0036] In another embodiment, incubating the reaction mixture is at about 15°C to about 35°C, about 16°C to about 35°C, about 17°C to about 35°C, about 18°C to about 35°C, about 18°C to about 34°C, about 18°C to about 33°C, about 18°C to about 32°C, about 18°C to about 31°C, about 18°C to about 30°C, about 18°C to about 29°C, about 18°C to about 28°C, about 18°C to about 27°C, about 18°C to about 26°C, about 18°C to about 25°C, about The reaction is carried out at a temperature of 18°C to about 24°C, about 18°C to about 23°C, about 18°C to about 22°C, about 18°C to about 21°C, about 18°C to about 20°C, about 18°C to about 19°C, about 25°C to about 26°C, about 25°C to about 27°C, about 25°C to about 28°C, about 25°C to about 29°C, about 25°C to about 30°C, about 25°C to about 31°C, about 21°C to about 22°C, about 21°C to about 23°C, about 21°C to about 24°C, or about 21°C to about 25°C.
[0037] In another embodiment, the reaction mixture may be incubated for a period of from about 1 hour to about 12 hours, from about 1 hour to about 11 hours, from about 1 hour to about 10 hours, from about 1 hour to about 9 hours, from about 1 hour to about 8 hours, from about 1 hour to about 7 hours, from about 1 hour to about 6 hours, from about 1 hour to about 5 hours, from about 1 hour to about 4 hours, from about 1 hour to about 3 hours, from about 1 hour to about 2 hours, from about 2 hours to about 12 hours, from about 3 hours to about 12 hours, from about 4 hours to about 12 hours, from about 5 hours to about 12 hours, from about 6 hours to about 12 hours, from about 7 hours to about 12 hours, from about 8 hours to about 12 hours, from about 9 hours to about 12 hours, from about 10 hours to about 12 hours, or from about 11 hours to about 12 hours.
[0038] In another embodiment, incubating the reaction mixture may occur at about 25° C. for about 1 hour to about 5 hours, about 1.5 hours to about 4.5 hours, about 2 hours to about 4 hours, about 2.5 hours to about 3.5 hours, or about 2.5 hours to about 3 hours.
[0039] In another embodiment, incubating the reaction mixture may occur at about 31° C. for about 1 hour to about 5 hours, about 1 hour to about 4.5 hours, about 1 hour to about 4 hours, about 1 hour to about 3.5 hours, about 1 hour to about 3 hours, about 1 hour to about 2.5 hours, about 1 hour to about 2 hours, about 1 hour to about 1.5 hours, about 0.5 hours to about 1 hour, or about 0.5 hours to about 1.5 hours.
[0040] In another embodiment, the DNA template may include a promoter operably linked to a nucleic acid, the nucleic acid comprising a 5' untranslated region (5' UTR), an open reading frame (ORF) encoding an RNA of interest, a 3' UTR, and a polyA region, wherein the promoter may contain the sequence TAATACGACTCACTATAX1X2X3 (SEQ ID NO: 16), where X1 is A or G, X2 is A or G, and X3 is A, T, G, or C, wherein the 5' UTR may be selected from SEQ ID NO: 1, 3, 5, or 9, and the 3' UTR may be selected from SEQ ID NO: 2, 4, 6, or 8, wherein the polyA region comprises at least 60 adenine bases (A).
[0041] In another embodiment, the promoter may contain a sequence selected from SEQ ID NOs: 10-15.
[0042] In another embodiment, the cap analog can be attached to the −1 and / or +1 nucleotide of the promoter.
[0043] In one aspect, the disclosure relates to a reaction mixture for in vitro transcription of a DNA template into RNA, the reaction mixture containing a buffer substance at a concentration of about 45 mM to about 55 mM, an RNase inhibitor at a concentration of about 0.01 U / μl to about 0.03 U / μl, an NTP at a concentration of about 3 mM to about 5 mM, a cap analog at a concentration of about 6 mM to about 8 mM, one or more magnesium salts at a concentration of about 20 mM to about 30 mM, a polyamine at a concentration of about 1.5 mM to about 2.5 mM, a DNA template at a concentration of about 0.01 μg / μl to about 0.05 μg / μl, a pyrophosphatase at a concentration of about 0.1 mU / μl to about 0.5 mU / μl, and an RNA polymerase at a concentration of about 0.01 μg / μl to about 0.05 μg / μl.
[0044] In another embodiment, the one or more magnesium salts may be MgCl and / or magnesium acetate (Mg(C2H3O2)2) (MgOAc).
[0045] In one aspect, the present disclosure relates to a method for in vitro transcribing a DNA template into RNA, the method comprising providing a reaction mixture of the present disclosure and incubating the reaction mixture at about 15° C. to about 35° C. for about 1 hour to about 12 hours to produce RNA.
[0046] In one embodiment, the 5' UTR may be selected from SEQ ID NOs: 23-69.
[0047] In another embodiment, the 5' UTR may be selected from SEQ ID NOs: 23-52.
[0048] In one aspect, the disclosure relates to a nucleic acid, the nucleic acid comprising, in a 5' to 3' direction, a 5' untranslated region (5' UTR), an open reading frame (ORF) encoding an RNA, and a 3' UTR, wherein the 5' UTR is selected from SEQ ID NOs: 23-69.
[0049] In one aspect, the disclosure relates to a nucleic acid, the nucleic acid comprising a nucleotide sequence selected from SEQ ID NOs: 23-52.
[0050] In another embodiment, any one of SEQ ID NOs: 23-52 may be the 5' UTR or 3' UTR. [Brief explanation of the drawings]
[0051] [Figure 1A] 1 illustrates the addition of poly-A tails of different lengths onto a DNA template according to one embodiment of the present disclosure. [Figure 1B] It shows that over 90% of the PCR products of the eGFP template have the 100A tail added by the PCR method disclosed in Example 1, with an average length of 1086 bp. [Figure 2A] 1 shows the quality of mRNA prepared by a method according to one embodiment of the present disclosure. [Figure 2B] 1 shows the expression of mRNA prepared by a method according to one embodiment of the present disclosure. [Figure 3] 1 shows an analysis of polyA fragment length according to one embodiment of the present disclosure. [Figure 4] 1 shows the effect of polyA tail length on mRNA expression according to one embodiment of the present disclosure. [Figure 5A] 1 shows a comparison of the expression levels of eGFP mRNA prepared by various methods according to one embodiment of the present disclosure, and the relative intensity of eGFP expression was measured by a fluorescent plate reader. [Figure 5B] The relative eGFP expression intensity in cells is shown, as measured, for example, by confocal microscopy. [Figure 6] 1 shows the expression level of luciferase mRNA prepared by a method according to one embodiment of the present disclosure. [Figure 7] 1 shows a comparison of the expression levels of espCas9 mRNA prepared by various methods, according to one embodiment of the present disclosure. [Figure 8] 8A-8C show the purity of mRNA prepared by various methods according to one embodiment of the present disclosure. [Figure 9A] Figure 1 shows the eGFP mRNA expression efficiency measured by a fluorescent plate reader. The mRNA was prepared by in vitro transcription at different reaction temperatures of 31°C or 37°C. [Figure 9B] For example, the purity of eGFP mRNA obtained in a 31° C. IVT reaction is shown, as determined by a bioanalyzer. [Figure 9C] 1 shows the purity of eGFP mRNA obtained in a 37° C. IVT reaction, as determined, for example, by bioanalyzer. [Figure 10A] 1 shows the use of a cap analog according to one embodiment of the present disclosure to initiate in vitro transcription at the −1 position. [Figure 10B] 1 shows initiation of in vitro transcription at the +1 position using a cap analog according to one embodiment of the present disclosure. [Figure 10C] 1 shows the capping efficiency of mRNA prepared by a method according to one embodiment of the present disclosure. [Figure 10D] 1 shows the expression levels of eGFP mRNA prepared by a method according to one embodiment of the present disclosure. IVT reactions performed with the T7GGG promoter and co-transcription initiated at the -1 position with a Cap 1 analog have similar mRNA expression intensity compared to mRNA IVT initiated with T7AGG using a Cap 1 analog initiating transcription at the +1 position. [Figure 11A] 1 shows the purity of 10 kb mRNA prepared by a method according to one embodiment of the present disclosure. [Figure 11B] 1 shows the purity of 10 kb mRNA prepared by a method according to another embodiment of the present disclosure. [Figure 11C] 1 shows the integrity of a 10 kb mRNA prepared by a method according to one embodiment of the present disclosure. [Figure 11D] 1 shows the yield of 10 kb mRNA prepared by a method according to one embodiment of the present disclosure. [Figure 12A] 1 shows the effect of magnesium on 1 kb mRNA yield according to one embodiment of the present disclosure. [Figure 12B] 1 shows the effect of magnesium on 1 kb mRNA integrity according to one embodiment of the present disclosure. [Figure 13] 1 shows the variation in length of poly-A tails produced by in vitro transcription according to one embodiment of the present disclosure. [Figure 14] 1 shows the 5' end sequence of an RNA product prepared by IVT initiated from the -1 position of a DNA template according to one embodiment of the present disclosure. [Figure 15] 1 shows the 5′ end sequence of an RNA product prepared by IVT initiated from the +1 position of a DNA template according to one embodiment of the present disclosure. [Figure 16A] 1 shows the effect of 5' UTR sequences on gene expression according to one embodiment of the present disclosure. [Figure 16B] 1 shows the influence of 5' UTR sequences on gene expression according to another example of the present disclosure. [Figure 16C]1 shows the influence of 5' UTR sequences on gene expression according to another example of the present disclosure. [Figure 17A] 1 shows the influence of 5' UTR sequences on gene expression according to another example of the present disclosure. [Figure 17B] 1 shows the influence of 5' UTR sequences on gene expression according to another example of the present disclosure. DETAILED DESCRIPTION OF THE INVENTION
[0052] The present specification provides methods and compositions for in vitro synthesis of mRNA. The mRNA may further comprise one or more caps, and methods and compositions are provided for in vitro synthesis of capped mRNA. The mRNA may further comprise a polyA tail, and methods and compositions are provided for in vitro synthesis of mRNA with a polyA tail. Embodiments of the disclosed methods and compositions can be used alone or in any combination. The disclosed methods and compositions can improve the efficiency of mRNA synthesis and provide mRNA with improved properties.
[0053] Advantages of the present disclosure may include, for example, improved yield of mRNA, improved purity of mRNA, improved capping efficiency, and improved uniformity of poly-A tail length and / or distribution. Improved time and / or cost benefits may also be realized.
[0054] The disclosed methods and compositions can be used alone or in any combination to effect the in vitro synthesis of mRNAs of different sizes, for example, from about 100b to about 20Kb, from about 200b to about 19Kb, from about 300b to about 18Kb, from about 400b to about 17Kb, from about 500b to about 16Kb, from about 600b to about 15Kb, from about 700b to about 14Kb, from about 800b to about 13Kb, from about 900b to about 12Kb, from about 1Kb to about 11Kb, from about 1Kb to about 10Kb, from about 1Kb to about 9Kb, from about 1Kb to about 8Kb, from about 1Kb to about The mRNA may be in the range of, but is not limited to, 7 Kb, about 1 Kb to about 6 Kb, about 1 Kb to about 5 Kb, about 1 Kb to about 4 Kb, about 1 Kb to about 3 Kb, about 1 Kb to about 2 Kb, about 50 b to about 200 b, about 60 b to about 190 b, about 70 b to about 180 b, about 80 b to about 160 b, about 90 b to about 100 b, about 90 b to about 110 b, about 90 b to about 120 b, about 90 b to about 130 b, about 90 b to about 140 b, about 90 b to about 150 b, about 100 b to about 140 b, about 110 b to about 130 b, or about 110 b to about 120 b.
[0055] The mRNA synthesized using the disclosed compositions and / or methods can have applications including, but not limited to, basic science research applications, pharmacological development applications, diagnostic development applications, therapeutic development applications, pharmacological applications, diagnostic applications, therapeutic applications, or any combination thereof.
[0056] Methods for in vitro transcription of RNA are known in the art (see, e.g., Geall et al. (2013) Semin. Immunol. 25(2): 152-159; Brunelle et al. (2013) Methods Enzymol. 530: 101-14). The reagents used in the method include a linear DNA template having a promoter sequence with high binding affinity for its corresponding RNA polymerase, ribonucleoside triphosphates (NTPs) of the four bases (adenine, cytosine, guanine, and uracil), cap analogs (e.g., m7G(5')ppp(5')G (m7G)), other modified nucleotides, a DNA-dependent RNA polymerase (e.g., T7, T3, or SP6 RNA polymerase), a ribonuclease (RNase) inhibitor to inactivate any contaminating RNases, a pyrophosphatase to degrade transcription-inhibiting pyrophosphates, and Mg 2+ The solution may also contain MgCl and / or MgOAc to provide as cofactors for RNA polymerase, an antioxidant (e.g., DTT), a polyamine such as spermidine, and a buffer to maintain an appropriate pH value.
[0057] A common buffer system used for RNA in vitro transcription may contain 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) and tris(hydroxymethyl)aminomethane (Tris). The pH of the buffer can generally be adjusted to a pH value between 6 and 8.5. Some common transcription buffers may contain 80 mM HEPES / KOH (pH 7.5) and 40 mM Tris / HCl (pH 7.5).
[0058] The transfer buffer may further contain magnesium salts, such as MgCl2 and / or MgOAc, generally in the range between 5 and 50 mM. 2+ Magnesium ions (Mg) can function as a cofactor in the catalytic center of RNA polymerase and may be important for the RNA polymerization reaction. 2+) may be an essential component in RNA in vitro transcription buffer systems. In diffusion binding, fully hydrated Mg ions can also interact with RNA products via nonspecific long-range electrostatic interactions.
[0059] RNA in vitro transcription reactions can be performed in batch reactions, where all components are combined and incubated until the reaction is complete to allow the synthesis of RNA molecules. Fed-batch reactions have also been developed to increase the efficiency of RNA in vitro transcription reactions (Kern et al. (1997) Biotechnol. Prog. 13: 747-756, Kern et al. (1999) Biotechnol. Prog. 15: 174-184). In a fed-batch system, all components are combined, and different amounts of some reagents (e.g., NTPs, MgCl2, and / or MgOAc) are added over time to maintain constant reaction conditions.
[0060] For clarity and readability, the following definitions are provided. Any technical features mentioned in these definitions can be read in the context of the embodiments of the present invention. In particular, other definitions and interpretations can be provided in the context of these embodiments.
[0061] In vitro transcription: The terms "in vitro transcription" or "RNA in vitro transcription" may refer to a process in which RNA is synthesized in a cell-free system (in vitro). DNA, particularly plasmid DNA, is used as a template for producing RNA transcripts. RNA can be obtained by DNA-dependent in vitro transcription of a suitable DNA template, which, according to the present disclosure, may preferably be a linearized plasmid DNA template. The promoter for controlling in vitro transcription may be any promoter for any DNA-dependent RNA polymerase. Specific, non-limiting examples of DNA-dependent RNA polymerases are T7, T3, and SP6 RNA polymerases. A DNA template for in vitro RNA transcription can be obtained, for example, by cloning a nucleic acid (particularly a cDNA corresponding to the RNA of interest to be in vitro transcribed) and introducing it into a suitable vector for in vitro transcription, e.g., plasmid DNA. In a preferred embodiment of the present disclosure, the DNA template may be linearized with an appropriate restriction enzyme before in vitro transcription. cDNA can be obtained by reverse transcription of mRNA or chemical synthesis. Alternatively, a DNA template for in vitro RNA synthesis can also be obtained by gene synthesis.
[0062] For example, reagents used in in vitro transcription include: 1) a linearized DNA template having a promoter sequence that has high binding affinity for a corresponding RNA polymerase (e.g., a phage-encoded RNA polymerase); 2) ribonucleoside triphosphates (NTPs) of the four bases (adenine, cytosine, guanine, and uracil); 3) optionally a cap analog defined as follows (e.g., m7G(5')ppp(5')A(m7G)); 4) a DNA-dependent RNA polymerase (e.g., T7, T3, or SP6 RNA polymerase) capable of binding to a promoter sequence within a linearized DNA template; 5) an optional ribonuclease (RNase) inhibitor to inactivate any contaminating RNases; and 6) an optional pyrophosphatase to degrade pyrophosphates that can inhibit transcription; and 7) Mg 2+ MgCl and / or magnesium acetate (Mg(CHO)) (MgOAc), which provide ions as cofactors for the polymerase; 8) A buffer solution for maintaining an appropriate pH value, which may further contain optimal concentrations of antioxidants (e.g., DTT), amines (e.g., betaine), and / or polyamines (e.g., spermidine).
[0063] In the examples, the methods of RNA in vitro transcription according to the present disclosure do not use the following reagents, which are only necessary for in vitro translation of transcribed RNA into proteins, but are not necessary for RNA in vitro transcription. In particular, the mixture for RNA in vitro transcription may not contain any proteinogenic amino acids or tRNA. Furthermore, the mixture may not contain any proteinogenic amino acids, tRNA, or ribosome-containing cell extracts.
[0064] As used herein, the term "co-transcription" refers to the preparation of mRNA with a cap structure in a one-step in vitro transcription reaction using an RNA polymerase (e.g., T7 RNA polymerase). In contrast, one or more conventional post-transcriptional capping methods may require in vitro transcription (IVT) in the presence of an RNA polymerase to prepare uncapped RNA, and then adding a cap using a capping enzyme (e.g., vaccinia capping enzyme) with the aid of a 2'-O-methyltransferase to add methylation to the +1 base of the mRNA.
[0065] Nucleic Acid: The term "nucleic acid" refers to any DNA or RNA molecule and is used synonymously with polynucleotide. However, modifications or derivatives of nucleic acids as defined herein are expressly included in the general term "nucleic acid." For example, peptide nucleic acids (PNAs) are also included in the term "nucleic acid."
[0066] Nucleic acid template: The nucleic acid template provides a nucleic acid sequence that is transcribed into RNA by an in vitro transcription process and thus contains a nucleic acid sequence that is complementary to the RNA sequence transcribed therefrom. In addition to the nucleic acid sequence that is transcribed into RNA, the nucleic acid template further contains a promoter, and the RNA polymerase used in the in vitro transcription process binds to the promoter with high affinity.
[0067] Preferably, the nucleic acid template may be a linearized plasmid DNA template. Linear template DNA can be obtained by contacting plasmid DNA with a restriction enzyme under appropriate conditions, so that the restriction enzyme cleaves the plasmid DNA at one or more of its recognition sites, disrupting the circular plasmid structure. Preferably, the plasmid DNA is cleaved immediately after the end of the sequence to be transcribed into RNA. Therefore, the linear template DNA contains a free 5' end and a free 3' end that are not linked to each other. If the plasmid DNA contains only one recognition site for the restriction enzyme, the linear template DNA has the same number of nucleotides as the plasmid DNA. If the plasmid DNA contains multiple recognition sites for the restriction enzyme, the linear template DNA has fewer nucleotides than the plasmid DNA. Thus, the linear template DNA is a fragment of plasmid DNA that contains elements necessary for in vitro transcription, including promoter and template DNA elements for RNA transcription. According to base-pairing rules, the open reading frame (ORF) of the linear template DNA can determine the sequence of the transcribed RNA.
[0068] In other examples, the nucleic acid template may be selected from a synthetic double-stranded DNA construct, a single-stranded DNA template having a double-stranded DNA region containing a promoter bound by RNA polymerase, a circular double-stranded DNA template having a promoter and terminator sequence, or a linear DNA template amplified by PCR or isothermal amplification.
[0069] According to preferred embodiments of the present disclosure, the concentration of nucleic acid template in the in vitro transcription mixtures described herein may be within the range of about 1 to about 200 nM, about 10 nM to about 150 nM, about 20 nM to about 140 nM, about 30 nM to about 130 nM, about 40 nM to about 120 nM, about 50 nM to about 110 nM, about 60 nM to about 100 nM, about 65 nM to about 90 nM, about 65 nM to about 80 nM, about 65 nM to about 75 nM, about 65 nM to about 70 nM, about 70 nM to about 75 nM, about 1 to about 40 nM, about 1 to about 30 nM, about 1 to about 20 nM, or about 1 to about 10 nM. Even more preferably, the concentration of nucleic acid template may be about 10 to about 30 nM. Most preferably, the concentration of nucleic acid template may be about 40, 50, 60, 70, 80, 90 or 100 nM.
[0070] RNA, mRNA: RNA is a common abbreviation for ribose nucleic acid. It is a nucleic acid molecule, i.e., a polymer composed of nucleotide monomers. These nucleotides are generally adenosine monophosphate (AMP), uridine monophosphate (UMP), guanosine monophosphate (GMP), and cytidine monophosphate (CMP) monomers or their analogs linked together along a so-called backbone. The backbone is formed by a phosphodiester bond between the sugar of a first monomer (i.e., ribose) and the phosphate moiety of a second adjacent monomer. The specific order of the monomers (i.e., the order of the bases linked to the sugar / phosphate backbone) is called the RNA sequence. Generally, RNA can be obtained (e.g., intracellularly) by transcription of a DNA sequence. In eukaryotic cells, transcription generally occurs in the cell nucleus or mitochondria. In vivo, DNA transcription generally produces so-called premature RNA, which must be processed into so-called messenger RNA (commonly abbreviated as mRNA). For example, the processing of immature RNA in eukaryotic organisms involves several different post-transcriptional modifications, such as splicing, 5'-capping, polyadenylation, and export from the nucleus or mitochondria. The sum of these processes is also called RNA maturation. Mature messenger RNA generally provides a nucleotide sequence that can be translated into the amino acid sequence of a specific peptide or protein. Typically, mature mRNA contains a 5'-cap, optionally a 5' UTR, an open reading frame, optionally a 3' UTR, and a poly(A) sequence.
[0071] In addition to messenger RNA, there are also several non-coding types of RNA, which may be involved in regulating transcription and / or translation and immune stimulation. The term "RNA" further covers RNA molecules such as viral RNA, retroviral RNA and replicon RNA, small interfering RNA (siRNA), antisense RNA, CRISPR / Cas9 guide RNA, ribozyme, aptamer, ribose switch, immune stimulatory RNA, transfer RNA (tRNA), ribosomal RNA (rRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), microRNA (miRNA), and Piwi-interacting RNA (piRNA).
[0072] Dicarboxylic acids or their salts: Dicarboxylic acids are organic acids with two carboxyl groups (-COOH). The term refers to the general formula HO2C-(CH2) n These include linear saturated dicarboxylic acids with -COH, such as oxalic acid, malonic acid, succinic acid, glutaric acid, adipic acid, pimelic acid, suberic acid, azelaic acid, and sebacic acid. They also include unsaturated dicarboxylic acids with at least one double bond (e.g., maleic acid and fumaric acid), and substituted dicarboxylic acids with at least one additional functional group (e.g., malic acid, tartaric acid, chicoric acid, and dimercaptosuccinic acid). Salts of dicarboxylic acids are obtained by combining a dicarboxylic acid anion with a suitable cation, such as Na. + , K. + , Ca 2+ or Mg 2+ Includes:
[0073] Tricarboxylic acids or their salts: Tricarboxylic acids are organic acids with three carboxyl groups (-COOH). Examples of tricarboxylic acids include citric acid, isocitric acid, aconitic acid, trimesic acid, nitrilotriacetic acid, and propane-1,2,3-tricarboxylic acid. In the buffer system and method of the present invention, citric acid (3-carboxy-3-hydroxypentane-1,5-dioic acid) is preferably used. Salts of tricarboxylic acids are formed by combining a tricarboxylic acid anion with a suitable cation, such as Na. + , K.+ , Ca 2+ or Mg 2+ Preferably, sodium citrate or magnesium citrate is used. When magnesium citrate is added to an RNA in vitro transcription reaction, the magnesium ions in the magnesium citrate can act as a cofactor for RNA polymerase, so it may not be necessary to add a magnesium salt to the reaction. Therefore, in such cases, the reaction mixture for RNA in vitro transcription contains magnesium citrate, a buffer substance, ribonucleoside triphosphates, a nucleic acid template, and an RNA polymerase.
[0074] Buffer: A buffer is a weak acid or base used to maintain the acidity (pH) of a solution near a selected value after the addition of another acid or base. Therefore, the function of a buffer is to prevent a sudden change in pH when an acid or base is added to a solution. Suitable buffers for use in the present invention include Tris (2-amino-2-hydroxymethyl-propane-1,3-diol) and HEPES (2-[4-(2-hydroxyethyl)piperazin-1-yl]ethanesulfonic acid). The buffer may further contain an acid or base to adjust the pH, such as HCl in the case of Tris (Tris-HCl) and KOH in the case of HEPES (HEPES-KOH). In a preferred embodiment of the present invention, citric acid is used to adjust the pH of the buffer (preferably Tris base), thereby avoiding the addition of other acids. In an alternative embodiment, the pH of the buffer is adjusted using an acid or base (e.g., HCl and KOH), and in addition to the pH-adjusted buffer, a salt of a dicarboxylic or tricarboxylic acid, preferably a citrate salt, is also present in the reaction mixture.
[0075] The concentration of the buffer in the mixture for in vitro transcription described herein may be about 10 to about 100 mM, about 10 to about 80 mM, about 10 to about 50 mM, about 10 to about 40 mM, about 10 to about 30 mM, or about 10 to about 20 mM. Preferably, the concentration of the buffer is 80 mM.
[0076] Preferably, the buffer has a pH value of about 6 to about 8.5, about 6.5 to about 8.0, about 7.0 to about 7.5, and even more preferably about 7.5 or about 8.0.
[0077] Ribonucleoside triphosphates: Ribonucleoside triphosphates (NTPs) (i.e., GTP, ATP, CTP, and UTP) are monomers polymerized in the in vitro transcription process. They can be provided with monovalent or divalent cations as counterions. Preferably, the monovalent cation is Li + , Na + , K. + , NH4 + or tris(hydroxymethyl)-aminomethane (Tris). Preferably, the divalent cation is selected from the group consisting of Mg 2+ , Ba 2+ and Mn 2+ More preferably, the monovalent cation is selected from the group consisting of Na + or tris(hydroxymethyl)-aminomethane (Tris).
[0078] According to a preferred embodiment of the present invention, some or all of at least one ribonucleoside triphosphate in an in vitro transcription reaction mixture is replaced with a modified nucleoside triphosphate, as defined below.
[0079] Modified nucleoside triphosphate: As used herein, the term "modified nucleoside triphosphate" refers to chemical modifications, including backbone modifications and sugar or base modifications. These modified nucleoside triphosphates are also referred to herein as (nucleotide) analogs.
[0080] In this context, a modified nucleoside triphosphate as defined herein is a nucleotide analog / modification, such as a backbone modification, sugar modification, or base modification. A backbone modification according to the present invention is a modification in which the phosphate in the backbone of the nucleotide is chemically modified. A sugar modification according to the present invention is a chemical modification of the sugar in the nucleotide. Note that a base modification according to the present invention is a chemical modification of the base moiety of the nucleotide. In this context, the nucleotide analog or modification is preferably selected from nucleotide analogs applicable to transcription and / or translation. sugar modification
[0081] Modified nucleosides and nucleotides usable in the context of the present invention can be modified in the sugar moiety. For example, the 2' hydroxy group (OH) can be modified or replaced with several different "oxy" or "deoxy" substituents. Examples of "oxy"-2' hydroxy groups include alkoxy or aryloxy groups (-OR, e.g., R=H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugars), and polyethylene glycol (PEG), -O(CHCHO). n These include, but are not limited to, CH2CH2OR, "locked" nucleic acids (LNAs) in which the 2' hydroxy group is linked to the 4' carbon of the same ribose, for example via a methylene bridge, and amino groups (-O-amino groups, where the amino group (e.g., NRR) can be an alkylamino group, dialkylamino group, heterocyclyl group, arylamino group, diarylamino group, heteroarylamino group, or diheteroarylamino group, ethylenediamine, polyamino group) or aminoalkoxy groups.
[0082] A "deoxy" modification can include a hydrogen, an amino group (e.g., NH, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid), or the amino group can be attached to the sugar via a linker, where the linker includes one or more of C, N, and O atoms.
[0083] The sugar group may contain one or more additional carbons that have the opposite stereochemical configuration to the corresponding carbons in ribose, so modified nucleotides may include, for example, nucleotides that contain arabinose as the sugar. skeletal modifications
[0084] The phosphate backbone may be further modified in modified nucleosides and nucleotides. The backbone phosphate group can be modified by replacing one or more oxygen atoms with different substituents. Additionally, modified nucleosides and nucleotides may include the complete replacement of the unmodified phosphate moiety with a modified phosphate as described herein. Examples of modified phosphate groups include, but are not limited to, thiophosphates, selenium phosphates, boranophosphates, boranophosphate esters, hydrogen phosphate esters, phosphate amides, alkyl or aryl phosphonates, and phosphate triesters. Dithiophosphates have two non-linked oxygens replaced with sulfur. The phosphate linker can be further modified by replacing the linking oxygen with nitrogen (bridged phosphate amides), sulfur (bridged thiophosphates), and carbon (bridged methylene-phosphonates). Base modification
[0085] The modified nucleosides and nucleotides usable in the present disclosure may be further modified in the nucleobase moiety. Examples of nucleobases found in RNA include, but are not limited to, adenine, guanine, cytosine, and uracil. For example, the nucleosides and nucleotides described herein may be chemically modified on the major groove surface. In some embodiments, the major groove chemical modification may include an amino group, a thiol group, an alkyl group, or a halo group.
[0086] In a particularly preferred embodiment of the present invention, the nucleotide analogues / modifications may be selected from base modifications, which are preferably 2-amino-6-chloropurine nucleoside-5'-triphosphate, 2-aminopurine-nucleoside-5'-triphosphate, 2-aminoadenosine-5'-triphosphate, 2'-amino-2'-deoxycytidine-triphosphate, 2-thiocytidine-5'-triphosphate, 2-thiouridine-5'-triphosphate, 2'-fluorothymidine-5'-triphosphate, 2'-O-methylinosine-5'-triphosphate, 4-thiouridine-5'-triphosphate, 5-aminoallylcytidine-5'-triphosphate, 5-aminoallyluridine-5'-triphosphate, 5-bromocytidine-5'-triphosphate, 5-bromouridine-5'-triphosphate, 5-bromo-2'-deoxycytidine-5'-triphosphate, 5-bromo-2'-deoxyuridine-5'-triphosphate, 5-iodocytidine-5'-triphosphate, 5-iodo-2'-deoxycytidine-5'-triphosphate, 5- Iodouridine-5'-triphosphate, 5-iodo-2'-deoxyuridine-5'-triphosphate, 5-methylcytidine-5'-triphosphate, 5-methyluridine-5'-triphosphate, 5-propynyl-2'-deoxycytidine-5'-triphosphate, 5-propynyl-2'-deoxyuridine-5'-triphosphate, 6-azacytidine-5'-triphosphate, 6-azauridine-5'-triphosphate, 6-chloropurine nucleoside-5'-triphosphate, 7-deazaadenosine-5'-triphosphate, 7-deaza The base-modified nucleotides are selected from the group consisting of 5-methylcytidine-5'-triphosphate, 7-deazaguanosine-5'-triphosphate, 5-bromocytidine-5'-triphosphate, and pseudouridine-5'-triphosphate.
[0087] In some embodiments, the modified nucleoside is pyridine-4-ketoribose nucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinemethyluridine, 1-taurinemethyl-pseudouridine, 5-taurinemethyl-2-thio-uridine, 1-taurinemethyl- The pseudouridine may include 1-methyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine and 4-methoxy-2-thio-pseudouridine.
[0088] In some embodiments, the modified nucleoside is 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine May include isocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine and 4-methoxy-1-methyl-pseudoisocytidine.
[0089] In other examples, the modified nucleoside is 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, N6 These may include -(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycylcarbamoyladenosine, N6-threoninoylcarbamoyladenosine, 2-methylthio-N6-threoninoylcarbamoyladenosine, N6,N6-dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, and 2-methoxy-adenine.
[0090] In other examples, modified nucleosides may include inosine, 1-methyl-inosine, uiosine, uibutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio-guanosine.
[0091] In some examples, the nucleotide may be modified on the major groove face and may include replacing the hydrogen on C-5 of uracil with a methyl or halo group.
[0092] In specific embodiments, the modified nucleoside is 5'-O-(1-thiophosphate)-adenosine, 5'-O-(1-thiophosphate)-cytidine, 5'-O-(1-thiophosphate)-guanosine, 5'-O-(1-thiophosphate)-uridine, or 5'-O-(1-thiophosphate)-pseudouridine.
[0093] In another specific embodiment, the modified nucleotide is 6-aza-cytidine, 2-thio-cytidine, α-thio-cytidine, pseudoisocytidine, 5-aminoallyl-uridine, 5-iodo-uridine, N1-methyl-pseudouridine, 5,6-dihydrouridine, α-thio-uridine, 4-thio-uridine, 6-aza-uridine, 5-hydroxy-uridine, deoxy-thymidine, 5-methyl-uridine, pyrrolo-cytidine, ino The nucleoside modifications may be selected from cytidine, α-thio-guanosine, 6-methyl-guanosine, 5-methyl-cytidine, 8-oxo-guanosine, 7-deaza-guanosine, N1-methyl-adenosine, 2-amino-6-chloro-purine, N6-methyl-2-amino-purine, pseudoisocytidine, 6-chloro-purine, N6-methyl-adenosine, α-thio-adenosine, 8-azidoadenosine, 7-deaza-adenosine.
[0094] Magnesium salt: A magnesium salt comprises a magnesium cation and a suitable anion (e.g., chloride or acetate). Preferably, the magnesium salt is magnesium chloride. In one or more in vitro transcription mixtures described herein, preferably, the initial free Mg 2+ The concentration may be about 1 to about 100 mM, about 1 to about 75 mM, about 1 to about 50 mM, about 1 to about 25 mM, or about 1 to about 10 mM. 2+ The concentration is about 5 to about 50 mM, about 10 to about 45 mM, about 15 to about 40 mM, or about 16 to about 37 mM, e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37 mM. 2+The choice of concentration may be influenced by the initial total NTP concentration, as using a higher total NTP concentration in the in vitro transcription mixture may result in a higher Mg 2+ In some embodiments, the concentration of the magnesium salt may be from about 2 mM to about 50 mM, from about 2 mM to about 40 mM, from about 2 mM to about 30 mM, from about 2 mM to about 40 mM, from about 2 mM to about 30 mM, from about 2 mM to about 20 mM, from about 2 mM to about 10 mM, from about 2 mM to about 5 mM, from about 5 mM to about 50 mM, from about 10 mM to about 45 mM, from about 15 mM to about 40 mM, from about 20 mM to about 35 mM, from about 20 mM to about 30 mM, from about 20 mM to about 25 mM, from about 22 mM to about 28 mM, or from about 25 mM to about 30 mM.
[0095] RNA polymerase: An RNA polymerase is an enzyme that catalyzes the transcription of a DNA template into RNA. Suitable RNA polymerases for use in the present disclosure may include T7, T3, SP6, and E. coli RNA polymerase. Preferably, T7 RNA polymerase may be used. More preferably, the RNA polymerase for use in the present disclosure may be a recombinant RNA polymerase, meaning that it is added to an RNA in vitro transcription reaction as a single component, rather than as part of a cell extract containing other components in addition to the RNA polymerase. As will be understood by those skilled in the art, the choice of RNA polymerase depends on the promoter present in the DNA template, which must be bound to the appropriate RNA polymerase. Preferably, the concentration of RNA polymerase in one or more of the in vitro transcription mixtures described herein is from about 0.001 μg / μl to about 2 μg / μl, from about 0.001 μg / μl to about 1.5 μg / μl, from about 0.001 μg / μl to about 1 μg / μl, from about 0.01 μg / μl to about 1 μg / μl, from about 0.01 μg / μl to about 0.5 μg / μl, from about 0.01 μg / μl to about 0.5 μg / μl, from about 0.01 μg / μl to about 0.1 μg / μl, or from about 0.01 μg / μl to about 0.5 μg / μl. The RNA polymerase concentration may be from about 1 μg / μl to about 0.05 μg / μl, from about 0.1 μg / μl to about 1 μg / μl, from about 0.1 μg / μl to about 0.9 μg / μl, from about 0.1 μg / μl to about 0.8 μg / μl, from about 0.1 μg / μl to about 0.7 μg / μl, from about 0.1 μg / μl to about 0.6 μg / μl, from about 0.1 μg / μl to about 0.5 μg / μl, from about 0.1 μg / μl to about 0.4 μg / μl, from about 0.1 μg / μl to about 0.3 μg / μl, or from about 0.1 μg / μl to about 0.2 μg / μl. As will be appreciated by those skilled in the art, the selection of the RNA polymerase concentration may be influenced by the DNA template concentration.
[0096] Pyrophosphatase: Pyrophosphatase is an anhydride hydrolase that hydrolyzes diphosphate bonds. In in vitro transcription reactions, it is used to hydrolyze the bond within the diphosphate that is released after ribonucleoside triphosphates are incorporated into the nascent RNA strand. Preferably, the concentration of pyrophosphatase in one or more of the in vitro transcription mixtures described herein may be from about 1 to about 100 units / ml, from about 10 units / ml to about 90 units / ml, from about 20 units / ml to about 80 units / ml, from about 30 units / ml to about 70 units / ml, from about 40 units / ml to about 60 units / ml, from about 45 units / ml to about 55 units / ml, from about 45 units / ml to about 50 units / ml, from about 50 units / ml to about 55 units / ml, from about 10 units / ml to about 50 units / ml, from about 15 units / ml to about 40 units / ml, from about 20 units / ml to about 30 units / ml, from about 20 units / ml to about 25 units / ml, from about 25 units / ml to about 30 units / ml, from about 1 to about 15 units / ml, from about 1 to about 10 units / ml, from about 1 to about 5 units / ml, or from about 1 to about 2.5 units / ml. Even more preferably, the concentration of pyrophosphatase may be about 50 units / ml, or about 25 units / ml.
[0097] 5'-cap structure: A 5'-cap is typically a modified nucleotide, particularly a guanine nucleotide, added to the 5' end of an RNA molecule. Preferably, the 5'-cap can be added using a 5'-5'-triphosphate linkage. The 5'-cap may be methylated, e.g., m7GpppN, where N is the terminal 5' nucleotide of the 5'-capped nucleic acid, typically at the 5' end of the RNA. Naturally occurring 5'-caps may include m7GpppN.
[0098] Other examples of 5' cap structures may include a glyceryl group, an inverted deoxyabasic residue (moiety), a 4',5' methylene nucleotide, a 1-(β-D-erythrofuranosyl) nucleotide, a 4'-thionucleotide, a carbocyclic nucleotide, a 1,5-anhydrohexitol nucleotide, an L-nucleotide, an α-nucleotide, a modified base nucleotide, a threo-pentofuranosyl nucleotide, an acyclic 3',4'-open ring nucleotide, an acyclic 3,4-dihydroxybutyl nucleotide, an acyclic 3,5 dihydroxypentyl nucleotide, a 3'-3'-inverted nucleotide moiety', a 3'-3'-inverted abasic moiety', a 3'-2'-inverted nucleotide moiety, a 3'-2'-inverted abasic moiety, 1,4-butanediol phosphate, a 3'-phosphoamide, a hexyl phosphate, an aminohexyl phosphate, a 3'-phosphate, a 3' thiophosphate, a dithiophosphate, or a bridged or non-bridged methylphosphonate moiety.
[0099] Particularly preferably, the 5' cap structure may be Cap 1 (methylation of the ribose of the nucleotide adjacent to m7G).
[0100] The 5' cap structure may be formed from a cap analog.
[0101] Cap analog: A cap analog refers to a non-extendable dinucleotide or trinucleotide with capping function, which means that when incorporated at the 5' end of an RNA molecule, it promotes translation or localization and / or prevents degradation of the RNA molecule. Capped mRNA without a 5'-terminal triphosphate structure reduces its immunogenic side effects. Non-extendable means that the cap analog is incorporated only at the 5' end, does not have a 5' triphosphate, and therefore cannot be extended in the 3' direction by template-dependent RNA polymerase.
[0102] Cap analogs include, but are not limited to, chemical structures selected from the group consisting of m7GpppG, m7GpppA, m7GpppC, unmethylated cap analogs (e.g., GpppG), dimethylated cap analogs (e.g., m2,7GpppG), trimethylated cap analogs (e.g., m2,2,7GpppG), dimethylated symmetric cap analogs (e.g., m7Gpppm7G), or anti-reverse cap analogs (e.g., ARCA, m7,2'OmeGpppG, m7,2'dGpppG, m7,3'OmeGpppG, m7,3'dGpppG and their tetraphosphate derivatives) (Stepinski et al., 2001. RNA 7(10):1486-95, the contents of which are incorporated herein by reference in their entirety).
[0103] Other cap analogs have been previously described (U.S. Patent Nos. 7,074,596, 8,304,529, 8,153,773, 8,519,110, 9,295,717, and 9,388,420, the contents of which are incorporated herein by reference in their entireties). Recently, the synthesis of N7-(4-chlorophenoxyethyl) substituted dinucleotide cap analogs has been described (Kore et al., 2013. Bioorg. Med. Chem. 21(15):4570-4).
[0104] Particularly preferred cap analogs are G[5']ppp[5']G, m 7 G[5']ppp[5']G, m3 2,2,7 G[5']ppp[5']G, m2 7,3’-O G[5']ppp[5']G(3'-ARCA), m2 7,2’-O GpppG(2'-ARCA), m2 7,2’-O GppspG D1 (β-S-ARCA D1), m2 7,2’-O GppspG D2 (β-S-ARCA D2), m 7 GpppmAG, m 7 GpppmAmG, m 7 GpppmAmGG, m 7 GpppmA, m 7mGpppmA, m 7 Gpppm 7 mAG and m 7 mGpppm 7 It may also be mAG.
[0105] In some embodiments, the cap analog may be a cap0, cap1, or cap2 analog.
[0106] In some embodiments, the cap analog is [ka] It may contain a cap [I] having the structure:
[0107] Preferably, the cap analog may be added at an initial concentration ranging from about 1 to about 20 mM, about 1 to about 17.5 mM, about 1 to about 15 mM, about 1 to about 12.5 mM, about 1 to about 10 mM, about 1 to about 7.5 mM, about 1 to about 5 mM, or about 1 to about 2.5 mM, and even more preferably, from about 5 to about 20 mM, about 7.5 to about 20 mM, about 10 to about 20 mM, or about 12.5 to about 20 mM. In some embodiments, the concentration of the cap analog is from about 0.5 mM to about 50 mM, from about 0.5 mM to about 40 mM, from about 0.5 mM to about 30 mM, from about 0.5 mM to about 20 mM, from about 0.5 mM to about 10 mM, from about 0.5 mM to about 5 mM, from about 1 mM to about 10 mM, from about 2 mM to about 10 mM, from about 3 mM to about 10 mM, from about 3 mM to about 9 mM, from about 3 mM to about 9 mM, It may be about 8 mM, about 3 mM to about 7 mM, about 3 mM to about 6 mM, about 3 mM to about 5 mM, about 3 mM to about 4 mM, about 4 mM to about 10 mM, about 5 mM to about 10 mM, about 6 mM to about 10 mM, about 6 mM to about 9 mM, about 6 mM to about 8 mM, about 6 mM to about 7 mM, about 7 mM to about 10 mM, about 8 mM to about 10 mM, or about 9 mM to about 10 mM.
[0108] In some embodiments, cap analogs can be chemically synthesized by known methods, such as, but not limited to, phosphorylation, oxidation with amidite, and formation of dimeric fragments starting from nucleosides, followed by chemical synthesis of GDP imidazolide fragments, followed by a final coupling reaction.
[0109] Ribonuclease inhibitors: Ribonuclease inhibitors inhibit the action of ribonucleases, which degrade RNA. Preferably, the concentration of the ribonuclease inhibitor in one or more in vitro transcription mixtures described herein can be about 1 to about 500 units / ml, about 1 to about 400 units / ml, about 1 to about 300 units / ml, about 1 to about 200 units / ml, or about 1 to about 100 units / ml. Even more preferably, the concentration of the ribonuclease inhibitor can be about 100 to about 300 units / ml, e.g., 100 units / ml, 150 units / ml, 200 units / ml, 250 units / ml, or 300 units / ml.
[0110] Antioxidants: Antioxidants inhibit the oxidation of other molecules. Suitable antioxidants for use in the present disclosure may include, but are not limited to, DTT (dithiothreitol), TCEP (tris(2-carboxyethyl)phosphine), NAC (N-acetylcysteine), β-mercaptoethanol, glutathione, cysteine, and cystine. Preferably, DTT can be used in the in vitro transcription reaction.
[0111] The concentration of antioxidant, preferably DTT, in one or more in vitro transcription mixtures described herein may be about 1 to about 50 mM, about 5 to about 48 mM, about 8 to about 47 mM, about 10 to about 46 mM, about 15 to about 45 mM, about 18 to about 44 mM, about 20 to about 43 mM, about 23 to about 42 mM, about 25 to about 41 mM, or about 28 to about 40 mM. Preferably, the concentration may be about 40 mM.
[0112] Amine: Preferably, the amine used in the present invention may be betaine (trimethylglycine). The concentration of the amine (preferably betaine) may be from about 10 mM to about 2 M, preferably from about 0.7 M to about 1.3 M.
[0113] Polyamine: Preferably, the polyamine may be selected from the group consisting of spermine and spermidine. Preferably, the concentration of the polyamine may be about 1 to about 25 mM, about 1 to about 20 mM, about 1 to about 15 mM, about 1 to about 10 mM, about 1 to about 5 mM, or about 1 to about 2.5 mM. Even more preferably, the concentration of the polyamine may be about 2 mM. Most preferably, the concentration of the polyamine may be about 2 mM spermidine.
[0114] DNA enzyme: A DNA enzyme is an enzyme that hydrolyzes DNA by catalyzing the hydrolytic cleavage of phosphodiester bonds in the DNA backbone. Suitable DNA enzymes can be isolated from bovine pancreatic glands and are available from different suppliers (e.g., Sigma-Aldrich, New England Biolabs, Qiagen, and ThermoFisher). Preferably, the DNA enzyme does not have any RNase activity. In the method of the present disclosure, DNA enzyme treatment can be performed after the RNA in vitro transcription reaction by adding a DNA enzyme to the reaction mixture for RNA in vitro transcription. Preferably, an appropriate amount of calcium chloride can be added to the RNA in vitro transcription mixture along with the DNA enzyme. The appropriate amount of CaCl2 can be about 1 to about 5 mM, preferably about 2 to about 4 mM, and more preferably about 3 mM. DNA can be treated with the DNA enzyme for about 1 to about 5 hours, preferably about 1.5 to about 3 hours, and more preferably about 2 hours. DNA enzyme treatment can be performed at a temperature of preferably about 37°C. In one example, about 3 mM CaCl2 and about 200 U / ml DNA enzyme I may be added to the RNA in vitro transcription mixture, and the resulting mixture may be incubated at about 37°C for about two hours. In another example, about 3 mM CaCl2 and about 400 U / ml DNA enzyme I may be added to the RNA in vitro transcription mixture, and the resulting mixture may be incubated at about 37°C for about two hours. The DNA enzyme treatment may be stopped by adding EDTA or another chelating agent. Preferably, the DNA enzyme treatment may be stopped by adding EDTA to a final concentration of about 25 mM.
[0115] Examples of the present disclosure can provide a combined solution for in vitro synthesis of mRNAs of different sizes, for example, but not limited to, about 1 Kb to 20 Kb, such as 1 Kb to 15 Kb or 1 Kb to 10 Kb, in a time-efficient manner with high capping efficiency, uniform polyA tails, high yield, and integrity. Examples of the present disclosure can include transcribing capped mRNAs in vitro using T7 RNA polymerase by designing a T7 promoter sequence in a DNA template to provide high affinity for the cap analog. Such a DNA template promoter design can include a T7 Φ6.5 promoter followed by the sequence GG. Such a design ensures efficient initiation of transcription, allowing for the preparation of capped mRNAs with high fidelity at the 5' end in a one-step process. 5'-end capping of mRNA
[0116] One of the important factors determining mRNA translation efficiency may be its 5'-end capping. Typically, capping is performed using a capping enzyme, and although the capping efficiency can be high, the process is time-consuming and expensive. Therefore, an efficient co-transcription method that allows for more rapid production of capped mRNA with higher efficiency is needed. Ishikawa M., Ishikawa et al., "Preparation of eukaryotic mRNA having differentially methylated adenosine at the 5'-terminus and the effect of the methyl group in translation," Nucleic Acids Symposium Series, Vol. 53, Issue 1, September-October 2009, pp. 129-130, addressed this need. Ishikawa demonstrated the use of a trinucleotide cap analog with the structure m7GpppA*pG (where A* is adenosine or a methylated adenosine derivative) to prepare capped mRNA in one-step in vitro transcription. Using these molecules, Ishikawa demonstrated the ability to synthesize capped mRNAs containing A, A, and A.m , m6 A or m6 A m We obtained reporter 5'-capped mRNAs with a cap analog (as the first transcribed nucleotide) and studied their translational properties in a rabbit reticulocyte system. Another study also demonstrated co-transcriptional capping of mRNAs using cap analogs. Sikorski, PJ et al., 2020, "The identity and methylation status of the first transcribed nucleotide in eukaryotic mRNA 5' cap modulates protein expression in living cells," Nucleic Acids Research, 48(4), pp. 1607-1626. While these methods demonstrated higher transcriptional capping efficiencies, the capping efficiency remains approximately 95%-96% or lower (due to the nature of the cap molecule). Therefore, there remains a need for efficient co-transcriptional methods that allow for the production of higher-quality capped mRNAs with greater time and / or cost benefits.
[0117] In embodiments, methods and / or compositions can be provided that increase capping efficiency, such as to greater than about 96%, greater than about 96.5%, greater than about 97%, greater than about 97.5%, greater than about 98%, greater than about 98.5%, greater than about 99%, or greater than about 99.5%, as measured, for example, by cleaving mRNA with RNase H followed by measuring capping efficiency by LC-MS.
[0118] In an embodiment, the cap analog can initiate in vitro transcription to synthesize capped mRNA in a one-pot reaction. In an embodiment, the first base, methyl-A, after the reverse G cap can bind to the −1 position of the DNA template, and the second base, G, can bind to the +1 position of the DNA template, forming a complex with RNA polymerase to recruit the next ribonucleoside triphosphate (NTP), thereby extending the RNA during the transcription process. For example, as shown in Figure 10A, cap [I] ( m7 G 5 pppA 2’-Ome When a reverse G cap is used, the first base after the reverse G cap, methyl-A, binds to the -1 position of the DNA template, and the second base, G, binds to the +1 position of the DNA template, forming a complex with T7 RNA polymerase to recruit the next NTP, thereby extending the RNA during the transcription process.
[0119] In embodiments, compositions comprising one or more cap analogs as described herein are provided. In embodiments, methods using one or more cap analogs as described herein are provided. In embodiments, cap analogs as described herein may be used in combination with compositions and / or methods described herein and / or in combination with conventional compositions and / or methods. In embodiments, the methods and / or compositions described herein can increase mRNA capping efficiency to greater than about 96%, greater than about 96.5%, greater than about 97%, greater than about 97.5%, greater than about 98%, greater than about 98.5%, greater than about 99%, greater than about 99.5%, or at most about 100%. promoter
[0120] The promoter design in the DNA template can be important for initiation of in vitro transcription by DNA-dependent RNA polymerase. In an embodiment where T7 RNA polymerase (a monosubunit polymerase derived from T7 phage) can be used, the DNA template promoter design can include the T7 Φ6.5 promoter, followed by the sequence GG, GA, or AGG. In an embodiment, such a design can efficiently initiate transcription and produce mRNA with high fidelity at the 5' end in a one-step process.
[0121] In an embodiment, the promoter may have the sequence TAATACGACTCACTATAX1X2X3 (SEQ ID NO: 16), where X1 is A or G, X2 is A or G, and X3 is A, T, G, or C.
[0122] In embodiments where T7 RNA polymerase can be used, in vitro transcription may be initiated using at least one of the promoter sequences in Table 1. Promoters can be added to a plasmid vector by gene synthesis or subcloning.
[0123] [Table 1]
[0124] In embodiments, at least one of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, or SEQ ID NO: 15 may be used to prime in vitro transcription.
[0125] In examples, compositions are provided comprising one or more promoters as described herein. In examples, vectors are provided comprising one or more promoters as described herein. In examples, methods of using one or more promoters as described herein are provided. In examples, compositions are provided comprising mRNA, the mRNA comprising one or more promoters as described herein. In examples, vectors are provided comprising mRNA, the mRNA comprising one or more promoters as described herein. In examples, methods of using mRNA, the mRNA comprising one or more promoters as described herein are provided.
[0126] In some embodiments, in vitro transcription may be initiated at the -1 position, which helps form a more favorable complex with T7 RNA polymerase and produce RNA that is more fully formed. Using the -1 and +1 positions of the initiation site for in vitro transcription allows for more flexibility in selecting the first mRNA base (not including the cap base) and leaves the +2 position open for custom sequences, such as those listed in Table 1, to produce mRNA. Currently, common practice for incorporating cap molecules during in vitro transcription is to use the +1 position to initiate mRNA synthesis, which requires the template to have the correct sequence of AG or AT after the T7 promoter TATA box sequence. Examples of the present disclosure may include a method using a DNA template with a generic T7 promoter sequence (which has GG after the T7 promoter TATA box), which eliminates the need for specific mutagenesis of the DNA template when preparing capped mRNA by co-transcription.
[0127] In some embodiments, a method for in vitro transcribing a DNA template into RNA includes: (1) a DNA template, the DNA template comprising a promoter operably linked to a nucleic acid, the nucleic acid comprising a 5' untranslated region (5' UTR), an open reading frame (ORF) encoding an RNA of interest, a 3' UTR, and a polyA region; and (2) a cap analog, the cap analog comprising: [ka] It contains the structure wherein R1 and R2 may each be CH3 or H, and B1 and B2 may each be A, U, G, or C; wherein the promoter may contain the sequence TAATACGACTCACTATAX1X2X3 (SEQ ID NO: 16); wherein A at position 17 is the −1 nucleotide and X1 at position 18 is the +1 nucleotide; When X1 is G, and X2 and X3 are each A, T, G, or C, B1 is A and B2 is G; When X1 is A, and X2 and X3 are each A, T, G, or C, B1 is A and B2 is A; When X1 is C, and X2 and X3 are each A, T, G, or C, then B1 is A and B2 is C; and When X1 is T and X2 and X3 are each A, T, G or C, B1 is A and B2 is U; This may include providing a cap analog attached to the -1 and +1 nucleotides of the promoter, and incubating the DNA template and the cap analog in a reaction mixture, wherein the incubation may include incubating the reaction mixture at about 15°C to about 35°C for about 1 hour to about 12 hours to produce RNA.
[0128] The promoter may contain a sequence selected from SEQ ID NOs: 10, 11, 13 and 14.
[0129] In some embodiments, a method for in vitro transcribing a DNA template into RNA may include providing (1) a DNA template, the DNA template comprising a promoter operably linked to a nucleic acid, the nucleic acid comprising a 5' untranslated region (5' UTR), an open reading frame (ORF) for encoding an RNA of interest, a 3' UTR, and a polyA region; and (2) a cap analog, the cap analog attached to the -1 and +1 nucleotides of the promoter; and incubating the DNA template and the cap analog in a reaction mixture, wherein the incubation may include incubating the reaction mixture at about 15°C to about 35°C, preferably about 18°C to about 31°C, for a suitable period of time, preferably about 1 hour to about 12 hours, to produce RNA.
[0130] In some embodiments, a method for in vitro transcribing a DNA template into RNA may include providing (1) a DNA template, the DNA template comprising a promoter operably linked to a nucleic acid, the nucleic acid comprising a 5' untranslated region (5' UTR), an open reading frame (ORF) encoding an RNA of interest, a 3' UTR, and a polyA region; and (2) a cap analog, the cap analog attached to the -1 and +1 nucleotides of the promoter, and producing RNA by incubating the DNA template and the cap analog in a reaction mixture.
[0131] In some embodiments, the reaction mixture comprises NTPs and an RNA polymerase. In some embodiments, the reaction mixture may further comprise one or more of a buffer, an RNase inhibitor, a magnesium salt, a polyamine, and a pyrophosphatase.
[0132] In some embodiments, the reaction mixture comprises a buffer substance at a concentration of about 45 mM to about 55 mM, an RNase inhibitor at a concentration of about 0.01 U / μl to about 0.03 U / μl, an NTP at a concentration of about 3 mM to about 5 mM, a cap analog at a concentration of about 6 mM to about 8 mM, one or more magnesium salts at a concentration of about 20 mM to about 30 mM, a polyamine at a concentration of about 1.5 mM to about 2.5 mM, a DNA template at a concentration of about 0.01 μg / μl to about 0.05 μg / μl, a pyrophosphatase at a concentration of about 0.1 mU / μl to about 0.5 mU / μl, and an RNA polymerase at a concentration of about 0.01 μg / μl to about 0.05 μg / μl. 5' UTR and 3' UTR
[0133] The mRNA molecule may be flanked by 5'- and 3'-untranslated regions (UTRs). The 5'-UTR can be recognized by ribosomes to allow translation initiation, and the 3'-UTR may contain regulatory sequences that can affect the expression and half-life of the mRNA. When mRNA is expressed in mammalian cells, several different combinations of 5' and 3' UTRs can achieve high mRNA expression efficiency.
[0134] Cao et al. (Cao et al., "High-throughput 5'UTR engineering for enhanced protein production in non-viral gene therapies," Nature Communications, (2021) 12:4138, pp. 1-10, incorporated herein by reference in its entirety) reported a method for producing artificial 5' UTRs through a high-throughput screening process.
[0135] In an embodiment, a combination of an artificially selected 5' UTR and a human hemoglobin or mouse hemoglobin 3' UTR can be used to generate a construct for efficient expression of an mRNA sequence. The combination can be selected and used to construct a vector for in vitro transcription (IVT). The combination can be used to produce an mRNA with efficient protein expression capabilities. In an embodiment, one or more UTRs listed in Table 5 (see Example 1 below) are used. In an embodiment, one or more UTRs listed in Table 5 can be used in any combination. In an embodiment, UTRs can be used in pairs, such as those shown in Table 5, where the paired members are located in the same row. In some embodiments, SEQ ID NO:1 and SEQ ID NO:2 are paired, SEQ ID NO:3 and SEQ ID NO:2 are paired, SEQ ID NO:1 and SEQ ID NO:4 are paired, SEQ ID NO:1 and SEQ ID NO:6 are paired, SEQ ID NO:3 and SEQ ID NO:6 are paired, and / or SEQ ID NO:9 and SEQ ID NO:2 are paired. In some embodiments, one or more UTRs listed in Table 5 can achieve high expression efficiency when mRNA is expressed in mammalian cells. In some embodiments, one or more pairs of UTRs listed in Table 5 can be used to achieve high expression efficiency when mRNA is expressed in mammalian cells.
[0136] In an embodiment, a native 5' UTR (e.g., SEQ ID NOs: 53-69 (Table 13)) can be modified to produce a mutant 5' UTR (e.g., SEQ ID NOs: 23-52 (Table 14)). Combinations of mutant 5' UTRs and 3' UTRs (e.g., SEQ ID NOs: 2, 4, 6, 8, and 71) can be used to produce constructs for efficient expression of mRNA sequences. The combinations can be selected and used to construct vectors for in vitro transcription (IVT). The combinations can be used to produce mRNAs capable of efficient protein expression.
[0137] In examples, the nucleic acids of the present disclosure may include nucleic acids that are at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleic acid sequence of SEQ ID NOs: 1-71.
[0138] In embodiments, the nucleic acids of the present disclosure may include nucleic acids that are at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleic acid sequence of SEQ ID NOs: 1-9.
[0139] In embodiments, the nucleic acids of the present disclosure may include nucleic acids that are at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleic acid sequence of SEQ ID NOs: 23-52.
[0140] In embodiments, the nucleic acids of the present disclosure may include nucleic acids that are at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleic acid sequence of SEQ ID NOs: 53-69.
[0141] In examples, a T7 promoter sequence, UTRs can be added to an open reading frame coding sequence by gene synthesis, which can then be subcloned into a plasmid vector to produce large-scale plasmid DNA for in vitro transcription applications. Compositions are provided that include one or more UTRs as described herein. In examples, vectors are provided that include one or more UTRs as described herein. In examples, methods are provided that use one or more UTRs as described herein. In examples, compositions are provided that include mRNA, wherein the mRNA includes one or more UTRs as described herein. In examples, vectors are provided that include mRNA, wherein the mRNA includes one or more UTRs as described herein. In examples, methods are provided that use mRNA, wherein the mRNA includes one or more UTRs as described herein. PolyA tail
[0142] The quality of the poly(A) tail (e.g., length and uniformity of length and distribution) can directly affect mRNA expression efficiency. Traditional methods for adding poly(A) tails to mRNA products in vitro use poly(A) polymerase. See, e.g., Cao, GJ, and Sarkar, N., "Identification of the gene for an Escherichia coli poly(A) polymerase," Proc. Natl. Acad. Sci. USA, (1992) 89(21), 10380-10384, incorporated herein by reference in its entirety. However, such methods typically produce products with a wide distribution of poly(A) tail lengths, with only about 70% of the mRNA being tailed.
[0143] In addition to the length and distribution of capping and polyA tail, mRNA purity and integrity can be important factors affecting mRNA properties, such as, but not limited to, its stability and / or expression efficiency. Purification, promoter sequence, one or more 5' and / or 3' UTR sequences, and / or transcription conditions can aid in the production of high-quality mRNA.
[0144] Methods for adding polyA tails to mRNA products in vitro use polyA polymerase, as described, for example, by Cao et al. (Proc. Natl. Acad. Sci. USA. 89, 10380-10384). However, such methods can produce polyA products with a wide distribution of polyA tail lengths, for example, where only approximately 70% of mRNA is polyadenylated. Because examples of the present disclosure include methods for effectively adding polyA tails to DNA templates by polymerase chain reaction (PCR), these methods offer the advantage of engineering template tail designs in a one-step PCR reaction rather than through the traditional tedious cloning and plasmid purification steps to produce more uniform polyA tail products for efficient mRNA expression. Examples of the present disclosure can also provide polyA tails longer than those produced by some conventional methods.
[0145] In embodiments, the methods and / or compositions may include providing a capped analog, a method for providing and / or improving the length and / or distribution of a polyA tail, providing an effective promoter, providing an effective UTR (e.g., a UTR pair), providing effective transcription conditions, providing an effective transcription system, providing effective purification, or any combination thereof.
[0146] In embodiments, methods and / or compositions can be provided that increase the uniformity of poly-A tail length and / or distribution in transcribed mRNA molecules. In embodiments, the methods and / or compositions can produce an mRNA population, wherein greater than about 70% are tailed, wherein at least about 71% are tailed, wherein at least about 72% are tailed, wherein at least about 73% are tailed, wherein at least about 74% are tailed, wherein at least about 75% are tailed, wherein at least about 76% are tailed, wherein at least about 77% are tailed, wherein at least about 78% are tailed, wherein at least about 79% are tailed, wherein at least about 80% are tailed, wherein at least about 85% are tailed, wherein at least about 90% are tailed, wherein at least about 95% are tailed, and wherein at least about 99% are tailed.
[0147] In embodiments, the methods and / or compositions can produce a population of mRNA wherein the length (number of adenines) of the poly-A tail varies between mRNA molecules by at most about 70 to about 130 adenines, varies between mRNA molecules by at most about 60 to about 120 adenines, varies between mRNA molecules by at most about 50 to about 100 adenines, varies between mRNA molecules by at most about 40 to about 90 adenines, varies between mRNA molecules by at most about 50 to about 80 adenines, varies between mRNA molecules by at most about 40 to about 70 adenines, varies between mRNA molecules by at most about 30 to about 50 adenines, or varies between mRNA molecules by at most about 20 to about 40 adenines. The length of the polyA tail of mRNA can be measured by digesting the mRNA with RNase T1, followed by purifying and recovering the polyA fragment with oligo-dT magnetic beads, and detecting the length of the polyA fragment by capillary gel electrophoresis on a bioanalyzer.
[0148] In some embodiments, a polyA tail is added to a DNA template before transcription. In some embodiments, a method for adding a polyA tail to a DNA template before transcription can be provided. In some embodiments, this is a novel method for adding a polyA tail compared to the traditional method of adding a polyA tail to a DNA template by polymerase chain reaction (PCR) and then inserting the polyA tail into a plasmid vector by gene synthesis. In some embodiments, adding a polyA tail to a DNA template can result in the production of more uniform polyA-tailed mRNA products, products with longer polyA tails, or both, either or both of which can result in more efficient mRNA expression.
[0149] In examples, compositions are provided that include mRNA, the mRNA comprising a polyA tail as described herein added by PCR. In examples, vectors are provided that include a polyA tail as described herein, the polyA tail being added to the vector by PCR. In examples, pVAX1 or pUC57 vectors are provided that include mRNA containing an ampicillin resistance gene, a T7 promoter sequence, 5' UTR and 3' UTR sequences, and a polyA tail (e.g., 100 A) as described herein added by PCR. In examples, methods are provided that use mRNA, the mRNA comprising a polyA tail as described herein added by PCR.
[0150] In embodiments, the disclosed methods and / or compositions can produce a population of mRNA, wherein greater than about 70% is tailed, wherein at least about 71% is tailed, wherein at least about 72% is tailed, wherein at least about 73% is tailed, wherein at least about 74% is tailed, wherein at least about 75% is tailed, wherein at least about 76% is tailed, wherein at least about 77% is tailed, wherein at least about 78% is tailed, wherein at least about 79% is tailed, wherein at least about 80% is tailed, wherein at least about 85% is tailed, wherein at least about 90% is tailed, wherein at least about 95% is tailed, wherein at least about 99% is tailed, and wherein about 100% is tailed.
[0151] In embodiments, the disclosed methods and / or compositions can produce a population of mRNA wherein the length (number of adenines) of the poly-A tail varies between mRNA molecules by at most about 70 to about 130 adenines, varies between mRNA molecules by at most about 60 to about 120 adenines, varies between mRNA molecules by at most about 50 to about 100 adenines, varies between mRNA molecules by at most about 40 to about 90 adenines, varies between mRNA molecules by at most about 50 to about 80 adenines, varies between mRNA molecules by at most about 40 to about 70 adenines, varies between mRNA molecules by at most about 30 to about 50 adenines, or varies between mRNA molecules by at most about 20 to about 40 adenines.
[0152] Bacterial studies have demonstrated that repeat sequences (e.g., CTG·CAG) and the mode and level of plasmid replication and transcription can function in the amplification and deletion of repeat sequences. The deletion frequency of cloned repeat sequences can increase by up to 20-fold after inducing the lacZ promoter, which drives transcription of the inserted sequence in pUC19 (Bowater et al., 1997. Transcription increases the deletion frequency of long CTG·CAG triplet repeats from plasmids in Escherichia coli. Nucleic Acids Res 25: 2861–2868, the contents of which are incorporated herein by reference in their entirety). Common vectors are typically maintained at high copy numbers, and inducing the transcription and translation of antibiotic resistance genes, indicator genes (e.g., blue / white screening genes), and inserts can cause instability for some classes of DNA sequences. As extremely repeat sequences and sequences with extremely low GC ratios, poly(A) sequences may be easily lost during the plasmid cloning and replication process. The presence of such sequences may lead to unexpected transcription and translation, influenced by the inducing activity of upstream and downstream promoters, further increasing the instability of the polyA sequence. To avoid the initiation activity of similar promoters in the vector for the inserted sequence, common strategies include fragmenting the inserted gene (if the inserted gene has obvious cytotoxicity) or directional cloning of the ORF in the "reverse" direction transcribed from the vector's promoter. However, these two strategies may not be applicable to gene cloning containing polyA sequences. While fragmentation can eliminate genotoxicity after expression of the cloned gene, such strategies may not solve the problem of polyA sequence instability because the transcription process is not eliminated and reverse insertion can only eliminate the effects of the promoter in one direction.Therefore, embodiments of the present disclosure may include modifying vectors by inserting transcription terminators upstream and downstream of the polyclonal region, which effectively disrupts the influence of promoters upstream and downstream of the polyclonal region on the inserted gene. This strategy effectively improves the stability of poly(A) sequences during the plasmid cloning and replication process, particularly for highly unstable poly(A)-containing cassettes. Results showed that adding transcription terminators upstream and downstream of the polyclonal region increased the clonal positive rate to 25%-50% (almost zero before adding the terminators), and the number of A bases in the poly(A) tail increased from 70-110 to approximately 120. Furthermore, adding terminators upstream and downstream of the inserted cassette also increased the plasmid yield by 32.5%. Without being limited to a particular theory, this increase may be due to the restoration of replication origin activity by the insertion of a transcription terminator (Stueber et al., 1982. Transcription from efficient promoters can interfere with plasmid replication and diminish expression of plasmid-specified genes. EMBO J 1: 1399-1404, the contents of which are incorporated herein by reference in their entirety). The use of transcription terminators upstream and downstream of the polyclonal site to facilitate the cloning of cytotoxic or repeat sequences (e.g., polyA tails) has not yet been reported in the art.
[0153] A transcription termination sequence may be any nucleotide sequence that, when placed downstream of a nucleotide sequence encoding an open reading frame by transcription, causes transcription termination of the open reading frame. Such sequences are known in the art and may be derived from prokaryotic, eukaryotic, or phage genes. Examples of terminator sequences include, but are not limited to, the PTH terminator, pET-T7 terminator, T3-Tφ terminator, pBR322-P4 terminator, vesicular stomatitis virus terminator, rrnB-T1 terminator, rrnB-T2 terminator, λt0 terminator, rrnC terminator, Ttadc transcription terminator, and yeast-recognized termination sequences (e.g., Matα (α-factor) transcription terminator, native α-factor transcription termination sequence, ADR1 transcription termination sequence, ADH2 transcription termination sequence, and GAPD transcription termination sequence). A non-exhaustive list of transcription terminator sequences can be found in the iGEM Registry at: partsregistry.org / Terminators / Catalog. A series of 2, 3, 4, 5, 6, 7, or more first transcription terminator sequences may be placed directly 3' of the final nucleotide of the gene of interest (or open reading frame) or may be placed directly 3' of the final nucleotide of the gene of interest (or open reading frame) at least 1-5, 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50, 50-100, 100-150, 150-200, 200-300, 300-400, 400-500, 500-1,000, or more nucleotides away. The number of nucleotides between the tandem transcription terminator sequences can vary, for example, the transcription terminator sequences are separated by 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50 or more nucleotides. vector
[0154] In embodiments, a vector is provided, the vector comprising one or more of: (i) a polyA tail as described herein; (ii) one or more UTRs as described herein; (iii) one or more promoters as described herein; or (iv) a combination thereof. In embodiments, the vector may have a variety of uses, including, but not limited to, being used for inserting a target template nucleotide sequence. In embodiments, such a vector having a target template nucleotide sequence can be used (as a non-limiting example) for cloning or transcribing the target template nucleotide sequence. In embodiments, transcription may comprise in vitro transcription. In embodiments, transcription may be performed using T7 RNA polymerase. In embodiments, the vector may be a plasmid or a viral vector, such as, but not limited to, pVAX1 and / or pUC57. mRNA purity
[0155] mRNA integrity can affect cellular expression, so it can be important to initiate translation with mRNA of high integrity. Transcription conditions can affect the quality of the mRNA produced. Some transcription conditions can cause higher cleavage products.
[0156] Because mRNA integrity can be one of the key factors affecting cellular expression, starting with mRNA with high integrity can be very important. mRNA integrity is twofold. Typically, RNA tends to degrade faster than DNA due to its chemical instability, so storage conditions affect RNA quality. Also, transcription conditions can lead to higher cleavage products, so optimal buffer conditions can be empirically determined to achieve higher integrity and higher yields across a wide range of mRNA sizes.
[0157] The conditions for purification can affect the quality of the mRNA produced. For example, the presence of a trinucleotide cap analog in the final mRNA product. m7 GpppA* pG residues can inhibit mRNA translation efficiency in cells by competing with capped mRNA for ribosome recruitment. Purification after in vitro transcription can be a crucial step to ultimately obtain purified mRNA products.
[0158] The present disclosure further provides a solution for obtaining pure mRNA products with minimal contaminant cap analogs, free NTPs, and other proteins that may interfere with and damage the performance of the mRNA product. mRNA purity is the ratio of full-length mRNA species in the crude transcribed mRNA product, which may be quantified by the full-length peak ratio in capillary gel electrophoresis.
[0159] In embodiments, purification as described herein can produce highly pure mRNA products with minimal contaminant analogs, free NTPs, and / or other proteins that may interfere with and / or damage the stability and / or translation efficiency of the mRNA product. In embodiments, the purification method includes binding the nucleic acid to a silica membrane column and washing with about 60% to about 80% ethanol in water, preferably about 70% to about 80% ethanol in water, followed by elution in water.
[0160] Other common purification methods, such as LiCl precipitation or affinity-based magnetic bead purification, can be used for the same purpose. In embodiments, purification methods such as those described herein may be used in combination with compositions and / or methods described herein and / or in combination with conventional compositions and / or methods.
[0161] In embodiments, methods and / or compositions can be provided for increasing the purity of transcribed mRNA. In embodiments, mRNA can be obtained with a purity of about 79% or greater, about 79.5% or greater, about 80% or greater, about 80.5% or greater, about 81% or greater, about 81.5% or greater, about 82% or greater, about 82.5% or greater, about 83% or greater, about 83.5% or greater, about 84% or greater, about 84.5% or greater, about 85% or greater, about 85.5% or greater, about 86% or greater, about 86.5% or greater, about 87% or greater. The present invention also provides methods and / or compositions for producing mRNA of about 87.5% or greater purity, about 88% or greater purity, about 88.5% or greater purity, about 89% or greater purity, about 89.5% or greater purity, about 90% or greater purity, about 91% or greater purity, about 92% or greater purity, about 93% or greater purity, about 94% or greater purity, about 95% or greater purity, about 96% or greater purity, about 97% or greater purity, about 98% or greater purity, about 99% or greater purity, or about 100% pure mRNA. mRNA purity may be measured by capillary gel electrophoresis using a bioanalyzer instrument, and the target peak area ratio (target length ± 15%) can be calculated for the purity measurement.
[0162] In the examples, methods and / or compositions for increasing the purity or integrity of transcribed mRNA can be provided. Obtaining high-quality long mRNA from in vitro transcription is a major challenge due to the tendency of long mRNA to degrade. The present inventors have discovered that temperature and the duration of the in vitro transcription reaction are important factors affecting the quality of the long mRNA produced. As shown in Figure 11A, in vitro transcription performed at 25°C for 2.5 hours produced a 10 kb mRNA product with a purity of approximately 57% as determined by a bioanalyzer, whereas the same IVT reaction performed at 31°C for 2.5 hours produced a 10 kb mRNA with a purity of approximately 2%, due to cleavage of most of the mRNA product (Figure 11B). The yield and purity of mRNA produced by IVT reactions performed at temperatures of 18°C, 21°C, 25°C, and 31°C were investigated, and the mRNA purity and yield results are shown in Figures 11C and 11D, respectively. At temperatures as low as 18° C., long mRNAs can be transcribed by T7 polymerase in the disclosed manner. Transcription mediated by T7 RNA polymerase
[0163] In eukaryotes, transcription of messenger RNA (mRNA) is completed by RNA polymerase II, a complex, multi-subunit enzyme under intricate regulation. To perform large-scale in vitro transcription, researchers typically use monosubunit phage polymerases derived from T7, T3, SP6, K1-5, K1E, K1F, or K11 phages. This polymerase family uses a simple, minimal promoter sequence of approximately 17 nucleotides, which does not require auxiliary proteins and may have minimal restrictions on the initiating nucleotide sequence. While this application focuses on T7 RNA polymerase (T7 RNAP), those skilled in the art will understand that the present disclosure can be practiced with other RNA polymerases.
[0164] T7 RNA polymerase (RNAP) exists in at least two protein states. The first, called the "abortive complex," may be involved in transcription initiation. The second, which assumes a highly persistent conformation, is called the "elongation complex." In vitro transcription can be divided into six steps: 1) binding of RNA polymerase to promoter sequences; 2) initiation of transcription; 3) non-persistent elongation, called abortive transcription, during which the polymerase frequently releases the DNA template and short abortive transcripts; 4) conversion of the open complex to a closed complex; 5) persistent elongation; and 6) transcription termination. The large amount of RNA produced during transcription may include short, abortive fragments that are approximately 2-8 nucleotides in length (Biochemistry 19:3245-3253 (1980), Nucleic Acids Res. 9:31-45 (1981), Nucleic Acids Res. 15:8783-8798 (1987), Biochemistry 27:3966-3974 (1988), each of which is incorporated herein by reference in its entirety). After synthesizing approximately 10-14 bases, the RNA polymerase may exit the abortive cycle, lose specific contacts with the promoter DNA sequence, and form a persistent elongation complex in which the RNA strand can elongate in a sequence-independent manner (J. Mol. Biol. 183:165-177 (1985); Proc. Natl. Acad. Sci. USA 83:3614-3618 (1986); Mol. Cell Biol. 7:3371-3379 (1987); each of which is incorporated herein by reference in its entirety).
[0165] [Table 2]
[0166] The shared sequence of the most active class III T7 promoters can cover a 17-bp sequence upstream and a 6-bp sequence downstream of the transcription start site (Cell 16:815-25 (1979), incorporated herein by reference in its entirety). The position of the first transcribed nucleotide is generally referred to as the +1 transcript nucleotide of the RNA, the second transcribed nucleotide as the +2 transcript nucleotide, and so on (Table 2). During transcription, the two strands can melt to form a transcription bubble, and the bottom strand of the duplex (shown as 3' to 5' in Table 2) is the template for transcription. From transcript nucleotide +3 onwards, the template strand can define the identity of the transcribed nucleotide through Watson-Crick base pairing interactions. Here, the nucleotide encoding the first RNA transcript nucleotide is defined as the +1 nucleotide of the template. In the example shown in Table 2, the +1 transcript nucleotide is G and the +1 template nucleotide is C. Similarly, the +4 transcript nucleotide is an A and the +4 template nucleotide is a T.
[0167] T7 RNAP is known to be capable of initiating with short oligonucleotide primers. For example, 13 promoters in the T7 genome are known to be capable of initiating with pppGpG (J. Mol. Biol. 370:256-268 (2007), incorporated herein by reference in its entirety). It has been shown that T7 RNAP can initiate from dinucleotide primers (Biochemistry 24:5716-5723 (1985), incorporated herein by reference in its entirety). Axelrod et al. demonstrated that an uncapped GpA dinucleotide can initiate from the +1 and +2 template nucleotides, 2'-deoxycytidine and 2'-deoxythymidine, respectively ("CT" template). Reaction conditions are 200 micromolar (μM) dimers and 100 μM ATP, CTP, GTP, and UTP. The reaction conditions further contained 100 μM 3' dATP, 3' dCTP, 3' dUTP, or 50 μM 3' dGTP. Only GpA-initiated RNA was observed; a mixture of GpA-initiated RNA and GTP-initiated 5' triphosphate RNA was not observed. This may be due to the reaction conditions used. 100 μM GTP is much lower than the 2 mM Kd of T7 polymerase for the first initiating guanosine (J. Mol. Biol. (2007) 370, 256-268, incorporated herein by reference in its entirety). Because GTP competes with the initiator oligonucleotide for initiation, using a low GTP concentration favors GpA initiation but may result in low transcription yields (estimated maximum calculated yields of <150 μg / mL reaction). When ApG, CpG, UpG, or GpG was used to initiate transcription on the "CT" template, the formation of RNA transcripts with an additional non-templated 5' nucleotide (A, C, U, or G, respectively) was observed.
[0168] According to Ishikawa et al., the structure m7 GpppApG, m7 Gppp m6 ApG, m7 GpppA 2’Ome pG or m7 Gpppm6 A 2’Ome The pG capped initiator oligonucleotide trimer can initiate transcription with 2'-deoxycytidine residues at template positions +1 and +2 on the template ("CC" template, Nucleic Acids Symposium Series Vol. 53:129 (2009), incorporated herein by reference in its entirety). m7 The results differed when G5'pppG was used. m7 pointed out that this may be due to base pairing between another adenosine (N1) in G5'pppN1pG and the 2'-deoxythymidine at the -1 position in the T7 promoter. This method is distinct from the method described in this disclosure, in which the +1 and +2 nucleotides of the initiating capped oligonucleotide trimer paired with the +1 and +2 nucleotides of the template nucleotide. Ishikawa et al. used 6 mM initiating oligonucleotide trimer, 0.9 mM GTP, and 7.5 mM each of ATP, CTP, and UTP. The authors used a more than six-fold excess of capped initiating oligonucleotide primer (the most expensive nucleotide component in the transcription reaction) over competitive GTP to drive the transcription reaction toward capped RNA rather than pppRNA, which increased the overall cost of synthesizing RNA. In another embodiment, a low concentration of GTP (0.9 mM) limited the total yield of RNA in the transcription reaction (less than the theoretical 1.4 mg / mL). Conversely, the methods described herein can achieve efficient RNA capping and higher RNA yields (approximately 2 to 10 mg / mL) without limiting NTP concentrations, thereby allowing the production of high-quality mRNA at a commercially viable cost. T7 RNA polymerase
[0169] In some embodiments, the at least one modification of the T7 RNA polymerase may be selected from the group consisting of P266L, P270L, P270S, P270A, P270Y, Q744L, Q744P, Q744R, Y639F, H784A, E593G, Y639V, V685A, H784G, S430P, N433T, S633P, F849I, and F880Y. In some embodiments, the at least one modification comprises Y639F and H784A. In some embodiments, the at least one modification comprises E593G, Y639V, V685A, and H784G. In some embodiments, the at least one modification comprises S430P, N433T, S633P, F849I, and F880Y. In some embodiments, the at least one modification comprises S430P, N433T, S633P, F849I, F880Y, and P266L. In some embodiments, the at least one modification comprises S430P, N433T, S633P, F849I, F880Y, Y639F, and H784A. In some embodiments, the at least one modification comprises S430P, N433T, S633P, F849I, F880Y, P266L, Y639F, and H784A. In some embodiments, the at least one modification comprises S430P, N433T, S633P, F849I, F880Y, E593G, Y639V, V685A, and H784G. In some embodiments, the at least one modification comprises S430P, N433T, S633P, F849I, F880Y, P266L, E593G, Y639V, V685A, and H784G.
[0170] In some embodiments, at least one modification of the T7 RNA polymerase promotes initiation-elongation transition. In some embodiments, at least one modification increases the rate of promoter removal. In some embodiments, at least one modification increases the stability and / or activity of the polymerase. In some embodiments, at least one modification increases the thermostability of the polymerase. In some embodiments, at least one modification produces 2'-ome incorporation. Magnesium ions in in vitro transcription
[0171] Magnesium ions (Mg 2+ ) is an essential component in RNA in vitro transcription buffer systems and is used to initiate transcription using cap analogs rather than GTP. Common buffer systems for RNA in vitro transcription (e.g., HEPES buffer, Tris-HCl buffer) may have high concentrations of free magnesium ions, which ensures high activity of RNA polymerase. 2+ In vitro transcription processes may require Mg ions. 2+ and NTPs complex during the reaction, and excess free Mg 2+ The absence of ions in the buffer system is important to ensure high capping efficiency and high integrity of the transcribed mRNA. Therefore, a high concentration of Mg 2+ This can be problematic, especially for high-yield / industrial-scale RNA production. 2+ Some ion-related problems can include magnesium-driven precipitation, which is caused by free Mg 2+ This can cause a decrease in Mg concentration, which consumes magnesium ions from the RNA polymerase reaction center. As a result, the efficiency of RNA in vitro transcription is low. To evaluate the effect of Mg concentration on mRNA IVT yield and integrity, IVT was performed in the presence of increasing Mg concentrations. By maintaining the final Mg concentrations in the IVT reaction at 16.5 mM, 21 mM, 29 mM, and 37 mM, respectively, the free Mg in the IVT reaction system after complexing with NTPs and cap analogs was significantly reduced. 2+ The concentrations of Mg were set to -12 mM, -8 mM, 0 mM, and +8 mM, respectively. 2+ When the concentration was increased, the mRNA yield decreased (Fig. 12A), and 2+ As the concentration increases, the integrity of the mRNA also decreases (Figure 12B). example Example 1 Construction of DNA templates Encoding a poly(A) tail in a DNA template
[0172] Appropriately tailed PCR primers were used to encode a poly(A) tail in the DNA template. Forward primers and reverse primers containing poly(T) sequence oligonucleotides were synthesized by methods known in the art. The primers used here were synthesized by solid-phase oligonucleotide synthesis (e.g., but not limited to, solid-phase chemistry) and assembled in a PCR reaction using a reverse primer containing a poly(T) sequence.
[0173] Forward primer: GCTTAGGAAATTAATACGACTCACTATAAGG (SEQ ID NO: 17)
[0174] Reverse primer:tttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt ttttttttttttttttttttttttttttttttttttttttttttttttttgccgcccactcagactttattc(SEQ ID NO: 18)
[0175] The reaction mixture is described in Table 3 below.
[0176] [Table 3]
[0177] A DNA template containing a T7 promoter (SEQ ID NO: 10), 5' UTR (SEQ ID NO: 9), Kozak sequence (GCCACC), eGFP coding sequence, and 5' UTR (SEQ ID NO: 2) was subcloned into the pVAX vector. (i) A poly(A) tail was added to the DNA of the DNA template encoding enhanced green fluorescent protein (eGFP) using a reverse primer (SEQ ID NO: 18) with different lengths of T. The lengths of the resulting DNA templates with 100 A, 80 A, 60 A, and 40 A were confirmed by DNA bioanalyzer (Agilent DNA 7500 kit) testing (Figure 1).
[0178] [Table 4]
[0179] Reactions #1 to #3 (Table 4) performed using a conventional PCR method failed to add a polyA tail and produced DNA products 969 bp in length. In contrast, Figure 1A shows that the disclosed method produced DNA with an average length of 1086 bp, approximately 90% purity, and a 100A tail. Figure 1B shows that over 90% of the PCR products from the eGFP template had a 100A tail and an average length of 1086 bp. Cloning of 5' UTR and 3' UTR into DNA templates
[0180] During gene synthesis, different UTRs were cloned into a vector containing the eGFP target DNA template. A gene fragment containing a T7 promoter (SEQ ID NO: 10), a 5' UTR (SEQ ID NO: 9), a Kozak sequence (GCCACC), an eGFP coding sequence, and a 3' UTR (SEQ ID NO: 2) was prepared by gene synthesis and subcloned into the vector pVAX to generate a plasmid for mRNA preparation. The 5' UTR and 3' UTR pairs are shown in Table 5.
[0181] [Table 5-1] [Table 5-2] [Table 5-3]
[0182] The plasmid was linearized with restriction enzymes and purified to prepare the linearized plasmid for in vitro transcription. mRNA was prepared using the previously described co-transcription method with cap [I] and purified on a silica membrane column. mRNA quality was tested using an Agilent RNA Nano 6000 kit on a bioanalyzer (Figure 2A).
[0183] The expression efficiency of eGFP mRNA with different UTRs in A549 cells was tested. 1 μg of mRNA was transfected into each well of A549 cells in a 96-well plate using lipofectamine 2000. Triplicate samples were tested, and the eGFP expression level was measured relative to its fluorescence intensity using a plate reader. TM Normalization was performed based on cell number measured by XTT cell viability assay. Figure 2B shows the expression levels of mRNAs with different UTR combinations. The UTR combinations in mRNAs #4 (SEQ ID NOs: 3 and 2), #5 (SEQ ID NOs: 5 and 8), #6 (SEQ ID NOs: 1 and 6), and #8 (SEQ ID NOs: 9 and 2) produced higher EGFP expression levels than the others (e.g., #1 (SEQ ID NOs: 1 and 2), #2 (SEQ ID NOs: 1 and 4), #3 (SEQ ID NOs: 1 and 8), and #7 (SEQ ID NOs: 7 and 4)). Example 2 Construction of DNA templates Encoding a poly(A) tail in a DNA template
[0184] By using appropriately chemically modified tailed PCR primers coupled with T7 exonuclease digestion, highly purified poly(A) tails can be encoded in DNA templates. A phosphorothioate-modified forward primer and a reverse primer containing a poly(T) sequence oligonucleotide were synthesized using solid-phase chemistry with modified amidites. PCR reactions were assembled with the modified primers to generate DNA templates for in vitro transcription. The PCR products were further digested with T7 exonuclease (NEB) to remove any cleaved DNA products, thereby generating highly purified templates for downstream mRNA preparation.
[0185] Forward primer: C*A*C*TGCTTACTGGCTTATCGAAATTAATACGACTCACTATA*G*G*A (SEQ ID NO: 19)
[0186] Reverse primer: T*mU*T*[T] 96 TGCCGCCCACTCAGACTTTATTCAAAGA*C*C*A(SEQ ID NO: 20) Note: * denotes a phosphorothioate backbone modification and mU denotes 2'-O-methyl-uridine.
[0187] The reaction mixture is described in Table 6 below.
[0188] [Table 6]
[0189] Reaction #4 (Table 6), which used the touch-up PCR method, produced a DNA template with a uniform poly(A) tail for downstream applications. Using KAPA HiFi DNA polymerase (Roche), touch-up PCR was performed at an annealing temperature of 62°C for five cycles, followed by 20 cycles at an annealing temperature of 68°C. Following standard procedures, the resulting PCR product was purified with DNA selection magnetic beads (Yeasen) and further digested with T7 exonuclease in NEB buffer 4 at 25°C for 30 minutes to remove all impurities. Example 3 Effect of promoter on capping efficiency
[0190] To test the effect of promoters on capping efficiency, we performed mutagenesis using the pVAX vector to prepare plasmids containing different promoters listed in Table 1, the 5' UTR (SEQ ID NO: 9), the eGFP ORF, the 3' UTR (SEQ ID NO: 2), and 100 A's. These plasmids were purified by maxi-prep and linearized with a restriction enzyme after the poly(A) sequence to generate templates for mRNA preparation.
[0191] mRNA was prepared using the in vitro transcription method described herein, using a linearized plasmid as a template, T7 polymerase, cap [I]AG, and N1-methyl-pseudo-UTP. The prepared mRNA was purified using a silica membrane column. The capping efficiency of each mRNA was then tested. To test the capping efficiency, a 24-mer probe was synthesized from Integrate DNA Technologies (IDT). The 24-mer probe contained four DNA nucleotides at the 5' end, a 20-nt RNA sequence reverse-complementary to the 5' end of the mRNA, and a biotin modification at the 3' end. The probe was then hybridized to the prepared mRNA, which was then digested with RNase H to cleave the DNA / RNA hybridization site, releasing the 5'-end mRNA 24-mer. The 24-mer was then purified using streptavidin magnetic beads and analyzed by LC-MS. UPLC conditions were 5% B, 0–0.5 min hold, 5 min 6%–20% B, Clarity Oligo-xt 2.1 x 50 mm, 2.6 μm column, 60°C, B = 65 / 35 ACN / water, A = 1% HFIP buffer, 0.4 mL / min. Mass spectrometry was performed using an Orbitrap Velos Pro mass spectrometer.
[0192] Figure 10A shows an exemplary schematic diagram of initiating in vitro transcription at the -1 position of a promoter using a cap[I] 3-mer nucleotide (e.g., 7mGpppmAG) to prepare capped mRNA (e.g., G at the +1 position of a promoter). For clarity, the TATA sequence upstream of the +1 position is boxed. Therefore, 7mGpppmAG binds to the -1 and +1 positions to initiate in vitro transcription. Figure 10B shows an exemplary schematic diagram of initiating in vitro transcription at the +1 position using a cap[I] 3-mer nucleotide (e.g., 7mGpppmAG) to prepare capped mRNA (e.g., A at the +1 position and G at the +2 position). Therefore, 7mGpppmAG binds to the +1 and +2 positions to initiate in vitro transcription. Figure 10C shows LC-MS data for testing the capping efficiency of exemplary mRNAs produced using cap analogs and the disclosed in vitro transcription method. FIG. 10D shows that mRNA prepared using the disclosed in vitro transcription method with template 6.5GGG (SEQ ID NO: 10), which initiates IVT from the -1 position, template 6.5AGG (SEQ ID NO: 12), which initiates IVT from the +1 position, or template 2.5AGG (SEQ ID NO: 15), which initiates IVT from the +1 position, produced capped eGFP mRNA with similar expression efficiency in A549 cells.
[0193] The capping efficiency was calculated by the ratio of the target capped molecular weight fragments to the total fragments in the LC-MS analysis. The capping efficiency test results for promoters with Cap[I]-AG are listed in Table 7 below.
[0194] [Table 7]
[0195] Table 7 showed that the ORF driven by the promoter (SEQ ID NO: 10) produced eGFP mRNA with a higher capping efficiency of cap [I] than the ORFs driven by other promoters.
[0196] While higher organisms generally have more extensively methylated cap structures, yeast mRNAs primarily contain the Cap 0 structure. 2'-o-methylation on the second base after the triphosphate bond was designated the Cap 2 structure. Approximately half of human poly(A)-tailed mRNA molecules were found to have the Cap 2 structure. Methylation of Cap 1 and Cap 2 in U2 snRNA was essential for its splice body formation and associated splicing activity (Werner Maria, Purta Elzbieta, et al., Nucleic Acid Research, 2011, Vol. 30, No. 11, pp. 4756-4768, the contents of which are incorporated herein by reference in their entirety). New cap analogs were evaluated as capping analogs for preparing capped mRNA in a one-step in vitro transcription reaction. Cap [II] was added to an IVT reaction system using the modified T7 polymerase P266L described above according to the method disclosed herein. The resulting mRNA was purified on a silica membrane column and the capping efficiency was tested using RNase H digestion coupled with an LC-MS method. Example 4 Determining the length of the poly(A) tail
[0197] The length of the polyA tail could be determined by the following method: digesting the mRNA sample with RNase T1 (which can cleave RNA after G bases) and purifying the digested fragments, recovering the polyA tail fragments with oligo-dT magnetic beads, denaturing with hot water or a denaturing agent, and then eluting the purified polyA tail fragments, followed by analyzing the length of the polyA tail by bioanalyzer or other capillary electrophoresis or LC-MS.
[0198] Length analysis of poly(A) fragments was performed using RNase T1 digestion coupled with a bioanalyzer to detect the length of the mRNA tail. Briefly, mRNA was digested with RNase T1 (which cleaves mRNA after each rG base), and the poly(A) fragments were purified using oligo-dT magnetic beads. The purified poly(A) fragments were analyzed on a bioanalyzer using a miniRNA kit.
[0199] The length of the polyA tail is an important quality attribute of mRNA, and the results in Figure 4 indicate that mRNAs with longer polyA tails have better mRNA translation / expression efficiency in cells. Generally, mRNAs longer than 80 A are expected to have better protein translation. Figure 3 shows the results of polyA tail length analysis of mRNA samples performed by a bioanalyzer. Peak 3: PolyA tails of mRNA obtained from Company A. This shows a broad length distribution ranging from 20 to 100 nt, consistent with the typical distribution of polyA tails produced by polyA polymerase, with an average polyA tail length of 63 nt. Peak 4: PolyA tails of mRNA produced using the PCR-based method disclosed herein. This shows a sharp distribution with a uniform distribution around the size of 120 ± 20 nt. Peak 5: PolyA tails of mRNA produced using Company T's method. This shows an average tail length of 140 nt, but with a broader distribution. The results showed that the poly(A) tails produced by the PCR-based method described in Example 1 generated high-quality DNA templates with uniform poly(A) length distribution, which further promoted the formation of high-quality mRNA with uniformly distributed poly(A) tails. The mRNA translation or expression efficiency, as shown in Figures 5A and 5B, indicated that the internal (IH) eGFP mRNA had stronger expression than the eGFP mRNA from Company T (T), while the eGFP from Company A (A) had the lowest expression. Peak 1 was a noise peak. Peak 2 (Figure 3) indicated a low-labeled product in the miniRNA bioanalyzer kit. This product was a 4-nt-long internal size control added to each sample run and used for analytical alignment. Effect of poly(A) tail length on gene expression
[0200] eGFP mRNA with poly(A) tails of different lengths was prepared using the co-transcriptional capping method described above with cap [I], replacing UTP with 100% N1-methyl-pseudo-UTP. The resulting mRNA was purified using a silica membrane purification method and used in cell expression assays. The day before the experiment, A549 cells were plated in 96-well plates and transfected with 0.5 μg of mRNA per well using Lipofectamine 2000. Untreated cells alone served as a background control, and triplicate groups containing EGFP-mRNA-100A, EGFP-mRNA-80A, EGFP-mRNA-60A, EGFP-mRNA-40A, or eGFP mRNA prepared in-house using the methods disclosed herein were tested. The next day, eGFP protein expression levels were measured using a plate reader and analyzed by CyQUANT. TM The numbers were normalized by the number of viable cells that passed the XTT cell viability test.
[0201] Figure 4 shows that the expression level of eGFP in A549 cells increased with increasing length of the mRNA poly(A) tail. mRNAs with at least 60 A's were more likely to be expressed and translated. Example 5 In vitro transcription
[0202] Both linearized DNA plasmids and PCR products could be used as DNA templates to prepare mRNA by in vitro transcription. To test in vitro transcription conditions, a plasmid vector containing a T7 promoter (SEQ ID NO: 11), 5'-UTR (SEQ ID NO: 9), eGFP coding sequence, 3'-UTR (SEQ ID NO: 2), and poly(A) tail (100A) was linearized with BspQ1 or Bbs1 restriction enzyme and purified by ethanol precipitation. The linearized plasmid was transcribed to prepare capped mRNA using T7 RNA polymerase (M3Q), a cap analog (Cap[I]), 10x transcription buffer, NTPs, and RNase inhibitors.
[0203] [Table 8]
[0204] The cap analog may be any cap analog described herein. The HEPES buffer was 400 mM HEPES in water, pH 7.5, and the Tris buffer was 400 mM Tris-HCl buffer, pH 7.5. The RNA polymerase may be wild-type T7 RNA polymerase or a mutant T7 RNA polymerase with enhanced stability and / or the ability to incorporate cap [II] analogs. In vitro transcription can be performed in 0.2 mL to 15 mL DNA-free, RNA-free enzyme plastic tubes, with or without shaking, at the restricted temperature.
[0205] The in vitro transcription mixture and conditions are described in Table 8. More specifically, a 10x buffer solution containing HEPES or Tris buffer was prepared by adding magnesium acetate, spermidine, and DTT and stored at -20°C for use. For the in vitro transcription reaction, buffer, DNA enzyme-free and RNase-free water, NTPs, and a cap analog were added to a reaction tube, followed by the DNA template, T7 polymerase, RNase inhibitor, and inorganic pyrophosphatase. The reaction was maintained at a designated temperature ranging from 20°C to 40°C, and transcription was carried out for 1 to 6 hours. The DNA template was then removed by digestion with DNA enzyme 1 and RNase-free enzyme.
[0206] The eGFP mRNA prepared in this manner using the promoter (SEQ ID NO: 15) was used in an expression efficiency assay in A549 cells. Two batches of capped [I], modified 100% N1-methyl-pseudo-UTP, 100A-tailed eGFP mRNA were prepared and designated internal (IH)1 and IH2. Cells alone (indicating that the cells were not treated with mRNA) were used as background controls. For comparison, eGFP mRNA was also obtained from Company T (T) and Company A (A). Company T used co-transcriptional capping with the promoter of SEQ ID NO: 12, and Company A used conventional enzymatic in vitro transcription to prepare uncapped mRNA, then added a cap analog using vaccinia virus capping enzyme and 2'-O-methyltransferase, and added a polyA tail using polyA polymerase. Triplicate eGFP mRNA samples were transfected into A549 cells in a 96-well black transparent plate. 1 μg of mRNA was transfected into the cells with 0.5 μL of lipofectamine 2000 and OptiMEM. The cells and mRNA were incubated overnight, and expression efficiency was measured by the relative fluorescence intensity of eGFP mRNA-treated cells using a plate reader, and normalized based on the relative cell number tested, for example, by Cyquant XTT cell viability assay. Figure 5 shows that the expression of eGFP mRNA prepared by the methods of the present disclosure, i.e., IH1 and IH2, was higher than that of eGFP mRNA prepared by the methods of Company T (T) and Company A (A), where Company T used co-transcriptional capping with the promoter of SEQ ID NO: 12, and Company A used conventional enzymatic in vitro transcription to prepare uncapped mRNA and added a cap analog using vaccinia virus capping enzyme and 2'-O-methyltransferase, and a polyA tail using polyA polymerase.eGFP mRNA samples were prepared in triplicate and transfected into A549 cells in a 96-well black transparent plate. 1 μg of mRNA was transfected into the cells using 0.5 μL of lipofectamine 2000 and OptiMEM. The cells and mRNA were incubated overnight, and expression efficiency was measured using a plate reader based on the relative fluorescence intensity of eGFP mRNA-treated cells, and normalized based on the relative cell number tested, for example, by the Cyquant XTT cell viability assay. Figure 5 shows that the expression of eGFP mRNA prepared using the disclosed method, i.e., IH1 and IH2, was higher than that of eGFP mRNA prepared using the methods of Company T (T) and Company A (A). Figure 9 shows that eGFP mRNA prepared by in vitro transcription reactions at 31°C had higher expression efficiency than eGFP mRNA prepared in reactions at 37°C.
[0207] To determine luciferase mRNA expression using the disclosed method, a plasmid vector (F-Luc) containing a T7 promoter (SEQ ID NO: 15), a 5'-UTR (SEQ ID NO: 10), a luciferase coding sequence, a 3'-UTR (SEQ ID NO: 2), and a polyA tail (100A) was used for in vitro transcription, followed by transfection into A549 cells via lipofectamine (Lipo). Figure 6 shows that luciferase mRNA was readily expressed and translated compared to controls (e.g., cells alone, Lipo alone, and eGFP-transfected cells as a negative control).
[0208] To determine espCas9 mRNA expression using the disclosed method, a plasmid vector containing a T7 promoter (SEQ ID NO: 12), a 5'-UTR (SEQ ID NO: 9), espCas9 (espCas9-1) and espCas9-EGFP (espCas9-2) coding sequences, a 3'-UTR (SEQ ID NO: 2), and a polyA tail (100A) was used for in vitro transcription, followed by transfection into A549 cells. Figure 7 shows that the expression levels of espCas9-1 and espCas9-2 mRNA were higher than those of mRNA prepared by the method of Company T (T) and the cell control alone.
[0209] The integrity of the mRNA prepared by the disclosed method was analyzed using a bioanalyzer to assess its size-based purity. The Agilent RNA Nano 6000 kit was used. The x-axis indicated the length of the mRNA, and the y-axis indicated the fluorescence intensity of the mRNA tested in capillary electrophoresis. The purity of the analyzed mRNA was analyzed by smear analysis, and the proportion of mRNA populations within the target length ±10% was calculated. The results showed that the purity of the mRNA prepared by the disclosed method was approximately 85% (Figure 8A, inner panel), which was higher than the 68% (Figure 8B) and 79% (Figure 8C) purity of the mRNA prepared by Company T's method. The temperature of the IVT reaction was one of the important factors affecting mRNA purity. For the 1 kb mRNA eGFP, reactions at 31°C produced 90% purer mRNA (Figure 9B) compared to 80% pure mRNA (Figure 9C) produced in reactions at 37°C. For the 10 kb mRNA, reactions at 25°C produced purer mRNA (Figure 11A) compared to 31°C (Figure 11B). Temperature effects on mRNA integrity
[0210] Temperature may be an important factor for maintaining high integrity of mRNA produced from in vitro transcription. For example, the integrity of 10 kb mRNA prepared at 31°C or 25°C was tested using a bioanalyzer. The integrity was analyzed using the software's smear analysis function to obtain the main peak ratio. Figure 11C shows that IVT conditions lasting 3 hours at 25°C produced 10 kb-long mRNA with 57% integrity, while in vitro transcription at 31°C for 3 hours produced mRNA with 6% integrity. For example, the main peak was analyzed by smear analysis using a bioanalyzer. Figure 11D shows that the mRNA yield at 31°C for 3 hours was higher than that at 25°C for 3 hours, but the mRNA yield at 25°C for 4 hours was higher than that at 31°C for 4 hours. These results indicated that mRNA prepared at 25°C may have better integrity than mRNA prepared at 31°C. Effect of reaction time on mRNA integrity
[0211] The in vitro transcription reaction time may be another important factor affecting mRNA integrity. Table 9 shows that for a 10 kb mRNA, when the IVT reaction was performed at 25°C, the integrity of the transcribed mRNA decreased from 57% after 3 hours to 52% after 4 hours. When the IVT reaction was performed at 31°C, the mRNA integrity decreased from 90% after 1 hour to 6% after 1 hour.
[0212] [Table 9] Example 6 mRNA purification
[0213] The mRNA obtained from Example 5 was further purified using a silica membrane column or magnetic beads. Briefly, mRNA from in vitro transcription was mixed with buffer and ethanol and loaded onto a silica membrane column. Subsequently, the mRNA was washed with 70% ethanol and eluted with water or another storage buffer. The residual trimer cap was detected for the product from each purification method using HPLC. Protein residues were examined using the Nano Orange protein residue assay. Example 7 Reduced poly(A) tail length changes caused by transcription terminators
[0214] The same GFP gene with different poly(A) segments (70 nt, 100 nt, and 120 nt) was ligated into pUC57 (terminator-less) or pUC57-terminator vectors, in which the rrnB-T1 and rrnB-T2 terminators were located upstream of the T7 promoter and the λt0 terminator was located downstream of the poly(A) segment, and digested with NheI-XhoI. The resulting plasmids were transformed into E. coli using standard methods and grown at 30°C. Ten clones were randomly picked from the LB plate and Sanger sequenced to verify the length of the poly(A) segment. The lengths of the poly(A) tails of these clones are shown in Table 10 and summarized in Figure 13.
[0215] [Table 10]
[0216] Figure 13 shows that the variation in polyA tail length produced by in vitro transcription using the pUC57-terminator vector was smaller than that produced by in vitro transcription using the pUC57 (no terminator) vector with different polyA segments (70 nt, 100 nt, and 120 nt). Example 8 IVT was initiated at the -1 position to increase the 5' end uniformity of the RNA product
[0217] To study the effect of initiating IVT at the -1 or +1 position of the DNA template on the 5'-end uniformity of the RNA products, IVT reactions were performed in the presence of cap [I] using the DNA template TAATACGACTCACTATAGGG (SEQ ID NO: 10) (IVT initiated at the -1 position from the DNA template) or TAATACGACTCACTATAAGG (SEQ ID NO: 12) (IVT initiated at the +1 position from the DNA template). The RNA products were then reverse transcribed into cDNA using Illumina's NEBNext Single-Cell / Low-Input RNA Library Preparation Kit. DNA libraries were prepared using NEB 7805 (FS DNA Library Preparation Kit with UMI), and alignment maps were generated using Geneuous Prime software.
[0218] Sequence alignments showed that IVTs initiated at the -1 position using the TAATACGACTCACTATAGGG (SEQ ID NO: 10) (TATA-GGG) template had a lower error rate (e.g., 0.09%) at the 5'-terminal guanine (G) position (indicated by the arrow) (Figure 14) than IVTs initiated at the +1 position using the TAATACGACTCACTATAAGG (SEQ ID NO: 12) (TATA-AGG) template (e.g., 0.19%) (Figure 15). In other words, 5'-end sequence alignments from next-generation sequencing (NGS) showed that IVTs initiated at the -1 position had more uniform 5'-ends of their RNA products than IVTs initiated at the +1 position. Example 9 RNA yield, purity and capping efficiency under different IVT conditions
[0219] [Table 11]
[0220] To identify IVT conditions that improve RNA yield, purity, and capping efficiency, IVT reactions were performed under conditions #1, #2, and #3 (Table 11). Condition #1 is also shown in Table 8 (Example 5).
[0221] [Table 12]
[0222] Table 12 shows that the RNA yield, purity, and capping efficiency produced under condition #1 were better than those produced under conditions #2 and #3. Thus, under condition #1, the RNA in vitro transcription yield and final product purity were significantly improved. High purity may be important for improving mRNA expression efficiency, as shown, for example, in Figures 5A, 5B, and 6. The size-based purity of the final mRNA was measured by capillary electrophoresis using a bioanalyzer. The capping efficiency assay was performed by digestion with RNase H followed by LC-MS analysis. Example 10 Assembling 5' UTR sequences for efficient mRNA expression
[0223] In eukaryotic cells, protein expression levels can be highly dependent on mRNA levels, which can be further controlled by transcription and translation mechanisms. Indeed, the translation efficiency of transcripts can be particularly important for the efficiency and efficacy of mRNA therapeutics. In this context, the mRNA payload in gene therapy / vaccine can be optimized to enhance protein expression. mRNA generally contains the following elements: a promoter (which may include an enhancer), a 5' untranslated region (5' UTR), a protein-coding region, a 3' UTR, and a polyadenylation (polyA) signal. Among these elements, the 5' UTR may be an attractive target for optimization. It has been shown that the 5' UTR is important for ribosome recruitment and can exert a significant role in regulating translation efficiency. Multiple regulatory elements within the 5' UTR sequence can regulate gene expression. A 5' UTR sequence with a less complex mRNA structure and a lower predicted minimum free energy may be associated with a higher expression level.
[0224] Rational design of 5' UTRs remains challenging due to the difficulty in predicting RNA secondary structure and the lack of experimental data, so the effects of engineered 5' UTR sequences can vary significantly from predictions.
[0225] Examples of the present disclosure may include a collection of native and mutant 5' UTR sequences that exhibit enhanced protein translation efficiency relative to a reference sequence (e.g., 5' UTR-001 (SEQ ID NO: 70)) and can be used to produce high mRNA expression. Therefore, native or mutant 5' UTRs of the present disclosure that produce mRNA expression comparable to or superior to that of a reference sequence (e.g., 5' UTR-001) may be considered good candidates. While artificial design of 5' UTR sequences may produce promising candidates, modified 5' UTRs based on native sequences found in human genes may result in elements that are better recognized by the translational machinery in human cells.
[0226] For example, genes that are highly expressed in tissues and cells (e.g., hematopoietic cells and neuronal cells) may be selected. 5' UTR sequences from the major transcript variants are then assembled into DNA templates for mRNA production, and expression in cells is used to compare with a reference 5' UTR sequence. Those native 5' UTR sequences (full length or truncation) that result in improved protein expression are then selected for further modification (e.g., point mutation and / or deletion) and the subsequent effect on mRNA expression is tested. method 1. Sequence Selection and Standardization 1-1. Initial screening of natural sequences
[0227] For subset A of test sequences, a literature search identified genes known to be highly expressed in different tissues / cells, such as CD14 (primarily expressed by macrophages), CD19 (widely expressed in B cells), CD80 (primarily expressed in immune cells), MB (primarily expressed in skeletal and cardiac muscles), GMCSF (a cellular factor secreted by immune cells and other cells), NeuN / RBFOX3 (a neuron-specific protein), and enolase 2 (expressed at very high levels in neurons and nervous tissues). Genomic and transcript sequence information for these genes was retrieved from NCBI. For each gene in this subset, the following criteria were set: (1) only the most common variant / isoform sequences were considered; (2) 5' UTR sequences <106 bp in length, including the entire sequence, were used for subsequent testing; and (3) for those sequences >106 bp in length, only the first 106 bp sequence was further tested.
[0228] For subset B of test sequences, a survey of published RNA-sequencing results identified genes highly expressed in neurons and astrocytes. Based on this survey, 5' UTR sequences from the first 50 genes were selected. For each gene in the group, each unique transcript was considered and similar criteria were used to assemble the final list of 5' UTR sequences for the study. 1-2. Mutant sequences
[0229] The sequences of promising 5' UTR candidates obtained from the initial screen (Table 13) were used to generate mutant 5' UTR sequences for subsequent testing. In all cases, the commercially available 5' UTR-001 (AAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGA) (SEQ ID NO: 70) may be used as a reference sequence. For all experiments described below, the same KODAK (e.g., GCCACC) and 3' UTR (HBA1) (TAAGCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTT GGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGCA) (SEQ ID NO: 71) sequences were used to assemble the DNA template. 2. IVT Mold Assembly
[0230] For subset A, to generate the DNA template for IVT, PCR amplification was performed using the following: a plasmid encoding eGFP as a template, which further contains the 3' UTR sequence (HBA1) (SEQ ID NO: 71), a forward primer containing the T7 promoter (6.5), and a reverse primer containing a single 5' UTR sequence and a strong KOZAK sequence, and polyA.
[0231] For subset B, we first obtained a gene fragment encoding the following elements: a T7 promoter (6.5), a single 5' UTR sequence, a strong KOZAK sequence, eGFP cDNA, and a 3' UTR sequence (HBA1) (SEQ ID NO: 71). To generate the final DNA template for IVT, PCR amplification was performed using a forward primer with the T7 promoter sequence (6.5) and a reverse primer containing poly(A). 3. IVT and mRNA Expression
[0232] For IVT, the PCR product was used as a template. mRNA was produced, purified, and transfected into cells. eGFP expression was assessed using a plate reader or flow cytometer. result
[0233] [Table 13-1] [Table 13-2] [Table 13-3]
[0234] [Table 14-1] [Table 14-2] [Table 14-3]
[0235] Approximately 250 natural 5' UTR sequences were screened. Table 13 lists the natural sequences that showed comparable or higher eGFP expression than the reference sequence (5' UTR-001) (SEQ ID NO: 70) in different cell lines. Table 14 lists mutant 5' UTR sequences (SEQ ID NOs: 23-52) derived from promising natural sequences that showed comparable or higher eGFP expression than the reference sequence (5' UTR-001) (SEQ ID NO: 70) in different cell lines.
[0236] mRNA encoding eGFP and containing the native 5' UTR sequence (from a gene highly expressed in tissues / cells, such as immune cells, brain, muscle, and adipose tissue) was purified on a silica column and transfected at 200 ng / well into A549 cells (Figures 16A and 16B) or Jurkat cells (Figure 16C) seeded in a 96-well plate. After 24 hours, eGFP fluorescence was measured using a plate reader (Figures 16A and 16B) or a flow cytometer (Figure 16C). The fold change in eGFP expression or mean fluorescence intensity was shown compared to cells expressing eGFP with the commercially available 5' UTR-001 reference sequence (SEQ ID NO: 70). These results demonstrated that the 5' UTR of the present disclosure is superior to the 5' UTR-001 reference sequence.
[0237] Figure 17A shows an example, in which purified mRNA encoding eGFP and containing mutant 5' UTR sequences (Table 14) was transfected at 100 ng / well into A549 cells seeded in a 96-well plate. After 24 hours, eGFP fluorescence was measured using a plate reader. The fold change in eGFP expression compared to cells expressing eGFP with the 5' UTR-001 reference sequence is plotted, as indicated. In Figure 17B, HeLa cells transfected with eGFP-encoding mRNA (100 ng / well, which contains several mutant 5' UTR sequences, e.g., LIRF m3 (SEQ ID NO: 41), ENO2 m2 (SEQ ID NO: 32), and GMCSF m5 (SEQ ID NO: 39)) showed higher expression than HeLa cells transfected with mRNA with the reference sequence 5' UTR-001 (SEQ ID NO: 70).
[0238] Advantages of the present disclosure may include: (1) in vitro transcription reaction mixtures and conditions that can increase mRNA yield, integrity, and purity; (2) cap analogs that bind to the -1 and / or +1 nucleotide of DNA templates and promoters for in vitro transcription, thereby producing mRNAs that are more full in length, allowing for more flexibility in selecting the first mRNA base, and providing the +2 position open for custom sequences; and (3) 5' UTRs derived from natural and novel mutant 5' UTR sequences that exhibit high mRNA expression in specific tissues / cells may provide tissue-specific advantages over artificial sequences.
[0239] All references cited herein are incorporated by reference as if each reference were specifically and individually indicated to be incorporated by reference herein. Any reference is referenced as though disclosed prior to the filing date and should not be construed as an admission that such reference is not entitled to antedate the present disclosure by virtue of prior invention.
[0240] It should be understood that each one, two, or more of the above elements may find useful application in other types of methods different from those described above. Without further analysis, the above content sufficiently reveals the gist of the present disclosure so that others, by applying their current knowledge, can readily employ them in various applications without omitting features that, in the light of the prior art, fairly constitute essential features of the general or specific aspects of the present disclosure as set forth in the appended claims. The above embodiments are presented by way of example only, and the scope of the present disclosure is limited by the following claims.
Claims
1. 1. A method for in vitro transcription of a DNA template into RNA, comprising: (1) A DNA template, the DNA template comprising a promoter operably linked to a nucleic acid, the nucleic acid comprising a 5' untranslated region (5' UTR), an open reading frame (ORF) encoding the RNA, a 3' UTR, and a polyA region; and (2) a cap analog, wherein the cap analog is 【Chemical 1】 It includes the structure Here, R 1 and R 2 are CH 3 or H and B 1 and B 2 are each A, U, G, or C; wherein the promoter is TAATACGACTCACTATAX 1 X 2 X 3 (SEQ ID NO: 16), where A at position 17 is a −1 nucleotide and X at position 18 is a −1 nucleotide. 1 is the +1 nucleotide, X 1 is G and X 2 and X 3 are A, T, G, or C, respectively, then B 1 is A and B 2 is G, X 1 is C and X 2 and X 3 are A, T, G, or C, respectively, then B 1 is A and B 2 is C, and X 1 is T and X 2 and X 3 are A, T, G, or C, respectively, then B 1 is A and B 2 is U, wherein said cap analog is attached to the −1 and +1 nucleotides of said promoter; and incubating the DNA template and the cap analog in a reaction mixture, wherein said incubating comprises incubating the reaction mixture at about 15°C to about 35°C for about 1 hour to about 12 hours to produce the RNA.
2. 2. The method of claim 1, wherein the promoter comprises a sequence selected from SEQ ID NOs: 10, 11, 13 and 14.
3. 3. The method of claim 1 or 2, wherein the 5'UTR and the 3'UTR are SEQ ID NOs: 1 and 2, 1 and 4, 1 and 6, 3 and 2, 3 and 4, 3 and 6, 3 and 8, 5 and 2, 5 and 4, 5 and 6, 7 and 2, 7 and 4, 7 and 6, 7 and 8, 9 and 2, 9 and 4, 9 and 6, or 9 and 8, respectively.
4. 4. The method of claim 3, wherein the 5' UTR and the 3' UTR are SEQ ID NOs: 1 and 2, 1 and 4, 3 and 2, 1 and 6, 7 and 4, 9 and 2, or 3 and 6, respectively.
5. The method of any one of claims 1 to 4, wherein the poly A region comprises from about 60 to about 200 A's.
6. The cap analog is m 7 GpppApC, m 7 GpppApG, m 7 GpppApU, m 7 G 3’Ome pppApC, m 7 G 3’Ome pppApG, m 7 G 3’Ome pppApU,m 7 G 3’Ome pppA 2’Ome pC, m 7 G 3’Ome pppA 2’Ome pG, m 7 G 3’Ome pppA 2’Ome pU,m 7 GpppA 2’Ome pC, m 7 GpppA 2’Ome pG and m 7 GpppA 2’Ome The method according to any one of claims 1 to 5, wherein the nucleotide sequence is selected from the group consisting of pU.
7. The reaction mixture comprises: a buffering substance having a concentration of about 45 mM to about 55 mM; an RNase inhibitor at a concentration of about 0.01 U / μl to about 0.03 U / μl; NTP at a concentration of about 3 mM to about 5 mM; the cap analog at a concentration of about 6 mM to about 8 mM; one or more magnesium salts at a concentration of about 20 mM to about 30 mM; a polyamine at a concentration of about 1.5 mM to about 2.5 mM; the DNA template at a concentration of about 0.01 μg / μl to about 0.05 μg / μl; pyrophosphatase at a concentration of about 0.1 mU / μl to about 0.5 mU / μl; The method of any one of claims 1 to 6, comprising an RNA polymerase at a concentration of about 0.01 µg / µl to about 0.05 µg / µl.
8. The method of claim 7 , wherein the RNA polymerase is selected from wild-type T7 RNA polymerase or a mutant thereof.
9. The method of any one of claims 1 to 8, wherein said incubating comprises incubating said reaction mixture at about 18°C to about 31°C.
10. 10. The method of claim 9, wherein said incubating comprises incubating said reaction mixture at about 30°C for about 4 hours.
11. The method of any one of claims 1 to 10, wherein the DNA template further comprises at least one transcription terminator located upstream and / or downstream of the open reading frame (ORF).
12. X 1 is G and X 2 and X 3 are A, T, G or C, and B 1 is A and B 2 The method of any one of claims 1 to 11, wherein is G.
13. X 1 is C and X 2 and X 3 are A, T, G or C, and B 1 is A and B 2 The method of any one of claims 1 to 11, wherein is C.
14. X 1 is T and X 2 and X 3 are A, T, G or C, and B 1 is A and B 2 The method of any one of claims 1 to 11, wherein is U.
15. 15. The method of any one of claims 1 to 14, wherein the concentration of the cap analog is from about 0.5 mM to about 50 mM.
16. 10. The method of claim 1, wherein incubating the reaction mixture is carried out at about 25°C for about 1 hour to about 5 hours.
17. The method of claim 2 , wherein the promoter comprises the sequence of SEQ ID NO:
10.
18. The method of claim 2 , wherein the promoter comprises the sequence of SEQ ID NO:
11.
19. The method of claim 2 , wherein the promoter comprises the sequence of SEQ ID NO:
13.
20. The method of claim 2 , wherein the promoter comprises the sequence of SEQ ID NO:
14.
21. 2. The method of claim 1, wherein the 5' UTR is selected from SEQ ID NOs: 1, 3, 5, 7, 9 and 23-69.
22. 22. The method of claim 21, wherein the 5' UTR is selected from SEQ ID NOs: 23-52.
23. 23. The method of claim 21 or 22, wherein the 3' UTR is selected from SEQ ID NOs: 2, 4, 6, 8 and 71.
24. A nucleic acid comprising, in a 5' to 3' direction, a 5' untranslated region (5' UTR), an open reading frame (ORF) encoding an RNA, and a 3' UTR, wherein the 5' UTR is selected from SEQ ID NOs: 1, 3, 5, 7, 9, and 23-69.
25. 25. The nucleic acid of claim 24, wherein the 5' UTR is selected from SEQ ID NOs: 23-52.
26. 26. The nucleic acid of claim 24 or 25, wherein the 3' UTR is selected from SEQ ID NOs: 2, 4, 6, 8 and 71.
27. A vector comprising the nucleic acid according to any one of claims 24 to 26.
28. 28. The vector of claim 27, wherein the vector further comprises a promoter.
29. 29. The vector of claim 27 or 28, wherein the promoter is selected from SEQ ID NOs: 10, 11, 13 and 14.
30. A nucleic acid comprising a nucleotide sequence selected from SEQ ID NOs: 23-52.
31. 31. The nucleic acid of claim 30, wherein the nucleic acid is a 5' UTR or a 3' UTR.