Affinity binding entities directed to PSMA and methods of use thereof

Engineering γδ T cells with PSMA-targeting CARs addresses the limitations of αβ T cells in adoptive cell therapy by enhancing safety and efficacy, enabling effective targeting of PSMA-expressing tumors.

JP2025528177APending Publication Date: 2025-08-26ADICET THERAPEUTICS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025507681
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-08-11
Filing Date
2023-08-11
Publication Date
2025-08-26

AI Technical Summary

Technical Problem

Current PSMA-targeted adoptive cell therapies using αβ T cells face challenges such as graft-versus-host disease and cytokine release syndrome, limiting their efficacy in treating solid tumors.

Method used

Development of γδ T cells engineered with chimeric antigen receptors (CARs) that specifically bind to prostate-specific membrane antigen (PSMA), utilizing specific antigen-binding domains and intracellular signaling domains to enhance safety and efficacy.

Benefits of technology

The engineered γδ T cells demonstrate improved cell activity, survival, and proliferation, reducing the risk of adverse reactions and effectively targeting PSMA-expressing tumor cells.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025528177000054
    Figure 2025528177000054
  • Figure 2025528177000055
    Figure 2025528177000055
  • Figure 2025528177000056
    Figure 2025528177000056
Patent Text Reader

Abstract

Aspects of the present disclosure include affinity binding entities that target prostate-specific membrane antigen (PSMA), chimeric antigen receptors (CARs) comprising the same, modified immune cells comprising the CARs, and compositions and methods comprising the same for the treatment of conditions associated with PSMA expression. In some embodiments, the modified immune cells are engineered γδ T cells.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 397,296, filed August 11, 2022, the disclosure of which is incorporated herein by reference in its entirety.

[0002] Field of Disclosure The present disclosure relates generally to affinity binding entities for prostate-specific membrane antigen (PSMA). Provided are chimeric antigen receptors (CARs) capable of binding to PSMA, polynucleotides, host cells comprising the polynucleotides and / or CARs, and methods of treating PSMA-associated disorders in patients. [Background technology]

[0003] Adoptive immune cell therapy has undergone continuous iterations for over 30 years, from its early days focused on basal lymphokine activation and / or tumor infiltration to the more recent strategy of genetically engineering these immune cells to express engineered antigen receptors, such as chimeric antigen receptors (CARs). While some hints and indications have emerged regarding the curative potential of these approaches, much remains to be done. In particular, successful tumor eradication by CAR-T lymphocytes depends on the persistence and effector function of CAR-T cells, but excess of either can induce a graft-versus-host (GvH) effect in patients. Furthermore, while adoptive transfer of CAR-expressing T cells has shown some success in the treatment of hematological malignancies, it has shown limited efficacy in other cancer types, particularly solid tumors. Compared to hematological diseases, solid tumors present unique challenges, including, but not limited to, a highly immunosuppressive and metabolically challenging tumor microenvironment.

[0004] Prostate-specific membrane antigen (PSMA), also known as glutamate carboxypeptidase II, N-acetylated alpha-linked acidic dipeptidase 1, or folate hydrolase 1 (FOLH1), is a dimeric type 2 transmembrane glycoprotein. PSMA is a prostate cancer-associated cell membrane antigen frequently overexpressed in prostatic intraepithelial neoplasia (PIN) (a condition in which a subset of prostate cells begins to exhibit abnormal appearance and behavior), primary and metastatic prostate cancer, and the angiogenesis of other solid tumors (e.g., breast, lung, bladder, and kidney). PSMA expression correlates with disease progression and Gleason score. PSMA expression is increased in metastatic disease, hormone-refractory cases, and higher-grade lesions, and is further upregulated in androgen-insensitive tumors.

[0005] To date, PSMA-targeting adoptive cell therapy approaches have been associated with toxicity issues, thereby limiting the practical translation of such approaches. In August 2020, a phase I clinical trial conducted by Poseida Therapeutics was halted following the death of a patient treated with P-PSMA-101, an autologous CAR T cell therapy utilizing αβ T cells engineered to target PSMA-expressing prostate cancer cells. The patient in this case developed symptoms consistent with macrophage activation syndrome (MAS), a severe and sometimes fatal overactivation of the immune system associated with CAR-T therapy. In March 2021, results were reported from a phase I clinical trial conducted by the University of Pennsylvania that tested the efficacy of autologous CAR T cells using αβ T cells engineered to target PSMA and armed with dominant-negative transforming growth factor (TGF)-β (Narayan et al., (2022) Nature Medicine. doi:10.1038). The results revealed that of 13 patients treated at all four dose levels, 5 of the 13 patients developed grade 2 or higher cytokine release syndrome (CRS), and one patient died of sepsis after grade 4 CRS. Thus, to date, PSMA-targeting CARs have been explored in the context of αβ T cells, and their potential efficacy appears to be compromised by generally high alloreactivity and a tendency to cause complications such as CRS and MAS.

[0006] Gamma delta (γδ) T cells are thymus-derived lymphocytes that differ from αβ T cells in their anatomical distribution as well as their activation and functional mechanisms. Notably, while αβ T cells function primarily in adaptive immunity, γδ T cells, like NK cells, are innate immune-like cells that recognize malignant cells through a repertoire of activating receptors in an MHC-independent manner (Welsh et al., Immunol. Rev. 1997;159:79-93). Therefore, in contrast to αβ T cells, γδ T cells have the potential to be used in the allogeneic setting without the risk of causing graft-versus-host disease (GvHD). Furthermore, recent studies suggest that engineered γδ T cells may produce fewer proinflammatory cytokines than αβ T cells, potentially reducing the risk of CRS in patients (Harrer et al., BMC. Cancer, 2017;17(1):551).

[0007] Despite the rapid and powerful development of CAR T therapy, the optimal parameters for CAR T cell-target interactions that result in efficacy in vivo and in humans remain poorly understood. Given the distinct mechanisms of action and function of αβ T cells compared with γδ T cells, demonstrating CAR function and efficacy in the context of αβ T cells is not predictive of CAR function and efficacy in the context of γδ T cells. Thus, the practical application of PSMA-targeted CAR T therapy approaches for γδ T cells is uncertain at best.

[0008] Thus, there is still a clear need for improved strategies to improve cell activity, survival, and / or proliferation upon administration while simultaneously improving the safety of PSMA-targeted adoptive cell therapy approaches. Summary of the Invention

[0009] The present disclosure provides methods, cells, compositions, and kits that improve the safety and efficacy of PSMA-targeted adoptive cell therapy approaches. In one aspect, an affinity binding entity is provided that includes an antigen-binding domain that specifically binds to prostate-specific membrane antigen (PSMA). In embodiments, the antigen-binding domain is a heavy chain variable region / light chain variable region (HCVR / LCHV) selected from the group consisting of SEQ ID NOs: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, 13 / 14, 15 / 16, 17 / 18, 19 / 20, 21 / 22, 23 / 24, 25 / 26, 27 / 28, 29 / 30, 31 / 32, 33 / 34, and 35 / 36. In an embodiment, the numbering system used is that of Kabat et al.

[0010] In embodiments, the antigen-binding domain comprises an HCVR / LCVR sequence pair selected from the group consisting of SEQ ID NOs: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, and 13 / 14, or the six CDRs of an HCVR / LCVR sequence pair selected from the group consisting of SEQ ID NOs: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, and 13 / 14.

[0011] In embodiments, the antigen-binding domain specifically binds to an epitope within residues 574-686 of human PSMA (residues numbered according to SEQ ID NO: 329 in Figure 18B). In embodiments, the antigen-binding domain specifically binds to an epitope consisting of residues 574-686 of human PSMA (residues numbered according to SEQ ID NO: 329 in Figure 18B). In embodiments, the antigen-binding domain specifically binds to an epitope consisting of or including residues 574-580, 644-649, and 674-686 of human PSMA (residues numbered according to SEQ ID NO: 329 in Figure 18B). In embodiments, the epitope is mapped by phage panning using biotinylated recombinant human PSMA protein bound to streptavidin beads. In embodiments, the antigen-binding domain comprises the HCVR / LCVR sequence pair of SEQ ID NOs: 1 / 2.

[0012] In embodiments, the antigen-binding domain specifically binds to an epitope within residues 150-261 of human PSMA (residues numbered according to SEQ ID NO: 330 in Figure 18B). In embodiments, the antigen-binding domain specifically binds to an epitope consisting of residues 150-261 of human PSMA (residues numbered according to SEQ ID NO: 330 in Figure 18B). In embodiments, the antigen-binding domain specifically binds to an epitope consisting of or including residues 150-161, 167-172, and 256-261 of human PSMA (residues numbered according to SEQ ID NO: 330 in Figure 18B). In embodiments, the epitope is mapped by phage panning using biotinylated recombinant human PSMA protein bound to streptavidin beads. In embodiments, the antigen-binding domain comprises the HCVR / LCVR sequence pair of SEQ ID NOs: 9 / 10.

[0013] In embodiments, the affinity binding entity is an antibody or antibody fragment. In embodiments, the antibody or antibody fragment is bispecific. In embodiments, the antibody or antibody fragment is a chimeric, humanized, or human antibody or antibody fragment. In embodiments, the antibody or antibody fragment is monoclonal. In embodiments, the affinity binding entity is selected from the group consisting of scFv, Fab, Fab', Fv, F(ab')2, dsFv, dAb, and any combination or plurality thereof.

[0014] According to one aspect of the present invention, there is provided a chimeric antigen receptor (CAR) comprising an affinity binding entity comprising an antigen-binding domain that specifically binds to prostate-specific membrane antigen (PSMA), wherein the antigen-binding domain comprises an HCVR / LCVR sequence pair selected from the group consisting of SEQ ID NOs: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, and 13 / 14, or six CDRs of an HCVR / LCVR sequence pair selected from the group consisting of SEQ ID NOs: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, and 13 / 14.

[0015] In embodiments, the CAR further comprises a hinge domain. In embodiments, the hinge domain comprises a glycine polymer, a glycine-serine polymer, a glycine-alanine polymer, an alanine-serine polymer, an immunoglobulin heavy chain hinge, or a receptor-derived hinge. In embodiments, the receptor-derived hinge is a CD8 alpha hinge domain. In embodiments, the CD8 alpha hinge domain comprises the amino acid sequence set forth in SEQ ID NO: 156.

[0016] In embodiments, the CAR further comprises a transmembrane (TM) domain. In embodiments, the TM domain is selected from the group consisting of 4-1BB / CD137, activating NK cell receptor, immunoglobulin protein, B7-H3, BAFFR, BL4-1BB / CD137, activating NK cell receptor, immunoglobulin protein, B7-H3, BAFFR, BLAME (SLAMF8), BTLA, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, or CD154, CD100 (SEM A4D), CD103, CD160 (BY55), CD18, CD19, CD19a, CD2, CD247, CD27, CD276 (B7-H3), CD28, CD29, CD3 delta, CD3 epsilon, CD3 gamma, CD3 zeta, CD30, CD4, CD40, CD49a, CD49D, CD49f, CD69, CD7, CD84, CD8, CD8α, CD8β, CD96 (Tactile), CD11a, CD11b, CD11c, CD11d, CDS, CEACAM1, CRTAM, Cytokinin Ig receptor, DAP10, DNAM1 (CD226), Fc gamma receptor, GADS, GITR, HVEM (LIGHTR), IA4, ICAM-1, Igα (CD79a), IL-2Rβ, IL-2Rγ, IL-7Rα, inducible T cell costimulatory factor (ICOS), integrin, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB2, ITGB7, ITGB1, KIRDS2, LAT, LFA-1, ligands that specifically bind to CD83, LIGHT, LTB R, Ly9 (CD229), lymphocyte function-associated antigen-1 (LFA-1; CD11a / CD18), MHC class 1 molecules, NKG2C, NKG2D, NKp30, NKp44, NKp46, NKp80 (KLRF1), OX-40, PAG / Cbp, programmed death-1 (PD-1), PSGL1, SELPLG (CD162), signaling lymphocyte activation molecule (SLAM protein), SLAM (SLAMF1; CD150; IPO-3), SLAMF4 (CD244; 2B4), SLAMF6 (NTB-A;The TM domain comprises the TM region of a CD8 TM domain, preferably a CD8 TM domain, or a fragment, truncation, or combination thereof. In embodiments, the TM domain comprises the TM domain of CD8, and preferably the TM domain of CD8 alpha. In embodiments, the TM domain comprises the amino acid sequence set forth in SEQ ID NO: 158.

[0017] In embodiments, the CAR further comprises a costimulatory domain. In embodiments, the costimulatory domain is selected from the group consisting of TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, CARD11, B7-H3, CEACAM1, CRTAM, CD2, CD3C, CD4, CD7, CD8α, CD8β, CD11a, CD11b, CD11c, CD11d, IL2Rβ, IL2γ, IL7Rα, IL4R, IL7R, IL15R, IL21R, CD18, CD19, CD19a, CD27, CD28, CD29, CD30, CD40, CDS, CD49a, CD49D, CD49f, CD54(ICAM), CD69, CD70, CD80, CD83, CD84, CD86, CD96(Tactile), CD100(SEMA4D), CD103, C D134(OX40), CD137(4-1BB), CD152(CTLA-4), CD160(BY55), CD162(SELPLG), CD244(2B4), CD270(HVEM), CD226(DNAM1), CD229(Ly 9), CD278(ICOS), ICAM-1, LFA-1(CD11a / CD18), FcR, FcγRI, FcγRII, FcγRIII, LAT, NKG2C, SLP76, TRIM, ZAP70, GITR, BAFFR, LTBR, LAT, GADS, LIGHT, HVEM(LIGHTR), KIRDS2, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB1, ITGB2, ITGB7, NKG2C, NKG2D, I The costimulatory domain may comprise a costimulatory domain of A4, VLA-1, VLA-6, SLAM (SLAMF1, CD150, IPO-3), SLAMF4, SLAMF6 (NTB-A, Ly108), SLAMF7, SLAMF8 (BLAME), SLP-76, PAG / Cbp, NKp80 (KLRF1), NKp44, NKp30, NKp46, BTLA, JAML, CD150, PSGL1, TSLP, TNFR2, or TRANCE / RANKL, or a portion thereof, or a combination thereof. In embodiments, the costimulatory domain is a 4-1BB costimulatory domain. In embodiments, the 4-1BB costimulatory domain comprises the amino acid sequence set forth in SEQ ID NO: 162.

[0018] In embodiments, the CAR further comprises an intracellular signaling domain. In embodiments, the intracellular signaling domain is a CD3ζ intracellular signaling domain. In embodiments, the CD3ζ intracellular signaling domain comprises the amino acid sequence set forth in SEQ ID NO: 164, 166, or 167.

[0019] In embodiments, the CAR further comprises a signal peptide. In embodiments, the signal peptide comprises the amino acid sequence set forth in SEQ ID NO: 152.

[0020] In an aspect of the present invention, there is provided an isolated polynucleotide comprising a nucleic acid sequence encoding any one of the aforementioned affinity binding entities. In embodiments, an expression vector comprises the polynucleotide. In embodiments, the polynucleotide is operably linked to a cis-acting regulatory element.

[0021] According to an aspect of the present invention, there is provided a cell comprising any one or more of the affinity binding entities, polynucleotides, and / or expression vectors described above.

[0022] According to aspects of the present invention, there is provided an isolated polynucleotide comprising a nucleic acid sequence encoding any one of the aforementioned CARs. In embodiments, the polynucleotide further comprises a nucleic acid sequence encoding at least one multicistronic linker region. In embodiments, the multicistronic linker region encodes a cleavage sequence. In embodiments, the cleavage sequence is selected from T2A, F2A, P2A, E2A, furin, and furin-P2A (FP2A). In embodiments, the multicistronic linker region encodes an internal ribosome entry site (IRES).

[0023] In embodiments, the isolated polynucleotide further comprises a nucleic acid sequence encoding one or more additional polypeptides. In embodiments, the one or more additional polypeptides comprise or are selected from the group consisting of lymphotoxin beta receptor (LTBR), low-affinity nerve growth factor receptor (LNGFR), dominant-negative (dn) receptor for TGF-beta or Fas, truncated human epidermal growth factor receptor (EGFRt), and membrane-bound IL-12 (mbIL-12), or any combination thereof. In embodiments, the one or more additional polypeptides are selected from a fluorescent protein, a gamma chain cytokine, CD19, CD20, LNGFR, EGFRt, LTBR, ​​dnTGFβR2, and any combination thereof.

[0024] In embodiments, the one or more additional polypeptides are a dominant-negative receptor for TGF-beta. In embodiments, the dominant-negative receptor for TGF-beta is dnTGFβR2. In embodiments, dnTGFβR2 comprises the amino acid sequence set forth in SEQ ID NO: 265. In embodiments, the one or more additional polypeptides are lymphotoxin beta receptor (LTBR). In embodiments, the LTBR comprises the amino acid sequence set forth in SEQ ID NO: 267. In embodiments, the one or more additional polypeptides are truncated epidermal growth factor receptor (EGFRt). In embodiments, EGFRt comprises the amino acid sequence set forth in SEQ ID NO: 261. In embodiments, the one or more additional polypeptides are low-affinity nerve growth factor receptor (LNGFR). In embodiments, LNGFR comprises the amino acid sequence set forth in SEQ ID NO: 273. In embodiments, the one or more additional polypeptides are dominant-negative Fas (dnFas). In embodiments, the one or more additional polypeptides are membrane-bound IL-12 (mbIL-12). In embodiments, the one or more additional polypeptides are a CAR that binds to CD70.

[0025] In embodiments, the one or more additional polypeptides are operably linked to a nucleic acid sequence encoding a signal peptide, in embodiments, the signal peptide comprises an amino acid sequence selected from SEQ ID NO:259, SEQ ID NO:263, SEQ ID NO:267, SEQ ID NO:271, and SEQ ID NO:248.

[0026] In embodiments, the isolated polynucleotide comprising a nucleic acid sequence encoding a CAR comprises the nucleic acid sequence of SEQ ID NO: 205, 209, 213, 217, 221, 225, 229, or 233. In embodiments, an expression vector comprises the isolated polynucleotide comprising a nucleic acid sequence encoding a CAR. In embodiments, the polynucleotide is operably linked to a cis-acting regulatory element.

[0027] According to one aspect, provided herein is a γδ T cell comprising (a) a nucleic acid sequence encoding a chimeric antigen receptor (CAR) comprising an affinity binding domain that specifically binds to prostate-specific membrane antigen (PSMA), and / or (b) a polypeptide comprising a CAR comprising an amino acid sequence encoded by the nucleic acid sequence of (a), wherein the γδ T cell functionally expresses the binding domain of the CAR encoded by the polypeptide or nucleic acid on the surface of the γδ T cell. In embodiments, the γδ T cell is a δ1, δ2, δ3, or δ4 γδ T cell, preferably a δ2-γδ T cell, and more preferably a δ1 γδ T cell.

[0028] According to one aspect, provided herein is a modified immune cell comprising a CAR, an isolated polynucleotide comprising a nucleic acid sequence encoding a CAR, and / or an expression vector comprising a polynucleotide comprising a nucleic acid sequence encoding a CAR, as described herein. In embodiments, the modified immune cell is a γδ T cell, a γδ NKT cell, an αβ T cell, an NK cell, an NKT cell, or a macrophage. In embodiments, the modified immune cell is a γδ T cell. In embodiments, the γδ T cell is a δ1, δ2, δ3, or δ4 γδ T cell, preferably a δ2-γδ T cell, and more preferably a δ1 γδ T cell.

[0029] In embodiments, the modified immune cells or γδ T cells exhibit in vitro and / or in vivo cell-killing activity against tumor cells that exhibit cell surface expression of PSMA. In embodiments, the cell-killing activity is greater than the native level of in vitro and / or in vivo tumor cell-killing activity of a control modified immune cell or control γδ T cell of the same type that does not contain a CAR construct. In embodiments, the modified immune cells or γδ T cells proliferate in response to contact with tumor cells that exhibit cell surface expression of PSMA. In embodiments, the modified immune cells or γδ T cells exhibit increased proliferation in response to contact with tumor cells that exhibit cell surface expression of PSMA compared to a control modified immune cell or γδ T cell of the same type that does not contain a CAR construct.

[0030] In embodiments, the modified immune cells or γδ T cells are grown in a host organism that contains tumor cells that exhibit cell surface expression of PSMA.

[0031] In embodiments, the modified immune cells or γδ T cells express proinflammatory cytokines after contact with tumor cells that exhibit cell surface expression of PSMA.

[0032] In embodiments, the modified immune cells or γδ T cells comprise at least one disrupted gene. In embodiments, the at least one disrupted gene is cytokine-inducible SH2-containing protein (CISH). In embodiments, the at least one disrupted endogenous gene is CBL proto-oncogene B (CBL-B). In embodiments, the at least one disrupted endogenous gene is zinc finger protein 91 (ZFP91). In embodiments, the at least one disrupted endogenous gene is Roquin. In embodiments, the at least one disrupted endogenous gene is CD58 and / or ICAM-1.

[0033] According to one aspect, there is provided a plurality of modified immune cells as disclosed herein.

[0034] According to one aspect, there is provided a plurality of γδ T cells as disclosed herein, preferably γδ T cells comprising (a) a nucleic acid encoding a CAR disclosed herein, the nucleic acid comprising an affinity binding domain that specifically binds to PSMA, and / or (b) a polypeptide comprising a CAR comprising an amino acid sequence encoded by the nucleic acid of (a), wherein the γδ T cells functionally express the binding domain of the CAR encoded by the polypeptide or nucleic acid on the surface of the γδ T cell.

[0035] In embodiments, the plurality of modified immune cells or the plurality of γδ T cells are at least 60%, 80%, or about 60% or 80% to about 90% or 95% δ1, δ2, δ3, or δ4 γδ T cells, preferably δ1 or δ2 γδ T cells, more preferably δ2 - The composition comprises γδ T cells, most preferably δ1 γδ T cells.

[0036] In embodiments, the plurality of modified immune cells or the plurality of γδ T cells each comprises at least about 10 7 modified immune cells or γδ T cells, preferably about 10 8 modified immune cells or γδ T cells to approximately 10 11 modified immune cells or γδ T cells.

[0037] According to one aspect, there is provided a method of generating a modified immune cell, a γδ T cell, a plurality of modified immune cells, or a plurality of γδ T cells, said method comprising transfecting an immune cell(s) or γδ T cell(s) with an expression vector comprising a nucleic acid encoding a CAR disclosed herein, optionally wherein said cell(s) have at least one disrupted gene. In embodiments, the method comprises retroviral transduction. In embodiments, the method comprises ex vivo expansion of the immune cell(s) or γδ T cell(s), wherein the ex vivo expansion is performed before and / or after transfection of the immune cell(s) or γδ T cell(s).

[0038] According to an aspect of the present invention, there is provided an antibody-drug conjugate (ADC) comprising any one of the affinity binding entities described above.

[0039] According to aspects of the present invention, there is provided a pharmaceutical composition comprising any one of the affinity binding entity(ies), modified immune cell(ies), γδ T cell(ies), or ADC(ies) described above, and a pharmaceutically acceptable carrier.

[0040] According to an aspect of the invention, there is provided a method of inhibiting proliferation of a cell that exhibits cell surface expression of PSMA, the method comprising contacting the cell with any one of the affinity binding entity(ies), modified immune cell(ies), γδ T cell(ies), ADC(ies), or pharmaceutical composition(ies) described above.

[0041] According to aspects of the invention, in an embodiment, the method comprises introducing into a host organism comprising tumor cells a therapeutically effective amount of affinity binding entity(ies), modified immune cell(s), γδ T cell(s), ADC(s), or pharmaceutical composition(s).

[0042] In embodiments of the method of killing tumor cells, the method further comprises simultaneously or sequentially administering one or more methods of elevating common gamma chain cytokine(s). In embodiments, administering one or more methods of elevating common gamma chain cytokine(s) comprises simultaneously or sequentially administering, before and / or after introduction of the modified immune cell(s) or γδ T cell(s), an amount of common gamma chain cytokine(s) effective to increase proliferation, cytotoxic activity, persistence, or a combination thereof, of the introduced modified immune cell(s) or γδ T cell(s). In embodiments, the one or more methods of elevating common gamma chain cytokine(s) comprises lymphodepletion before introducing the modified immune cell(s) or γδ T cell(s). In embodiments, the one or more methods of elevating common gamma chain cytokine(s) comprises secretion of one or more common gamma chain cytokine(s) from the introduced modified immune cell(s) or γδ T cell(s).

[0043] In embodiments herein of methods for inhibiting the proliferation of cells that exhibit cell surface expression of PSMA or methods for killing tumor cells that exhibit cell surface expression of PSMA, the method(s) reduce the in vivo tumor burden in the host organism and / or increase the mean survival time of the host organism compared to a control organism, where the control organism has not been treated with the affinity binding entity(ies), modified immune cell(s), γδ T cell(s), ADC(s), or pharmaceutical composition(s). In embodiments, the host organism is a human. In embodiments, the method is a method of treating cancer in a subject in need of treatment.

[0044] According to one aspect, there is provided a use of any one of the affinity binding entity(ies), modified immune cell(ies), γδ T cell(ies), ADC(ies) or pharmaceutical composition(ies) described above in the preparation of a medicament for the treatment of cancer.

[0045] In one aspect, provided is a method of reducing or inhibiting a graft-versus-host response to administered immune cells to a subject in need thereof, comprising administering a therapeutically effective amount of γδ T-cells according to the subject invention. In embodiments, the γδ T-cells may comprise a dual CAR that binds to CD70 and PSMA, or the method may further comprise co-administering the γδ T-cells according to the subject invention simultaneously or sequentially with immune cells (e.g., T cells or NK cells) comprising a CAR that binds PSMA and a CAR that binds CD70.

[0046] Incorporation by Reference All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. [Brief explanation of the drawings]

[0047] [Figure 1] Binding profiles of anti-PSMA antibodies to both PSMA-expressing 22Rv1 cells and 22Rv1 cells knocked out for PSMA expression are shown. [Figure 2A] 1 illustrates a tabulation of EC50 of anti-PSMA antibodies against recombinant human PSMA protein. [Figure 2B] 1 shows the differential binding profiles of selected anti-PSMA antibodies to the monomeric or dimeric state of recombinant human PSMA protein. [Figure 3A] 1 is a graph showing the in vitro cytotoxicity of various PSMA CAR constructs of the present disclosure against PSMA-expressing cell lines (PSMA-expressing 22Rv1 target cells). [Figure 3B] 1 is a graph showing the in vitro cytotoxicity of various PSMA CAR constructs of the present disclosure relative to the corresponding negative control (22Rv1, in which PSMA expression is knocked out). [Figure 3C] 1 is a graph showing the in vitro cytotoxicity of various PSMA CAR constructs of the present disclosure against PSMA-expressing cell lines (PSMA-expressing 22Rv1 target cells). [Figure 3D] 1 is a graph showing the in vitro cytotoxicity of various PSMA CAR constructs of the present disclosure relative to the corresponding negative control (22Rv1, in which PSMA expression is knocked out). [Figure 3E] 1 is a graph showing the in vitro cytotoxicity of various PSMA CAR constructs of the present disclosure against a PSMA-expressing cell line (PC3 cells engineered to express PSMA). [Figure 3F] 1 is a graph showing the in vitro cytotoxicity of various PSMA CAR constructs of the present disclosure relative to the corresponding negative control (parental PC3 cell line, which does not express PSMA). [Figure 3G] 1 is a graph showing the in vitro cytotoxicity of various PSMA CAR constructs of the present disclosure against a PSMA-expressing cell line (PC3 cells engineered to express PSMA). [Figure 3H] 1 is a graph showing the in vitro cytotoxicity of various PSMA CAR constructs of the present disclosure relative to the corresponding negative control (parental PC3 cell line, which does not express PSMA). [Figure 4] (A) and (B) are graphs showing the in vitro cytotoxicity profile of a PSMA CAR construct modified to express a dominant-negative TGFβ receptor II (dnTGFβRII). (A) shows that the cytotoxicity profile of the modified PSMA CAR construct is comparable to that of a similar PSMA CAR construct lacking dnTGFβRII. (B) shows that no cytotoxicity was observed against a PSMA knockout cell line. [Figure 5A] 1 shows that expression of a PSMA CAR construct modified to express dnTGFβRII is unchanged from expression of a similar PSMA CAR lacking dnTGFβRII. [Figure 5B] 1 shows that expression of dnTGFβRII is detected in a PSMA CAR construct modified to express dnTGFβRII, but not in a similar unmodified PSMA CAR construct. [Figure 5C]We show that γδ T cells containing a PSMA CAR construct modified to express dnTGFβRII have reduced expression of CD103 compared to control cells containing a similar PSMA CAR construct lacking dnTGFβRII. [Figure 5D] 1 shows that pSMAD2 / 3 expression is reduced in γδ T cells containing a PSMA CAR construct modified to express dnTGFβRII compared to control cells containing a similar PSMA CAR construct lacking dnTGFβRII. [Figure 6] 15-day cell proliferation profile of anti-PSMA CAR-transduced γδ T cells. [Figure 7A] 10 is a graph showing the in vivo efficacy of anti-PSMA CAR-transduced γδ T cells in the subcutaneous human xenograft 22Rv1 clone E7 model in NOD scid gamma (NSG) mice. [Figure 7B] 10 is a graph showing the in vivo efficacy of anti-PSMA CAR-transduced γδ T cells in the subcutaneous human xenograft 22Rv1 clone E7 model in NOD scid gamma (NSG) mice. [Figure 8] FIG. 1 is a graph showing the gene knockout efficiency of two different guide RNAs targeting cytokine-inducible SH2-containing proteins (CISH). [Figure 9] (A) Graph showing that CISH-knocked out V51 T cells can be enriched after αβ T cell depletion. (B) Graph showing viability of CISH-knocked out V51 T cells. [Figure 10A] Binding profiles of anti-PSMA antibodies to both PSMA-expressing 22Rv1 cells and 22Rv1 cells knocked out for PSMA expression are shown. [Figure 10B] We summarize the binding profiles of anti-PSMA antibodies to three different PSMA+ prostate cancer (PCa) cell lines with different levels of PSMA expression. [Figure 11A] EC50 of anti-PSMA antibodies against recombinant human PSMA protein. [Figure 11B]1 shows the differential binding profiles of several anti-PSMA antibodies to the monomeric or dimeric state of recombinant human PSMA protein. [Figure 12] Figure 1 shows the in vitro cytotoxicity of different PSMA CAR constructs against the PSMA-expressing PCa cell lines 22Rv1 and PC3-PSMA, and the corresponding knockout or parental lines lacking PSMA expression. [Figure 13] Shows the in vitro cytotoxicity of PSMA CAR in the presence of TGFβ1. [Figure 14A] 1 shows that expression of CAR in the "bolt-on" modified PSMA CAR construct is unchanged from expression of naked CAR. [Figure 14B] Shows expression of dominant-negative TGFβ receptor II (dnTGFβRII) in "bolt-on" modified PSMA CAR constructs compared to unmodified naked CAR. [Figure 14C] Shows reduced CD103 expression in the "bolt-on" modified PSMA CAR construct compared to naked CAR. [Figure 14D] Figure 1 shows the reduction of pSMAD2 / 3 expression in the "bolt-on" modified PSMA CAR construct following the addition of exogenous TGFβ compared to unmodified naked CAR. [Figure 15] Shown are cell proliferation profiles across three donors of anti-PSMA CAR-transduced γδ T cells with and without a "bolt-on," as well as Benchmark (J591). [Figure 16] Shows the in vivo efficacy of anti-PSMA CAR-transduced γδ T cells expanded in three donors in the subcutaneous human xenograft 22Rv1 clone E7 model in NOD scid gamma (NSG) mice compared to Benchmark J591-transduced γδ T cells. [Figure 17] Shows the in vivo efficacy of anti-PSMA CAR with and without dnTGFβRII "bolt-on", including suboptimal doses, in the subcutaneous human xenograft PC3-PIP model in NSG mice. [Figure 18A]Figure 1 shows the epitopes of binders in two anti-PSMA CAR-transduced γδ T cells mapped to the crystal structure of human PSMA. The predicted linear epitope of Benchmark (J591), and the conformational epitopes of Lead 1 and Lead 2 are shown in the figure. [Figure 18B] Using cross-linking mass spectrometry (XL-MS), sequences on human PSMA (SEQ ID NOs: 329-330) that were described as epitopes for binders in Leads 1 and 2 are listed. [Figure 19] 1 shows the design of the CAR-mbIL-12 construct. [Figure 20A] 1 shows the proliferation and expression of CAR-mbIL-12 in V51 T cells. [Figure 20B] 1 shows the proliferation and expression of CAR-mbIL-12 in V51 T cells. [Figure 20C] 1 shows the proliferation and expression of CAR-mbIL-12 in V51 T cells. [Figure 20D] 1 shows the proliferation and expression of CAR-mbIL-12 in V51 T cells. [Figure 21] 1 shows the enhanced in vitro cytotoxicity of CAR-mbIL-12 in V51 T cells. [Figure 22] Shows the in vivo therapeutic efficacy of CAR-mbIL-12 with Vδ1 T cells in a subcutaneous human xenograft Raji cell NSG mouse model. [Figure 23A] Figure 1 shows that KO of CISH enhanced the in vitro cytotoxicity of Vδ1 T cells. [Figure 23B] Figure 1 shows that KO of CISH enhanced the in vitro cytotoxicity of Vδ1 T cells. [Figure 24A] Figure 1 shows that KO of CBL-B enhanced the in vitro cytotoxicity of Vδ1 T cells. [Figure 24B] Figure 1 shows that KO of CBL-B enhanced the in vitro cytotoxicity of Vδ1 T cells. [Figure 25A] Figure 1 shows that KO of Roquin enhanced the in vitro cytotoxicity of Vδ1 T cells. [Figure 25B] Figure 1 shows that KO of Roquin enhanced the in vitro cytotoxicity of Vδ1 T cells. [Figure 26A] Figure 1 shows that KO of CD58 or ICAM-1 enhanced in vitro cell survival of Vδ1 T cells in an allogeneic MLR assay. [Figure 26B] Figure 1 shows that KO of CD58 or ICAM-1 enhanced in vitro cell survival of Vδ1 T cells in an allogeneic MLR assay. DETAILED DESCRIPTION OF THE INVENTION

[0048] I. Definition For purposes of interpreting this specification, the following definitions shall apply, and where appropriate, terms used in the singular shall include the plural and vice versa. In the event that a set forth definition conflicts with a document incorporated herein by reference, the definition set forth below shall prevail. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains.

[0049] As used herein, "about" when referring to a measurable value, e.g., amount, temporal duration, etc., is meant to encompass a variation of ±20% or ±10%, more preferably ±5%, more preferably ±1%, and even more preferably ±0.1% from the specified value, as appropriate for carrying out the disclosed methods.

[0050] As used herein, "w / v" refers to the weight of a component in a given volume of solution.

[0051] "Range": Throughout this disclosure, various aspects of the disclosure may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the disclosure. Accordingly, the description of a range should be considered to have specifically disclosed not only each individual numerical value within that range, but also all possible subranges. For example, description of a range such as 1 to 6 is considered to have specifically disclosed subranges, e.g., 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., as well as each individual number within that range, e.g., 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the broadness of the range.

[0052] The terms "patient," "subject," "individual," and the like are used interchangeably herein and refer to any animal amenable to the methods described herein. In certain non-limiting embodiments, the patient, subject, or individual is a human.

[0053] The term "diagnosis" or "diagnosing" refers to the process of identifying a disease, such as cancer, through signs, symptoms, and / or the results of various tests. The conclusion reached through such a process is a diagnosis. Common forms of testing include blood tests, medical imaging, urine tests, biopsies, etc.

[0054] As used herein, the term "agent" refers to any protein, nucleic acid molecule (including chemically modified nucleic acids), compound, antibody, small molecule, organic compound, inorganic compound, other molecule of interest, or cell (e.g., a cell engineered to express a chimeric antigen receptor). Agents can include therapeutic agents, diagnostic agents, or pharmaceutical agents. A therapeutic or pharmaceutical agent is one that, alone or together with additional agents, induces a desired response (such as inducing a therapeutic or prophylactic effect when administered to a subject, including treating a subject suffering from cancer or other disease / condition).

[0055] The term "therapeutically effective amount" or simply "effective amount" refers to an amount of an agent or composition (e.g., a composition containing an agent) that elicits the biological or medical response in a tissue, system, or subject that is desired by a researcher, veterinarian, physician, or other clinician. The term "therapeutically effective amount" includes an amount of an agent or a composition containing an agent that, when administered, is sufficient to prevent the occurrence of, or alleviate to some extent, one or more signs or symptoms of, the disorder or disease (e.g., prostate cancer) being treated. The therapeutically effective amount will vary depending on the composition, the disease and its severity, and the age, weight, etc., of the subject being treated.

[0056] As used herein, the term "γδ T cells (gamma delta T cells)" refers to a subset of T cells that express a distinct T cell receptor (TCR), i.e., γδ TCR, on their surface, which is composed of one γ chain and one δ chain. The term "γδ T cells" includes all subsets of γδ T cells, particularly, but not limited to, Vδ1, Vδ2, Vδ3 γδ T cells, as well as naive, effector memory, central memory, and terminally differentiated γδ T cells. As a further example, the term "γδ T cells" includes Vδ4, Vδ5, Vδ7, and Vδ8 γδ T cells, as well as Vγ2, Vγ3, Vγ5, Vγ8, Vγ9, Vγ10, and Vγ11 γδ T cells. In embodiments, γδ T cells are Vδ1 - , Vδ2 - or Vδ1 - and Vδ2 -Compositions and methods for making and using engineered and non-engineered γδ T cells and / or their subtypes include, but are not limited to, those described in US2016 / 0175358, WO2017 / 197347, US9499788, US2018 / 0169147, US9907820, US2018 / 0125889, and US2017 / 0196910, the contents of each of which are incorporated by reference for all purposes, including compositions and methods for making and using engineered and non-engineered γδ T cells and / or their subtypes. The present application further contemplates T cells, or other engineered leukocytes or lymphocytes, that express one gamma chain or one delta chain, optionally in combination with a second polypeptide to form a functional TCR. Such genetically engineered leukocytes or lymphocytes expressing one gamma chain or one delta chain may be used in the methods or present in the compositions described herein.

[0057] The γδ T cells described herein can be δ1, δ2, δ3, or δ4 γδ T cells, or a combination thereof. In some cases, the γδ T cells are predominantly (more than 50%), mostly (more than 90%), essentially all, or entirely δ2 γδ T cells. In some cases, the γδ T cells are predominantly (more than 50%), mostly (more than 90%), essentially all, or entirely δ1 γδ T cells. In some cases, the γδ T cells are predominantly (more than 50%), mostly (more than 90%), essentially all, or entirely δ3 γδ T cells.

[0058] As described herein, T cells for use in γδ can be obtained from allogeneic or autologous donors. γδ T cells can be partially or completely purified, or expanded ex vivo without purification. Methods and compositions for ex vivo expansion include, but are not limited to, those described in WO2017 / 197347. Expansion may be performed before or after, or both, introducing a CAR polypeptide of the present disclosure into the γδ T cell(s). Other additional or alternative expansion methods include the use of artificial antigen-presenting cells (aAPCs), aminobisphosphonates, cytokine cocktails, and feeder cells (Cortes-Selva, D et al., (2021) Trends Pharmacol Sci. 42(1):45-59).

[0059] As used herein, the term "αβ T cell" refers to a T cell that expresses the α and β chains of the TCR as part of a complex with a CD3 chain molecule. Each α and β chain contains one variable domain and one constant domain. αβ T cells primarily recognize peptide antigens presented by major histocompatibility complex (MHC) class I and class II molecules, with most of the receptor diversity contained within the third complementarity-determining region (CDR3) of the TCR α and β chains.

[0060] As used herein, the term "natural killer (NK) cells" refers to CD56 cells that play a key role in immunity against viruses and tumor immunosurveillance and constitute an important cell subset of the innate immune system. + CD3 -NK cells refer to granular lymphocytes (Godfrey J, et al. Leuk Lymphoma, 2012, 53:1666-1676). NK cells express a highly diverse repertoire of inhibitory and activating receptors on their cell surface, which control immune responses. NK cells can kill mutant and infected cells by releasing perforin and granzymes, or by using effector molecules of the tumor necrosis factor (TNF) family (e.g., TNF, TNF-related apoptosis-inducing ligand (TRAIL), and Fas ligand, which induce apoptosis in target cells). Furthermore, upon activation, NK cells rapidly produce chemokines and cytokines (e.g., interferon (IFN)-γ, GM-CSF, and IL-10), which recruit and affect the function of host hematopoietic and non-hematopoietic cells. Cytotoxic CD8 + Unlike T lymphocytes, NK cells exert cytotoxicity against tumor cells without the need for prior sensitization and can eradicate MHC-I negative cells (Narni-Mancinelli E, et al. Int Immunol 2011 23:427-431). NK cells are considered to be fairly safe effector cells because they can avoid the potentially fatal complications of cytokine storm (Morgan RA, et al. Mol Ther 2010 18:843-851), tumor lysis syndrome (Porter DL, et al. N Engl J Med 2011 365:725-733), and off-target tumor effects.

[0061] NK cells can be obtained from allogeneic or autologous donors. NK cells can be partially or completely purified, or expanded in vitro without purification. Methods and compositions for in vitro expansion include, but are not limited to, those described in Becker et al., (2016) Cancer Immunol. Immunother. 65(4):477-84. Expansion may be performed before or after, or both, the CAR is introduced into the NK cell(s). Briefly, and without limitation, NK cell expansion can include the use of engineered feeder cells, cytokine cocktails (e.g., IL-2, IL-15), and / or aAPCs (Cortes-Selva, D et al., (2021) Trends Pharmacol Sci. 42(1):45-59).

[0062] In some examples, placental hematopoietic stem cell-derived natural killer (PNK) cells or immortalized cell lines (e.g., NK-92) can be modified to express the chimeric adapter polypeptides of the present disclosure. In other examples, NK cells that can be used to engineer expression of the CARs herein can be differentiated from human embryonic stem cells (hESCs) and induced pluripotent stem cells (iPSCs). As used herein, the term "natural killer T (NKT) cells" refers to T lineage cells that share morphological and functional characteristics with both T cells and NK cells. NKT cells are rapid responders of the innate immune system and mediate potent immunoregulatory and effector functions in a variety of disease conditions. Ligand recognition by NKT cells results in the rapid secretion of pro-inflammatory cytokines (e.g., IFN-γ and TNF-α) and anti-inflammatory cytokines (e.g., IL-4, IL-10, and IL-13). This can enhance immune responses, for example, against cancer, by directly targeting tumor cells and indirectly regulating anti-tumor responses through the release of various cytokines or by modifying the TME. After activation, NKT cells can immediately begin secreting cytokines without first differentiating into effector cells. Due to their rapid response, NKT cells play an important role in the first line of innate defense against several types of bacterial and viral infections. Furthermore, many of the cytokines secreted by NKT cells have potent effects on the differentiation and function of αβT cells, linking NKT cells to adaptive defense. NKT cells bridge the adaptive and innate immune systems. Unlike conventional T cells, which recognize peptide antigens presented by major histocompatibility complex (MHC) molecules, NKT cells recognize glycolipid antigens presented by a molecule called CD1d. NKT cells can be obtained from allogeneic or autologous donors. NKT cells can be partially or completely purified, or expanded ex vivo without purification. Briefly, NKT cells can be expanded by the use of ex vivo IL-2 and / or a monoclonal antibody specific for the TCR α chain CDR3 loop (Cortes-Selva, D et al., (2021) Trends Pharmacol Sci. 42(1):45-59).

[0063] As used herein, the term "γδ natural killer T cells" or "γδ NKT cells" refers to iPSC-derived cells that express γδ TCR and NK receptors but lack expression of characteristic γδ T cell markers (Cortes-Selva, D et al., (2021) Trends Pharmacol Sci. 42(1):45-59). These cells have been shown to have anti-tumor activity against multiple cancer cell lines, but not normal cells, and exhibited more potent killing than donor-derived γδ T cells or donor-derived NK cells (Zeng J et al., (2019) PLoS ONE 14(5):e0216815). In embodiments herein, a CAR can be expressed in the γδ NKT cells used according to the methods disclosed herein.

[0064] As used herein, the term "myeloid cells" refers to a subpopulation of leukocytes represented by granulocytes, monocytes, macrophages, and dendritic cells (DCs). They circulate through the blood and lymphatic system and are rapidly recruited to sites of tissue injury and infection via various chemokine receptors. Within tissues, they are activated for phagocytosis and secretion of inflammatory cytokines, thereby playing an important role in protective immunity. Myeloid cells can also be found in tissues in the steady state, where they regulate development, homeostasis, and tissue repair.

[0065] As used herein, the term "macrophage" refers to highly plastic innate cells that contain functional and phenotypic signatures that can be shaped in response to various stimuli. Macrophage polarization is broadly classified into two distinct states: the M1 phenotype (classically activated), which responds to factors such as lipopolysaccharide (LPS) or IFN-γ, or the M2 phenotype, which responds to cytokines such as IL-4, IL-5, and IL-13. An example of an M1-like macrophage expresses iNOS and proinflammatory cytokines such as TNF-α, IL-1-β, IL-6, IL-12, and IL-23. An example of an M2 macrophage shows increased expression of CD209, CD200R, CD1a, and CD1b in humans, suggesting its involvement in wound healing and antitumor responses. The ability of macrophages to infiltrate solid tumors and be reprogrammed, and the anti-tumor effects associated with switching to an M1 phenotype, are relevant to the present disclosure with respect to engineered macrophages expressing CARs described herein. For example, in a mouse ovarian cancer model, it has been shown that inhibiting NK-κB signaling can reprogram macrophages into anti-tumor M1 phenotype cells capable of producing nitric oxide and inducing IL-12-dependent, NK-mediated anti-tumor effects (Zhang F et al., (2019) Nat Commun 10:3974).

[0066] Macrophages can be obtained / derived from allogeneic or autologous donors. Macrophages can be partially or completely purified, or cultured in vitro without purification (see, for example, Davies JQ and Gordon A (2005) Methods Mol Biol 290:105016). In embodiments, the present disclosure encompasses hESC-derived macrophages (Karlsson, KR et al., (2008) Exp Hematol 36:1167-1175) or iPSC-derived macrophages (Takata K. et al., (2017) Immunity 47:183-198).

[0067] As used herein, the term "T lymphocyte" or "T cell" refers to an immune cell that expresses or has expressed CD3 (CD3+) and a T cell receptor (TCR+). T cells play a central role in cell-mediated immunity. T cells that "express" CD3 and a TCR have been engineered to remove cell surface expression of CD3 and / or TCR.

[0068] As used herein, the term "TCR" or "T cell receptor" refers to dimeric heterologous cell surface signaling proteins that form alpha-beta or gamma-delta receptors, or combinations thereof. αβTCRs recognize antigens presented by MHC molecules, whereas γδTCRs are capable of recognizing antigens independently of MHC presentation.

[0069] The term "MHC" (major histocompatibility complex) refers to a subset of genes that encode cell surface antigen-presenting proteins. In humans, these genes are referred to as human leukocyte antigen (HLA) genes. The abbreviations MHC or HLA are used interchangeably herein.

[0070] As used herein, "prostate-specific membrane antigen" or "PSMA," unless otherwise indicated, refers to any native PSMA from any vertebrate source, including mammals such as primates (e.g., humans, non-human primates, and rodents). The term encompasses "full-length," unprocessed PSMA and any form of PSMA that results from processing in cells. The term also encompasses naturally occurring variants of PSMA, such as splice variants, allelic variants, and isoforms. PSMA is a type II membrane protein originally characterized by the murine monoclonal antibody (mAb) 7E11-C5.3. The PSMA protein has a three-part structure: a 19-amino acid internal portion, a 24-amino acid transmembrane portion, and a 707-amino acid external portion (e.g., extracellular domain). An exemplary amino acid sequence of human PSMA is set forth herein in SEQ ID NO: 150. An exemplary amino acid sequence of the extracellular domain of human PSMA is set forth in SEQ ID NO: 151.

[0071] As used herein, "activated" refers to a state of T cells that have been sufficiently stimulated to induce detectable cell proliferation. Activation may also be associated with induced cytokine production and detectable effector function. The term "activated T cells" refers, inter alia, to T cells that are undergoing cell division.

[0072] A "costimulatory domain" in the context of a chimeric receptor, herein referred to as a chimeric antigen receptor (CAR) of the present disclosure, enhances cell proliferation, cell survival, and memory cell development of cytotoxic cells expressing the chimeric receptor. The chimeric receptors of the present invention may include one or more costimulatory domains selected from the costimulatory domains of proteins of the TNFR superfamily, CD28, CD137 (4-1BB), CD134 (OX40), DaplO, CD27, CD2, CD7, CD5, ICAM-1, LFA-1 (CD11a / CD18), Lck, TNFR-I, PD-1, TNFR-II, Fas, CD30, CD40, ICOS LIGHT, NKG2C, B7-H3, or combinations thereof. When a chimeric receptor includes more than one costimulatory domain, these domains may optionally be arranged in tandem, separated by a linker. The costimulatory domain is an intracellular domain that may be located between the CD70 (truncated or full-length) and the intracellular signaling domain of the chimeric receptor.

[0073] As used herein, the term "costimulatory domain" also encompasses any modifications thereof, examples of which are described in U.S. Patent Application No. 20200129554, U.S. Patent Application No. 20200317777, WO2019010383, Li, W., et al., (2020) Immunity, 53:456-470; and Li, G., et al., (2017) J. Immunol. 198(1 Supplement):198.4, the contents of each of which are incorporated herein in their entirety.

[0074] An "intracellular signaling domain," in the context of the chimeric receptors of the present disclosure, transmits an effector function signal and directs the cytotoxic cell to perform its specialized function, i.e., to injure and / or destroy a target cell. Examples of suitable intracellular signaling domains include, for example, the zeta chain of the T cell receptor complex or its homologs, such as the eta chain, FcsRly and β chains, MB1 (Iga) chain, B29 (Ig) chain, etc., human CD3 zeta chain, CD3 polypeptides (Δ, δ, and ε), syk family tyrosine kinases (Syk, ZAP70, etc.), src family tyrosine kinases (Lck, Fyn, Lyn, etc.), and other molecules involved in T cell signaling, such as CD2, CD5, and CD28. In embodiments, the intracellular signaling domain of the chimeric receptor may be human CD3 zeta chain, FcyRIII, FcsRI, the cytoplasmic tail of an Fc receptor, an immunoreceptor tyrosine-based activation motif (ITAM)-containing cytoplasmic receptor, and combinations thereof.

[0075] The intracellular signaling domain may include several types of intracellular signaling domains of various other immune signaling receptors, including, but not limited to, first-, second-, and third-generation T cell signaling proteins, including CD3, B7 family costimulatory factors, and tumor necrosis factor receptor (TNFR) superfamily receptors (Park et al., "Are all chimeric antigen receptors created equal?" J. Clin. Oncol., vol. 33, pp. 651-653, 2015). Additional intracellular signaling domains include signaling domains used by NK cells and NKT cells (Hermanson, et al., "Utilizing chimeric antigen receptors to direct natural killer cell activity," Front Immunol., vol. 6, p. 195, 2015), such as the signaling domain of NKp30 (B7-H6) (Zhang et al., "An NKp30-based chimeric antigen receptor promotes T cell effector functions and antitumor efficacy in vivo," J. Immunol., vol. 189, pp. 2290-2299, 2012), and DAP12 (Topfer et al., "DAP12-based activating chimeric antigen receptor for NK cell tumor immunotherapy," J. Immunol., vol. 194, pp. 3201-3212, 2015), NKG2D, NKp44, NKp46, DAP10, and CD3z.Furthermore, intracellular signaling domains also include signaling domains of human immunoglobulin receptors containing immunoreceptor tyrosine-based activation motifs (ITAMs), such as FcgammaRI, FcgammaRIIA, FcgammaRIIC, FcgammaRIIIA, and FcRL5 (Gillis et al., "Contribution of Human Fc.gamma.Rs to Disease with Evidence from Human Polymorphisms and Transgenic Animal Studies," Front Immunol., vol. 5, p. 254, 2014).

[0076] In embodiments, the intracellular signaling domain comprises the cytoplasmic signaling domain of TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, or CD66d. In exemplary embodiments, the intracellular signaling domain in the chimeric receptor comprises the cytoplasmic signaling domain of human CD3ζ. As used herein, the term "intracellular signaling domain" also encompasses any modifications thereof, examples of which are described in U.S. Patent Application No. 2020 / 0317777, as well as Roda-Navarro, P., and Reyburn, H.T., (2009), J. Biol. Chem. 284(24): 16463-16472; Giuri Satoshi, E., et al., (2007), Mol. Cell. Biol. 27(24): 8583-8599, and Wu, J., et al., (2000), J. Exp. Med. 192(7): 1059-1068, the contents of each of which are incorporated herein in their entirety.

[0077] The term "affinity binding entity" refers to an entity that binds to a specific antigen with higher affinity than to a non-specific antigen, and has a binding affinity of at least 10, as determined by assays well known in the art, including surface plasmon resonance (SPR). -6It refers to a binding moiety having an affinity of M. According to particular embodiments, the affinity is between 500 nM and 0.01 nM, between 100 nM and 0.01 nM, between 50 nM and 0.01 nM, between 10 nM and 0.01 nM, between 5 nM and 0.01 nM.

[0078] According to embodiments, the affinity binding entity is an antibody. The term "antibody" is used in the broadest sense and specifically encompasses, for example, single anti-PSMA monoclonal antibodies (including agonist, antagonist, neutralizing, and full-length or intact monoclonal antibodies), anti-PSMA antibody compositions with polyepitopic specificity, polyclonal antibodies, multivalent antibodies, multispecific antibodies formed from at least two intact antibodies (e.g., bispecific antibodies, so long as they exhibit the desired biological activity), single-chain anti-PSMA antibodies, and fragments of anti-PSMA antibodies, including Fab, Fab', F(ab')2, and Fv fragments (see below), diabodies, and single-domain antibodies (sdAbs), so long as they exhibit the desired biological or immunological activity. Also included among anti-PSMA antibodies, particularly among fragments, are portions of anti-PSMA antibodies (and combinations of anti-PSMA antibody portions, e.g., scFvs), which can be used as targeting arms, e.g., directed against PSMA tumor epitopes, in the chimeric antigen receptors of the present disclosure. Such fragments are not necessarily proteolytic fragments, but rather are portions of a polypeptide sequence that may confer affinity for a target. The term "immunoglobulin" (Ig) is used interchangeably with antibody herein. An antibody may be, for example, a human antibody, a humanized antibody, and / or an affinity matured antibody.

[0079] Methods for producing antibodies and antibody fragments are known in the art (see, e.g., Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1988, incorporated herein by reference).

[0080] Antibodies can be produced by immunizing various animals, including mice, rats, rabbits, goats, primates, humans, and chickens, with target antigens, such as PSMA or peptide fragments of PSMA containing anti-PSMA epitopes of the present disclosure. Antibodies can also be isolated from phage antibody libraries, for example, using the techniques described in Clackson et al., Nature, 352:624-8 (1991) and Marks et al., J. Mol. Biol., 222:581-97 (1991). The antibodies or antigen-binding fragments of the present invention can be purified by methods known in the art, such as gel filtration, ion exchange, affinity chromatography, etc. Polyclonal or monoclonal antibodies can be isolated, for example, from serum, ascites, or hybridoma supernatants using affinity chromatography or any of a number of other techniques known in the art.

[0081] The terms "anti-PSMA antibody," "PSMA antibody," and "antibody that binds to PSMA" are used interchangeably. The anti-PSMA antibody is preferably capable of binding with sufficient affinity such that the antibody, whether isolated or as part of a fusion protein, cell, or cell composition, is useful as a diagnostic and / or therapeutic agent.

[0082] An "isolated antibody" is an antibody that has been identified, separated, and / or recovered from components of its natural environment. Contaminant components of its natural environment are materials that would interfere with therapeutic uses for the antibody, and may include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes.

[0083] The basic four-chain antibody unit is a heterotetrameric glycoprotein composed of two identical light (L) chains and two identical heavy (H) chains. In the case of IgG, the four-chain unit is generally approximately 150,000 daltons. Each L chain is linked to an H chain by one covalent disulfide bond, while the two H chains are linked to each other by one or more disulfide bonds depending on the H chain isotype. Each H and L chain also has regularly spaced interchain disulfide bridges. Each H chain has a variable domain (VH) at its N-terminus, followed by three constant domains (CH) for each of the α and γ chains, and four CH domains for the μ and ε isotypes. Each L chain has a variable domain (VL) at its N-terminus, followed by a constant domain (CL) at its other end. The VL is aligned with the VH, and the CL is aligned with the first constant domain (CH1) of the heavy chain. Particular amino acid residues are believed to form an interface between the light-chain variable domain and the heavy-chain variable domain. The pairing of VH and VL together forms a single antigen-binding site. For the structure and properties of different classes of antibodies, see, for example, page 71 and Chapter 6 of "Basic and Clinical Immunology," 8th edition, Daniel P. Stites, Abba I. Terr and Tristram G. Parslow (eds.), Appleton & Lange, Norwalk, CT, 1994.

[0084] Light chains from any vertebrate species can be assigned to one of two clearly distinct types, called kappa and lambda, based on the amino acid sequence of their constant domains. Depending on the amino acid sequence of the constant domain (CH) of their heavy chains, immunoglobulins can be assigned to different classes or isotypes. There are five classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, with heavy chains designated α, δ, ε, γ, and μ, respectively. The γ and α classes are further divided into subclasses based on relatively minor differences in CH sequence and function; for example, humans express the following subclasses: IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2.

[0085] The "variable region" or "variable domain" of an antibody refers to the amino-terminal domain of the heavy or light chain of the antibody. The variable domain of the heavy chain is designated "VH" or "VH". H The variable domain of the light chain is sometimes referred to as a "VL" or "V L These domains are generally the most variable parts of antibodies and contain the antigen-binding sites.

[0086] The term "variable" refers to the fact that certain segments of variable domains differ significantly in sequence among antibodies. V domains mediate antigen binding and define the specificity of a particular antibody for its particular antigen. However, variability is not evenly distributed across the 110-amino acid span of the variable domains. Instead, V regions consist of relatively invariant stretches of 15-30 amino acids called framework regions (FRs) separated by shorter regions of extreme variability called "hypervariable regions," each approximately 9-12 amino acids long. Native heavy and light chain variable domains each contain four FRs that adopt a primarily β-sheet configuration, connected by three hypervariable regions that form loops connecting, and in some cases forming part of, the β-sheet structure. The hypervariable regions in each chain are held together in close proximity by FRs and, together with the hypervariable regions from the other chain, contribute to the formation of the antigen-binding site of antibodies (see Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD. (1991)).

[0087] An "intact" antibody is one that comprises an antigen-binding site as well as a CL and at least heavy chain constant domains, CH1, CH2, and CH3. The constant domains may be native sequence constant domains (e.g., human native sequence constant domains) or amino acid sequence variants thereof. Preferably, the intact antibody has one or more effector functions.

[0088] An "antibody fragment" comprises a portion of an intact antibody, preferably the antigen-binding region or one or more variable regions of the intact antibody. Examples of antibody fragments include Fab, Fab', F(ab')2, and Fv fragments; diabodies; linear antibodies (see U.S. Pat. No. 5,641,870, Example 2; Zapata et al., Protein Eng. 8(10):1057-62 (1995)); single-chain antibody molecules; and multispecific antibodies formed from antibody fragments. In one embodiment, an antibody fragment comprises the antigen-binding site of an intact antibody and thus retains the ability to bind to an antigen. Anti-PSMA antibody fragments also include portions of anti-PSMA antibodies (and combinations of anti-PSMA antibody portions, e.g., scFvs) that can be used as targeting arms, e.g., directed against the PSMA tumor epitope, in the chimeric antigen receptors of the present disclosure. Such fragments are not necessarily proteolytic fragments, but rather portions of polypeptide sequences that can confer affinity for a target.

[0089] Papain digestion of antibodies produces two identical antigen-binding fragments called "Fab" fragments and a residual "Fc" fragment, a designation reflecting the ability to crystallize readily. The Fab fragment consists of an entire L chain plus the variable region domain (VH) of the H chain and the first constant domain (CH1) of one heavy chain. Each Fab fragment is monovalent with respect to antigen binding; i.e., it has a single antigen-binding site. Pepsin treatment of antibodies produces a single large F(ab')2 fragment, which roughly corresponds to two disulfide-linked Fab fragments with bivalent antigen-binding activity and is still capable of cross-linking antigen. Fab' fragments differ from Fab fragments by having a few additional residues at the carboxy terminus of the CH1 domain, including one or more cysteines from the antibody hinge region. Fab'-SH is the designation used herein for Fab' in which the cysteine ​​residue(s) of the constant domains bear a free thiol group. F(ab')2 antibody fragments originally were produced as pairs of Fab' fragments which have hinge cysteines between them. Other chemical couplings of antibody fragments are also known.

[0090] The Fc fragment contains the carboxy-terminal portions of both H chains held together by disulfides. The effector functions of an antibody are determined by sequences in the Fc region, which is also the region recognized by Fc receptors (FcRs) found on certain types of cells.

[0091] An "Fv" is the minimum antibody fragment containing a complete antigen-recognition and antigen-binding site. This fragment consists of a dimer of one heavy-chain variable region domain and one light-chain variable region domain in tight, non-covalent association. In single-chain Fv (scFv) species, one heavy-chain variable domain and one light-chain variable domain can be covalently linked by a flexible peptide linker so that the light and heavy chains can associate in a "dimeric" structure similar to that in two-chain Fv species. The folding of these two domains generates six hypervariable loops (three loops each from the H and L chains) that provide the amino acid residues for antigen binding and confer antigen-binding specificity to the antibody. However, even a single variable domain (or half of an Fv containing only three antigen-specific CDRs) has the ability to recognize and bind antigen, albeit with lower affinity than the complete binding site.

[0092] A "single-chain Fv," also abbreviated as "sFv" or "scFv," is an antibody fragment comprising VH and VL antibody domains connected into a single polypeptide chain. In embodiments, the sFv polypeptide further comprises a polypeptide linker between the VH and VL domains, which enables the scFv to form the desired structure for antigen binding. For a review of sFvs, see, e.g., Plückthun in The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds., Springer-Verlag, New York, pp. 269-315 (1994); Borrebaeck 1995 (infra). In one embodiment, an scFv derived from an anti-PSMA antibody is used as the targeting arm of a CAR-modified immune cell, as disclosed herein. With respect to scFv antibody fragments, where a particular order of VH and VL regions in a binding domain is explicitly or implicitly described, the present disclosure also includes alternative embodiments in which the order of the VH and VL regions is reversed, for example, in a CAR comprising an scFV or scFv binding domain. Thus, a description of a VH-VL order also describes alternative VL-VH orders, for example, in a CAR comprising an scFV or scFv binding domain. Furthermore, a description of a VL-VH order also describes alternative VH-VL orders, for example, in a CAR comprising an scFV or scFv binding domain. The VH and VL regions are either directly linked or linked by a peptide-encoded linker, which connects the N-terminus of the VH to the C-terminus of the VL, or the C-terminus of the VH to the N-terminus of the VL.

[0093] scFv linkers are typically rich in glycine for flexibility and serine or threonine for solubility. The linker can connect the heavy and light chain variable regions of the extracellular antigen-binding domain. Non-limiting examples of linkers are described in Shen et al., Anal. Chem. 80(6):1910-1917 (2008) and WO2014 / 087010, the contents of which are incorporated herein by reference in their entirety. Various linker sequences are known in the art, including, but not limited to, glycine-serine (GS) linkers, such as (GS), (GSGGS) (SEQ ID NO: 275), (GGGS) (SEQ ID NO: 276), and (GGGGS) (SEQ ID NO: 277), where n represents an integer of at least 1. Exemplary linker sequences can include amino acid sequences including, but not limited to, GGSG (SEQ ID NO: 278), GGSGG (SEQ ID NO: 279), GSGSG (SEQ ID NO: 280), GSGGG (SEQ ID NO: 281), GGGSG (SEQ ID NO: 282), GSSSG (SEQ ID NO: 283), GGGGS (SEQ ID NO: 284), GGGGSGGGGSGGGGS (SEQ ID NO: 154), and the like. One of skill in the art will be able to select an appropriate linker sequence for use in the present invention. In one embodiment, the antigen-binding domain of the present invention comprises a heavy chain variable region (VH) and a light chain variable region (VL), wherein the VH and VL are separated by a linker sequence having the amino acid sequence GGGGSGGGGSGGGGS (SEQ ID NO: 154) and can be encoded by the nucleic acid sequence GGAGGCGGGAGGATCTGGTGGTGGTGGATCTGGCGGCGGAGGCTCT (SEQ ID NO: 155).

[0094] As used herein, the term "monoclonal antibody" refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible minor naturally occurring mutations. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, in contrast to polyclonal antibody preparations, which include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen. In addition to their specificity, monoclonal antibodies are advantageous in that they may be synthesized uncontaminated by other antibodies. The modifier "monoclonal" should not be construed as requiring production of the antibody by any particular method. For example, monoclonal antibodies useful in the present invention may be prepared by the hybridoma method first described by Kohler et al., Nature, 256:495 (1975), or may be made using recombinant DNA methods in bacterial, eukaryotic, or plant cells (e.g., U.S. Pat. No. 4,816,567). The "monoclonal antibodies" may also be isolated from phage antibody libraries using, for example, the techniques described in Clackson et al., Nature, 352:624-8 (1991) and Marks et al., J. Mol. Biol., 222:581-97 (1991).

[0095] As used herein, the terms "hypervariable region," "HVR," or "HV" refer to regions of an antibody variable domain that are highly variable in sequence and / or form structurally defined loops. Antibodies generally contain six hypervariable regions, three in the VH (H1, H2, and H3) and three in the VL (L1, L2, and L3). Several hypervariable region boundary demarcations are in use and are encompassed herein. Kabat complementarity-determining regions (CDRs) are the most commonly used, based on sequence variability (Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD. (1991)). Chothia instead refers to the location of the structural loops (Chothia and Lesk J. Mol. Biol. 196:901-917 (1987)). The terminus of the Chothia CDR-H1 loop, when numbered using the Kabat numbering convention, varies between H32 and H34 depending on the length of the loop (this is because the Kabat numbering scheme places insertions at H35A and H35B; if neither 35A nor 35B are present, the loop ends at 32; if only 35A is present, the loop ends at 33; and if both 35A and 35B are present, the loop ends at 34). The AbM hypervariable regions represent a compromise between the Kabat CDRs and the Chothia structural loops and are used by Oxford Molecular's AbM antibody modeling software. The "contact" hypervariable regions are based on an analysis of available complex crystal structures. Residues from each of these hypervariable regions are listed below. TIFF2025528177000001.tif87170

[0096] The hypervariable regions may also include "extended hypervariable regions" as follows: 24-36 or 24-34 (L1), 46-56 or 50-56 (L2), and 89-97 (L3) in VL, and 26-35B (H1), 50-65, 47-65, or 49-65 (H2), and 93-102, 94-102, or 95-102 (H3) in VH. The variable domain residues are numbered according to Kabat et al. (supra) for each of these definitions.

[0097] "Framework" or "FR" residues are those variable domain residues other than the hypervariable region residues as herein defined.

[0098] The terms "variable domain residue numbering as in Kabat" or "amino acid position numbering as in Kabat," and variations thereof, refer to the numbering system used for the heavy or light chain variable domains of the antibody collection in Kabat et al. (supra). Using this numbering system, the actual linear amino acid sequence may contain fewer or additional amino acids corresponding to a shortening of, or insertion into, a FR or CDR of the variable domain. For example, a heavy chain variable domain may contain a single amino acid insertion after residue 52 of H2 (residue 52a according to Kabat) and inserted residues after heavy chain FR residue 82 (e.g., residues 82a, 82b, and 82c according to Kabat, etc.). The Kabat numbering of residues may be determined for a given antibody by alignment of the antibody's sequence with the "standard" Kabat numbered sequence at the regions of homology.

[0099] The Kabat numbering system is generally used when referring to residues in the variable domain (approximately residues 1-107 of the light chain and residues 1-113 of the heavy chain) (e.g., Kabat et al., supra). The "EU numbering system" or "EU index" is generally used when referring to residues in the immunoglobulin heavy chain constant region (e.g., the EU index reported in Kabat et al., supra). "EU index as in Kabat" refers to the residue numbering of the human IgG1 EU antibody. Unless otherwise specified herein, references to residue numbers in the variable domain of an antibody refer to residue numbering according to the Kabat numbering system.

[0100] A "blocking" or "antagonist" antibody is an antibody that inhibits or reduces the biological activity of the antigen to which it binds. Preferred blocking or antagonist antibodies substantially or completely inhibit the biological activity of the antigen. In one embodiment, an anti-PSMA antibody is provided that is an antagonist antibody.

[0101] An antibody that "binds" to an antigen or epitope of interest is one that binds to the antigen or epitope with sufficient affinity that it differs measurably from nonspecific interactions. Specific binding can be measured, for example, by determining the binding of a molecule compared to the binding of a control molecule (which is generally a molecule of similar structure that has no binding activity).

[0102] As used herein, the term "antigen" or "Ag" is defined as a molecule that elicits an immune response. This immune response may include either antibody production or activation of specific immunocompetent cells, or both. Those skilled in the art will understand that any macromolecule, including a protein or peptide, can function as an antigen.

[0103] The term "epitope" includes any protein, lipid, or carbohydrate determinant capable of specific binding to an immunoglobulin or T-cell receptor. Epitopic determinants usually consist of active surface groupings of molecules such as amino acids, lipid, or sugar side chains and usually have specific three-dimensional structural characteristics, as well as specific charge characteristics. An exemplary epitope of one particular anti-PSMA antigen-binding domain according to the subject invention is shown in Figure 18B.

[0104] As used herein, the term "specifically binds" refers to a receptor (including, but not limited to, an antibody or antibody fragment) that recognizes a specific molecule / ligand but does not substantially recognize or bind other molecules in a sample. For example, a receptor that specifically binds to a molecule of one species may also bind to molecules of one or more other species. However, such cross-species reactivity does not, in itself, alter its classification as specific. In another example, a receptor that specifically binds to a molecule may also bind to different allelic forms of the molecule. However, such cross-reactivity does not, in itself, alter its classification as specific. In some cases, the terms "specific binding" or "specifically binds" can be used in reference to the interaction of a protein (or peptide) with a second chemical species, meaning that the interaction is dependent on the presence of a specific structure (e.g., an antigenic determinant or epitope) on the chemical species; for example, the receptor recognizes and binds to a specific structure rather than a general protein. If a receptor is specific for epitope "A," then in a reaction containing labeled "A" and the receptor, the presence of a molecule containing epitope A (or no molecule, unlabeled A) will reduce the amount of labeled A that binds to the receptor.

[0105] In embodiments, specific binding is at least about 1 x 10 -8 The binding can be characterized by an equilibrium dissociation constant equal to or less than M (e.g., a smaller K indicates stronger binding). Methods for determining whether two molecules specifically bind are well known in the art and include, for example, equilibrium dialysis, surface plasmon resonance, and the like.

[0106] As used herein, the term "anti-tumor effect" refers to a biological effect that may be manifested by a reduction in tumor volume, a reduction in tumor cell number, a reduction in the number of metastases, an increase in life expectancy, or an improvement in various physiological symptoms associated with a cancerous condition. An "anti-tumor effect" may also be manifested by the ability of the peptides, polynucleotides, cells, and antibodies of the present invention to prevent the development of tumors in the first place.

[0107] The terms "cancer" and "cancerous" refer to or describe the physiological condition in mammals that is typically characterized by uncontrolled cell growth. Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma (including liposarcoma), neuroendocrine tumors, mesothelioma, schwannoma, meningioma, adenocarcinoma, melanoma, and leukemia or lymphoid malignancies. Cancer can include, but is not limited to, prostate cancer, lung cancer, liver cancer, pancreatic cancer, colon cancer, gastric cancer, breast cancer, ovarian cancer, kidney cancer, prostate cancer, bladder cancer, melanoma, and glioma.

[0108] As used herein, the term "autologous" refers to a material that originates from an individual and is later reintroduced into the same individual.

[0109] As used herein, the term "allogeneic" refers to a material derived from one animal that is subsequently introduced into a different animal of the same species.

[0110] As used herein, a "modification" of an amino acid residue / position refers to a change in the primary amino acid sequence compared to the starting amino acid sequence, where the modification results from a change in the sequence containing the amino acid residue / position. For example, typical modifications include substitution of the residue (or at the position) with another amino acid (e.g., conservative or non-conservative substitution), insertion of one or more (usually less than five or three) amino acids adjacent to the residue / position, and deletion of the residue / position. An "amino acid substitution" or variant thereof refers to the replacement of an existing amino acid residue in a predetermined (starting) amino acid sequence with a different amino acid residue. Generally, the modification results in a change in at least one physico-biochemical activity of the variant polypeptide compared to the polypeptide containing the starting (or "wild-type") amino acid sequence. For example, in the case of an antibody, the altered physico-biochemical activity can be binding affinity, binding ability, and / or binding effect for a target molecule.

[0111] As used herein, the term "treating or preventing" a disease means reducing the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject. In one example, a therapy (e.g., administration of a therapeutic agent of the present disclosure) treats a disease or condition by reducing one or more signs or symptoms associated with the disease or condition, for example, compared to the response in the absence of the therapy. For example, administration of a therapeutic agent may provide an anti-tumor effect that reduces one or more signs or symptoms associated with cancer. Treating or preventing can refer to delaying the onset of symptoms, reducing the severity of symptoms, reducing the severity of acute episodes, reducing the number of symptoms, reducing the incidence of disease-related symptoms, reducing the latency of symptoms, ameliorating symptoms, alleviating secondary symptoms, reducing secondary infections, extending patient survival, preventing relapse to disease, reducing the number or frequency of recurrent episodes, extending the latency period between symptomatic episodes, increasing the time to sustained progression, hastening remission, inducing remission, enhancing remission, hastening recovery, or increasing the effectiveness of or reducing resistance to alternative therapies. In one embodiment, "treating" refers to both therapeutic and prophylactic or preventative treatment, the purpose of which is to prevent or alleviate the targeted condition or disorder described herein.

[0112] As used herein, the term "administering" means providing or giving to a subject, by any effective route, one or more agents, such as agents to treat one or more signs or symptoms associated with a condition / disorder or disease, including, but not limited to, cancer (e.g., lymphoma), viral infection, bacterial infection, etc. Exemplary routes of administration include, but are not limited to, injection (e.g., subcutaneous, intramuscular, intradermal, intraperitoneal, and intravenous), oral, sublingual, rectal, transdermal, intranasal, vaginal, and inhalation routes. Administration "in combination with" one or more additional therapeutic agents includes simultaneous (concurrent) administration and sequential administration in any order.

[0113] As used herein, the term "pharmaceutically acceptable" refers to a substance, including, but not limited to, salts, carriers, or diluents, that does not abrogate the biological activity or properties of a compound and is relatively non-toxic; i.e., the substance may be administered to an individual without causing undesired biological effects or interacting in a deleterious manner with any of the components of the composition in which it is contained. Pharmaceutically acceptable carriers (vehicles) useful in the present disclosure are conventional. Remington's Pharmaceutical Sciences by E.W. Martin, Mack Publishing Co., Easton, Pa., 19th Edition (1995) describes compositions and formulations suitable for the drug delivery of one or more pharmaceutical agents, e.g., one or more modulatory agents. In general, the nature of the carrier will depend on the particular mode of administration being used. For example, parenteral formulations may comprise injectable solutions containing pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solution, aqueous dextrose, glycerol, or the like as a vehicle. In addition to biologically neutral carriers, the administered pharmaceutical agent may contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents, e.g., sodium acetate or sorbitan monolaurate, sodium lactate, potassium chloride, calcium chloride, and triethanolamine oleate. For example, the present invention provides pharmaceutical compositions comprising a pharmaceutically acceptable excipient and, e.g., γδ T cells, preferably γδ T cells engineered to express a CAR directed against PSMA, as described herein.

[0114] "Encoding" refers to the inherent property of a particular sequence of nucleotides in a polynucleotide, such as a gene, cDNA, or mRNA, to serve as a template for the synthesis of other polymers and macromolecules in biological processes, either having a defined sequence of nucleotides (i.e., rRNA, tRNA, and mRNA) or a defined sequence of amino acids, and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of the mRNA corresponding to the gene produces the protein in a cell or other biological system. Both the coding strand, whose nucleotide sequence is identical to that of the mRNA and usually provided in a sequence listing, and the non-coding strand, which is used as a template for transcription of a gene or cdnA, can be said to encode the protein or other product of that gene or cdnA.

[0115] "Isolated" means changed or removed from its natural state. For example, a nucleic acid or peptide naturally present in a living animal is not "isolated," but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is. An isolated nucleic acid or protein can exist in a substantially purified form, or it can exist in a non-native environment, such as, for example, a host cell.

[0116] Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA may contain introns.

[0117] The terms "patient," "subject," "individual," and the like are used interchangeably herein and refer to any animal amenable to the methods described herein. In certain non-limiting embodiments, the patient, subject, or individual is a human.

[0118] An "expression cassette" refers to a nucleic acid comprising expression control sequences operably linked to a nucleic acid encoding a transcript or polypeptide to be expressed. An expression cassette contains sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system. An expression cassette can be a component of a vector such as a cosmid, a plasmid (e.g., naked in a liposome or contained in a liposome), or a virus (e.g., a lentivirus, retrovirus, adenovirus, and adeno-associated virus). An expression cassette can be present in a host cell, such as a γδ T cell.

[0119] II. Compositions and Methods of the Invention A. Anti-PSMA antibody In one embodiment, the present invention provides anti-PSMA antibodies that may be used herein as therapeutic agents. Exemplary antibodies include polyclonal, monoclonal, chimeric, humanized, and human antibodies.

[0120] 1. Polyclonal antibodies Polyclonal antibodies can be raised in animals by multiple subcutaneous (sc) or intraperitoneal (ip) injections of the relevant antigen and adjuvant. It may be useful to conjugate the relevant antigen to a protein that is immunogenic in the species being immunized (especially when synthetic peptides are used). For example, antigens can be conjugated to keyhole limpet hemocyanin (KLH), serum albumin, bovine thyroglobulin, or soybean trypsin inhibitor using bifunctional or derivatizing agents such as maleimidobenzoyl sulfosuccinimide ester (conjugation via cysteine ​​residues), N-hydroxysuccinimide (via lysine residues), glutaraldehyde, succinic anhydride, SOCl, or R'N=C=NR (where R and R are different alkyl groups).

[0121] Animals are immunized against the antigen, immunogenic conjugate, or derivative by combining, for example, 100 μg or 5 μg of protein or conjugate (for rabbits or mice, respectively) with 3 volumes of Freund's complete adjuvant and injecting the solution intradermally at multiple sites. One month later, the animals are boosted with 1 / 5 to 1 / 10 of the original amount of peptide or conjugate in Freund's complete adjuvant by subcutaneous injection at multiple sites. Seven to 14 days later, the animals are bled and the serum is assayed for antibody titer. Animals are boosted until the titer reaches a plateau. Conjugates can also be produced in recombinant cell culture as protein fusions. Aggregating agents such as alum are also preferably used to enhance the immune response.

[0122] 2. Monoclonal antibodies Monoclonal antibodies (mAbs) to an antigen of interest can be prepared using any technique known in the art, including, but not limited to, the hybridoma technique originally described by Kohler and Milstein (1975, Nature 256, 495-497), the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV-hybridoma technique (Cole et al., 1985, Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). Selected Lymphocyte Antibody Method (SLAM) (Babcook, JS, et al., A novel strategy for generating monoclonal antibodies from single, isolated lymphocytes producing antibodies of defined specificities. Proc Natl Acad Sci USA, 1996. 93(15):7843-8.) and (McLean G et al., 2005, J Immunol. 174(8):4768-78). Such antibodies can be of any immunoglobulin class, including IgG, IgM, IgE, IgA, and IgD, and any subclass thereof. Hybridomas for producing mAbs useful in the present invention can be cultivated in vitro or in vivo.

[0123] Monoclonal antibodies may be made using the hybridoma method first described by Kohler et al., Nature, 256:495 (1975), or may be made by recombinant DNA methods (U.S. Pat. No. 4,816,567).

[0124] In the hybridoma method, a mouse or other suitable host animal, such as a hamster, is immunized as described above to elicit lymphocytes that produce, or are capable of producing, antibodies that specifically bind to the protein used for immunization. Alternatively, lymphocytes can be immunized in vitro. After immunization, lymphocytes are isolated and then fused with a myeloma cell line using a suitable fusing agent, such as polyethylene glycol, to form hybridoma cells (Goding, Monoclonal Antibodies: Principles and Practice, pp. 59-103 (Academic Press, 1986)).

[0125] The hybridoma cells thus prepared are seeded and grown in a suitable medium which may contain one or more substances that inhibit the growth or survival of the unfused, parental myeloma cells (also referred to as the fusion partner). For example, if the parental myeloma cells lack the enzyme hypoxanthine guanine phosphoribosyltransferase (HGPRT or HPRT), the selective medium for hybridomas will typically contain hypoxanthine, aminopterin, and thymidine (HAT medium), which inhibit the growth of HGPRT-deficient cells.

[0126] Preferred fusion partner myeloma cells are those that fuse efficiently, support stable high-level production of antibody by the selected antibody-producing cells, and are sensitive to selective media that select against unfused parental cells. Preferred myeloma cell lines are mouse myeloma lines, such as those derived from the MOPC-21 and MPC-11 mouse tumors available from the Salk Institute Cell Distribution Center, San Diego, Calif., USA, and SP-2 and derivatives, such as X63-Ag8-653 cells, available from the American Type Culture Collection, Manassas, Va., USA. Human myeloma and mouse-human heteromyeloma cell lines have also been described for the production of human monoclonal antibodies (Kozbor, J. Immunol., 133:3001 (1984), and Brodeur et al., Monoclonal Antibody Production Techniques and Applications, pp. 51-63 (Marcel Dekker, Inc., New York, 1987)).

[0127] The culture medium in which the hybridoma cells are growing is assayed for production of monoclonal antibodies directed against the antigen. Preferably, the binding specificity of the monoclonal antibodies produced by the hybridoma cells is determined by immunoprecipitation or by an in vitro binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunosorbent assay (ELISA).

[0128] The binding affinity of the monoclonal antibody can, for example, be determined by the Scatchard analysis described in Munson et al., Anal. Biochem. 107:220 (1980).

[0129] Once hybridoma cells producing antibodies of the desired specificity, affinity, and / or activity are identified, the clones may be subcloned by limiting dilution procedures and grown by standard methods (Goding, Monoclonal Antibodies: Principles and Practice, pp. 59-103 (Academic Press, 1986)). Suitable media for this purpose include, for example, D-MEM or RPMI-1640 medium. In addition, hybridoma cells may be grown in vivo as ascites tumors in animals, for example, by intraperitoneal injection of the cells into mice.

[0130] The monoclonal antibodies secreted by the subclones are suitably separated from the culture medium, ascites fluid, or serum by conventional antibody purification procedures such as, for example, affinity chromatography (e.g., using Protein A or Protein G-Sepharose) or ion exchange chromatography, hydroxylapatite chromatography, gel electrophoresis, or dialysis.

[0131] DNA encoding monoclonal antibodies is readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes capable of binding specifically to genes encoding the heavy and light chains of murine antibodies). Hybridoma cells serve as a preferred source of such DNA. Once isolated, the DNA may be placed into an expression vector, which is then transfected into host cells that do not otherwise produce antibody protein, such as E. coli cells, simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells, to obtain the synthesis of monoclonal antibodies in the recombinant host cells. Review articles on recombinant expression of antibody-encoding DNA in bacteria include Skerra et al., Curr. Opinion in Immunol. 5:256-62 (1993) and Pluckthun, Immunol. Rev. 130:151-88 (1992).

[0132] In a further embodiment, monoclonal antibodies or antibody fragments can be isolated from antibody phage libraries generated using the techniques described in McCafferty et al., Nature, 348:552-54 (1990). Clackson et al., Nature, 352:624-28 (1991) and Marks et al., J. Mol. Biol., 222:581-97 (1991) describe the isolation of murine and human antibodies, respectively, using phage libraries. Subsequent publications describe the production of high-affinity (nM range) human antibodies by chain shuffling (Marks et al., Bio / Technology, 10:779-783 (1992)), and combinatorial infection and in vivo recombination as strategies for constructing very large phage libraries (Waterhouse et al., Nuc. Acids. Res. 21:2265-6 (1993)). Therefore, these techniques are viable alternatives to traditional monoclonal antibody hybridoma techniques for isolating monoclonal antibodies.

[0133] DNA encoding an antibody may be modified to produce chimeric or fusion antibody polypeptides, for example, by substituting human heavy and light chain constant domains (CH and CO sequences) for the homologous murine sequences (U.S. Pat. No. 4,816,567, and Morrison, et al., Proc. Natl. Acad. Sci. USA, 81:6851 (1984)), or by fusing immunoglobulin coding sequences with all or part of the coding sequence of a non-immunoglobulin polypeptide (heterologous polypeptide). Non-immunoglobulin polypeptide sequences can be substituted for the constant domains of an antibody, or they can be substituted for the variable domains of one antigen-binding site of an antibody, creating a chimeric, bivalent antibody with one antigen-binding site with specificity for one antigen and another antigen-binding site with specificity for a different antigen.

[0134] 3. Chimeric, Humanized, and Human Antibodies In an embodiment, the anti-PSMA antibody is a chimeric antibody. Certain chimeric antibodies are described, for example, in U.S. Patent No. 4,816,567 and Morrison et al., Proc. Natl. Acad. Sci. USA, 81:6851-5 (1984). In one example, a chimeric antibody contains a non-human variable region (e.g., a variable region derived from a mouse, rat, hamster, rabbit, or non-human primate such as a monkey) and a human constant region. In a further example, a chimeric antibody is a "class-switched" antibody, in which the class or subclass is changed from that of the parent antibody. Chimeric antibodies include antigen-binding fragments thereof.

[0135] In embodiments, a chimeric antibody is a humanized antibody. Typically, a non-human antibody is humanized to reduce immunogenicity to humans while retaining the specificity and affinity of the non-human parent antibody. Generally, a humanized antibody comprises one or more variable domains in which the HVRs, e.g., CDRs (or portions thereof), are derived from a non-human antibody and the FRs (or portions thereof) are derived from human antibody sequences. A humanized antibody also optionally comprises at least a portion of a human constant region. In embodiments, some FR residues in a humanized antibody are substituted with corresponding residues from a non-human antibody (e.g., the antibody from which the CDR residues are derived), e.g., to restore or improve antibody specificity or affinity.

[0136] The anti-PSMA antibodies of the present invention may include humanized or human antibodies. Humanized forms of non-human (e.g., mouse or rabbit) antibodies are chimeric immunoglobulins, immunoglobulin chains, or fragments thereof (such as Fv, Fab, Fab', F(ab')2, or other antigen-binding sequences of antibodies) that contain minimal sequence derived from the non-human immunoglobulin. Humanized antibodies include human immunoglobulins (recipient antibodies) in which residues from a complementarity-determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat, or rabbit having the desired specificity, affinity, and capacity. In some cases, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies may also comprise residues found neither in the recipient antibody nor in the imported CDR or framework sequences. Generally, a humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence. The humanized antibody optionally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin (Jones et al., Nature, 321:522-5 (1986); Riechmann et al., Nature, 332:323-9 (1988); and Presta, Curr. Op. Struct. Biol., 2:593-6 (1992)).

[0137] A humanized antibody of the invention may comprise one or more human and / or human consensus non-hypervariable region (e.g., framework) sequences in its heavy and / or light chain variable domains. In embodiments, one or more additional modifications are present within the human and / or human consensus non-hypervariable region sequences. In one embodiment, the heavy chain variable domain of an antibody of the invention comprises a human consensus framework sequence, which in one embodiment is a subgroup III consensus framework sequence. In one embodiment, an antibody of the invention comprises a variant subgroup III consensus framework sequence modified at at least one amino acid position.

[0138] As is known in the art, the amino acid positions / boundaries defining an antibody hypervariable region can vary depending on the context and the various definitions known in the art. Some positions within a variable domain can be considered hybrid hypervariable positions, in that these positions can be considered within a hypervariable region under one set of criteria, while being considered outside of a hypervariable region under a different set of criteria. One or more of these positions can also be found in an extended hypervariable region (defined further below). The present invention provides antibodies containing modifications at these hybrid hypervariable positions. In one embodiment, these hypervariable positions include one or more of positions 26-30, 33-35B, 47-49, 57-65, 93, 94, and 101-102 in the heavy chain variable domain. In one embodiment, these hybrid hypervariable positions include one or more of positions 24-29, 35-36, 46-49, 56, and 97 in the light chain variable domain. In one embodiment, an antibody of the invention comprises a human variant human subgroup consensus framework sequence altered at one or more hybrid hypervariable positions.

[0139] The antibodies of the invention can comprise any suitable human or human consensus light chain framework sequence, so long as the antibody exhibits the desired biological properties (e.g., desired binding affinity). In one embodiment, the antibodies of the invention comprise at least a portion (or all) of the framework sequence of a human κ light chain. In one embodiment, the antibodies of the invention comprise at least a portion (or all) of the human κ subgroup I framework consensus sequence.

[0140] Methods for humanizing non-human antibodies are well known in the art. As mentioned above, a humanized antibody generally has one or more amino acid residues introduced into it from a non-human source. These non-human amino acid residues are often referred to as "import" residues, and these residues typically come from an "import" variable domain. Humanization is essentially performed according to the method of Winter and coworkers (Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-327 (1988); Verhoeyen et al., Science, 239:1534-1536 (1988)), by substituting rodent CDRs for the corresponding sequences of a human antibody in place of the CDR sequences. Accordingly, such "humanized" antibodies are essentially chimeric antibodies (U.S. Patent No. 4,816,567) in which less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.

[0141] If an antibody is intended for human therapeutic use, the selection of human variable domains, both light and heavy, used in making the humanized antibody is very important to reduce antigenicity and the HAMA response (human anti-mouse antibody). Reduction or elimination of the HAMA response is an important aspect of the clinical development of suitable therapeutic agents (see, e.g., Khaxzaeli et al., J. Natl. Cancer Inst. (1988), 80:937; Jaffers et al., Transplantation (1986), 41:572; Shawler et al., J. Immunol. (1985), 135:1530; Sears et al., J. Biol. Response Mod. (1984), 3:138; Miller et al., Blood (1983), 62:988; Hakimi et al., J. Immunol. (1991), 147:1352; Reichmann et al., Nature (1988), 332:323; Junghans et al., Cancer Res. (1990), 50:1495). As described herein, the present invention provides antibodies that have been humanized to reduce or eliminate HAMA responses. Further variants of these antibodies can be obtained using conventional methods known in the art, some of which are further described below. According to the so-called "best-fit" method, the sequence of the variable domain of a rodent antibody is screened against the entire library of known human variable domain sequences. The human V-domain sequence that is closest to the rodent V-domain sequence is identified, and the human framework regions (FRs) therein are accepted for the humanized antibody (Sims et al., J. Immunol. 151:2296 (1993); Chothia et al., J. Mol. Biol., 196:901 (1987)). Another method uses specific framework regions derived from the consensus sequence of all human antibodies of a particular light or heavy chain subgroup.The same framework can be used for several different humanized antibodies (Carter et al., Proc. Natl. Acad. Sci. USA, 89:4285 (1992); Presta et al., J. Immunol. 151:2623 (1993)).

[0142] For example, an amino acid sequence from an antibody as described herein can serve as the starting (parent) sequence for diversifying the framework and / or hypervariable sequence(s). The selected framework sequence to which the starting hypervariable sequence is linked is referred to herein as the acceptor human framework. The acceptor human framework may be from or derived from a human immunoglobulin (its VL and / or VH regions), but preferably the acceptor human framework is from or derived from a human consensus framework sequence, as such frameworks have been demonstrated to have minimal or no immunogenicity in human patients.

[0143] If the acceptor is derived from a human immunoglobulin, optionally, the human framework sequence may be selected based on its homology with the donor framework sequence by aligning the donor framework sequence with various human framework sequences in a population of human framework sequences and selecting the framework sequence that is most homologous to the acceptor.

[0144] In one embodiment, the human consensus framework herein is from or derived from a VH subgroup III and / or VL kappa subgroup I consensus framework sequence.

[0145] Although the acceptor may be identical in sequence to the selected human framework sequence, whether derived from a human immunoglobulin or a human consensus framework, the present invention contemplates that the acceptor sequence may contain pre-existing amino acid substitutions relative to the human immunoglobulin sequence or human consensus framework sequence. These pre-existing substitutions are preferably minimal, typically no more than four, three, two, or one amino acid difference relative to the human immunoglobulin sequence or consensus framework sequence.

[0146] Hypervariable region residues of a non-human antibody are incorporated into the VL and / or VH acceptor human framework. For example, residues corresponding to Kabat CDR residues, Chothia hypervariable loop residues, Abm residues, and / or contact residues may be introduced. Optionally, extended hypervariable region residues such as 24-34 (L1), 50-56 (L2), and 89-97 (L3), 26-35B (H1), 50-65, 47-65, or 49-65 (H2), and 93-102, 94-102, or 95-102 (H3) are incorporated.

[0147] While the "incorporation" of hypervariable region residues is discussed herein, it will be understood that this can be achieved in a variety of ways. For example, a nucleic acid encoding a desired amino acid sequence can be generated by mutating a nucleic acid encoding a murine variable domain sequence so that its framework residues are changed to acceptor human framework residues, or by mutating a nucleic acid encoding a human variable domain sequence so that hypervariable domain residues are changed to non-human residues, or by synthesizing a nucleic acid encoding the desired sequence, etc.

[0148] Hypervariable region-grafted variants may be generated by Kunkel mutagenesis of nucleic acids encoding human acceptor sequences, using separate oligonucleotides for each hypervariable region, as described herein (Kunkel et al., Methods Enzymol. 154:367-382 (1987)). Appropriate changes can be introduced into the framework and / or hypervariable regions using conventional techniques to modify and re-establish proper hypervariable region-antigen interactions.

[0149] Phage(mid) display (also referred to herein as phage display in some contexts) can be used as a convenient and rapid method for generating and screening many different potential antibody variants in libraries generated by sequence randomization, although other methods for generating and screening altered antibodies are available to those skilled in the art.

[0150] Phage(mid) display technology has provided a powerful tool for generating and selecting novel proteins that bind to ligands such as antigens. Phage(mid) display techniques allow the generation of large libraries of protein variants that can be rapidly screened for sequences that bind to target molecules with high affinity. Nucleic acids encoding mutant polypeptides are typically fused to nucleic acid sequences encoding viral coat proteins, such as gene III or gene VIII proteins. Monovalent phagemid display systems have been developed in which nucleic acid sequences encoding proteins or polypeptides are fused to nucleic acid sequences encoding portions of the gene III protein (Bass, S., Proteins, 8:309 (1990); Lowman and Wells, Methods: A Companion to Methods in Enzymology, 3:205 (1991)). In monovalent phagemid display systems, gene fusions are expressed at low levels, and wild-type gene III protein is also expressed to maintain particle infectivity. Methods for generating peptide libraries and screening those libraries are disclosed in many patents (e.g., U.S. Patent No. 5,723,286, U.S. Patent No. 5,432,018, U.S. Patent No. 5,580,717, U.S. Patent No. 5,427,908, and U.S. Patent No. 5,498,530).

[0151] Libraries of antibodies or antigen-binding polypeptides have been prepared in several ways, including by altering a single gene, inserting random DNA sequences, or cloning a family of related genes. Methods for displaying antibodies or antigen-binding fragments using phage(mid) display are described in U.S. Patent Nos. 5,750,373, 5,733,743, 5,837,242, 5,969,108, 6,172,197, 5,580,717, and 5,658,727. The libraries are then screened for the expression of antibodies or antigen-binding proteins with the desired properties.

[0152] Methods for substituting selected amino acids into template nucleic acids are well established in the art, and some of these are described herein. For example, methods for introducing modifications into nucleic acid sequences can include the use of various commercially available kits (e.g., QuickChange Site Directed Mutagenesis Kit, Agilent, Santa Clara, CA). As another example, hypervariable region residues can be substituted using the Kunkel method (e.g., Kunkel et al., Methods Enzymol. 154:367-382 (1987)).

[0153] It is important that antibodies be humanized with retention of high binding affinity for the antigen and other favorable biological properties. To achieve this goal, according to a preferred method, humanized antibodies are prepared by a process of analysis of the parental sequences and various conceptual humanized products using three-dimensional models of the parental and humanized sequences. Three-dimensional immunoglobulin models are commonly available and are familiar to those skilled in the art. Computer programs are available that illustrate and display probable three-dimensional conformations of selected candidate immunoglobulin sequences. Inspection of these displays permits analysis of the likely role of the residues in the functioning of the candidate immunoglobulin sequence, i.e., analysis of residues that influence the ability of the candidate immunoglobulin to bind to its antigen. In this way, FR residues can be selected and combined from the recipient and import sequences so that the desired antibody characteristic, such as increased affinity for the target antigen(s), is achieved. In general, hypervariable region residues are directly and most substantially involved in influencing antigen binding.

[0154] Various forms of humanized anti-PSMA antibodies are contemplated. For example, the humanized antibody may be an antibody fragment, such as a Fab. Alternatively, the humanized antibody may be an intact antibody, such as an intact IgG1 antibody.

[0155] As an alternative to humanization, human antibodies can be generated. For example, it is now possible to produce transgenic animals (e.g., mice) that are capable, upon immunization, of producing a full repertoire of human antibodies in the absence of endogenous immunoglobulin production. For example, the homozygous deletion of the antibody heavy-chain joining region (JH) gene in chimeric and germ-line mutant mice has been described, resulting in complete inhibition of endogenous antibody production. Transfer of the human germ-line immunoglobulin gene array into such germ-line mutant mice results in the production of human antibodies upon antigenic stimulation (see, e.g., Jakobovits et al., Proc. Natl. Acad. Sci. USA, 90:2551 (1993); Jakobovits et al., Nature, 362:255-8 (1993); Bruggemann et al., Year in Immuno. 7:33 (1993); U.S. Patent Nos. 5,545,806, 5,569,825, 5,591,669, 5,545,807, and WO 97 / 17852).

[0156] Alternatively, phage display technology (McCafferty et al., Nature 348:552-53 (1990)) can be used to produce human antibodies and antibody fragments in vitro from immunoglobulin variable (V) domain gene repertoires from unimmunized donors. According to this technique, antibody V domain genes are cloned in frame into either the major or minor coat protein gene of a filamentous bacteriophage, such as M13 or fd, and displayed as functional antibody fragments on the surface of the phage particle. Because the filamentous particle contains a single-stranded DNA copy of the phage genome, selections based on the functional properties of the antibody also result in selection of the gene encoding the antibody exhibiting those properties. Thus, the phage mimics some of the properties of B cells. Phage display can be performed in a variety of formats, as reviewed, for example, in Johnson, Kevin S., and Chiswell, David J., Current Opinion in Structural Biology 3:564-571 (1993). Several sources of V-gene segments can be used for phage display. Clackson et al., Nature, 352:624-628 (1991) isolated a wide variety of anti-oxazolone antibodies from a small random combinatorial library of V genes derived from the pancreases of immunized mice. Essentially following the techniques described by Marks et al., J. Mol. Biol. 222:581-97 (1991) or Griffith et al., EMBO J. 12:725-34 (1993) (see also U.S. Pat. Nos. 5,565,332 and 5,573,905), a repertoire of V genes from unimmunized human donors can be constructed, and antibodies against a wide variety of antigens (including self-antigens) can be isolated.

[0157] Human antibodies may also be generated by in vitro activated B cells (see, eg, US Pat. Nos. 5,567,610 and 5,229,275).

[0158] Thus, in embodiments, human monoclonal antibodies directed against PSMA can be generated using transgenic or transchromosomic mice carrying parts of the human immune system rather than the mouse system.

[0159] HuMAb Mice™ (Medarex, Inc.) contain human immunoglobulin gene minilocuses encoding unrearranged human heavy (μ and γ) and κ light chain immunoglobulin sequences, along with targeted mutations that inactivate the endogenous μ and κ chain loci (see, e.g., Lonberg, et al. (1994) Nature 368(6474):856-9). Thus, the mice exhibit reduced mouse IgM or κ expression, and in response to immunization, the introduced human heavy and light chain transgenes undergo class switching and somatic mutation to generate high-affinity human IgGκ monoclonal antibodies (Lonberg, N. et al. (1994) supra; reviewed in Lonberg, N. (1994) Handbook of Experimental Pharmacology 113:49-101; Lonberg, N. and Huszar, D. (1995) Intern. Rev. Immunol. 13:65-93; and Harding, F. and Lonberg, N. (1995) Ann. NY Acad. Sci. 764:536-46). The preparation and use of HuMAb Mice™, and the genomic modifications carried by such mice, are described in Taylor, L. et al. (1992) Nucleic Acids Research 20:6287-6295, Chen, J. et al. (1993) International Immunology 5:647-656, Tuaillon et al. (1993) Proc. Natl. Acad. Sci. USA 90:3720-4, Choi et al. (1993) Nature Genetics 4:117-23, Chen, J. et al. al. (1993) EMBO J.12:21-830; Tuaillon et al., (1994) J. Immunol.152:2912-20, Taylor, L. et al. (1994) International Immunology 6:579-91, and Fishwild, D. et al. (1996) Nature Biotechnology 14:845-51, the entire contents of which are expressly incorporated herein by reference in their entirety.Further, U.S. Patent Nos. 5,545,806, 5,569,825, 5,625,126, 5,633,425, 5,789,650, 5,877,397, 5,661,016, 5,814,318, 5,874,299, and 5,770,429 No. 5,545,807, PCT Publication Nos. WO 92 / 03918, WO 93 / 12227, WO 94 / 25585, WO 97 / 13852, WO 98 / 24884, and WO 99 / 45962, and PCT Publication No. WO 01 / 14424.

[0160] In another embodiment, the human antibodies of the disclosure can be produced using mice termed "KM mice™" that carry human immunoglobulin sequences on transgenes and transchromosomes, as described in detail in PCT Publication No. WO 02 / 43478.

[0161] In another embodiment, an alternative transgenic system called Xenomouse (Abgenix, Inc.) can be used; such mice are described, for example, in U.S. Pat. Nos. 5,939,598, 6,075,181, 6,114,598, 6,150,584, and 6,162,963.

[0162] Additional transchromosomic animal systems expressing human immunoglobulin genes are available in the art and can be used to produce the anti-PSMA antibodies of the present disclosure. For example, mice carrying both a human heavy chain transchromosome and a human light chain transchromosome, referred to as "TC mice," can be used; such mice are described in Tomizuka et al. (2000) Proc. Natl. Acad. Sci. USA 97:722-7. As another example, cattle carrying human heavy and light chain transchromosomes have been described in the art (e.g., Kuroiwa et al. (2002) Nature Biotechnology 20:889-94 and PCT Application WO2002 / 092812) and can be used to produce the anti-PSMA antibodies of the present disclosure. Additional examples of transgenic animals that can be used to produce anti-PSMA antibodies include OmniRat™ and OmniMouse™ (see, e.g., Osborn M., et al. (2013) Journal of Immunology 190:1481-90; Ma B., et al. (2013) Journal of Immunological Methods 400-401:78-86; Geurts A., et al. (2009) Science 325:433; U.S. Patent No. 8,907,157; ​​European Patent No. 2152880B1; European Patent No. 2336329B1). Yet another example includes the use of VELOCIMMUNE® technology (see, e.g., U.S. Patent No. 6,596,541; Regeneron Pharmaceuticals; VELOCIMMUNE®). Briefly, VELOCIMMUNE® technology involves the generation of transgenic mice whose genomes comprise human heavy and light chain variable regions operably linked to endogenous mouse constant region loci, such that the mice produce antigen-binding proteins, e.g., antibodies, comprising human variable regions and mouse constant regions in response to antigenic challenge. DNA encoding the antibody heavy and light chain variable regions is isolated and operably linked to DNA encoding the human heavy and light chain constant regions.This DNA is then expressed in cells capable of expressing fully human antibodies.

[0163] 4. Antibody fragment Embodiments of the present disclosure include antibody fragments.

[0164] Various techniques have been developed for the production of antibody fragments. Traditionally, these fragments were obtained via proteolytic digestion of intact antibodies (see, e.g., Morimoto et al., Journal of Biochemical and Biophysical Methods 24:107-7 (1992) and Brennan et al., Science, 229:81 (1985)). However, these fragments can now be produced directly by recombinant host cells. Fab, Fv, and scFv antibody fragments can all be expressed in and secreted from E. coli, allowing for the facile production of large amounts of these fragments. Antibody fragments can be isolated from the antibody phage libraries described above. Alternatively, Fab'-SH fragments can be directly recovered from E. coli and chemically coupled to form F(ab')2 fragments (Carter et al., Bio / Technology 10:163-7 (1992)). According to another approach, F(ab')2 fragments can be isolated directly from recombinant host cell culture. Fab and F(ab')2 fragments with increased in vivo half-lives containing salvage receptor-binding epitope residues are described in U.S. Patent No. 5,869,046. Other techniques for producing antibody fragments will be apparent to those skilled in the art. In other embodiments, the antibody of choice is a single-chain Fv fragment (scFv) (see WO 93 / 16185, U.S. Patent No. 5,571,894, and U.S. Patent No. 5,587,458). Fv and sFv are the only species with intact binding sites that are devoid of constant regions and are therefore suitable for reduced nonspecific binding during in vivo use. sFv fusion proteins can be constructed to generate fusion of effector proteins at either the amino or carboxy terminus of the sFv (see Antibody Engineering, ed. Borrebaeck, supra). An antibody fragment may also be a "linear antibody," eg, as described in US Pat. No. 5,641,870.

[0165] In one embodiment, an scFv derived from an anti-PSMA antibody is used in the CAR of the present disclosure. Anti-PSMA antibody fragments include portions of anti-PSMA antibodies (and combinations of anti-PSMA antibody portions, e.g., scFvs) that can be used as targeting arms directed against the PSMA tumor epitope in the CARs and CAR-modified immune cells of the present disclosure. Such fragments are not necessarily proteolytic fragments, but rather portions of a polypeptide sequence that can confer affinity for a target.

[0166] 5. Multispecific antibodies In any aspect of the present disclosure, the anti-PSMA antibodies provided herein are multispecific antibodies, e.g., bispecific antibodies. Bispecific antibodies are antibodies with binding specificities for at least two different epitopes. Exemplary bispecific antibodies may bind to two different epitopes of the PSMA protein described herein. Other such antibodies may combine a PSMA-binding site with a binding site of another protein. In some embodiments, the anti-PSMA arm may be combined with an arm that binds to a triggering molecule on leukocytes, such as a T cell receptor molecule (e.g., CD3), or an Fc receptor for IgG (FcγR), such as FcγRI (CD64), FcγRII (CD32), and FcγRIII (CD16), to focus and localize cellular defense mechanisms to PSMA-expressing cells. Bispecific antibodies can also be used to localize cytotoxic agents to PSMA-expressing cells. These antibodies possess a PSMA-binding arm and an arm that binds a cytotoxic agent (e.g., saporin, anti-interferon-α, vinca alkaloid, ricin A chain, methotrexate, or radioactive isotope hapten). Bispecific antibodies can be prepared as full-length antibodies or antibody fragments (e.g., F(ab')2 bispecific antibodies).

[0167] Methods for producing bispecific antibodies are known in the art. Traditional production of full-length bispecific antibodies is based on the coexpression of two immunoglobulin heavy-light chain pairs, with these two chains having different specificities (Millstein et al., Nature 305:537-9 (1983)). Due to the random assortment of immunoglobulin heavy and light chains, these hybridomas (quadromas) may produce a mixture of 10 different antibody molecules, only one of which has the correct bispecific structure. Purification of the correct molecule, usually performed by affinity chromatography steps, is somewhat cumbersome and results in low product yields. Similar procedures are described in WO 93 / 08829 and Traunecker et al., EMBO J. 10:3655-3659 (1991).

[0168] Other approaches to generating bispecific antibodies are known. One approach is the "knob-into-hole" or "protrusion-into-cavity" approach (see, e.g., U.S. Pat. No. 5,731,168). In this approach, two immunoglobulin polypeptides (e.g., heavy chain polypeptides) each contain an interface. The interface of one immunoglobulin polypeptide interacts with a corresponding interface of the other immunoglobulin polypeptide, thereby allowing the two immunoglobulin polypeptides to associate. These interfaces can be engineered so that a "knob" or "protuberance" (these terms may be used interchangeably herein) located at the interface of one immunoglobulin polypeptide corresponds to a "hole" or "cavity" (these terms may be used interchangeably herein) located at the interface of the other immunoglobulin polypeptide. In embodiments, the holes are of the same or similar size as the knobs and are suitably positioned so that, when the two interfaces interact, the knobs of one interface can be positioned within the corresponding holes of the other interface. Without wishing to be bound by theory, this is thought to stabilize the heteromultimer and favor the formation of heteromultimers over other species, e.g., homomultimers. In embodiments, this approach promotes heteromultimerization of two different immunoglobulin polypeptides and can be used to create bispecific antibodies comprising two immunoglobulin polypeptides with binding specificities for different epitopes.

[0169] According to a different approach, antibody variable domains with the desired binding specificities (antibody-antigen combining sites) are fused to immunoglobulin constant domain sequences. The fusion is preferably with an immunoglobulin heavy chain constant domain, comprising at least part of the hinge, CH2, and CH3 regions. Typically, the first heavy chain constant region (CH1) containing the site necessary for light chain binding is present in at least one of the fusions. DNAs encoding the immunoglobulin heavy chain fusions and, if desired, the immunoglobulin light chain are inserted into separate expression vectors and co-transfected into a suitable host organism. This provides great flexibility in adjusting the relative proportions of the three polypeptide fragments in embodiments where unequal ratios of the three polypeptide chains used in the construction result in optimal yields. However, it is possible to insert the coding sequences for two or all three polypeptide chains into a single expression vector when expression of at least two polypeptide chains in equal ratios results in high yields or when the ratio is not particularly critical.

[0170] In one embodiment of this approach, the bispecific antibody consists of a hybrid immunoglobulin heavy chain with a first binding specificity in one arm and a hybrid immunoglobulin heavy chain-light chain pair (providing a second binding specificity) in the other arm. This asymmetric structure has been found to facilitate separation of the desired bispecific compound from undesired immunoglobulin chain combinations, as the presence of an immunoglobulin light chain in only one half of the bispecific molecule provides a convenient separation method. This approach is disclosed in WO 94 / 04690. For further details on the generation of bispecific antibodies, see, e.g., Suresh et al., Methods in Enzymology, 121:210 (1986).

[0171] According to another approach described in WO 96 / 27011, the interface between a pair of antibody molecules can be engineered to maximize the percentage of heterodimers which are recovered from recombinant cell culture. One interface is the C HThe antibody comprises at least a portion of the three domains. In this method, one or more small amino acid side chains from the interface of a first antibody molecule are replaced with larger side chains (e.g., tyrosine or tryptophan). By replacing the large amino acid side chains with smaller ones (e.g., alanine or threonine), compensatory "cavities" of identical or similar size to the large side chain(s) are created on the interface of a second antibody molecule. This provides a mechanism for increasing the yield of heterodimers over other unwanted end-products, such as homodimers.

[0172] Bispecific antibodies include cross-linked or "heteroconjugate" antibodies. For example, one of the antibodies in the heteroconjugate can be coupled to avidin, while the other can be coupled to biotin. Such antibodies have been proposed, for example, to target immune system cells to unwanted cells (U.S. Pat. No. 4,676,980) and to treat HIV infection (WO 91 / 00360, WO 92 / 200373, and EP 03089). Heteroconjugate antibodies can be made using any convenient cross-linking method. Suitable cross-linking agents are well known in the art and are disclosed in U.S. Pat. No. 4,676,980, along with several cross-linking techniques.

[0173] Techniques for generating bispecific antibodies from antibody fragments are also described in this literature. For example, bispecific antibodies can be prepared using chemical linkage. Brennan et al., Science 229:81 (1985) describe a procedure in which intact antibodies are proteolytically cleaved to generate F(ab')2' fragments. These fragments are reduced in the presence of the dithiol complexing agent sodium arsenite to stabilize vicinal dithiols and prevent intermolecular disulfide formation. The generated Fab' fragments are then converted to thionitrobenzoate (TNB) derivatives. One of the Fab'-TNB derivatives is then reconverted to the Fab'-thiol by reduction with mercaptoethylamine and mixed with an equimolar amount of the other Fab'-TNB derivative to form the bispecific antibody. The resulting bispecific antibodies can be used as agents for the selective immobilization of enzymes. Shalaby et al., J. Exp. Med., 175:217-225 (1992) described the production of fully humanized bispecific antibody F(ab')2 molecules. Each Fab' fragment was separately secreted from E. coli and subjected to direct chemical coupling in vitro to form the bispecific antibody.

[0174] Various techniques for making and isolating bispecific antibody fragments directly from recombinant cell culture have also been described. For example, bispecific antibodies have been produced using leucine zippers. Kostelny et al., J. Immunol., 148(5):1547-1553 (1992). Leucine zipper peptides from the Fos and Jun proteins were attached to the Fab' portions of two different antibodies by gene fusion. Antibody homodimers were reduced at the hinge region to form monomers and then re-oxidized to form the antibody heterodimers. This method can also be utilized for the production of antibody homodimers. The "diabody" technology described by Hollinger et al., Proc. Natl. Acad. Sci. USA 90:6444-6448 (1993) provides an alternative mechanism for making bispecific antibody fragments. The fragments comprise a heavy-chain variable domain (VH) connected to a light-chain variable domain (VL) by a linker that is too short to allow pairing between the two domains on the same chain. Thus, the V H and V L Domain complementary to another fragment V L and V H The Fv domains pair to form two antigen-binding sites. Another strategy for making bispecific antibody fragments by the use of single-chain Fv (sFv) dimers has also been reported. See Gruber et al., J. Immunol., 152:5368 (1994).

[0175] Another technique for generating bispecific antibody fragments is the "bispecific T cell engager" or BiTE® approach (see, e.g., WO2004 / 106381, WO2005 / 061547, WO2007 / 042261, and WO2008 / 119567). This approach utilizes two antibody variable domains arranged on a single polypeptide. For example, the single polypeptide chain comprises two single-chain Fv (scFv) fragments, each having a variable heavy (VH) and variable light (VL) domain, separated by a polypeptide linker of sufficient length to allow intramolecular association between the two domains. The single polypeptide further comprises a polypeptide spacer sequence between the two scFv fragments. Each scFv recognizes a different epitope, and these epitopes can be specific for different cell types, such that cells of two different cell types are brought into close proximity or tethered when each scFv engages its cognate epitope. One particular embodiment of this approach involves an scFv that recognizes a cell surface antigen expressed by an immune cell, e.g., the CD3 polypeptide on a T cell, linked to another scFv that recognizes a cell surface antigen expressed by a target cell, such as a malignant or tumor cell.

[0176] Because it is a single polypeptide, the bispecific T cell engager can be expressed using any prokaryotic or eukaryotic expression system known in the art, such as a CHO cell line. However, specific purification techniques (see, e.g., EP 1691833) may be necessary to separate the monomeric bispecific T cell engager from other multimeric species that may have biological activity other than the intended activity of the monomer. In one exemplary purification scheme, a solution containing the secreted polypeptide is first subjected to metal affinity chromatography, and the polypeptide is eluted using a gradient of imidazole concentration. The eluate is further purified using anion exchange chromatography, and the polypeptide is eluted using a gradient of sodium chloride concentration. Finally, the eluate is subjected to size exclusion chromatography to separate the monomer from the multimeric species.

[0177] Other related bispecific antibody fragment formats include, but are not limited to, dual affinity retargeting proteins (DARTs) and tandem diabodies (TandAbs). DARTs are composed of two Fv fragments, which form two unique antigen-binding sites upon heterodimerization (Holliger et al., 2004). al., Proc. Natl. Acad. Sci. USA. 90:6444-6448 (1993). Specifically, Fv1 consists of the VH from antibody "A" and the VL from antibody "B," while Fv2 is made from the VH from antibody "B" and the VL from antibody "A." Unlike BiTE antibodies, which are connected by a polypeptide linker, this combination allows DART to mimic the natural interactions within an IgG molecule. Adding an additional cysteine ​​residue at the end of each heavy chain improves stability by forming a C-terminal disulfide bridge. TandAbs are tetravalent, bispecific antibodies that provide two binding sites for each antigen to maintain the affinity of natural bivalent antibodies. Furthermore, TandAbs have a molecular weight (approximately 105 kDa) that exceeds the first-pass renal clearance threshold, thus resulting in a longer half-life compared to smaller antibody constructs (Reusch et al., Clin. Cancer 2010). Res.off. J. Am. Assoc. Cancer Res. 22:5829-5838 (2016); Reusch et al., MAbs. 6:728-739 (2014); Compte et al., Oncoimmunology. 3:e28810 (2014). For a recent review of common bispecific antibody formats, including scFv-based and full-length IgG-like asymmetric antibodies, including methods for their generation, see Wang et al., Antibodies (Basel), 8(3):43 (2019).

[0178] 6. Antibody Variants and Modifications a) Substitution, insertion, and deletion variants In addition to the anti-PSMA antibodies described herein, it is contemplated that anti-PSMA antibody variants can be prepared. Anti-PSMA antibody variants can be prepared by introducing appropriate nucleotide changes into the encoding DNA and / or by synthesis of the desired antibody or polypeptide. Those skilled in the art will understand that amino acid changes can alter post-translational processes of the anti-PSMA antibody, such as changing the number or position of glycosylation sites or altering membrane-tethering properties.

[0179] Alterations in the anti-PSMA antibodies described herein can be made using any of the techniques and guidelines for conservative and non-conservative mutations described, for example, in U.S. Patent No. 5,364,934. Alterations can be substitutions, deletions, or insertions of one or more codons encoding the antibody or polypeptide, resulting in a change in the amino acid sequence compared to the native sequence antibody or polypeptide. Optionally, the alteration is through the substitution of at least one amino acid with any other amino acid in one or more of the domains of the anti-PSMA antibody. Guidance in determining which amino acid residues can be inserted, substituted, or deleted without adversely affecting the desired activity can be found by comparing the sequence of the anti-PSMA antibody to that of known protein molecules of the same species and minimizing the number of amino acid sequence changes made in regions of high homology. Amino acid substitutions can result from replacing one amino acid with another amino acid having similar structural and / or chemical properties, e.g., replacing leucine with serine, i.e., conservative amino acid substitutions. Insertions or deletions can optionally range from about 1 to 5 amino acids. Permissible changes may be determined by systematically making insertions, deletions, or substitutions of amino acids in the sequence and testing the resulting variants for activity exhibited by the full-length or mature native sequence.

[0180] Anti-PSMA antibody fragments are provided herein. Such fragments may be, for example, N-terminally or C-terminally truncated or lack internal residues when compared with the full-length native antibody or protein. Certain fragments lack amino acid residues that are not essential for the desired biological activity of the anti-PSMA antibody.

[0181] Anti-PSMA antibody fragments may be prepared by any of several conventional techniques. The desired peptide fragment may be chemically synthesized. An alternative approach involves generating antibody or polypeptide fragments by enzymatic digestion, e.g., by treating the protein with an enzyme known to cleave the protein at sites defined by specific amino acid residues, or by digesting DNA with a suitable restriction enzyme and isolating the desired fragment. Yet another suitable technique involves isolating a DNA fragment encoding the desired antibody or polypeptide fragment and amplifying it by polymerase chain reaction (PCR). Oligonucleotides defining the desired termini of the DNA fragment are used at the 5' and 3' primers in the PCR. Preferably, the anti-PSMA antibody fragment shares at least one biological and / or immunological activity with the native anti-PSMA antibody disclosed herein.

[0182] In certain embodiments, conservative substitutions of interest are shown under the heading of preferred substitutions in Table 1. If such substitutions result in a change in biological activity, more substantial changes, such as those referred to as exemplary substitutions in Table 1 or further described below with reference to amino acid classes, are introduced and the products screened. [Table 1]

[0183] Substantial alterations in the function or immunological properties of anti-PSMA antibodies are achieved by selecting substitutions that differ significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the region of the substitution, e.g., as a sheet or helix structure, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain. Naturally occurring residues are divided into the following groups based on common side chain properties: (1) Hydrophobic: norleucine, met, ala, val, leu, ile, (2) Neutral hydrophilicity: cys, ser, thr, (3) Acidic: asp, glu, (4) Basic: asn, gln, his, lys, arg, (5) Residues that affect chain orientation: gly, pro, and (6) Aromatic: trp, tyr, phe

[0184] Non-conservative substitutions involve exchanging a member of one of these classes for another. Such substituted residues also may be introduced into the conservative substitution sites or, more preferably, into the remaining (non-conserved) sites.

[0185] The changes can be made using methods known in the art, such as oligonucleotide-mediated (site-directed) mutagenesis, alanine scanning, and PCR mutagenesis. Site-directed mutagenesis (Carter et al., Nucl. Acids Res., 13:4331 (1986); Zoller et al., Nucl. Acids Res., 10:6487 (1987)), cassette mutagenesis (Wells et al., Gene, 34:315 (1985)), restriction selection mutagenesis (Wells et al., Philos. Trans. R. Soc. London SerA, 317:415 (1986)), or other known techniques can be performed on the cloned DNA to produce anti-PSMA antibody variant DNAs.

[0186] Scanning amino acid analysis can also be used to identify one or more amino acids along a contiguous sequence. Among preferred scanning amino acids are relatively small, neutral amino acids. Such amino acids include alanine, glycine, serine, and cysteine. Alanine is typically the preferred scanning amino acid within this group because it excludes the side chain beyond the beta-carbon and is unlikely to alter the main-chain conformation of the variant (Cunningham and Wells, Science, 244:1081-5 (1989)). Alanine is also typically preferred because it is the most common amino acid. Furthermore, it is frequently found in both buried and exposed positions (Creighton, The Proteins, (WH Freeman & Co., NY); Chothia, J. Mol. Biol., 150:1 (1976)). If alanine substitution does not yield a sufficient amount of variant, an isosteric amino acid can be used.

[0187] Any cysteine ​​residue not involved in maintaining the proper conformation of the anti-PSMA antibody may also generally be substituted with serine to improve the oxidative stability of the molecule and prevent aberrant crosslinking. Conversely, cysteine ​​bond(s) can be added to the anti-PSMA antibody to improve its stability, particularly where the antibody is an antibody fragment such as an Fv fragment.

[0188] A particularly preferred type of substitutional variant involves substituting one or more hypervariable region residues of a parent antibody (e.g., a humanized or human antibody). Generally, the resulting variant(s) selected for further development will have improved biological properties relative to the parent antibody from which they are generated. A convenient method for generating such substitutional variants involves affinity maturation using phage display. Briefly, several hypervariable region sites (e.g., 6-7 sites) are mutated to generate all possible amino acid substitutions at each site. The antibody variants thus generated are displayed in a monovalent manner from filamentous phage particles as fusions to the gene III product of M13 packaged within each particle. The phage-displayed variants are then screened for their biological activity (e.g., binding affinity) as disclosed herein. To identify candidate hypervariable region sites for modification, alanine scanning mutagenesis can be performed to identify hypervariable region residues that contribute significantly to antigen binding. Alternatively, or additionally, it may be beneficial to analyze a crystal structure of the antigen-antibody complex to identify contact points between the antibody and PSMA polypeptide. Such contact and adjacent residues are candidates for substitution according to the techniques detailed herein. Once such variants are generated, the panel of variants can be subjected to screening as described herein, and antibodies with superior properties in one or more relevant assays can be selected for further development.

[0189] Nucleic acid molecules encoding amino acid sequence variants of anti-PSMA antibodies are prepared by a variety of methods known in the art, including, but not limited to, isolation from natural sources (in the case of naturally occurring amino acid sequence variants) or preparation by oligonucleotide-mediated (or site-directed) mutagenesis, PCR mutagenesis, and cassette mutagenesis of pre-prepared mutated or non-mutated versions of the anti-PSMA antibody.

[0190] b) Qualification Covalent modification of anti-PSMA antibodies is included within the scope of the present invention. One type of covalent modification involves reacting targeted amino acid residues of anti-PSMA antibodies with organic derivatizing agents that can react with selected side chains or N- or C-terminal residues of anti-PSMA antibodies. For example, derivatization with bifunctional agents is useful for cross-linking anti-PSMA antibodies to water-insoluble support matrices or surfaces for use in methods for purifying anti-PSMA antibodies, and vice versa. Commonly used cross-linking agents include, for example, 1,1-bis(diazoacetyl)-2-phenylethane, glutaraldehyde, N-hydroxysuccinimide esters, e.g., with 4-azidosalicylic acid, homobifunctional imidoesters including disuccinimidyl esters such as 3,3′-dithiobis(succinimidyl propionate), bifunctional maleimides such as bis-N-maleimido-1,8-octane, and agents such as methyl-3-[(p-azidophenyl)dithio]propioimidate.

[0191] Other modifications include deamidation of glutaminyl and asparaginyl residues to the corresponding glutamyl and aspartyl residues, respectively, hydroxylation of proline and lysine, phosphorylation of the hydroxyl group of seryl or threonyl residues, methylation of the α-amino groups of lysine, arginine, and histidine side chains (TECreighton, Proteins: Structure and Molecular Properties, W.H. Freeman & Co., San Francisco, pp. 79-86 (1983)), acetylation of the N-terminal amine, and amidation of any C-terminal carboxyl group.

[0192] Another type of covalent modification of an anti-PSMA antibody within the scope of the present invention involves altering the native glycosylation pattern of the antibody or polypeptide. "Altering the native glycosylation pattern," for purposes of this specification, is intended to mean deleting one or more carbohydrate moieties found in a native-sequence anti-PSMA antibody (either by removing the underlying glycosylation site or by deleting glycosylation by chemical and / or enzymatic means) and / or adding one or more glycosylation sites that are not present in the native-sequence anti-PSMA antibody. In addition, this phrase includes qualitative alterations in the glycosylation of the native protein, involving changes in the nature of the various carbohydrate moieties present and their proportions.

[0193] Glycosylation of antibodies and other polypeptides is typically either N-linked or O-linked. N-linked refers to the attachment of the carbohydrate moiety to the side chain of an asparagine residue. The tripeptide sequences asparagine-X-serine and asparagine-X-threonine, where X is any amino acid except proline, are the recognition sequences for enzymatic attachment of the carbohydrate moiety to the asparagine side chain. Thus, the presence of either of these tripeptide sequences in a polypeptide creates a potential glycosylation site. O-linked glycosylation refers to the attachment of one of the sugars N-acetylgalactosamine, galactose, or xylose to a hydroxyamino acid, most commonly serine or threonine, although 5-hydroxyproline or 5-hydroxylysine can also be used.

[0194] Addition of glycosylation sites to an anti-PSMA antibody is conveniently accomplished by altering the amino acid sequence so that it contains one or more of the above-described tripeptide sequences (for N-linked glycosylation sites). Modifications can also be made by adding or substituting one or more serine or threonine residues to the original anti-PSMA antibody sequence (for O-linked glycosylation sites). The anti-PSMA antibody amino acid sequence can optionally be altered through changes at the DNA level, particularly by mutating the DNA encoding the anti-PSMA antibody at preselected bases to generate codons that translate into the desired amino acids.

[0195] Another means of increasing the number of carbohydrate moieties on an anti-PSMA antibody is by chemical or enzymatic coupling of glycosides to the polypeptide. Such methods are described in the art, for example, in WO 87 / 05330, published September 11, 1987, and in Aplin and Wriston, CRC Crit. Rev. Biochem., pp. 259-306 (1981).

[0196] Removal of carbohydrate moieties present on anti-PSMA antibodies may be accomplished chemically or enzymatically, or by mutational substitution of codons encoding amino acid residues that serve as targets for glycosylation. Chemical deglycosylation techniques are known in the art and are described, for example, by Hakimuddin, et al., Arch. Biochem. Biophys., 259:52 (1987) and Edge et al., Anal. Biochem., 118:131 (1981). Enzymatic cleavage of carbohydrate moieties on polypeptides can be achieved by the use of various endo- and exo-glycosidases, as described by Thotakura et al., Meth. Enzymol., 138:350 (1987).

[0197] c) Fc region variants It may be desirable to modify the antibody of the invention with respect to effector function, for example, to enhance antigen-dependent cell-mediated cytotoxicity (ADCC) and / or complement-dependent cytotoxicity (CDC) of the antibody. This may be achieved by introducing one or more amino acid substitutions in the Fc region of the antibody. Alternatively, or additionally, cysteine ​​residue(s) may be introduced in the Fc region, thereby allowing interchain disulfide bond formation in this region. The homodimeric antibody thus generated may have improved internalization capability and / or increased complement-mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC) (see Caron et al., J. Exp Med. 176:1191-5 (1992); Shopes, BJ Immunol. 148:2918-22 (1992)). Homodimeric antibodies with enhanced anti-tumor activity may also be prepared using heterobifunctional cross-linkers, such as those described in Wolff et al., Cancer Research 53:2560-5 (1993). Alternatively, antibodies can be engineered to have dual Fc regions, thereby enhancing complement lysis and ADCC capabilities. See Stevenson et al., Anti-Cancer Drug Design 3:219-30 (1989). To increase the serum half-life of an antibody, a salvage receptor binding epitope may be incorporated into the antibody (e.g., antibody fragment), as described, for example, in U.S. Pat. No. 5,739,277. As used herein, the term "salvage receptor binding epitope" refers to an epitope in the Fc region of an IgG molecule (e.g., IgG1, IgG2, IgG3, or IgG4) that is responsible for increasing the in vivo serum half-life of the IgG molecule.

[0198] d) Cysteine ​​Engineered Antibody Variants In certain embodiments, it may be desirable to create cysteine ​​engineered antibodies, e.g., "thioMAbs," in which one or more residues of an antibody are substituted with cysteine ​​residues. In certain embodiments, the substituted residues occur at accessible sites of the antibody. By substituting those residues with cysteine, reactive thiol groups are thereby positioned at accessible sites of the antibody, which may be used to conjugate the antibody to other moieties, such as drug moieties or linker-drug moieties, to create immunoconjugates as further described herein. Cysteine ​​engineered antibodies can be generated, for example, as described in U.S. Pat. No. 7,521,541.

[0199] e) immune complexes The presently disclosed subject matter also provides immunoconjugates comprising an antibody disclosed herein conjugated to one or more cytotoxic agents, such as a chemotherapeutic agent or drug, a growth inhibitory agent, a protein, a peptide, a toxin (e.g., a protein toxin, an enzymatically active toxin of bacterial, fungal, plant, or animal origin, or fragments thereof), or a radioisotope. For example, an antibody of the disclosed subject matter can be operably linked (e.g., by chemical bond, genetic fusion, noncovalent bond, or otherwise) to one or more other binding molecules, such as another antibody, an antibody fragment, a peptide, or a binding mimetic.

[0200] In certain embodiments, the immunoconjugate is an antibody-drug conjugate (ADC) in which an antibody of the disclosure is conjugated to one or more drugs, including maytansinoids (see U.S. Pat. Nos. 5,208,020, 5,416,064, and European Patent No. EP 0425235 B1), auristatins such as monomethyl auristatin drug moieties DE and DF (MMAE and MMAF) (U.S. Pat. Nos. 5,208,020, 5,416,064, and European Patent No. EP 0425235 B1), or the like. Nos. 5,635,483, 5,780,588, and 7,498,298), dolastatins, calicheamicin or derivatives thereof (see U.S. Pat. Nos. 5,712,374, 5,714,586, 5,739,116, 5,767,285, 5,770,701, 5,770,710, 5,773,001, and 5,877,296; Hinman et al., Cancer Res. 53:3336-3342 (1993), and Lode et al., Cancer Res. 58:2925-2928 (1998)), anthracyclines (such as daunomycin or doxorubicin) (Kratz et al., Current Med. Chem. 13:477-523 (2006), Jeffrey et al., Bioorganic & Med. Chem. Letters 16:358-362 (2006), Torgov et al., Bioconj. Chem. 16:717-721 (2005), Nagy et al., Proc. Natl. Acad. Sci. USA 97:829-834 (2000), Dubowchik et al. al., Bioorg. & Med. Chem. Letters 12:1529-1532 (2002); King et al., J. Med. Chem. 45:4336-4343 (2002); and U.S. Patent No. 6,630,579), methotrexate, vindesine, taxanes (such as docetaxel, paclitaxel, larotaxel, tesetaxel, and ortataxel), trichothecenes, and CC1065.In certain embodiments, the immunoconjugate comprises an antibody described herein conjugated to an enzymatically active toxin or fragment thereof, including, but not limited to, diphtheria A chain, a nonbinding active fragment of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain, modeccin A chain, alpha-sarcin, Aleurites fordii proteins, diansin proteins, Phytolaca americana proteins (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, curcin, crotin, sapaonaria officinalis inhibitor, gelonin, mitogenin, restrictocin, phenomycin, enomycin, and a trichothecene.

[0201] In certain embodiments, the immunoconjugate comprises an antibody described herein conjugated to a radioactive atom to form a radioconjugate. A variety of radioisotopes are available for producing radioconjugates. Non-limiting examples include At 211 , Ac 225 , 1 131 , 1 125 , Y 90 ,Re 186 ,Re 188 , Sm 153 , Bi 212 , P 32 , Pb 212 When a radioconjugate is used for detection, it can be a radioactive atom, such as tc99m or I, for scintigraphy studies. 123 , or spin labels for nuclear magnetic resonance (NMR) imaging (also known as magnetic resonance imaging, mri), such as iodine-123, iodine-131, indium-111, fluorine-19, carbon-13, nitrogen-15, oxygen-17, gadolinium, manganese, or iron.

[0202] Conjugates of antibody fragments and cytotoxic agents can be prepared using a variety of bifunctional protein coupling agents, such as N-succinimidyl-3-(2-pyridyldithio)propionate (SPDP), succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), iminothiolane (IT), bifunctional derivatives of imidoesters (e.g., dimethyl adipimidate HCl), active esters (e.g., disuccinimidyl suberate), aldehydes (e.g., glutaraldehyde), bis-azido compounds (e.g., bis(p-azidobenzoyl)hexanediamine), bis-diazonium derivatives (e.g., bis-(p-diazoniumbenzoyl)-ethylenediamine), diisocyanates (e.g., toluene 2,6-diisocyanate), and bis-active fluorine compounds (e.g., 1,5-difluoro-2,4-dinitrobenzene). For example, ricin immunotoxins can be prepared as described in Vitetta et al., Science 238:1098 (1987). Carbon-14 labeled 1-isothiocyanatobenzyl-3-methyldiethylenetriaminepentaacetic acid (MX-DTPA) is an exemplary chelating agent for conjugating radionucleotides to antibodies. The linker may be a "cleavable linker" that facilitates the release of the cytotoxic drug inside the cell. For example, an acid-labile linker, peptidase-sensitive linker, photolabile linker, dimethyl linker, or disulfide-containing linker (Chari et al., Cancer Res. 52:127-131 (1992); U.S. Pat. No. 5,208,020) may be used. Non-limiting examples of linkers are disclosed above.The immunoconjugates disclosed herein expressly contemplate, but are not limited to, such conjugates prepared with cross-linker reagents, including, but not limited to, BMPS, EMCS, GMBS, HBVS, LC-SMCC, MBS, MPBH, SBAP, SIA, SIAB, SMCC, SMPB, SMPH, sulfo-EMCS, sulfo-GMBS, sulfo-KMUS, sulfo-MBS, sulfo-SIAB, sulfo-SMCC, and sulfo-SMPB, as well as commercially available SVSB (succinimidyl-(4-vinylsulfone)benzoate) (e.g., from Pierce Biotechnology, Inc., Rockford, Ill., USA).

[0203] f) Antibody fusion The subject matter of the present disclosure also encompasses antibody fusions. For example, proteins can be linked together by either chemical or genetic engineering using methods known in the art. See, e.g., Gillies et al., Proc. Nat'l Acad. Sci. USA 89:1428-1432 (1992) and U.S. Patent No. 5,650,150.

[0204] In one example, the present disclosure encompasses anti-PSMA antibody-cytokine fusion proteins. In principle, anti-PSMA antibodies as disclosed herein can be fused to any cytokine using recombinant molecular biology techniques. As an example, an anti-PSMA antibody can be fused to IL-2 (Gillies, S., Protein Engineering, Design and Selection 26(10):561-569(2013); Klein, C. et al., OncoImmunology 6:3(2017)).

[0205] In another example, the present disclosure encompasses anti-PSMA antibody-T cell engager fusion proteins. As discussed herein, anti-PSMA antibody-T cell engager fusion proteins comprise a fusion between an anti-PSMA antibody and a ligand for a receptor expressed on T cells. Examples of such ligands include, but are not limited to, CD40L, OX40L, 4-1BBL, CD80 / 86, ICOSL, and the like. In some embodiments, the ligand is fused to the Fc portion of the anti-PSMA antibody. In some embodiments, the ligand is fused to the C-terminus of the light chain of the anti-PSMA antibody. Such an approach has been described for 4-1BBL (Dafne M. et al., Journal of Immunotherapy 38(8):714-722 (2008)), and similar approaches can be used to generate other antibody-T cell engager fusion proteins.

[0206] B. Recombinant Methods and Compositions The anti-PSMA antibodies or antigen-binding fragments of the present disclosure can be produced using recombinant methods and compositions, such as those described in U.S. Patent No. 4,816,567. In embodiments, the present invention also provides transformed cells and their progeny into which a nucleic acid molecule encoding the antibody or antigen-binding fragment has been introduced by recombinant DNA techniques in vitro, ex vivo, or in vivo. Transformed eukaryotic or prokaryotic cells can be used to produce recombinant antibodies or antibody fragments for in situ or secreted expression for various purposes, such as purification or tumor diagnosis or treatment. Transformed cells can be propagated to transcribe the introduced nucleic acid or express the encoded protein. It is understood that progeny cells may not be identical to the parent cell because there may be mutations that occur during replication. Transformed cells include, but are not limited to, prokaryotic and eukaryotic cells, such as bacteria, fungi, plants, insects, and animal (e.g., mammalian, including human) cells. Cells can be present in culture, in vitro, within cells, tissues, or organs, or within a subject. In one embodiment, the antibody or antibody fragment is displayed on the surface of a yeast cell. In another embodiment, the antibody or antibody fragment is coated onto the surface of a nanoparticle. In another embodiment, the antibody or antibody fragment is displayed on the surface of a mammalian cell, such as a T cell, NK cell, or other human or other mammalian cell. In another embodiment, the antibody or antibody fragment is produced as a secreted protein by yeast, E. coli, or mammalian cells.

[0207] Typically, cell transformation uses a vector. The term "vector" refers to, for example, a plasmid, virus (such as a viral vector), or other vehicle that can be manipulated by insertion or incorporation of a nucleic acid for genetic manipulation (i.e., a "cloning vector") or that can be used to transcribe or translate an inserted polynucleic acid (i.e., an "expression vector"). Such vectors are useful for introducing nucleic acids, including nucleic acids encoding an antibody or antibody antigen-binding fragment operably linked to expression control elements, and expressing the encoded protein in vitro (e.g., in solution or solid phase), in cells, or in vivo.

[0208] In one embodiment, the expression vector(s) are transferred into host cells by conventional techniques, and the transfected cells are then cultured by conventional techniques to produce an antibody or antigen-binding fragment of the invention. Thus, the invention includes host cells containing polynucleic acid(s) encoding an antibody of the invention (e.g., a whole antibody, a heavy or light chain thereof, or a portion thereof, or a single-chain antibody, or a fragment or variant thereof) operably linked to a heterologous promoter. In other embodiments, for expression of a whole antibody molecule, vectors encoding both the heavy and light chains are co-expressed in the host cell for expression of the whole immunoglobulin molecule.

[0209] A variety of host-expression vector systems may be utilized to express the antibody molecules of the invention. Such host-expression systems represent vehicles in which a coding sequence of interest can be produced and subsequently purified, but also represent cells which, when transformed or transfected with the appropriate nucleic acid coding sequence, are capable of expressing the antibody molecules of the invention in situ. These include, but are not limited to, bacteriophage particles engineered to express antibody fragments or variants thereof (single-chain antibodies); microorganisms such as bacteria (e.g., E. coli, B. subtilis) transformed with recombinant bacteriophage DNA, plasmid DNA, or cosmid DNA expression vectors containing antibody coding sequences; yeast (e.g., Saccharomyces, Pichia) transformed with recombinant yeast expression vectors containing antibody coding sequences; insect cell systems infected with recombinant viral expression vectors (e.g., baculovirus) containing antibody coding sequences; and recombinant viral expression vectors (e.g., cloning). Examples of suitable cell lines include plant cell lines infected with cereal mosaic virus (CaMV; Tobacco mosaic virus (TMV)) or transformed with a recombinant plasmid expression vector (e.g., Ti plasmid) containing an antibody coding sequence; or mammalian cell lines (e.g., COS, CHO, BHK, 293, 3T3, NSO cells) harboring a recombinant expression construct containing a promoter derived from the genome of a mammalian cell (e.g., the metallothionein promoter) or a promoter derived from a mammalian virus (e.g., the adenovirus late promoter; the vaccinia virus 7.5K promoter, the CMV promoter, or the EF1a promoter). Preferably, bacterial cells such as Escherichia coli, and more preferably eukaryotic cells, are used for the expression of a recombinant antibody molecule, particularly for the expression of whole recombinant antibody molecules.For example, mammalian cells such as Chinese hamster ovary cells (CHO) are effective expression systems for antibodies in combination with vectors such as the major intermediate-early gene promoter element from human cytomegalovirus (Foecking et al. Gene 45:101 (1986); Cockett et al., Bio / Technology 8:2 (1990); Bebbington et al., Bio / Techniques 10:169 (1992); Keen and Hale, Cytotechnology 18:207 (1996)). These references are incorporated herein by reference in their entireties.

[0210] Vectors or host expression vectors used to transform cells generally contain at least an origin of replication for propagation within the cell. Control elements present in the vector, including the expression control elements described herein, are included to facilitate transcription and translation. The term "expression control element" is intended to include, at a minimum, one or more components whose presence can affect expression, and can include components other than or in addition to promoters or enhancers, such as leader sequences and fusion partner sequences, internal ribosome binding site (IRES) elements for creating multigene or polycistronic messages, intron splicing signals, maintaining the correct reading frame of a gene to allow in-frame translation of mRNA, polyadenylation signals for providing proper polyadenylation of transcripts of the gene of interest, and stop codons.

[0211] A vector may contain a selection marker. As known in the art, a "selection marker" refers to a gene that allows for the selection of cells containing the gene. "Positive selection" refers to a process in which only cells containing the selection marker survive when exposed to positive selection. Drug resistance is an example of a positive selection marker. Cells containing the marker survive in medium containing the selection drug, while cells not containing the marker die. Such markers include, among others, drug resistance genes such as neo, which confers resistance to G418, hygr, which confers resistance to hygromycin, or puro, which confers resistance to puromycin. Other positive selection marker genes include genes that allow for the identification or screening of cells containing the marker. These genes include, among others, fluorescent protein (GFP) genes, lacZ genes, alkaline phosphatase genes, and surface markers such as CD8.

[0212] The vector may contain a negative selection marker. "Negative selection" refers to the process by which cells containing the negative selection marker die when exposed to an appropriate negative selection agent. For example, cells containing the herpes simplex virus-thymidine kinase (HSV-tk) gene (Wigler et al., Cell 11:223 (1977)) are sensitive to the drug ganciclovir (GANC). Similarly, the gpt gene makes cells sensitive to 6-thioxanthine.

[0213] Mammalian expression systems further include vectors specifically designed for in vivo and in vitro expression. Such systems include adeno-associated virus (AAV) vectors (U.S. Patent No. 5,604,090). AAV vectors have previously been shown to provide factor IX expression at levels sufficient for therapeutic efficacy in humans and mice (Kay et al., Nat. Genet. 24:257 (2000); Nakai et al., Blood 91:4600 (1998)). Adenoviral vectors (U.S. Pat. Nos. 5,700,470, 5,731,172, and 5,928,944), herpes simplex viral vectors (U.S. Pat. No. 5,501,979), and retroviral (e.g., lentiviral vectors are useful for infecting dividing cells, as well as non-dividing cells and foamy viruses) vectors (U.S. Pat. Nos. 5,624,820, 5,693,508, 5,665,577, 6,013,516, and 5,674,703, and WIPO publications WO 92 / 05266 and WO 92 / 14829), and papillomaviral vectors (e.g., human and bovine papillomavirus) have all been used in gene therapy (U.S. Pat. No. 5,719,054). Vectors also include cytomegalovirus (CMV)-based vectors (U.S. Patent No. 5,561,063). Vectors that efficiently deliver genes to cells in the intestinal tract have been developed and can be used (see, for example, U.S. Patent Nos. 5,821,235, 5,786,340 and 6,110,456). In yeast, for example, vectors that promote the integration of foreign nucleic acid sequences into chromosomes via homologous recombination are known in the art and can be used. Yeast artificial chromosomes (YACs) are typically used when the inserted nucleic acid is too large (for example, greater than about 12 kb) for conventional vectors.

[0214] In one embodiment, phagemid vectors for use in the present invention include any available in the art suitable for producing the antibody / antibody template / FR libraries of the present invention, including phagemid vectors pCB04, pIT1, pIT2, CANTAB6, and pComb3 HS. Filamentous vectors and methods of phagemid construction are described, for example, in U.S. Patent Nos. 6,054,312 and 6,803,230, which are incorporated herein by reference. Bacteriophage display systems, including non-filamentous bacteriophage vectors known as cytoplasmic or lytic phage, are also available, as described, for example, in U.S. Patent No. 5,766,905, incorporated herein by reference.

[0215] Bacterial expression constructs suitable for use in the present invention include, but are not limited to, commercially available expression constructs such as pCAL, pUC, pET, pETBlue™ (Novagen), pBAD, pLEX, pTrcHis2, pSE280, pSE380, pSE420 (Invitrogen), pKK223-2 (Clontech), pTrc99A, pKK223-3, pRIT2T, pMC1871, pEZZ 18 (Pharmacia), pBluescript II SK (Stratagene), pALTER-Exl, pALTER-Ex2, pGEMEX (Promega), pFivE (MBI), pQE (Qiagen), and their derivatives, as well as others known in the art. In embodiments of the present invention, the construct may also comprise a virus, plasmid, bacmid, phagemid, cosmid, or bacteriophage.

[0216] The use of liposomes to introduce various compositions, including nucleic acids, into cells is known to those skilled in the art (see, e.g., U.S. Pat. Nos. 4,844,904, 5,000,959, 4,863,740, and 4,975,282). Carriers comprising natural polymers, or derivatives or hydrolysates of natural polymers, as described in WO 94 / 20078 and U.S. Pat. No. 6,096,291, are suitable for mucosal delivery of molecules such as polypeptides and polynucleic acids, and piperazine-based amphiphilic cationic lipids useful for gene therapy are also known (see, e.g., U.S. Pat. No. 5,861,397). Cationic lipid systems are also known (see, e.g., U.S. Pat. No. 5,459,127). Accordingly, in vitro, in vivo, and ex vivo delivery of viral and non-viral vectors into cells or tissues are included.

[0217] In one embodiment, the nucleic acid sequences may be "operably linked," i.e., positioned, to ensure the function of the expression control sequences. These expression constructs are typically replicable in the cells, either as episomes or as an integral part of the cell's chromosomal DNA, and may contain an appropriate origin of replication for each prokaryotic strain used for expression. Expression constructs generally contain a selectable marker, such as tetracycline resistance, ampicillin resistance, kanamycin resistance, or chlormaphenicol resistance, to facilitate detection and / or selection of bacterial cells transformed with the desired nucleic acid sequence (see, e.g., U.S. Pat. No. 4,704,362). However, these markers are not exclusive, and numerous other markers may be used, as known to those skilled in the art. In another embodiment of the invention, the expression construct contains both positive and negative selectable markers.

[0218] Similarly, a reporter gene may be incorporated into the expression construct to facilitate identification of the transcript. Thus, in one embodiment of the present invention, the reporter gene utilized is selected from the group consisting of β-galactosidase, chloramphenicol acetyltransferase, luciferase, and fluorescent proteins.

[0219] Prokaryotic promoter sequences regulate the expression of encoded polynucleic acid sequences and, in some embodiments of the invention, are operably linked to polynucleic acids encoding polypeptides of the invention. In additional embodiments of the invention, these promoters are either constitutive or inducible, providing a means for high and low level expression of polypeptides of the invention, and, in some embodiments, a means for controlled expression of multiple polypeptides of the invention, which, in some embodiments, are expressed as fusion proteins.

[0220] Many well-known bacterial promoters, including the T7 promoter system, lactose promoter system, tryptophan (Trp) promoter system, Trc / Tac promoter system, beta-lactamase promoter system, tetA promoter system, arabinose-regulated promoter system, phage T5 promoter, or promoter system from phage lambda, or other promoter systems may be used and are included within the present invention. Promoters typically control expression, optionally via operator sequences, and may include, for example, ribosome binding site sequences for initiating and completing transcription and translation. According to additional embodiments, vectors also include expression control sequences, enhancers capable of regulating the transcriptional activity of the promoter, appropriate restriction sites adjacent to the promoter to facilitate cloning of inserts, and other necessary information processing sites, such as RNA splice sites, polyadenylation sites, and transcription termination sequences, as well as any other sequences capable of promoting expression of the inserted nucleic acid.

[0221] C. Purification of anti-PSMA antibodies The anti-PSMA antibody form may be recovered from the culture medium or from host cell lysates. If membrane-bound, it can be released from the membrane using a suitable detergent solution (e.g., Triton-X 100) or by enzymatic cleavage. Cells used to express anti-PSMA antibodies can be disrupted by various physical or chemical means, such as freeze-thaw cycling, sonication, mechanical disruption, or the use of cell lysing agents.

[0222] It may be desirable to purify anti-PSMA antibodies from recombinant cell proteins or polypeptides. The following procedures are representative of suitable purification procedures: fractionation on an ion exchange column; ethanol precipitation; reverse-phase HPLC; chromatography on a cation exchange resin such as silica or DEAE; chromatofocusing; SDS-PAGE; ammonium sulfate precipitation; gel filtration, e.g., using Sephadex G-75; a protein A Sepharose column to remove contaminants such as IgG; and a metal chelate column to bind epitope-tagged forms of anti-PSMA antibodies. Various protein purification methods may be used, and such methods are known in the art and are described, for example, in Deutscher, Methods in Enzymology, 182 (1990); Scopes, Protein Purification: Principles and Practice, Springer-Verlag, New York (1982). The purification step(s) selected will depend, for example, on the nature of the production process used and the particular anti-PSMA antibody being produced.

[0223] When using recombinant techniques, antibodies can be produced intracellularly, in the periplasmic space, or directly secreted into the medium. If the antibody is produced intracellularly, as a first step, particulate debris (either host cells or lysed fragments) is removed, for example, by centrifugation or ultrafiltration. Carter et al., Bio / Technology 10:163-7 (1992) describes a procedure for isolating antibodies secreted into the periplasmic space of E. coli. Briefly, cell paste is thawed in the presence of sodium acetate (pH 3.5), EDTA, and phenylmethylsulfonyl fluoride (PMSF) for approximately 30 minutes. Cell debris can be removed by centrifugation. If the antibody is secreted into the medium, the supernatant of such expression systems is generally first concentrated using a commercially available protein concentration filter, such as an Amicon or Millipore Pellicon ultrafiltration unit. A protease inhibitor such as PMSF may be included in any of the foregoing steps to inhibit proteolysis, and antibiotics may be included to prevent the growth of adventitious contaminants.

[0224] Antibody compositions prepared from cells can be purified using, for example, hydroxylapatite chromatography, gel electrophoresis, dialysis, and affinity chromatography, with affinity chromatography being the preferred purification technique. The suitability of protein A as an affinity ligand depends on the species and isotype of any immunoglobulin Fc domain present in the antibody. Protein A can be used to purify antibodies based on human γ1, γ2, or γ4 heavy chains (Lindmark et al., J. Immunol. Meth. 62:1-13 (1983)). Protein G is recommended for all mouse isotypes and human γ3 (Guss et al., EMBO J. 5:15671575 (1986)). The matrix to which the affinity ligand is attached is most often agarose, although other matrices are also available. Mechanically stable matrices such as controlled-pore glass or poly(styrenedivinyl)benzene allow for faster flow rates and shorter processing times than those achievable with agarose. If the antibody contains a CH3 domain, Bakerbond ABX™ resin (JT Baker, Phillipsburg, NJ) is useful for purification. Other techniques for protein purification, such as fractionation on an ion exchange column, ethanol precipitation, reverse-phase HPLC, chromatography on silica, chromatography on heparin SEPHAROSE™ chromatography on anion or cation exchange resins (such as polyaspartic acid columns), chromatofocusing, SDS-PAGE, and ammonium sulfate precipitation, are also available, depending on the antibody to be recovered.

[0225] After any preliminary purification step(s), the mixture containing the antibody of interest and contaminants may be subjected to low pH hydrophobic interaction chromatography using an elution buffer at a pH of about 2.5-4.5 and generally with a low salt concentration (e.g., about 0-0.25 M salt).

[0226] D. Assay The antibodies of the present invention can be used in any known assay method, such as ELISA, competitive binding assays, direct and indirect sandwich assays, and immunoprecipitation assays (Zola, (1987) Monoclonal Antibodies: A Manual of Techniques, pp. 147-158, CRC Press, Inc.).

[0227] Detection labels can be useful for localizing, visualizing, and quantifying binding or recognition events. The labeled antibodies of the present invention can detect cell surface receptors or antigens. Another application of detectably labeled antibodies is bead-based immunocapture methods, which involve conjugating beads with fluorescently labeled antibodies and detecting a fluorescent signal upon ligand binding. A similar binding detection technique uses surface plasmon resonance (SPR) to measure and detect antibody-antigen interactions.

[0228] Detection labels, such as fluorescent dyes and chemiluminescent dyes (Briggs et al. (1997) J. Chem. Soc., Perkin-Trans. 1:1051-8), provide a detectable signal and are generally applicable to labeling antibodies, with those having the following properties being preferred: (i) the labeled antibody should generate a very high signal with low background, so that small amounts of antibody can be detected with high sensitivity in both cell-free and cell-based assays, and (ii) the labeled antibody should be photostable, so that the fluorescent signal can be observed, monitored, and recorded without significant photobleaching. For applications involving membrane or cell surface binding of labeled antibodies, particularly to live cells, it is preferred that the label (iii) have good water solubility to achieve effective conjugation concentrations and detection sensitivity, and (iv) be non-toxic to live cells so as not to disrupt the cells' normal metabolic processes or result in premature cell death.

[0229] Direct quantification of cellular fluorescence intensity and enumeration of fluorescently labeled events (e.g., cell surface binding of peptide dye conjugates) can be performed using a system (FMAT® 8100 HTS System, Applied Biosystems, Foster City, Calif.) that automates mix-and-read, non-radioactive assays using live cells or beads (Miraglia, “Homogeneous cell- and bead-based assays for high throughput screening using fluorometric microvolume assay technology,” (1999) J. of Biomolecular Screening 4:193-204). Uses of labeled antibodies also include cell surface receptor binding assays, immunocapture assays, fluorescence-linked immunosorbent assays (FLISA), caspase cleavage (Zheng, "Caspase-3 controls both cytoplasmic and nuclear events associated with Fas-mediated apoptosis in vivo," (1998) Proc. Natl. Acad. Sci. USA 95:618-23; US6372907), apoptosis (Vermes, "A novel assay for apoptosis. Flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein-labeled Annexin V," (1995) J. Immunol. Methods 184:39-51), and cytotoxicity assays. Fluorometric microvolume assay technology can be used to identify up- or down-regulation by molecules targeted to the cell surface (Swartzman, "A homogeneous and multiplexed immunoassay for high-throughput screening using fluorometric microvolume assay technology", (1999) Anal. Biochem. 271:143-51).

[0230] The labeled antibodies of the present invention are useful as imaging biomarkers and probes for various biomedical and molecular imaging methods and techniques, such as (i) MRI (magnetic resonance imaging), (ii) MicroCT (computed tomography), (iii) SPECT (single photon emission computed tomography), (iv) PET (positron emission tomography) Chen et al. Bioconjugate Chem. 15:41-9 (2004), (v) bioluminescence, (vi) fluorescence, and (vii) ultrasound. Immunoscintigraphy is an imaging procedure in which a radiolabeled antibody is administered to an animal or human patient and images are obtained at sites in the body where the antibody localizes (U.S. Pat. No. 6,528,624). Imaging biomarkers can be objectively measured and evaluated as indicators of normal biological processes, pathological processes, or pharmacological responses to therapeutic interventions.

[0231] Peptide labeling methods are well known (e.g., Haugland, 2003, Molecular Probes Handbook of Fluorescent Probes and Research Chemicals, Molecular Probes, Inc.; Brinkley, 1992, Bioconjugate Chem. 3:2; Garman, (1997) Non-Radioactive Labelling: A Practical Approach, Academic Press, London; Means (1990) Bioconjugate Chem. 1:2; Glazer et al. (1975) Chemical Modification of Proteins. Laboratory Techniques in Biochemistry and Molecular Biology (T.S. Work and E. Work, Eds.) American Elsevier Publishing Co., New York; Lundblad, R.L. and Noyes, C.M. (1984) Chemical Reagents for Protein Modification, Vols. I and II, CRC Press, New York, Pfleiderer, G. (1985) “Chemical Modification of Proteins”, Modern Methods in Protein Chemistry, H. Tschesche, Ed., Walter DeGryter, Berlin and New York, and Wong (1991) Chemistry of Protein Conjugation and Cross-linking, CRC Press, Boca Raton, Fla.); De Leon-Rodriguez et al. (2004) Chem. Eur. J. 10:1149-1155; Lewis et al. (2001) Bioconjugate Chem. 12:320-324; Li et al. (2002) Bioconjugate Chem. 13:110-115; Mier et al. (2005) Bioconjugate Chem. 16:240-237).

[0232] Peptides and proteins labeled with two moieties, a fluorescent reporter and a quencher, in sufficient proximity are subjected to fluorescence resonance energy transfer (FRET). The reporter group is typically a fluorescent dye that is excited by light of a specific wavelength and transfers energy to an acceptor or quencher group, with a Stokes shift suitable for maximum brightness emission. Fluorescent dyes include highly aromatic molecules such as fluorescein and rhodamine, and their derivatives. The fluorescent reporter can be partially or largely quenched by the quencher in the intact peptide. Cleavage of the peptide by peptidases or proteases can result in a detectable increase in fluorescence (Knight, C. (1995) "Fluorimetric Assays of Proteolytic Enzymes", Methods in Enzymology, Academic Press, 248:18-34).

[0233] The labeled antibodies of the present invention can also be used as affinity purification agents. In this process, the labeled antibodies are immobilized on a solid phase, such as Sephadex resin or filter paper, using methods well known in the art. The immobilized antibodies are contacted with a sample containing the antigen to be purified, and the support is then washed with a suitable solvent to remove substantially all materials in the sample except for the antigen to be purified that is bound to the immobilized polypeptide variant. Finally, the support is washed with another suitable solvent, such as glycine buffer at pH 5.0, thereby separating the antigen from the polypeptide variant.

[0234] 1. Activity Assay In one embodiment, an assay is provided for identifying anti-PSMA antibodies that have biological activity. Biological activity can include, for example, the ability to inhibit cell growth or proliferation (e.g., "cell-killing" activity) or the ability to induce cell death, including programmed cell death (apoptosis). Antibodies that have such biological activity in vivo and / or in vitro are also provided.

[0235] In certain embodiments, anti-PSMA antibodies are tested for their ability to inhibit cell growth or proliferation in vitro. Assays for inhibiting cell growth or proliferation are well known in the art. Certain assays for cell proliferation, such as "cell killing" assays, measure cell viability. One such assay is the CellTiter-Glo™ Luminescent Cell Viability Assay, commercially available from Promega (Madison, WI). This assay determines the number of viable cells in culture based on the quantification of ATP present, which is an indicator of metabolically active cells. See Crouch et al. (1993) J. Immunol. Meth. 160:81-8; U.S. Patent No. 6,602,677. This assay can be performed in a 96-well or 384-well format, making it suitable for automated high-throughput screening (HTS) (see Cree et al. (1995) AntiCancer Drugs 6:398-404). The assay procedure involves adding a single reagent (CellTiter-Glo® Reagent) directly to cultured cells. This results in cell lysis and the generation of a luminescent signal produced by a luciferase reaction. The luminescent signal is proportional to the amount of ATP present, which is directly proportional to the number of viable cells present in the culture. Data can be recorded by a luminometer or CCD camera imaging device. Luminescent output is expressed as relative light units (RLU).

[0236] Another assay for cell proliferation is the "MTT" assay, a colorimetric assay that measures the oxidation of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide to formazan by mitochondrial reductase. Like the CellTiter-Glo™ assay, this assay indicates the number of metabolically active cells present in a cell culture (see, e.g., Mosmann (1983) J. Immunol. Meth. 65:55-63, and Zhang et al. (2005) Cancer Res. 65:3877-82).

[0237] In one aspect, anti-PSMA antibodies are tested for their ability to induce cell death in vitro. Assays for cell death induction are well known in the art. In embodiments, such assays measure loss of membrane integrity, as indicated by, for example, propidium iodide (PI), trypan blue (see Moore et al., Cytotechnology, 17:1-11 (1995)), or 7AAD uptake. In an exemplary PI uptake assay, cells are cultured in Dulbecco's Modified Eagle's Medium (D-MEM):Ham's F-12 (50:50) supplemented with 10% heat-inactivated FBS (HyClone) and 2 mM L-glutamine. Thus, the assay is performed in the absence of complement and immune effector cells. Cells are seeded in 100x20 mm dishes at a density of 3x106 per dish and allowed to adhere overnight. The medium is removed and replaced with fresh medium alone or medium containing various concentrations of antibody. The cells are incubated for a period of 3 days. Following treatment, the monolayer is washed with PBS and detached by trypsinization. The cells are then centrifuged at 1200 rpm at 4°C for 5 minutes, and the pellet is resuspended in 3 mL of cold Ca2+ binding buffer (10 mM Hepes (pH 7.4), 140 mM NaCl, 2.5 mM CaCl2) and aliquoted into 12 x 75 mm tubes with 35 mm strainer caps (1 mL per tube, 3 tubes per treatment group) to remove cell clumps. Tubes are then spiked with PI (10 μg / mL). Samples are analyzed using a FACSCAN™ flow cytometer and FACSCONVERT™ CellQuest software (Becton Dickinson). Antibodies that induce statistically significant levels of cell death as determined by PI uptake are thus identified.

[0238] In one embodiment, anti-PSMA antibodies are tested for their ability to induce apoptosis (programmed cell death) in vitro. An exemplary assay for antibodies that induce apoptosis is an annexin binding assay. In an exemplary annexin binding assay, cells are cultured as discussed in the previous paragraph and plated in dishes. The medium is removed and replaced with fresh medium alone or medium containing 0.001 to 10 μg / mL of antibody. Following a 3-day incubation period, the monolayer is washed with PBS and detached by trypsinization. The cells are then centrifuged as discussed in the previous paragraph, resuspended in Ca2+-binding buffer, and aliquoted into tubes. The tubes then contain labeled annexin (e.g., annexin V-FITC) (1 μg / mL). Samples are analyzed using a FACSCAN™ flow cytometer and FACSCONVERT™ CellQuest software (BD Biosciences). In this way, antibodies that induce statistically significant annexin binding levels compared to control are identified. Another exemplary assay for antibodies that induce apoptosis is the histone DNA ELISA colorimetric assay for detecting internucleosomal degradation of genomic DNA. Such an assay can be carried out, for example, using a cell death detection ELISA kit (Roche, Palo Alto, CA).

[0239] Cells for use in any of the above-described in vitro assays include cells or cell lines that naturally express PSMA or that have been engineered to express PSMA. Such cells include tumor cells that overexpress PSMA compared to normal cells of the same tissue origin. Such cells also include cell lines (including tumor cell lines) that express PSMA, and cell lines that do not normally express PSMA but have been transfected with a nucleic acid encoding PSMA.

[0240] In one aspect, the anti-PSMA antibody is tested for its ability to inhibit cell growth or proliferation in vivo. In certain embodiments, the anti-PSMA antibody is tested for its ability to inhibit tumor growth in vivo. An in vivo model system, such as a xenograft model, can be used for such testing. In an exemplary xenograft system, human tumor cells are introduced into a suitable immunodeficient non-human animal, such as a SCID mouse. An antibody of the present invention is administered to the animal. The ability of the antibody to inhibit or reduce tumor growth is measured. In certain embodiments of the above xenograft system, the human tumor cells are tumor cells from a human patient. In certain embodiments, the human tumor cells are introduced into a suitable immunodeficient non-human animal by subcutaneous injection or by implantation into a suitable site, such as the mammary fat pad.

[0241] 2. Binding Assays and Other Assays In one aspect, anti-PSMA antibody is tested for its antigen binding activity.For example, in certain embodiments, anti-PSMA antibody is tested for its ability to bind to PSMA expressed on the surface of cell.FACS assay can be used for this test.

[0242] In one embodiment, a monoclonal antibody that competes with a monoclonal antibody comprising the HCVR / LCVR sequence pairs of SEQ ID NOs: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, 13 / 14, 15 / 16, 17 / 18, 19 / 20, 21 / 22, 23 / 24, 25 / 26, 27 / 28, 29 / 30, 31 / 32, 33 / 34, or 35 / 36 using a competition assay; or Monoclonal antibodies may be identified that compete with a monoclonal antibody comprising the six CDRs of an HCVR / LCVR sequence pair selected from SEQ ID NOs: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, 13 / 14, 15 / 16, 17 / 18, 19 / 20, 21 / 22, 23 / 24, 25 / 26, 27 / 28, 29 / 30, 31 / 32, 33 / 34, or 35 / 36.

[0243] In certain embodiments, such competing antibodies are monoclonal antibodies comprising the HCVR / LCVR sequence pairs of SEQ ID NOs: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, 13 / 14, 15 / 16, 17 / 18, 19 / 20, 21 / 22, 23 / 24, 25 / 26, 27 / 28, 29 / 30, 31 / 32, 33 / 34, or 35 / 36, or , 7 / 8, 9 / 10, 11 / 12, 13 / 14, 15 / 16, 17 / 18, 19 / 20, 21 / 22, 23 / 24, 25 / 26, 27 / 28, 29 / 30, 31 / 32, 33 / 34, or 35 / 36. Exemplary competitive assays include, but are not limited to, routine assays such as those provided in Harlow and Lane (1988) Antibodies: A Laboratory Manual ch. 14 (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY). Detailed exemplary methods for mapping antibody-binding epitopes are provided in Morris (1996) "Epitope Mapping Protocols," in Methods in Molecular Biology, vol. 66 (Humana Press, Totowa, NJ). Two antibodies are said to bind to the same epitope if each blocks the binding of the other by 50% or more.

[0244] In an exemplary competitive assay, immobilized PSMA is incubated in a solution containing a first labeled antibody that binds to PSMA and a second unlabeled antibody being tested for its ability to compete with the first antibody for binding to PSMA. The second antibody may be present in hybridoma supernatant. As a control, immobilized PSMA is incubated in a solution containing the first labeled antibody but not the second unlabeled antibody. After incubation under conditions that allow binding of the first antibody to PSMA, excess unbound antibody is removed and the amount of label associated with immobilized PSMA is measured. If the amount of label associated with immobilized PSMA is substantially reduced in the test sample compared to the control sample, this indicates that the second antibody competes with the first antibody for binding to PSMA. In certain embodiments, the immobilized PSMA is present on the surface of cells expressing PSMA on their surface or in a membrane preparation obtained from those cells.

[0245] In one embodiment, the purified anti-PSMA antibodies may be further characterized by a range of assays including, but not limited to, N-terminal sequencing, amino acid analysis, non-denaturing size-exclusion high pressure liquid chromatography (HPLC), mass spectrometry, ion exchange chromatography, and papain digestion.

[0246] E. Methods for Identifying Epitopes In one aspect, the present disclosure provides a method for identifying the epitope of an anti-PSMA antibody or antigen-binding fragment thereof.

[0247] An epitope can include at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids in a unique spatial conformation. Epitopes can be formed both from contiguous amino acids or from noncontiguous amino acids juxtaposed by tertiary folding of a protein. Epitopes formed from contiguous amino acids can typically be retained upon exposure to denaturing solvents, whereas epitopes formed by tertiary folding are typically lost upon treatment with denaturing solvents.

[0248] Epitope mapping can be performed to identify linear or nonlinear discontinuous amino acid sequence(s), i.e., epitopes, recognized (e.g., specifically) by an anti-PSMA antibody or antigen-binding fragment thereof. A general approach to epitope mapping may require the expression of the full-length polypeptide sequence recognized by the antibody or ligand of interest, as well as various fragments of the polypeptide sequence, i.e., truncated forms of the polypeptide sequence, generally in a heterologous expression system. These various recombinant polypeptide sequences or fragments thereof (e.g., fused to an N-terminal protein (e.g., GFP)) can then be used to determine whether the antibody or ligand of interest can bind to one or more of the truncated forms of the polypeptide sequence.

[0249] By using recursive truncation to generate recombinant polypeptide sequences with overlapping amino acid regions, it is possible to identify the region of a polypeptide sequence recognized by an antibody of interest (see, for example, Epitope Mapping Protocols in Methods in Molecular Biology, Vol. 66, Glenn E. Morris, Ed. (1996)). These methods rely on the ability of an agent, such as an antibody of interest, to bind to a sequence reconstructed from an epitope library, such as an epitope library from which it was derived, a synthetic peptide array on a membrane support, or a combinatorial phage display peptide library. The epitope library then provides a variety of possibilities for screening antibodies. In addition, site-directed mutagenesis or random Ala scanning targeting one or more residues of the epitope can be performed to confirm the identity of the epitope.

[0250] Libraries of epitopes can be generated by synthetically designing various portions of PSMA as constructs and expressing them in an appropriate system. Optionally, portions of PSMA can be amplified from total RNA extracted from PSMA-expressing cells isolated from human normal and / or malignant tissue.

[0251] The host system can be any suitable expression system, such as 293 cells, insect cells, or a suitable in vitro translation system. Binding of an anti-PSMA antibody or antigen-binding fragment thereof to one of the epitopes in the library can be detected by contacting a labeled PSMA antibody of the disclosure with the epitope in the library and detecting a signal from the label.

[0252] Computational algorithms have also been developed for epitope mapping that have been shown to map conformationally discontinuous epitopes. Conformational epitopes can be identified by determining the spatial conformation of amino acids using methods including, for example, X-ray crystallography and two-dimensional nuclear magnetic resonance. Some epitope mapping methods, such as X-ray analysis of crystals of antigen:antibody complexes, can provide atomic resolution of epitopes. In other cases, computational combinatorial methods for epitope mapping can be used to model potential epitopes based on the sequence of an anti-PSMA antibody or its antigen-binding fragment. In such cases, the antigen-binding portion of the antibody is sequenced, and computational models are used to reconstruct and predict potential binding sites of the antibody.

[0253] In some cases, the present disclosure provides a method for determining PSMA epitopes, the method comprising: (a) preparing a library of epitopes from the PSMA receptor; (b) contacting the library of epitopes with an anti-PSMA antibody; and (c) identifying the amino acid sequence of at least one epitope in the epitope library to which the antibody binds. In one example, the antibody is attached to a solid support. The epitope library can include sequences corresponding to continuous and discontinuous epitopes of PSMA. In some cases, the epitope library includes fragments from the PSMA receptor ranging in length from about 10 amino acids to about 30 amino acids, from about 10 amino acids to about 20 amino acids, or from about 5 amino acids to about 12 amino acids. In some cases, the anti-PSMA antibody or antigen-binding fragment thereof is labeled, and the label is a radioactive molecule, a luminescent molecule, a fluorescent molecule, an enzyme, or biotin.

[0254] Phage panning can be used to identify PMSA-binding molecules that bind to PMSA or one or more epitopes on PMSA. In embodiments, phage panning using biotinylated recombinant human PSMA protein bound to streptavidin beads was performed on a highly diverse synthetic scFv phage display library using multiple rounds (e.g., five rounds) of selection, each time with decreasing antigen concentration (e.g., from 100 pmol to 2 pmol) and increasing wash stringency. In embodiments, an alternative panning strategy may be used, alternating selection with 1e8 PSMA+ cells or antigen (e.g., 100 pmol and 25 pmol, respectively). Antigen-bound phage may then be pulled down, eluted, amplified, and screened using ELISA for binder confirmation and selection. Following NGS and / or Sanger clone sequencing, selected scFvs may be reformatted into IgG, expressed, purified, and characterized.

[0255] In embodiments, PMSA-binding molecules may be generated using epitopes comprising or consisting of residues 574-580, 644-649, and 674-686 of human PSMA, where residues are numbered according to SEQ ID NO: 329 in Figure 18B. In embodiments, PMSA-binding molecules may be generated using epitopes comprising or consisting of residues 150-161, 167-172, and 256-261 of human PSMA, where residues are numbered according to SEQ ID NO: 330 in Figure 18B.

[0256] F. Chimeric Antigen Receptor (CAR) Constructs Aspects of the invention include nucleic acids encoding CARs, as well as constructs and vectors containing such nucleic acids. In some cases, the nucleic acid is a component of, e.g., a heterologous expression cassette. In embodiments, the nucleic acid is a component of, e.g., a heterologous retroviral vector. In embodiments, the nucleic acid is a component of, e.g., a heterologous αβ T cell or γδ T cell, preferably a γδ T cell. In embodiments, the nucleic acid is a component of, e.g., a heterologous γ +T cells and / or delta + In embodiments, the nucleic acid is a heterologous, α - T cells and / or β - It is a component of T cells.

[0257] A subject CAR of the present invention comprises an antigen-binding domain capable of specifically binding to PSMA. The antigen-binding domain can be operably linked to another domain of the CAR, such as a transmembrane domain, a costimulatory domain, and / or an intracellular signaling domain described herein. The antigen-binding domain described herein can be combined with any of the transmembrane, costimulatory, and / or intracellular signaling domain(s) described herein and / or any of the other domains described herein that can be included in a CAR of the present invention. A subject CAR of the present invention can also comprise a hinge domain described herein. A subject CAR of the present invention can also comprise at least one spacer domain described herein.

[0258] 1. Antigen-binding domain The antigen-binding domain can include any domain that binds to PSMA, including, but not limited to, monoclonal antibodies, polyclonal antibodies, synthetic antibodies, human antibodies, humanized antibodies, non-human antibodies, and fragments thereof. In embodiments, the antigen-binding domain portion comprises a mammalian antibody or fragment thereof. The choice of antigen-binding domain can depend on the type and number of antigens present on the surface of the target cell.

[0259] In embodiments, the antigen-binding domain is selected from the group consisting of an antibody, an antigen-binding fragment (Fab), and a single-chain variable fragment (scFv).

[0260] The present disclosure provides antibodies and CARs that have "substantial identity" or "substantial similarity" in the CDR or framework regions to the sequences provided herein. The terms "substantial identity" or "substantially identical," when referring to a nucleic acid or a fragment thereof, indicate that when optimally aligned with another nucleic acid (or the complementary strand of another nucleic acid), there is, for example, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% nucleotide sequence identity as measured by any well-known sequence identity algorithm, such as FASTA, BLAST, or GAP, as described below. A nucleic acid molecule having substantial identity to a reference nucleic acid molecule can, in certain instances, encode a polypeptide having the same or substantially similar amino acid sequence as the polypeptide encoded by the reference nucleic acid molecule.

[0261] When applied to polypeptides, the term "substantial similarity" or "substantially similar" means that two peptide sequences share at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% sequence identity when optimally aligned, such as by the programs GAP or BESTFIT using default gap weighting. In some embodiments, residue positions that are not identical differ by conservative amino acid substitutions. A "conservative amino acid substitution" is one in which an amino acid residue is replaced with another amino acid residue having a side chain (R group) with similar chemical properties (e.g., charge or hydrophobicity). Generally, conservative amino acid substitutions will not substantially alter the functional properties of a protein. When two or more amino acid sequences differ from each other by conservative substitutions, the percent or degree of similarity may be adjusted upward to correct for the conservative nature of the substitution. Means for making this adjustment are well known to those of skill in the art. See, e.g., Pearson, (1994), Methods Mol. Biol. 24:307-331 (incorporated herein by reference). Examples of groups of amino acids having side chains with similar chemical properties include: 1) aliphatic side chains: glycine, alanine, valine, leucine, and isoleucine; 2) aliphatic hydroxyl side chains: serine and threonine; 3) amide-containing side chains: asparagine and glutamine; 4) aromatic side chains: phenylalanine, tyrosine, and tryptophan; 5) basic side chains: lysine, arginine, and histidine; 6) acidic side chains: aspartic acid and glutamic acid; and 7) sulfur-containing side chains: cysteine ​​and methionine. Preferred conservative amino acids substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, glutamate-aspartate, and asparagine-glutamine.Alternatively, a conservative substitution is any change that has a positive value in the PAM250 log-likelihood matrix, as disclosed in Gonnet et al. (1992) Science, 256:1443 45, which is incorporated herein by reference. A "moderately conservative" substitution is any change that has a non-negative value in the PAM250 log-likelihood matrix.

[0262] Sequence identity and / or similarity of polypeptides is typically measured using sequence analysis software. Protein analysis software matches similar sequences using measures of similarity assigned to various substitutions, deletions, and other modifications, including conservative amino acid substitutions. For example, GCG software contains programs such as GAP and BESTFIT, which can be used with default parameters to determine sequence homology or sequence identity between closely related polypeptides, such as homologous polypeptides from different species, or between a wild-type protein and its mutant protein. See, for example, GCG version 6.1. Polypeptide sequences can also be compared using FASTA, a program in GCG version 6.1, using default or recommended parameters. FASTA (e.g., FASTA2 and FASTA3) provides alignment and percent sequence identity of the best overlapping regions between the query and search sequences (Pearson (2000) supra). Sequences can also be compared using the Smith-Waterman homology search algorithm, which uses an affine gapped search with a gap open penalty of 12, a gap extension penalty of 2, and a BLOSUM matrix of 62. Another preferred algorithm for comparing the sequences disclosed herein to a database containing a large number of sequences from different organisms is the computer program BLAST, particularly BLASTP or TBLASTN, using default parameters. See, e.g., Altschul et al. (1990) J. Mol. Biol. 215:403-410 and (1997) Nucleic Acids Res. 25:3389-3402, each of which is incorporated herein by reference.

[0263] Provided herein are anti-PSMA CARs that include variants of any of the HCVR, LCVR, and / or CDR amino acid sequences disclosed herein with one or more substitutions (e.g., conservative substitutions). For example, the disclosure includes anti-PSMA CARs that have HCVR, LCVR, and / or CDR amino acid sequences with, for example, 20 or less, 19 or less, 18 or less, 17 or less, 16 or less, 15 or less, 14 or less, 13 or less, 12 or less, 11 or less, 10 or less, 9 or less, 8 or less, 7 or less, 6 or less, 5 or less, 4 or less, 3 or less, 2 or less, or 1 amino acid substitution compared to any of the HCVR, LCVR, and / or CDR (e.g., HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, or LCDR3) amino acid sequences disclosed herein. For example, an anti-PSMA CAR can include 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 amino acid substitution (such as a conservative amino acid substitution) compared to any of the HCVR, LCVR, and / or CDR (e.g., HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, or LCDR3) amino acid sequences disclosed herein.

[0264] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising an amino acid sequence selected from the group consisting of any one of SEQ ID NOs: 1 to 36. In embodiments, the anti-PSMA binding domain binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising an HCVR amino acid sequence selected from the group consisting of any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, and 35. In embodiments, the anti-PSMA binding domain binds to, competes with, or is the same epitope as an anti-PSMA binding domain comprising an LCVR amino acid sequence selected from the group consisting of any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, and 36. In embodiments, the anti-PSMA binding domain binds to, competes with, or is the same epitope as an anti-PSMA binding domain comprising an LCVR amino acid sequence selected from the group consisting of any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, and 13. In embodiments, the anti-PSMA binding domain binds to, competes with, or is the same epitope as an anti-PSMA binding domain comprising an LCVR amino acid sequence selected from the group consisting of any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, and 14.

[0265] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising an HCVR that comprises a CDR1 amino acid sequence selected from the group consisting of SEQ ID NOs: 37 to 54, a CDR2 amino acid sequence selected from the group consisting of SEQ ID NOs: 55 to 72, and a CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 73 to 90. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising an LCVR that comprises a CDR1 amino acid sequence selected from the group consisting of SEQ ID NOs: 91 to 108, a CDR2 amino acid sequence selected from the group consisting of SEQ ID NOs: 109 to 126, and a CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 127 to 144.

[0266] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising an HCVR comprising a CDR1 amino acid sequence selected from the group consisting of SEQ ID NOs: 37 to 43, a CDR2 amino acid sequence selected from the group consisting of SEQ ID NOs: 55 to 61, and a CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 73 to 79. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising an LCVR comprising a CDR1 amino acid sequence selected from the group consisting of SEQ ID NOs: 91 to 97, a CDR2 amino acid sequence selected from the group consisting of SEQ ID NOs: 109 to 115, and a CDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 127 to 133.

[0267] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising the HCVR amino acid sequence set forth in SEQ ID NO: 1 and the LCVR amino acid sequence set forth in SEQ ID NO: 2. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising the HCVR amino acid sequence set forth in SEQ ID NO: 3 and the LCVR amino acid sequence set forth in SEQ ID NO: 4. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising the HCVR amino acid sequence set forth in SEQ ID NO: 5 and the LCVR amino acid sequence set forth in SEQ ID NO: 6. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising the HCVR amino acid sequence set forth in SEQ ID NO: 7 and the LCVR amino acid sequence set forth in SEQ ID NO: 8. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising the HCVR amino acid sequence set forth in SEQ ID NO: 9 and the LCVR amino acid sequence set forth in SEQ ID NO: 10. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising the HCVR amino acid sequence set forth in SEQ ID NO: 11 and the LCVR amino acid sequence set forth in SEQ ID NO: 12. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising the HCVR amino acid sequence set forth in SEQ ID NO: 13 and the LCVR amino acid sequence set forth in SEQ ID NO: 14.In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising the HCVR amino acid sequence set forth in SEQ ID NO: 15 and the LCVR amino acid sequence set forth in SEQ ID NO: 16. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising the HCVR amino acid sequence set forth in SEQ ID NO: 17 and the LCVR amino acid sequence set forth in SEQ ID NO: 18. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising the HCVR amino acid sequence set forth in SEQ ID NO: 19 and the LCVR amino acid sequence set forth in SEQ ID NO: 20. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising the HCVR amino acid sequence set forth in SEQ ID NO: 21 and the LCVR amino acid sequence set forth in SEQ ID NO: 22. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising the HCVR amino acid sequence set forth in SEQ ID NO: 23 and the LCVR amino acid sequence set forth in SEQ ID NO: 24. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising the HCVR amino acid sequence set forth in SEQ ID NO: 25 and the LCVR amino acid sequence set forth in SEQ ID NO: 26.In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising the HCVR amino acid sequence set forth in SEQ ID NO: 27 and the LCVR amino acid sequence set forth in SEQ ID NO: 28. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising the HCVR amino acid sequence set forth in SEQ ID NO: 29 and the LCVR amino acid sequence set forth in SEQ ID NO: 30. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising the HCVR amino acid sequence set forth in SEQ ID NO: 31 and the LCVR amino acid sequence set forth in SEQ ID NO: 32. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising the HCVR amino acid sequence set forth in SEQ ID NO: 33 and the LCVR amino acid sequence set forth in SEQ ID NO: 34. In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising the HCVR amino acid sequence set forth in SEQ ID NO: 35 and the LCVR amino acid sequence set forth in SEQ ID NO: 36.

[0268] Preferred embodiments include those in which the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising the HCVR amino acid sequence set forth in SEQ ID NO:1 and the LCVR amino acid sequence set forth in SEQ ID NO:2, the HCVR amino acid sequence set forth in SEQ ID NO:3 and the LCVR amino acid sequence set forth in SEQ ID NO:4, the HCVR amino acid sequence set forth in SEQ ID NO:5 and the LCVR amino acid sequence set forth in SEQ ID NO:6, the HCVR amino acid sequence set forth in SEQ ID NO:7 and the LCVR amino acid sequence set forth in SEQ ID NO:8, the HCVR amino acid sequence set forth in SEQ ID NO:9 and the LCVR amino acid sequence set forth in SEQ ID NO:10, the HCVR amino acid sequence set forth in SEQ ID NO:11 and the LCVR amino acid sequence set forth in SEQ ID NO:12, or the HCVR amino acid sequence set forth in SEQ ID NO:13 and the LCVR amino acid sequence set forth in SEQ ID NO:14.

[0269] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising an HCVR comprising the CDR1 sequence set forth in SEQ ID NO: 37, the CDR2 sequence set forth in SEQ ID NO: 55, and the CDR3 sequence set forth in SEQ ID NO: 73, and / or an LCVR comprising the CDR1 sequence set forth in SEQ ID NO: 91, the CDR2 sequence set forth in SEQ ID NO: 109, and the CDR3 sequence set forth in SEQ ID NO: 127.

[0270] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising an HCVR comprising the CDR1 sequence set forth in SEQ ID NO: 38, the CDR2 sequence set forth in SEQ ID NO: 56, and the CDR3 sequence set forth in SEQ ID NO: 74, and / or an LCVR comprising the CDR1 sequence set forth in SEQ ID NO: 92, the CDR2 sequence set forth in SEQ ID NO: 110, and the CDR3 sequence set forth in SEQ ID NO: 128.

[0271] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising an HCVR comprising the CDR1 sequence set forth in SEQ ID NO: 39, the CDR2 sequence set forth in SEQ ID NO: 57, and the CDR3 sequence set forth in SEQ ID NO: 75, and / or an LCVR comprising the CDR1 sequence set forth in SEQ ID NO: 93, the CDR2 sequence set forth in SEQ ID NO: 111, and the CDR3 sequence set forth in SEQ ID NO: 129.

[0272] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising an HCVR comprising the CDR1 sequence set forth in SEQ ID NO: 40, the CDR2 sequence set forth in SEQ ID NO: 58, and the CDR3 sequence set forth in SEQ ID NO: 76, and / or an LCVR comprising the CDR1 sequence set forth in SEQ ID NO: 94, the CDR2 sequence set forth in SEQ ID NO: 112, and the CDR3 sequence set forth in SEQ ID NO: 130.

[0273] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising an HCVR comprising the CDR1 sequence set forth in SEQ ID NO: 41, the CDR2 sequence set forth in SEQ ID NO: 59, and the CDR3 sequence set forth in SEQ ID NO: 77, and / or an LCVR comprising the CDR1 sequence set forth in SEQ ID NO: 95, the CDR2 sequence set forth in SEQ ID NO: 113, and the CDR3 sequence set forth in SEQ ID NO: 131.

[0274] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising an HCVR comprising the CDR1 sequence set forth in SEQ ID NO: 42, the CDR2 sequence set forth in SEQ ID NO: 60, and the CDR3 sequence set forth in SEQ ID NO: 78, and / or an LCVR comprising the CDR1 sequence set forth in SEQ ID NO: 96, the CDR2 sequence set forth in SEQ ID NO: 114, and the CDR3 sequence set forth in SEQ ID NO: 132.

[0275] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising an HCVR comprising the CDR1 sequence set forth in SEQ ID NO: 43, the CDR2 sequence set forth in SEQ ID NO: 61, and the CDR3 sequence set forth in SEQ ID NO: 79, and / or an LCVR comprising the CDR1 sequence set forth in SEQ ID NO: 97, the CDR2 sequence set forth in SEQ ID NO: 115, and the CDR3 sequence set forth in SEQ ID NO: 133.

[0276] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising an HCVR comprising the CDR1 sequence set forth in SEQ ID NO: 44, the CDR2 sequence set forth in SEQ ID NO: 62, and the CDR3 sequence set forth in SEQ ID NO: 80, and / or an LCVR comprising the CDR1 sequence set forth in SEQ ID NO: 98, the CDR2 sequence set forth in SEQ ID NO: 116, and the CDR3 sequence set forth in SEQ ID NO: 134.

[0277] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising an HCVR comprising the CDR1 sequence set forth in SEQ ID NO: 45, the CDR2 sequence set forth in SEQ ID NO: 63, and the CDR3 sequence set forth in SEQ ID NO: 81, and / or an LCVR comprising the CDR1 sequence set forth in SEQ ID NO: 99, the CDR2 sequence set forth in SEQ ID NO: 117, and the CDR3 sequence set forth in SEQ ID NO: 135.

[0278] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising an HCVR comprising the CDR1 sequence set forth in SEQ ID NO: 46, the CDR2 sequence set forth in SEQ ID NO: 64, and the CDR3 sequence set forth in SEQ ID NO: 82, and / or an LCVR comprising the CDR1 sequence set forth in SEQ ID NO: 100, the CDR2 sequence set forth in SEQ ID NO: 118, and the CDR3 sequence set forth in SEQ ID NO: 136.

[0279] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising an HCVR comprising the CDR1 sequence set forth in SEQ ID NO: 47, the CDR2 sequence set forth in SEQ ID NO: 65, and the CDR3 sequence set forth in SEQ ID NO: 83, and / or an LCVR comprising the CDR1 sequence set forth in SEQ ID NO: 101, the CDR2 sequence set forth in SEQ ID NO: 119, and the CDR3 sequence set forth in SEQ ID NO: 137.

[0280] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising an HCVR comprising the CDR1 sequence set forth in SEQ ID NO: 48, the CDR2 sequence set forth in SEQ ID NO: 66, and the CDR3 sequence set forth in SEQ ID NO: 84, and / or an LCVR comprising the CDR1 sequence set forth in SEQ ID NO: 102, the CDR2 sequence set forth in SEQ ID NO: 120, and the CDR3 sequence set forth in SEQ ID NO: 138.

[0281] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising an HCVR comprising the CDR1 sequence set forth in SEQ ID NO: 49, the CDR2 sequence set forth in SEQ ID NO: 67, and the CDR3 sequence set forth in SEQ ID NO: 85, and / or an LCVR comprising the CDR1 sequence set forth in SEQ ID NO: 103, the CDR2 sequence set forth in SEQ ID NO: 121, and the CDR3 sequence set forth in SEQ ID NO: 139.

[0282] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising an HCVR comprising the CDR1 sequence set forth in SEQ ID NO: 50, the CDR2 sequence set forth in SEQ ID NO: 68, and the CDR3 sequence set forth in SEQ ID NO: 86, and / or an LCVR comprising the CDR1 sequence set forth in SEQ ID NO: 104, the CDR2 sequence set forth in SEQ ID NO: 122, and the CDR3 sequence set forth in SEQ ID NO: 140.

[0283] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising an HCVR comprising the CDR1 sequence set forth in SEQ ID NO: 51, the CDR2 sequence set forth in SEQ ID NO: 69, and the CDR3 sequence set forth in SEQ ID NO: 87, and / or an LCVR comprising the CDR1 sequence set forth in SEQ ID NO: 105, the CDR2 sequence set forth in SEQ ID NO: 123, and the CDR3 sequence set forth in SEQ ID NO: 141.

[0284] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising an HCVR comprising the CDR1 sequence set forth in SEQ ID NO: 52, the CDR2 sequence set forth in SEQ ID NO: 70, and the CDR3 sequence set forth in SEQ ID NO: 88, and / or an LCVR comprising the CDR1 sequence set forth in SEQ ID NO: 106, the CDR2 sequence set forth in SEQ ID NO: 124, and the CDR3 sequence set forth in SEQ ID NO: 142.

[0285] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising an HCVR comprising the CDR1 sequence set forth in SEQ ID NO: 53, the CDR2 sequence set forth in SEQ ID NO: 71, and the CDR3 sequence set forth in SEQ ID NO: 89, and / or an LCVR comprising the CDR1 sequence set forth in SEQ ID NO: 107, the CDR2 sequence set forth in SEQ ID NO: 125, and the CDR3 sequence set forth in SEQ ID NO: 143.

[0286] In embodiments, the isolated nucleic acid encodes an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising an HCVR comprising the CDR1 sequence set forth in SEQ ID NO: 54, the CDR2 sequence set forth in SEQ ID NO: 72, and the CDR3 sequence set forth in SEQ ID NO: 90, and / or an LCVR comprising the CDR1 sequence set forth in SEQ ID NO: 108, the CDR2 sequence set forth in SEQ ID NO: 126, and the CDR3 sequence set forth in SEQ ID NO: 144.

[0287] In a preferred embodiment, the isolated nucleic acid is selected from the group consisting of: an HCVR comprising the CDR1 sequence set forth in SEQ ID NO: 37, the CDR2 sequence set forth in SEQ ID NO: 55, and the CDR3 sequence set forth in SEQ ID NO: 73, and an LCVR comprising the CDR1 sequence set forth in SEQ ID NO: 91, the CDR2 sequence set forth in SEQ ID NO: 109, and the CDR3 sequence set forth in SEQ ID NO: 127; an HCVR comprising the CDR1 sequence set forth in SEQ ID NO: 38, the CDR2 sequence set forth in SEQ ID NO: 56, and the CDR3 sequence set forth in SEQ ID NO: 74, and an LCVR comprising the CDR1 sequence set forth in SEQ ID NO: 92, the CDR2 sequence set forth in SEQ ID NO: 110, and the CDR3 sequence set forth in SEQ ID NO: 128; an HCVR comprising the CDR1 sequence set forth in SEQ ID NO: 39, the CDR2 sequence set forth in SEQ ID NO: 57, and the CDR3 sequence set forth in SEQ ID NO: 75, and an LCVR comprising the CDR1 sequence set forth in SEQ ID NO: 93, the CDR2 sequence set forth in SEQ ID NO: 111, and the CDR3 sequence set forth in SEQ ID NO: 129. an LCVR comprising the sequence; an HCVR comprising the CDR1 sequence shown in SEQ ID NO: 40, the CDR2 sequence shown in SEQ ID NO: 58, and the CDR3 sequence shown in SEQ ID NO: 76, and an LCVR comprising the CDR1 sequence shown in SEQ ID NO: 94, the CDR2 sequence shown in SEQ ID NO: 112, and the CDR3 sequence shown in SEQ ID NO: 130; an HCVR comprising the CDR1 sequence shown in SEQ ID NO: 41, the CDR2 sequence shown in SEQ ID NO: 59, and the CDR3 sequence shown in SEQ ID NO: 77, and an LCVR comprising the CDR1 sequence shown in SEQ ID NO: 95, the CDR2 sequence shown in SEQ ID NO: 113, and the CDR3 sequence shown in SEQ ID NO: 131; an HCVR comprising the CDR1 sequence shown in SEQ ID NO: 42, the CDR2 sequence shown in SEQ ID NO: 60, and the CDR3 sequence shown in SEQ ID NO: 78, and an LCVR comprising the CDR1 sequence shown in SEQ ID NO: 96, the CDR2 sequence shown in SEQ ID NO: 114, and the CDR3 sequence shown in SEQ ID NO: 132;or embodiments encoding an anti-PSMA binding domain that binds to the same epitope as, competes with, or is an anti-PSMA binding domain comprising an HCVR comprising the CDR1 sequence set forth in SEQ ID NO: 43, the CDR2 sequence set forth in SEQ ID NO: 61, and the CDR3 sequence set forth in SEQ ID NO: 79, and an LCVR comprising the CDR1 sequence set forth in SEQ ID NO: 97, the CDR2 sequence set forth in SEQ ID NO: 115, and the CDR3 sequence set forth in SEQ ID NO: 133;

[0288] Other anti-PSMA binding domains and anti-PSMA CARs are known and can be used in accordance with the teachings of the present disclosure. See, e.g., WO2017180713, WO2019245991A1, WO2002098897, WO2001009192, WO2016179534, WO2019224718, WO2021 / 188599, WO2016111344, WO2017027325, WO2018098354, WO2017212250, WO2021 / 050656, and Narayan et al., (2022) Nature Medicine. doi:10.1038, the contents of each of which are expressly incorporated herein by reference in their entirety. In preferred embodiments, such anti-PSMA binding domains are incorporated into CARs as described herein, or known CARs are used as is or modified in accordance with the present disclosure, wherein said CARs are expressed in γδ T cells for use in the methods described herein.

[0289] 2. Transmembrane domain The CAR of the present disclosure may comprise a transmembrane domain that couples the antigen-binding domain of the CAR to one or more intracellular domains of the CAR. The transmembrane domain of the CAR of the present disclosure is a region that can span the cell membrane of a cell (e.g., a γδ T cell). In embodiments, the transmembrane domain is inserted between the antigen-binding domain of the CAR and one or more intracellular domains.

[0290] In embodiments, the transmembrane domain is naturally associated with one or more domains in the CAR. In embodiments, the transmembrane domain can be selected or modified by one or more amino acid substitutions to avoid binding of such domains to transmembrane domains of the same or different surface membrane proteins and minimize interaction with other members of the receptor complex.

[0291] For example, but not by way of limitation, the transmembrane domain may be of natural or synthetic origin. If the source is natural, the domain may be derived from any membrane-bound or transmembrane protein. Transmembrane regions of particular use in the present invention include 4-1BB / CD137, activating NK cell receptor, immunoglobulin proteins, B7-H3, BAFFR, BL4-1BB / CD137, activating NK cell receptor, immunoglobulin proteins, B7-H3, BAFFR, BLAME (SLAMF8), BTLA, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, or CD154, CD100 (S EMA4D), CD103, CD160 (BY55), CD18, CD19, CD19a, CD2, CD247, CD27, CD276 (B7-H3), CD28, CD29, CD3 delta, CD3 epsilon, CD3 gamma, CD3 zeta, CD30, CD4, CD40, CD49a, CD49D, CD49f, CD69, CD7, CD84, CD8, CD8α, CD8β, CD96 (Tactile), CD11a, CD11b, CD11c, CD11d, CDS, CEACAM1, CRTAM, cytokines Ligands that specifically bind to integrin receptors, DAP10, DNAM1 (CD226), Fc gamma receptor, GADS, GITR, HVEM (LIGHTR), IA4, ICAM-1, Igα (CD79a), IL-2Rβ, IL-2Rγ, IL-7Rα, inducible T cell costimulatory factor (ICOS), integrins, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB2, ITGB7, ITGB1, KIRDS2, LAT, LFA-1, CD83, LIGHT, and LTB R, Ly9 (CD229), lymphocyte function-associated antigen-1 (LFA-1; CD11a / CD18), MHC class 1 molecules, NKG2C, NKG2D, NKp30, NKp44, NKp46, NKp80 (KLRF1), OX-40, PAG / Cbp, programmed death-1 (PD-1), PSGL1, SELPLG (CD162), signaling lymphocyte activation molecule (SLAM protein), SLAM (SLAMF1; CD150; IPO-3), SLAMF4 (CD244; 2B4), SLAMF6 (NTB-A;Ly108), SLAMF7, SLP-76, TNF receptor protein, TNFR2, TNFSF14, Toll ligand receptor, TRANCE / RANKL, VLA1, or VLA-6, or a fragment, truncation, or combination thereof (i.e., comprising at least the transmembrane region(s) thereof). Alternatively, the transmembrane domain may be synthetic, in which case it will primarily comprise hydrophobic residues such as leucine and valine. Preferably, a phenylalanine, tryptophan, and valine triplet will be found at each end of the synthetic transmembrane domain.

[0292] In certain embodiments, the transmembrane domain comprises the transmembrane domain of CD8. In certain embodiments, the transmembrane domain of CD8 is the transmembrane domain of CD8α. In certain embodiments, the transmembrane domain of CD8 comprises the amino acid sequence set forth in SEQ ID NO: 158. In certain embodiments, the transmembrane domain comprises the transmembrane domain of CD28. In certain embodiments, the transmembrane domain of CD28 comprises the amino acid sequence set forth in SEQ ID NO: 285. In certain embodiments, the transmembrane domain comprises the transmembrane domain of ICOS. In certain embodiments, the transmembrane domain of ICOS comprises the amino acid sequence set forth in SEQ ID NO: 286.

[0293] The transmembrane domains described herein can be combined with any of the antigen binding domains described herein, any of the intracellular domains described herein, or any of the other domains described herein that can be included in a subject CAR.

[0294] In embodiments, the transmembrane domain further comprises a hinge region. A subject CAR of the present invention may also comprise a hinge region. The hinge region of a CAR is a hydrophilic region located between the antigen-binding domain and the transmembrane domain. In embodiments, this domain promotes proper protein folding of the CAR. The hinge region is an optional component of a CAR. The hinge region may comprise a domain selected from an Fc fragment of an antibody, a hinge region of an antibody, a CH2 region of an antibody, a CH3 region of an antibody, an artificial hinge sequence, or a combination thereof. Examples of hinge regions include, but are not limited to, a CD8α hinge, a CD8β hinge, a CD28 hinge, a 4-1BB hinge, a CD7 hinge, an artificial hinge made of a polypeptide that may be as large as three glycines (Gly), and the CHI and CH3 domains of IgG (such as human IgG4). A naturally occurring hinge domain may be used as the wild-type hinge region, or the molecule may be modified.

[0295] In embodiments, a subject CAR of the present disclosure comprises a hinge region that couples the antigen-binding domain to the transmembrane domain, which in turn couples to one or more intracellular domain(s). The hinge region preferably can support the antigen-binding domain in recognizing and binding to a target antigen on a target cell (see, e.g., Hudecek et al., Cancer Immunol. Res. (2015) 3(2):125-135). In embodiments, the hinge region is a flexible domain, thus enabling the antigen-binding domain to have a structure that optimally recognizes the specific structure and density of the target antigen on a cell, such as a tumor cell (Hudecek et al., supra). The flexibility of the hinge region allows it to adopt many different conformations. In embodiments, the hinge region is an immunoglobulin heavy chain hinge region. In embodiments, the hinge region is a receptor-derived hinge region polypeptide (e.g., a hinge region from CD8).

[0296] The hinge region can have a length of about 4 to about 50 amino acids, e.g., about 4 to about 10 amino acids, about 10 to about 15 amino acids, about 15 to about 20 amino acids, about 20 to about 25 amino acids, about 25 to about 30 amino acids, about 30 to about 40 amino acids, or about 40 to about 50 amino acids. In embodiments, the hinge region can have a length of more than 5 amino acids, more than 10 amino acids, more than 15 amino acids, more than 20 amino acids, more than 25 amino acids, more than 30 amino acids, more than 35 amino acids, more than 40 amino acids, more than 45 amino acids, more than 50 amino acids, more than 55 amino acids, or more.

[0297] A suitable hinge region can be readily selected and can be of any suitable length, such as, for example, from 1 amino acid (e.g., Gly) to 20 amino acids, from 2 to 15 amino acids, from 3 to 12 amino acids, from 4 to 10 amino acids, from 5 to 9 amino acids, from 6 to 8 amino acids, or from 7 to 8 amino acids, and can be 1, 2, 3, 4, 5, 6, or 7 amino acids. Suitable hinge regions can have a length of more than 20 amino acids (e.g., 30, 40, 50, 60, or more amino acids).

[0298] For example, the hinge region can include glycine polymers (G)n, glycine-serine polymers (e.g., (GS)n, (GSGGS)n (SEQ ID NO:275), and (GGGS)n (SEQ ID NO:276), where n is an integer of at least 1), glycine-alanine polymers, alanine-serine polymers, and other flexible linkers known in the art. Glycine and glycine-serine polymers can be used; both Gly and Ser are relatively unstructured and can therefore function as neutral tethers between components. Glycine polymers can be used; glycine utilizes much more φ-ψ space than alanine and is much less restricted than residues with long side chains (see, e.g., Scheraga, Rev. Computational. Chem. (1992) 2:73-142). Exemplary hinge regions may comprise amino acid sequences including, but not limited to, GGSG (SEQ ID NO: 278), GGSGG (SEQ ID NO: 279), GSGSG (SEQ ID NO: 280), GSGGG (SEQ ID NO: 281), GGGSG (SEQ ID NO: 282), GSSSG (SEQ ID NO: 283), and the like.

[0299] In embodiments, the hinge region is an immunoglobulin heavy chain hinge region. The amino acid sequences of immunoglobulin hinge regions are known in the art. See, e.g., Tan et al., Proc. Natl. Acad. Sci. USA (1990) 87(1):162-166, and Huck et al., Nucleic Acids Res. (1986) 14(4):1779-1789. As non-limiting examples, an immunoglobulin hinge region can comprise one of the following amino acid sequences: DKTHT (SEQ ID NO: 287), CPPC (SEQ ID NO: 288); CPEPKSCDTPPPCPR (SEQ ID NO: 289) (see, e.g., Glaser et al., J. Biol. Chem. (2005) 280:41494-41503), ELKTPLGDTTHT (SEQ ID NO: 290), KSCDKTHTCP (SEQ ID NO: 291); KCCVDCP (SEQ ID NO: 292), KYGPPCP (SEQ ID NO: 293), EPKSCDKTHTCPPCP (SEQ ID NO: 294) (human IgG1 hinge), ERKCCVECPPCP (SEQ ID NO: 295) (human IgG2 hinge), ELKTPLGDTTHTCPRCP (SEQ ID NO: 296) (human IgG3 hinge), SPNMVPHAHHAQ (SEQ ID NO: 297) (human IgG4 hinge), etc.

[0300] The hinge region can comprise the amino acid sequence of a human IgG1, IgG2, IgG3, or IgG4 hinge region. In one embodiment, the hinge region can comprise one or more amino acid substitutions and / or insertions and / or deletions compared to a wild-type (natural) hinge region. For example, His229 of a human IgG1 hinge can be substituted with Tyr, such that the hinge region comprises the sequence EPKSCDKTYTCPPCP (SEQ ID NO: 298). See, e.g., Yan et al., J. Biol. Chem. (2012) 287:5891-5897.

[0301] In certain embodiments, the hinge region may comprise an amino acid sequence derived from human CD8, or a variant thereof. In certain embodiments, the CAR comprises a CD8 alpha hinge sequence comprising the amino acid sequence set forth in SEQ ID NO: 156. In certain embodiments, the CAR comprises a hinge and transmembrane domain sequence comprising the amino acid sequence set forth in SEQ ID NO: 160.

[0302] 3. Costimulatory Domain In embodiments, the CAR encoded by the nucleic acid may further comprise at least one costimulatory domain, wherein the costimulatory domain comprises a functional costimulatory signaling domain derived from, for example, an MHC class I molecule, a TNF receptor protein, an immunoglobulin-like protein, a cytokine receptor, an integrin, a signaling lymphocyte activation molecule (SLAM protein), an activating NK cell receptor, BTLA, a Toll ligand receptor, etc. For example, it is within the scope of the present disclosure that a CAR may comprise two, three, four, or more costimulatory domains. It is also within the scope of the present disclosure that when multiple costimulatory domains are included, the costimulatory domains may be the same or different.In embodiments, the costimulatory domain is selected from the group consisting of TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, CARD11, B7-H3, CEACAM1, CRTAM, CD2, CD3C, CD4, CD7, CD8α, CD8β, CD11a, CD11b, CD11c, CD11d, IL2Rβ, IL2γ, IL7Rα, IL4R, IL7R, IL15R, IL21R, CD18, CD19, CD19a, CD27, CD28, CD29, C D30, CD40, CDS, CD49a, CD49D, CD49f, CD54(ICAM), CD69, CD70, CD80, CD83, CD84, CD86, CD96(Tactile), CD100(SEMA4D), CD103, CD 134(OX40), CD137(4-1BB), CD152(CTLA-4), CD160(BY55), CD162(SELPLG), CD244(2B4), CD270(HVEM), CD226(DNAM1), CD229(Ly9 ), CD278(ICOS), ICAM-1, LFA-1(CD11a / CD18), FcR, FcγRI, FcγRII, FcγRIII, LAT, NKG2C, SLP76, TRIM, ZAP70, GITR, BAFFR, LTBR, ​​L AT, GADS, LIGHT, HVEM(LIGHTR), KIRDS2, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB1, ITGB2, ITGB7, NKG2C, NKG2D, IA 4, derived from one or more of VLA-1, VLA-6, SLAM (SLAMF1, CD150, IPO-3), SLAMF4, SLAMF6 (NTB-A, Ly108), SLAMF7, SLAMF8 (BLAME), SLP-76, PAG / Cbp, NKp80 (KLRF1), NKp44, NKp30, NKp46, BTLA, JAML, CD150, PSGL1, TSLP, TNFR2, and TRANCE / RANKL, or portions thereof, and one or more combinations thereof.

[0303] In embodiments, the nucleic acid encoding the CAR encodes at least one 4-1BB costimulatory domain and, optionally, a second costimulatory domain selected from 4-1BB, 2B4, ICOS, CD28, OX40, and CD27 costimulatory domains, or any of the costimulatory domains described above. In embodiments, the nucleic acid encodes at least two 4-1BB costimulatory domains, or at least two 4-1BB costimulatory domains in combination with one, two, three, or four or more costimulatory domains selected from 4-1BB, ICOS, CD28, OX40, and CD27, or any of the costimulatory domains described above. In embodiments, the 4-1BB costimulatory domain comprises the amino acid sequence set forth in SEQ ID NO: 162. In embodiments, the 4-1BB costimulatory domain comprises an amino acid sequence having at least one, at least two, or at least three, or more modifications of the amino acid sequence of SEQ ID NO: 162. In some embodiments, the 4-1BB costimulatory domain is substantially similar to a 4-1BB costimulatory domain comprising SEQ ID NO: 162.

[0304] In embodiments, the nucleic acid encoding the CAR encodes at least one CD27 costimulatory domain and, optionally, at least one second costimulatory domain selected from 4-1BB, ICOS, CD28, OX40, 2B4, and a CD27 costimulatory domain, or any of the costimulatory domains described above. In embodiments, the nucleic acid encodes at least one CD27 costimulatory domain and a 4-IBB costimulatory domain. In embodiments, the nucleic acid encodes two CD27 costimulatory domains and at least one second costimulatory domain selected from 4-1BB, ICOS, CD28, and CD27. In embodiments, the CD27 costimulatory domain comprises SEQ ID NO: 39. In embodiments, the CD27 costimulatory domain comprises an amino acid sequence having at least one, at least two, at least three, or more modifications of the amino acid sequence of SEQ ID NO: 300. In some embodiments, the CD27 costimulatory domain is substantially similar to a CD27 costimulatory domain comprising SEQ ID NO: 300.

[0305] In embodiments, the nucleic acid encoding the CAR encodes at least one CD28 costimulatory domain and, optionally, a second costimulatory domain selected from 4-1BB, 2B4, ICOS, CD28, OX40, and CD27 costimulatory domains, or any of the costimulatory domains described above. In embodiments, the nucleic acid encodes at least two CD28 costimulatory domains, or at least two CD28 costimulatory domains in combination with one, two, three, or four or more costimulatory domains selected from 4-1BB, ICOS, CD28, OX40, and CD27, or any of the costimulatory domains described above. In some embodiments, the CD28 costimulatory domain comprises SEQ ID NO: 254. In some embodiments, the CD28 costimulatory domain comprises SEQ ID NO: 301. Included in SEQ ID NO: 254 and SEQ ID NO: 301 are three subdomains capable of regulating signaling pathways: YMNM, PRRP, and PYAP. In embodiments, the disclosed CARs comprise mutations or deletions of one or more of the subdomains (see, e.g., WO2019010383). In embodiments, the CD28 costimulatory domain comprises the amino acid sequence of SEQ ID NO: 254, or an amino acid sequence having at least one, at least two, at least three, or more modifications of the amino acid sequence of SEQ ID NO: 301. In embodiments, the CD28 costimulatory domain is substantially similar to a CD28 costimulatory domain comprising SEQ ID NO: 254. In embodiments, the CD28 costimulatory domain is substantially similar to a CD28 costimulatory domain comprising SEQ ID NO: 301.

[0306] In embodiments, the nucleic acid encoding the CAR encodes at least one ICOS costimulatory domain and, optionally, a second costimulatory domain selected from 4-1BB, 2B4, ICOS, CD28, OX40, and CD27 costimulatory domains, or any of the costimulatory domains described above. In embodiments, the nucleic acid encodes at least two ICOS costimulatory domains, or at least two ICOS costimulatory domains in combination with one, two, three, or more costimulatory domains selected from 4-1BB, ICOS, CD28, OX40, and CD27, or any of the costimulatory domains described above. In embodiments, the ICOS costimulatory domain comprises SEQ ID NO: 255. In embodiments, the ICOS costimulatory domain comprises an amino acid sequence having at least one, at least two, at least three, or more modifications of the amino acid sequence of SEQ ID NO: 255 (see, e.g., US20170209492). In embodiments, the ICOS costimulatory domain is substantially similar to an ICOS costimulatory domain comprising SEQ ID NO: 255.

[0307] In embodiments, the nucleic acid encoding the CAR encodes at least one OX40 costimulatory domain and, optionally, a second costimulatory domain selected from 4-1BB, 2B4, ICOS, CD28, OX40, and CD27 costimulatory domains, or any of the costimulatory domains described above. In embodiments, the nucleic acid encodes at least two OX40 costimulatory domains, or at least two OX40 costimulatory domains in combination with one, two, three, or more costimulatory domains selected from 4-1BB, ICOS, CD28, OX40, and CD27, or any of the costimulatory domains described above. In embodiments, the OX40 costimulatory domain comprises SEQ ID NO: 256. In embodiments, the OX40 costimulatory domain comprises an amino acid sequence having at least one, at least two, at least three, or more modifications of the amino acid sequence of SEQ ID NO: 256. In embodiments, the OX40 costimulatory domain is substantially similar to an OX40 costimulatory domain comprising SEQ ID NO: 256.

[0308] 4. Intracellular signaling domain In embodiments, the nucleic acid encoding a CAR encodes at least one intracellular signaling domain. In embodiments, the at least one intracellular signaling domain is in addition to one or more costimulatory domains. In embodiments, the one or more intracellular signaling domains are included to enhance proliferation, persistence, and / or cytotoxic activity of host cells, preferably γδ cells, harboring a CAR as disclosed herein. For example, in some embodiments, the intracellular signaling domain(s) include signaling domains from CD3ζ, repeats (e.g., 2-5) of the DAP10 YINM motif; LFA-1, DAP12, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD79a, CD79b, CD5, CD22, FcεRI, CD66d, etc. It is within the scope of the present disclosure that the endodomain of the disclosed CARs can include multiple (e.g., 2, 3, 4, or more) intracellular signaling domains. When multiple intracellular signaling domains are included, the intracellular signaling domains can be the same or different.

[0309] In embodiments, the intracellular signaling domain of the disclosed CAR is or comprises a CD3ζ signaling domain. In embodiments, the signaling domain of CD3ζ is or comprises the amino acid sequence set forth in SEQ ID NO: 164, 166, or 167.

[0310] 5. Additional Polypeptides In embodiments, an isolated nucleic acid encoding a CAR of the subject invention can also encode one or more polycistronic linker region(s) configured to facilitate translation of the CAR polypeptide and one or more additional polypeptides. In embodiments, the nucleic acid encoding the one or more additional polypeptides and associated linker region(s) can be located at the 3' end of the isolated nucleic acid, or at the 5' end of the isolated nucleic acid, or in some examples, at both the 5' and 3' ends of the isolated nucleic acid. In some examples, the linker region(s) can encode a self-cleaving and / or cleavage polypeptide sequence. In some examples, the self-cleaving sequence is a 2A self-cleaving sequence (e.g., T2A, P2A, E2A, F2A) that can induce ribosome skipping during translation of the CAR. In embodiments, the cleavage sequence is a furin sequence. In some examples, the cleavage sequence (e.g., the furin cleavage sequence set forth in SEQ ID NO: 242) is the amino terminus of a self-cleaving sequence, e.g., furin P2A (FP2A). In embodiments, the polycistronic linker region encodes an internal ribosome entry site. In embodiments, the addition of an optional linker, such as "GSG" or "SGSG," may improve cleavage efficiency. In this way, one or more additional polypeptides may be released from the CAR and directed to the secretory pathway.

[0311] In embodiments, the cleavage sequence is the FP2A amino acid sequence set forth in SEQ ID NO: 236. In embodiments, the cleavage sequence is the P2A amino acid sequence set forth in SEQ ID NO: 238 or SEQ ID NOs: 240-241. In embodiments, the cleavage sequence is the amino acid sequence of Furin set forth in SEQ ID NO: 242. In embodiments, the cleavage sequence is the F2A amino acid sequence set forth in SEQ ID NO: 243. In embodiments, the cleavage sequence is the E2A amino acid sequence set forth in SEQ ID NO: 244. In embodiments, the cleavage sequence is the T2A amino acid sequence set forth in SEQ ID NO: 245. In certain aspects, multiple cleavage sequences and / or self-cleaving sequences may be encoded at the carboxy terminus of the signaling domain and / or costimulatory domain(s) and the amino terminus of the encoded one or more additional polypeptides. In certain aspects, one or more self-cleaving sequences and one or more sequences cleaved by an endogenous protease are encoded in the constructs described herein. In certain embodiments, an endogenous protease recognition site is encoded at the amino terminus of the self-cleaving sequence.

[0312] In embodiments, the polycistronic linker region encodes an internal ribosome entry site. An exemplary internal ribosome entry site is encoded by the nucleotide sequence set forth in SEQ ID NO: 246. Another exemplary internal ribosome entry site is encoded by the nucleotide sequence set forth in SEQ ID NO: 247. Further suitable internal ribosome entry sites include those disclosed in Nucleic Acids Res. 2010, Jan;38 (Database issue):D131-6. doi:10.1093 / nar / gkp981. Epub, 2009, Nov. 16; those disclosed in Epub 2009 Nov 16; those described at iresite.org; those described in WO2018 / 215787; the sequence set forth in GenBank accession no. KP019382.1; and the IRES element set forth in GenBank accession no. LT727339.1. Additional multicistronic linker regions containing self-cleaving and IRES elements are disclosed in US2018 / 0360992 and US8,865,467.

[0313] In embodiments, the one or more additional polypeptides comprise one or more soluble gamma chain cytokines expressed as a separate polypeptide from the CAR. The one or more soluble common gamma chain cytokines include, but are not limited to, IL-2, IL-4, IL-7, IL-9, IL-15, IL-21, and IL-23. In embodiments, the common gamma chain cytokine is selected from IL-2, IL-7, and IL-15. In embodiments, the common gamma chain cytokine is IL-15. IL-15 sequences, including codon-optimized nucleic acid sequences encoding soluble IL-15 (sIL-15), are disclosed herein and in WO 2007 / 037780.

[0314] In embodiments, the one or more additional polypeptides comprise one or more labels or markers, for example, to facilitate the ability to monitor CAR expression levels, to serve as an internal control, etc. In embodiments, the isolated nucleic acid encoding a CAR encodes a fluorescent protein, examples of which include, but are not limited to, green fluorescent protein (GFP), red fluorescent protein (RFP), enhanced GFP (EGFP), enhanced cyan fluorescent protein (ECFP), enhanced yellow fluorescent protein (EYFP), etc. Other examples can include, but are not limited to, chloramphenicol acetyltransferase, β-galactosidase, β-glucuronidase, β-lactamase, luciferase, etc.

[0315] In embodiments, the one or more additional polypeptides can encode a protein that is expressed on the cell surface to facilitate detection and / or isolation of cells expressing the protein, e.g., via fluorescence-activated cell sorting (FACS); or for enrichment by positive selection using an antibody specific for the encoded protein, e.g., using an antibody to purify or enrich cell products on a column or device; or for in vivo binding of the antibody to the protein to enhance or remove activity, e.g., to facilitate removal of cells expressing the protein in a patient for safety considerations. Exemplary proteins useful for these purposes include, e.g., CD19, CD20 (rituxumab recognition domain), RQR8, LNGFR, truncated human epidermal growth factor receptor (EGFRt), etc. By way of example, EGFRt can be targeted by a clinical-stage antibody, and such treatment of a patient with the antibody results in elimination of isolated nucleic acid encoding a CAR and / or cells containing the CAR as disclosed herein.For example, Wang et al.A transgene-encoded cell surface polypeptide for selection, in vivo tracking, and ablation of engineered cells;Blood 2011 118(5):1255-63;Philip et al.,A highly compact epitope-based marker / suicide gene for easier and safer T-cell therapy;Blood 2014 124(8):1277-87;Smith J.et al.,UCART19,an allogeneic “off-the-shelf” adoptive T-cell immunotherapy against CD19+ B-cell leukemias,DOI:10.1200 / jco.2015.33.15_suppl.3069 Journal of Clinical Oncology 33,no.15_suppl(May 20,2015)3069-3069;Gouble A.et al.,In Vivo Proof of Concept of Activity and Safety of See UCART19, an Allogeneic "Off-the-Shelf" Adoptive T-Cell Immunotherapy Against CD19+ B-Cell Leukemias, Blood (2014) 124(21):4689, doi.org / 10.1182 / blood.V124.21.4689.4689, each of which is incorporated by reference in its entirety.

[0316] In embodiments, the one or more additional polypeptides include proteins that function to enhance resistance to exhaustion- and activation-induced apoptosis and / or upregulate one or more pro-inflammatory cytokines, costimulatory molecules, and / or antigen presentation machinery. Representative examples include, but are not limited to, lymphotoxin beta receptor (LTBR). LTBR is normally expressed in a subset of myeloid cells but is absent in lymphocytes. When expressed in T cells, LTBR may induce transcriptional remodeling that confers one or more of the above-mentioned beneficial functions on T cells (Legut et al., Blood. (2021); 138(1):1726).

[0317] In embodiments, the one or more additional polypeptides include, for example, a polypeptide that confers on the host cell the ability to resist tumor antigen-specific cellular immunity mediated by transforming growth factor beta (TGF-β). For example, the isolated nucleic acid may encode a dominant-negative receptor for TGF-beta (dnTGFβR2), as described, for example, in Foster et al., J. Immunother. (2008); 31:500-505, WO2019 / 173324A1, WO2020 / 183131A1, and WO2020042647A1. Incorporation of such a dominant-negative receptor for TGF-β may confer a functional advantage, such as enhanced anti-tumor activity, in the presence of a tumor secreting TGF-β relative to control cells lacking the dominant-negative receptor for TGF-β.

[0318] In embodiments, the isolated nucleic acid encodes a signal peptide operably linked to facilitate direction of one or more additional polypeptides into the secretory pathway. Such one or more additional polypeptides can be present within a specific organelle, secreted from the host cell, or inserted into the cell membrane. In embodiments, the signal peptide comprises or consists of the amino acid sequence set forth in SEQ ID NO: 152. In embodiments, the signal peptide comprises or consists of the amino acid sequence set forth in SEQ ID NO: 248. In embodiments, the signal peptide comprises or consists of the amino acid sequence set forth in SEQ ID NO: 259. In embodiments, the signal peptide comprises or consists of the amino acid sequence set forth in SEQ ID NO: 263. In embodiments, the signal peptide comprises or consists of the amino acid sequence set forth in SEQ ID NO: 267. In embodiments, the signal peptide comprises or consists of the amino acid sequence set forth in SEQ ID NO: 271.

[0319] In embodiments, the one or more additional polypeptides comprise or consist of the amino acid sequence of EGFRt set forth in SEQ ID NO: 261. In some embodiments, the one or more additional polypeptides comprise or consist of the amino acid sequence of GMCSFR set forth in SEQ ID NO: 260. In embodiments, a signal peptide comprising or consisting of the amino acid sequence set forth as SEQ ID NO: 259 is operably linked to SEQ ID NO: 260. In embodiments, the one or more additional polypeptides comprise or consist of the amino acid sequence of dominant-negative TGFβ receptor II (dnTGFβR2) set forth in SEQ ID NO: 265. In embodiments, a signal peptide comprising or consisting of the amino acid sequence set forth as SEQ ID NO: 263 is operably linked to SEQ ID NO: 265. In embodiments, the one or more additional polypeptides comprise the amino acid sequence of full-length LTBR set forth in SEQ ID NO: 269. In embodiments, a signal peptide comprising or consisting of the amino acid sequence set forth as SEQ ID NO: 267 is operably linked to SEQ ID NO: 269. In embodiments, the one or more additional polypeptides comprise the amino acid sequence of LNGFR set forth in SEQ ID NO: 273. In embodiments, a signal peptide comprising, or consisting of, the amino acid sequence set forth as SEQ ID NO: 271 is operably linked to SEQ ID NO: 273. In embodiments, the one or more additional polypeptides comprise the amino acid sequence of sIL-15 set forth in SEQ ID NO: 249. In embodiments, a signal peptide comprising, or consisting of, the amino acid sequence set forth as SEQ ID NO: 248 is operably linked to SEQ ID NO: 249.

[0320] In embodiments, the one or more additional polypeptides include a chimeric switch receptor comprising an extracellular domain of a TGFβ receptor (e.g., TGFβRI and / or TGFβRII) for binding to TGFβ and an intracellular domain of a cytokine receptor. The chimeric switch receptor can convert a TGFβ signal into a cytokine signal that promotes cytotoxicity. Examples of such chimeric switch receptors include those described in WO2012138858, WO2016122738, WO2018094244, WO2014172584, WO2019109980, and WO2022037562, each of which is incorporated by reference in its entirety.

[0321] In embodiments, the one or more additional polypeptides include a dominant-negative Fas (dnFas). Incorporation of such a dominant-negative Fas into T cells may confer a functional advantage over control cells lacking such a dominant-negative Fas in preventing Fas ligand-induced apoptosis and enabling T cell persistence and antitumor efficacy. Examples of dnFas include those described in Yamamoto TN et al., T cells genetically engineered to overcome death signaling enhance adoptive cancer immunotherapy, J Clin Invest. 2019, Feb. 25;129(4):1551-1565, which is incorporated herein by reference in its entirety.

[0322] In embodiments, the one or more additional polypeptides comprise membrane-bound IL-12 (mbIL-12), the incorporation of which into T cells may confer a functional advantage over control cells lacking such mbIL-12 in enhancing T cell effector function and / or reducing IL-12-associated systemic toxicity. Examples of mbIL-12 include Hu J.et al.,Cell membrane-anchored and tumor-targeted IL-12(attIL12)-T cell therapy for eliminating large and heterogeneous solid tumors,J.Immunother.Cancer.2022,Jan;10(1):e003633;Hombach A.et al.,IL12 integrated into the CAR exodomain converts CD8+T cells to poly-functional NK-like cells with superior killing of antigen-loss tumors,Mol.Ther.2022,Feb.2;30(2):593-605;and Lee EH.et al.,Antigen-dependent IL-12 signaling in CAR T cells promotes regional to systemic disease targeting, bioRxiv. 2023, Jan. 7; 2023.01.06.522784, each of which is incorporated herein by reference in its entirety.

[0323] In some embodiments, the one or more additional polypeptides comprise an antibody or fragment thereof that binds to CD70, or a CAR comprising such an antibody or fragment.The incorporation of such a CD70 binding molecule into T cells can provide a functional advantage over control cells that lack CD70 binding molecules in targeting CD70+ activated T cells and thereby reducing HvG alloreactivity.Examples of such CD70 binding molecules include those described in PCT / US2023 / 29047, which is incorporated herein by reference in its entirety.

[0324] 6. Illustrative CAR The present invention provides a nucleic acid molecule encoding one or more CAR constructs described herein. In one embodiment, the nucleic acid molecule is provided as a messenger RNA transcript. In one embodiment, the nucleic acid molecule is provided as a DNA construct.

[0325] In embodiments, the isolated nucleic acid encodes SEQ ID NO: 204, a CAR polypeptide PL805 comprising the following domains, in order: a signal peptide, a PSMA-binding domain, a CD8 hinge and transmembrane domain, a 4-1BB costimulatory domain, and a CD3ζ signaling domain.

[0326] In embodiments, the nucleic acid encoding the PL805 CAR comprises the sequence of SEQ ID NO: 205. Table 2 below provides annotation of the nucleotide sequence of SEQ ID NO: 205. [Table 2]

[0327] In embodiments, the isolated nucleic acid encodes SEQ ID NO: 208, a CAR polypeptide PL880 comprising the following domains, in order: a signal peptide, a PSMA-binding domain, a CD8 hinge and transmembrane domain, a 4-1BB costimulatory domain, and a CD3ζ signaling domain.

[0328] In embodiments, the nucleic acid encoding the PL880 CAR comprises the sequence of SEQ ID NO: 209. Table 3 below provides annotation of the nucleotide sequence of SEQ ID NO: 209. [Table 3]

[0329] In embodiments, the isolated nucleic acid encodes SEQ ID NO: 212, a CAR polypeptide PL1027 comprising the following domains, in order: a signal peptide, a PSMA-binding domain, a CD8 hinge and transmembrane domain, a 4-1BB costimulatory domain, and a CD3ζ signaling domain.

[0330] In embodiments, the nucleic acid encoding the PL1027 CAR comprises the sequence of SEQ ID NO: 213. Table 4 below provides annotation of the nucleotide sequence of SEQ ID NO: 213. [Table 4]

[0331] In embodiments, the isolated nucleic acid encodes SEQ ID NO: 216, a CAR polypeptide PL1028 comprising the following domains, in order: a signal peptide, a PSMA-binding domain, a CD8 hinge and transmembrane domain, a 4-1BB costimulatory domain, and a CD3ζ signaling domain.

[0332] In embodiments, the nucleic acid encoding the PL1028 CAR comprises the sequence of SEQ ID NO: 217. Table 5 below provides annotation of the nucleotide sequence of SEQ ID NO: 217. [Table 5]

[0333] In embodiments, the isolated nucleic acid encodes SEQ ID NO: 220, a CAR polypeptide PL1042 comprising the following domains, in order: a signal peptide, a PSMA-binding domain, a CD8 hinge and transmembrane domain, a 4-1BB costimulatory domain, and a CD3ζ signaling domain.

[0334] In embodiments, the nucleic acid encoding the PL1042 CAR comprises the sequence of SEQ ID NO: 221. Table 6 below provides annotation of the nucleotide sequence of SEQ ID NO: 221. [Table 6]

[0335] In embodiments, the isolated nucleic acid encodes SEQ ID NO: 224, a CAR polypeptide PL1045 comprising the following domains, in order: a signal peptide, a PSMA-binding domain, a CD8 hinge and transmembrane domain, a 4-1BB costimulatory domain, and a CD3ζ signaling domain.

[0336] In embodiments, the nucleic acid encoding the PL1045 CAR comprises the sequence of SEQ ID NO: 225. Table 7 below provides annotation of the nucleotide sequence of SEQ ID NO: 225. [Table 7]

[0337] In embodiments, the isolated nucleic acid encodes SEQ ID NO: 228, a CAR polypeptide PL1049 comprising the following domains, in order: a signal peptide, a PSMA-binding domain, a CD8 hinge and transmembrane domain, a 4-1BB costimulatory domain, and a CD3ζ signaling domain.

[0338] In embodiments, the nucleic acid encoding the PL1049 CAR comprises the sequence of SEQ ID NO: 229. Table 8 below provides annotation of the nucleotide sequence of SEQ ID NO: 229. [Table 8]

[0339] In embodiments, the isolated nucleic acid encodes SEQ ID NO: 232, a CAR polypeptide PL1062 comprising the following domains, in order: a signal peptide, a PSMA-binding domain, a CD8 hinge and transmembrane domain, a 4-1BB costimulatory domain, and a CD3ζ signaling domain.

[0340] In embodiments, the nucleic acid encoding the PL1062 CAR comprises the sequence of SEQ ID NO: 223. Table 9 below provides annotation of the nucleotide sequence of SEQ ID NO: 233. [Table 9]

[0341] The CARs described above and the nucleic acids encoding them contain specific signal peptides. In embodiments, it may be desirable to replace one signal peptide with another in a CAR of the present disclosure. Thus, in embodiments, an isolated nucleic acid comprising SEQ ID NO:207 encodes SEQ ID NO:206, which includes PL805 minus the signal peptide; an isolated nucleic acid comprising SEQ ID NO:211 encodes SEQ ID NO:210, which includes PL880 minus the signal peptide; an isolated nucleic acid comprising SEQ ID NO:215 encodes SEQ ID NO:214, which includes PL1027 minus the signal peptide; an isolated nucleic acid comprising SEQ ID NO:219 encodes SEQ ID NO:218, which includes PL1028 minus the signal peptide; a nucleic acid comprising SEQ ID NO:223 encodes SEQ ID NO:222, which includes PL1042 minus the signal peptide; an isolated nucleic acid comprising SEQ ID NO:227 encodes SEQ ID NO:226, which includes PL1045 minus the signal peptide; a nucleic acid comprising SEQ ID NO:231 encodes SEQ ID NO:230, which includes PL1049 minus the signal peptide; or an isolated nucleic acid comprising SEQ ID NO:235 encodes SEQ ID NO:234, which includes PL1062 minus the signal peptide.

[0342] Any of the above-described isolated nucleic acids encoding a particular CAR polypeptide can further encode one or more additional polypeptides as discussed herein. For example, but not limited to, any of the above-described nucleic acids encoding a particular CAR can include at least one multicistronic linker and a polynucleic acid encoding a dnTGFβR2 polypeptide.

[0343] 7. Vector The present invention encompasses DNA constructs containing the sequence of CAR. The nucleic acid sequence encoding the desired molecule can be obtained using recombinant methods known in the art, for example, by screening a library from cells that express the gene using standard techniques, by introducing the gene from a vector known to contain the gene, or by directly isolating the gene from cells and tissues containing the gene. Alternatively, the gene of interest can be produced synthetically rather than cloned.

[0344] The present invention provides a vector into which the DNA of the present invention is inserted. Vectors derived from retroviruses such as lentiviruses are suitable tools for achieving long-term gene transfer because they allow long-term stable integration of the transgene and its propagation in daughter cells. Lentivirus vectors have an additional advantage over vectors derived from oncoretroviruses such as murine leukemia viruses in that they can transduce non-proliferating cells such as hepatocytes. They also have the additional advantage of low immunogenicity.

[0345] In another embodiment, the vector comprising the nucleic acid encoding the desired CAR of the present invention is an adenoviral vector (A5 / 35). In another embodiment, expression of the nucleic acid encoding the CAR can be achieved using transposons, such as Sleeping Beauty, CRISPR, CAS9, and zinc finger nucleases.

[0346] Briefly summarized, expression of a natural or synthetic nucleic acid encoding a CAR is typically carried out by operably linking a nucleic acid encoding a CAR polypeptide or a portion thereof to a promoter and incorporating the construct into an expression vector. The vector may be suitable for replication and integration in eukaryotes. Typical cloning vectors contain transcription and translation terminators, initiation sequences, and promoters useful for regulating the expression of the desired nucleic acid sequence.

[0347] The expression constructs of the present invention may also be used for nucleic acid immunization and gene therapy using standard gene delivery protocols. Methods for gene delivery are known in the art (e.g., U.S. Patent Nos. 5,399,346, 5,580,859, and 5,589,466, which are incorporated herein by reference in their entireties). In another embodiment, the present invention provides a gene therapy vector.

[0348] Nucleic acids can be cloned into several types of vectors. For example, nucleic acids can be cloned into vectors including, but not limited to, plasmids, phagemids, phage derivatives, animal viruses, and cosmids. Vectors of particular interest include expression vectors, replication vectors, probe generation vectors, and sequencing vectors.

[0349] Furthermore, the expression vector may be provided to cells in the form of a viral vector. Viral vector technology is well known in the art and is described, for example, in Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York) and other virology and molecular biology manuals. Viruses useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses. In general, suitable vectors contain an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers (e.g., WO01 / 96584, WO01 / 29058, and U.S. Patent No. 6,326,193). Several virus-based systems have been developed for gene transfer into mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. A selected gene can be inserted into a vector and packaged into retroviral particles using techniques known in the art. The recombinant virus can then be isolated and delivered to cells of a subject in vivo or ex vivo. Several retroviral systems are known in the art. In embodiments, adenoviral vectors are used. Several adenoviral vectors are known in the art. In one embodiment, lentiviral vectors are used.

[0350] Additional promoter elements, such as enhancers, regulate the frequency of transcription initiation. Typically, these are located in the region 30–110 bp upstream of the start site, although recent studies have shown that some promoters also contain functional elements downstream of the start site. The spacing between promoter elements is often flexible, allowing promoter function to be maintained when elements are inverted or moved relative to one another. In the thymidine kinase (tk) promoter, the spacing between promoter elements can be increased to 50 bp apart, after which activity begins to decline. Depending on the promoter, individual elements appear to function cooperatively or independently to activate transcription.

[0351] One example of a suitable promoter is the immediate-early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of driving high-level expression of any polynucleotide sequence operably linked to it. Another example of a suitable promoter is elongation growth factor-1α (EF-1α). However, other constitutive promoter sequences may also be used, including, but not limited to, the simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, avian leukosis virus promoter, Epstein-Barr virus immediate-early promoter, Rous sarcoma virus promoter, and human gene promoters such as, but not limited to, the actin promoter, myosin promoter, hemoglobin promoter, and creatine kinase promoter. Furthermore, the present invention should not be limited to the use of constitutive promoters. Inducible promoters are also contemplated as part of the present invention. The use of an inducible promoter provides a molecular switch that can turn on expression of a polynucleotide sequence to which it is operably linked when such expression is desired, or turn off expression when expression is not desired. Examples of inducible promoters include, but are not limited to, metallothionine promoters, glucocorticoid promoters, progesterone promoters, and tetracycline promoters.

[0352] To assess the expression of a CAR polypeptide or a portion thereof, the expression vector introduced into cells may also contain either a selectable marker gene or a reporter gene, or both, to facilitate the identification and selection of expressing cells from a population of cells to be transfected or infected via a viral vector. In other embodiments, the selectable marker may be carried on a separate piece of DNA and used in a co-transfection procedure. Both the selectable marker and the reporter gene may be flanked by appropriate regulatory sequences that allow expression in the host cell. Useful selectable markers include, for example, antibiotic resistance genes, such as neo.

[0353] Reporter genes are used to identify potentially transfected cells and to evaluate the functionality of regulatory sequences. Generally, reporter genes are genes that are not present in or expressed by recipient organisms or tissues and encode polypeptides whose expression is manifested by some easily detectable property, such as enzymatic activity. Expression of the reporter gene is assayed at a suitable time after DNA is introduced into recipient cells. Suitable reporter genes may include luciferase, beta-galactosidase, chloramphenicol acetyltransferase, genes encoding secreted alkaline phosphatase, or the green fluorescent protein gene (e.g., Ui-Tei et al., 2000 FEBS Letters 479:79-82). Suitable expression systems are well known and may be prepared using known techniques or commercially available. Generally, the construct that exhibits the highest expression level of the reporter gene with the minimum 5' flanking region is identified as the promoter. Such promoter regions may be linked to reporter genes and used to evaluate drugs for their ability to modulate promoter-driven transcription.

[0354] Methods for introducing and expressing genes into cells are known in the art. In the context of expression vectors, the vectors can be easily introduced into host cells, such as mammalian, bacterial, yeast, or insect cells, by any method in the art. For example, the expression vector can be transferred into the host cell by physical, chemical, or biological means.

[0355] Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, etc. Methods for producing cells containing vectors and / or exogenous nucleic acids are well known in the art. See, for example, Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York). One method for introducing polynucleotides into host cells is calcium phosphate transfection.

[0356] Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors. Viral vectors, particularly retroviral vectors, have become the most widely used method for inserting genes into mammalian, e.g., human, cells. Other viral vectors can be derived from lentiviruses, poxviruses, herpes simplex virus type I, adenoviruses, and adeno-associated viruses, etc. See, e.g., U.S. Patent Nos. 5,350,674 and 5,585,362.

[0357] Chemical means for introducing polynucleotides into host cells include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems, including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).

[0358] When a non-viral delivery system is utilized, an exemplary delivery vehicle is a liposome. The use of lipid formulations is contemplated for the introduction of nucleic acids into host cells (in vitro, ex vivo, or in vivo). In another embodiment, the nucleic acid may be associated with a lipid. The lipid-associated nucleic acid may be encapsulated in the aqueous interior of the liposome, interspersed within the lipid bilayer of the liposome, bound to the liposome via a linking molecule associated with both the liposome and the oligonucleotide, entrapped in the liposome, complexed with the liposome, dispersed in a solution containing lipids, mixed with lipids, combined with lipids, contained as a suspension in lipids, contained in or complexed with micelles, or otherwise associated with lipids. The lipid, lipid / DNA, or lipid / expression vector-associated compositions are not limited to any particular structure in solution. For example, they may exist in a bilayer structure, as micelles, or in a "collapsed" structure. They may also simply be dispersed in solution, possibly forming aggregates that are not uniform in size or shape.Lipid is a fatty substance that can be naturally occurring lipid or synthetic lipid.For example, lipid includes the lipid droplets that naturally occur in cytoplasm, and the class of compounds that contain long-chain aliphatic hydrocarbons and their derivatives, such as fatty acids, alcohols, amines, amino alcohols, and aldehydes.

[0359] Lipids suitable for use can be obtained from commercial sources. For example, dimyristyl phosphatidylcholine ("DMPC") can be obtained from Sigma, St. Louis, Mo.; dicetyl phosphate ("DCP") can be obtained from K & K Laboratories (Plainview, NY); cholesterol ("Choi") can be obtained from Calbiochem-Behring; and dimyristyl phosphatidylglycerol ("DMPG") and other lipids can be obtained from Avanti Polar Lipids, Inc. (Birmingham, AL). Lipid stock solutions in chloroform or chloroform / methanol can be stored at approximately -20°C. Chloroform evaporates more readily than methanol and is therefore used as the sole solvent. "Liposome" is a generic term encompassing a variety of unilamellar and multilamellar lipid vesicles formed by the formation of enclosed lipid bilayers or aggregates. Liposomes can be characterized as having a vesicular structure with a phospholipid bilayer membrane and an internal aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before forming a closed structure, trapping water and dissolved solutes between the lipid bilayers (Ghosh et al., 1991 Glycobiology 5:505-10). However, compositions with structures in solution that differ from the typical vesicular structure are also encompassed. For example, lipids may adopt a micellar structure or simply exist as heterogeneous aggregates of lipid molecules. Lipofectamine-nucleic acid complexes are also contemplated.

[0360] Regardless of the method used to introduce exogenous nucleic acid into host cells or otherwise expose the cells to the inhibitors of the present invention, various assays may be performed to confirm the presence of the recombinant DNA sequence in the host cells. Such assays include "molecular biological" assays well known to those skilled in the art, such as Southern and Northern blotting, RT-PCR and PCR; "biochemical" assays, such as detecting the presence or absence of specific peptides by immunological means (ELISA and Western blot) or by the assays described herein to identify agents within the scope of the present invention.

[0361] 8.Host cells The CAR polypeptides of the present disclosure can be expressed in a variety of host cells through their corresponding nucleic acid constructs. In embodiments, the host cells are mammalian cells. The host cells described herein can be preserved, for example, cryopreserved, for use in adoptive cell transfer. In embodiments, the host cells are preserved before engineering the cells to express the CAR polypeptide. In embodiments, the cells are engineered to express the CAR polypeptide, and then the cells are preserved.

[0362] Preferred host cells for use with the CAD polypeptides and chimeric receptors of the present disclosure include immune cells. Such cells may be obtained from the subject to be treated (i.e., autologous), or alternatively, immune cell lines or donor immune cells (allogeneic, syngeneic) can be used. Immune cells can be obtained from a number of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from an infection site, ascites, pleural effusion, spleen tissue, and tumors. Immune cells can be obtained from blood drawn from a subject using any number of techniques known to those skilled in the art, such as Ficoll™ separation. For example, cells from an individual's circulating blood can be obtained by apheresis. In embodiments, immune cells are isolated from peripheral blood lymphocytes by lysing red blood cells and depleting monocytes, e.g., by centrifugation through a PERCOLL™ gradient or counterflow centrifugation. Specific subpopulations of immune cells can be further separated using positive or negative selection techniques. For example, immune cells can be isolated using a combination of antibodies directed against surface markers specific to the positively selected cells, e.g., by incubation with antibody-conjugated beads for a time sufficient to positively select the desired immune cells. Alternatively, enrichment of immune cell populations can be achieved by negative selection using a combination of antibodies targeting surface markers specific to the negatively selected cells. Other specific methods of separation and / or enrichment are disclosed herein.

[0363] In embodiments, immune cells include any white blood cells involved in the body's defense against infections and foreign substances. For example, immune cells may include lymphocytes, monocytes, macrophages, dendritic cells, mast cells, neutrophils, basophils, eosinophils, or any combination thereof. For example, immune cells relevant to the present disclosure may include, but are not limited to, αβ T cells, γδ T cells, NK cells, NKT cells, γδ NKT cells, B cells, innate lymphoid cells (ILCs), cytokine-induced killer (CIK) cells, cytotoxic T lymphocytes (CTLs), lymphokine-activated killer (LAK) cells, regulatory T cells, and the like. In embodiments, preferred immune cells include αβ T cells, γδ T cells, NK cells, NKT cells, γδ NKT cells, and / or, in some examples, macrophages. In embodiments, preferred immune cells include γδ T cells. In embodiments, immune cells relevant to the present disclosure include allogeneic cells, autologous cells, or syngeneic cells.

[0364] Accordingly, aspects of the invention include host cells (in some preferred embodiments, γδ T cells) that functionally express the isolated nucleic acids described herein, thereby expressing a CAR on the surface of the cell.

[0365] Embodiments of the invention may additionally or alternatively comprise host cells, preferably γδ T cells, that have in vitro or in vivo cytotoxic activity against tumor cells that exhibit cell surface expression of PSMA.

[0366] In some cases, the cytotoxic activity is innate. In some cases, the cytotoxicity is at least partially, significantly (> about 25%), or entirely due to the presence of a CAR construct having a binding domain that specifically binds to PSMA expressed on the surface of the tumor cells. In some cases, the host cells, preferably γδ T cells, exhibit tumor cytotoxic activity that is higher than the innate level of tumor cytotoxic activity in vitro and / or in vivo in control cells of the same cell type. In some cases, the control cells do not comprise a CAR construct. In some cases, the control cells comprise a CAR construct that lacks a binding domain described herein, a hinge region described herein, a transmembrane domain described herein, an intracellular signaling domain described herein, and / or a costimulatory endodomain described herein.

[0367] In some cases, the cytotoxicity is at least partially, significantly (>about 25%), or entirely due to the presence of a CAR construct having a binding domain that specifically binds to PSMA or an epitope within PSMA. In some cases, the host cells, preferably γδ T cells, functionally express a PSMA-specific CAR encoded by an isolated nucleic acid described herein.

[0368] In embodiments, when the host cell is a γδ T cell, the γδ T cell may exhibit HLA-restricted (e.g., HLA class I restricted) cytotoxicity. In other embodiments, most (>50%), substantially all (>90%), or all cytotoxic activity is not HLA-restricted (e.g., HLA class I restricted). HLA-restricted cytotoxic activity can be assessed by comparing in vitro cytotoxicity against an HLA (e.g., HLA class I) (null) tumor cell line with in vitro cytotoxicity against an HLA+ (e.g., HLA class I+) tumor cell line. In embodiments, HLA-restricted cytotoxic activity is at least partially, significantly (>25%), or completely provided by the use of a T cell receptor-like binding domain. T cell receptor-like binding domains are binding domains that specifically recognize antigens when presented on the surface of cells in complex with MHC molecules. T cell receptor-like binding domains are further described, for example, in WO2016 / 199141.

[0369] The host cells, preferably γδ T cells, described herein are capable of exhibiting potent and / or persistent tumor cytotoxic activity. In some cases, the tumor cytotoxic activity may persist for at least about 6 to 120 days, or at least about 6 to 180 days, from initial contact with tumor cells. In some cases, the tumor cytotoxic activity of the host cells, preferably γδ T cells, described herein, or their progeny, may persist for at least about 6 to 120 days, or at least about 6 to 180 days, from initial contact with tumor cells or from administration of the host cells. This persistent tumor cytotoxic activity may be demonstrated in vitro, in vivo, or both in vitro and in vivo.

[0370] Embodiments of the present invention may also or alternatively include host cells, preferably γδ T cells, that proliferate in response to contact with cells that exhibit cell surface expression or overexpression of PSMA. The cells exhibiting cell surface expression or overexpression of PSMA may be tumor cells or non-tumor cells. In some cases, the proliferation is an innate activity. In some cases, the proliferation is at least partially, significantly (>about 20% or >about 25%), or entirely due to the presence of a CAR construct having a binding domain that specifically binds to PSMA expressed on the surface of the tumor cells. In some cases, the host cells, preferably γδ T cells, exhibit a higher level of proliferation in vitro and / or in vivo compared to control cells of the same type. In some cases, the control cells do not contain a CAR construct. In some cases, the control cells contain a CAR construct that lacks a binding domain described herein, a hinge region described herein, a transmembrane domain described herein, an intracellular signaling domain described herein, and / or a costimulatory endodomain described herein.

[0371] The host cells, preferably γδ T cells, described herein can exhibit robust and / or sustained growth in a host organism containing cells, e.g., tumor cells, that exhibit cell surface expression or overexpression of PSMA. In some cases, growth can persist for at least about 6 to 120 days, or at least about 6 to 180 days, from initial contact with tumor cells or from the date of administration of the host cells, preferably γδ T cells, to the host organism. In some cases, growth of the host cells, preferably γδ T cells, described herein, or their progeny, in a host organism containing cells that exhibit cell surface expression or overexpression of PSMA can persist for at least about 6 to 120 days, or at least about 6 to 180 days, from initial contact with PSMA-expressing cells or from the date of initial administration of the host cells, preferably γδ T cells, to the host organism. In some cases, growth in the host organism is at least partially, significantly (>about 20% or >about 25%), or entirely due to the presence of PSMA or a CAR construct having a binding domain that specifically binds to an epitope within PSMA. In some cases, host cells, preferably γδ T cells, exhibiting proliferation in a host organism comprising cells exhibiting cell surface expression of PSMA functionally express a PSMAD-specific CAR encoded by an isolated nucleic acid described herein.

[0372] In embodiments, a host cell described herein, preferably a γδ T cell, expresses or persistently expresses a pro-inflammatory cytokine such as tumor necrosis factor alpha or interferon gamma after contact with a PSMA-expressing cell. In embodiments, a host cell described herein, or its progeny, expresses or persistently expresses a pro-inflammatory cytokine such as tumor necrosis factor alpha or interferon gamma after contact with a PSMA-expressing cell, e.g., in a host organism comprising the PSMA-expressing cell.

[0373] In embodiments, γδ T cells or pharmaceutical compositions containing γδ T cells, when introduced into an allogeneic host, exhibit substantially no or no graft-versus-host response. In embodiments, γδ T cells or pharmaceutical compositions comprising γδ T cells, when introduced into an allogeneic host, exhibit a clinically acceptable level of graft-versus-host response. In embodiments, a clinically acceptable level is an amount of graft-versus-host response that does not require cessation of γδ T cell therapy to achieve therapeutically effective treatment. In embodiments, a clinically acceptable level of graft-versus-host response (GvHD) is an acute response less severe than Grade C according to the applicable IBMTR grading scale. The severity of acute graft-versus-host reaction is determined by assessing the degree of involvement of the skin, liver, and gastrointestinal tract. The stages of involvement in individual organs are combined to create an overall grade that has prognostic significance. Grade I (A) GvHD is considered mild disease, Grade II (B) GvHD is moderate, Grade III (C) is severe, and Grade IV (D) is life-threatening. The IBMTR staging system defines the severity of acute GvHD as follows (Rowlings et al., Br. J. Haematol. 1997;97:855): Grade A - No liver or gastrointestinal involvement, only stage 1 skin involvement (maculopapular rash on <25% of the body) Grade B - Stage 2 skin lesions, Stage 1 to 2 intestinal or liver lesions Grade C - Stage 3 disease in any organ system (generalized erythroderma, bilirubin 6.1-15.0 mg / dL, diarrhea 1500-2000 mL / day) • Grade D - Stage 4 involvement of any organ system (generalized erythroderma with blister formation, bilirubin >15 mg / dL, diarrhea >2000 mL / day or pain or bowel obstruction). See also Tables 1 and 2 in Schoemans et al., Bone Marrow Transplantation volume 53, pages 1401-1415 (2018), which also discloses criteria for assessing and grading acute GvHD.

[0374] In embodiments, the γδ T cells, or pharmaceutical compositions comprising the γδ T cells, exhibit a reduced or substantially reduced graft-versus-host response when introduced into an allogeneic host compared to the graft-versus-host response exhibited by control αβ T cells, or a control pharmaceutical composition comprising control αβ T cells, administered to the allogeneic host. Optionally, the control αβ T cells are allogeneic, non-genetically engineered control αβ T cells. Optionally, the control αβ T cells do not comprise a CAR or do not comprise the same CAR as the reference γδ T cells.

[0375] In embodiments, the host cells described herein, preferably γδ T cells, can be modified to include one or more gene edits. As discussed herein, gene editing is a type of genetic manipulation that inserts, deletes, or replaces nucleotide(s) / nucleic acid(s) in a DNA sequence, such as the genome of a γδ T cell. Targeted gene editing allows for insertion, deletion, and / or replacement at a preselected site in the genome of a target cell. When the base sequence of an endogenous gene is edited, for example, by deleting, inserting, or substituting nucleotide(s) / nucleic acid(s), the endogenous gene containing the affected sequence may be knocked out or knocked down due to the change in base sequence. Thus, targeted editing may be used to disrupt expression of an endogenous gene. As discussed herein, a "disrupted gene" refers to a gene that includes an insertion, deletion, or substitution relative to the endogenous gene such that expression of a functional protein from the endogenous gene is reduced or inhibited. As used herein, " gene disruption " refers to the method of inserting, deleting or replacing at least one nucleotide / nucleic acid into endogenous gene, so that the expression of functional protein from endogenous gene is reduced or inhibited. Methods of gene disruption are known to those skilled in the art, and are described in, for example, U.S. Patent No. 1,125,4912, which is incorporated herein by reference in its entirety.

[0376] In embodiments, targeted gene editing of T cells can be performed using a nuclease-dependent approach. Such a nuclease-dependent approach can achieve targeted editing through the specific introduction of double-strand breaks (DSBs) by specific endonucleases. Such nuclease-dependent targeted editing utilizes DNA repair mechanisms that occur in response to DSBs, such as non-homologous end joining (NHEJ). DNA repair by NHEJ often results in the random insertion or deletion (indel) of a small number of endogenous nucleotides. In contrast to NHEJ-mediated repair, repair can also occur through homology-directed repair (HDR). When a donor template containing exogenous genetic material flanked by a pair of homologous arms exists, the exogenous genetic material can be introduced into the genome by HDR, resulting in targeted integration of the exogenous genetic material. Available endonucleases capable of introducing specific and targeted DSBs include, but are not limited to, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and RNA-guided CRISPR-Cas9 nucleases (CRISPR / Cas9, clustered regularly interspaced short palindromic repeats associated 9). The CRISPR system, or CRISPR nuclease system discussed herein, can include a non-coding RNA (e.g., guide RNA) that binds to DNA and a Cas protein (e.g., Cas9) with nuclease function (Sander et al., Nature Biotechnology, (2014); 32: 347-355; Hsu et al., Cell, (2014); 157(6): 1262-1278).

[0377] In embodiments, the host cell, preferably a γδ T cell, comprises one or more disrupted genes. For example, the one or more genes whose expression is disrupted may be adenosine A2A receptor (ADORA), CD276, V-set domain-containing inhibitor of T-cell activation 1 (VTCN1), B and T lymphocyte-associated (BTLA), cytotoxic T lymphocyte-associated protein 4 (CTLA4), indoleamine 2,3-dioxygenase 1 (IDO1), killer cell immunoglobulin-like receptor, three domain, long cytoplasmic tail, 1 (KIR3DL1), lymphocyte activation gene 3 (LAG3), programmed cell death 1 (PD-1), hepatitis A virus cellular receptor 2 (HAVCR2), V-domain immunoglobulin inhibitor of T-cell activation (VISTA), natural killer cell receptor 2B4 (CD244), cytokine-inducible SH2-containing protein (CISH), hypoxanthine phosphoribosyltransferase 1 (HPRT), adeno-associated virus integration site (AAVS SITE (EGFR)), or EGFR-associated virus (EGFR) integration site (AAVS SITE (EGFR)). AAVS1, AAVS2, ETT), or chemokine (CC motif) receptor 5 (gene / pseudogene) (CCR5), CD160 molecule (CD160), T cell immunoreceptor with Ig and ITIM domains (TIGIT), CD96 molecule (CD96), cytotoxic and regulatory T cell molecule (CRTAM), leukocyte-associated immunoglobulin-like receptor 1 (LAIR1), sialic acid-binding Ig like lectin 7 (SIGLEC7), sialic acid-binding Ig like lectin 9 (SIGLEC9), tumor necrosis factor receptor superfamily member 10b (TNFRSF10B), tumor necrosis factor receptor superfamily member -10a (TNFRSF10A), caspase 8 (CASP8), caspase 10 (CASP10), caspase 3 (CASP3), caspase 6 (CASP6), caspase 7 (CASP7), Fas associated via death domain (FADD), Fas cell surface death receptor (Fas), transforming growth factor beta receptor II (TGFBRII), transforming growth factor beta receptor I (TGFBR1), SMAD family member 2 (SMAD2), SMAD family member 3 (SMAD3), SMAD family member 4 (SMAD4), SKI proto-oncogene (SKI), SKI-like proto-oncogene (SKIL),TGFB-inducing factor homeobox 1 (TGIF1), interleukin-10 receptor subunit α (IL10RA), interleukin-10 receptor subunit β (IL10RB), heme oxygenase 2 (HMOX2), interleukin-6 receptor (IL6R), interleukin-6 signal transducer (IL6ST), c-src tyrosine kinase (CSK), phosphoprotein membrane anchor with glycosphingolipid microdomain 1 (PAG1), signal transduction threshold-regulating transmembrane adaptor 1 (SIT1), forkhead box P3 (FOXP3), PR domain 1 (PRDM1), basic leucine zipper transcription factor, ATF-like (BA TF), guanylate cyclase 1, soluble, alpha 2 (GUCY1A2), guanylate cyclase 1, soluble, alpha 3 (GUCY1A3), guanylate cyclase 1, soluble, beta 2 (GUCY1B2), guanylate cyclase 1, soluble, beta 3 (GUCY1B3), cytokine-inducible SH2-containing protein (CISH), proteins of the prolyl hydroxylase domain (PHD1, PHD2, PHD3) family of proteins, or Cbl proto-oncogene B (CBL-B), zinc finger protein 91 (ZFP91), Roquin, CD58, ICAM-1, or any combination thereof.

[0378] In embodiments, the gene whose expression is disrupted is CISH, a negative regulator of TCR signaling. Disruption of the CISH gene may provide a functional advantage over control cells with an intact CISH gene, such as increased sensitivity to certain cytokines (e.g., IL-2 / IL-15), increased T cell proliferation, and / or suppressed T cell exhaustion. In some examples, the CISH gene may be disrupted by the methods described in Daher M. et al., "Targeting a cytokine checkpoint enhances the fitness of armored cord blood CAR-NK cells," Blood. 2021, Feb. 4;137(5):624-636, the entire contents of which are incorpora...

Claims

1. 1. An affinity binding entity comprising an antigen-binding domain that specifically binds to prostate-specific membrane antigen (PSMA), said antigen-binding domain comprising: a heavy chain variable region / light chain variable region (HCVR / LCVR) sequence pair selected from the group consisting of SEQ ID NOs: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, 13 / 14, 15 / 16, 17 / 18, 19 / 20, 21 / 22, 23 / 24, 25 / 26, 27 / 28, 29 / 30, 31 / 32, 33 / 34, and 35 / 36; The affinity binding entity comprises six CDRs of an HCVR / LCVR sequence pair selected from the group consisting of sequence numbers 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, 13 / 14, 15 / 16, 17 / 18, 19 / 20, 21 / 22, 23 / 24, 25 / 26, 27 / 28, 29 / 30, 31 / 32, 33 / 34, and 35 / 36.

2. the antigen-binding domain 2. The affinity binding entity of claim 1, comprising an HCVR / LCVR sequence pair selected from the group consisting of SEQ ID NOs: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, and 13 / 14, or six CDRs of an HCVR / LCVR sequence pair selected from the group consisting of SEQ ID NOs: 1 / 2, 3 / 4, 5 / 6, 7 / 8, 9 / 10, 11 / 12, and 13 / 14.

3. The affinity binding entity is an antibody or an antibody fragment, optionally wherein the affinity binding entity is an scFv, Fab, Fab', Fv, F(ab') 2 3. The affinity binding entity of claim 1 or claim 2, selected from the group consisting of: a dsFv, a dAb, and any combination or plurality thereof.

4. The affinity binding entity of claim 3 , wherein the antibody or antibody fragment is bispecific or monoclonal.

5. 5. The affinity binding entity of claim 3 or claim 4, wherein the antibody or antibody fragment is a chimeric, humanized, or human antibody or antibody fragment.

6. A chimeric antigen receptor (CAR), wherein the CAR comprises an affinity binding entity according to any one of claims 2 to 5.

7. The CAR of claim 6, further comprising a hinge domain, optionally wherein the hinge domain comprises a glycine polymer, a glycine-serine polymer, a glycine-alanine polymer, an alanine-serine polymer, an immunoglobulin heavy chain hinge, or a receptor-derived hinge.

8. The CAR of claim 7, wherein the receptor-derived hinge is a CD8 alpha hinge domain, optionally wherein the CD8 alpha hinge domain comprises the amino acid sequence set forth in SEQ ID NO:

156.

9. and further comprising a transmembrane (TM) domain, optionally wherein said TM domain is selected from the group consisting of 4-1BB / CD137, activating NK cell receptor, immunoglobulin protein, B7-H3, BAFFR, BLAME (SLAMF8), BTLA, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, or CD154, CD100 (SEMA4D), CD103, CD160 (BY55), CD18, CD19, CD19a, CD2, CD247, CD27, CD276 (B7-H3), CD28, CD29, CD3 delta, CD3 epsilon, CD3 gamma, CD3 zeta, CD30, CD4, CD40, CD49a, CD49D, CD49f, CD69, CD7, CD84, CD8, CD8 alpha, CD8 beta, CD96 (Tactile), CD11a, CD11b, CD11c, CD11d, CDS, CEACAM1, CRTAM, cytokine receptor, DAP10, DNAM1 (CD226), Fc gamma receptor, GADS, GITR, HVEM (LIGHTR), IA4, ICAM-1, Ig alpha (CD79a), IL-2R beta, IL-2R gamma, IL-7R alpha, inducible T cell costimulator (ICOS), integrin, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB2, ITGB7, ITGB1, KIRDS2, LAT, LFA-1, ligand that specifically binds to CD83, LIGHT, LTBR, ​​L y9 (CD229), lymphocyte function-associated antigen-1 (LFA-1; CD11a / CD18), MHC class 1 molecules, NKG2C, NKG2D, NKp30, NKp44, NKp46, NKp80 (KLRF1), OX-40, PAG / Cbp, programmed death-1 (PD-1), PSGL1, SELPLG (CD162), signaling lymphocyte activation molecule (SLAM protein), SLAM (SLAMF1; CD150; IPO-3), SLAMF4 (CD244; 2B4), SLAMF6 (NTB-A;The CAR according to any one of claims 6 to 8, comprising a TM region of Ly108), SLAMF7, SLP-76, TNF receptor protein, TNFR2, TNFSF14, Toll ligand receptor, TRANCE / RANKL, VLA1, or VLA-6, or a fragment, truncation, or combination thereof.

10. The CAR of claim 9, wherein the TM domain comprises the TM domain of CD8, preferably the CD8 TM domain is the TM domain of CD8 alpha, optionally wherein the TM domain comprises the amino acid sequence set forth in SEQ ID NO:

158.

11. and further comprising at least one costimulatory domain, optionally wherein the costimulatory domain is selected from the group consisting of TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, CARD11, B7-H3, CEACAM1, CRTAM, CD2, CD3C, CD4, CD7, CD8α, CD8β, CD11a, CD11b, CD11c, CD11d, IL2Rβ, IL2γ, IL7Rα, IL4R, IL7R, IL15R, IL21R, CD18, CD19, CD19a, CD2 7, CD28, CD29, CD30, CD40, CDS, CD49a, CD49D, CD49f, CD54 (ICAM), CD69, CD70, CD80, CD83, CD84, CD86, CD96 (Tactile), CD100 (SEMA4D), CD103, CD134 (OX40), CD137 (4-1BB), CD152 (CTLA-4), CD160 (BY55), CD162 (SELPLG), CD244 (2B4), CD270 (HVEM), CD226 (DNAM1), CD229 (L y9), CD278 (ICOS), ICAM-1, LFA-1 (CD11a / CD18), FcR, FcγRI, FcγRII, FcγRIII, LAT, NKG2C, SLP76, TRIM, ZAP70, GITR, BAFFR, LTBR, ​​LAT, GADS, LIGHT, HVEM (LIGHTR), KIRDS2, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB1, ITGB2, ITGB7, NKG2C, NKG2D, IA4, VLA-1, V The CAR according to any one of claims 6 to 10, comprising a costimulatory domain of LA-6, SLAM (SLAMF1, CD150, IPO-3), SLAMF4, SLAMF6 (NTB-A, Ly108), SLAMF7, SLAMF8 (BLAME), SLP-76, PAG / Cbp, NKp80 (KLRF1), NKp44, NKp30, NKp46, BTLA, JAML, CD150, PSGL1, TSLP, TNFR2, or TRANCE / RANKL, or a part thereof, or a combination thereof.

12. The CAR of claim 11, wherein the costimulatory domain is a 4-1BB costimulatory domain, optionally wherein the 4-1BB costimulatory domain comprises the amino acid sequence set forth in SEQ ID NO:

162.

13. The CAR according to any one of claims 6 to 12, further comprising one or more intracellular signaling domains, preferably wherein the intracellular signaling domain is a CD3ζ intracellular signaling domain, optionally wherein the CD3ζ intracellular signaling domain comprises the amino acid sequence set forth in SEQ ID NO: 164, 166, or 167.

14. The CAR according to any one of claims 6 to 13, further comprising a signal peptide, optionally wherein the signal peptide comprises the amino acid sequence shown in SEQ ID NO:

152.

15. An isolated polynucleotide comprising a nucleic acid sequence encoding an affinity binding entity according to any one of claims 1 to 5.

16. 16. An expression vector comprising the polynucleotide of claim 15 operably linked to a cis-acting control element.

17. A cell comprising an affinity binding entity according to any one of claims 1 to 5, an isolated polynucleotide according to claim 15, and / or an expression vector according to claim 16.

18. An isolated polynucleotide comprising a nucleic acid sequence encoding the CAR according to any one of claims 6 to 14.

19. 19. The isolated polynucleotide of claim 18, further comprising a nucleic acid sequence encoding at least one multicistronic linker region, optionally wherein the multicistronic region encodes a cleavage sequence and / or an internal ribosome entry site (IRES).

20. 20. The isolated polynucleotide of claim 19, wherein the cleavage sequence is selected from T2A, F2A, P2A, E2A, furin, and furin-P2A (FP2A).

21. 21. The isolated polynucleotide of any one of claims 18 to 20, further comprising a nucleic acid sequence encoding one or more additional polypeptides.

22. 22. The isolated polynucleotide of claim 21, wherein the one or more additional polypeptides are selected from the group consisting of lymphotoxin beta receptor (LTBR), low-affinity nerve growth factor receptor (LNGFR), dominant-negative (dn) receptor for TGF-beta or Fas, truncated human epidermal growth factor receptor (EGFRt), membrane-bound IL-12 (mbIL-12), fluorescent proteins, gamma chain cytokines, CARs that bind to CD19, CD20, CD70, and any combination thereof.

23. 23. The isolated polynucleotide of claim 22, wherein the one or more additional polypeptides is dnTGFβR2, optionally wherein the dnTGFβR2 comprises the amino acid sequence set forth in SEQ ID NO:

265.

24. 23. The isolated polynucleotide of claim 22, wherein the additional polypeptide is LTBR, ​​and the LTBR comprises the amino acid sequence set forth in SEQ ID NO:

267.

25. 23. The isolated polynucleotide of claim 22, wherein the additional polypeptide is EGFRt, and the EGFRt comprises the amino acid sequence set forth in SEQ ID NO:

261.

26. 23. The isolated polynucleotide of claim 22, wherein the additional polypeptide is LNGFR, and the LNGFR comprises the amino acid sequence set forth in SEQ ID NO:

273.

27. 27. The isolated polynucleotide of any one of claims 22 to 26, wherein the one or more additional polypeptides are operably linked to a nucleic acid sequence encoding a signal peptide, optionally wherein the signal peptide comprises an amino acid sequence selected from SEQ ID NO:259, SEQ ID NO:263, SEQ ID NO:267, SEQ ID NO:271, and SEQ ID NO:

248.

28. 28. The isolated polynucleotide of any one of claims 18 to 27, comprising the nucleic acid sequence of SEQ ID NO: 205, 209, 213, 217, 221, 225, 229, or 233.

29. An expression vector comprising the isolated polynucleotide of any one of claims 18 to 28 operably linked to a cis-regulatory element.

30. γδ T cells, (a) a nucleic acid sequence encoding a chimeric antigen receptor (CAR) comprising an affinity binding domain that specifically binds to prostate-specific membrane antigen (PSMA), and / or (b) a polypeptide comprising a CAR comprising an amino acid sequence encoded by the nucleic acid of (a); The γδ T cell, wherein the γδ T cell functionally expresses the binding domain of the CAR encoded by the polypeptide or the nucleic acid on the surface of the γδ T cell.

31. The CAR comprises an affinity binding entity according to any one of claims 2 to 5, or 31. A γδ T-cell according to claim 30, wherein the nucleic acid sequence comprises the isolated polynucleotide of any one of claims 18 to 28, or the expression vector of claim 29.

32. A modified immune cell comprising the CAR according to any one of claims 6 to 14, the polynucleotide according to any one of claims 18 to 28, or the expression vector according to claim 29.

33. 33. The modified immune cell of claim 32, wherein the modified immune cell is a γδ T cell, a γδ NKT cell, an αβ T cell, an NK cell, an NKT cell, or a macrophage.

34. The modified immune cells are γδ T cells, optionally wherein the γδ T cells are δ1, δ2, δ3, or δ4 γδ T cells, preferably δ2 - The modified immune cell of claim 33, which is a γδ T cell, more preferably a δ1 γδ T cell.

35. The modified immune cell of any one of claims 32 to 34, or the γδ T cell of claim 30 or claim 31, wherein the modified immune cell or the γδ T cell exhibits in vitro and / or in vivo cell-killing activity against tumor cells that exhibit cell surface expression of PSMA.

36. 36. The modified immune cell or γδ T cell of claim 35, wherein the modified immune cell or γδ T cell proliferates in response to contact with the tumor cell that exhibits cell surface expression of PSMA, optionally wherein the modified immune cell or γδ T cell proliferates in a host organism that contains tumor cells that exhibit cell surface expression of PSMA.

37. The modified immune cell of any one of claims 32-36, or the γδ T cell of any one of claims 30-31 or 35-36, wherein the modified immune cell or γδ T cell expresses proinflammatory cytokines after contact with tumor cells that exhibit cell surface expression of PSMA.

38. 38. The modified immune cell of any one of claims 32-37, or the γδ T-cell of any one of claims 30-31 or 35-37, further comprising at least one disrupted gene, optionally wherein said at least one disrupted gene is cytokine-inducible SH2-containing protein (CISH), CBL proto-oncogene B (CBL-B), zinc finger protein 91 (ZFP91), CD58, ICAM-1, or any combination thereof.

39. 39. A method of producing a modified immune cell according to any one of claims 32-38, or a γδ T-cell according to any one of claims 30-31 or 35-38, comprising transfecting an immune cell(s) or γδ T-cell(s) with an expression vector according to claim 29, optionally wherein said cell(s) have at least one disrupted gene.

40. 40. The method of claim 39, wherein the method comprises retroviral transduction.

41. 41. The method of claim 39 or 40, wherein the method comprises ex vivo expansion of immune cell(s) or γδ T cell(s), wherein the ex vivo expansion is performed before and / or after transfection with the expression vector.

42. An antibody-drug conjugate (ADC) comprising an affinity binding entity according to any one of claims 1 to 5.

43. 43. A pharmaceutical composition comprising an affinity binding entity according to any one of claims 1 to 5, an ADC according to claim 42, and a pharmaceutically acceptable carrier.

44. 39. A pharmaceutical composition comprising a plurality of modified immune cells according to any one of claims 32-38, or a plurality of γδ T cells according to any one of claims 30-31 or 35-38, and a pharmaceutically acceptable carrier, optionally wherein the plurality is at least 60%, 80%, or about 60% or 80% to about 90% or 95% δ1, δ2, δ3, or δ4 γδ T cells, preferably δ1 or δ2 γδ T cells, more preferably δ2-γδ T cells, and most preferably δ1 γδ T cells.

45. each of said plurality of at least about 10 7 modified immune cells or γδ T cells, preferably about 10 8 modified immune cells or γδ T cells to about 10 11 45. The pharmaceutical composition of claim 44, comprising a modified immune cell or a γδ T cell.

46. 10. A method of inhibiting proliferation of a cell that exhibits cell surface expression of PSMA, the method comprising contacting the cell with an affinity binding entity of any one of claims 1 to 5, a modified immune cell(s) of any one of claims 32 to 38, a γδ T-cell(s) of any one of claims 30 to 31 or 35 to 38, an ADC of claim 42, or a pharmaceutical composition of any one of claims 43 to 45.

47. 10. A method of killing a tumor cell that exhibits cell surface expression of PSMA, said method comprising contacting said tumor cell with a therapeutically effective amount of an affinity binding entity of any one of claims 1-5, a modified immune cell(s) of any one of claims 32-38, a γδ T-cell(s) of any one of claims 30-31 or 35-38, an ADC of claim 42, or a pharmaceutical composition of any one of claims 43-45.

48. 48. The method of claim 47, wherein the method comprises introducing a therapeutically effective amount of the affinity binding entity, the modified immune cell(s), the γδ T-cell(s), the ADC, or the pharmaceutical composition into a host organism comprising tumor cells.

49. 49. The method of claim 48, further comprising simultaneously or sequentially administering one or more methods of elevating common gamma chain cytokine(s), optionally wherein administering one or more methods of elevating said common gamma chain cytokine(s) comprises simultaneously or sequentially administering an amount of said common gamma chain cytokine(s), lymphodepletion prior to introducing said modified immune cell(s) or said γδ T-cell(s), and / or secretion of one or more common gamma chain cytokine(s) from the introduced modified immune cell(s) or said γδ T-cell(s).

50. 50. The method of any one of claims 46 to 49, wherein the host organism is a human and the method is a method of treating cancer in a subject in need thereof.

51. 46. ​​Use of an affinity binding entity according to any one of claims 1 to 5, a modified immune cell(s) according to any one of claims 32 to 38, a γδ T-cell(s) according to any one of claims 30 to 31 or 35 to 38, an ADC according to claim 42, or a pharmaceutical composition according to any one of claims 43 to 45, in the preparation of a medicament for the treatment of cancer.