Reusable flow cell with signal strength retention, method for retaining signal strength in a reusable flow cell, and reagents and kits therefor

Abstract

A reusable flow cell for sequencing that exhibits signal intensity retention over multiple cycles of use, an activated surface comprising poly-azide functional moieties, a method for treating a flow cell surface with a reagent to provide such poly-azide functional moieties, and reagents therefor.

Description

[Background technology]

[0001] Flow cells are used in a variety of methods and applications, such as gene sequencing and genotyping. For various analyses, such as nucleic acid analysis, the surface of the flow cell can be functionalized with specific surface chemistries, such as primers, polymerases, etc., depending on the reaction being performed. In many cases, the surface chemistry is covalently attached to the flow cell surface. Covalent attachment can be desirable to maintain the surface chemistry in the active region of the flow cell throughout the various stages of the analysis or throughout the life of the flow cell during various uses.

[0002] The large number of use cycles and associated reactions performed to functionalize the flow cell surface can reduce the flow cell's ability to maintain the surface chemistry required for various analyses, and in some cases, the flow cell may simply be considered a consumable. As in most industries, fewer consumables in a process are desirable. Summary of the Invention

[0003] Various embodiments of the present invention generally relate to flow cells for sequencing, methods for treating the substrate of flow cells, and reagents for such treatment. Various embodiments of the present invention provide reusable flow cells with signal strength retention. Reusable flow cells according to various embodiments of the present invention maintain or preserve signal strength levels in use over multiple analytical cycles. Various embodiments of the present invention provide methods for treating the surface of a flow cell to maintain, preserve, and enhance signal strength from the flow cell in use over multiple analytical cycles. Various embodiments of the present invention provide reagents for use in such methods.

[0004] In various embodiments, the flow cell may include functional groups on its surface that can attach to primers used in nucleic acid sequencing, and in various embodiments, such functional groups may be bound to a polymer hydrogel at the surface of the flow cell. After a sequencing cycle (e.g., priming, nucleotide grafting, analysis, data capture, nucleotide removal, etc.), the primers are removed. In some cases, primer removal may leave behind post-sequencing functional groups that are different from the functional groups that can attach to primers. In these cases, the flow cell surface may be contacted with reagents according to various embodiments and methods according to various embodiments may be used to convert the post-sequencing functional groups back into functional groups that can attach to primers, thus maintaining or preserving, or even enhancing, signal strength for the next sequencing cycle.

[0005] One embodiment of the present invention includes a reagent comprising a solution of a compound having two or more terminal azide functionalities, the terminus of which has a moiety capable of covalently bonding to an amine group. Another embodiment of the present invention includes a reagent comprising a mixture of (i) a compound having two or more terminal azide functionalities, the terminus of which has a moiety capable of covalently bonding to an amine group, and (ii) a biologically compatible buffer solution. "Biologically compatible" or "biocompatible" in this context refers to buffer systems and buffer components that are generally mild, safe / non-toxic to biological systems, and non-reactive with nucleic acid functional groups. Another embodiment of the present invention includes a reagent comprising a compound having the general formula (I):

[0006] [ka] wherein each Az represents an azide moiety, R represents a moiety that forms a covalent bond with an amine group, each X independently represents a bridging group, Y represents nitrogen or carbon, and a represents an integer of 1 or 2. Suitable bridging groups may include polyethylene glycols having 2 to 20 ethylene glycol groups, alkyl chains, polysaccharides, and polypeptides.

[0007] Additional embodiments of the invention include methods comprising providing a flow cell having a substrate, the substrate having one or more terminal amine functionalities bound thereto, and contacting the substrate with a reagent comprising a compound having two or more terminal azide functionalities and a terminus having a moiety capable of covalently bonding to an amine group. Additional embodiments of the invention include kits comprising a flow cell and one or more reagents according to various embodiments described herein. Additional embodiments of the invention include a flow cell comprising a substrate that has been contacted with a reagent according to embodiments of the invention, such that the substrate comprises a molecule having two or more terminal azide functionalities bound thereto.

[0008] In various preferred embodiments of the present invention, the compound comprises N-(PEG-N-hydroxysuccinimide)-N-bis(PEG-azide), represented herein by formula (Ia):

[0009] [ka]

[0010] In various preferred embodiments of the present invention, the compound comprises N-hydroxysuccinimide-PEG5-tris(PEG3-azide), represented herein by formula (Ib):

[0011] [ka]

[0012] Other aspects, features and advantages will become apparent from the following disclosure, including the detailed description, preferred embodiments, and the appended claims. [Brief explanation of the drawings]

[0013] The foregoing summary, as well as the following detailed description of preferred embodiments of the present invention, will be better understood when read in conjunction with the accompanying drawings. For the purpose of illustrating the invention, there are shown in the drawings embodiments that are presently preferred. It should be understood, however, that the invention is not limited to the precise arrangements and instrumentalities shown. In the drawings, like reference numerals correspond to similar, although perhaps not identical, components. For purposes of brevity, reference numerals or features having previously described functions may or may not be described in conjunction with the other drawings in which they appear.

[0014] In the drawings: [Figure 1A] FIG. 1 is a top view of a reference flow cell suitable for use with various embodiments of the present invention. [Figure 1B] 1A-1C are enlarged, partial cutaway views of different examples of flow channels of a flow cell. [Figure 1C] 1A-1C are enlarged, partial cutaway views of different examples of flow channels of a flow cell. [Figure 1D] 1A-1C are enlarged, partial cutaway views of different examples of flow channels of a flow cell. [Figure 2] 10 is a schematic diagram of an example of a method according to an embodiment of the present invention for treating a flow cell substrate with a reagent according to another embodiment. [Figure 3] 1 shows exemplary data illustrating relative CFR (CAL Fluor Red) grafting signal intensity for multiple flow channels (lanes) within a flow cell, some lanes treated with reagents according to embodiments of the present invention. [Figure 4] 1 shows exemplary data illustrating relative DNA sequencing signal intensities for flow cell lanes, some lanes treated with reagents according to embodiments of the present invention. [Figure 5] An example of increased signal intensity over a series of DNA sequencing runs is shown. DETAILED DESCRIPTION OF THE INVENTION

[0015] Terms used herein should be understood to have their ordinary meaning in the relevant art unless otherwise specified. Some terms used herein and the meanings encompassed by those terms are set forth below.

[0016] As used herein, the singular terms "a" and "the" are synonymous and are used interchangeably with "one or more" and "at least one," unless language and / or context clearly dictate otherwise. Thus, for example, reference to "a compound" or "the compound" in this specification or the appended claims can refer to a single compound or to two or more compounds. Additionally, all numerical values ​​are understood to be modified by the word "about" unless otherwise specified. The terms "comprising," "including," and "containing," as well as various forms of these terms, are synonymous and intended to be equally broad.

[0017] Terms such as "first," "second," and the like are also not meant to indicate a specific orientation or order, but rather are used to distinguish one component from another. Ranges provided herein should be understood to include the stated range and any value or subrange within the stated range, as if such value or subrange were explicitly recited. For example, a range of about 400 nm to about 1 μm (1000 nm) should be interpreted not only to include the explicitly recited limit of about 400 nm to about 1 μm, but also to include individual values, e.g., about 708 nm, about 945.5 nm, etc., and subranges, e.g., about 425 nm to about 825 nm, about 550 nm to about 940 nm, etc. Furthermore, when "about" and / or "substantially" are used to describe values, these terms are intended to encompass minor variations (e.g., up to ±10%) of the stated value.

[0018] For simplicity and clarity of illustration, elements in the figures are not necessarily drawn to scale and the same reference numbers in different figures refer to the same elements.

[0019] Certain terminology is used in the following description for convenience only and is not limiting. The words "right," "left," "bottom," and "top" designate directions in the referenced drawings and are used herein to describe the flow cell and / or various components thereof. It should be understood that these directional terms are not meant to designate a specific orientation, but are used to designate relative orientations between components. The use of directional terms should not be construed to limit the examples disclosed herein to any specific orientation. The terms "inwardly" and "outwardly" refer to directions toward and away from, respectively, the geometric center of the object being described and the designated portion thereof. The terminology includes the words specifically mentioned above, derivatives thereof, and words of similar import.

[0020] "Acrylamide" has the structure

[0021] [ka] where each H can alternatively be alkyl, alkylamino, alkylamido, alkylthio, aryl, glycol, and / or optionally substituted versions thereof.

[0022] As used herein, "alkyl" refers to a straight or branched hydrocarbon chain that is fully saturated (e.g., contains no double or triple bonds). The alkyl group can have 1 to 20 carbon atoms. Exemplary alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tertiary butyl, pentyl, hexyl, and the like. For example, the designation "C1-C6 alkyl" indicates that there are 1 to 6 carbon atoms in the alkyl chain, e.g., the alkyl chain is selected from the group consisting of methyl, ethyl, propyl, iso-propyl, n-butyl, isobutyl, sec-butyl, t-butyl, pentyl, and hexyl.

[0023] As used herein, "alkylamino" refers to an alkyl group in which one or more of the hydrogen atoms has been replaced with an amino group, the amino group being -NR a R b R refers to the group a and R b are each independently selected from C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C7 carbocycle, C6-C10 aryl, 5- to 10-membered heteroaryl, and 5- to 10-membered heterocycle.

[0024] As used herein, "alkylamido" refers to an alkyl group in which one or more of the hydrogen atoms has been replaced with a C-amido or N-amido group. A "C-amido" group is defined as "-C(=O)N(R a R b ) group, where R a and R b may be independently selected from the group consisting of alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, aryl, heteroaryl, heteroalicycle, aralkyl, or (heteroalicyclic)alkyl. An "N-amido" group is defined as "RC(═O)N(R a )-" group, where R and R a may be independently selected from the group consisting of alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, aryl, heteroaryl, heteroalicyclic, aralkyl, or (heteroalicyclic)alkyl. Any alkylamide may be substituted or unsubstituted.

[0025] As used herein, "alkylthio" refers to RS-, where R is alkyl. Alkylthio may be substituted or unsubstituted.

[0026] As used herein, "alkene" or "alkenyl" or "olefin" refers to a straight or branched hydrocarbon chain containing one or more double bonds. An alkenyl group can have 2 to 20 carbon atoms. Exemplary alkenyl groups include ethenyl, propenyl, butenyl, pentenyl, hexenyl, and the like.

[0027] As used herein, "alkyne" or "alkynyl" refers to a straight or branched hydrocarbon chain containing one or more triple bonds. Alkynyl groups can have 2 to 20 carbon atoms.

[0028] "Allyl" refers to the unsaturated hydrocarbon radical -CH=CHCH2.

[0029] As used herein, "aralkyl" and "aryl(alkyl)" refer to an aryl group bonded as a substituent via a lower alkylene group. The lower alkylene and aryl groups of an aralkyl may be substituted or unsubstituted. Examples include, but are not limited to, benzyl, 2-phenylalkyl, 3-phenylalkyl, and naphthylalkyl.

[0030] The term "aryl" refers to an aromatic ring or ring system (e.g., two or more fused rings sharing two adjacent carbon atoms) containing only carbon in the ring structure. When an aryl is a ring system, all rings in the system are aromatic. An aryl group can have 6 to 18 carbon atoms. Examples of aryl groups include phenyl, naphthyl, azulenyl, and anthracenyl. Any aryl may be a heteroaryl having at least one heteroatom, i.e., an element other than carbon (e.g., nitrogen, oxygen, sulfur, etc.), in the ring structure.

[0031] As used herein, the term "attached" refers to the state in which two things are joined, fastened, adhered, connected, or bonded to one another, either directly or indirectly. For example, a nucleic acid can be attached to a functionalized polymer by a covalent or non-covalent bond. A covalent bond is characterized by the sharing of electron pairs between atoms. A non-covalent bond is a physical bond that does not involve the sharing of electron pairs, and can include, for example, hydrogen bonds, ionic bonds, van der Waals forces, hydrophilic interactions, and hydrophobic interactions.

[0032] An "azide" or "azido" functional group refers to an -N3.

[0033] As used herein, "carbocycle" refers to a non-aromatic cyclic ring or ring system containing only carbon atoms in the ring system backbone. When a carbocycle is a ring system, two or more rings can be joined together in a fused, bridged, or spiro-connected manner. Carbocycles can have any degree of saturation, provided that at least one ring in the ring system is not aromatic. Thus, carbocycles include cycloalkyl, cycloalkenyl, and cycloalkynyl. Carbocyclic groups can have 3 to 20 carbon atoms. Examples of carbocyclic rings include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohexenyl, 2,3-dihydro-indene, bicyclo[2.2.2]octanyl, adamantyl, and spiro[4.4]nonanyl. Any of the carbocycles may be heterocycles having at least one heteroatom in the ring backbone.

[0034] As used herein, "cycloalkyl" refers to a monocyclic or polycyclic hydrocarbon ring system that is fully saturated (e.g., has no double or triple bonds). When composed of more than one ring, the rings may be joined together in a fused fashion. A cycloalkyl group may contain 3 to 10 atoms in the ring(s). In some examples, a cycloalkyl group may contain 3 to 8 atoms in the ring(s). A cycloalkyl group may be unsubstituted or substituted. Exemplary cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl.

[0035] As used herein, "cycloalkenyl" or "cycloalkene" means a carbocyclic ring or ring system having at least one double bond, wherein none of the rings in the ring system are aromatic. Examples include cyclohexenyl or cyclohexene and norbornenyl or norbornene.

[0036] As used herein, "cycloalkynyl" or "cycloalkyne" means a carbocyclic ring or ring system having at least one triple bond, wherein none of the rings in the ring system is aromatic. An example is cyclooctyne. Another example is bicyclononyne (bicyclo[6.1.0]non-4-yne, also known as "BCN"). Yet another example is dibenzocyclooctyne (DBCO).

[0037] As used herein, the term "deposition" refers to any suitable application technique, which may be manual or automated, and which, in some cases, results in the modification of surface properties. Generally, deposition may be carried out using evaporation techniques, coating techniques, grafting techniques, etc. Some specific examples include chemical vapor deposition (CVD), spray coating (e.g., ultrasonic spray coating), spin coating, dunk or dip coating, doctor blade coating, puddle dispensing, flow-through coating, aerosol printing, screen printing, microcontact printing, inkjet printing, etc.

[0038] As used herein, the term "recess" refers to a discrete, concave feature in a substrate or patterned material having a surface opening at least partially surrounded by a void region of the substrate or patterned material. The recess can take any of a variety of shapes at the surface opening, such as, for example, a circle, an ellipse, a square, a polygon, a star (with any number of vertices), etc. The cross section of the recess taken perpendicular to the surface can be a curved shape, a square, a polygon, a hyperbola, a cone, an angled shape, etc. By way of example, the recess can be a well or two interconnected wells. The recess can also have a more complex structure, such as a ridge, a stepped feature, etc.

[0039] The term "each," when used in reference to a collection of items, is intended to identify each individual item in the set, but does not necessarily refer to every item in the set. Exceptions may occur where express disclosure or context clearly dictates otherwise.

[0040] As used herein, the term "flow cell" is intended to mean a vessel having a flow channel in fluid communication with at least one unmodified surface or at least one surface modified with a first member of a transition metal complex binding pair. The unmodified or modified surface can have attached thereto a surface chemistry used during nucleic acid analysis and can release the surface chemistry electrochemically or upon exposure to visible light. The flow cell also includes an inlet for delivering reagents to the flow channel and an outlet for removing reagents from the flow channel. The flow cell allows for the detection of reactions involving surface chemistry. For example, the flow cell can include one or more transparent surfaces, which allow for the optical detection of arrays, optically labeled molecules, and the like, within the flow channel.

[0041] As used herein, a "flow channel" or "channel" can be a region defined between two joined components that can selectively receive a liquid sample. In some examples, a flow channel can be defined between a patterned or unpatterned structure and a lid. In other examples, a flow channel can be defined between two patterned or unpatterned structures that are joined together.

[0042] As used herein, "heteroalicyclic" or "heteroalicyclic" refers to 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-, and up to 18-membered monocyclic, bicyclic, and tricyclic ring systems in which the carbon atoms, together with one to five heteroatoms, comprise the ring system. Heteroalicyclic ring systems may, however, optionally contain one or more unsaturated bonds positioned in such a way that a fully delocalized pi-electron system does not occur throughout the entire ring. Heteroatoms are independently selected from oxygen, sulfur, and nitrogen. Heteroalicyclic ring systems may further contain one or more carbonyl or thiocarbonyl functional groups, such that the definition includes oxo and thio systems, such as lactams, lactones, cyclic imides, cyclic thioimides, and cyclic carbamates. Rings may be joined together in a fused fashion. Additionally, any nitrogen in a heteroalicyclic ring may be quaternized. Heteroalicyclic or heterocycloaliphatic groups may be unsubstituted or substituted. Examples of such "heteroalicyclic" or "heteroaliphatic" groups include 1,3 dioxine, 1,3-dioxane, 1,4-dioxane, 1,2-dioxolane, 1,3-dioxolane, 1,4-dioxolane, 1,3-oxathiane, 1,4-oxathiine, 1,3-oxathiolane, 1,3-dithiol, 1,3-dithiolane, 1,4-oxathiane, tetrahydro-1,4-thiazine, 2H-1,2-oxazine, maleimide, succinimide, barbituric acid, thiobarbituric acid, dioxopiperazine, hydantoin, dihydrouracil, trioxane, hexahydro-1,3,5-triazine, imidazoline, imidazoline, methyltriazol-1,3,5-triazine ... These include dazolidine, isoxazoline, isoxazolidine, oxazoline, oxazolidine, oxazolidinone, thiazoline, thiazolidine, morpholine, oxirane, piperidine N-oxide, piperidine, piperazine, pyrrolidine, pyrrolidone, pyrrolidione, 4-piperidone, pyrazoline, pyrazolidine, 2-oxopyrrolidine, tetrahydropyran, 4H-pyran, tetrahydrothiopyran, thiamorpholine, thiamorpholine sulfoxide, thiamorpholine sulfone, and benzo-fused analogs thereof (e.g., benzimidazolidinone, tetrahydroquinoline, 3,4-methylenedioxyphenyl).

[0043] "(Heteroalicyclic)alkyl" refers to a heterocyclic or heteroalicyclic group bonded as a substituent via a lower alkylene group. The lower alkylene and heterocyclic ring of the (heteroalicyclic)alkyl, or the heterocyclic ring, may be substituted or unsubstituted. Examples include tetrahydro-2H-pyran-4-yl)methyl, (piperidin-4-yl)ethyl, (piperidin-4-yl)propyl, (tetrahydro-2H-thiopyran-4-yl)methyl, and (1,3-thiazinane-4-yl)methyl.

[0044] As used herein, "hydroxy" or "hydroxyl" refers to an --OH group.

[0045] As used herein, the term "glycol" refers to a glycol having a terminal group -(CH2) n OH, where n ranges from 2 to 10. As a specific example, the glycol can be an ethylene glycol terminated group -CH2CH2OH, a propylene glycol terminated group -CH2CH2CH2OH, or a butylene glycol terminated group -CH2CH2CH2CH2OH.

[0046] As used herein, the term "gap region" refers to a region of, for example, a substrate, patterned resin, or other support, that separates recesses or protrusions. For example, a gap region can separate one recess in an array from another recess in the array, or one protrusion in an array from another protrusion in the array. Two recesses or protrusions that are separated from each other may be distinct, e.g., lacking physical contact with each other. In many examples, the gap region is continuous, but the recesses or protrusions are discontinuous, as in the case of multiple recesses defined in an otherwise continuous surface. In other examples, the gap region and the features (e.g., recesses or protrusions) are discontinuous, as in the case of multiple trenches separated by respective gap regions. The separation provided by the gap region can be partial or complete. The gap region can have a surface material that is different from the surface material of the recesses or protrusions. For example, the recess or protrusion surface can include a polymer hydrogel, but the gap region does not include a polymer hydrogel.

[0047] As used herein, a "nucleotide" comprises a nitrogen-containing heterocyclic base, a sugar, and one or more phosphate groups. Nucleotides are the monomeric units of nucleic acid sequences. In ribonucleic acid (RNA), the sugar is ribose, and in deoxyribonucleic acid (DNA), the sugar is deoxyribose, e.g., a sugar lacking the hydroxyl group at the 2' position of the ribose. The nitrogen-containing heterocyclic base (e.g., nucleobase) can be a purine or pyrimidine base. Purine bases include adenine (A) and guanine (G), as well as modified derivatives or analogs thereof. Pyrimidine bases include cytosine (C), thymine (T), and uracil (U), as well as modified derivatives or analogs thereof. The C-1 atom of deoxyribose is linked to the N-1 atom of a pyrimidine or the N-9 atom of a purine. Nucleic acid analogs may have alterations in the phosphate backbone, sugar, or nucleobase. Examples of nucleic acid analogs include universal base or phosphate-sugar backbone analogs, such as peptide nucleic acids (PNAs).

[0048] In some instances, the term "over" can mean that one component or material is positioned directly on top of another component or material. When one is directly on top of the other, the two are in contact with each other. In FIG. 1B, polymer hydrogel 28 is applied over base support 14 such that it is directly on and in contact with single-layer base support 14.

[0049] In other examples, the term "over" can mean that one component or material is indirectly positioned on another component or material. Indirectly means that a gap or additional component or material can be positioned between the two components or materials. In FIG. 1D, the polymer hydrogel 28 is positioned over the base support 14 of the multi-layer structure 16' such that the two are in indirect contact. More specifically, layer 18 is positioned between the polymer hydrogel 28 and the base support 14.

[0050] As used herein, the terms "poly-azide," "poly-azido," "multi-azide," and "multi-azido" are synonymous and used interchangeably to refer to molecules having two or more azide or azido functionalities.

[0051] As used herein, the term "primer" is defined as a single-stranded nucleic acid sequence (e.g., single-stranded DNA). Some primers are part of a primer set that serves as the initiation point for template amplification and cluster generation. Other primers, referred to herein as sequencing primers, serve as the initiation point for DNA synthesis. The 5' end of the primer set may be modified to allow for coupling with a functional group of one of the orthogonal polymers. Primers can be any number of bases in length and can contain a variety of non-naturally occurring nucleotides. In one example, sequencing primers are short, ranging from 10 to 60 bases or 20 to 40 bases.

[0052] The term "substrate" refers to a structure onto which the various components of the flow cell (e.g., polymer hydrogel, primer, etc.) can be applied. The substrate may be a wafer, a panel, a rectangular sheet, a die, or any other suitable configuration. The substrate is generally rigid and hard and insoluble in aqueous liquids. The substrate may be a single layer structure or a multilayer structure (e.g., including a support and a patterned material on the support). Examples of suitable substrates will be described further herein.

[0053] As used herein, the terms "tetrazine" and "tetrazinyl" refer to a six-membered heteroaryl group containing four nitrogen atoms. The tetrazine can be optionally substituted.

[0054] Flow cells suitable for use with various method embodiments of the present invention can include any of the following suitable configurations: Thus, flow cells described herein prepared with mono-azide functional primer binding sites can be treated with reagents according to the present invention using methods according to various embodiments of the present invention before or after each use or any subsequent use in a nucleic acid sequencing process. Additionally, flow cells according to embodiments of the present invention can be of any of the following configurations:

[0055] An example of a flow cell 10 having a structure suitable for use in all embodiments is shown from a top view in Figure 1A. The flow cell 10 may include one or more (e.g., two) patterned or unpatterned structures bonded together, or a single patterned or unpatterned structure bonded to a lid, or similarly a single patterned or unpatterned structure.

[0056] The patterned structure, the unpatterned structure, or the patterned or unpatterned structure and the lid may be attached to one another via a spacer layer (not shown). The spacer layer may be any material that will seal portions of the patterned or unpatterned structure together, or seal portions of the patterned or unpatterned structure and the lid. By way of example, the spacer layer may be an adhesive, a radiation-absorbing material that aids in bonding, or the like. In some examples, the spacer layer is a radiation-absorbing material, such as KAPTON® Black. The patterned or unpatterned structure and the lid may be bonded using any suitable technique, such as laser bonding, diffusion bonding, anodic bonding, eutectic bonding, plasma-activated bonding, glass frit bonding, or other methods known in the art.

[0057] Between two patterned or unpatterned structures, or between one patterned or unpatterned structure and the lid, is a flow channel 12. The example shown in FIG. 1A includes eight flow channels 12. While eight flow channels 12 are shown, it should be understood that any number of flow channels 12 may be included in the flow cell 10 (e.g., a single flow channel 12, four flow channels 12, etc.). Each flow channel 12 may be isolated from other flow channels 12 such that fluids introduced into one flow channel 12 do not flow into adjacent flow channels 12. Some examples of fluids introduced into the flow channels 12 may introduce reaction components (e.g., cleavage fluids, DNA samples, polymerases, sequencing primers, nucleotides, etc.), wash solutions, deblocking agents, etc.

[0058] The flow channels 12 can have any desired shape. In one example, the flow channels 12 have a substantially rectangular configuration. The length of the flow channels 12 depends in part on the size of the substrate on which the patterned or unpatterned structures are to be formed. The width of the flow channels 12 depends in part on the size of the substrate on which the patterned or unpatterned structures are to be formed, the desired number of flow channels 12, the desired spacing between adjacent channels 12, and the desired spacing around the patterned or unpatterned structures.

[0059] The depth of flow channel 12 can be as little as a monolayer thickness when microcontact, aerosol, or inkjet printing is used to deposit the separate materials defining the flow channel 12 walls. In other examples, the depth of flow channel 12 can be about 1 μm, about 10 μm, about 50 μm, about 100 μm, or greater. In one example, the depth can range from about 10 μm to about 100 μm. In another example, the depth can range from about 10 μm to about 30 μm. In yet another example, the depth is about 5 μm or less. It should be understood that the depth of flow channel 12 can be greater than, less than, or between the values ​​specified above.

[0060] Each flow channel 12 is in fluid communication with an inlet and an outlet (not shown). The inlet and outlet of each flow channel 12 may be located at opposite ends of the flow cell 10. Alternatively, the inlet and outlet of each flow channel 12 may be positioned anywhere along the length and width of the flow channel 12 that allows for the desired fluid flow.

[0061] The inlets allow fluid to be introduced into the flow channel 12, and the outlets allow fluid to be withdrawn from the flow channel 12. Each of the inlets and outlets is fluidly connected to a fluid control system (e.g., including reservoirs, pumps, valves, waste containers, etc.) that controls the introduction and removal of fluids.

[0062] 1B, 1C, and 1D show different examples of structures within flow channel 12. FIG.

[0063] Each of the structures includes a substrate, such as a single layer base support 14 (shown in FIG. 1B) or a multi-layer structure 16, 16' (shown in FIGS. 1C and 1D, respectively).

[0064] Examples of suitable single layer base supports 14 include epoxy siloxane, glass, modified or functionalized glass, plastics (including acrylics, polystyrene, copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethane, polytetrafluoroethylene (such as TEFLON® from Chemours), cyclic olefins / cyclo-olefin polymers (COP) (such as ZEONOR® from Zeon), polyimides, etc.), nylon (polyamide), ceramic / ceramic oxide, silica, fused silica, silica-based materials, aluminum silicate, silicon and modified silicon (e.g., boron-doped p+ silicon), silicon nitride (Si3N4), silicon dioxide (SiO2), tantalum pentoxide (Ta2O5) or other tantalum oxides (TaO x ), hafnium oxide (HfO2), carbon, metals, inorganic glass, etc.

[0065] An example of a multi-layer structure 16, 16' includes a base support 14 and at least one other layer 18 thereon, as shown in Figures 1C and 1D.

[0066] Some examples of multilayer structures 16, 16' include glass or silicon as the base support 14, with a tantalum oxide (e.g., tantalum pentoxide or another tantalum oxide (TaO x )) or another ceramic oxide coating layer (e.g., layer 18).

[0067] Another example of a multilayer structure 16, 16' includes a base support 14 (e.g., glass, silicon, tantalum pentoxide, or any of other base support 14 materials) and a patterned resin as the other layer 18. It should be understood that any material that can be selectively deposited, or deposited and patterned, to form recessed portions 20 and gap regions 22 (FIG. 1C), or protruding portions 24 and gap regions 22 (FIG. 1D), can be used for the patterned resin.

[0068] As an example of a patterned resin, an inorganic oxide may be selectively applied via vapor deposition, aerosol printing, or inkjet printing to the base support 14. Examples of suitable inorganic oxides include tantalum oxide (e.g., TaO), aluminum oxide (e.g., AlO), silicon dioxide (e.g., SiO), hafnium oxide (e.g., HfO), and the like.

[0069] As another example of a patterned resin, a polymeric resin may be applied to the base support 14 and then patterned. Suitable deposition techniques include chemical vapor deposition, dip coating, dunk coating, spin coating, spray coating, droplet dispensing, ultrasonic spray coating, doctor blade coating, aerosol printing, screen printing, microcontact printing, and the like. Suitable patterning techniques include photolithography, nanoimprint lithography (NIL), stamping techniques, embossing techniques, molding techniques, microetching techniques, and the like. Some examples of suitable resins include polyhedral oligomeric silsesquioxane resin (POSS)-based resins, non-POSS epoxy resins, poly(ethylene glycol) resins, polyether resins (e.g., ring-opened epoxies), acrylic resins, acrylate resins, methacrylate resins, amorphous fluoropolymer resins (e.g., CYTOP® from Bellex), and combinations thereof.

[0070] As used herein, the term "polyhedral oligomeric silsesquioxanes" (POSS) refers to hybrid intermediates between silica (SiO) and silicone (RSiO) (e.g., RSiO 1.5) refers to a chemical composition having the chemical formula [RSiO 3 / 2 ] n where the R groups can be the same or different. Exemplary R groups of POSS include epoxy, azide / azido, thiol, poly(ethylene glycol), norbornene, tetrazine, acrylate, and / or methacrylate, or even alkyl, aryl, alkoxy, and / or haloalkyl groups, for example.

[0071] In one example, the single base support 14 (whether used alone or as part of a multi-layer structure 16, 16') can be a circular sheet, panel, wafer, die, etc. having a diameter ranging from about 2 mm to about 300 mm, e.g., from about 200 mm to about 300 mm, or a rectangular sheet, panel, wafer, die, etc. having a maximum dimension of up to about 10 feet (about 3 meters). For example, the die can have a width ranging from about 0.1 mm to about 10 mm. While exemplary dimensions are provided, it should be understood that a single base support 14 having any suitable dimensions can be used.

[0072] The structure shown in FIG. 1B is an unpatterned structure. The substrate of the unpatterned structure can be a single-layer base support 14. In this example, the single-layer base support 14 has lanes 26 surrounded by edge regions 30. The lanes 26 provide designated areas for polymer hydrogels 28. The edge regions 30 provide bonding areas where two unpatterned structures can be attached to each other or one unpatterned structure can be attached to a lid. Thus, in this example, the surface of the flow cell is unpatterned, and the polymer hydrogels 28 are disposed within the lanes 26 of the unpatterned surface.

[0073] Polymer hydrogel 28 can be any gel material that can swell when liquid is absorbed and shrink when the liquid is removed, for example, by drying. In an example of a flow cell suitable for use in a method embodiment according to the present invention for treatment with a reagent according to various embodiments of the present invention, polymer hydrogel 28 comprises an acrylamide copolymer. Some examples of acrylamide copolymers include the following structure (II):

[0074] [ka] where R A is selected from the group consisting of azide and optionally substituted amine; R B is H or optionally substituted alkyl, and R C , R D , and R E are each independently selected from the group consisting of H and optionally substituted alkyl, and —(CH) p Each of - can be optionally substituted, p is an integer ranging from 1 to 50, n is an integer ranging from 1 to 50,000, and m is an integer ranging from 1 to 100,000.

[0075] One specific example of an acrylamide copolymer represented by structure (I) is poly(N-(5-azidoacetamidylpentyl)acrylamide-co-acrylamide, PAZAM).

[0076] Those skilled in the art will recognize that the arrangement of the "n" and "m" repeating features in structure (II) is representative, and that the monomer subunits can be present in any order in the polymer structure (e.g., random, block, patterned, or combinations thereof).

[0077] The molecular weight of the acrylamide copolymer can range from about 5 kDa to about 1500 kDa, or from about 10 kDa to about 1000 kDa, or in a specific example, can be about 312 kDa.

[0078] In some instances, the acrylamide copolymer is a linear polymer. In some other instances, the acrylamide copolymer is a lightly crosslinked polymer.

[0079] In another example, the gel material can be a variation of structure (II). In one example, the acrylamide unit is N,N-dimethylacrylamide:

[0080] [ka] may be substituted with

[0081] In this example, the acrylamide unit in structure (II) is

[0082] [ka] wherein R D , R E , and R F are each H or C1-C6 alkyl, and R G and R H are each C1-C6 alkyl (not H as in acrylamide). In this example, q can be an integer ranging from 1 to 100,000.

[0083] In another example, in addition to the acrylamide unit, N,N-dimethylacrylamide can be used. In this example, structure (II) is:

[0084] [ka] In addition to the repeated "n" and "m" features, D , R E , and R F are each H or C1-C6 alkyl, and R G and R Hare each C1-C6 alkyl. In this example, q can be an integer ranging from 1 to 100,000.

[0085] As another example of a polymer hydrogel, the "n" repeating features in structure (II) can be replaced with a heterocyclic azide group-containing monomer having structure (III):

[0086] [ka] In the formula, R 1 is H or C1-C6 alkyl, and R 2 is H or C1-C6 alkyl; L is a linker comprising a linear chain of 2-20 atoms selected from the group consisting of carbon, oxygen, and nitrogen, and including 10 optional substituents on the carbon and any nitrogen atoms in the chain; E is a linear chain of 1-4 atoms selected from the group consisting of carbon, oxygen, and nitrogen, and including optional substituents on the carbon and any nitrogen atoms in the chain; A is an N-substituted amide with H or C1-C4 alkyl attached to the N; and Z is a nitrogen-containing heterocycle. Examples of Z include 5-10 carbon-containing ring members present as single ring structures or fused structures. Some specific examples of Z include pyrrolidinyl, pyridinyl, or pyrimidinyl. As yet another example, the gel material may comprise repeating units of each of structures (III) and (IV):

[0087] [ka] In the formula, R 1a , R 2a , R 1b and R 2b each independently selected from hydrogen, optionally substituted alkyl, or optionally substituted phenyl; R 3a and R 3b each is independently selected from hydrogen, optionally substituted alkyl, optionally substituted phenyl, or optionally substituted C7-C14 aralkyl; 1 and L 2are each independently selected from an optionally substituted alkylene linker or an optionally substituted heteroalkylene linker.

[0088] In yet another example, the acrylamide copolymer is formed using nitroxide-mediated polymerization, and therefore, at least a portion of the copolymer chain has an alkoxyamine end group. In the copolymer chain, the term "alkoxyamine end group" refers to a dormant species -ONR1R2, where each of R1 and R2 can be the same or different and can independently be a linear or branched alkyl, or a ring structure, and the oxygen atom is attached to the remainder of the copolymer chain. In some examples, the alkoxyamine also is attached to some of the repeating acrylamide monomers, such as the R of structure (I). A Thus, in one example, structure (I) includes an alkoxyamine end group, and in another example, structure (I) includes an alkoxyamine end group and an alkoxyamine group on at least a portion of the side chain.

[0089] Examples disclosed herein may utilize a variety of polymeric architectures that include acrylic monomers (e.g., acrylamide, acrylates, etc.), such as dendrimers (e.g., multi-arm or star polymers), branched polymers, including star or star-block polymers, etc. For example, monomers (e.g., acrylamide, acrylamide containing a catalyst, etc.) may be incorporated into the branches (arms) of the dendrimer, either randomly or in blocks.

[0090] To introduce the polymer hydrogel 28 into the lanes 26, a mixture of the polymer hydrogel 28 can be created and then applied to the monolayer base support 14. In one example, the polymer hydrogel 28 can be present in a mixture (e.g., with water, or with ethanol and water). The mixture can then be applied to the respective substrate surface (including the lanes 26) using spin coating, dipping or dip coating, or flow of material under positive or negative pressure, or another suitable technique. These types of techniques deposit the polymer hydrogel 28 within the lanes 26 and over the edge regions 30. Other selective deposition techniques (e.g., involving masks, controlled printing techniques, etc.) can be used to specifically deposit the polymer hydrogel 28 within the lanes 26 and not over the edge regions 30.

[0091] In some examples, the surface of the monolayer base support 14 (including the lanes 26) can be activated, and then the mixture (including the polymer hydrogel 28) can be applied thereto. In one example, a silane or silane derivative (e.g., norbornene silane) can be deposited on the surface of the monolayer base support 14 using vapor deposition, spin coating, or other deposition methods. In another example, the substrate surface can be exposed to plasma ashing to generate surface-activating agents (e.g., —OH groups) capable of adhering to the polymer hydrogel 28.

[0092] Depending on the chemical nature of the polymer hydrogel 28, the applied mixture may be subjected to a curing process. In one example, curing can occur at temperatures ranging from room temperature (e.g., about 25° C.) to about 95° C. for times ranging from about 1 millisecond to about several days.

[0093] Polishing can then be performed to remove the polymer hydrogel 28 from the edge regions 30 around the lanes 26, while leaving the polymer hydrogel 28 on the surfaces within the lanes 26 at least substantially intact.

[0094] The structure shown in Figure 1C is an example of a patterned structure. The substrate of this patterned structure is a multilayer structure 16 having recesses 20 defined in layer 18. The recesses 20 provide designated areas for polymer hydrogel 28. In this example, the surface of flow cell 10 is patterned with recesses 20 separated by gap areas 22, and polymer hydrogel 28 is disposed within each recess 20 of the patterned surface.

[0095] Many different layouts of the recesses 20 are possible, including regular, repeating, and irregular patterns. In one example, the recesses 20 are arranged in a hexagonal grid to provide close packing and improve density. Other layouts may include, for example, rectangular layouts, triangular layouts, etc. In some examples, the layout or pattern may be in an xy format with rows and columns. In some other examples, the layout or pattern may be a repeating arrangement of recesses 20 and void regions 22. In yet other examples, the layout or pattern may be a random arrangement of recesses 20 and void regions 22.

[0096] The layout or pattern can be characterized in terms of the density (number) of recesses 20 within a defined area. For example, recesses 20 are spaced apart from each other by 1 mm 2 For example, they may be present at a density of about 2 million per mm 2 Approximately 100, 1mm per 2 Approximately 1,000 per 1mm 2 Approximately 100,000 per 1mm 2 Approximately 1 million per 1mm 2 Approximately 2 million per 1mm 2 Approximately 5 million per 1mm 2 Approximately 10 million per mm 2The density can be adjusted to different densities, including densities of about 50 million per unit area, or higher or lower. It should be further understood that the density can be between one of the lower limit values ​​and one of the upper limit values ​​selected from the range above, or other densities (outside of the given range) can be used. By way of example, a high-density array can be characterized as having recesses 20 separated by less than about 100 nm, a medium-density array can be characterized as having recesses 20 separated by about 400 nm to about 1 μm, and a low-density array can be characterized as having recesses 20 separated by more than about 1 μm.

[0097] The layout or pattern of recesses 20 may additionally or alternatively be characterized in terms of average pitch, or the spacing from the center of one recess 20 to the center of an adjacent recess 20 (center-to-center spacing), or the spacing from the right edge of one recess 20 to the left edge of an adjacent recess 20 (edge-to-edge spacing). The pattern can be regular, such that the coefficient of variation around the average pitch is small, or irregular, such that the coefficient of variation can be relatively large. In either case, the average pitch may be, for example, about 50 nm, about 0.1 μm, about 0.5 μm, about 1 μm, about 5 μm, about 10 μm, or about 100 μm. The average pitch of a particular pattern may be between one of the lower values ​​and one of the upper values ​​selected from the ranges above. In one example, recesses 28A, 28B have a pitch (center-to-center spacing) of about 1.5 μm. While example average pitch values ​​have been provided, it should be understood that other average pitch values ​​may also be used.

[0098] The size of each recess 20 may be characterized by its volume, open area, depth, and / or diameter. For example, the volume may be about 1×10 -3 μm 3 ~about 100μm 3 ranges from about 1 × 10 -2 μm 3 , about 0.1μm 3 , about 1μm 3 , about 10μm 3In another example, the opening area may be about 1×10 3 μm 2 ~about 100μm 2 ranges from about 1 × 10 -2 μm 2 , about 0.1μm 2 , about 1μm 2 , at least about 10 μm 2 In yet another example, the depth may range from about 0.1 μm to about 100 μm, such as about 0.5 μm, about 1 μm, about 10 μm, or more or less. In yet another example, the diameter or length and width may range from about 0.1 μm to about 100 μm, such as about 0.5 μm, about 1 μm, about 10 μm, or more or less.

[0099] Any of the examples of polymer hydrogel 28 disclosed herein may be used in the structure shown in Figure 1C.

[0100] To introduce the polymer hydrogel 28 into the recesses 20, a mixture of the polymer hydrogel 28 can be created and then applied to the multilayer structure 16. In one example, the polymer hydrogel 28 can be present in a mixture (e.g., with water, or with ethanol and water). The mixture can then be applied to each substrate surface (including the lanes 26) using spin coating, dipping or dip coating, or flow of material under positive or negative pressure, or another suitable technique. These types of techniques deposit the polymer hydrogel 28 into the recesses and over the interstitial regions 22. Other selective deposition techniques (e.g., involving masks, controlled printing techniques, etc.) can be used to specifically deposit the polymer hydrogel 28 into the recesses 20 and not over the interstitial regions 22.

[0101] In some examples, the surface of layer 18 (including recesses 20) may be activated, and then the mixture (including polymer hydrogel 28) may be applied thereto. In one example, a silane or silane derivative (e.g., norbornene silane) may be deposited on the surface of layer 18 using vapor deposition, spin coating, or other deposition methods. In another example, layer 18 may be exposed to plasma ashing to generate surface-activating agent(s) (e.g., —OH groups) that can adhere to polymer hydrogel 28.

[0102] Depending on the chemical nature of the polymer hydrogel 28, the applied mixture may be subjected to a curing process. In one example, curing can occur at temperatures ranging from room temperature (e.g., about 25° C.) to about 95° C. for times ranging from about 1 millisecond to about several days.

[0103] Polishing may then be performed to remove the polymer hydrogel 28 from the gap regions 22 while leaving the polymer hydrogel 28 within the recesses 20 at least substantially intact.

[0104] The structure shown in FIG. 1D is another example of a patterned structure. The substrate of this patterned structure is a multilayer structure 16′ having protrusions 24 defined within layer 18. The protrusions 24 are three-dimensional structures that extend outward (upward) from an adjacent surface. The protrusions 24 may be created via etching, photolithography, imprinting, etc. In this example, the surface of the flow cell 10 is patterned with protrusions 24 separated by gap regions 22, and a polymer hydrogel 28 is disposed on each protrusion 24 of the patterned surface.

[0105] While any suitable three-dimensional shape can be used for the protrusions 24, a geometric shape having at least a substantially flat upper surface may be desirable. Examples of geometric shapes for the protrusions include spheres, cylinders, cubes, polygonal prisms (e.g., rectangular prisms, hexagonal prisms, etc.), and the like.

[0106] Many different layouts of protrusions 24 are possible, including any of those described herein for recesses 20. The layout or pattern can be characterized in terms of the density (number) of protrusions 24 within a defined area. The protrusions 24 may be spaced apart from each other by 1 mm. 2 The protrusions 24 may be present at a density of approximately 2 million per protrusion, or any of the other examples shown herein for the recesses 20. The layout or pattern of the protrusions 24 may also or alternatively be characterized in terms of an average pitch, or the spacing from the center of one protrusion 24 to the center of an adjacent protrusion 24 (center-to-center spacing), or the spacing from the right edge of one protrusion 24 to the left edge of an adjacent protrusion 24 (edge-to-edge spacing).

[0107] The size of each protrusion 24 can be characterized by its surface area. The surface area of ​​protrusion 28 is approximately 1×10 -3 μm 2 ~about 100μm 2 range, e.g., about 1 × 10 -2 μm 2 , about 0.1μm 2 , about 1μm 2 , at least about 10 μm 2 , or may be more or less.

[0108] The height of each protrusion 24 (measured from the gap region 22) can range from about 10 nm to about 500 nm.

[0109] Any example of the polymer hydrogel 28 disclosed herein can be used in the structure shown in Figure ID. To introduce the polymer hydrogel 28 onto the protrusions 24, a mixture of the polymer hydrogel 28 can be created and then applied to the protrusions 24. Selective deposition techniques can be used to deposit the polymer hydrogel 28 on the protrusions 24 but not in the gap regions 22. A mask can be used to cover the gap regions 22 while the polymer hydrogel is deposited on the protrusions 24.

[0110] Each example flow cell configuration also includes a primer 32, 34. The primer 32, 34 may be introduced into the flow cell 10 and grafted to the azide or amine functional groups of the polymer hydrogel 28 at the beginning of a nucleic acid analysis. Several primers 32, 34 are discussed below with reference to various kits and methods.

[0111] The example flow cell 10 disclosed herein can be used in a variety of methods for regenerating primer grafting functional groups after a sequencing cycle has been performed and can be included in various kits along with the fluids used in the methods. Additionally, the example flow cell 10 disclosed herein can be treated with reagents according to various embodiments of the present invention before the flow cell is used in any sequencing process, such that amine functional groups present on the surface of an unused flow cell react with compounds to provide molecules bearing two or more azide functional groups on the flow cell surface. The kits and methods will now be described with reference to Figures 1-5.

[0112] In a first example, a kit according to one embodiment of the present invention includes a reusable flow cell including at least one surface functionalized with a polymer hydrogel containing azide functional groups (and optionally amine functional groups), a primer fluid including a plurality of alkyne-containing primers, each having an amino-cleavable group that attaches the primer sequence of the alkyne-containing primer to the alkyne-containing portion of the alkyne-containing primer, and a cleavage fluid reactive with the amino-cleavable group. This kit can be used in the method illustrated in FIG.

[0113] In this exemplary kit, the flow cell 10 can be any of the examples described herein with reference to Figures 1B-1D. The polymer hydrogel-functionalized surface can be any of the patterned or unpatterned structures described herein and can include any example of polymer hydrogel 28.

[0114] This exemplary kit includes a primer fluid, which includes multiple alkyne-containing primers, e.g., primers 32A and 34A, in a carrier liquid. The alkyne-containing primers 32A and 34A may include forward and reverse amplification primer sequences that terminate in an alkyne for reaction with azide functional groups on the polymer hydrogel 28 (and may optionally also include forward and reverse amplification primer sequences that contain an internal alkyne for reaction with a tetrazine molecule that may be attached to the polymer hydrogel 28). Together, the primers 32A and 34A enable amplification of library templates that have terminal adapters that are complementary to two different primers 32A and 34A.

[0115] For example, the primer sequences of alkyne-containing primers 32A and 34A may include the P5 and P7 primer sequences, the P15 and P7 primer sequences, or any combination of the PA, PB, PC, and PD primer sequences shown herein.

[0116] Exemplary P5 and P7 primers are used on the surface of commercially available flow cells sold by Illumina Inc., for example, for sequencing on HISEQ™, HISEQX™, MISEQ™, MISEQDX™, MINISEQ™, NEXTSEQ™, NEXTSEQDX™, NOVASEQ™, ISEQ™, GENOME ANALYZER™, and other instrument platforms.

[0117] The P5 primer sequence is P5: 5'→3' AATGATACGGCGACCACCGAGAnCTACAC (SEQ ID NO: 1) where "n" is uracil or alkene-thymidine (e.g., alkene-dT).

[0118] The P7 primer sequence can be any of the following: P7 number 1: 5'→3' CAAGCAGAAGACGGCATACGAnAT (SEQ ID NO: 2) P7 number 2: 5'→3' CAAGCAGAAGACGGCATACnAGAT (SEQ ID NO: 3) where "n" is 8-oxoguanine in each of the sequences.

[0119] The P15 primer sequence is P15:5'→3' AATGATACGGCGACCACCGAGAnCTACAC (SEQ ID NO: 4), where "n" is allyl-T.

[0120] Other primers (PA-PD) mentioned above include: PA 5'→3' GCTGGCACGTCCGAACGCTTCGTTAATCCGTTGAG (SEQ ID NO: 5) cPA(PA') 5'→3'CTCAACGGATTAACGAAGCGTTCGGACGTGCCAGC (SEQ ID NO: 6) PB 5'→3' CGTCGTCTGCCATGGCGCTTCGGTGGATATGAACT (SEQ ID NO: 7) cPB(PB') 5'→3'AGTTCATATCCACCGAAGCGCCATGGCAGACGACG (SEQ ID NO: 8) PC 5'→3' ACGGCCGCTAATATCAACGCGTCGAATCCGCAACT (SEQ ID NO: 9) cPC(PC')5'→3' AGTTGCGGATTCGACGCGTTGATATTAGCGGCCGT (SEQ ID NO: 10) PD 5'→3' GCCGCGTTACGTTAGCCGGACTATTCGATGCAGC (SEQ ID NO: 11) cPD(PD')5'→3'GCTGCATCGAATAGTCCGGCTAACGTAACGCGGC (SEQ ID NO: 12)

[0121] Although not shown in the exemplary sequence for PA-PD, it should be understood that any of these primer sequences may contain a cleavage site (e.g., uracil, 8-oxoguanine, allyl-T, etc.) at any point in the strand.

[0122] Each of the alkyne-containing primers 32A, 34A in the first exemplary kit also includes an amino-cleavable group 36 (see FIG. 2) attached to the 5' end of one of the sequences shown herein. The amino-cleavable group 36 has a cleavage chemistry that is orthogonal to the cleavage chemistry of the cleavage site (e.g., uracil, 8-oxoguanine, allyl-T, etc.) used for linearization during cluster generation. Thus, the amino-cleavable group 36 is not cleaved during linearization. When cleaved, the amino-cleavable group 36 leaves a terminal amine functional group on the polymer hydrogel 28. Examples of amino-cleavable groups 36 are selected from the group consisting of phthalimide groups, BOC (tertbutyloxycarbonyl)amide, and triphenylmethylamine. These cleavable groups are stable through at least 300 sequencing cycles that may be performed during nucleic acid analysis.

[0123] Each of the alkyne-containing primers 32A, 34A in the first exemplary kit can also include a poly-T sequence attached to the amino-cleavable group 36. In some examples, the poly-T region includes between 2 T bases and 20 T bases. As specific examples, the poly-T region can include 3, 4, 5, 6, 7, or 10 T bases.

[0124] The alkyne-containing primers 32A, 34A in the first exemplary kit contain an alkyne to react with the azide functional groups of the polymer hydrogel 28.

[0125] The alkyne is part of an alkyne-containing moiety 38 (FIG. 2) attached to an amino-cleavable group 36 attached to the 5′ end of the primer sequence. Thus, the amino-cleavable group 36 attaches the primer sequence of the alkyne-containing primer 32A, 34A to the alkyne-containing moiety 38 of the alkyne-containing primer 32A, 34A. In some examples, the alkyne is a terminal alkyne (shown in FIG. 2). Hexynyl is an example that can be attached to the amino-cleavable group 36 to generate a terminal alkyne. In various embodiments where the primer fluid also includes an optional primer sequence containing an internal alkyne for reaction with a tetrazine molecule, the alkyne can be part of a cyclic compound attached to the amino-cleavable group 36 at the 5′ end of the primer 32A, 34A. Bicyclo[6.1.0]nonyne (BCN) is an example that can be attached to the amino-cleavable group 36 to generate an internal alkyne.

[0126] The alkyne-containing primers 32A, 34A may be contained in the carrier liquid at a concentration ranging from about 5 μM to about 10 μM.

[0127] The carrier liquid for the primer fluid in the first exemplary kit may be water. A buffer solution may be added to the carrier liquid to graft the primers 32A and 34A to suitable functional groups on the polymer hydrogel 28. The buffer solution has a pH ranging from 7 to 10, and the buffer solution used will depend on the alkyne-containing primer used. A neutral buffer solution may be added to the primer fluid for grafting BCN-terminated primers, while an alkaline buffer solution may be added to the primer fluid for copper-assisted grafting methods (e.g., click reactions). Examples of neutral buffer solutions include tris(hydroxymethyl)aminomethane (TRIS) buffers, such as TRIS-HCl or TRIS-EDTA, or sodium sulfate. Examples of alkaline buffers include tris(hydroxymethyl)aminomethane (CHES) and 3-(cyclohexylamino)-1-propanesulphonic acid (CAPS).

[0128] The first exemplary kit can also include a cleavage fluid 44. The cleavage fluid 44 is reactive with the amino cleavable group 36. In one example, the amino cleavable group 36 is a phthalimide group and the cleavage fluid 44 is hydrazine or methylhydrazine. In another example, the amino cleavable group 36 is a BOC amide or triphenylmethylamine and the cleavage fluid 44 is an acid. Exemplary acids include hydrochloric acid in water, trifluoroacetic acid in water, and methanol.

[0129] The first exemplary kit also includes a regeneration fluid 46 (FIG. 2). The regeneration fluid according to various embodiments described herein is a reagent including a compound having two or more terminal azide functionalities and a terminus having a moiety capable of covalently bonding to an amine group. The regeneration fluid 46 includes a compound having two or more terminal azide functionalities and a terminus having a moiety capable of covalently bonding to an amine group. In various embodiments, the compound having two or more terminal azide functionalities and a terminus having a moiety capable of covalently bonding to an amine group may be selected from the group consisting of N-(PEG3-N-hydroxysuccinimide)-N-bis(PEG3-azide) and N-hydroxysuccinimide-PEG5-tris(PEG3-azide). The regeneration fluid according to various embodiments may include a solution or mixture of one or more compounds having the general formula (I):

[0130] [ka] wherein each Az represents an azide moiety, R represents a moiety that forms a covalent bond with an amine group, each X independently represents a bridging group, Y represents nitrogen or carbon, and a is equal to 1 or 2. In various embodiments, suitable bridging groups can include alkyl chains, polyalkylene glycol chains, polypeptides, and polysaccharides. In certain embodiments, suitable bridging groups can include polyethylene glycol having 2 to 20 PEG units, and in some embodiments, 3 to 10 PEG units. In various embodiments, the regeneration fluid can include a solution of a first compound and a second compound, each having the general formula (I):

[0131] [ka] wherein each Az represents an azide moiety, R represents a moiety that forms a covalent bond with an amine group, each X independently represents a bridging group, Y represents nitrogen or carbon, a is equal to 1 or 2, and each X in the first compound has a longer chain length (e.g., more ethylene glycol units) than each X in the second compound. In various embodiments, the X bridging the R group and Y in the first compound can have a longer chain length than the X bridging the R group and Y in the second compound. In various embodiments, the regenerating fluid can include a solution of compounds having the general formula (I), wherein at least one X bridging Y and an Az group has a longer chain length than another X bridging Y and another Az group in the compound.

[0132] The regeneration fluid may also contain (or may be included in the kit as an additional regeneration fluid) a tetrazine-terminated molecule selected from the group consisting of tetrazine-N-hydroxysuccinimide ester and methyltetrazine-sulfo-N-hydroxysuccinimide ester. The regeneration fluid may also contain (or may be included in the kit as another additional regeneration fluid) an amine oxidizer, such as imidazole-1-sulfonyl azide hydrochloride (as an amine oxidizer), which may be present in an alcoholic solution with one or more salts.

[0133] The regeneration fluid 46 may also include a carrier liquid such as water, alone or in combination with a buffer. Exemplary buffers include phosphate, citric acid, boric acid, or any alkaline buffer. The pH of the regeneration fluid ranges from about 7 to about 10.5. The poly-azide-terminated molecules may be included in the carrier liquid at a concentration of about 100 μM up to about 10 mM.

[0134] In various embodiments, the first exemplary kit also includes an optional linker fluid that can include tetrazine molecules to react with the amine functional groups of the polymer hydrogel 28 of the flow cell 10. In this linker fluid, the tetrazine molecules include tetrazine-N-hydroxysuccinimide ester, methyltetrazine-sulfo-N-hydroxysuccinimide ester, and methyltetrazine-PEG.n -N-hydroxysuccinimide esters (n=4 or 5 or 8). In another example, the linker fluid includes a tetrazine molecule to be reacted with the azide functional group of the polymer hydrogel 28 of the flow cell 10. In this linker fluid, the tetrazine molecule is sulfo-6-methyl-tetrazine-dibenzocyclooctyne. In any example of the linker fluid, the tetrazine molecule may be included in the carrier liquid at a concentration of about 100 μM and up to about 10 mM.

[0135] The carrier liquid of the linker fluid may be water alone or in combination with a buffer. Exemplary buffers include phosphate, citric acid, boric acid, or any alkaline buffer. The pH of the regeneration fluid ranges from about 7 to about 10.5.

[0136] In some examples, the optional linker fluid may be included in a kit having a flow cell 10 containing a polymer hydrogel 28 with amine functional groups. In other examples, the optional linker fluid may be included in a kit having a flow cell 10 containing a polymer hydrogel 28 with azide functional groups. The kit may also include an azide reducing agent to initially convert the azide functional groups to amine functional groups if the tetrazine molecules in the linker fluid are to react with the amine functional groups. Examples of suitable azide reducing agents include phosphines or phosphites.

[0137] A method according to an embodiment of the present invention that can utilize the first exemplary kit includes grafting a plurality of alkyne-containing primers 32A, 34A onto respective azide functional groups 61 (and optionally tetrazine functional groups) of a polymer hydrogel 28 on the surface of a flow cell 10, wherein each of the plurality of alkyne-containing primers 32A, 34A has an amino cleavable group 36 that attaches the primer sequence of the alkyne-containing primer to the alkyne-containing portion of the alkyne-containing primer; performing a nucleic acid analysis involving the grafted plurality of alkyne-containing primers 32A, 34A; introducing a cleavage fluid to cleave the grafted plurality of alkyne-containing primers 32A, 34A at the amino cleavable groups 36, thereby leaving a plurality of amine functional groups on the surface of the flow cell 10; and contacting the surface of the flow cell 10 with a regeneration fluid to provide a plurality of new azide functional groups 61′ on the surface of the flow cell 10. In each instance of FIG. 2, (Az) represents an azide functionality, x represents an integer greater than 0, and at least one (Az) x is a molecule of formula (I) attached to an amine group 50.

[0138] It should be understood that in this example of the method, the plurality of alkyne-containing primers 32A, 34A may alternatively be pre-grafted onto the flow cell 10. In these examples, the method includes performing a nucleic acid assay including the grafted plurality of alkyne-containing primers 32A, 34A, introducing a cleavage fluid to cleave the grafted plurality of alkyne-containing primers 32A, 34A at the amino cleavable groups 36, thereby leaving a plurality of amine functional groups on the surface of the flow cell 10, and contacting the surface of the flow cell 10 with a regeneration fluid to provide a plurality of new azide functional groups on the surface of the flow cell 10.

[0139] An example of such a method is shown in Figure 2. This example shows the regeneration of azide functional groups (N3) of polymer hydrogel 28 in lane 26 of an unpatterned configuration of flow cell 10. Lane 26 of flow cell 10 is designated by the letter A in Figure 2. It should be understood that any of the flow cell 10 configurations disclosed herein may be used.

[0140] If the alkyne-containing primers 32A, 34A are not pre-grafted onto the polymer hydrogel 28 of the flow cell 10, the method includes grafting the alkyne-containing primers 32A, 34A onto at least a portion of the azide functional groups of the polymer hydrogel 28. To graft, the primer fluid of the first exemplary kit is introduced into the flow cell 10. The primer fluid may be introduced using flow-through deposition. Grafting can be performed at a temperature ranging from about 15°C to about 100°C for a time ranging from about 5 minutes to about 180 minutes, or longer. In one example, grafting is performed at 60°C for about 30 minutes. During grafting, the alkyne-containing primers 32A, 34A attach to at least a portion of the azide groups of the polymer hydrogel 28 and have no affinity for the interstitial region 22 or the edge portion 30 of the flow cell 10. The grafted primers 32A, 34A are designated by the letter B in FIG. 2.

[0141] Nucleic acid analysis can then be performed. In one example, nucleic acid analysis includes introducing a sample containing multiple template nucleic acid strands into the flow cell 10, whereby at least a portion of the multiple template nucleic acid strands hybridize to at least a portion of the primer sequences of the grafted multiple alkyne-containing primers 32A, 34A, respectively, and performing sequencing-by-synthesis. The sequencing-by-synthesis method includes amplifying the template nucleic acid strands and sequencing the amplified template nucleic acid strands.

[0142] A sample containing multiple template nucleic acid strands (e.g., library templates) can be initially prepared from any nucleic acid sample (e.g., a DNA sample or an RNA sample). A DNA nucleic acid sample can be fragmented into similarly sized (e.g., less than 1000 bp) single-stranded DNA fragments. An RNA nucleic acid sample can be used to synthesize complementary DNA (cDNA), and the cDNA can be fragmented into similarly sized (e.g., <1000 bp) single-stranded cDNA fragments. During preparation, adapters can be added to either end of the fragments. Reduced cycle amplification can introduce different motifs into the adapters, such as sequencing primer binding sites, indexes, and regions complementary to primers 32A and 34A on the flow cell surface. The final library template contains DNA or cDNA fragments and adapters at both ends. The DNA or cDNA fragments represent a portion of the final library template to be sequenced.

[0143] A sample can be introduced into the flow cell 10. A template nucleic acid strand, for example, hybridizes to one of two types of primers 32A, 34A.

[0144] Amplification of template nucleic acid strands can be initiated to form clusters of template strands across the polymer hydrogel 28 (e.g., in lanes 26, in each recess 20, or on each protrusion 24). In one example, amplification includes cluster generation. In one example of cluster generation, library templates are copied from hybridized primers by 3' extension using a high-fidelity DNA polymerase. The original library templates are denatured, leaving the copies immobilized in the polymer hydrogel 28. Isothermal bridge amplification or some other form of amplification can be used to amplify the immobilized copies. For example, the copied template loops over and hybridizes to an adjacent complementary primer, and the polymerase copies the copied template to form a double-stranded bridge and denatures to form two single strands. These two strands loop over and hybridize to adjacent complementary primers and are extended again to form two new double-stranded loops. This process is repeated for each template copy through cycles of isothermal denaturation and amplification to create dense clonal clusters. Each cluster of double-stranded bridges is denatured. In one example, the reverse strand is removed by specific cleavage at a cleavage site in the primer sequence (e.g., uracil, 8-oxoguanine, allyl-T, etc.), leaving the forward template strand. The generated template strand 40 is indicated by the letter C in FIG. 2A. Clustering results in the formation of several template strands 40 immobilized on the polymer hydrogel 28 via primers 32 or 34. This example of clustering is referred to as bridge amplification, and this amplification is an example of a possible amplification. It should be understood that other amplification techniques may be used.

[0145] Some example methods then include blocking the unprotected (free) 3' OH terminus of template strand 40 and primer 32 or 34 that does not have template strand 40 attached. A blocking group (e.g., a 3' phosphate) attached to the exposed 3' terminus can be added to prevent undesired extension.

[0146] A sequencing primer can then be introduced into the flow cell 10. The sequencing primer hybridizes to the template nucleic acid strand 40. The sequencing primer renders the template strand 40 available for sequencing.

[0147] An incorporation mix containing labeled nucleotides may then be introduced into flow cell 10, for example, via an inlet. In addition to labeled nucleotides, the incorporation mix may include water, buffer, and polymerase. Once the incorporation mix is ​​introduced into flow cell 10, it enters flow channel 12 and contacts immobilized and sequencing-ready template strands 40.

[0148] The incorporation mix is ​​incubated in flow cell 10, and the labeled nucleotides (including optical labels) are incorporated into nascent strands 42 by respective polymerases along template strands 40. During incorporation, one of the labeled nucleotides is incorporated by the respective polymerase into a nascent strand 42 that is complementary to one of the template strands 40 by extending a sequencing primer. Incorporation is performed in a template strand-dependent manner, such that detection of the order and type of labeled nucleotides added to nascent strands 42 can be used to determine the sequence of template strand 40. Incorporation occurs on at least a portion of the template strands 40 that traverse flow cell 10 during a single sequencing cycle.

[0149] The incorporated labeled nucleotides may contain reversible termination properties due to the presence of a 3'OH blocking group that terminates further sequencing primer extension upon addition of the labeled nucleotide. After a desired time of incubation and incorporation, the incorporation mix, including unincorporated labeled nucleotides, may be removed from the flow cell 10 during a wash cycle. The wash cycle may involve a flow-through technique in which a wash solution (e.g., a buffer) is directed through and then out of the flow channel 12, e.g., by a pump or other suitable mechanism.

[0150] The most recently incorporated labeled nucleotide can be detected through an imaging event without further incorporation. During the imaging event, an illumination system can provide excitation light to the flow cell 10. The optical labels of the incorporated labeled nucleotides emit optical signals in response to the excitation light. These optical signals can be captured using an imaging device.

[0151] After imaging, a cleavage mix can then be introduced into the flow cell 10. In one example, the cleavage mix can (i) remove the 3'OH blocking group from the incorporated nucleotide and (ii) cleave the optical label from the incorporated nucleotide. Examples of 3'OH blocking groups and suitable deblocking agents / components in the cleavage mix can include ester moieties that can be removed by base hydrolysis; allyl moieties that can be removed with NaI, chlorotrimethylsilane, and NaSO or with Hg(II) in acetone / water; azidomethyls that can be cleaved with phosphines such as tris(2-carboxyethyl)phosphine (TCEP) or tri(hydroxypropyl)phosphine (THP); acetals such as tert-butoxy-ethoxys that can be cleaved under acidic conditions; MOM (-CHOCH) moieties that can be cleaved with LiBF and CHCN / HO; 2,4-dinitrobenzenesulfenyl that can be cleaved with nucleophiles such as thiophenol and thiosulfate; tetrahydrofuranyl ethers that can be cleaved with Ag(I) or Hg(II); and / or 3' phosphates that can be cleaved by phosphatase enzymes (e.g., polynucleotide kinase). Examples of suitable optically labeled cleaving agents / components in the cleavage mix may include sodium periodate, which can cleave vicinal diols; phosphines such as tris(2-carboxyethyl)phosphine (TCEP) or tri(hydroxypropyl)phosphine (THP), which can cleave azidomethyl bonds; palladium and THP, which can cleave allyls; bases, which can cleave ester moieties; and / or any other suitable cleaving agents of 3'OH blocking groups.

[0152] Additional sequencing cycles can then be performed until template strand 40 is sequenced. Nascent strand 42 can be dehybridized and the blocking groups on the 3' OH ends of the template strand and primer 32 or 34 can be removed. Clustering is performed again, and this time the forward strand is removed by specific cleavage at a cleavage site in the primer sequence (e.g., uracil, 8-oxoguanine, allyl-T, etc.), leaving the reverse template strand, which can be sequenced as described herein.

[0153] The azide functional groups that are not attached to the primers 32A, 34A during grafting are reduced to amino functional groups 50 by the cleavage mix used during sequencing, which is indicated by the letter C in Figure 2A.

[0154] After sequencing, a cleavage fluid 44 is introduced into the flow cell 10, for example, via an inlet, to cleave the plurality of alkyne-containing primers 32A, 34A grafted with amino-cleavable groups 36, thereby leaving a plurality of amine functional groups on the surface of the flow cell 10. This is indicated by the letter D in Figure 2. Figures 4A-4C show different examples of reactions that take place at the amino-cleavable groups 36 when the cleavage fluid 44 is introduced.

[0155] In one example, the amino cleavable group can be a phthalimide group and the cleaving fluid is methylhydrazine. In this example, hydrazine could also be used in place of methylhydrazine. In another example, the amino cleavable group can be BOC amide and the cleaving fluid is hydrochloric acid (HCl) in water. In this example, another acid could be used in place of HCl. In another example, the amino cleavable group can be triphenylmethylamine and the cleaving fluid is hydrochloric acid (HCl) in water or trifluoroacetic acid (TFA) in water. Each such cleavage reaction produces a cleaved moiety, leaving behind an amino functional group (NH) 50 attached to the polymer hydrogel 28 in the flow cell 10.

[0156] After the desired time for cleavage, a wash cycle can be performed to remove the cleaved portions.

[0157] Nucleic acid analysis and cleavage of the amino cleavable group 36 leaves an amino functional group 50 attached to the polymer hydrogel 28, as indicated by the letter D in FIG. 2A.

[0158] Next, a regeneration fluid 46 is introduced into the flow cell 10, for example, via an inlet (see letter E in FIG. 2). The regeneration fluid 46 includes a compound having two or more terminal azide functionalities and a terminal end bearing a moiety capable of covalently bonding with an amine group. The moiety capable of covalently bonding with an amine group reacts with the amino functional groups 50 to provide multiple azide functionalities on the polymer hydrogel 28, as shown by the letter F in FIG. 2.

[0159] In this exemplary method, the flow cell 10 includes azide functional groups, some of which remain free after grafting (indicated by the letter B in FIG. 2 ), the free azide functional groups are reduced to amine groups 50 during nucleic acid analysis (indicated by the letter C in FIG. 2 ), and at least some of the azide-terminated molecules (introduced into the regeneration fluid 46) react with at least some of the plurality of amine functional groups 50 (generated when the amino cleavable group 36 is cleaved, as indicated by the letter D in FIG. 2 ).

[0160] With multiple free azide functional groups 61' again disposed on the surface of the polymer hydrogel 28, the flow cell surface is ready for another round of grafting of primers 32A, 34A and nucleic acid analysis. The process shown and described with reference to letters B through F can be repeated as desired to perform multiple nucleic acid analyses.

[0161] Methods and kits according to various embodiments of the present invention may include a regenerating fluid containing two or more compounds, each having two or more terminal azide functionalities and a terminus having a moiety capable of covalently bonding to an amine group. In various embodiments, such a regenerating fluid may include, for example, one compound having two terminal azide functionalities and one compound having three or more terminal azide functionalities. In various embodiments, methods and kits may include two or more regenerating fluids, each containing one or more compounds, each having two or more terminal azide functionalities and a terminus having a moiety capable of covalently bonding to an amine group.

[0162] In various embodiments, the methods and kits may include two or more regenerating fluids, a first regenerating fluid comprising one or more compounds each having two or more terminal azide functionalities and a terminus having a moiety capable of covalently bonding to an amine group, and a second regenerating fluid comprising a compound having a single terminal azide functionality and a terminus having a moiety capable of covalently bonding to an amine group.

[0163] Various methods according to some embodiments of the present invention may include: (i) grafting a plurality of alkyne-containing primers onto respective azide functional groups (and optionally tetrazine functional groups) of a polymer hydrogel on a surface of a flow cell, each of the plurality of alkyne-containing primers having an amino-cleavable group that attaches the primer sequence of the alkyne-containing primer to the alkyne-containing portion of the alkyne-containing primer; (ii) performing a nucleic acid analysis involving the grafted plurality of alkyne-containing primers; (iii) introducing a cleavage fluid to cleave the grafted plurality of alkyne-containing primers at the amino-cleavable groups, thereby leaving a plurality of amine functional groups on the surface of the flow cell; (iv) contacting the surface of the flow cell with a regeneration fluid to provide a plurality of new azide functional groups on the surface of the flow cell; and (v) repeating steps (i)-(iv) one or more times. In various embodiments, subsequent repetitions of step (iv) or step (iv) may be performed using alternative or different regeneration fluids. For example, a method according to one embodiment may include step (iv) treatment with a regenerating fluid containing a compound having two or more terminal azide functionalities and a terminus having a moiety capable of covalently bonding to an amine group ("poly-azide treatment" or "PAT"), followed by repeated step (iv) treatment with a regenerating fluid containing a compound having one terminal azide functionality and a terminus having a moiety capable of covalently bonding to an amine group ("mono-azide treatment" or "MAT"), or vice versa. Such repeated treatments may be performed multiple times, alternating, blocked, or at different times in the progressive repetition of steps (i)-(iv), e.g., PAT-PAT-MAT-MAT-PAT-PAT-MAT-MAT-, or PAT-MAT-PAT-MAT-PAT-MAT-PAT-MAT-MAT-, or MAT-MAT-MAT-PAT-MAT-MAT-MAT-PAT-.Such alternation between poly-azide and mono-azide treatments over multiple gene sequencing cycles of a flow cell can provide a degree of control over the number of free azide functions available for primer grafting in each cycle, which can allow the user to balance between signal intensity maintenance and cluster generation quality control (often expressed in terms of PF%).

[0164] The signal strength maintenance and other properties of flow cells, methods and kits according to various embodiments of the present invention are illustrated in the following non-limiting examples with reference to FIGS.

[0165] Figure 3 shows exemplary data showing the relative CFR grafting signal intensity in flow cell lanes using mono-azide and poly-azide treatments. For example, as shown in Figure 3, a flow cell can include eight lanes numbered 1 through 8. An initial sequencing run can be performed, and post-sequencing processing can occur. One or more lanes (e.g., lanes 1, 3, 5, and 7) can be supplemented with a single-azide molecule (e.g., single-azide-PEG-NHS), while one or more lanes (e.g., lanes 2, 4, 6, and 8) can be supplemented with a multi-azide molecule (e.g., bis-azide-PEG-NHS). Primers can then be reattached (e.g., grafted) to the surface of the flow cell lanes via the reattached azide molecules. The signal intensity of the grafted primers can then be measured. As shown in Figure 3, the lanes supplemented with multi-azide molecules can have a higher CFR grafting signal intensity than the lanes supplemented with single-azide molecules. The difference in signal intensity can be proportional to the number of azide moieties in the multi-azide molecule. For example, as shown in Figure 3, approximately twice the signal intensity can be obtained using a bis-azide molecule compared to using a single-azide molecule.

[0166] After the primers are reattached to the flow cell surface, a second DNA sequencing run can be performed and the signal intensity can be measured. Figure 4 shows exemplary data illustrating the relative DNA sequencing signal intensity in flow cell lanes using single-azide molecule reattachment and multi-azide molecule reattachment. For example, the flow cell data shown in Figure 4 can be based on the same flow cell shown and described in Figure 3. As shown in Figure 4, the lane supplemented with multi-azide molecules can have a higher DNA sequencing signal intensity than the lane supplemented with single-azide molecules. The difference in signal intensity can be proportional to the number of azide moieties in the multi-azide molecule. For example, as shown in Figure 4, using bis-azide molecules can achieve approximately twice the signal intensity compared to using single-azide molecules.

[0167] Increased signal intensity through the use of multi-azide molecule (e.g., bis-azide-PEG) reattachment can be applied to a series of DNA sequencing runs performed on a flow cell. Figure 5 shows an example of increased signal intensity over a series of DNA sequencing runs. For example, as shown in Figure 5, one or more (e.g., five) paired-end ("PE") runs of 2 x 151 cycles can be performed on the flow cell and shown as the x-axis of the graph. PF% and signal intensity can be tracked for various conditions. One or more lanes of the flow cell (e.g., lanes 1 and 7, represented by blue and gray lines in Figure 5) can have single-azide molecules (e.g., single-azide-PEG) reattached to the flow cell surface between runs 1 and 2, between runs 2 and 3, and between runs 3 and 4. As shown in Figure 5, signal intensity can gradually decrease as attachment points are used up and become more difficult to find. The PF may also decrease after a given number of runs (e.g., after three runs, as shown in Figure 5). Between runs 4 and 5, lanes 1 and 7 may have multi-azide molecules (e.g., bis-azide-PEG) reattached to the flow cell surface, which may cause an increase in signal intensity and PF, indicating that poly-azide treatment can increase the durability of the flow cell, providing maintained signal intensity and quality.

[0168] As shown in Figure 5, one or more lanes of the flow cell (e.g., lanes 2 and 8, represented by orange and yellow lines in Figure 5) may have multi-azide molecules (e.g., bis-azide-PEG) redeposited to the flow cell surface between runs 1 and 2, between 2 and 3, between 3 and 4, and between 4 and 5. As shown in Figure 5, signal intensity may increase with each run in lanes 2 and 8. However, the PF may decrease over successive runs in lanes 2 and 8, which may be evidence of overclustering (e.g., occupancy may be too high).

[0169] References throughout this specification to "one example," "another example," "an example," etc. mean that particular elements (e.g., features, structures, and / or characteristics) described in connection with an example are included in at least one example described herein and may or may not be present in other examples. Additionally, unless the context clearly dictates otherwise, it should be understood that the described elements with respect to any example may be combined in any suitable manner in the various examples.

[0170] Those skilled in the art will appreciate that changes could be made to the embodiments described above without departing from the broader concept of the present invention. It is understood, therefore, that the invention is not limited to the particular embodiments disclosed, but that it is intended to cover modifications within the spirit and scope of the present invention as defined by the appended claims.

Claims

1. A reagent comprising a solution of a compound having two or more terminal azide functionalities and a terminus having a moiety capable of covalently bonding with an amine group.

2. 10. The reagent of claim 1, wherein the compound has three or more terminal azide functionalities, the termini bearing moieties capable of covalently bonding with amine groups.

3. 10. The reagent of claim 1, wherein the compound is present in the solution at a concentration of up to about 10 mM.

4. A reagent comprising a mixture of (i) a compound having two or more terminal azide functionalities and a terminus having a moiety capable of covalently bonding to an amine group, and (ii) a biologically compatible buffer solution.

5. 5. The reagent of claim 4, wherein the compound is present in the solution at a concentration of up to about 10 mM.

6. A reagent comprising a solution of a compound having general formula (I), 【Chemical 1】 wherein each Az represents an azide moiety, R represents a moiety that forms a covalent bond with an amine group, each X independently represents a bridging group, Y represents nitrogen or carbon, and a is 1 or 2.

7. 7. The reagent of claim 6, wherein at least one X comprises an additional branch point from which a bridging group having a terminal azide moiety is pendant.

8. 7. The reagent of claim 6, wherein each X represents polyethylene glycol, a is 1, and Y is nitrogen.

9. The reagent according to claim 6, wherein the compound of general formula (I) is N-(PEG3-N-hydroxysuccinimide)-N-bis(PEG3-azide).

10. A flow cell comprising a substrate, said substrate comprising attached thereto a molecule having two or more terminal azide functions.

11. 11. The flow cell of claim 10, wherein the substrate comprises a plurality of molecules attached thereto, each of the molecules having two or more terminal azide functions.

12. 12. The flow cell of claim 11, wherein each molecule of the plurality of molecules comprises N-(PEG3-N-hydroxysuccinimide)-N-bis(PEG3-azide).

13. 1. A method comprising: providing a flow cell having a substrate, the substrate having one or more terminal amine functionalities attached thereto; contacting the substrate with a reagent comprising a solution of a compound having two or more terminal azide functionalities and a terminus having a moiety capable of covalently bonding to an amine group.

14. 14. The method of claim 13, wherein contacting the substrate with the reagent is performed after the flow cell has been used for a sequencing cycle.

15. 14. The method of claim 13, wherein contacting the substrate with the reagent is performed before the flow cell is used for a sequencing cycle.

16. 14. The method of claim 13, wherein contacting the substrate with the reagent is performed after each of two or more successive sequencing cycles using the reagent each time.

17. 14. The method of claim 13, wherein contacting the substrate with the reagent is performed after each of two or more successive sequencing cycles, and wherein the second or subsequent contacting of the substrate uses a second reagent comprising a solution of a second compound having two or more terminal azide functionalities and a terminus having a moiety capable of covalently bonding to an amine group.

18. 1. A kit comprising a flow cell, a cleavage fluid, and a regeneration fluid, wherein the regeneration fluid comprises a compound having two or more terminal azide functionalities and a terminus having a moiety capable of covalently bonding to an amine group.

19. 20. The kit of claim 18, wherein the flow cell comprises a substrate, the substrate comprising a pre-grafted primer.

20. 20. The kit of claim 18, wherein the flow cell comprises a substrate, the substrate comprising a terminal azide functionality, and the kit further comprises a primer fluid comprising one or more alkyne-terminated primers.

Images