Use of an AKRIC3 inhibitor in the preparation of a medicament for the treatment or prevention of metabolically related fatty liver disease - Patents.com

Abstract

The present application discloses the use of an aldo-ketoreductase family 1 member C3 (AKR1C3) inhibitor in inhibiting lipid droplet formation and promoting lipid droplet degradation, its use in preparing a medicament for treating or preventing MAFLD, a pharmaceutical composition comprising the inhibitor, the use of the inhibitor as a medicament for treating diseases associated with an abnormal increase in lipid droplets, a method for inhibiting aldo-ketoreductase family 1 member C3 (AKR1C3), and a method for constructing a genetically engineered animal model of MAFLD.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to CN202211207421.2 filed on September 30, 2022 and CN2023111446975 filed on September 6, 2023, the contents of which are incorporated herein by reference in their entireties.

[0002] The present application relates to the field of medicine and pharmaceutical technology, and in particular to the use of an aldo-keto reductase family 1 member C3 (AKR1C3) inhibitor in the preparation of a medicament for the treatment or prevention of metabolic-related fatty liver disease. [Background technology]

[0003] The liver is a key organ in human lipid metabolism, primarily responsible for the synthesis and transport of endogenous lipids. Hepatocytes ingest circulating fatty acids to synthesize substances such as triglycerides, phospholipids, and cholesterol, which are then rapidly converted into low-density lipoproteins (LDLPs) and excreted into the circulating blood. Lipid synthesis and degradation in the liver are in a dynamic balance. If lipids accumulated in hepatocytes are not metabolized and removed in a timely manner, excess triglycerides and other toxic lipids are likely to accumulate intracellularly, leading to steatosis and MAFLD, which can further lead to liver fibrosis and inflammatory hepatocyte injury, resulting in steatohepatitis, and in severe cases, cirrhosis and liver cancer.

[0004] Metabolic-associated fatty liver disease (MAFLD) is a hepatic manifestation of metabolic syndrome (MetS). Its pathogenesis is primarily driven by initial lipid accumulation and subsequent inflammatory responses. MAFLD not only functions as an independent risk factor for cardiovascular disease (CVD), but also increases the risk of death from liver and non-liver causes, such as diabetes, malignancies, and coronary artery disease. Statistics show that the per capita prevalence of MAFLD is approximately 25% worldwide, but in China, the prevalence is as high as 29.4%, with a trend toward increasing prevalence and younger ages. Currently, MAFLD is the second leading cause of liver transplantation. Approximately 15–25% of MAFLD patients may progress to nonalcoholic steatohepatitis (NASH), and 20% of NASH patients may eventually develop cirrhosis or liver cancer. Furthermore, a growing body of clinical evidence has shown that, in addition to intrahepatic lesions, MAFLD is independently associated with the development of cardiovascular disease, chronic kidney disease, and type 2 diabetes, potentially leading to severe multisystem diseases. MAFLD has attracted attention in the field of chronic diseases worldwide. It is more meaningful to study the mechanisms of MAFLD and implement timely interventions. However, to date, the pathogenesis of MAFLD remains unclear, and no specific drug has been approved for sale.

[0005] In summary, thorough investigation and research into the pathogenesis of MAFLD and the discovery of potential intervention targets will have important social and medical research significance for the treatment of MAFLD. At the same time, establishing a MAFLD transgenic mouse model will be of great significance for the research and development of MAFLD therapeutic drugs.

[0006] Aldo-keto reductase family 1 member C3 (AKR1C3) is a member of the oxidoreductase superfamily. Its main function is to catalyze the reduction of aldehydes and ketones to the corresponding alcohols using NADH or NADPH as a cofactor. It plays an important role in the biosynthesis of prostaglandins and sex hormones, regulating the metabolism of androgens, estrogens, and progesterone, and maintaining cell growth and survival. Summary of the Invention [Means for solving the problem]

[0007] In response to the above challenges, this application has conducted multifaceted verification using clinical samples, cell experiments, and animal experiments. It has been demonstrated for the first time that the relationship between AKR1C3 and MAFLD can be reversed by targeting and inhibiting AKR1C3, which is expected to provide a new theoretical basis and a new therapeutic target for future MAFLD treatment and fill the gap in effective drugs for the treatment of metabolically related fatty liver disease. At the same time, this application has established a standardized and reliable MAFLD animal model that can be used for preclinical evaluation of drug efficacy.

[0008] To achieve the above objectives, this application provides the following technical solutions:

[0009] 1. Use of an aldo-keto reductase family 1 member C3 (AKR1C3) inhibitor in inhibiting lipid droplet formation and promoting lipid droplet degradation. 2. The AKR1C3 inhibitor is selected from the group consisting of the following I to IV: I. sgRNA as CRISPR-Cas9 targeting AKR1C3 gene; II. microRNA, shmiR, siRNA, or shRNA targeting AKR1C3 mRNA; III. An expression vector or other type of vector comprising the targeting inhibitor sgRNA, microRNA, shmiR, siRNA or shRNA sequence described in I and II; the expression vector is preferably one or more of the following vectors: a plasmid expression vector, a retrovirus (RV), a lentivirus (LV), an adenovirus (AV), an adeno-associated virus (AAV), a baculovirus (BV), and a self-replicating virus; the other type of vector is preferably one or more of the following vectors: a liposome, a polymeric nanoparticle, and an RNA nanosphere; IV. A targeting proteolytic agent for targeting AKR1C3 proteostasis, selected from a proteolysis-inducing chimeric molecule (PROTAC), a molecular glue, a dual mechanism degrader, a CHAMP, a lysosomal targeting chimera (LYTAC), a GlueTAC, an antibody-based PROTAC (AbTAC), an autophagy targeting chimera (AUTAC), an ATTEC, and an AUTOTAC. The use according to item 1, comprising at least one of: 3. The use described in item 2, wherein the AKR1C3 inhibitor inhibits the test subject's AKR1C3 gene through one or more gene editing techniques selected from zinc finger structures, transcription activator-like effector nucleases (TALENS), base editors, prime editors, and AAV-directed homology recombination. 4. Use of an aldo-keto reductase family 1 member C3 (AKR1C3) inhibitor in the preparation of a medicament for the treatment or prevention of MAFLD. 5. The AKR1C3 inhibitor is selected from the group consisting of the following I to IV: I. sgRNA as CRISPR-Cas9 targeting AKR1C3 gene; II. microRNA, shmiR, siRNA, or shRNA targeting AKR1C3 mRNA; III. An expression vector or other type of vector comprising a targeting inhibitor sgRNA, microRNA, shmiR, siRNA or shRNA sequence as described in I and II; the expression vector is preferably one or more of the following vectors: a plasmid expression vector, a retrovirus (RV), a lentivirus (LV), an adenovirus (AV), an adeno-associated virus (AAV), a baculovirus (BV), a self-replicating virus; the other type of vector is preferably one or more of the following vectors: a liposome, a polymeric nanoparticle, and an RNA nanosphere; IV. Targeting protein degraders for targeting AKR1C3 proteostasis, such as proteolysis-inducing chimeric molecules (PROTACs), molecular glues, dual mechanism degraders, CHAMPs, lysosomal targeting chimeras (LYTACs), GlueTACs, antibody-based PROTACs (AbTACs), autophagy targeting chimeras (AUTACs), ATTECs, and AUTOTACs and The use according to Item 4, wherein the gene editing technology used to target AKR1C3 in steps I to III is preferably one or more selected from zinc finger, transcription activator-like effector nucleases (TALENS), base editors, prime editors, and AAV-directed homology recombination. 6. The use according to item 4 or 5, wherein the MAFLD includes simple non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, and liver fibrosis and / or cirrhosis resulting therefrom. 7. A pharmaceutical composition comprising the aldo-ketoreductase family 1 member C3 (AKR1C3) inhibitor described in item 2. 8. The pharmaceutical composition according to item 7, which is used to treat or prevent a disease associated with an increase in lipid droplets. 9. The pharmaceutical composition according to item 8, wherein the disease associated with an increase in lipid droplets includes MAFLD. 10. The use according to item 9, wherein the MAFLD includes simple non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, and liver fibrosis and / or cirrhosis resulting therefrom. 11. Use of aldo-ketoreductase family 1 member C3 (AKR1C3) as a therapeutic target for diseases associated with increased lipid droplets. 12. The use described in item 11, wherein the application form of the use of aldo-ketoreductase family 1 member C3 (AKR1C3) as a therapeutic target for diseases associated with an increase in lipid droplets is the use of an aldo-ketoreductase family 1 member C3 (AKR1C3) inhibitor in the preparation of a drug for treating or preventing diseases associated with an increase in lipid droplets. 13. The use of item 11 or 12, wherein the disease associated with increased lipid droplets is MAFLD. 14. The use according to item 13, wherein the MAFLD includes simple non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, and liver fibrosis and / or cirrhosis resulting therefrom. 15. The inhibitor is selected from the group consisting of I to IV of the following: I. sgRNA as CRISPR-Cas9 targeting AKR1C3 gene; II. microRNA, shmiR, siRNA, or shRNA targeting AKR1C3 mRNA; III. An expression vector or other type of vector comprising a targeting inhibitor sgRNA, microRNA, shmiR, siRNA or shRNA sequence as described in I and II; the expression vector is preferably one or more of the following vectors: a plasmid expression vector, a retrovirus (RV), a lentivirus (LV), an adenovirus (AV), an adeno-associated virus (AAV), a baculovirus (BV), a self-replicating virus; the other type of vector is preferably one or more of the following vectors: a liposome, a polymeric nanoparticle, and an RNA nanosphere; IV. Targeting protein degraders for targeting AKR1C3 proteostasis, such as proteolysis-inducing chimeric molecules (PROTACs), molecular glues, dual mechanism degraders, CHAMPs, lysosomal targeting chimeras (LYTACs), GlueTACs, antibody-based PROTACs (AbTACs), autophagy targeting chimeras (AUTACs), ATTECs, and AUTOTACs and The use according to any one of Items 12 to 14, wherein the gene editing technology used to target AKR1C3 in steps I to III is preferably one or more selected from zinc finger, transcription activator-like effector nucleases (TALENS), base editors, prime editors, and AAV-directed homology recombination. 16. A method for inhibiting aldo-keto reductase family 1 member C3 (AKR1C3), comprising interfering with the expression of the AKR1C3 protein at the gene level or interfering with the homeostasis of the AKR1C3 protein at the protein level to promote its degradation. 17. Use of a vector specifically overexpressing aldo-keto reductase family 1 member C3 (AKR1C3) in generating a MAFLD disease model. 18. The use according to item 17, wherein the overexpression vector comprises an AKR1C3 overexpression plasmid and a CAG-LSL-AKR1C3-3xflag-WPRE-pA expression cassette. 19. The use according to item 18, wherein the sequence of the CAG-LSL-AKR1C3-3xflag-WPRE-pA expression cassette is set forth in SEQ ID NO: 2. 20. The use according to item 17, wherein the model includes an animal model and a cell model. 21. The use according to item 17, wherein the MAFLD includes simple non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, and liver fibrosis and / or cirrhosis resulting therefrom. 22. A method for constructing a genetically engineered animal model of MAFLD, comprising feeding mice overexpressing the AKR1C3 gene with normal chow to obtain the genetically engineered animal model of MAFLD. 23. The method according to item 22, wherein the MAFLD includes simple non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, and liver fibrosis and / or cirrhosis resulting therefrom. 24. A method for constructing a Rosa26 site-specific knock-in mouse model capable of conditionally overexpressing the AKR1C3 gene, comprising using CRISPR / Cas9 technology to site-specifically insert a CAG-LSL-AKR1C3-3xflag-WPRE-pA expression cassette into the Rosa26 gene site on mouse chromosome 6 by homologous recombination, thereby obtaining a Rosa26 site-specific knock-in mouse model capable of conditionally overexpressing the AKR1C3 gene. 25. The method of claim 24, wherein the expression cassette is the CAG-LSL-AKR1C3-3xflag-WPRE-pA expression cassette whose sequence is set forth in SEQ ID NO:2. 26. A method for constructing a MAFLD animal model with liver-specific overexpression of AKR1C3, comprising hybridizing the Rosa26 site-specific knock-in mouse, which is capable of conditionally overexpressing the AKR1C3 gene and which has been prepared as described in paragraph 24, with a liver-specific Cre (Alb-Cre) mouse to obtain a mouse with liver-specific overexpression of AKR1C3. 27. The method according to item 26, wherein the MAFLD includes simple non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, and liver fibrosis and / or cirrhosis resulting therefrom. 28. The method according to item 26 or 27, wherein the MAFLD animal model constructed by the method is a MAFLD animal model obtained by feeding normal chow. 29. The method according to any one of items 26 to 28, wherein the MAFLD animal model constructed by the method is used for screening therapeutic agents for MAFLD and related basic research. 30. A method for constructing a MAFLD animal model with systemic overexpression of AKR1C3, comprising hybridizing a Rosa26 site-specific knock-in mouse capable of conditionally overexpressing the AKR1C3 gene, prepared as described in paragraph 24 or 25, with a fetal Cre(Dppa3-Cre) mouse to obtain a mouse with systemic overexpression of AKR1C3. 31. The method according to item 30, wherein the MAFLD includes simple non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, and liver fibrosis and / or cirrhosis resulting therefrom. 32. The method according to item 30 or 31, wherein the MAFLD animal model constructed by the method is a MAFLD animal model obtained by feeding the animal with normal feed for 12 months. 33. The method according to any one of items 30 to 32, wherein the MAFLD animal model constructed by the method is used for screening of therapeutic agents for MAFLD and related basic research. [Effects of the Invention]

[0010] Currently, there are no globally approved drugs for the prevention and treatment of MAFLD. This application demonstrates for the first time that AKR1C3 liver-specific transgenic mice can develop a MAFLD phenotype highly similar to clinical MAFLD pathophysiology under a normal diet. It also demonstrates that targeted inhibition of AKR1C3 can attenuate the development and progression of MAFLD in mice. This application reveals the important function of AKR1C3 in promoting hepatic lipid synthesis and proposes the use of AKR1C3 as a target for the treatment of MAFLD. This provides an experimental basis and practical means for the treatment of MAFLD, filling the gap for effective therapeutic agents for MAFLD. [Brief explanation of the drawings]

[0011] [Figure 1] Figure 1 shows the positive correlation between AKR1C3 expression and triglyceride content in liver tissue. Figure 1A is a schematic diagram of AKR1C3 expression in normal liver tissue and fatty liver tissue, Figure 1B is a histogram of AKR1C3 expression abundance in normal liver tissue and fatty liver tissue, and Figure 1C is a schematic diagram of the relative triglyceride content in the high AKR1C3 expression group and the low AKR1C3 expression group. All data are quantified as mean ± SEM. * indicates significant difference, * indicates p<0.05, and **** indicates p<0.0001. [Figure 2]Figure 2 shows the relationship between AKR1C3 downregulation at the cellular level and intracellular lipid droplet content. Figure 2A shows the Western blot results of AKR1C3 protein expression levels in HepG2 cells after transfection with si-scramble (control group) and siAKR1C3. Figure 2B shows a comparison of intracellular lipid droplet content under a fluorescent microscope after transfection with si-scramble (control group) and siAKR1C3. Figure 2C shows a quantitative analysis of the fluorescence intensity of intracellular lipid droplets compared to si-scramble (control group) after siAKR1C3 inhibition of AKR1C3 in HepG2 cells. Figure 2D shows the Western blot results of AKR1C3 protein expression levels in HepG2 cells after transfection with pLKO.1-scramble (control group) and shAKR1C3. Figure 2E shows a comparison of the intracellular lipid droplet content under a fluorescence microscope after transfection of HepG2 cells with pLKO.1-scramble (control group) and shAKR1C3, respectively. Figure 2F shows a quantitative analysis of the fluorescence intensity of the intracellular lipid droplets in Figure 2E. Figure 2G shows Western blot results of AKR1C3 protein expression levels in cells after transfection of Lenti-guide (control group) and Lenti-sgRNA plasmid into HepG2-Cas9 stably expressing cell lines, respectively. Figure 2H shows a comparison of the intracellular lipid droplet content under a fluorescence microscope after transfection of Lenti-guide (control group) and Lenti-sgRNA plasmid into HepG2-Cas9 stably expressing cells, respectively. Figure 2I shows a quantitative analysis of the fluorescence intensity of the intracellular lipid droplets in Figure 2H. Figure 2 shows that the intracellular lipid droplet content was significantly reduced after inhibiting AKR1C3 through the three pathways, indicating that inhibiting AKR1C3 can suppress the increase in intracellular lipid droplets. [Figure 3]Figure 3 shows agarose gel electrophoresis images for identifying the Rosa26 LSL genotype on the chromosome of transgenic mice. Figure 3A shows an electrophoresis image of the amplification product of the first primer set (i.e., primer pair P1 and P2). Figure 3B shows an electrophoresis image of the amplification product of the second primer set (i.e., primer pair P3 and P4). Figure 3C shows a 3% agarose gel electrophoresis image of the DL2000 DNA marker. [Figure 4] Figure 4A shows agarose gel electrophoresis images for identifying the Cre genotype on the chromosome of AKR1C3 liver-specific overexpression transgenic mice, where Figure 4A is a 3% agarose gel electrophoresis image of the DL2000 DNA marker, and Figure 4B is an agarose gel electrophoresis image of the PCR product amplified using primers P5, P6, and P7. [Figure 5] Figure 5A shows agarose gel electrophoresis images for identifying the Cre genotype on the chromosome of AKR1C3 systemically overexpressing transgenic mice, where Figure 5A is a 3% agarose gel electrophoresis image of the DL2000 DNA marker, and Figure 5B is an agarose gel electrophoresis image of the PCR product amplified using primers P8, P9, and P10. [Figure 6] Figure 6A is a schematic diagram of the phenotypic validation of MAFLD produced by overexpression of AKR1C3 in mice. Figure 6A is a schematic diagram of HE and Oil Red O staining of liver pathological sections from AKR1C3 transgenic mice. Figure 6B is a schematic diagram of the relative quantification of the percentage of lipid vacuole content by HE staining of liver pathological sections from AKR1C3 transgenic mice. Figure 6C is a schematic diagram of the relative quantification of lipid droplet content (droplets, the black areas in Figure 6A) by Oil Red O staining of liver from AKR1C3 transgenic mice. Figure 6D is a schematic diagram of serum triglyceride levels in AKR1C3 transgenic mice. All data are quantified as mean ± SEM. * indicates significant difference, ** indicates p<0.01, and **** indicates p<0.0001. [Figure 7]Schematic diagram of the use of adeno-associated virus targeting AKR1C3 in vivo to ameliorate the MAFLD phenotype in mice. Figure 7A is a schematic diagram of HE and Oil Red O staining of mouse liver pathological sections after injection of an adeno-associated virus that targets and inhibits AKR1C3 expression in the liver of transgenic mice. Figure 7B is a schematic diagram of relative quantification of the percentage of lipid vacuole content in HE-stained mouse liver pathological sections after injection of an adeno-associated virus that targets and inhibits AKR1C3 expression in the liver of transgenic mice. Figure 7C is a schematic diagram of relative quantification of the content of lipid droplets (droplets represented by the black areas in Figure 7A) in Oil Red O staining of mouse liver after injection of an adeno-associated virus that targets and inhibits AKR1C3 expression in the liver of transgenic mice. Figure 7D is a schematic diagram of mouse serum triglyceride content after injection of an adeno-associated virus that targets and inhibits AKR1C3 expression in the liver of transgenic mice. All data are quantified as mean ± SEM. * indicates significant difference, *** indicates p<0.001, and **** indicates p<0.0001. DETAILED DESCRIPTION OF THE INVENTION

[0012] The present application will be described in detail below with reference to embodiments illustrated in the accompanying drawings, in which like reference numerals represent like components throughout the drawings. While specific embodiments of the present application are illustrated in the drawings, it should be understood that the present application may be embodied in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided to provide a thorough understanding of the application and to fully convey the scope of the application to those skilled in the art.

[0013] It should be noted that the specification and claims use specific terms to refer to specific components. Those skilled in the art will understand that different nouns may be used to refer to the same component. The specification and claims do not use differences in nouns as a way to distinguish between components, but rather use differences in the functions of the components as a basis for distinction. The words "containing" or "including" used throughout the specification and claims are open terms, and should be interpreted as "including but not limited to." The following descriptions are preferred embodiments for implementing the present application, but these descriptions are intended to illustrate the general principles of the specification and do not limit the scope of the present application. The scope of protection of the present application shall be determined by the appended claims.

[0014] The aldo-keto reductase family 1 member C3 (AKR1C3) is the third member of the C subfamily of the first family of aldo-keto reductases. It is a monomeric cytoplasmic protein containing 323 amino acids and approximately 37 kDa in size. AKR1C3 is ubiquitous throughout the biological world and its primary function is to reduce aldehydes and ketones to their corresponding alcohols using NADH and NADPH as cofactors, playing an important role in the biosynthesis of prostaglandins and sex hormones.

[0015] One aspect of the present application relates to the use of aldo-ketoreductase family 1 member C3 (AKR1C3) inhibitors in inhibiting lipid droplet formation and promoting lipid droplet degradation.

[0016] The method of inhibiting aldo-keto reductase family 1 member C3 (AKR1C3) includes disrupting the expression of the AKR1C3 protein at the gene level, or disrupting the homeostasis of the AKR1C3 protein at the protein level to promote its degradation.

[0017] The AKR1C3-targeting preparation refers to a substance that has an inhibitory effect on the expression, activity, and stability of AKR1C3 protein, and can effectively inhibit adipogenesis at the cellular level and in animals by inhibiting the expression of AKR1C3 protein and promoting the degradation of AKR1C3 protein.

[0018] The AKR1C3 targeting / inhibiting preparations include the following I to IV: I. sgRNA as CRISPR-Cas9 targeting AKR1C3 gene; II. microRNA, shmiR (short hairpin microRNA), siRNA, or shRNA (short hairpin RNA) targeting AKR1C3 mRNA; III. An expression vector or other type of vector comprising a targeting inhibitor sgRNA, microRNA, shmiR, siRNA or shRNA sequence as described in I and II; the expression vector is preferably one or more of the following vectors: a plasmid expression vector, a retrovirus (RV), a lentivirus (LV), an adenovirus (AV), an adeno-associated virus (AAV), a baculovirus (BV), a self-replicating virus; the other type of vector is preferably one or more of the following vectors: a liposome, a polymeric nanoparticle, and an RNA nanosphere; IV. Targeting Protein Degraders for Targeting AKR1C3 Proteostasis, Such as Proteolysis-Inducing Chimeric Molecules (PROTACs), Molecular Glues, Dual Mechanism Degraders, CHAMPs, Lysosomal Targeting Chimeras (LYTACs), GlueTACs, Antibody-Based PROTACs (AbTACs), Autophagy Targeting Chimeras (AUTACs), ATTECs, and AUTOTACs It includes at least one of the following: The gene editing technology used to target AKR1C3 in I to III above is preferably one or more selected from zinc finger structures, transcription activator-like effector nucleases (TALENS), base editors, prime editors, and AAV-directed homology recombination.

[0019] The term "metabolic-associated fatty liver disease (MAFLD)" used in this application encompasses simple nonalcoholic fatty liver disease (NSFLD), nonalcoholic steatohepatitis, and the resulting liver fibrosis and / or cirrhosis. Simple nonalcoholic fatty liver disease (NSFLD) is a condition characterized by increased intrahepatic fat but with little or no inflammation or hepatocyte damage. Nonalcoholic steatohepatitis (NASH) refers to a disease caused by inflammation resulting from excessive accumulation of fat in the liver. While subjects suffering from NFLD alone are usually asymptomatic, the inflammation and hepatocyte damage caused by NASH can lead to liver fibrosis or scarring, and in severe cases, to cirrhosis (advanced scarring) or liver cancer. The applicant has conducted extensive research into the mechanisms involved in metabolic-associated fatty liver disease (MAFLD). After long-term exploration and experimental verification, the applicant has discovered that aldo-keto reductase family 1 member C3 (AKR1C3) plays an important regulatory role in hepatic lipid metabolism. Clinically relevant research has shown that the expression level of AKR1C3 in fatty liver is significantly higher than that in normal liver tissue. Furthermore, comprehensive and in-depth investigations into the correlation between lipid metabolism in hepatocytes have revealed that AKR1C3 is involved in lipid synthesis and lipid droplet content. Therefore, it has been hypothesized that inhibiting AKR1C3 downregulates lipid (lipid droplet) content in hepatocytes, thereby treating MAFLD. Based on this hypothesis, AKR1C3 protein levels in hepatocytes were knocked down or knocked out using techniques such as siRNA, shRNA, and CRISPR-Cas9, respectively, to downregulate AKR1C3 expression. Results showed that intracellular lipid (lipid droplets) were indeed significantly reduced after AKR1C3 downregulation, indicating that inhibiting AKR1C3 can effectively reduce lipid (lipid droplet) increases.

[0020] In another aspect, the present application relates to the use of an aldo-ketoreductase family 1 member C3 (AKR1C3) inhibitor in the preparation of a medicament for the treatment or prevention of MAFLD.

[0021] The AKR1C3 inhibitor includes the following I to IV: I. sgRNA as CRISPR-Cas9 targeting AKR1C3 gene; II. microRNA, shmiR, siRNA, or shRNA targeting AKR1C3 mRNA; III. An expression vector or other type of vector comprising a targeting inhibitor sgRNA, microRNA, shmiR, siRNA or shRNA sequence as described in I and II; the expression vector is preferably one or more of the following vectors: a plasmid expression vector, a retrovirus (RV), a lentivirus (LV), an adenovirus (AV), an adeno-associated virus (AAV), a baculovirus (BV), a self-replicating virus; the other type of vector is preferably one or more of the following vectors: a liposome, a polymeric nanoparticle, and an RNA nanosphere; IV. Targeting protein degraders for targeting AKR1C3 proteostasis, such as proteolysis-inducing chimeric molecules (PROTACs), molecular glues, dual mechanism degraders, CHAMPs, lysosomal targeting chimeras (LYTACs), GlueTACs, antibody-based PROTACs (AbTACs), autophagy targeting chimeras (AUTACs), ATTECs, and AUTOTACs and The gene editing technology used to target AKR1C3 in I to III above is preferably one or more selected from zinc finger structures, transcription activator-like effector nucleases (TALENS), base editors, prime editors, and AAV-directed homology recombination. The MAFLD includes simple non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, and liver fibrosis and / or cirrhosis resulting therefrom.

[0022] In another aspect, the present application relates to a pharmaceutical composition comprising the aldo-keto reductase family 1 member C3 (AKR1C3) inhibitor described above, The pharmaceutical composition is used to treat or prevent a disease associated with an increase in lipid droplets, The disease associated with an increase in lipid droplets includes MAFLD, The MAFLD includes simple non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, and liver fibrosis and / or cirrhosis resulting therefrom.

[0023] In another aspect, the present application relates to the use of aldo-ketoreductase family 1 member C3 (AKR1C3) as a therapeutic target for diseases associated with increased lipid droplets, An application form of the use of aldo-ketoreductase family 1 member C3 (AKR1C3) as a therapeutic target for diseases associated with an increase in lipid droplets is the use of an aldo-ketoreductase family 1 member C3 (AKR1C3) inhibitor in the preparation of a medicament for treating or preventing diseases associated with an increase in lipid droplets, The disease associated with an increase in lipid droplets is MAFLD, The MAFLD includes simple non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, and liver fibrosis and / or cirrhosis resulting therefrom; The inhibitors include the following I to IV: I. sgRNA as CRISPR-Cas9 targeting AKR1C3 gene; II. microRNA, shmiR, siRNA, or shRNA targeting AKR1C3 mRNA; III. An expression vector or other type of vector comprising a targeting inhibitor sgRNA, microRNA, shmiR, siRNA or shRNA sequence as described in I and II; the expression vector is preferably one or more of the following vectors: a plasmid expression vector, a retrovirus (RV), a lentivirus (LV), an adenovirus (AV), an adeno-associated virus (AAV), a baculovirus (BV), a self-replicating virus; the other type of vector is preferably one or more of the following vectors: a liposome, a polymeric nanoparticle, and an RNA nanosphere; IV. Targeting protein degraders for targeting AKR1C3 proteostasis, such as proteolysis-inducing chimeric molecules (PROTACs), molecular glues, dual mechanism degraders, CHAMPs, lysosomal targeting chimeras (LYTACs), GlueTACs, antibody-based PROTACs (AbTACs), autophagy targeting chimeras (AUTACs), ATTECs, and AUTOTACs and The gene editing technology used to target AKR1C3 in I to III above is preferably one or more selected from zinc finger structures, transcription activator-like effector nucleases (TALENS), base editors, prime editors, and AAV-directed homology recombination.

[0024] The applicant's in vivo mouse experiments on the effectiveness of targeting AKR1C3 in the treatment of MAFLD showed that a MAFLD model could be obtained by feeding AKR1C3 transgenic mice a normal diet. Subsequent targeted inhibition of AKR1C3 protein expression using the adeno-associated virus AAV-TBGp-shAKR1C3 can reliably reverse the onset and progression of MAFLD, thereby playing a role in treating MAFLD.

[0025] In another aspect, the present application relates to a method of inhibiting aldo-keto reductase family 1 member C3 (AKR1C3), comprising disrupting the expression of AKR1C3 protein at the gene level or disrupting the homeostasis of AKR1C3 protein at the protein level to promote its degradation, Interfering with the expression of AKR1C3 protein at the gene level refers to inhibiting the expression of AKR1C3 gene at the gene level, and the inhibitor that inhibits the expression of AKR1C3 gene is at least one selected from the following I to III, and the decomposition agent that promotes the degradation of AKR1C3 protein is at least one selected from the following IV: I. sgRNA as CRISPR-Cas9 targeting AKR1C3 gene; II. microRNA, shmiR, siRNA, or shRNA targeting AKR1C3 mRNA; III. An expression vector or other type of vector comprising a targeting inhibitor sgRNA, microRNA, shmiR, siRNA or shRNA sequence as described in I and II; the expression vector is preferably one or more of the following vectors: a plasmid expression vector, a retrovirus (RV), a lentivirus (LV), an adenovirus (AV), an adeno-associated virus (AAV), a baculovirus (BV), a self-replicating virus; the other type of vector is preferably one or more of the following vectors: a liposome, a polymeric nanoparticle, and an RNA nanosphere; IV. Targeting protein degraders for targeting AKR1C3 proteostasis, such as proteolysis-inducing chimeric molecules (PROTACs), molecular glues, dual mechanism degraders, CHAMPs, lysosomal targeting chimeras (LYTACs), GlueTACs, antibody-based PROTACs (AbTACs), autophagy targeting chimeras (AUTACs), ATTECs, and AUTOTACs; The gene editing technology used to target AKR1C3 in I to III above is preferably one or more selected from zinc finger structures, transcription activator-like effector nucleases (TALENS), base editors, prime editors, and AAV-directed homology recombination.

[0026] In another aspect, the present application relates to the use of a vector that specifically overexpresses aldo-ketoreductase family 1 member C3 (AKR1C3) in generating a MAFLD disease model, the overexpression vector comprises an AKR1C3 overexpression plasmid and a CAG-LSL-AKR1C3-3xflag-WPRE-pA expression cassette; The sequence of the CAG-LSL-AKR1C3-3xflag-WPRE-pA expression cassette is shown in SEQ ID NO: 2; The models include animal models and cell models; The MAFLD includes simple non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, and liver fibrosis and / or cirrhosis resulting therefrom.

[0027] In another aspect, the present application also relates to a method for constructing a Rosa26 site-specific knock-in mouse model capable of conditionally overexpressing the AKR1C3 gene, the method comprising using CRISPR / Cas9 technology to site-specifically insert a CAG-LSL-AKR1C3-3xflag-WPRE-pA expression cassette into the Rosa26 gene site on mouse chromosome 6 by homologous recombination, thereby obtaining a Rosa26 site-specific knock-in mouse model capable of conditionally overexpressing the AKR1C3 gene.

[0028] The expression cassette is the CAG-LSL-AKR1C3-3xflag-WPRE-pA expression cassette, the sequence of which is shown in SEQ ID NO:2.

[0029] In another aspect, the present application also relates to a method for constructing a MAFLD animal model with liver-specific overexpression of AKR1C3, by hybridizing the above-prepared Rosa26 site-specific knock-in mouse, which is capable of conditionally overexpressing the AKR1C3 gene, with a liver-specific Cre (Alb-Cre) mouse to obtain an AKR1C3 liver-specific overexpression mouse.

[0030] The MAFLD includes simple non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, and liver fibrosis and / or cirrhosis resulting therefrom; The MAFLD animal model with hepatic overexpression of AKR1C3 constructed by the method can be obtained by feeding the animal with a normal diet; The MAFLD animal model constructed by the above method can be used to screen for therapeutic agents for MAFLD.

[0031] In another aspect, the present application also relates to a method for constructing a MAFLD animal model with systemic AKR1C3 overexpression, in which the above-prepared Rosa26 site-specific knock-in mouse capable of conditionally overexpressing the AKR1C3 gene is hybridized with a fetal Cre(Dppa3-Cre) mouse to obtain a mouse with systemic AKR1C3 overexpression.

[0032] The MAFLD includes simple non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, and liver fibrosis and / or cirrhosis resulting therefrom; The MAFLD animal model constructed by the above method can be obtained by feeding it with normal feed.

[0033] The MAFLD animal model with systemic overexpression of AKR1C3 constructed by the above method can be used to screen for therapeutic agents for MAFLD. [Example]

[0034] This application provides general and / or specific descriptions of the materials and test methods used in the tests, and in the following examples, unless otherwise specified, % means wt%, i.e., percent by weight. If the manufacturers of the reagents and instruments used are not indicated, they are all conventional commercially available reagent products.

[0035] material: (1) Cells: HepG2 cells (ATCC). (2) Plasmids and siRNAs: PsPAX2 plasmid (12260, Addgene), pMD2.G plasmid (12259, Addgene), AKR1C3 gene silencing plasmid (pLKO.1-shRNA, designated as “shAKR1C3” in Figure 2 ) (TRCN0000026561, Sigma); AKR1C3 gene silencing negative control plasmid (pLKO.1-scramble, referred to as "control group" in Figure 2) (SCH001, Sigma). Note: scramble is a meaningless scrambled sequence and is used as a control. Cas9 plasmid (52962, Addgene), AKR1C3 gene knockout plasmid (Lenti-sgRNA, denoted as "AKR1C3- / -" in Figure 2) (sgRNA was designed using the GPP Web Portal (https: / / portals.broadinstitute.org / gpp / public / ) website and synthesized by GENEWIZ, Inc. The sgRNA was then ligated into the "Lenti-guide" empty vector to synthesize the AKR1C3 gene knockout plasmid). AKR1C3 gene knockout negative control plasmid (Lenti-guide empty vector, referred to as "control group" in Figure 2) (52963, Addgene), AKR1C3 siRNA (denoted as “siAKR1C3” in Figure 2 ) (customized by Genepharma); siRNA negative control (referred to as "control group" in Figure 2) (A06001, Genepharma). (3) Reagents: DMEM medium (12430062, Gibco), fetal bovine serum (10100147, Gibco), trypsin (25300054, Gibco), PBS (10010002, Gibco), puromycin dihydrochloride (HY-B1743A, MCE), blasticidin S hydrochloride (S7419, Selleck), cell lysis solution (R0100, Solarbio), protein quantification kit (23225, ThermoFisher), 5x Loading Buffer (1610767, Bio-red), SDS-PAGE gel preparation kit (P1200, Solarbio), 5x Tris-glycine electrophoresis buffer (T1070, Solarbio), 10x electrophoresis transfer buffer (D1060, Solarbio), 5% BSA blocking solution (SW3015, Solarbio), AKR1C3 antibody (PA5-28065, ThermoFisher), actin antibody (sc-47778, Santa Cruz Biosciences), and ELISA kit (Santa Cruz Biosciences). Cruz), goat anti-rabbit secondary antibody (31786, ThermoFisher), goat anti-mouse secondary antibody (31786, MA1-10378, ThermoFisher), TBST (T1081, Solarbio), ECL luminescence solution (32209, ThermoFisher), Bodipy lipid droplet staining kit (D3922, ThermoFisher), anti-fluorescence quenching mounting medium (S2100, Solarbio), Oil Red O powder (00625-25G, SIGMA), triglyceride quantitative detection kit (MAK266, Sigma), 4% tissue cell fixative (Solarbio), immunohistochemistry UltraSenstive SP kit (KIT-9720, MXB), methanol, isopropyl alcohol, 75% ethanol, etc. (4) Equipment: PVDF transfer membrane (03010040001, Roach), transfer device (1704071, Bio-red), T25 culture flask (707003, NEST), T75 culture flask (708003, NEST), 6 cm culture dish (705001, NEST), 10 cm Petri dish (704004, NEST), 6-well plate (7003001, NEST), 15 mL centrifuge tube (601001, NEST), 50 mL centrifuge tube (602001, NEST), 6-well plate cell slide (YA0352, Solarbio), mouse sampling device, etc.

[0036] Example 1: The expression level of AKR1C3 in liver tissue is positively correlated with triglyceride content. Fatty liver tissue samples were collected from 10 patients (one normal liver tissue sample, three samples each of fatty liver associated with obesity, fatty liver associated with polycystic ovary syndrome, and fatty liver associated with type 2 diabetes). The liver tissue was fixed in 4% paraformaldehyde for at least 24 hours. After 24 hours, the sections were dehydrated in graded alcohols, permeabilized in xylene, and embedded in paraffin to prepare paraffin sections (4 μm thick) for immunohistochemical staining of AKR1C3. Differences in AKR1C3 expression levels between fatty liver and normal liver tissue were compared by immunohistochemistry and quantitative analysis was performed.

[0037] Twenty liver cancer tissue samples were collected and divided into two groups: high AKR1C3 expression and low AKR1C3 expression. The liver tumor tissues were divided according to the AKR1C3 content in normal liver tissue. Tumor tissues with lower AKR1C3 expression levels than normal liver tissue were classified as the low AKR1C3 expression group (AKR1C3 low group), while tumor tissues with higher AKR1C3 expression levels than normal liver tissue were classified as the high AKR1C3 expression group (AKR1C3 high group). The differences in triglyceride content between the two groups were detected and quantitatively analyzed using liquid chromatography-mass spectrometry. The results are shown in Figure 1. Figure 1A is a schematic diagram of AKR1C3 expression in normal liver tissue and fatty liver tissue. Figure 1B is a schematic diagram of AKR1C3 expression levels in normal liver tissue and fatty liver tissue. Figure 1C is a schematic diagram of the relative triglyceride content in groups with high and low AKR1C3 expression levels. All data are quantified as mean ± SEM. "*" indicates significant difference, * indicates p<0.05, and **** indicates p<0.0001.

[0038] As can be seen from Figures 1A and 1B, AKR1C3 expression is significantly increased in fatty liver tissue compared to normal liver tissue. Figure 1C shows that the triglyceride content in tumor tissues of the AKR1C3 high expression group was higher. This indicates that the expression level of AKR1C3 in liver tissue is positively correlated with the triglyceride content.

[0039] Example 2: Inhibition of AKR1C3 at the cellular level can reduce the increase in intracellular lipid droplets. The Cas9, PsPAX2, and pMD2.G plasmids were co-transfected into 293T cells using Lipo3000 transfection reagent. The virus was packaged in the 293T cells and released into the culture medium. After 48 hours, the 293T medium was harvested, and the virus-containing 293T culture supernatant was filtered through a 0.45 μm filter to obtain Cas9-overexpressing virus. The virus was then aliquoted and stored frozen at -80°C. The Cas9-overexpressing virus was added to HepG2 cell culture supernatant and used to infect HepG2 cells. The medium was replaced 24 hours later. After 48 hours, blasticidin S hydrochloride was added and the cells were screened to obtain HepG2-Cas9 stable cell lines. 293T cells were then selected and co-transfected with the Lenti-sgRNA plasmid, PsPAX2 plasmid, and pMD2.G plasmid using Lipo3000 transfection reagent. The viruses were packaged in the 293T cells and released into the culture medium. After 48 hours, the 293T culture supernatant was collected, filtered through a 0.45 μm filter, aliquoted, and frozen at -80°C to obtain the AKR1C3 gene knockout virus solution. The AKR1C3 gene knockout virus solution was added to the culture supernatant of HepG2-Cas9 stably expressing cells. The medium was replaced after 24 hours, and puromycin dihydrochloride was added after 48 hours to screen for stably transfected cells. Subsequently, monoclonal cell lines were obtained to obtain HepG2 cells with a complete knockout of the AKR1C3 gene (AKR1C3- / -). (The sgRNA sequence used for CRISPR-Cas9 is SEQ ID NO: 1: AATGAGCAGAATCTATATGG.) In this example, the inhibition process may involve lentivirus infection containing Cas9 / sgRNA, or siRNA / shRNA-containing liposomes may be used to mediate siRNA / shRNA transfection. Total protein was extracted from a portion of the transfected cells, and the AKR1C3 inhibition efficiency was detected by Western blot. The remaining portion was spread onto a 6-well plate cell slide at 500,000 per well. After the cells adhered to the wall, lipid droplet staining was performed.The specific procedure was as follows: The culture medium supernatant was aspirated and the 6-well plate was washed three times with PBS. A dye solution was prepared according to the Bodipy dye instructions and incubated in the dark at 37°C for 20 minutes. The dye solution was discarded and the plate was washed three times with PBS. The slides were prepared in advance. 10 μL of anti-fluorescence quenching mounting medium was added to the surface of the slide. The cell slide was removed from the 6-well plate and placed on top of the mounting medium. Confocal microscopy was used to detect intracellular fluorescence.

[0040] The results are shown in Figure 2. Figure 2A shows Western blot results of AKR1C3 protein expression levels in HepG2 cells after transfection with si-scramble (control group) and siAKR1C3. Figure 2B shows a comparison of intracellular lipid droplet content under a fluorescence microscope after transfection with si-scramble (control group) and siAKR1C3. Figure 2C shows a quantitative analysis of the fluorescence intensity of intracellular lipid droplets after siAKR1C3 inhibition in HepG2 cells compared with si-scramble (control group). Figure 2D shows Western blot results of AKR1C3 protein expression levels in HepG2 cells after transfection with pLKO.1-scramble (control group) and shAKR1C3 plasmids. Figure 2E shows a comparison of the intracellular lipid droplet content under a fluorescence microscope after transfection of HepG2 cells with pLKO.1-scramble (control group) and shAKR1C3, respectively. Figure 2F shows a quantitative analysis of the fluorescence intensity of the intracellular lipid droplets in Figure 2E. Figure 2G shows Western blot results of AKR1C3 protein expression levels in cells after transfection of Lenti-guide (control group) and Lenti-sgRNA plasmids into HepG2-Cas9 stably expressing cell lines, respectively. Figure 2H shows a comparison of the intracellular lipid droplet content under a fluorescence microscope after transfection of Lenti-guide (control group) and Lenti-sgRNA plasmids into HepG2-Cas9 stably expressing cells, respectively. Figure 2I shows a quantitative analysis of the fluorescence intensity of the intracellular lipid droplets in Figure 2H.

[0041] Figure 2 shows that the intracellular lipid droplet content was significantly reduced after inhibiting AKR1C3 through the three pathways, indicating that inhibiting AKR1C3 can suppress the increase in intracellular lipid droplets.

[0042] Example 3: Construction of AKR1C3 liver-specific overexpression mice and AKR1C3 systemic overexpression mice NOTE: Herein, "Alb" (referred to as albumin) indicates that the gene-marked cell type is a hepatic parenchymal cell (achieving specific expression of the gene of interest AKR1C3 in the liver), and "Dppa3" (referred to as developmental pluripotency-associated 3) indicates that the gene-marked cell type is an embryonic germ cell (achieving systemic expression of the gene of interest AKR1C3). AKR1C3 fl / fl :fl / fl is "flox / flox" and AKR1C3 fl / fl Rosa26 LSL / LSL This means that the "CAG-LSL-AKR1C3-3xflag-WPRE-pA" expression cassette, which contains a loxP sequence that can be recognized by Cre recombinase, has been site-specifically inserted into the Rosa26 gene site on both strands of mouse chromosome 6. CRE Alb : The "IRES-iCre-WPRE-pA" expression cassette was inserted into the stop codon of the mouse Alb gene to specifically express CRE recombinase in the liver. CRE Dppa3 By inserting an IRES-Cre expression cassette into the 3'UTR region of the Dppa3 gene, Dppa3-Cre can effectively exert Cre recombinase activity in early embryos and germ cell lines, achieving the goal of overexpressing Cre recombinase in tissue cells throughout the body. "Rosa26 LSL / LSL :CRE Alb " and "Rosa26 LSL / LSL :CRE Dppa3 " is "AKR1C3 fl / fl / CRE Alb " and "AKR1C3 fl / fl / CRE Dppa3 " has the same meaning as " LSL is an abbreviation for "loxP-stop-loxP" structure. Cre recombinase in cells acts on the LSL structure of the sequence "CAG-LSL-AKR1C3-3xflag-WPRE-pA" to activate the expression of AKR1C3. "Rosa26 LSL / LSL :CreAlb " and "AKR1C3 fl / fl / CRE Alb ": In other words, the Rosa26 gene contains the "CAG-LSL-AKR1C3-3xflag-WPRE-pA" expression cassette on both complementary DNA strands, and the mouse Alb gene contains the "IRES-iCre-WPRE-pA" sequence, which means that the mice overexpress Cre recombinase in a liver-specific manner. At this time, Cre recombinase acts on the "CAG-LSL-AKR1C3-3xflag-WPRE-pA" sequence in the Rosa26 gene to achieve liver-specific overexpression of the AKR1C3 protein. "Rosa26 LSL / LSL :Cre Dppa3 " and "AKR1C3 fl / fl / CRE Dppa3 ": In other words, the "CAG-LSL-AKR1C3-3xflag-WPRE-pA" sequence is present on both complementary DNA strands of the Rosa26 gene, and at the same time, the "IRES-Cre" expression cassette is present in the 3'UTR region of the mouse Dppa3 gene. This means that the mouse overexpresses Cre recombinase in tissue cells throughout its body. At this time, Cre recombinase acts on the "CAG-LSL-AKR1C3-3xflag-WPRE-pA" sequence of the Rosa26 gene to achieve systemic overexpression of the AKR1C3 protein. The above abbreviations apply throughout this application.

[0043] To construct a Rosa26 site-specific knock-in mouse model capable of conditional overexpression of the AKR1C3 gene, we used CRISPR / Cas9 technology to site-specifically insert the CAG-LSL-AKR1C3-3xflag-WPRE-pA expression cassette into the Rosa26 gene site on mouse chromosome 6 via homologous recombination, resulting in a Rosa26 site-specific knock-in mouse model capable of conditional overexpression of the AKR1C3 gene. The process is summarized as follows: Cas9 mRNA and gRNA were obtained through in vitro transcription. A homologous recombination vector (donor vector) was constructed through In-Fusion cloning. This vector contained a 3.3 kb 5' homologous arm, CAG-LSL-AKR1C3-3xflag-WPRE-pA, and a 3.3 kb 3' homologous arm. Cas9 mRNA, gRNA, and the donor vector were microinjected into fertilized eggs of C57BL / 6J mice to generate F0 mice. F0 mice identified as positive by PCR amplification and sequencing were crossed with C57BL / 6J mice to obtain five positive F1 mice. ROSA26 site-specific knock-in mice capable of conditionally overexpressing the AKR1C3 gene were obtained.

[0044] The sequence of the CAG-LSL-AKR1C3-3xflag-WPRE-pA expression cassette is shown in SEQ ID NO:2. SEQ ID NO:2:

[0045] I. Construction of F2 generation AKR1C3 liver-specific overexpression mice and AKR1C3 systemic overexpression mice. Pre-prepared Rosa26 site-specific knock-in (Rosa26 LSL / +) mice, which can conditionally overexpress the AKR1C3 gene, were selected and hybridized with liver-specific Cre (Alb-Cre) mice to generate AKR1C3 liver-specific overexpression mice (Rosa26 LSL / +:Cre Alb ) was obtained. We selected previously prepared Rosa26 knock-in mice (Rosa26 LSL / +) that can conditionally overexpress the AKR1C3 gene, and hybridized them with fetal Cre (Dppa3-Cre) mice to generate AKR1C3 systemic overexpression mice (Rosa26 LSL / +:Cre Dppa3 ) was obtained.

[0046] II. Genotyping of F2 generation mice. Mouse genomic DNA was extracted. 1. Two sets of PCR primers are required to identify the Rosa26 LSL genotype on the chromosome of transgenic mice. First set: forward primer P1 (SEQ ID NO: 3) and reverse primer P2 (SEQ ID NO: 4): SEQ ID NO: 3: TCAGATTCTTTTATAGGGGACACA SEQ ID NO: 4: TAAAGGCCACTCAATGCTCACTAA Second set: forward primer P3 (SEQ ID NO: 5) and reverse primer P4 (SEQ ID NO: 6): SEQ ID NO: 5: CGGCCACAACTCCTCATAA SEQ ID NO: 6: CAATGAGCAGCGCATCAGAC. The reaction system was prepared according to the protocol for the Mouse Tail Detection Kit (B40013, Biomake). The reaction conditions are shown in Table 1.

[0047] [Table 1]

[0048] The results of gel electrophoresis detection of the PCR products are shown in Figure 3 (3% agarose gel electrophoresis). The results in Figure 3 show that the amplification product of the first primer set (i.e., primer pair P1 and P2) is 967 bp, and the amplification product of the second primer set (i.e., primer pair P3 and P4) is 447 bp. If the PCR amplification product is only the 967 bp product, it is wild-type (WT). If both 967 bp and 447 bp amplification products are present, it is a heterozygote (Rosa26 LSL / +). If only the 447 bp amplification product is present, it is a homozygote (Rosa26 LSL / LSL).

[0049] 2. The primers required to identify the Cre genotype on the chromosome of AKR1C3 liver-specific overexpression transgenic mice are as follows. Primer P5 (SEQ ID NO: 7): TGCAAACATCACATGCACAC Primer P6 (SEQ ID NO: 8): TTGGCCCCTTACCATAACTG Primer P7 (SEQ ID NO: 9): GAAGCAGAAGCTTAGGAAGATGG The reaction system is shown in Table 2.

[0050] [Table 2]

[0051] The reaction conditions are shown in Table 3.

[0052] [Table 3]

[0053] The results of gel electrophoresis detection of the PCR products are shown in Figure 4 (3% agarose gel electrophoresis). The agarose gel electrophoresis detection results shown in Figure 4 indicate that if the PCR amplification product contains only one 351-bp band, the genotype is Cre-negative, and if the PCR amplification product contains multiple bands, the genotype is Cre-positive.

[0054] 3. To identify the Cre genotype on the chromosome of AKR1C3 systemic overexpression transgenic mice, the necessary primers are as follows: Primer P8 (SEQ ID NO: 10): TGGGTTGGGTGTCTGTTTCATTGT Primer P9 (SEQ ID NO: 11): GATCCACCTGTCTCTGCCTTCC Primer P10 (SEQ ID NO: 12): GACCTTGCATTCCTTTGGCGAGAG The reaction system is shown in Table 4.

[0055] [Table 4]

[0056] The reaction conditions are shown in Table 5.

[0057] [Table 5]

[0058] The results of gel electrophoresis detection of the PCR products are shown in FIG. 5 (3% agarose gel electrophoresis). In the agarose gel electrophoresis results shown in Figure 5, if the PCR amplification product contains only one 828-bp band, the genotype is Cre-negative (WT), if the PCR amplification product contains both 470-bp and 828-bp bands, the genotype is Cre-positive heterozygote, and if the PCR amplification product contains only the 470-bp band, the genotype is Cre-positive homozygote.

[0059] III. Breeding of AKR1C3 transgenic mice: Rosa26, 8-28 weeks old LSL / LSLSelect a female mouse (or a male mouse) and use Rosa26 LSL / LSL :Cre Alb (or Rosa26 LSL / LSL :Cre Dppa3 ) and mated with male (or female) mice. Female mice become pregnant and give birth in about 21 days. When the newborn mice were 10 days old, their toes were amputated, numbered, and genotyped (as described above). In this breeding method, Rosa26 LSL / LSL :Cre Alb (or Rosa26 LSL / LSL :Cre Dppa3 )(50%) mice and Rosa26 LSL / LSL (50%) mice can be obtained.

[0060] Example 4: Liver-specific overexpression of AKR1C3 in vivo in mice can result in the MAFLD phenotype. Based on the results of in vitro experiments, it is hypothesized that increased hepatic AKR1C3 levels may promote increased hepatic fat and facilitate hepatic steatosis in vivo.

[0061] Experimental Design: AKR1C3 transgenic mice were fed a normal diet (1010082, Cooperative Biology). Samples were collected from 10 mice at 12 months of age. The mice were euthanized, and liver tissue was removed and fixed in 4% paraformaldehyde for at least 24 hours. After 24 hours, a portion was dehydrated through a graded alcohol series, permeabilized in xylene, and embedded in paraffin to prepare 4-μm-thick paraffin sections for H&E staining. Another portion of the fixed tissue was removed and placed in 30% sucrose solution overnight. The following day, it was snap-frozen at -80°C, embedded in OCT, and frozen pathological sections (10 μm thick) for Oil Red O staining were prepared. The specific procedures were performed according to the reagent protocol. Simultaneously, whole blood was collected in a 1.5 ml centrifuge tube, left at room temperature to solidify, and then centrifuged at 3000 rpm for 10 minutes at 4°C. Serum triglyceride content was detected using a triglyceride quantitative detection kit (MAK266, Sigma). The results are shown in Figure 6.

[0062] Figure 6A is a schematic diagram of HE staining and Oil Red O staining of liver pathological sections from AKR1C3 transgenic mice. Figure 6B is a schematic diagram of relative quantification of the percentage of lipid vacuole content by HE staining of liver pathological sections from AKR1C3 transgenic mice. Figure 6C is a schematic diagram of relative quantification of lipid droplet content by Oil Red O staining of livers from AKR1C3 transgenic mice. Figure 6D is a schematic diagram of serum triglyceride levels in AKR1C3 transgenic mouse livers. All data are quantified as mean ± SEM. "*" indicates significant difference, ** indicates p<0.01, and **** indicates p<0.0001.

[0063] As can be seen from Figure 6, the liver tissue of AKR1C3-overexpressing mice on a normal diet contained significantly more lipid vacuoles (white vacuoles in the figure) and lipid droplets (droplets, the black areas in the figure) than the control group. At the same time, the serum triglyceride levels of AKR1C3-overexpressing mice on a normal diet were significantly higher than those of the control group. These results indicate that under normal dietary conditions, AKR1C3-overexpressing mice may develop a fatty liver phenotype accompanied by hepatic steatosis and elevated serum triglycerides.

[0064] Example 5: Targeted inhibition of mouse liver AKR1C3 expression using adeno-associated virus can ameliorate the MAFLD phenotype. Based on the results of the above in vitro and in vivo experiments, to further investigate the important role of AKR1C3 in the development and progression of MAFLD in vivo, we used adeno-associated virus to target and inhibit the expression of AKR1C3 protein in the liver of transgenic mice, and investigated the inhibitory effect of targeted inhibition of AKR1C3 on the development and progression of MAFLD.

[0065] Adenovirus construction: AAV8 was selected as the serotype. The vector backbone was GV681 (purchased from Shanghai Genechem). The element sequence was: TBGp-EGFP-MCS-SV40-PloyA. The enzyme digestion sites were NheI and HindIII. Using molecular cloning techniques, the scramble (control sequence) and shAKR1C3 sequences were inserted into the GV681 vector backbone. The recombinant expression plasmid was co-transfected into HEK-293 cells with pHelper (carrying adenovirus-derived genes) and pAAV-RC (carrying AAV replication and capsid genes). Recombinant AAV packaging was completed 2–3 days after transfection, and the supernatant and cells were collected. After purification and filtration, the virus was collected and the viral concentration was titrated by quantitative PCR.

[0066] Experimental design: 10-month-old AKR1C3 fl / fl :Cre Alb and AKR1C3 fl / fl :Cre Dppa3 Twelve mice were selected and randomly divided into two groups. AAV8-TBG-scramble virus solution (control group) and AAV8-TBG-shAKR1C3 virus solution were injected via the tail vein, respectively, at a concentration of 5 × 10 11 The mice were euthanized at 12 months of age, and serum was collected and stored at -80°C for subsequent testing to determine serum triglyceride content. Liver tissue was stored in liquid nitrogen for further analysis. The degree of steatosis in the mouse liver was assessed by H&E staining and Oil Red O staining. The results are shown in Figure 7.

[0067] Figure 7A is a schematic diagram of HE and Oil Red O staining of mouse liver pathological sections after injection of an adeno-associated virus that targets and inhibits AKR1C3 expression in the liver of transgenic mice. Figure 7B is a schematic diagram of relative quantification of the percentage of lipid vacuole content in HE-stained mouse liver pathological sections after injection of an adeno-associated virus that targets and inhibits AKR1C3 expression in the liver of transgenic mice. Figure 7C is a schematic diagram of relative quantification of lipid droplet content in Oil Red O staining of mouse liver after injection of an adeno-associated virus that targets and inhibits AKR1C3 expression in the liver of transgenic mice. Figure 7D is a schematic diagram of mouse serum triglyceride content after injection of an adeno-associated virus that targets and inhibits AKR1C3 expression in the liver of transgenic mice. All data are quantified as mean ± SEM. "*" indicates a significant difference, *** indicates p<0.001, and **** indicates p<0.0001.

[0068] As can be seen in Figure 7, AKR1C3 transgenic mice injected with AAV8-TBG-shAKR1C3 (i.e., AKR1C3 expression was inhibited) showed significantly reduced liver tissue lipid vacuoles (white vacuoles in the figure) and lipid droplet content (black droplets in the figure) compared to controls under normal dietary conditions, and serum triglyceride levels were also reduced. These results suggest that inhibiting AKR1C3 in vivo alleviates liver fat accumulation (reduced lipid vacuoles and lipid droplets) and lowers blood lipids, thereby alleviating the onset and progression of MAFLD.

[0069] The above is only a preferred embodiment of the present application, and is not intended to limit the present application to other forms, and those skilled in the art can make modifications or amendments by adding equivalent changes to the equivalent embodiments using the technical content disclosed above. However, any simple modifications, equivalent changes and amendments made to the above embodiments based on the technical essence of the present application without departing from the content of the technical solution of the present application still fall within the protection scope of the technical solution of the present application.

Claims

1. Use of an aldo-keto reductase family 1 member C3 (AKR1C3) inhibitor in inhibiting lipid droplet formation and promoting lipid droplet degradation.

2. The AKR1C3 inhibitors include the following I to IV: I. sgRNA as CRISPR-Cas9 targeting the AKR1C3 gene; II. microRNA, shmiR, siRNA, or shRNA targeting AKR1C3 mRNA; III. An expression vector or other type of vector comprising a targeting inhibitor sgRNA, microRNA, shmiR, siRNA or shRNA sequence as described in I and II; said expression vector is preferably one or more of the following vectors: a plasmid expression vector, a retrovirus (RV), a lentivirus (LV), an adenovirus (AV), an adeno-associated virus (AAV), a baculovirus (BV), or a self-replicating virus; said other type of vector is preferably one or more of the following vectors: a liposome, a polymeric nanoparticle, and an RNA nanosphere; IV. A targeting proteolytic agent for targeting AKR1C3 proteostasis selected from a proteolysis-inducing chimeric molecule (PROTAC), a molecular adhesive, a dual mechanism degrader, a CHAMP, a lysosomal targeting chimeric molecule (LYTAC), a GlueTAC, an antibody-based PROTAC (AbTAC), an autophagy targeting chimeric molecule (AUTAC), an ATTEC, and an AUTOTAC. The use according to claim 1, comprising at least one of:

3. 3. The use of claim 2, wherein the AKR1C3 inhibitor inhibits the AKR1C3 gene of the test subject through one or more gene editing techniques selected from zinc finger structures (Zinc Finger), transcription activator-like effector nucleases (TALENS), base editors (Base Editor), prime editors (Prime Editor), and AAV Directed Homology Recombination (AAV Directed Homology Recombination).

4. Use of an aldo-keto reductase family 1 member C3 (AKR1C3) inhibitor in the preparation of a medicament for the treatment or prevention of MAFLD.

5. The AKR1C3 inhibitors include the following I to IV: I. sgRNA as CRISPR-Cas9 targeting the AKR1C3 gene; II. microRNA, shmiR, siRNA, or shRNA targeting AKR1C3 mRNA; III. An expression vector or other type of vector comprising a targeting inhibitor sgRNA, microRNA, shmiR, siRNA or shRNA sequence as described in I and II; said expression vector is preferably one or more of the following vectors: a plasmid expression vector, a retrovirus (RV), a lentivirus (LV), an adenovirus (AV), an adeno-associated virus (AAV), a baculovirus (BV), or a self-replicating virus; said other type of vector is preferably one or more of the following vectors: a liposome, a polymeric nanoparticle, and an RNA nanosphere; IV. Targeting protein degraders for targeting AKR1C3 proteostasis, such as proteolysis-inducing chimeric molecules (PROTACs), molecular adhesives, dual mechanism degraders, CHAMPs, lysosomal targeting chimeras (LYTACs), GlueTACs, antibody-based PROTACs (AbTACs), autophagy targeting chimeras (AUTACs), ATTECs, and AUTOTACs and The use according to claim 4, wherein the gene editing technology used to target AKR1C3 in any of I to III is preferably one or more selected from zinc finger structures (Zinc Finger), transcription activator-like effector nucleases (TALENS), base editors, prime editors, and AAV directed homology recombination.

6. The use according to claim 4 or 5, wherein the MAFLD comprises simple non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, and liver fibrosis and / or cirrhosis resulting therefrom.

7. A pharmaceutical composition comprising the aldo-ketoreductase family 1 member C3 (AKR1C3) inhibitor of claim 2.

8. The pharmaceutical composition according to claim 7, which is used to treat or prevent a disease associated with an increase in lipid droplets.

9. The pharmaceutical composition according to claim 8, wherein the disease associated with increased lipid droplets includes MAFLD.

10. The use according to claim 9, wherein the MAFLD includes simple non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, and liver fibrosis and / or cirrhosis resulting therefrom.

11. Use of aldo-ketoreductase family 1 member C3 (AKR1C3) as a therapeutic target for diseases associated with increased lipid droplets.

12. The use described in claim 11, wherein the application form of the use of aldo-ketoreductase family 1 member C3 (AKR1C3) as a therapeutic target for diseases associated with an increase in lipid droplets is the use of an aldo-ketoreductase family 1 member C3 (AKR1C3) inhibitor in the preparation of a drug for treating or preventing diseases associated with an increase in lipid droplets.

13. The use according to claim 11 or 12, wherein the disease associated with an increase in lipid droplets is MAFLD.

14. The use according to claim 13, wherein the MAFLD includes simple non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, and liver fibrosis and / or cirrhosis resulting therefrom.

15. The inhibitors are selected from the group consisting of I to IV: I. sgRNA as CRISPR-Cas9 targeting the AKR1C3 gene; II. microRNA, shmiR, siRNA, or shRNA targeting AKR1C3 mRNA; III. An expression vector or other type of vector comprising a targeting inhibitor sgRNA, microRNA, shmiR, siRNA or shRNA sequence as described in I and II; said expression vector is preferably one or more of the following vectors: a plasmid expression vector, a retrovirus (RV), a lentivirus (LV), an adenovirus (AV), an adeno-associated virus (AAV), a baculovirus (BV), or a self-replicating virus; said other type of vector is preferably one or more of the following vectors: a liposome, a polymeric nanoparticle, and an RNA nanosphere; IV. Targeting protein degraders for targeting AKR1C3 proteostasis, such as proteolysis-inducing chimeric molecules (PROTACs), molecular adhesives, dual mechanism degraders, CHAMPs, lysosomal targeting chimeras (LYTACs), GlueTACs, antibody-based PROTACs (AbTACs), autophagy targeting chimeras (AUTACs), ATTECs, and AUTOTACs and The use according to any one of claims 12 to 14, wherein the gene editing technology used to target AKR1C3 in I to III is preferably one or more selected from zinc finger structures (Zinc Finger), transcription activator-like effector nucleases (TALENS), base editors, prime editors, and AAV directed homology recombination.

16. A method for inhibiting aldo-keto reductase family 1 member C3 (AKR1C3) comprising disrupting the expression of the AKR1C3 protein at the gene level or disrupting the homeostasis of the AKR1C3 protein at the protein level to promote its degradation.

17. Use of a vector specifically overexpressing aldo-keto reductase family 1 member C3 (AKR1C3) in generating a MAFLD disease model.

18. The use according to claim 17, wherein the overexpression vector comprises an AKR1C3 overexpression plasmid and a CAG-LSL-AKR1C3-3xflag-WPRE-pA expression cassette.

19. The use according to claim 18, wherein the sequence of the CAG-LSL-AKR1C3-3xflag-WPRE-pA expression cassette is shown in SEQ ID NO:

2.

20. The use according to claim 17, wherein the models include animal models and cell models.

21. The use according to claim 17, wherein the MAFLD includes simple non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, and liver fibrosis and / or cirrhosis resulting therefrom.

22. A method for constructing a genetically engineered animal model of MAFLD, comprising feeding mice overexpressing AKR1C3 gene with normal feed to obtain the genetically engineered animal model of MAFLD.

23. 23. The method of claim 22, wherein the MAFLD comprises simple non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, and liver fibrosis and / or cirrhosis resulting therefrom.

24. A method for constructing a Rosa26 site-specific knock-in mouse model capable of conditionally overexpressing the AKR1C3 gene, the method comprising using CRISPR / Cas9 technology to site-specifically insert a CAG-LSL-AKR1C3-3xflag-WPRE-pA expression cassette into the Rosa26 gene site on mouse chromosome 6 by homologous recombination, thereby obtaining a Rosa26 site-specific knock-in mouse model capable of conditionally overexpressing the AKR1C3 gene.

25. 25. The method of claim 24, wherein the expression cassette is the CAG-LSL-AKR1C3-3xflag-WPRE-pA expression cassette whose sequence is set forth in SEQ ID NO:

2.

26. A method for constructing a MAFLD animal model with liver-specific overexpression of AKR1C3, comprising hybridizing the prepared Rosa26 site-specific knock-in mouse capable of conditionally overexpressing the AKR1C3 gene as described in claim 24 with a liver-specific Cre (Alb-Cre) mouse to obtain a mouse with liver-specific overexpression of AKR1C3.

27. 27. The method of claim 26, wherein the MAFLD comprises simple non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, and liver fibrosis and / or cirrhosis resulting therefrom.

28. The method according to claim 26 or 27, wherein the MAFLD animal model constructed by the method is a MAFLD animal model obtained by feeding normal chow.

29. The method according to any one of claims 26 to 28, wherein the MAFLD animal model constructed by said method is used for screening of therapeutic agents for MAFLD and related basic research.

30. A method for constructing a MAFLD animal model with systemic AKR1C3 overexpression, comprising hybridizing the prepared Rosa26 site-specific knock-in mouse capable of conditionally overexpressing the AKR1C3 gene described in claim 24 or 25 with a fetal Cre (Dppa3-Cre) mouse to obtain a mouse with systemic AKR1C3 overexpression.

31. 31. The method of claim 30, wherein the MAFLD comprises simple non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, and liver fibrosis and / or cirrhosis resulting therefrom.

32. The method according to claim 30 or 31, wherein the MAFLD animal model constructed by the method is a MAFLD animal model obtained by feeding normal feed for 12 months.

33. The method according to any one of claims 30 to 32, wherein the MAFLD animal model constructed by said method is used for screening of therapeutic agents for MAFLD and related basic research.

Images