Antisense oligonucleotides, compositions and pharmaceutical formulations for exon skipping

Abstract

This technology provides novel antisense oligonucleotides ("ASOs") that generate or promote exon skipping during pre-mRNA splicing, pharmaceutical compositions containing such ASOs, and uses thereof. ASOs (e.g., bipartite ASOs) contain a target sequence and a 5' splice site decoy sequence operably linked to the 5' and / or 3' ends of the target sequence. The decoy sequence can be 5, 6, 7, 8, 9, 10, 11, 12, or 13 nucleotides in length, a portion of which can be complementary to the single-stranded 5' end of U1 snRNA. The target sequence hybridizes to a region of interest, such as a target exon, an adjacent intron sequence upstream or downstream of the target exon, or an intron-exon junction upstream or downstream of the target exon.

Description

[Technical Field]

[0001] (CROSS-REFERENCE TO RELATED APPLICATIONS) This application claims the benefit of U.S. Provisional Patent Application No. 63 / 377,946, filed September 30, 2022, which is incorporated by reference in its entirety, including any drawings. [Background technology]

[0002] The primary tool for exon skipping is antisense oligonucleotides (ASOs). ASOs can generate or enhance exon skipping by binding to splice sites or splicing regulatory elements. The splicing process can be regulated by various cis- and trans-acting elements that influence splice site selection. ASOs promote or inhibit pre-mRNA splicing depending on the target sequence, either by preventing the binding of RNA-binding proteins (RBPs) or snRNAs to specific sites or by disrupting secondary RNA structures. (Matlin A, et al. Understanding alternative splicing: towards a cellular code. 2005 May. Nat. Rev. Mol. Cell Bio. 6:386-398. doi: 10.1038 / nrm1645. Aartsma-Rus A, et al. Exonic sequences provide better targets for antisense oligonucleotides than splice site sequences in the modulation of Duchenne muscular dystrophy splicing. Oligonucleotides. 2010 Apr; 20(2):69-77. doi: 10.1089 / oli.2009.0215)

[0003] One example of a human genetic disease associated with mutations that disrupt reading frames is Duchenne muscular dystrophy (DMD), a progressive muscular dystrophy that causes progressive weakening and loss (atrophy) of skeletal and cardiac muscles. Muscle weakness worsens with age and progresses to the arms, legs, and trunk. Most children with DMD are full-time wheelchair users by age 13. Heart and respiratory muscle problems begin in the teenage years and can lead to serious, life-threatening complications.

[0004] DMD is caused by mutations in the DMD gene. The DMD gene codes for the protein dystrophin. Dystrophin is produced primarily in skeletal muscle cells and cardiac muscle cells, but also in small amounts in neurons in certain parts of the brain. DMD is inherited in an X-linked recessive inheritance pattern. Becker muscular dystrophy (BMD) is also caused by mutations in the DMD gene. Patients with BMD have milder symptoms than those with DMD. Summary of the Invention

[0005] Certain aspects of the present technology generally relate to novel antisense oligonucleotides (ASOs), methods of using such ASOs to generate or promote the skipping of exons of interest during pre-mRNA splicing, compositions (e.g., pharmaceutical compositions) containing such ASOs, and methods of using such compositions to treat diseases and / or their complications. ASO-mediated exon skipping can be an approach for manipulating the expression of a gene of interest. The expression of a gene of interest can be manipulated by an ASO to induce exon skipping, which can lead to, but is not limited to, correcting the reading frame caused by a frameshift mutation, skipping a toxic portion of the gene, silencing the gene, creating a dominant-negative isoform, or altering the structure and function of the gene. Exon skipping of a gene of interest can be beneficial for treating diseases and / or their complications, even if the gene of interest may or may not be the cause of the disease. The disease may be a genetic or non-genetic disease (e.g., some non-genetic cancers, metabolic diseases, or infectious diseases) as disclosed herein. The genetic disease may or may not be associated with a splicing defect.

[0006] In some embodiments, the present technology provides oligonucleotides, also referred to as bipartite ASOs, that comprise or consist of a target sequence (also referred to as an "ASO target sequence") and a 5' splice site decoy sequence (also referred to as an "ASO decoy," "ASO decoy sequence," "decoy sequence," or "decoy") operably linked to the 5' and / or 3' ends of the target sequence. The decoy sequence may comprise a nucleotide sequence of 5, 6, 7, 8, 9, 10, or 11 nucleotides complementary to part or all of the single-stranded 5' end of U1 snRNA. The target sequence hybridizes to a sequence selected from the group consisting of an exon of interest, an adjacent intron sequence upstream of the exon of interest, an adjacent intron sequence downstream of the exon of interest, an intron-exon junction upstream of the exon of interest, and an intron-exon junction downstream of the exon of interest. The decoy sequence may resemble an optimal 5' splice site.

[0007] In some embodiments, ASOs containing the same target sequence may have a higher exon skipping effect and / or efficiency than ASOs consisting of the target sequence. The exon skipping effect and / or efficiency may be quantified by the exclusion rate of the target exon in the total transcript of each gene (%excl, also referred to as exon skipping rate). In some embodiments, the improvement quantified by the increase in the exclusion rate may be about 14-fold or more, about 15-fold or more, about 16-fold or more, or about 17-fold or more.

[0008] In some embodiments, the ASO decoy sequence comprises or consists of a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-23 and 347-353.

[0009] Examples of exons of interest include, but are not limited to, exon 7 of the endogenous SMN1 and SMN2 genes, exons 45, 51 and 53 of the endogenous DMD gene, exon 17 of the endogenous APP gene, exon 41 of the endogenous CEP290 gene, exon 19 of the endogenous HER2 gene, exon 10 of the SCA3 gene, exon 10 of the endogenous PKM gene, and exon 6 of the endogenous MDM4 gene.

[0010] In some embodiments, the ASO target sequence comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 25, 29, 33, 37, 41, 45, 49, 75, 92, 124, 156, 188, 220, 252, 284, and 316.

[0011] The target sequence may be linked to the decoy sequence directly or via a linker (eg, having a length of, but not limited to, 1, 2, 3, 4, or 5 nucleotides).

[0012] In some embodiments, the ASO (e.g., a bipartite ASO) comprises or consists of a nucleotide sequence selected from the group consisting of SEQ ID NOs: 26-27, 30-31, 34-35, 38-39, 42-43, 46-47, 50-73, 76-90, 93-122, 125-154, 157-186, 189-218, 221-250, 253-282, 285-314, 317-346, and 354-356.

[0013] In some embodiments, the ASO (e.g., bipartite ASO) comprises at least one nucleotide analog. Examples of nucleotide analogs include, but are not limited to, 2'-O-methoxyethyl (MOE)-modified oligonucleotides having phosphodiester or phosphorothioate backbones, and phosphorodamidate morpholino oligomers.

[0014] In some aspects, the present technology provides a composition comprising an ASO (e.g., a bipartite ASO) disclosed herein and a pharmaceutically acceptable carrier. In certain embodiments, the composition is a pharmaceutical formulation or composition.

[0015] In some aspects, the technology provides vectors encoding the ASOs (e.g., bipartite ASOs) disclosed herein.

[0016] In some aspects, the present technology provides methods for generating or promoting exon skipping of an exon of interest during splicing of a pre-mRNA, comprising contacting pre-mRNA in a cell or subject with an ASO (e.g., a bipartite ASO) disclosed herein, a composition (e.g., a pharmaceutical composition) comprising an ASO (e.g., a bipartite ASO) disclosed herein, and / or a vector encoding an ASO (e.g., a bipartite ASO). In some embodiments, the method further comprises delivering an ASO (e.g., a bipartite ASO) disclosed herein to a cell or administering it to a subject. ASO-mediated exon skipping may be an approach for manipulating the expression of a gene of interest. Expression of a gene of interest can be manipulated by ASOs to inhibit splicing of exons, introns, or specific splice sites of the gene of interest, which can result in, for example, but not limited to, restoring a defective reading frame of the gene of interest, generating different isoforms of the gene of interest (e.g., dominant-negative isoforms), skipping toxic portions of the gene, silencing the gene, and / or altering the structure and function of the gene.

[0017] In some aspects, the present technology provides a method for improving the efficacy and / or efficiency of exon skipping of a target sequence, the method comprising obtaining one or more ASOs (e.g., bipartite ASOs) comprising a target sequence and a decoy sequence operably linked to the 5' and / or 3' ends of the target sequence, wherein the decoy sequence comprises a nucleotide sequence of 5, 6, 7, 8, 9, 10, or 11 nucleotides complementary to part or all of the single-stranded 5' end of U1 snRNA. The decoy sequence may resemble an optimal 5' splice site. In certain embodiments, the method further comprises screening one or more ASOs (e.g., bipartite ASOs) according to the efficacy and / or efficiency of exon skipping of the target exon. The efficacy and / or efficiency of exon skipping may be quantified by the exclusion rate (%excl) of the target exon in the total transcript of each gene. The target sequence may be capable of hybridizing to a sequence selected from the group consisting of an exon of interest in a cell or subject, an adjacent intron sequence upstream of the exon of interest, an adjacent intron sequence downstream of the exon of interest, an intron-exon junction upstream of the exon of interest, and an intron-exon junction downstream of the exon of interest.

[0018] In some embodiments, the present technology provides a method for treating a disease and / or its complications in a subject, comprising administering to the subject an ASO (e.g., a bipartite ASO), a composition (e.g., a pharmaceutical composition) comprising an ASO (e.g., a bipartite ASO) disclosed herein, and / or a vector encoding an ASO (e.g., a bipartite ASO). The ASO (e.g., a bipartite ASO) may generate or promote skipping of an exon of interest during pre-mRNA splicing. ASO-mediated exon skipping may be an approach for manipulating the expression of a gene of interest. The expression of a gene of interest can be manipulated by the ASO to inhibit splicing of an exon, intron, or specific splice site of the gene of interest, which may result in, for example, but not limited to, restoring a defective reading frame of the gene of interest, generating a different isoform (e.g., a dominant-negative isoform) of the gene of interest, skipping a toxic portion of the gene, silencing the gene, and / or altering the structure and function of the gene. The manipulation of the expression of a gene of interest by ASO may be beneficial for treating disease and / or its complications, even if the gene of interest is the cause of the disease or not.Diseases may be hereditary or non-hereditary diseases (for example, some non-hereditary cancers, metabolic diseases, or infectious diseases) as disclosed herein.Hereditary diseases may or may not be associated with mutations related to splicing defects.

[0019] Examples of diseases and / or its complications include, but are not limited to, diseases and / or its complications that can benefit from exon skipping of one or more genes selected from the group consisting of SMN1, SMN2, DMD, APP, CEP290, HER2, SCA3, PKM and MDM4 genes.For example, but not limited to, diseases and / or its complications can be treated by exon skipping of one or more exons selected from the group consisting of exon 7 of endogenous SMN1 and SMN2 genes, exons 45, 51 and 53 of endogenous DMD gene, exon 17 of endogenous APP gene, exon 41 of endogenous CEP290 gene, exon 19 of endogenous HER2 gene, exon 10 of SCA3 gene, exon 10 of endogenous PKM gene and exon 6 of endogenous MDM4 gene. Exemplary diseases include, but are not limited to, Duchenne muscular dystrophy (DMD), Alzheimer's disease, Joubert syndrome, spinocerebellar ataxia 3 (SCA3), and cancer (e.g., but not limited to, breast cancer, HER2-positive biliary tract cancer, colorectal cancer, non-small cell lung cancer, bladder cancer, prostate cancer, lung cancer, cervical cancer, kidney cancer, papillary thyroid cancer, colon cancer, colorectal cancer, glioma, ovarian cancer, gastric cancer, hepatoblastoma, fibrolamellar carcinoma, hepatocellular carcinoma, soft tissue sarcoma, osteosarcoma, chronic lymphocytic leukemia, acute myeloid leukemia, mantle cell lymphoma, pediatric Burkitt's lymphoma, salivary gland cancer, liver cancer, and melanoma). In certain embodiments, the ASO (e.g., a bipartite ASO), a composition (e.g., a pharmaceutical composition) comprising the ASO (e.g., a bipartite ASO), and / or a vector encoding the ASO (e.g., a bipartite ASO) is administered in a therapeutically effective amount.

[0020] In some embodiments, the present technology provides the use of an ASO (e.g., a bipartite ASO) disclosed herein, a composition (e.g., a pharmaceutical composition) comprising an ASO (e.g., a bipartite ASO) disclosed herein, and / or a vector encoding an ASO (e.g., a bipartite ASO) disclosed herein to generate or promote exon skipping of an exon of interest. ASO-mediated exon skipping may be an approach for manipulating the expression of a gene of interest. Expression of a gene of interest can be manipulated by an ASO to inhibit splicing of an exon, intron, or specific splice site of the gene of interest, which may lead, for example, but not limited to, to restoring a defective reading frame of the gene of interest, generating a different isoform (e.g., a dominant-negative isoform) of the gene of interest, skipping a toxic portion of the gene, silencing the gene, and / or altering the structure and function of the gene. Examples of exons of interest and genes of interest include, but are not limited to, those disclosed herein.

[0021] In some aspects, the present technology provides for the use of an ASO (e.g., a bipartite ASO) disclosed herein, a composition (e.g., a pharmaceutical composition) comprising an ASO (e.g., a bipartite ASO) disclosed herein, and / or a vector encoding an ASO (e.g., a bipartite ASO) disclosed herein, in the treatment of a disease and / or complications thereof. Exemplary diseases include, but are not limited to, those disclosed herein.

[0022] In some embodiments, the present technology provides an ASO (e.g., a bipartite ASO) disclosed herein, a composition (e.g., a pharmaceutical composition) comprising an ASO (e.g., a bipartite ASO) disclosed herein, and / or a vector encoding an ASO (e.g., a bipartite ASO) disclosed herein for use in generating or promoting exon skipping of an exon of interest. ASO-mediated exon skipping may be an approach for manipulating the expression of a gene of interest. Expression of a gene of interest can be manipulated by an ASO to inhibit splicing of an exon, intron, or specific splice site of the gene of interest, which may result in, for example, but not limited to, restoring a defective reading frame of the gene of interest, generating a different isoform of the gene of interest (e.g., a dominant-negative isoform), skipping a toxic portion of the gene, silencing the gene, and / or altering the structure and function of the gene. Exons of interest and genes of interest include, but are not limited to, those disclosed herein.

[0023] In some embodiments, the subject technology provides ASOs (e.g., bipartite ASOs) disclosed herein, compositions (e.g., pharmaceutical compositions) comprising ASOs (e.g., bipartite ASOs) disclosed herein, and / or vectors encoding ASOs (e.g., bipartite ASOs) disclosed herein for use in treating diseases and / or complications thereof. Examples of diseases and / or complications thereof include, but are not limited to, those disclosed herein.

[0024] In some embodiments, the present technology provides an ASO (e.g., a bipartite ASO) disclosed herein, a composition (e.g., a pharmaceutical composition) comprising an ASO (e.g., a bipartite ASO) disclosed herein, and / or a kit comprising a vector encoding an ASO (e.g., a bipartite ASO) disclosed herein for use in generating or promoting exon skipping of an exon of interest. ASO-mediated exon skipping may be an approach for manipulating the expression of a gene of interest. Expression of a gene of interest can be manipulated by an ASO to inhibit splicing of an exon, intron, or specific splice site of the gene of interest, which may lead, for example, but not limited to, to restoring a defective reading frame of the gene of interest, generating a different isoform of the gene of interest (e.g., a dominant-negative isoform), skipping a toxic portion of the gene, silencing the gene, and / or altering the structure and function of the gene. Examples of exons of interest and genes of interest include, but are not limited to, those disclosed herein.

[0025] In some embodiments, the subject technology provides ASOs (e.g., bipartite ASOs) disclosed herein, compositions (e.g., pharmaceutical compositions) comprising ASOs (e.g., bipartite ASOs) disclosed herein, and / or kits comprising vectors encoding ASOs (e.g., bipartite ASOs) disclosed herein for use in treating diseases and / or complications thereof, including, but not limited to, those disclosed herein. [Brief explanation of the drawings]

[0026] [Figure 1]Figures 1A-1B show schematic diagrams of several ASOs (e.g., bipartite ASOs) of the present technology, each of which comprises 1) a "target" sequence that is fully or substantially complementary to a region of interest within a target nucleic acid (e.g., a pre-mRNA) and 2) a "decoy" sequence located immediately adjacent to the target sequence (i.e., the decoy sequence is in a region adjacent to the target sequence). Figure 1A shows two schematic diagrams of bipartite ASOs in which the decoy sequence is located immediately upstream (left) of the 5' end of the target sequence and immediately downstream (right) of the 3' end of the target sequence, respectively. Without being bound by any particular theory, Figure 1B illustrates one possible mechanism for how the bipartite ASO of Figure 1A generates or promotes skipping of a desired exon in which the decoy sequence is located immediately upstream of the 5' end of the target sequence. The decoy sequence resembles the optimal 5′ splice site and can be complementary to part or all of the free single-stranded sequence at the 5′ end of U1 snRNA, thereby preventing U1 snRNA from recognizing the nearby authentic 5′ splice site. [Figure 2]Figures 2A-2D show the effect of the presence and / or location of decoy sequence 11 (SEQ ID NO: 21) on exon 7 skipping in the SMN1 and SMN2 genes in HEK293 cells using an ASO containing one of three target sequences (2203, 1938, and 0120). Figure 2A shows a schematic diagram of the approximate binding locations of the three tested target sequences (2203, 1938, and 0120) in the SMN1 and SMN2 genes. Figure 2B shows the exon 7 skipping effect of an ASO containing target sequence 2203 in the SMN1 and SMN2 genes. The left panel of Figure 2B shows representative semiquantitative fluorescent RT-PCR imaging analysis of SMN1 and SMN2 in HEK293 cells transfected with ASOs (12.5 nM, 25 nM, or 50 nM) containing target sequence 2203 alone (2203), target sequence 2203 with decoy sequence 11 attached to the 5' end (2203-L11), and target sequence 2203 with decoy sequence 11 attached to the 3' end (2203-R11). The center panel of Figure 2B shows quantification of exon 7 skipping (% excl.) in SMN1 using the same ASOs, expressed as mean ± standard deviation (n = 3, **P < 0.01 compared to 2203). For each concentration, data for 2203 are shown on the left, data for 2203-L11 in the center, and data for 2203-R11 on the right. The right panel of Figure 2B shows the quantification of exon 7 skipping (% excl) in SMN2 using the same ASO, expressed as the mean ± standard deviation (n = 3, **P < 0.01 compared to 2203). For each concentration, data for 2203 are shown on the left, data for 2203-L11 in the middle, and data for 2203-R11 on the right. Buffer was used as a negative control. Figure 2C shows the exon 7 skipping effect of an ASO containing the target sequence 1938 in SMN1 and SMN2.The left panel of Figure 2C shows representative semiquantitative fluorescent RT-PCR imaging analysis of SMN1 and SMN2 in HEK293 cells transfected with ASOs (12.5 nM, 25 nM, or 50 nM) containing target sequence 1938 alone (1938), target sequence 1938 with decoy sequence 11 attached to the 5' end (1938-L11), and target sequence 1938 with decoy sequence 11 attached to the 3' end (1938-R11). The center panel of Figure 2C shows quantification of exon 7 skipping (% excl.) in SMN1 using the same ASOs, expressed as mean ± standard deviation (n = 3, *P < 0.05, **P < 0.01 compared to 1938). For each concentration, data for 1938 are shown on the left, data for 1938-L11 in the middle, and data for 1938-R11 on the right. The right panel of Figure 2C shows quantification of exon 7 skipping (% excl) in SMN2 using the same ASO, expressed as the mean ± standard deviation (n = 3, *P < 0.05, **P < 0.01 compared to 1938). For each concentration, data for 1938 are shown on the left, data for 1938-L11 in the middle, and data for 1938-R11 on the right. Buffer was used as a negative control. Figure 2D shows the exon 7 skipping effect of an ASO containing the target sequence 0120 in SMN1 and SMN2. The left panel of Figure 2D shows representative semiquantitative fluorescent RT-PCR imaging analysis of SMN1 and SMN2 in HEK293 cells transfected with ASOs (12.5 nM, 25 nM, or 50 nM) containing target sequence 0120 alone (0120), target sequence 0120 with decoy sequence 11 attached to the 5' end (0120-L11), and target sequence 0120 with decoy sequence 11 attached to the 3' end (0120-R11). The center panel of Figure 2D shows quantification of exon 7 skipping (% excl.) of SMN1 using the same ASOs, expressed as mean ± standard deviation (n = 3, **P < 0.01 compared to 0120). For each concentration, data for 0120 are shown on the left, 0120-L11 in the center, and 0120-R11 on the right.The right panel of Figure 2D shows quantification of exon 7 skipping (% excl) in SMN2 using the same ASOs, expressed as mean ± standard deviation (n = 3, **P < 0.01 compared to 0120). For each concentration, three columns are shown: 0120 data on the left, 0120-L11 data in the middle, and 0120-R11 data on the right. Buffer was used as a negative control. [Figure 3]Figures 3A-3B show the effect of the presence and / or position of decoy sequence 11 on exon 51 skipping in the DMD gene in rhabdomyosarcoma (RD) cells using an ASO containing one of four target sequences (148, 155, 165, and eteplirsen (Etep)). Figure 3A shows the exon 51 skipping effect of an ASO containing one of three target sequences (148, 155, and 165) in the DMD gene. The left panel of Figure 3A shows a representative semiquantitative fluorescent RT-PCR imaging analysis using RD cells transfected with ASOs (50 nM) containing one of three target sequences without a decoy sequence (148, 155, and 165), one target sequence with a decoy sequence 11 attached to the 5' end (148-L11, 155-L11, and 165-L11), or one target sequence with a decoy sequence 11 attached to the 3' end (148-R11, 155-R11, and 165-R11). The right panel of Figure 3A shows quantification of exon 51 skipping (% exon 51 skipping) expressed as mean ± standard deviation (n = 4, *P < 0.05 (148-L11 vs. 148), **P < 0.01 (155-L11 vs. 155, 165-L11 vs. 165)) in DMD in RD cells transfected with ASOs (50 nM) containing one of three target sequences without a decoy sequence (148, 155, and 165), target sequences with decoy sequence 11 attached to the 5' end (148-L11, 155-L11, and 165-L11), or target sequences with decoy sequence 11 attached to the 3' end (148-R11, 155-R11, and 165-R11). Buffer was used as a negative control. Figure 3B shows the exon 51 skipping effect of an ASO containing the target sequence Etep in the DMD gene. The left panel of Figure 3B shows a representative semi-quantitative fluorescent RT-PCR imaging analysis using RD cells transfected with ASOs (12.5 nM, 25 nM, or 50 nM) containing the target sequence Etep without a decoy sequence (Etep), a target sequence with a decoy sequence 11 attached to the 5' end (Etep-L11), or a target sequence with a decoy sequence 11 attached to the 3' end (Etep-R11).The right panel of Figure 3B shows the quantification of exon 51 skipping (% exon skipping) in DMD in RD cells transfected with ASOs (12.5 nM, 25 nM, or 50 nM) containing a target sequence without a decoy sequence (Etep, left column of three concentrations), a target sequence with a decoy sequence 11 attached to its 5' end (Etep-L11, center column of three concentrations), or a target sequence with a decoy sequence 11 attached to its 3' end (Etep-R11, right column of three concentrations). Buffer was used as a negative control. [Figure 4] Figure 4 shows the effect of the presence, length, and / or sequence of various decoy sequences (6a–6f, 7a–7e, 8a–8d, 9a–9c, 10a–10b, 11, 12, and 13) attached to the 5' end of the target sequence Etep on exon 51 skipping in the DMD gene in RD cells. The upper panel of Figure 4 shows a representative semi-quantitative fluorescent RT-PCR analysis of the DMD gene in RD cells transfected with ASOs (25 nM) containing the target sequence Etep without a decoy sequence (Etep) or the target sequence Etep with decoy sequences of different lengths (L6a–L6f, L7a–L7e, L8a–L8d, L9a–L9c, L10a–L10b, L11, L12, and L13) attached to the 5' end. Buffer was used as a negative control. The bottom panel of Figure 4 shows quantification of exon 51 skipping (% exon 51 skipping) expressed as mean ± standard deviation (n = 3, #P < 0.05 (all vs. Etep), *P < 0.05, **P < 0.01 (all vs. Etep-L11)) in DMD in RD cells transfected with the same ASOs (25 nM) tested in the top panel of Figure 4 (Etep, Etep-L6a to Etep-L6f, Etep-L7a to Etep-L7e, Etep-L8a to Etep-L8d, Etep-L9a to Etep-L9c, Etep-L10a to Etep-L10b, Etep-L11, Etep-L12, and Etep-L13). Buffer was used as a negative control. [Figure 5]Figure 5 shows the effect of the presence, length, and / or sequence of various decoy sequences (7a–7e, 8a–8d, 9a–9c, 10a–10b, and 11) attached to the 5' end of the target sequence 000A on exon 51 skipping in the DMD gene in RD cells. The upper panel of Figure 5 shows a representative semi-quantitative fluorescent RT-PCR analysis of the DMD gene in RD cells transfected with ASOs (25 nM) containing the target sequence 000A without a decoy sequence (000A) or the target sequence 000A with decoy sequences of different lengths (L7a–L7e, L8a–L8d, L9a–L9c, L10a–L10b, and L11) attached to the 5' end. Buffer was used as a negative control. The bottom panel of Figure 5 shows quantification of exon 51 skipping (% exon 51 skipping), expressed as mean ± standard deviation (n = 3, *P < 0.05, **P < 0.01, all vs. 000A), in DMD in RD cells transfected with the same ASOs (25 nM) tested in the top panel of Figure 5 (000A, 000A-L7a to 000A-L7e, 000A-L8a to 000A-L8d, 000A-L9a to 000A-L9c, 000A-L10a to 000A-L10b, and 000A-L11). Buffer was used as a negative control. [Figure 6]Figure 6 shows the effect of the presence, length, and / or sequence of various decoy sequences (7c, 8c, 9b, and 10a for target sequence Etep, and 8c, 9a–9c for target sequence 000A) attached to the 5′ end of the target sequence Etep or 000A on exon 51 skipping of the DMD gene in the tibialis anterior and gastrocnemius muscles of DMD-humanized mice. The upper left panel of Figure 6 shows representative semi-quantitative fluorescent RT-PCR analysis of DMD exon 51 skipping in the tibialis anterior muscles of DMD-humanized mice administered ASOs containing the target sequence Etep without a decoy sequence (Etep), the target sequence Etep with decoy sequences of different lengths (L7c, L8c, L9b, and L10a) attached to its 5′ end, or the target sequence 000A with decoy sequences of different lengths (L8c, and L9a–L9c). Saline was used as a negative control. The upper right panel of Figure 6 shows representative semi-quantitative fluorescent RT-PCR analysis of DMD exon 51 skipping in the gastrocnemius muscle of DMD-humanized mice administered ASOs containing the target sequence Etep (Etep) without a decoy sequence, the target sequence Etep with decoy sequences of different lengths (L7c, L8c, L9b, and L10a) attached to the 5' end, or the target sequence 000A with decoy sequences of different lengths (L8c, and L9a-L9c). Saline was used as a negative control. The bottom left panel of Figure 6 shows quantification of exon 51 skipping (% excl.), expressed as mean ± standard deviation (n = 3, *P < 0.05, **P < 0.01, ***P < 0.001 (all vs. Etep), in the tibialis anterior muscle of DMD-humanized mice administered the same ASOs tested in the top left panel of Figure 6 (Etep, Etep-L7c, Etep-L8c, Etep-L9b, Etep-L10a, 000A-L8c, and 000A-L9a to 000A-L9c). Saline was used as a negative control.The bottom right panel of Figure 6 shows quantification of exon 51 skipping (% excl.) expressed as mean ± standard deviation (n = 3, *P < 0.05, **P < 0.01 (all vs. Etep)) in the gastrocnemius muscle of DMD-humanized mice administered the same ASOs (Etep, Etep-L7c, Etep-L8c, Etep-L9b, Etep-L10a, 000A-L8c, and 000A-L9a to 000A-L9c) tested in the top right panel of Figure 6. Saline was used as a negative control. [Figure 7]Figure 7 shows the effects of the presence, position, length, and / or sequence of various decoy sequences (7a–7e, 8a–8d, 9a–9c, 10a–10b, and 11) attached to the 5′ or 3′ end of the target sequence viltolarsen (Vilto) on exon 53 skipping in the DMD gene in RD cells. The upper left panel of Figure 7 shows a representative semiquantitative fluorescent RT-PCR analysis of exon 53 skipping in the DMD gene in RD cells transfected with ASOs (25 nM) containing only the target sequence Vilto (Vilto) or the target sequence Vilto with decoy sequences of different lengths attached to the 5′ end (Vilto-L7a–Vilto-L7e, Vilto-L8a–Vilto-L8d, Vilto-L9a–Vilto-L9c, Vilto-L10a–Vilto-L10b, and Vilto-L11). Buffer solution was used as a negative control. The upper right panel of Figure 7 shows a representative semiquantitative fluorescent RT-PCR analysis of exon 53 skipping in the DMD gene in RD cells transfected with ASOs (25 nM) containing the target sequence Vilto alone (Vilto) or the target sequence Vilto with decoy sequences of different lengths attached to the 3' end (Vilto-R7a to Vilto-R7e, Vilto-R8a to Vilto-R8d, Vilto-R9a to Vilto-R9c, Vilto-R10a to Vilto-R10b, and Vilto-R11). Buffer solution was used as a negative control. The bottom left panel of Figure 7 shows quantification of exon 53 skipping (% excl.) expressed as mean ± standard deviation (n = 3, *P < 0.05, **P < 0.01, ***P < 0.001, all vs. Vilto) in the DMD gene in RD cells transfected with the same ASO (25 nM) tested in the top left panel of Figure 7 (Vilto, Vilto-L7a to Vilto-L7e, Vilto-L8a to Vilto-L8d, Vilto-L9a to Vilto-L9c, Vilto-L10a to Vilto-L10b, and Vilto-L11). Buffer was used as a negative control.The bottom right panel of Figure 7 shows quantification of exon 53 skipping (% excl.) expressed as mean ± standard deviation (n = 3, *P < 0.05, **P < 0.01, all vs. Vilto) in the DMD gene in RD cells transfected with the same ASO (25 nM) tested in the top right panel of Figure 7 (Vilto, Vilto-R7a to Vilto-R7e, Vilto-R8a to Vilto-R8d, Vilto-R9a to Vilto-R9c, Vilto-R10a to Vilto-R10b, and Vilto-R11). Buffer was used as a negative control. [Figure 8]Figures 8A-8B show the effects of the presence, location, length, and / or sequence of various decoy sequences (7a-7e, 8a-8d, 9a-9c, 10a-10b, and 11) attached to the 5' or 3' end of target sequence 002A on partial exon 45 skipping in the DMD gene in RD cells. Figure 8A shows a schematic diagram of activation of a potential 5' splice site in DMD exon 45 by the tested target sequence 002A, leading to the loss of the last 32 nt of exon 45. The loss of 32 nt, referred to here as partial exon 45 skipping, can restore the reading frame in some DMD patients in a similar way to skipping the entire 176 nt of exon 45, but results in much less loss of the protein sequence encoded by exon 45. The upper left panel of Figure 8B shows a representative semi-quantitative fluorescent RT-PCR analysis of partial exon 45 skipping in the DMD gene in RD cells transfected with ASOs (25 nM) containing only the target sequence 002A (002A) or the target sequence 002A with decoy sequences of different lengths attached to the 5' end (002A-L7a to 002A-L7e, 002A-L8a to 002A-L8d, 002A-L9a to 002A-L9c, 002A-L10a to 002A-L10b, and 002A-L11). Buffer was used as a negative control. The upper right panel of Figure 8B shows a representative semi-quantitative fluorescent RT-PCR analysis of partial exon 45 skipping in the DMD gene in RD cells transfected with ASOs (25 nM) containing only the target sequence 002A (002A) or the target sequence 002A with decoy sequences of different lengths attached to the 3' end (002A-R7a to 002A-R7e, 002A-R8a to 002A-R8d, 002A-R9a to 002A-R9c, 002A-R10a to 002A-R10b, and 002A-R11). Buffer was used as a negative control.The bottom left panel of Figure 8B shows quantification of partial exon 45 skipping (% excl.) expressed as mean ± standard deviation (n = 3, *P < 0.05, **P < 0.01 (all vs. 002A)) in the DMD gene in RD cells transfected with the same ASOs (25 nM) tested in the top left panel of Figure 8B (002A, 002A-L7a to 002A-L7e, 002A-L8a to 002A-L8d, 002A-L9a to 002A-L9c, 002A-L10a to 002A-L10b, and 002A-L11). Buffer was used as a negative control. The bottom right panel of Figure 8B shows quantification of partial exon 45 skipping (% excl.) expressed as mean ± standard deviation (n = 3, *P < 0.05, total vs. 002A) in DMD in RD cells transfected with the same ASOs (25 nM) tested in the top right panel of Figure 8B (002A, 002A-R7a to 002A-R7e, 002A-R8a to 002A-R8d, 002A-R9a to 002A-R9c, 002A-R10a to 002A-R10b, and 002A-R11). Buffer was used as a negative control. [Figure 9]Figures 9A-9B show the effect of the presence, position, length, and / or sequence of various decoy sequences (7a-7e, 8a-8d, 9a-9c, 10a-10b, and 11) attached to the 5′ or 3′ end of target sequence 014B on exon 17 skipping in the APP gene in HEK293 cells. The left panel of Figure 9A shows a representative semi-quantitative fluorescent RT-PCR analysis of exon 17 skipping in the APP gene in HEK293 cells transfected with ASOs (50 nM) containing only the target sequence 014B (014B) or the target sequence 014B with decoy sequences of different lengths attached to the 5' end (014B-L7a to 014B-L7e, 014B-L8a to 014B-L8d, 014B-L9a to 014B-L9c, 014B-L10a to 014B-L10b, and 014B-L11). Buffer was used as a negative control. The right panel of Figure 9A shows quantification of exon 17 skipping (% excl.) expressed as mean ± standard deviation (n = 3, *P < 0.05, **P < 0.01, ***P < 0.001 (all vs. 014B)) in the APP gene in HEK293 cells transfected with the same ASOs (50 nM) tested in the left panel of Figure 9A (014B, 014B-L7a to 014B-L7e, 014B-L8a to 014B-L8d, 014B-L9a to 014B-L9c, 014B-L10a to 014B-L10b, and 014B-L11). Buffer was used as a negative control. The left panel of Figure 9B shows a representative example of semiquantitative fluorescent RT-PCR analysis of exon 17 skipping in the APP gene in HEK293 cells transfected with ASOs (50 nM) containing only the target sequence O14B (014B) or the target sequence O14B with decoy sequences of different lengths attached to the 3' end (014B-R7a to 014B-R7e, 014B-R8a to 014B-R8d, 014B-R9a to 014B-R9c, 014B-R10a to 014B-R10b, and 014B-R11). Buffer was used as a negative control.The right panel of Figure 9B shows quantification of exon 17 skipping (% excl.) expressed as mean ± standard deviation (n = 3, *P < 0.05, **P < 0.01, ***P < 0.001 (all vs. 014B)) in the APP gene in HEK293 cells transfected with the same ASOs (50 nM) tested in the left panel of Figure 9B (014B, 014B-R7a to 014B-R7e, 014B-R8a to 014B-R8d, 014B-R9a to 014B-R9c, 014B-R10a to 014B-R10b, and 014B-R11). Buffer was used as a negative control. [Figure 10]Figures 10A-10B show the effect of the presence, position, length, and / or sequence of various decoy sequences (7a-7e, 8a-8d, 9a-9c, 10a-10b, and 11) attached to the 5' or 3' end of target sequence 017B on exon 41 skipping in the CEP290 gene in HEK293 cells. The left panel of Figure 10A shows a representative example of semiquantitative fluorescent RT-PCR analysis of exon 41 skipping in the CEP290 gene in HEK293 cells transfected with ASOs (50 nM) containing only the target sequence 017B (017B) or with decoy sequences of different lengths attached to the 5' end (017B-L7a to 017B-L7e, 017B-L8a to 017B-L8d, 017B-L9a to 017B-L9c, 017B-L10a to 017B-L10b, and 017B-L11). Buffer was used as a negative control. The right panel of Figure 10A shows quantification of exon 41 skipping (% excl.) expressed as mean ± standard deviation (n = 3, *P < 0.05, **P < 0.01, ***P < 0.001 (all vs. 017B)) in the CEP290 gene in HEK293 cells transfected with the same ASOs (50 nM) tested in the left panel of Figure 10A (017B, 017B-L7a to 017B-L7e, 017B-L8a to 017B-L8d, 017B-L9a to 017B-L9c, 017B-L10a to 017B-L10b, and 017B-L11). Buffer was used as a negative control. The left panel of Figure 10B shows a representative example of semiquantitative fluorescent RT-PCR analysis of exon 41 skipping in the CEP290 gene in HEK293 cells transfected with ASOs (50 nM) containing only the target sequence 017B (017B) or with decoy sequences of different lengths attached to the 3' end (017B-R7a to 017B-R7e, 017B-R8a to 017B-R8d, 017B-R9a to 017B-R9c, 017B-R10a to 017B-R10b, and 017B-R11). Buffer was used as a negative control.The right panel of Figure 10B shows quantification of exon 41 skipping (% excl.) expressed as mean ± standard deviation (n = 3, **P < 0.01, ***P < 0.001 (all vs. 017B)) in the CEP290 gene in HEK293 cells transfected with the same ASOs (50 nM) tested in the left panel of Figure 10B (017B, 017B-R7a to 017B-R7e, 017B-R8a to 017B-R8d, 017B-R9a to 017B-R9c, 017B-R10a to 017B-R10b, and 017B-R11). Buffer was used as a negative control. [Figure 11]Figures 11A-11B show the effect of the presence, position, length, and / or sequence of various decoy sequences (7a-7e, 8a-8d, 9a-9c, 10a-10b, and 11) attached to the 5' or 3' end of target sequence 024B on exon 19 skipping in the HER2 gene (also called ERBB2) in HeLa cells. The left panel of Figure 11A shows a representative example of semiquantitative fluorescent RT-PCR analysis of exon 19 skipping in the HER2 gene in HeLa cells transfected with ASOs (50 nM) containing the target sequence 024B alone (024B) or the target sequence 024B with various lengths of decoy sequences attached to the 5' end (024B-L7a to 024B-L7e, 024B-L8a to 024B-L8d, 024B-L9a to 024B-L9c, 024B-L10a to 024B-L10b, and 024B-L11). Buffer was used as a negative control. The right panel of Figure 11A shows quantification of exon 19 skipping (% excl) expressed as mean ± standard deviation (n = 3, *P < 0.05, **P < 0.01, ***P < 0.001 (all vs. 024B)) in the HER2 gene in HeLa cells transfected with the same ASOs (50 nM) tested in the left panel of Figure 11A (024B, 024B-L7a to 024B-L7e, 024B-L8a to 024B-L8d, 024B-L9a to 024B-L9c, 024B-L10a to 024B-L10b, and 024B-L11). Buffer was used as a negative control. The left panel of Figure 11B shows a representative example of semiquantitative fluorescent RT-PCR analysis of exon 19 skipping in the HER2 gene in HeLa cells transfected with ASOs (50 nM) containing the target sequence 024B alone (024B) or with decoy sequences of various lengths attached to the 3' end of the target sequence 024B (024B-R7a to 024B-R7e, 024B-R8a to 024B-R8d, 024B-R9a to 024B-R9c, 024B-R10a to 024B-R10b, and 024B-R11). Buffer was used as a negative control.The right panel of Figure 11B shows quantification of exon 19 skipping (% excl) expressed as mean ± standard deviation (n = 3, *P < 0.05, **P < 0.01 (all vs. 024B)) in the HER2 gene in HeLa cells transfected with the same ASOs (50 nM) tested in the left panel of Figure 11B (024B, 024B-R7a to 024B-R7e, 024B-R8a to 024B-R8d, 024B-R9a to 024B-R9c, 024B-R10a to 024B-R10b, and 024B-R11). Buffer was used as a negative control. [Figure 12]Figures 12A-12B show the effect of the presence, position, length, and / or sequence of various decoy sequences (7a-7e, 8a-8d, 9a-9c, 10a-10b, and 11) attached to the 5' or 3' end of target sequence 015C on exon 10 skipping in the ATXN3 gene (also called SCA3) in A549 cells. The left panel of Figure 12A shows a representative semi-quantitative fluorescent RT-PCR analysis of exon 10 skipping in the ATXN3 gene in A549 cells transfected with ASOs (40 nM) containing only the target sequence 015C (015C) or the target sequence 015C with decoy sequences of different lengths attached to the 5' end (015C-L7a to 015C-L7e, 015C-L8a to 015C-L8d, 015C-L9a to 015C-L9c, 015C-L10a to 015C-L10b, and 015C-L11). Buffer was used as a negative control. The right panel of Figure 12A shows quantification of exon 10 skipping (% excl) expressed as mean ± standard deviation (n = 3, *P < 0.05, **P < 0.01, ***P < 0.001 (all vs. 015C)) in the ATXN3 gene in A549 cells transfected with the same ASOs (40 nM) tested in the left panel of Figure 12A (015C, 015C-L7a to 015C-L7e, 015C-L8a to 015C-L8d, 015C-L9a to 015C-L9c, 015C-L10a to 015C-L10b, and 015C-L11). Buffer was used as a negative control. The left panel of Figure 12B shows a representative semi-quantitative fluorescent RT-PCR analysis of exon 10 skipping in the ATXN3 gene in A549 cells transfected with ASOs (40 nM) containing only the target sequence 015C (015C) or the target sequence 015C with decoy sequences of different lengths attached to the 3' end (015C-R7a to 015C-R7e, 015C-R8a to 015C-R8d, 015C-R9a to 015C-R9c, 015C-R10a to 015C-R10b, and 015C-R11). Buffer was used as a negative control.The right panel of Figure 12B shows quantification of exon 10 skipping (% excl) expressed as mean ± standard deviation (n = 3, *P < 0.05, **P < 0.01, ***P < 0.001 (all vs. 015C)) in the ATXN3 gene in A549 cells transfected with the same ASOs (40 nM) tested in the left panel of Figure 12B (015C, 015C-R7a to 015C-R7e, 015C-R8a to 015C-R8d, 015C-R9a to 015C-R9c, 015C-R10a to 015C-R10b, and 015C-R11). Buffer was used as a negative control. [Figure 13]Figures 13A-13B show the effect of the presence, position, length, and / or sequence of various decoy sequences (7a-7e, 8a-8d, 9a-9c, 10a-10b, and 11) attached to the 5' or 3' end of target sequence 027B on exon 10 skipping in the PKM gene in RD cells. The left panel of Figure 13A shows a representative semi-quantitative fluorescent RT-PCR analysis of exon 10 skipping in the PKM gene in RD cells transfected with ASOs (50 nM) containing only the target sequence 027B (027B) or the target sequence 027B with decoy sequences of different lengths attached to the 5' end (027B-L7a to 027B-L7e, 027B-L8a to 027B-L8d, 027B-L9a to 027B-L9c, 027B-L10a to 027B-L10b, and 027B-L11). Buffer was used as a negative control. The right panel of Figure 13A shows quantification of exon 10 skipping (% excl.) expressed as mean ± standard deviation (n = 3, **P < 0.01, ***P < 0.001 (all vs. 027B)) at the PKM gene in RD cells transfected with the same ASOs (50 nM) tested in the left panel of Figure 13A (027B, 027B-L7a to 027B-L7e, 027B-L8a to 027B-L8d, 027B-L9a to 027B-L9c, 027B-L10a to 027B-L10b, and 027B-L11). Buffer was used as a negative control. The left panel of Figure 13B shows a representative semi-quantitative fluorescent RT-PCR analysis of exon 10 skipping in the PKM gene in RD cells transfected with ASOs (50 nM) containing only the target sequence 027B (027B) or the target sequence 027B with decoy sequences of different lengths attached to the 3' end (027B-R7a to 027B-R7e, 027B-R8a to 027B-R8d, 027B-R9a to 027B-R9c, 027B-R10a to 027B-R10b, and 027B-R11). Buffer was used as a negative control.The right panel of Figure 13B shows quantification of exon 10 skipping (% excl.) expressed as mean ± standard deviation (*P < 0.05, **P < 0.01, ***P < 0.001 (all vs. 027B)) at the PKM gene in RD cells transfected with the same ASOs (50 nM) tested in the left panel of Figure 13B (027B, 027B-R7a to 027B-R7e, 027B-R8a to 027B-R8d, 027B-R9a to 027B-R9c, 027B-R10a to 027B-R10b, and 027B-R11). Buffer was used as a negative control. [Figure 14]Figures 14A-14B show the effect of the presence, position, length, and / or sequence of various decoy sequences (7a-7e, 8a-8d, 9a-9c, 10a-10b, and 11) attached to the 5' or 3' end of target sequence 029B on exon 6 skipping in the MDM4 gene in HEK293 cells. The left panel of Figure 14A shows a representative semi-quantitative fluorescent RT-PCR analysis of exon 6 skipping in the MDM4 gene in HEK293 cells transfected with ASOs (50 nM) containing only the target sequence 029B (029B) or the target sequence 029B with decoy sequences of different lengths attached to the 5' end (029B-L7a to 029B-L7e, 029B-L8a to 029B-L8d, 029B-L9a to 029B-L9c, 029B-L10a to 029B-L10b, and 029B-L11). Buffer was used as a negative control. The right panel of Figure 14A shows quantification of exon 6 skipping (% excl) expressed as mean ± standard deviation (n = 3, *P < 0.05, **P < 0.01, ***P < 0.001 (all vs. 029B)) in the MDM4 gene in HEK293 cells transfected with the same ASOs (50 nM) tested in the left panel of Figure 14A (029B, 029B-L7a to 029B-L7e, 029B-L8a to 029B-L8d, 029B-L9a to 029B-L9c, 029B-L10a to 029B-L10b, and 029B-L11). Buffer was used as a negative control. The left panel of Figure 14B shows a representative semi-quantitative fluorescent RT-PCR analysis of exon 6 skipping in the MDM4 gene in HEK293 cells transfected with ASOs (50 nM) containing only the target sequence 029B (029B) or the target sequence 029B with decoy sequences of different lengths attached to the 3' end (029B-R7a to 029B-R7e, 029B-R8a to 029B-R8d, 029B-R9a to 029B-R9c, 029B-R10a to 029B-R10b, and 029B-R11). Buffer was used as a negative control.The right panel of Figure 14B shows quantification of exon 6 skipping (% excl) expressed as mean ± standard deviation (n = 3, *P < 0.05, **P < 0.01 (all vs. 029B)) in the MDM4 gene in HEK293 cells transfected with the same ASOs (50 nM) tested in the left panel of Figure 14B (029B, 029B-R7a to 029B-R7e, 029B-R8a to 029B-R8d, 029B-R9a to 029B-R9c, 029B-R10a to 029B-R10b, and 029B-R11). Buffer was used as a negative control. DETAILED DESCRIPTION OF THE INVENTION

[0027] Exon skipping is a potential therapeutic approach for subjects with a disease and / or its complications that may benefit from manipulating the expression of a gene of interest using an ASO to induce exon skipping. ASOs may be used to generate or promote exon skipping, but screening for an ASO that provides the desired efficiency and efficacy for exon skipping can be difficult. Expression of a gene of interest can be manipulated by an ASO to inhibit splicing of exons, introns, or specific splice sites of the gene of interest, which may result in, for example, but not limited to, restoring the defective reading frame of the gene of interest, generating a different isoform of the gene of interest (e.g., a dominant-negative isoform), skipping a toxic portion of the gene, silencing the gene, and / or altering the structure and function of the gene. Manipulating the expression of a gene of interest can be beneficial for treating a disease and / or its complications, even if the gene of interest is not the cause of the disease. The disease may be a genetic or non-genetic disease (e.g., some non-genetic cancers, metabolic diseases, or infectious diseases) as disclosed herein. Genetic disorders may or may not be associated with splicing defects.

[0028] Most human genes contain introns, and introns in initial transcripts must be spliced ​​in the nucleus to generate mature mRNA, which must then be transported to the cytoplasm for protein translation by ribosomes. However, genes often undergo alternative splicing, which not only contributes to the expansion of transcript diversity but also serves as a mechanism for regulating gene function. One common form of alternative splicing is exon skipping. Exon skipping is a frequently observed natural phenomenon during gene expression and can be used as an approach to manipulate gene expression for therapeutic purposes. Depending on which exon is skipped, the outcome can vary dramatically. If the skipped exon is symmetric, i.e., if the exon length is divisible by three, the internally truncated protein isoform will only lose the amino acids encoded by the exon. If the skipped exon contains key components such as protein localization signals, motifs related to protein stability, or enzymatic active domains, the truncated protein isoform may alter its localization or stability, resulting in loss of function, a dominant-negative effect, or a protein with a different function. Exon skipping can restore gene function if the skipped exon is a poison exon, either naturally or through mutation. If the skipped exon is asymmetric, i.e., if the exon's length is not divisible by three, it disrupts the reading frame of the downstream exon, often creating a premature termination codon (PTC) in the next exon and triggering nonsense-mediated mRNA decay (NMD). For mRNA species that are out of frame but escape NMD, C-terminally truncated protein isoforms are generated, usually resulting in loss of function. In other words, exon skipping can result in the generation of mRNA isoforms or proteins with similar, opposite, or different functions, or even loss of function.(Aartsma-Rus A, van Ommen GJ. Antisense-mediated exon skipping: a versatile tool with therapeutic and research applications. RNA 2007 Oct; 13(10):1609-24. Doi: 10.1261 / rna.653607.)。

[0029] The exon skipping approach has been widely applied. First, it can be used to skip toxic portions of abnormal genes. One example of a toxic exon is exon 10 of the ATXN3 gene in SCA3 patients, which contains an abnormal expansion of an intraexonic CAG repeat. Second, exon skipping can be used to restore reading frames disrupted by frameshift mutations observed in multiple genetic disorders. One such disorder is called Duchenne muscular dystrophy. Furthermore, exon skipping can be used to disrupt the expression of harmful gene products, such as oncoproteins, viral proteins, or neurodegeneration-associated peptides. Finally, exon skipping can be used to generate beneficial protein isoforms. For example, skipping PDCD1 exon 3 generates a PD1 isoform that has the potential to act as a PDL1 / 2 antibody and treat cancer.(Toonen LJA, et al. Antisense Oligonucleotide-Mediated Removal of the Polyglutamine Repeat in Spinocerebellar Ataxia Type 3 Mice. Mol Ther Nucleic Acids. 2017 Sep; 8:232-242. doi: 10.1016 / j.omtn.2017.06.019. Lucia Echevarria L, et al. Exon-skipping advances for Duchenne muscular dystrophy. Human Molecular Genetics. 2018 Aug; 27(R2):R163-R172. doi.org / 10.1093 / hmg / ddy171. Chang JL, et al. Targeting Amyloid-β Precursor Protein, APP, Splicing with Antisense Oligonucleotides Reduces Toxic Amyloid-β Production. Mol Ther. 2018 Jun; 26(6):1539-1551. doi: 10.1016 / j.ymthe.2018.02.029. Sun J, et al. Modulation of PDCD1 exon 3 splicing. RNA Biol. 2019 Dec;16(12):1794-1805. Doi: 10.1080 / 15476286.2019.1659080.)。

[0030] As disclosed herein, without being bound by any particular theory, it has been found that ASOs comprising or consisting of decoy sequences (e.g., but not limited to, the nucleotide sequences of SEQ ID NOS: 1-23 and 347-353) attached to a target sequence can be more effective and / or efficient at generating or promoting exon skipping than ASOs comprising the target sequences disclosed herein but not including any decoy sequences. Without being bound by any particular theory, ASOs comprising the decoy sequences described herein surprisingly and unexpectedly improve the efficiency of exon skipping by the target sequence. In some embodiments, when a decoy sequence is combined with a target sequence that would otherwise be relatively inefficient at promoting exon skipping, the resulting ASO becomes highly efficient at modulating exon skipping. Alternatively, ASOs comprising or consisting of decoy sequences (e.g., nucleotide sequences of SEQ ID NOs: 1-23 and 347-353) attached to a target sequence may achieve comparable efficacy and / or efficiency in producing or promoting exon skipping at lower doses than ASOs comprising the target sequences disclosed herein but not any decoy sequences.

[0031] In some embodiments, exon skipping efficacy and / or efficiency may be quantified by the exclusion rate (%excl) of the target exon in all transcripts of each gene. In some embodiments, the exclusion rate of an ASO comprising a decoy sequence attached to a target sequence may be about 2.18-fold, about 2.3-fold, about 4-fold, about 10-fold or more, about 14-fold or more, about 15-fold or more, about 16-fold or more, or about 17-fold or more than the exclusion rate of an ASO consisting of the target sequence. In some embodiments, an ASO comprising a decoy sequence attached to a target sequence may achieve an exclusion rate equivalent to that of an ASO consisting of the target sequence (e.g., at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 110%, at least about 120%, at least about 130%, at least about 140%, or at least about 150%) at a dose of about 25% or less, or about 50% or less, of the dose of an ASO consisting of the target sequence.

[0032] In some embodiments, an optimal ASO comprises a decoy sequence (e.g., but not limited to, the nucleotide sequences of SEQ ID NOS: 1-23 and 347-353) attached to the 5' end of the target sequence. In some embodiments, an optimal ASO comprises a decoy sequence (e.g., but not limited to, the nucleotide sequences of SEQ ID NOS: 1-23 and 347-353) attached to the 3' end of the target sequence. In some embodiments, the ASO comprises decoy sequences (e.g., but not limited to, the nucleotide sequences of SEQ ID NOS: 1-23 and 347-353) attached to both the 3' and 5' ends of the target sequence. In some embodiments, the decoy sequence and target sequence are attached without a linker.

[0033] Thus, in some embodiments, provided herein are methods for generating or promoting exon skipping of an exon of interest during splicing of a pre-mRNA, comprising contacting pre-mRNA in a cell or subject with an ASO disclosed herein (e.g., a bipartite ASO), a composition (e.g., a pharmaceutical composition) comprising an ASO disclosed herein (e.g., a bipartite ASO), and / or a vector encoding an ASO disclosed herein (e.g., a bipartite ASO). ASO-mediated exon skipping may be an approach for manipulating the expression of a gene of interest. Expression of a gene of interest can be manipulated by an ASO to inhibit splicing of an exon, intron, or specific splice site of the gene of interest, which may result in, for example, but not limited to, restoring a defective reading frame of the gene of interest, generating a different isoform of the gene of interest (e.g., a dominant-negative isoform), skipping a toxic portion of the gene, silencing the gene, and / or altering the structure and function of the gene. In some embodiments, the method further comprises delivering an ASO (e.g., a bipartite ASO) disclosed herein to a cell or administering it to a subject.

[0034] Also provided herein, in certain embodiments, is a method for improving the efficacy and / or efficiency of exon skipping of a target sequence. The method comprises obtaining one or more ASOs (e.g., bipartite ASOs) comprising the target sequence and a decoy sequence (e.g., but not limited to, nucleotide sequences of SEQ ID NOS: 1-23 and 347-353) operably linked to the 5' and / or 3' ends of the target sequence. In certain embodiments, the method further comprises screening and / or optimizing the one or more ASOs (e.g., bipartite ASOs) according to the efficacy and / or efficiency of exon skipping of the target exon. The efficacy and / or efficiency of exon skipping may be quantified by the exclusion rate (%excl) of the target exon in the total transcript of each gene. The target sequence may be capable of hybridizing to a sequence selected from the group consisting of an exon of interest in a cell or subject, an adjacent intron sequence upstream of the exon of interest, an adjacent intron sequence downstream of the exon of interest, an intron-exon junction upstream of the exon of interest, and an intron-exon junction downstream of the exon of interest.

[0035] Also provided herein, in certain embodiments, are methods of treating a disease and / or complications thereof in a subject, comprising administering to the subject an ASO disclosed herein (e.g., a bipartite ASO), a pharmaceutical composition comprising an ASO disclosed herein (e.g., a bipartite ASO), and / or a vector encoding an ASO disclosed herein (e.g., a bipartite ASO).

[0036] Also provided herein are novel ASOs comprising a decoy sequence attached to a target sequence. In some embodiments, the decoy sequence is selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 1-23 and 347-353. In some embodiments, the ASOs can mediate skipping of one or more exons in genes such as the DMD gene (NCBI Gene ID: 1756), SMN1 gene (NCBI Gene ID: 6606), SMN2 gene (NCBI Gene ID: 6607), APP gene (NCBI Gene ID: 351), CEP290 gene (NCBI Gene ID: 80184), HER2 gene (NCBI Gene ID: 2064), ATXN3 gene (NCBI Gene ID: 4287), PKM gene (NCBI Gene ID: 5315), and MDM4 gene (NCBI Gene ID: 4194). This process is referred to as exon skipping. In some embodiments, the target sequence may target an exon, an intron, or a junction. In one embodiment, the exon of interest is selected from the group consisting of exon 7 of the endogenous SMN1 and SMN2 genes, exon 51 of the endogenous DMD gene, exon 53 of the endogenous DMD gene, exon 45 of the endogenous DMD gene, exon 17 of the endogenous APP gene, exon 41 of the endogenous CEP290 gene, exon 19 of the endogenous HER2 gene, exon 10 of the ATXN3 gene, exon 10 of the endogenous PKM gene, and exon 6 of the endogenous MDM4 gene. In one embodiment, the target sequence comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 25, 29, 33, 37, 41, 45, 49, 75, 92, 124, 156, 188, 220, 252, 284, and 316. In one embodiment, the ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 26-27, 30-31, 34-35, 38-39, 42-43, 46-47, 50-73, 76-90, 93-122, 125-154, 157-186, 189-218, 221-250, 253-282, 285-314, 317-346, and 354-356.In some embodiments, the target sequence is targeted to a target sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 24, 28, 32, 36, 40, 44, 48, 74, 91, 123, 155, 187, 219, 251, 283, and 315.

[0037] In some embodiments, the ASO or a composition (e.g., a pharmaceutical composition) comprising the ASO is useful for treating a disease and / or its complications treatable by skipping exons 45, 51, or 53 of the DMD gene. The ASO comprises or consists of a nucleotide sequence selected from the group consisting of nucleotide sequences set forth in SEQ ID NOs: 38-39, 42-43, 46-47, 50-73, 76-90, 93-122, and 125-154. In certain embodiments, the disease is Duchenne muscular dystrophy (DMD). DMD is caused by a frameshift mutation in the DMD gene, and exon skipping strategies using the ASO or a composition comprising the ASO disclosed herein can be employed to restore the reading frame and thus treat DMD.

[0038] In some embodiments, the ASO or a composition (e.g., a pharmaceutical composition) comprising the ASO is useful for treating a disease and / or its complications treatable by skipping exon 7 of the SMN1 / 2 gene. The ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 26-27, 30-31, 34-35, and 354-356.

[0039] In some embodiments, the ASO or a composition (e.g., a pharmaceutical composition) comprising the ASO is useful for treating a disease and / or its complications treatable by skipping exon 17 of the APP gene. The ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 157-186.

[0040] In some embodiments, the ASO or a composition (e.g., a pharmaceutical composition) comprising the ASO is useful for treating a disease and / or its complications treatable by skipping exon 41 of the CEP290 gene. The ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 189-218.

[0041] In some embodiments, the ASO or a composition (e.g., a pharmaceutical composition) comprising the ASO is useful for treating a disease and / or its complications treatable by skipping exon 19 of the HER2 gene. The ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 221-250.

[0042] In some embodiments, the ASO or a composition comprising the ASO (e.g., a pharmaceutical composition) is useful for treating a disease and / or its complications treatable by skipping exon 10 of the ATXN3 gene. The ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 253-282.

[0043] In some embodiments, the ASO or a composition comprising the ASO (e.g., a pharmaceutical composition) is useful for treating a disease and / or its complications treatable by skipping exon 10 of the PKM gene. The ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 285-314.

[0044] In some embodiments, the ASO or a composition (e.g., a pharmaceutical composition) comprising the ASO is useful for treating a disease and / or its complications treatable by skipping exon 6 of the MDM4 gene. The ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 317-346.

[0045] The following description is merely exemplary in nature and is not intended to limit the present technology, its application, or its uses. It should be understood that throughout the drawings, corresponding reference numerals indicate like or corresponding parts and features. The descriptions of specific examples shown in various embodiments of the present technology are for illustrative purposes only and are not intended to limit the scope of the present technology disclosed herein. Furthermore, the recitation of multiple embodiments having described features is not intended to exclude other embodiments having additional features or other embodiments incorporating different combinations of the described features.

[0046] Furthermore, the detailed description of various embodiments herein refers to the accompanying drawings, which illustrate various embodiments by way of example. While the embodiments have been described in sufficient detail to enable those skilled in the art to practice the present technology, it should be understood that other embodiments may be realized, and that logical and mechanical changes may be made without departing from the spirit and scope of the present technology. Accordingly, the detailed description herein is presented for illustrative purposes only, and not by way of limitation. For example, the steps or functions, any method, system, or process described herein may be performed in any order and are not limited to the order presented. Furthermore, any of the steps or functions may be outsourced to or performed by one or more third parties.

[0047] Additionally, references to the singular may include plural embodiments and references to plural elements may include singular embodiments. definition

[0048] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this technology belongs. For purposes of the present technology, the following terms are defined as follows:

[0049] The article "a" or "an" is used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or one or more elements.

[0050] The term "about" means an amount, level, value, number, frequency, percentage, dimension, size, amount, weight, or length that varies by an amount acceptable in the art. In some embodiments, such variation may be as much as 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1% of a reference amount, level, value, number, frequency, percentage, dimension, size, amount, weight, or length. When the term "about" is used in conjunction with a numerical range, the range is modified by extending the upper and lower limits of the stated numerical values.

[0051] The term "administration" includes delivering a therapeutic agent, including an ASO of the present technology, to a subject by either local or systemic administration. Administration may be topical (ophthalmic, vaginal, and rectal mucosal delivery, including nebulizer delivery), pulmonary (e.g., by inhalation or insufflation of a powder or aerosol, including by nebulizer), intratracheal, intranasal, epidermal, and transdermal, oral, or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion, or intracranial (e.g., intrathecal or intraventricular) administration.

[0052] The term "isolated" refers to a material that is substantially or essentially free from components that normally accompany it in its natural state. For example, an "isolated oligonucleotide" or "isolated oligomer" as used herein can refer to an oligomer that has been purified or removed from adjacent sequences in its naturally occurring state, e.g., a DNA fragment that has been removed from sequences adjacent to the fragment in a genome.

[0053] The term "isolation," with respect to cells, can refer to the purification of cells (e.g., fibroblasts, lymphoblasts) from a source subject (e.g., a subject with an oligonucleotide repeat disease). In the context of mRNA or proteins, "isolation" can refer to the recovery of the mRNA or protein from a source (e.g., a cell).

[0054] The term "functional" with respect to a protein includes not only the corresponding wild-type protein but also truncated forms of the wild-type protein derived from an mRNA transcript containing a sequence corresponding to the truncated transcript, lacking one or more exons but retaining sufficient biological activity to mitigate the adverse effects of the defective protein in a subject suffering from a disease and / or its complications. A functional protein may have approximately 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% (including all integers therebetween) of the in vitro or in vivo biological activity of the corresponding wild-type protein, as measured according to routine techniques in the art. A truncated protein with less than the full biological activity of the wild-type protein is sometimes referred to as a "semi-functional" protein. Animal models are also valuable resources for studying disease pathogenesis, providing a means to test disease-related activities; in some instances, less than 100% biological activity may be sufficient to treat a disease.

[0055] The term "functional" with respect to dystrophin proteins includes those proteins (also called wild-type proteins) derived from mRNA transcripts containing sequences corresponding to all exons 1 to 79 of the dystrophin gene. It also includes truncated forms of dystrophin derived from mRNA transcripts containing sequences corresponding to truncated transcripts, e.g., dystrophin mRNA transcripts having fewer than all exons 1 to 79 of the dystrophin gene, such as those produced by some current ASOs. In other words, truncated dystrophin mRNAs may exclude one or more exons of the corresponding dystrophin gene. Truncated dystrophin mRNAs may express truncated dystrophin proteins (also called microdystrophin proteins). A functional dystrophin protein generally refers to a dystrophin protein that has sufficient biological activity to alleviate the progressive deterioration of muscle tissue characteristic of Duchenne muscular dystrophy, compared to the altered or "defective" forms of dystrophin protein present in some subjects with DMD or related disorders. A functional dystrophin protein may have about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% (including all integers therebetween) of the in vitro or in vivo biological activity of wild-type dystrophin, as measured according to routine techniques in the art. Dystrophin proteins that have less than the full biological activity of wild-type dystrophin are sometimes referred to as "semi-functional" dystrophin proteins.For example, dystrophin-associated activity in in vitro muscle cultures can be measured by myotube size, myofibril organization (or disorganization), contractile activity, and spontaneous clustering of acetylcholine receptors (see, e.g., Susan C. Brown, et al. Dystrophic phenotype induced in vitro by antibody blockade of muscle α-dystroglycan-laminin interaction. 1999 Jan. Journal of Cell Science. 112:209-216. doi: 10.1242 / jcs.112.2.209). Animal models are also valuable resources for studying disease pathogenesis and provide a means to test dystrophin-associated activity. Widely used animal models for DMD research include the mdx mouse and the Golden Retriever Muscular Dystrophy (GRMD) dog, both of which are dystrophin-negative (see, e.g., CA Collins and JE Morgan. Duchenne's muscular dystrophy: animal models used to investigate pathogenesis and develop therapeutic strategies. 2003 Aug. Int J Exp Pathol. 84:165-172. doi: 10.1046 / j.1365-2613.2003.00354.x). These and other animal models can be used to measure the functional activity of various dystrophin proteins.

[0056] The terms "DMD gene" and "dystrophin gene" herein are used interchangeably herein to refer to the gene encoding dystrophin. Similarly, the terms "DMD protein," "dystrophin protein," and "dystrophin" herein are used interchangeably herein to refer to the translated protein product of the DMD gene.

[0057] "Exon skipping" generally refers to the process in which an entire exon or a portion thereof is removed from a given pre-RNA, thereby eliminating its presence in mature RNA, such as the mature mRNA that is translated into a protein. Thus, the portion of the protein encoded by the skipped exon is not present in the expressed form of the protein, typically resulting in a modified (but still functional) form of the protein. In some embodiments, the skipped exon is a variant exon of the human dystrophin gene, and its sequence may contain mutations or other modifications that cause variant splicing. The terms "pre-mRNA" and "precursor mRNA" are used interchangeably and refer to unprocessed or partially processed precursor mRNA synthesized from a DNA template in the cell nucleus by transcription.

[0058] In the context of the present technology, induction and / or promotion of exon skipping (or induction or promotion of exon skipping) as referred to herein means that said exon is absent in at least 1%, 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of the mRNA in one or more cells of a patient. The level of exon skipping can be assessed by PCR, as described in the Examples.

[0059] The terms "complementary" and "complementarity" generally refer to the interaction of two nucleotide sequences that hybridize to form a double-stranded molecule. In some embodiments, the terms "complementary" and "complementarity" refer to polynucleotides (i.e., a sequence of nucleotides) related by base-pairing rules. For example, the sequence "TGAC(5'-3')" is complementary to the sequence "GTCA(5'-3')." Complementarity can be "partial," in which only a portion of the bases of a nucleic acid match a reference or target sequence, such as a target region, according to the base-pairing rules. Alternatively, there can be "perfect," "exact," "total," or "sufficient" complementarity between nucleic acids, which has the same meaning as "fully complementary" or "fully complementary," in which all of the bases of the designated nucleic acid match according to the base-pairing rules. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands. While perfect complementarity is often desired, some embodiments can include one or more mismatches relative to the target region. Variations at any position within the oligomer are included.

[0060] The term "substantially complementary" refers to polynucleotides that have at least 70% partial complementarity, i.e., at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% of the nucleic acid bases match according to the base-pairing rules. Mismatches may be one or more base substitutions (mutations), one or more base deletions, or one or more base insertions.

[0061] The terms "antisense oligonucleotide," "antisense oligomer," "antisense compound," and "ASO" are used interchangeably and refer to an oligonucleotide comprising a target oligonucleotide sequence capable of hybridizing complementary to a target sequence within a nucleic acid (either RNA or DNA, typically RNA), such as a target region. In some embodiments, the ASO comprises a decoy sequence and a target sequence. In some embodiments, the target sequence of the ASO is fully or substantially complementary to the target region. In some embodiments, the target region is a pre-RNA sequence that is fully or partially complementary to the target sequence. The target region may be located in an exon of interest, adjacent intronic sequences upstream of the exon of interest, adjacent intronic sequences downstream of the exon of interest, an intron-exon junction upstream of the exon of interest, or an intron-exon junction downstream of the exon of interest. In some embodiments, the decoy sequence simulates an optimal 5' splice site and therefore functions as a 5' splice site decoy that prevents recognition of the adjacent authentic 5' splice site by U1 snRNA. In some embodiments, the ASO comprises one or more DNA nucleotides, one or more RNA nucleotides, and mixtures thereof. Thus, although the sequences disclosed herein are represented in DNA form, the sequences also include the corresponding RNA forms. In certain embodiments, one or more of the one or more DNA nucleotides and / or RNA nucleotides may be modified nucleotides. In some embodiments, the ASO further comprises one or more additional chemical moieties. In some embodiments, the additional chemical moieties are covalently attached to the 5' and / or 3' ends of the decoy target sequence portion. In some embodiments, the additional chemical moieties are cell-penetrating peptides.

[0062] The term "modified nucleotide" includes any chemical moiety that is structurally different from a natural nucleotide but can perform at least one function of a natural nucleotide. In some embodiments, a modified nucleotide comprises a modification in the sugar, base, and / or internucleotide linkage. In some embodiments, a modified nucleotide comprises a modified sugar, a modified nucleobase, and / or a modified internucleotide linkage. In some embodiments, a modified nucleotide can perform at least one function of a nucleotide, e.g., form a subunit in a polymer that can base pair with a nucleic acid comprising at least a complementary base sequence.

[0063] The term "moiety" refers to a specific segment or functional group of a molecule. Chemical moieties are often recognized as chemical compounds embedded in or attached to a molecule. In some embodiments, a moiety of a compound is a monovalent, divalent, or polyvalent group formed from the compound by removing one or more -H and / or its equivalents from the compound. In some embodiments, depending on the context, "moiety" can also refer to the compound or substance from which the moiety is derived.

[0064] "Exon" refers to a defined section of nucleic acid that encodes a protein, or a nucleic acid sequence that is represented in the mature form of an RNA molecule after any portion of preprocessed (or precursor) RNA has been removed by splicing. The mature RNA molecule can be messenger RNA (mRNA) or a functional form of non-coding RNA, such as rRNA or tRNA. The human dystrophin gene has approximately 79 exons.

[0065] "Intron" refers to a nucleic acid region (within a gene) that is not translated into protein. Introns are non-coding sections that are transcribed into precursor RNA (pre-RNA) and then removed by splicing during the formation of the mature RNA.

[0066] The term "in vitro" refers to events that occur within an artificial environment (e.g., a test tube or reaction vessel, cell culture) rather than within a living organism (e.g., an animal, plant, and / or microorganism).

[0067] The term "in vivo" refers to events that occur within an organism (e.g., an animal, plant, or microorganism).

[0068] The term "gene" is intended to mean a genomic gene, and also includes cDNA, precursor mRNA (ie, pre-mRNA), and mRNA.

[0069] The term "pharmaceutically acceptable salt" refers to a salt prepared from a pharmaceutically acceptable non-toxic acid or base, including inorganic acids and bases, and organic acids and bases.For example, in the case of compounds containing basic nitrogen, salts may be prepared from pharmaceutically acceptable non-toxic acids, including inorganic acids and organic acids.Suitable pharmaceutically acceptable acid addition salts for the compounds of the present technology include acetic acid, benzenesulfonic acid (besylic acid), benzoic acid, camphorsulfonic acid, citric acid, ethenesulfonic acid, fumaric acid, gluconic acid, glutamic acid, hydrobromic acid, hydrochloric acid, isethionic acid, lactic acid, maleic acid, malic acid, mandelic acid, methanesulfonic acid, mucic acid, nitric acid, pamoic acid, pantothenic acid, phosphoric acid, succinic acid, sulfuric acid, tartaric acid, p-toluenesulfonic acid, etc. When a compound contains an acidic side chain, suitable pharmaceutically acceptable base addition salts for the compounds of the present technology include metallic salts composed of aluminum, calcium, lithium, magnesium, potassium, sodium, and zinc, or organic salts composed of lysine, N,N'-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, ethylenediamine, meglumine (N-methylglucamine), and procaine.

[0070] The term "pharmaceutical composition" refers to a composition comprising a compound described herein and at least one component, including a pharmaceutically acceptable carrier, diluent, adjuvant, excipient, or vehicle, such as a preservative, filler, disintegrant, wetting agent, emulsifier, suspending agent, sweetener, flavoring agent, fragrance, antibacterial agent, antifungal agent, lubricant, dispensing agent, etc., depending on the method of administration and the nature of the dosage form.

[0071] The term "pharmaceutically acceptable carrier" as used herein refers to any carrier, diluent, adjuvant, excipient, or vehicle that is nontoxic and safe for human use. Examples of suspending agents include ethoxylated isostearyl alcohol, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, and tragacanth, or mixtures of these substances. Prevention of microbial action can be ensured by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, and sorbic acid. It may also be desirable to include isotonic agents, such as sugars and sodium chloride. Prolonged absorption of injectable dosage forms can be achieved by using agents that delay absorption, such as aluminum monostearate and gelatin. Examples of suitable carriers, diluents, solvents, or vehicles include water, ethanol, polyols, suitable mixtures thereof, vegetable oils (such as olive oil), and injectable organic esters, such as ethyl oleate. Examples of excipients include lactose, milk sugar, sodium citrate, calcium carbonate, and dicalcium phosphate. Examples of disintegrants include starch, alginic acid, and some complex silicates. Examples of lubricants include magnesium stearate, sodium lauryl sulfate, talc, and high molecular weight polyethylene glycol.

[0072] The term "pharmaceutically acceptable" means, within the scope of sound medical judgment, suitable for use in contact with the cells of humans and lower animals without undue toxicity, irritation, allergic response, etc., and commensurate with a reasonable benefit / risk ratio.

[0073] The term "immediately" as used in reference to an upstream or downstream sequence refers to a direct covalent bond between the two groups, with no intervening nucleotides.

[0074] The term "adjacent" is used to refer to nucleotide sequences that are directly attached to one another, with no intervening nucleotides. For example, a pentanucleotide 5'-AAAAAA-3' is adjacent to a trinucleotide 5'-TTT-3' when the two are linked, such as 5'-AAAAATTT-3' or 5'-TTTAAAAA-3', but not when the two are linked, such as 5'-AAAAACTTT-3'. In the latter case, a C nucleotide is said to be "intervening" between the pentanucleotide and the trinucleotide.

[0075] As used herein, the terms "therapeutically effective amount" and "effective amount" are used interchangeably and refer to an amount of a therapy (e.g., an ASO provided herein or a pharmaceutical composition thereof) sufficient to reduce and / or ameliorate the severity and / or duration of a particular disease and / or its associated symptoms. The term also includes the amount necessary to reduce or ameliorate the development or progression of a particular disease, reduce or ameliorate the recurrence, development, or onset of a particular disease, and / or improve or enhance the prophylactic or therapeutic effect of another therapy (e.g., a therapy other than an ASO provided herein).

[0076] The terms "decoy," "decoy sequence," "ASO decoy," "ASO decoy sequence," and "5' splice site decoy" are used interchangeably herein to refer to a nucleotide sequence that is fully or partially complementary to the single-stranded 5' end of U1 snRNA. In some embodiments, the decoy sequence functions as a 5' splice site decoy that simulates an optimal 5' splice site and thus prevents recognition of the adjacent authentic 5' splice site by U1 snRNA. overview

[0077] Disclosed herein, in various embodiments, are ASOs for treating diseases and / or complications thereof that can be treated by exon skipping in a gene of interest (e.g., without limitation, SMN1, SMN2, DMD, APP, CEP290, HER2, SCA3, PKM, and MDM4). In certain embodiments, the ASO (e.g., a bipartite ASO) comprises two components: 1) a "target" sequence that is fully or substantially complementary to a region of interest in the gene of interest, and 2) a "decoy" sequence located immediately upstream of the 5' end and / or immediately downstream of the 3' end of the target sequence. In some embodiments, the decoy sequence is located immediately upstream of the 5' end of the target sequence. In certain embodiments, the decoy sequence is located immediately downstream of the 3' end of the target sequence. In some embodiments, the decoy sequence has low sequence complementarity, such as less than about 80%, to the corresponding adjacent sequence immediately adjacent to the 5' or 3' end of the region of interest in the target nucleic acid (e.g., mRNA).

[0078] In some embodiments, the ASO (eg, a bipartite ASO) further comprises a linker between the decoy sequence and the target sequence.

[0079] In some embodiments, the ASOs (e.g., bipartite ASOs) of the present technology can bind to the transcript (e.g., pre-mRNA) of a gene of interest (e.g., SMN1, SMN2, DMD, APP, CEP290, HER2, SCA3, PKM, and MDM4) and alter the splicing pattern of the transcript by inducing skipping of one or more exons. In some embodiments, the ASOs (e.g., bipartite ASOs) of the present technology cause skipping of one or more exons in the mRNA, and the exon skipping rate (% excl) is increased by about 10% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, and about 90% or more. The exon skipping rate can be measured using techniques known in the art and are described throughout this application, for example, in the "Assays" section below.

[0080] The presence of a decoy sequence in a bipartite ASO may increase the rate of exon skipping by the target sequence, and in some embodiments, the presence of a decoy sequence in a bipartite ASO may increase the rate of exon skipping by the target sequence by at least about two-fold compared to an ASO with the same target sequence but without the decoy sequence. In some embodiments, the presence of a decoy sequence in a bipartite ASO increases the rate of exon skipping of the target sequence by about 2-fold or more, about 2.18-fold or more, about 2.3-fold or more, about 3-fold or more, about 4-fold or more, about 5-fold or more, about 6-fold or more, about 7-fold or more, about 8-fold or more, about 9-fold or more, about 10-fold or more, about 11-fold or more, about 12-fold or more, about 13-fold or more, about 14-fold or more, about 15-fold or more, about 16-fold or more, about 17-fold or more, about 18-fold or more, about 19-fold or more, about 20-fold or more, about 25-fold or more, about 30-fold or more, about 40-fold or more, about 50-fold or more, about 60-fold or more, about 70-fold or more, about 100-fold or more, about 80-fold or more, about 90-fold or more, about 100-fold or more, or more (including all values ​​and ranges therebetween) compared to an ASO having the same target sequence but without the decoy sequence. In certain embodiments, ASOs comprising or consisting of decoy sequences (e.g., nucleotide sequences of SEQ ID NOs: 1-23 and 347-353) attached to a target sequence may achieve comparable efficacy and / or efficiency in producing or promoting exon skipping at lower doses than ASOs comprising a target sequence disclosed herein but not including any decoy sequence.

[0081] In some embodiments, provided herein are compositions comprising an ASO (e.g., a bipartite ASO) disclosed herein and a pharmaceutically acceptable carrier. In some embodiments, the composition is a pharmaceutical formulation or composition.

[0082] Provided herein, in certain embodiments, are vectors encoding the ASOs (e.g., bipartite ASOs) disclosed herein.

[0083] Provided herein, in some embodiments, are methods for generating or promoting exon skipping of an exon of interest during splicing of a pre-mRNA, comprising contacting pre-mRNA in a cell or subject with an ASO disclosed herein (e.g., a bipartite ASO), a composition (e.g., a pharmaceutical composition) comprising an ASO disclosed herein (e.g., a bipartite ASO), and / or a vector encoding an ASO disclosed herein (e.g., a bipartite ASO). ASO-mediated exon skipping may be an approach for manipulating the expression of a gene of interest. Expression of a gene of interest can be manipulated by an ASO to inhibit splicing of an exon, intron, or specific splice site of the gene of interest, which may result, for example, but not limited to, restoring a defective reading frame of the gene of interest, generating a different isoform of the gene of interest (e.g., a dominant-negative isoform), skipping a toxic portion of the gene, silencing the gene, and / or altering the structure and function of the gene.

[0084] Provided herein, in certain embodiments, is a method for improving the efficacy and / or efficiency of exon skipping of a target sequence, the method comprising obtaining one or more ASOs (e.g., bipartite ASOs) comprising the target sequence and a decoy sequence disclosed herein operably linked to the 5' and / or 3' end of the target sequence. In certain embodiments, a plurality of ASOs (e.g., bipartite ASOs) are provided for screening and optimization, and one or more ASOs (e.g., bipartite ASOs) with improved exon skipping rates may be provided by a method that further comprises, for example, but not limited to, screening and / or optimizing one or more ASOs (e.g., bipartite ASOs) according to their exon skipping efficacy and / or efficiency of a target exon.

[0085] Also provided herein, in certain embodiments, is a method for treating a disease and / or its complications in a subject, comprising administering to the subject an ASO (e.g., a bipartite ASO), a composition (e.g., a pharmaceutical composition) comprising an ASO (e.g., a bipartite ASO) disclosed herein, and / or a vector encoding an ASO (e.g., a bipartite ASO). The ASO (e.g., a bipartite ASO) may generate or promote exon skipping of an exon of interest during pre-mRNA splicing. ASO-mediated exon skipping may be an approach for manipulating the expression of a gene of interest. Expression of a gene of interest can be manipulated by an ASO to inhibit splicing of an exon, intron, or specific splice site of the gene of interest, which may result in, for example, but not limited to, restoring a defective reading frame of the gene of interest, generating a different isoform (e.g., a dominant-negative isoform) of the gene of interest, skipping a toxic portion of the gene, silencing the gene, and / or altering the structure and function of the gene. Manipulation of the expression of a gene of interest may be beneficial in treating a disease and / or its complications, even if the gene of interest may or may not be the cause of the disease. The disease may be a genetic or non-genetic disease (e.g., some non-genetic cancers, metabolic diseases, or infectious diseases) as disclosed herein. The genetic disease may or may not be associated with a mutation related to a splicing defect.

[0086] Also provided herein, in certain embodiments, are ASOs (e.g., bipartite ASOs) disclosed herein, compositions (e.g., pharmaceutical compositions) comprising ASOs (e.g., bipartite ASOs) disclosed herein, and / or kits comprising vectors encoding ASOs (e.g., bipartite ASOs) disclosed herein for use in generating or promoting exon skipping of an exon of interest. ASO-mediated exon skipping can be an approach for manipulating the expression of a gene of interest. Expression of a gene of interest can be manipulated by an ASO to inhibit splicing of an exon, intron, or specific splice site of the gene of interest, which can lead to, for example, but not limited to, restoring a defective reading frame of the gene of interest, generating a different isoform of the gene of interest (e.g., a dominant-negative isoform), skipping a toxic portion of the gene, silencing the gene, and / or altering the structure and function of the gene. Examples of genes of interest and diseases potentially treatable with exon skipping Dystrophin and Duchenne muscular dystrophy

[0087] Duchenne muscular dystrophy (DMD) is an X-linked progressive muscle wasting disease caused by mutations in the DMD gene that abolish the production of the dystrophin protein. Dystrophin is a rod-shaped cytoplasmic protein and is an essential part of a protein complex that connects the cytoskeleton of muscle fibers to the surrounding extracellular matrix through the cell membrane. Dystrophin contains multiple functional domains. For example, dystrophin contains an actin-binding domain at amino acids 14–240 and a central rod-shaped domain at amino acids 253–3040. This large central domain is formed by 24 spectrin-like triple-helical elements of approximately 109 amino acids, which are homologous to α-actinin and spectrin. The repeats are typically interrupted by four proline-rich non-repeat segments, also known as hinge regions. Repeats 15 and 16 are separated by an 18-amino acid stretch that appears to provide the primary site for proteolytic cleavage of dystrophin. The sequence identity between most repeats ranges from 10–25%. Each repeat contains three alpha helices (1, 2, and 3). Alpha helices 1 and 3 each consist of seven helical turns, which interact as a coiled coil, presumably via a hydrophobic interface. Alpha helix 2 is a more complex structure, consisting of segments of four or three helical turns separated by glycine or proline residues. Each repeat is encoded by two exons, usually interrupted by an intron located between amino acids 47 and 48 in the first part of alpha helix 2. Another intron is found elsewhere in the repeat, usually interspersed within helix 3. Dystrophin also contains a cysteine-rich domain between amino acids 3080 and 3360, which contains a cysteine-rich segment (i.e., 15 cysteines in 280 amino acids) that shows homology to the C-terminal domain of alpha actinin from Dictyostelium discoideum (Dictyostelium discoideum). The carboxy-terminal domain is located between amino acids 3361 and 3685. The amino terminus of dystrophin binds to F-actin, and its carboxy terminus binds to the dystrophin-associated protein complex (DAPC) at the sarcolemma.The DAPC contains dystroglycan, sarcoglycan, integrins, and caveolin, and mutations in any of these components cause autosomal inherited muscular dystrophies. Absence of dystrophin destabilizes the DAPC, resulting in reduced levels of its member proteins and progressive fiber damage and membrane leakage. In various forms of muscular dystrophies, such as Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD), muscle cells produce altered, functionally defective dystrophin or no dystrophin at all, primarily due to mutations within the gene sequence leading to incorrect splicing. Predominant expression of defective dystrophin protein or the complete absence of dystrophin or dystrophin-like proteins leads to the rapid progression of muscle degeneration, as described above. In this regard, "defective" dystrophin protein may be characterized by the form of dystrophin produced in some subjects with DMD or BMD, or by the absence of detectable dystrophin, as known in the art.

[0088] Over 7,000 different mutations have been reported in DMD patients. Most patients (approximately 65%) harbor large deletions involving one or more exons, but large duplications (approximately 12%) and small mutations (20%) are also frequently reported. A common thread among these mutations is that they all result in nonfunctional dystrophin. For example, deletions of exon 45 are one of the most common deletions found in DMD patients, while deletions of exons 44 and 45 are commonly associated with BMD. Therefore, bypassing exon 44 in the pre-messenger RNA (mRNA) transcripts of these DMD patients would restore the reading frame and allow the production of partially functional BMD-like dystrophin. In fact, many patients with deletions bordering exon 44 appear to spontaneously skip exon 44, albeit at very low levels. This results in slightly increased dystrophin levels compared with DMD patients with other deletions, most likely accounting for the milder disease progression observed in these patients compared with DMD patients with other deletions. Exon skipping for the treatment of DMD

[0089] Antisense-mediated exon skipping can be used to induce skipping of one or more targeted exons and restore the defective reading frame. Mutations in the dystrophin gene are amenable to therapeutic exon skipping. For example, mutations in exons (e.g., 45-50, 47-50, 48-50, 49-50, 50, 52, and 52-63) are amenable to exon 51 skipping (Leiden Duchenne Muscular Dystrophy Mutation Database, Leiden University Medical Center, The Netherlands). It is possible to determine whether a patient has a mutation in the DMD gene that is amenable to exon skipping (see, e.g., Aartsma-Rus, et al. Theoretic applicability of antisense-mediated exon skipping for Duchenne muscular dystrophy mutations. 2009 Feb 24. Hum Mut. 30:293-299. doi: 10.1002 / humu.20918; Stephen Abbs, et al. Best Practice Guidelines on molecular diagnostics in Duchenne / Becker muscular dystrophies. 2010 Jun. Neuromusc Disorders. 20:422-427. doi: 10.1016 / j.nmd.2010.04.005, the disclosures of each of which are incorporated herein by reference in their entireties). To develop an exon-skipping approach for patients with specific defects in the DMD gene, it is necessary to develop ASOs with target sequences that target additional exons in the gene. For example, ASOs can be developed that skip exon 51, which is defective in 13%–14% of DMD patients.

[0090] The relevant physiological or cellular responses to the treatments involved in this technology (in vivo or in vitro) will be apparent to those skilled in the art and may include alleviation of symptoms or conditions of Duchenne muscular dystrophy (DMD) and related diseases, such as Becker muscular dystrophy (BMD), limb-girdle muscular dystrophy, congenital muscular dystrophy, facioscapulohumeral muscular dystrophy, myotonic muscular dystrophy, oculopharyngeal muscular dystrophy, distal muscular dystrophy, Emery-Dreifuss muscular dystrophy, muscle-wasting conditions or disorders, such as AIDS-, cancer-, or chemotherapy-related muscle wasting, and fibrosis or fibrosis-related disorders (e.g., skeletal muscle fibrosis). An "increase" in response may be "statistically significant" when compared to the response produced by a subject in need thereof without administration of the ASO compound and / or therapeutic agent (e.g., when compared to the "native" or "natural" expression rate for a particular subject or cohort), or when compared to a control compound.

[0091] In some embodiments, in DMD patients, the DMD allele contains a mutation in an exon, and the disorder can be treated by skipping one or more exons in the DMD gene transcript. In some embodiments, in DMD patients, the DMD allele or DMD transcript has a mutation in an exon, and the mutation is a missense or nonsense mutation, a deletion, an insertion, an inversion, a translocation, or a duplication. In some embodiments, in the treatment of muscular dystrophy, one or more exons in the DMD transcript are skipped, and the exons encode a string of amino acids that is not essential for DMD protein function, or the skipping results in a fully or at least partially functional DMD protein. Here, DMD protein refers to dystrophin. In some embodiments, in the treatment of muscular dystrophy, the ASO can mediate skipping of DMD exons 51 or 53, thereby creating an mRNA that can be translated into an artificially internally truncated DMD protein variant that provides at least partially improved or fully restored biological activity (e.g., a functional DMD protein variant). In some embodiments, internally truncated DMD protein variants produced from dystrophin DMD transcripts in which one or more exons have been skipped are more functional than truncated DMD proteins produced, for example, from dystrophin DMD transcripts with out-of-frame deletions. In some embodiments, internally truncated DMD protein variants produced from dystrophin DMD transcripts in which one or more exons have been skipped are more resistant to nonsense-mediated degradation, which can degrade truncated DMD proteins produced, for example, from dystrophin DMD transcripts with out-of-frame deletions. In some embodiments, restoring the reading frame can convert an out-of-frame mutation to an in-frame mutation, and in some embodiments, such a change can convert severe Duchenne muscular dystrophy to the milder Becker muscular dystrophy in humans.

[0092] The methods of the present technology may alleviate one or more characteristics of myogenic or muscle cells in patients with or have deletions in the DMD gene, which occur in 68% of all DMD patients, including, but not limited to, exons 44, 44-46, 44-47, 44-48, 44-49, 44-51, 44-53 (which can be corrected by exon 43 skipping), 19-45, 21-45, 43-45, 45, 47-54, 47-56 (which can be corrected by exon 46 skipping), 51, 51-53, 51-55, 51-57 (which can be corrected by exon 50 skipping), 13-50, 19- It may alleviate one or more symptoms in patients with DMD with deletions involving exons 50, 29–50, 43–50, 45–50, 47–50, 48–50, 49–50, 50, and 52 (which can be corrected by exon 51 skipping), exons 8–51, 51, 53, 53–55, 53–57, 53–59, and 53–60 (which can be corrected by exon 52 skipping), and exons 10–52, 42–52, 43–52, 45–52, 47–52, 48–52, 49–52, 50–52, and 52 (which can be corrected by exon 53 skipping) (Aartsma-Rus, (Eds. et al. Theoretic applicability of antisense-mediated exon skipping for Duchenne muscular dystrophy mutations. 2009 Feb 24. Hum Mut. 30:293-299. Doi: 10.1002 / humu.20918). See U.S. Patent No. 9,499,818, the entire contents of which are incorporated herein by reference. The SMN gene and spinal muscular atrophy

[0093] The SMN1 and SMN2 genes are associated with a disease called spinal muscular atrophy (SMA). Both genes encode the same protein (remnant of motor neurons, or SMN). One difference between the two genes is that SMN2 differs by a C to T transition in exon 7, which causes the net skipping of this exon, such that SMN2 expresses only low levels of functional protein. Additional genes of interest and related diseases that may be treatable by exon skipping

[0094] Examples of additional target genes include, but are not limited to, the APP gene, CEP290 gene, HER2 gene, PKM gene, and MDM4 gene. The APP gene is associated with Alzheimer's disease, and the CEP290 gene is associated with Joubert syndrome. ASOs that promote exon 19 of the HER2 gene, exon 10 of the PKM gene, or exon 6 of the MDM4 gene have the potential to treat various types of cancer, including breast cancer, HER2-positive biliary tract cancer, colorectal cancer, non-small cell lung cancer, bladder cancer, prostate cancer, lung cancer, cervical cancer, kidney cancer, papillary thyroid cancer, colon cancer, colorectal cancer, glioma, ovarian cancer, gastric cancer, hepatoblastoma, fibrolamellar carcinoma, hepatocellular carcinoma, soft tissue sarcoma, osteosarcoma, chronic lymphocytic leukemia, acute myeloid leukemia, mantle cell lymphoma, pediatric Burkitt's lymphoma, salivary gland cancer, liver cancer, and melanoma. (For example, Do-Youn Oh and Yung-Jue Bang. HER2-targeted therapies - a role beyond breast cancer. 2019 Sep 23. Nat. Rev. Clin. Oncol. 17:33-48. Doi: 10.1038 / s41571-019-0268-3; K. Zahra, et al. Pyruvate kinase M2 and cancer: the role of PKM2 in promoting tumorigenesis. 2020 Mar 2. Front. Oncol. 10:159. Doi: 10.3389 / fonc.2020.00159; and D. Yu, et al. Targeting MDMX for cancer therapy: rationale, strategies, and challenges. 2020 Aug 5. Front. Oncol. 10:1389. Doi: 10.3389 / fonc.2020.01389) Bipartite ASO for regulating pre-mRNA splicing by exon skipping

[0095] In some aspects, the present technology provides methods for generating or promoting exon skipping of an exon of interest during pre-mRNA splicing, comprising contacting pre-mRNA in a cell or subject with an ASO (e.g., a bipartite ASO) disclosed herein, a composition (e.g., a pharmaceutical composition) comprising an ASO (e.g., a bipartite ASO) disclosed herein, and / or a vector encoding an ASO (e.g., a bipartite ASO). In some embodiments, the method further comprises delivering an ASO (e.g., a bipartite ASO) disclosed herein to a cell or administering it to a subject. ASO-mediated exon skipping may be an approach for manipulating the expression of a gene of interest. Expression of a gene of interest can be manipulated by ASOs to inhibit splicing of exons, introns, or specific splice sites of the gene of interest, which can result in, for example, but not limited to, restoring a defective reading frame of the gene of interest, generating different isoforms of the gene of interest (e.g., dominant-negative isoforms), skipping toxic portions of the gene, silencing the gene, and / or altering the structure and function of the gene.

[0096] In some embodiments, the present technology provides for the use of an ASO (e.g., a bipartite ASO) disclosed herein, a composition (e.g., a pharmaceutical composition) comprising an ASO (e.g., a bipartite ASO), and / or a vector encoding an ASO (e.g., a bipartite ASO) disclosed herein to generate or promote exon skipping of an exon of interest. ASO-mediated exon skipping may be an approach for manipulating the expression of a gene of interest. Expression of a gene of interest can be manipulated by an ASO to inhibit splicing of an exon, intron, or specific splice site of the gene of interest, which may result in, for example, but not limited to, restoring a defective reading frame of the gene of interest, generating a different isoform (e.g., a dominant-negative isoform) of the gene of interest, skipping a toxic portion of the gene, silencing the gene, and / or altering the structure and function of the gene.

[0097] In some embodiments, the technology provides an ASO (e.g., a bipartite ASO) disclosed herein, a composition (e.g., a pharmaceutical composition) comprising an ASO (e.g., a bipartite ASO), and / or a vector encoding an ASO (e.g., a bipartite ASO) disclosed herein for use in generating or promoting exon skipping of an exon of interest. ASO-mediated exon skipping may be an approach for manipulating the expression of a gene of interest. Expression of a gene of interest can be manipulated by an ASO to inhibit splicing of an exon, intron, or specific splice site of the gene of interest, which may result in, for example, but not limited to, restoring a defective reading frame of the gene of interest, generating a different isoform of the gene of interest (e.g., a dominant-negative isoform), skipping a toxic portion of the gene, silencing the gene, and / or altering the structure and function of the gene.

[0098] ASOs contain target sequences, which are single-stranded oligonucleotides that are specific to and substantially complementary to the desired splicing sequence, and thus can hydrogen bond to that sequence.Those skilled in the art can easily design target sequences for ASOs to be specific to appropriate target regions, many of which are well known in the art.For example, those skilled in the art can obtain pre-mRNA sequences containing appropriate splicing sequences from publications or annotated public databases (such as the GenBank database operated by NCBI).A large number of target sequences have been incorporated into the design of ASOs to enhance exon skipping, and some are currently in preclinical or clinical trials.Any of these target sequences are suitable for use in the method of the present technology.

[0099] ASOs can be used to modulate exon skipping by blocking (hiding) specific sequence motifs (sometimes referred to here as "splice sequences") within pre-mRNA that are essential for exon inclusion from the splicing machinery. ASOs that block aberrant splice sites can restore normal splicing. Alternatively, ASOs that target some splice sequences can switch the splicing pattern from a harmful to a beneficial isoform or convert a nonfunctional mRNA into an at least partially functional one. The latter approach involves restoring a disrupted reading frame, thereby generating a semi-functional protein instead of a nonfunctional one.

[0100] The ASOs (e.g., bipartite ASOs) of the present technology can be used to block splicing at a target site by specifically interacting with (e.g., binding to) the splicing sequence at that site, either directly or indirectly. The term "splice sequence" refers to a sequence that regulates and / or is required for the splicing out of a specific intron and / or the retention of a specific exon. The splice sequence can be, for example, a splice donor site (5' splice site), a splice acceptor site (3' splice site), a branch site, an intron splicing enhancer (ISE), an exon splicing enhancer (ESE), an intron splicing silencer (ISS), or an exon splicing silencer (ESS).

[0101] The ASOs used in the methods of the present technology (e.g., bipartite ASOs) can directly and specifically bind to a target region, i.e., a target splicing sequence of interest. "Specific binding" means that the ASO preferentially binds to the target region but not to non-target sequences under conditions where specific binding is desired. These conditions may be, for example, physiological conditions in the case of in vivo assays or therapeutic treatments, or the conditions under which the assay is performed in the case of in vitro assays. The mechanism by which small molecule compounds of the present technology block splicing (e.g., enhance exon skipping) is not clear for all compounds, so it is unclear whether the compound binds directly to the splice site or acts indirectly (e.g., by binding to another RNA or protein component of the spliceosome). Regardless of the mechanism, a compound of the present technology that "specifically" inhibits a splicing event of interest is a compound that preferentially blocks a particular splicing event but does not inhibit non-target splicing events under conditions where specific inhibition is desired.

[0102] The ASOs (e.g., bipartite ASOs) disclosed herein may have a variety of different backbone chemical modifications, such as morpholinophosphorodiamidate (PMO), 2'-O-methyl, 2'-O-methoxyethyl (MOE), phosphorothioate (PS), 2'-fluororibose (2'-F), 4'-thioribosyl ribose, locked nucleic acid oligos (LNA), and / or constrained ethyl oligos (cEt), or peptide nucleic acids, which may improve the stability of the ASO. For example, the ASOs may be DNA, RNA, PNA, LNA, or chimeric mixtures, derivatives, or modified versions thereof. Nucleic acids can be modified at the base moiety, sugar moiety, or phosphate backbone using conventional procedures and modifications. Base modifications include, for example, methylation of purines or pyrimidines. Modifications may also include other additional groups apparent to the skilled artisan. Examples of oligonucleotide modifications are described throughout this application, for example, in the "Oligonucleotide Modifications" section below.

[0103] The ASOs (e.g., bipartite ASOs) disclosed herein can be constructed using chemical synthesis procedures known in the art. ASOs can be chemically synthesized using naturally occurring nucleotides or various modified nucleotides designed to increase the biological stability of the molecule or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids; for example, phosphorothioate derivatives and acridine-substituted nucleotides can be used.

[0104] Alternatively, ASOs can be produced biologically using an expression vector into which a nucleic acid has been subcloned in the antisense orientation (i.e., the nucleic acid transcribed from the inserted nucleic acid is in the antisense orientation relative to the target region). An expression control sequence (e.g., a regulatory sequence) operably linked to the nucleic acid cloned in the antisense orientation can be selected to direct the expression of the antisense RNA molecule in the cells of interest. For example, a promoter and / or enhancer or other regulatory sequence can be selected that directs constitutive, tissue-specific, or inducible expression of the ASO. For example, inducible expression of the antisense RNA regulated by an inducible eukaryotic regulatory system can be used. Antisense expression vectors can take the form of, for example, a recombinant plasmid, phagemid, or attenuated virus. Suitable viral vectors include, for example, adeno-associated virus (AAV) or lentiviral vectors. Antisense expression vectors can be introduced into cells using standard techniques well known in the art.

[0105] The length of the target sequence in ASO can be varied as long as it can selectively bind to the intended splicing sequence in pre-mRNA molecules.A skilled artisan can easily determine a satisfactory length.Generally, the length of the target sequence of ASO is about 10nt to about 80nt.Any length of nucleotides within this range, including the end point, can be used in the method of the present technology.

[0106] In some embodiments of this technology, the target sequence of the ASO contains a strand that is completely (100%) complementary to the splicing sequence it is designed to inhibit. That is, every consecutive nucleotide in the target sequence hybridizes with every nucleotide in the splicing sequence in the target gene. However, 100% sequence identity between the target sequence and the target region is not required. Therefore, this technology has the advantage of being tolerant of naturally occurring sequence variations that may be expected due to genetic mutation, strain polymorphism, or evolutionary divergence. Alternatively, mutants may be artificially generated. For example, nucleic acid sequences with small insertions, deletions, and single-point mutations relative to the target region may be effective for inhibition. The degree of sequence identity may be, for example, 90%, 95%, 98%, 99%, or 100%. Such mutant ASOs must, of course, retain the relevant activity of the ASO from which they are derived (e.g., the ability to inhibit splicing at the target site). Such mutants are sometimes referred to herein as "active mutants."

[0107] For further guidance on designing suitable antisense molecules that are complementary to regions of pre-mRNA involved in splicing (thereby blocking splicing), and methods for making and delivering such molecules to cells or subjects, see, e.g., US2008 / 0200409 or U.S. Patent Nos. 7,973,015, 7,960,541, 7,902,160, 7,888,012, 7,879,992, or 7,737,110. Examples of oligonucleotides for modulating dystrophin gene splicing

[0108] In September 2016, the US Food and Drug Administration (FDA) conditionally approved eteplirsen (Exondys 51), the first DMD antisense drug developed to exclude exon 51 from mutant DMD. Eteplirsen is an oligonucleotide modified with phosphorodiamidate morpholino oligomers (morpholinos or PMOs). However, eteplirsen remains controversial due to weak evidence supporting its efficacy in both restoring dystrophin protein to therapeutically beneficial levels and improving clinical outcomes. The FDA previously rejected another drug candidate for DMD exon 51 skipping, the 2′-O-methyl phosphorothioate oligonucleotide Drisapersen. While treatment must maximize possible benefits while minimizing risks, Drisapersen treatment failed to demonstrate significant improvements in muscle function, raising safety concerns about its use. Bipartite antisense oligonucleotides (bipartite ASOs)

[0109] In some embodiments, the present technology provides bipartite ASOs comprising: 1) a "target" sequence that is fully or substantially complementary to a region of interest within a target nucleic acid (e.g., a pre-mRNA of a gene of interest); and 2) a "decoy" sequence operably linked to and located at the 5' and / or 3' end of the target sequence. The decoy sequence may function as a 5' splice site decoy that simulates an optimal 5' splice site and thus prevents recognition of the adjacent authentic 5' splice site by U1 snRNA. As discussed herein, the presence of the decoy sequence may increase the efficiency of splicing regulation at the region of interest by the target sequence.

[0110] In various embodiments, the bipartite ASO of the present technology comprises: 1) a "target" sequence that is fully or substantially complementary to a region of interest within a target nucleic acid (e.g., a pre-mRNA of a gene of interest); and 2) a "decoy" sequence located immediately upstream of the 5' end and / or immediately downstream of the 3' end of the target sequence (i.e., the decoy sequence is located in a flanking region of the target sequence). In some embodiments, the decoy sequence is directly linked to the target sequence without any intervening nucleotides between the decoy sequence and the target sequence. In some embodiments, the decoy sequence is located immediately upstream of the 5' end of the target sequence (see FIG. 1A). In another embodiment, the decoy sequence is located immediately downstream of the 3' end of the target sequence.

[0111] When both the 5'-end and 3'-end of the target sequence are linked with decoy sequences, the decoy sequences linked to each end can be the same or different, and the linking method can be the same or different.For example, both decoy sequences can be linked to the target sequence without a linker, or one decoy sequence can be linked without a linker and the other decoy sequence can be linked with a linker.Alternatively, both decoy sequences can be linked to the target sequence with a linker, and the linkers can be the same or different.In some embodiments, the linker can have 1, 2, 3, 4, or 5 nucleotides.

[0112] In some embodiments, ASOs containing the same target sequence may have different exon skipping effects and / or efficiencies depending on the presence of a decoy sequence (e.g., the presence or absence of a decoy sequence), the length of the decoy sequence, the order of the decoy sequence, and / or the position of the decoy sequence (e.g., the 5' end and / or the 3' end of the target sequence). In certain embodiments, exon skipping effects and / or efficiencies may be quantified by the exclusion rate (%excl) of the exon of interest in the total transcript of each gene. In certain embodiments, the improvement, as quantified by an increase in clearance rate, may be at least about 2-fold, at least about 2.18-fold, at least about 2.3-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11-fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, at least about 15-fold, at least about 16-fold, at least about 17-fold, at least about 18-fold, at least about 19-fold, at least about 20-fold, at least about 25-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 60-fold, at least about 70-fold, at least about 80-fold, at least about 90-fold, or at least about 100-fold (including all values ​​and ranges therebetween) over the improvement of an ASO consisting of the target sequence.

[0113] In some embodiments, bipartite ASOs comprising or consisting of a decoy sequence attached to a target sequence (e.g., but not limited to, the nucleotide sequences of SEQ ID NOS: 1-23 and 347-353) may achieve comparable efficacy and / or efficiency in generating or promoting exon skipping at lower doses than ASOs consisting of a target sequence. In some embodiments, ASOs comprising a decoy sequence attached to a target sequence may achieve comparable exon skipping rates (e.g., at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 110%, at least about 120%, at least about 130%, at least about 140%, or at least about 150%) to ASOs consisting of a target sequence at doses that are about 10% or less, about 25% or less, about 40% or less, or about 50% or less of the dose of the ASO consisting of the target sequence.

[0114] In certain embodiments of bipartite ASOs containing the same target sequence and decoy sequence, the bipartite ASO with the decoy sequence at the 5' end of the target sequence may have a higher exon skipping efficacy and / or efficiency than the bipartite ASO with the decoy sequence at the 3' end of the target sequence. In some examples, both bipartite ASOs containing decoy sequences have a higher exon skipping efficacy and / or efficiency than ASOs consisting of the same target sequence.

[0115] In certain embodiments of bipartite ASOs containing the same target sequence and decoy sequence, the bipartite ASO with the decoy sequence at the 5' end of the target sequence may have a lower exon skipping efficacy and / or efficiency than the bipartite ASO with the decoy sequence at the 3' end of the target sequence. In some examples, both bipartite ASOs containing decoy sequences have a higher exon skipping efficacy and / or efficiency than ASOs consisting of the same target sequence.

[0116] In certain embodiments of ASOs that contain the same target and decoy sequences, an ASO with a decoy sequence at the 5' end of the target sequence is equivalent to an ASO with a decoy sequence at the 3' end of the target sequence.

[0117] In some embodiments, the bipartite ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 26-27, 30-31, 34-35, 38-39, 42-43, 46-47, 50-73, 76-90, 93-122, 125-154, 157-186, 189-218, 221-250, 253-282, 285-314, 317-346, and 354-356. In some embodiments, the bipartite ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 26, 30, 31, 34, 38, 42, 46, 50, 51, 60, 64, 65, 68, 70, 78, 83, 85, 86, 87, 88, 89, 103, 109, 110, 114, 115, 116, 127, 132, 144, 164, 189, 205, 213, 216, 228, 260, 276, 292, 294, 297, 298, 312, 320, 324, 327, 328, 332, and 354.

[0118] In some embodiments, the gene of interest is the SMN1 and / or SMN2 gene, and the ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 26-27, 30-31, 34-35, and 354-356. In certain embodiments, the ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 26, 30, 31, 34, and 354. In certain embodiments, the exon of interest is exon 7 of the SMN1 and / or SMN2 gene.

[0119] In some embodiments, the gene of interest is the DMD gene and the ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 38-39, 42-43, 46-47, 50-73, 76-90, 93-122, and 125-154. In certain embodiments, an optimal ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 38, 42, 46, 50, 51, 60, 64, 65, 68, 70, 78, 83, 85, 86, 87, 88, 89, 103, 109, 110, 114, 115, 116, 127, 132, and 144.

[0120] In one embodiment, the exon of interest is exon 51 of the DMD gene, and the ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 38-39, 42-43, 46-47, 50-73, and 76-90. In one embodiment, an optimal ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 38, 42, 46, 50, 51, 60, 64, 65, 68, 70, 78, 83, 85, 86, 87, 88, and 89.

[0121] In one embodiment, the exon of interest is exon 53 of the DMD gene, and the ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 93 to 122. In one embodiment, the optimal ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 103, 109, 110, 114, 115, and 116.

[0122] In one embodiment, the exon of interest is exon 45 of the DMD gene, and the ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 125 to 154. In one embodiment, the optimal ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 127, 132, and 144.

[0123] In some embodiments, the gene of interest is the APP gene and the ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 157-186. In certain embodiments, the optimal ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequence of SEQ ID NO: 164. In certain embodiments, the exon of interest is exon 17 of the APP gene.

[0124] In some embodiments, the gene of interest is the CEP290 gene and the ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 189-218. In certain embodiments, the optimal ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 189, 205, 213, and 216. In certain embodiments, the exon of interest is exon 41 of the CEP290 gene.

[0125] In some embodiments, the gene of interest is the HER2 gene and the ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 221-250. In certain embodiments, the optimal ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequence of SEQ ID NO: 228. In certain embodiments, the exon of interest is exon 19 of the HER2 gene.

[0126] In some embodiments, the gene of interest is the ATXN3 gene and the ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 253-282. In certain embodiments, the optimal ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 260 and 276. In certain embodiments, the exon of interest is exon 10 of the ATXN3 gene.

[0127] In some embodiments, the gene of interest is the PKM gene and the ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 285-314. In certain embodiments, the optimal ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 292, 294, 297, 298, and 312. In certain embodiments, the exon of interest is exon 10 of the PKM gene.

[0128] In some embodiments, the gene of interest is the MDM4 gene and the ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 317-346. In certain embodiments, the optimal ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 320, 324, 327, 328, and 332. In certain embodiments, the exon of interest is exon 6 of the MDM4 gene. Decoy sequence

[0129] In some embodiments, the decoy sequence comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 347, 348, 349, 350, 351, 352, and 353. In some embodiments, the decoy sequence is 5 to 13 nucleotides (nt) in length. In some embodiments, the decoy sequence is 5, 6, 7, 8, 9, 10, 11, 12, or 13 nt in length.

[0130] In some embodiments, the decoy sequence resembles the optimal 5' splice site and is fully or partially complementary to the single-stranded 5' end of the U1 snRNA. In some embodiments, the decoy sequence is 100% complementary to a portion of the single-stranded 5' end of the U1 snRNA. In some embodiments, 7 to 11 nt of the decoy sequence are complementary to the 5' end of the U1 snRNA.

[0131] In some embodiments, the decoy sequence has low sequence complementarity, such as less than about 80%, to the corresponding adjacent sequence immediately adjacent to the 5' or 3' end of the region of interest in the target nucleic acid (e.g., mRNA). In some embodiments, the decoy sequence is located immediately upstream of the 5' end of the target sequence and has low sequence complementarity to the corresponding adjacent region immediately downstream of the 3' end of the region of interest (see FIG. 1A). In some embodiments, the decoy sequence is located immediately downstream of the 3' end of the target sequence and has low sequence complementarity to the corresponding adjacent region immediately upstream of the 5' end of the region of interest in the target nucleic acid (e.g., pre-RNA, see FIG. 1A). In some embodiments, the decoy sequence has less than about 80% sequence complementarity to the corresponding region of the target nucleic acid. In some embodiments, the decoy sequence has less than about 70% sequence complementarity to the corresponding region of the target nucleic acid. In some embodiments, the decoy sequence has less than about 60% sequence complementarity to the corresponding region of the target nucleic acid. In some embodiments, the decoy sequence has less than about 50% sequence complementarity to the corresponding region of the target nucleic acid, in some embodiments, the sequence complementarity is less than about 40%, less than about 35%, less than about 30%, less than about 25%, less than about 20%, less than about 15%, less than about 10%, less than about 5%, or 0% to the corresponding region in the target nucleic acid.

[0132] In various embodiments, the first nucleotide of the decoy sequence immediately adjacent to the 5' or 3' end of the target sequence is not complementary to the corresponding nucleotide adjacent to the region of interest within the target nucleic acid. In some embodiments, the decoy sequence is located upstream of the 5' end of the target sequence within the ASO, and in such embodiments, the first nucleotide of the 3' end of the decoy sequence is not complementary to the corresponding adjacent nucleotide located immediately downstream of the 3' end of the region of interest within the target nucleic acid (see Figure 1A). In some embodiments, the decoy sequence is located downstream of the 3' end of the target sequence within the ASO, and in such embodiments, the first nucleotide of the 5' end of the decoy sequence is not complementary to the corresponding adjacent nucleotide located immediately upstream of the 5' end of the region of interest within the target nucleic acid (see Figure 1A). Target sequence

[0133] In various embodiments of the present technology, the target sequence of the ASO is fully or substantially complementary to the target region within the nucleic acid (e.g., pre-mRNA). In some embodiments, the target sequence of the ASO comprises a strand that is exactly (100%) complementary to the target region within the nucleic acid that it is designed to inhibit. That is, every consecutive nucleotide within the target sequence hybridizes with every corresponding nucleotide within the target region. However, 100% sequence identity between the target sequence and the target splicing sequence may not be necessary to perform the present technology. In another embodiment, the target sequence is substantially complementary to the target region. That is, the target sequence is 70% or more, 75% or more, 80% or more, 90% or more, 95% or more, 98% or more, or 99% or more complementary to the target region within the nucleic acid that it is designed to inhibit. The non-complementary positions within the target sequence of the ASO may be one or more insertions, deletions, and / or point mutations relative to the target region.

[0134] In some embodiments, the region of interest is an exon (see, e.g., FIG. 1B). In some embodiments, the region of interest is an intron region upstream of an exon (see FIG. 1B). In some embodiments, the region of interest is an intron region downstream of an exon (see FIG. 1B). In some embodiments, the target sequence binds to a region of interest that is an exon of interest, an adjacent intron sequence upstream of an exon of interest, an adjacent intron sequence downstream of an exon of interest, an intron-exon junction upstream of an exon of interest, or an intron-exon junction downstream of an exon of interest. In some embodiments, the exon of interest is exon 7 of the SMN1 gene or the SMN2 gene. In some embodiments, the exon of interest is exon 7 of the SMN1 gene. In some embodiments, the exon of interest is exon 51 of the DMD gene. In some embodiments, the exon of interest is exon 53 of the DMD gene. In some embodiments, the exon of interest is exon 45 of the DMD gene. In some embodiments, the exon of interest is exon 17 of the APP gene. In some embodiments, the exon of interest is exon 41 of the CEP290 gene. In some embodiments, the exon of interest is exon 19 of the HER2 gene. In some embodiments, the exon of interest is exon 10 of the ATXN3 gene. In some embodiments, the exon of interest is exon 10 of the PKM gene. In some embodiments, the exon of interest is exon 6 of the MDM4 gene.

[0135] In various embodiments, the length of the ASO target sequence is about 10 nt to about 80 nt. In some embodiments, the length of the ASO target sequence is about 10-60 nt. In some embodiments, the length of the ASO target sequence is about 10-50 nt. In some embodiments, the length of the ASO target sequence is about 10-40 nt. In some embodiments, the length of the ASO target sequence is about 12-35 nt. In some embodiments, the length of the ASO target sequence is about 14-30 nt. In some embodiments, the length of the ASO target sequence is about 15-25 nt. In some embodiments, the length of the ASO target sequence is about 18-23 nt. In some embodiments, the length of the ASO target sequence is about 20 nt. In some embodiments, the target sequence of the ASO comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 25, 29, 33, 37, 41, 45, 49, 75, 92, 124, 156, 188, 220, 252, 284, and 316.

[0136] In some embodiments, the target sequence that hybridizes to the SMN1 and / or SMN2 gene comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 25, 29, and 33. In certain embodiments, the target sequence is for exon skipping of exon 7 of the SMN1 and / or SMN2 gene.

[0137] In some embodiments, the target sequence that hybridizes to the DMD gene comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 37, 41, 45, 49, 75, 92, and 124.

[0138] In one embodiment, the target sequence is for exon skipping of exon 51 of the DMD gene, and the target sequence that hybridizes to the DMD gene comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 37, 41, 45, 49, and 75.

[0139] In one embodiment, the target sequence is for exon skipping of exon 53 of the DMD gene, and the target sequence that hybridizes to the DMD gene comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequence of SEQ ID NO: 92.

[0140] In one embodiment, the target sequence is for exon skipping of exon 45 of the DMD gene, and the target sequence that hybridizes to the DMD gene comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequence of SEQ ID NO: 124.

[0141] In some embodiments, the target sequence that hybridizes to the APP gene comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequence of SEQ ID NO: 156. In an embodiment, the target sequence is for exon skipping of exon 17 of the APP gene.

[0142] In some embodiments, the target sequence that hybridizes to the CEP290 gene comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequence of SEQ ID NO: 188. In an embodiment, the target sequence is for exon skipping of exon 41 of the CEP290 gene.

[0143] In some embodiments, the target sequence that hybridizes to the HER2 gene comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequence of SEQ ID NO: 220. In certain embodiments, the target sequence is for exon skipping of exon 19 of the HER2 gene.

[0144] In some embodiments, the target sequence that hybridizes to the ATXN3 gene comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequence of SEQ ID NO: 259. In an embodiment, the target sequence is for exon skipping of exon 10 of the ATXN3 gene.

[0145] In some embodiments, the target sequence that hybridizes to the PKM gene comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequence of SEQ ID NO: 284. In an embodiment, the target sequence is for exon skipping of exon 10 of the PKM gene.

[0146] In some embodiments, the target sequence that hybridizes to the MDM4 gene comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequence of SEQ ID NO: 316. In an embodiment, the target sequence is for exon skipping of exon 6 of the MDM4 gene. Variations

[0147] In some embodiments, there may be additional flanking nucleotide sequences at one or both ends of the oligonucleotide comprising the decoy sequence and the target sequence.

[0148] In some embodiments, the ASO further comprises one or more nucleotide modifications, hi some embodiments, at least one subunit of the ASO is a non-natural nucleotide analog having (i) a modified internucleoside linkage, (ii) a modified sugar moiety, (iii) a modified base, or (iv) a combination of the foregoing.

[0149] In some embodiments, the ASO contains one or more phosphorothioate linkages as modified internucleoside linkages. In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more internucleoside linkages of the ASO are phosphorothioate linkages. In some embodiments, all internucleoside linkages of the ASO are phosphorothioate linkages.

[0150] In some embodiments, the ASO comprises one or more 2'-O-methoxyethyl sugar moieties as modified sugar moieties. In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more sugar moieties of the ASO are 2'-O-methoxyethyl sugar moieties. In some embodiments, all sugar moieties of the ASO are 2'-O-methoxyethyl sugar moieties.

[0151] In some embodiments, the ASO contains one or more 5-methylcytosines instead of cytosine as modified bases. In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more cytosine bases in the ASO are modified as 5-methylcytosines. In some embodiments, all cytosine bases in the ASO are modified as 5-methylcytosines.

[0152] In some embodiments, the ASO further comprises one or more additional chemical moieties. In some embodiments, the one or more additional chemical moieties are covalently attached to one or more ends of the nucleic acid sequence. In some embodiments, the additional chemical moiety is a cell-penetrating peptide.

[0153] In some embodiments, the ASO of the present technology may include a nucleic acid moiety conjugated to a cell-penetrating peptide (CPP) moiety to enhance transport of the compound into cells. In some embodiments, the CPP moiety is attached to the end of the oligonucleotide. In some embodiments, the peptide has the ability to penetrate approximately 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of the cells in a given cell culture population (including all integers therebetween), enabling translocation of macromolecules within multiple tissues in vivo upon administration. In some embodiments, the cell-penetrating peptide may be an arginine-rich peptide transporter. In some embodiments, the cell-penetrating peptide may be a penetratin or Tat peptide. These peptides are well known in the art and are disclosed, for example, in U.S. Publication No. 2010-0016215A1, the entire contents of which are incorporated by reference. An exemplary approach for conjugating a peptide to an ASO can be found in PCT Publication No. WO2012 / 150960, the entire text of which is incorporated by reference. In some embodiments, the oligonucleotide and the CPP portion are conjugated via a linker. In some embodiments, the amino acid glycine is used as the linker between the CPP and the oligonucleotide portion.

[0154] The transport moieties described above are shown to significantly enhance cellular entry of the attached oligomer compared to uptake of the oligomer without the attached transport moiety, hi some embodiments, the CPP is an arginine-rich cell-penetrating peptide. Several peptide transporters have been shown to be highly effective in delivering compounds with antisense sequences to primary cells, including muscle cells (N.B. Marshall, et al. Arginine-rich cell-penetrating peptides facilitate delivery of antisense oligomers into murine leukocytes and alter pre-mRNA splicing. 2007 Aug 31. Journal of Immunological Methods. 325:114-126. doi: 10.1016 / j.jim.2007.06.009; N. Jearawiriyapaisarn, et al. Sustained dystrophin expression induced by peptide-conjugated morpholino oligomers in the muscles of mdx mice. 2008 Sep. Mol Ther. 16:1624-1629. doi: 10.1038 / mt.2008.120; Wu B, et al. Effective rescue of dystrophin improves cardiac function). function in dystrophin-deficient mice by a modified morpholino oligomer. 2008 Sep 30. Proc. Natl. Acad. Sci. USA. 105:14814-14819. doi: 10.1073 / pnas.0805676105). Assay to identify dichotomous ASOs with exon skipping effects

[0155] A non-limiting example of determining whether an ASO induces skipping of one or more exons in the transcript of a gene of interest may include introducing the ASO to be tested (e.g., by introducing an artificial minigene-containing plasmid into the cell line) into an appropriate cell line (e.g., dystrophin-expressing cells such as HEK293 cells for the SMN1, SMN2, CEP290, and MDM4 genes, HeLa cells for the HER2 gene, A549 cells for the ATXN3 gene, or human rhabdomyosarcoma cells for the DMD and PKM genes), or into a cell line expressing a gene construct that mimics the exon / intron organization of the region of interest, amplifying the region containing the exon of interest in the transcript from the total RNA of the cell line by RT-PCR, and performing nested PCR or sequence analysis on the PCR amplified product.

[0156] The skipping efficiency can be determined as follows: mRNA of the dystrophin gene is collected from test cells and amplified by RT-PCR. If "A" is the level of amplified polynucleotides of the target mRNA in which one or more exons of interest have been skipped, and "B" is the level of amplified polynucleotides of the target mRNA in which the exons of interest have not been skipped, the measured values ​​of "A" and "B" are used to calculate the efficiency using the following formula: Exon skipping rate / efficiency (%excl) = A / (A+B) × 100 Exon inclusion rate (%incl)=B / (A+B)×100

[0157] In some embodiments, the bipartite ASO of the present technology causes skipping of one or more exons of DMD mRNA, and the exon skipping rate (%excl) is about 10% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, about 2-fold or more, about 2.18-fold or more, about 2.3-fold or more, about 3-fold or more, about 4-fold or more, about 5-fold or more, about 6-fold or more, about 7-fold or more, about 8-fold or more, about 9-fold or more, about 10% or more, about 10% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, about 2-fold or more, about 2.18-fold or more, about 2.3-fold or more, about 3-fold or more, about 4-fold or more, about 5-fold or more, about 6-fold or more, about 9-fold or more, about 10% ... An increase of 7 fold or more, about 8 fold or more, about 9 fold or more, about 10 fold or more, about 11 fold or more, about 12 fold or more, about 13 fold or more, about 14 fold or more, about 15 fold or more, about 16 fold or more, about 17 fold or more, about 18 fold or more, about 19 fold or more, about 20 fold or more, about 25 fold or more, about 30 fold or more, about 40 fold or more, about 50 fold or more, about 60 fold or more, about 70 fold or more, about 80 fold or more, about 90 fold or more, about 100 fold or more (including all values ​​and ranges therebetween). Oligonucleotide Modification

[0158] Unmodified oligonucleotides may not be optimal for some applications, for example, unmodified oligonucleotides may be easily degraded by cellular nucleases.Nucleases can hydrolyze nucleic acid phosphodiester bonds.However, chemical modification of oligonucleotides can provide improved properties, for example, increase the stability of oligonucleotides against nucleases.

[0159] Because oligonucleotides are polymers of subunits or monomers, many of the modifications, such as modifications of the base, sugar, phosphate moiety, or non-bridging oxygen of the phosphate moiety, occur at positions that are repeated within the oligonucleotide. Not all positions in a given oligonucleotide need be uniformly modified; in fact, more than one of the aforementioned modifications may be incorporated into a single oligonucleotide, or even into a single nucleoside within an oligonucleotide.

[0160] In some embodiments, modifications occur at all target positions in an oligonucleotide, but not in many other embodiments. For example, modifications may occur only at the 3' or 5' terminal positions, only in internal regions, or only in terminal regions (e.g., at the terminal nucleotide position or the last 2, 3, 4, 5, or 10 nucleotides of an oligonucleotide). Modifications may occur in double-stranded regions, single-stranded regions, or both. Modifications may occur only in the double-stranded region of a double-stranded oligonucleotide or only in the single-stranded region of a double-stranded oligonucleotide. For example, phosphorothioate modifications at non-bridging oxygen positions may occur only at one or both ends, only in the terminal regions (e.g., at the terminal nucleotide position or the last 2, 3, 4, 5, or 10 nucleotides of a strand), or in both double-stranded and single-stranded regions (especially at the ends). The 5' end or both ends may be phosphorylated.

[0161] The modifications described herein can be a single modification, a single type of modification present in multiple nucleotides, or a modification can be combined with one or more other modifications described herein. The modifications described herein can also be combined with oligonucleotides, for example, where different nucleotides of the oligonucleotide have different modifications described herein.

[0162] In some embodiments, it may be desirable to, for example, increase stability, include specific nucleic acid bases in the overhang, or include modified nucleotides or nucleotide substitutes in the single-stranded overhang, for example, the 5' or 3' overhang, or both. For example, it may be desirable to include purine nucleotides in the overhang. In some embodiments, all or some of the bases in the 3' or 5' overhang are modified, for example, by the modifications described herein. Modifications may include, for example, the use of modifications at the 2'OH group of the ribose sugar, for example, the use of deoxyribonucleotides (e.g., deoxythymidine) instead of ribonucleotides, and modifications at the phosphate group (e.g., phosphothioate modifications). The overhang need not be homologous to the region of interest.

[0163] Specific modifications are discussed in more detail below. phosphate group

[0164] Phosphate group is a negatively charged species.The charge is evenly distributed on two non-bridging oxygen atoms.However, phosphate group can be modified by replacing one of oxygen with another substituent.One result of this modification to RNA phosphate backbone can be that oligoribonucleotide becomes more resistant to nucleic acid decay.Therefore, without wishing to be bound by theory, in some embodiments, it may be desirable to introduce a modification that results in either an uncharged linker or a charged linker with asymmetric charge distribution.

[0165] Examples of modified phosphate groups include phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, alkyl or aryl phosphonates, and phosphotriesters. In some embodiments, one of the non-bridging phosphate oxygen atoms in the phosphate backbone moiety can be replaced with either S, Se, BR3 (where R is hydrogen, alkyl, or aryl), C (i.e., alkyl, aryl, etc.), H, NR2 (where R is hydrogen, alkyl, or aryl), or (where R is alkyl or aryl). The phosphorus atom in an unmodified phosphate group is achiral. However, replacing one of the non-bridging oxygens with one of the above atoms or groups of atoms makes the phosphorus atom chiral. In other words, the phosphorus atom in such modified phosphate groups is a stereocenter. The stereogenic phosphorus atom can have either the "R" configuration (here, Rp) or the "S" configuration (here, Sp).

[0166] Phosphorodithioate has both non-bridging oxygens replaced with sulfur. The phosphorus center in phosphorodithioate is achiral, which prevents the formation of oligoribonucleotide diastereomers. Therefore, without wishing to be bound by theory, the modification of both non-bridging oxygens to eliminate the chiral center, for example, the formation of phosphorodithioate, may be desirable in that it cannot produce diastereomeric mixtures. Therefore, the non-bridging oxygens can independently be S, Se, B, C, H, N, or R (R is alkyl or aryl).

[0167] Phosphate linkers can also be modified by replacing the bridging oxygen (i.e., the oxygen that connects the phosphate to the nucleoside) with nitrogen (bridging phosphoramidates), sulfur (bridging phosphorothioates), or carbon (bridging methylene phosphonates). Replacement can occur at one or both of the linking oxygens. When the bridging oxygen is the 3'-oxygen of the nucleoside, substitution with carbon is preferred. When the bridging oxygen is the 5'-oxygen of the nucleoside, substitution with nitrogen is preferred. Phosphate group replacement

[0168] The phosphate group can be replaced with a non-phosphorus-containing connector. Without wishing to be bound by theory, it is believed that because the charged phosphodiester group is the reactive center in nucleic acid degradation, replacing it with a neutral structural mimic may improve nuclease stability. Also, without wishing to be bound by theory, in some embodiments, it may be desirable to introduce a modification that replaces the charged phosphate group with a neutral moiety.

[0169] Examples of moieties that can replace the phosphate group include methylphosphonate, hydroxylamino, siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thioformacetal, formacetal, oxime, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo, and methyleneoxymethylimino. Preferred replacements include methylenecarbonylamino and methylenemethylimino groups.

[0170] Modified phosphate linkages in which at least one of the oxygens attached to the phosphate is replaced or the phosphate group is replaced with a non-phosphorus group are also referred to as "non-phosphodiester backbone linkages." Replacement of the ribonucleotide backbone

[0171] Oligonucleotide-mimetic scaffolds can also be constructed in which the phosphate linker and ribose sugar are replaced with nuclease-resistant nucleoside or nucleotide surrogates. Without wishing to be bound by theory, it is believed that the absence of a repeatedly charged backbone reduces binding to proteins that recognize polyanions (e.g., nucleases). Also, without wishing to be bound by theory, in some embodiments, it may be desirable to introduce modifications in which the bases are tethered by neutral backbone surrogates. Examples include morpholino, cyclobutyl, pyrrolidine, and peptide nucleic acid (PNA) nucleoside surrogates. Other examples include morpholinos, which have nucleobases (e.g., adenine, cytosine, guanine, and thymine) linked to morpholine rings, and phosphorodiamidate morpholino oligomers (PMOs), which are DNA analogs built on a backbone of morpholine rings linked by phosphorodiamidate linkages. sugar modification

[0172] Modified RNAs can include modifications of all or some of the sugar groups of ribonucleic acids; for example, the 2' hydroxyl group (OH) can be modified or replaced with several different "oxy" or "deoxy" substituents. Without being bound by theory, it is expected that stability will be improved because the hydroxyl cannot be deprotonated to form a 2'-alkoxide ion. 2'-alkoxides can catalyze decomposition by intramolecular nucleophilic attack on the linker atom. Also, without being bound by theory, in some embodiments, it may be desirable to introduce modifications that do not allow alkoxide formation at the 2' position.

[0173] Examples of "oxy"-2' hydroxyl group modifications include alkoxy or aryloxy (OR, e.g., R = H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), polyethylene glycol (PEG), O(CH2CHO)nCH2CH2OR, "locked" nucleic acids (LNA) in which the 2' hydroxyl is linked to the 4' carbon of the same ribose sugar, e.g., by a methylene bridge, O-amine (amine = NH2, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, polyamino), and aminoalkoxy, O(CH2) n These include amines (e.g., amine = NH2, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, polyamino). Notably, oligonucleotides containing only methoxyethyl groups (MOE), (OCH2CHOCH3, PEG derivatives), or 2'-O-methoxyethyl exhibit nuclease stability comparable to those modified with the strong phosphorothioate modification.

[0174] "Deoxy" modifications include hydrogen (i.e., deoxyribose sugars, particularly relevant to the overhanging portion of a partial dsRNA), halo (e.g., fluoro), amino (e.g., N, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid), NH(CHCHNH)CHCH-amine (amine = NH, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino), -NHC(O)R (R = alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), cyano, mercapto, alkylthioalkyl, thioalkoxy, alkyl, cycloalkyl, aryl, alkenyl, and alkynyl, which may be optionally substituted, for example, with an amino functional group. Preferred substituents are 2'-methoxyethyl, 2'-OCH, 2'-O-allyl, 2'-C-allyl, and 2'-fluoro.

[0175] The sugar group may also contain one or more carbon atoms that have the opposite stereochemical configuration to the corresponding carbon atom in ribose.Thus, oligonucleotides may contain, for example, arabinose-containing nucleotides as sugars.Monomers may have alpha linkages (e.g., alpha nucleosides) at sugar positions.Oligonucleotides may also contain "abasic" sugars that lack a nucleobase at C-.These abasic sugars may further contain modifications to one or more of the constituent sugar atoms.Oligonucleotides may also contain one or more sugars in the L-form, for example, L-nucleosides. terminal modification

[0176] The 3' and 5' ends of an oligonucleotide can be modified. Such modifications can be made at the 3', 5', or both ends of the molecule. The modifications can include modifying or replacing the entire terminal phosphate or one or more atoms of the phosphate group. For example, the 3' and 5' ends of an oligonucleotide can be conjugated to other functional molecular entities, such as labeling moieties, such as fluorophores (e.g., pyrene, TAMRA, fluorescein, Cy3, or Cy5 dyes) or protecting groups (e.g., sulfur-, silicon-, boron-, or ester-based). The functional molecular entities can be attached to the sugar via the phosphate group and / or a linker. The terminal atom of the linker can be linked to or replace the linking atom of the phosphate group or the C-3' or C-5' O, N, S, or C group of the sugar. Alternatively, the linker can be linked to or replace the terminal atom of a nucleotide surrogate (e.g., PNA). When a linker / phosphate-functional molecular entity-linker / phosphate array is interposed between the two strands of a dsRNA, this array can be used in place of the hairpin RNA loop of a hairpin RNA agent.

[0177] The terminal modification useful for adjusting activity includes the modification of 5' end with phosphate or phosphate analogue.For example, in preferred embodiments, the antisense strand of dsRNA is 5' phosphorylated or comprises phosphoryl analogue at 5' prime end.5'-phosphate modification includes that which can be compatible with RISC-mediated gene silencing. Suitable modifications include 5′-monophosphate ((HO)2(O)PO-5′), 5′-diphosphate ((HO)2(O)POP(HO)(O)-O-5′), 5′-triphosphate ((HO)2(O)PO-(HO)(O)POP(HO)(O)-O-5′), 5′-guanosine cap (7-methylated or unmethylated) (7m-GO-5′-(HO)(O)PO-(HO)(O)POP(HO)(O)-O-5′), 5′-adenosine cap (Appp), any modified or unmodified nucleotide cap structure (NO-5′-(HO)(O)PO-(HO)(O)POP(HO)(O)-O-5′), 5′-monothiophosphate (phosphorothioate), (HO)2(S)PO-5′), 5′-monodithiophosphate (phosphorodithioate, These include (HO)(HS)(S)PO-5'), 5'-phosphorothiolate ((HO)2(O)PS-5'), and oxygen / sulfur-substituted monophosphates, diphosphates, and triphosphates (e.g., 5'-alpha-thiotriphosphate, 5'-gamma-thiotriphosphate, etc.), 5'-phosphoramidates ((HO)2(O)P-NH-5', (HO)(NH2)(O)PO-5'), 5'-alkylphosphonates (R = alkyl = methyl, ethyl, isopropyl, propyl, etc., e.g., RP(OH)(O)-O-5'-, (OH)2(O)P-5'-CH2-), and 5'-alkyl ether phosphonates (R = alkyl ether = methoxymethyl (MeOCH2-), ethoxymethyl, e.g., RP(OH)(O)-O-5'-).

[0178] Terminal modifications can also be useful for monitoring distribution; in such embodiments, preferred groups added include fluorophores, such as fluorescein, or Alexa dyes, such as Alexa 488. Terminal modifications can also be useful for enhancing uptake; useful modifications include cholesterol. Terminal modifications can also be useful for crosslinking an RNA agent to another moiety; useful modifications include mitomycin C. Nucleic acid bases

[0179] Adenine, guanine, cytosine, and uracil are the most common bases found in RNA. These bases can be modified or substituted to provide RNA with improved properties. For example, nuclease-resistant oligoribonucleotides can be prepared using these bases, or synthetic and natural nucleic acid bases (e.g., inosine, thymine, xanthine, hypoxanthine, nubularine, isoguanisine, or tubercidin) with any of the modifications described above. Alternatively, substituted or modified analogs of any of the above bases can be used, such as the "unusual bases," "modified bases," "unnatural bases," and "universal bases" described herein.Examples include 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 5-halouracil, 5-(2-aminopropyl)uracil, 5-aminoallyluracil, 8-halo, Amino, thiol, thioalkyl, hydroxyl, and other 8-substituted adenines and guanines, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine, 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines (including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine), dihydrouracil, 3-deaza-5-azacytosine, 2-aminopropyl Phosphorus, 5-alkyluracil, 7-alkylguanine, 5-alkylcytosine-deazaadenine, N6,N6-dimethyladenine, 2,6-diaminopurine, 5-amino-allyl-uracil, N3-methyluracil, substituted 1,2,4-triazoles, 2-pyridinone, 5-nitroindole, 3-nitropyrrole, 5-methoxyuracil, uracil-5-oxyacetic acid, 5-methoxycarbonylmethyluracil, 5-methyl-2-thiouracil, 5- These include, but are not limited to, methoxycarbonylmethyl-2-thiouracil, 5-methylaminomethyl-2-thiouracil, 3-(3-amino-3-carboxypropyl)uracil, 3-methylcytosine, 5-methylcytosine, N4-acetylcytosine, 2-thiocytosine, N6-methyladenine, N6-isopentyladenine, 2-methylthio-N6-isopentenyladenine, N-methylguanine, or O-alkylated bases.Further, purines and pyrimidines include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in Concise Encyclopedia of Polymer Science and Engineering (pp. 858-859, Roschwitz, JI, ed. John Wiley & Sons, 1990), and those disclosed by Uwe Englisch et al. (Chemically Modified Oligonucleotides as Probes and Inhibitors. 1991 June. Angewandte Chemie, International Edition. 30:613-629. doi: 10.1002 / anie.199106133). cationic group

[0180] Modification of oligonucleotides can also include the attachment of one or more cationic groups to the sugar, base, and / or phosphorus atom of the phosphate or modified phosphate backbone moiety. The cationic group can be attached to any atom that can be substituted on a natural, unusual, or universal base. The preferred position is one that does not interfere with hybridization, i.e., does not interfere with the hydrogen bonding interactions required for base pairing. For example, the cationic group can be attached to the C2' position of the sugar, or a similar position on a cyclic or acyclic sugar substitute.

[0181] Cationic groups include, for example, protonated amino groups derived from O-amines (amine = N, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, polyamino), aminoalkoxy, e.g., O(CH)AMINE (e.g., AMINE = NH, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, polyamino), amino (e.g., NH, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid), or NH(CHCHNH)CHCH-AMINE (AMINE = NH, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino). Substitutions within oligonucleotides

[0182] It is preferred that some modifications are included at specific positions of oligonucleotide (for example, at the internal position of the chain) or at the 5'-end or 3'-end of oligonucleotide.Preferred modification positions on oligonucleotide may give the drug preferred properties.For example, certain preferred modification positions may give optimal gene silencing properties or increased resistance to endonuclease or exonuclease activity.

[0183] One or more nucleotides of the oligonucleotide may have a 2'-5' linkage. One or more nucleotides of the oligonucleotide may have a reverse linkage (e.g., a 3'-3', 5'-5', 2'-2', or 2'-3' linkage).

[0184] The double-stranded oligonucleotide may contain at least one 5'-uridine-adenine-3' (5'-UA-3') dinucleotide (wherein uridine is a 2'-modified nucleotide), or a terminal 5'-uridine-guanine-3' (5'-UG-3') dinucleotide (wherein 5'-uridine is a 2'-modified nucleotide), or a terminal 5'-cytidine-adenine-3' (5'-CA-3') dinucleotide (wherein 5'-cytidine is a 2'-modified nucleotide), or a terminal 5'-uridine-uridine-3' (5'-UU-3') dinucleotide. The double-stranded oligonucleotide may contain a terminal 5'-cytidine-cytidine-3' (5'-CC-3') dinucleotide (wherein the 5'-cytidine is a 2'-modified nucleotide), or a terminal 5'-cytidine-uridine-3' (5'-CU-3') dinucleotide (wherein the 5'-cytidine is a 2'-modified nucleotide), or a terminal 5'-uridine-cytidine-3' (5'-UC-3') dinucleotide (wherein the 5'-uridine is a 2'-modified nucleotide). Double-stranded oligonucleotides containing these modifications are particularly stabilized against endonuclease activity. Reference Summary

[0185] The oligoribonucleotides and oligoribonucleosides used in accordance with the present technology may be synthesized by solid-phase synthesis (see, e.g., "Oligonucleotide synthesis, a practical approach," Ed. M. J. Gait, IRL Press, 1984; "Oligonucleotides and Analogues, A Practical Approach," Ed. F. Eckstein, IRL Press, 1991 (especially Chapter 1, Modern machine-aided methods of oligodeoxyribonucleotide synthesis; Chapter 2, Oligoribonucleotide synthesis; Chapter 3, 2'-O-Methyloligoribonucleotides: synthesis and applications; Chapter 4, Phosphorothioate oligonucleotides; Chapter 5, Synthesis of oligonucleotide phosphorodithioates; Chapter 6, Synthesis of oligo-2'-deoxyribonucleoside methylphosphonates; and Chapter 7, Oligodeoxynucleotides containing modified bases)).Other particularly useful synthetic procedures, reagents, blocking groups, and reaction conditions are described in P. Martin. A new approach to 2′-O-alkylribonucleoside and related oligonucleotides. 1995 March 22. Helv. Chim. Acta. 78: 486-504. doi: 10.1002 / hlca.19950780219; S.L. Beaucage and R.P. Iyer. Advances in the Synthesis of Oligonucleotides by the Phosphoramidite Approach. 1992 March 20. Tetrahedron. 48:2223-2311. doi: 10.1016 / S0040-4020(01)88752-4; S.L. Beaucage and R.P. Iyer. The synthesis of modified oligonucleotides by the phosphoramidite approach and their applications. 1993 Jul 9. Tetrahedron. 49:6123-6194. doi: 10.1016 / S0040-4020(01)87958-8, or the references cited therein. Modifications described in WO00 / 44895, WO01 / 75164, or WO02 / 44321 can be used herein. The disclosures of all publications, patents, and published patent applications cited herein are incorporated by reference.

[0186] The preparation of phosphinate oligoribonucleotides is described in U.S. Patent No. 5,508,270. The preparation of alkylphosphonate oligoribonucleotides is described in U.S. Patent No. 4,469,863. The preparation of phosphoramidite oligoribonucleotides is described in U.S. Patent No. 5,256,775 or U.S. Patent No. 5,366,878. The preparation of phosphotriester oligoribonucleotides is described in U.S. Patent No. 5,023,243. The preparation of boranophosphate oligoribonucleotides is described in U.S. Patent Nos. 5,130,302 and 5,177,198. The preparation of 3'-deoxy-3'-amino phosphoramidate oligoribonucleotides is described in U.S. Patent No. 5,476,925. 3'-Deoxy-3'-methylene phosphonate oligoribonucleotides are described in Haoyun An, et al. Synthesis of novel 3'-C-methylene thymidine and 5-methyluridine / cytidine H-phosphonates and phosphonamidites for new backbone modification of oligonucleotides. 2001 March 16. The Journal of Organic Chemistry. 66(8), pp.2789-2801. doi: 10.1021 / jo001699u. The preparation of sulfur-bridged nucleotides is described in Brian S. Sproat, et al. Synthesis of Modified Building Blocks Containing Amino or Thiol Moieties: Application of Modified Oligodeoxyribonucleotides. 2006 Dec 06. Nucleosides Nucleotides. 7:651-653. doi: 10.1080 / 07328318808056302 and Crosstick et al. Tetrahedron Lett. 1989, 30, 4693.

[0187] Modifications of the 2' sugar group can be found in S. Verma, et al. MODIFIED OLIGONUCLEOTIDES: Synthesis and Strategy for Users. 1998 Jul. Annu. Rev. Biochem. 67:99-134. doi: 10.1146 / annurev.biochem.67.1.99 and all references therein. Specific modifications to ribose include 2′-fluoro (Kawasaki, et. al. Uniformly modified 2′-deoxy-2′-fluoro-phosphorothioate oligonucleotides as nuclease-resistant antisense compounds with high affinity and specificity for RNA targets. 1993 Apr 1. J. Med. Chem. 36:831-841. doi: 10.1021 / jm00059a007), 2′-MOE (P. Martin. Stereoselective synthesis of 2′-O-(2-Methoxyethyl)ribonucleosides: Nachbargruppenbeteiligung der Methoxyethoxy-Group bei der Ribosylierung von Heterocyclen. 1996 Oct 30. Helv. Chim. Acta. 79:1930-1938. doi: 10.1002 / hlca.19960790716), "LNA" (J. Wengel. Synthesis of 3'-C- and 4'-C-Branched Oligodeoxynucleotides and the Development of Locked Nucleic Acid (LNA). 1998 Dec 4. Acc. Chem. Res. 32:301-310. doi: 10.1021 / ar980051p).

[0188] Methylenemethylimino-linked oligoribonucleosides (also identified herein as MMI-linked oligoribonucleosides), methylenedimethylhydrazo-linked oligoribonucleosides (also identified herein as MDH-linked oligoribonucleosides), and methylenecarbonylamino-linked oligonucleosides (also identified herein as amide-3-linked oligoribonucleosides), and methyleneaminocarbonyl-linked oligonucleosides (also identified herein as amide-3-linked oligoribonucleosides). Mido-4 linked oligoribonucleosides, as well as mixed backbone compounds having, for example, alternating MMI and PO or PS linkages, can be prepared as described in U.S. Pat. Nos. 5,378,825, 5,386,023, 5,489,677, and published PCT applications PCT / US92 / 04294 and PCT / US92 / 04305 (published as WO92 / 20822WO and 92 / 20823, respectively). Formacetal and thioformacetal linked oligoribonucleosides can be prepared as described in U.S. Pat. Nos. 5,264,562 and 5,264,564. Ethylene oxide linked oligoribonucleosides can be prepared as described in U.S. Pat. No. 5,223,618. Siloxane substitutions are described in James F. Cormier, et al. Synthesis of hexanucleotide analogues containing diisopropylsilyl internucleotide linkages. 1988 May 25. Nucleic Acids Res. 16:4583-4594. doi: 10.1093 / nar / 16.10.4583. Carbonate substitutions are described in JR Tittensor. The preparation of nucleoside carbonates. 1971 January. Chem. Soc. C. 2656-2662. doi: 10.1039 / J39710002656.Carboxymethyl replacement is described in MD Edge, et al. Synthetic analogues of polynucleotides. Part VIII. Analogues of oligonucleotides containing carboxymethylthymidine. 1991. J. Chem. Soc. Perkin Trans. 1. 1972. doi: 10.1039 / P19720001991. Carbamate replacement is described in EP Stirchak, et al. Uncharged stereoregular nucleic acid analogs: 2. Morpholino nucleoside oligomers with carbamate internucleoside linkages. 1989 Aug 11. Nucleic Acids Res. 17, 6129. doi: 10.1093 / nar / 17.15.6129.

[0189] Cyclobutyl sugar surrogate compounds can be prepared as described in U.S. Patent No. 5,359,044. Pyrrolidine sugar surrogates can be prepared as described in U.S. Patent No. 5,519,134. Morpholino sugar surrogates can be prepared as described in U.S. Patent Nos. 5,142,047 and 5,235,033, and other related patent disclosures. Peptide nucleic acids (PNAs) are known per se and can be prepared according to any of the various procedures mentioned in Peptide Nucleic Acids (PNA): Synthesis, Properties and Potential Applications, Bioorganic & Medicinal Chemistry, 1996, 4, 5-23. They may also be prepared according to U.S. Patent No. 5,539,083.

[0190] Terminal modifications are described in M. Manoharan, et al. Oligonucleotide Conjugates as Potential Antisense Drugs with Improved Uptake, Biodistribution, Targeted Delivery, and Mechanism of Action. 2004 Jul 8. Antisense and Nucleic Acid Drug Development. 12, 103-128. doi: 10.1089 / 108729002760070849 and references therein. Nucleobase References N-2 substituted purine nucleoside amidites can be prepared as described in U.S. Patent No. 5,459,255. 3-Deazapurine nucleoside amidites can be prepared as described in U.S. Patent No. 5,457,191. 5,6-substituted pyrimidine nucleoside amidites can be prepared as described in U.S. Patent No. 5,614,617. 5-Propynylpyrimidine nucleoside amidites can be prepared as described in U.S. Patent No. 5,484,908. ASO manufacturing

[0191] The ASOs (e.g., bipartite ASOs) used in accordance with the present technology can be conveniently and routinely produced by well-known solid-phase synthesis techniques. Equipment for such synthesis is sold by several vendors, including, for example, Applied Biosystems (Foster City, California). One method for synthesizing oligonucleotides on modified solid supports is described in U.S. Patent No. 4,458,066.

[0192] Other means for such synthesis known in the art may additionally or alternatively be used. It is well known to use similar techniques to prepare oligonucleotides, such as phosphorothioates and alkylated derivatives. In one such automated embodiment, diethyl phosphoramidite is used as a starting material and may be synthesized as described in SL Beaucage, et al. Deoxynucleoside phosphoramidites - A new class of key intermediates for deoxypolynucleotide synthesis. 2001 March 9. Tetrahedron Letters. 22:1859-1862. doi: 10.1016 / S0040-4039(01)90461-7.

[0193] The ASOs of the present technology may be synthesized in vitro and do not include ASOs derived from living organisms or genetic vector constructs designed to direct the in vivo synthesis of ASOs. The molecules of the present technology may also be mixed, conjugated, associated with, or encapsulated in other molecules, molecular structures, or mixtures of compounds, such as liposomes, receptor-targeting molecules, oral, rectal, topical, or other formulations, to aid in uptake, distribution, and / or absorption. Methods for improving the efficacy and / or efficiency of exon skipping of ASOs containing or consisting of a target sequence

[0194] In some aspects, the present technology provides a method for improving the efficacy and / or efficiency of exon skipping of an ASO comprising or consisting of a target sequence, the method comprising providing one or more bipartite ASOs comprising the target sequence and a 5' splice site decoy sequence disclosed herein. In certain embodiments, each decoy sequence of the one or more bipartite ASOs comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 1-23 and 347-353. In certain embodiments, at least a portion of the one or more bipartite ASOs has a decoy sequence operably linked to the 5' end of the target sequence. In certain embodiments, at least a portion of the one or more bipartite ASOs has a decoy sequence operably linked to the 3' end of the target sequence. In certain embodiments, at least a portion of the one or more bipartite ASOs has a decoy sequence operably linked to both the 5' end and the 3' end of the target sequence. In one embodiment, at least some of the one or more bipartite ASOs have a decoy sequence operably linked to only one of the 5' and 3' ends of the target sequence.

[0195] In one embodiment, the method further comprises screening and / or optimizing one or more bipartite ASOs according to their exon skipping effectiveness and / or efficiency. In certain embodiments, the bipartite ASO increases the efficiency of exon skipping of a target sequence by about 2-fold or more, about 3-fold or more, about 4-fold or more, about 5-fold or more, about 6-fold or more, about 7-fold or more, about 8-fold or more, about 9-fold or more, about 10-fold or more, about 11-fold or more, about 12-fold or more, about 13-fold or more, about 14-fold or more, about 15-fold or more, about 16-fold or more, about 17-fold or more, about 18-fold or more, about 19-fold or more, about 20-fold or more, about 25-fold or more, about 30-fold or more, about 40-fold or more, about 50-fold or more, about 60-fold or more, about 70-fold or more, about 100-fold or more, about 80-fold or more, about 90-fold or more, about 100-fold or more, or more (including all values ​​and ranges therebetween) compared to an ASO having the same target sequence but no decoy sequence.

[0196] In certain embodiments, the target sequence is capable of hybridizing to a sequence selected from the group consisting of an exon of interest in a cell or subject, an adjacent intron sequence upstream of the exon of interest, an adjacent intron sequence downstream of the exon of interest, an intron-exon junction upstream of the exon of interest, and an intron-exon junction downstream of the exon of interest. Composition of bipartite ASO

[0197] In some aspects, the present technology provides a composition comprising a bipartite ASO disclosed herein and a pharmaceutically acceptable carrier. In some embodiments, the composition is a pharmaceutical formulation or composition. Vectors encoding bipartite ASOs

[0198] In some aspects, the technology provides vectors encoding the ASOs (e.g., bipartite ASOs) disclosed herein. Using bipartite ASOs to treat disease

[0199] In some embodiments, the present technology provides a method for treating a disease and / or its complications in a subject, comprising administering to the subject an ASO (e.g., a bipartite ASO), a composition (pharmaceutical composition) comprising an ASO (e.g., a bipartite ASO) disclosed herein, and / or a vector encoding an ASO (e.g., a bipartite ASO). The ASO (e.g., a bipartite ASO) may generate or promote exon skipping of a target exon during pre-mRNA splicing. ASO-mediated exon skipping may be an approach for manipulating the expression of a gene of interest. The expression of a gene of interest can be manipulated by the ASO to inhibit splicing of an exon, intron, or specific splice site of the gene of interest, which may result in, for example, but not limited to, restoring a defective reading frame of the gene of interest, generating a different isoform (e.g., a dominant-negative isoform) of the gene of interest, skipping a toxic portion of the gene, silencing the gene, and / or altering the structure and function of the gene.

[0200] In some aspects, the present technology provides for the use of an ASO (e.g., a bipartite ASO) disclosed herein, a composition (e.g., a pharmaceutical composition) comprising an ASO (e.g., a bipartite ASO) disclosed herein, and / or a vector encoding an ASO (e.g., a bipartite ASO) disclosed herein, in the treatment of a disease and / or complications thereof. Exemplary diseases include, but are not limited to, those disclosed herein.

[0201] In some embodiments, the present technology provides ASOs (e.g., bipartite ASOs) disclosed herein, compositions (e.g., pharmaceutical compositions) comprising ASOs (e.g., bipartite ASOs) disclosed herein, and / or vectors encoding ASOs (e.g., bipartite ASOs) disclosed herein for use in treating diseases and / or complications thereof. Exemplary diseases include, but are not limited to, those disclosed herein.

[0202] Examples of diseases and / or complications thereof include, but are not limited to, diseases and / or complications thereof that may benefit from exon skipping of one or more genes of interest. In one embodiment, the genes of interest are selected from the group consisting of SMN1, SMN2, DMD, APP, CEP290, HER2, SCA3, PKM, and MDM4 genes.

[0203] Examples of diseases and / or complications thereof include, but are not limited to, those that can be treated by exon skipping of a target exon. In one embodiment, the target exon is selected from the group consisting of exon 7 of the endogenous SMN1 and SMN2 genes, exons 45, 51, and 53 of the endogenous DMD gene, exon 17 of the endogenous APP gene, exon 41 of the endogenous CEP290 gene, exon 19 of the endogenous HER2 gene, exon 10 of the SCA3 gene, exon 10 of the endogenous PKM gene, and exon 6 of the endogenous MDM4 gene.

[0204] Examples of diseases and / or complications thereof include, but are not limited to, those that can be treated by inhibiting splicing of exons, introns or specific splice junctions of a gene of interest.

[0205] Examples of diseases and / or their complications include, but are not limited to, those that can be treated by restoring the reading frame of a defective gene of interest.

[0206] Examples of diseases and / or their complications include, but are not limited to, those that can be treated by generating different isoforms (eg, dominant negative isoforms) of a gene of interest.

[0207] Examples of diseases and / or complications thereof include, but are not limited to, those that can be treated by skipping a toxic portion of a gene.

[0208] Examples of diseases and / or complications thereof include, but are not limited to, those that can be treated by silencing genes.

[0209] Examples of diseases and / or their complications include, but are not limited to, those that can be treated by altering the structure and function of a gene to obtain a beneficial or desirable isoform.

[0210] Examples of diseases and / or complications thereof include, but are not limited to, those that can be treated by the production of functional proteins encoded by different isoforms of a gene of interest.

[0211] Examples of diseases and / or complications thereof include, but are not limited to, Duchenne muscular dystrophy (DMD), Alzheimer's disease, Joubert syndrome, spinocerebellar ataxia 3 (SCA3), and cancer (e.g., but not limited to, breast cancer, HER2-positive biliary tract cancer, colorectal cancer, non-small cell lung cancer, bladder cancer, prostate cancer, lung cancer, cervical cancer, kidney cancer, papillary thyroid cancer, colon cancer, colorectal cancer, glioma, ovarian cancer, gastric cancer, hepatoblastoma, fibrolamellar carcinoma, hepatocellular carcinoma, soft tissue sarcoma, osteosarcoma, chronic lymphocytic leukemia, acute myeloid leukemia, mantle cell lymphoma, childhood Burkitt's lymphoma, salivary gland cancer, liver cancer, and melanoma).

[0212] In certain embodiments, the ASO (e.g., a bipartite ASO), a composition (e.g., a pharmaceutical composition) comprising the ASO (e.g., a bipartite ASO), and / or a vector encoding the ASO (e.g., a bipartite ASO) is administered in a therapeutically effective amount.

[0213] Examples of subjects include, but are not limited to, mammals such as humans.

[0214] In some embodiments, one or more ASOs designed using one or more methods of the present technology can be used to treat diseases treatable by exon skipping. For example, spinocerebellar ataxia type 3 (SCA3) is a neurodegenerative disease caused by the expansion of a CAG triplet in exon 10 of the ATXN3 gene. ASOs can be used to promote the skipping of exon 9, exon 10, or both to promote potentially functional, partially functional, or non-toxic ATXN3 mutants.

[0215] "Treatment" of an individual (e.g., a mammal, such as a human) or cell is any type of intervention used to alter the natural course of the individual or cell. Treatment includes, but is not limited to, the administration of pharmaceutical compositions or combination therapies and may be performed prophylactically or after the onset of a pathological event or contact with a pathogenic agent. Treatment may include a desired effect on the symptoms or pathology of a disease or condition associated with a dystrophin protein, as in the case of some muscular dystrophies, or may include a minimal change or improvement in one or more measurable markers of the disease or condition being treated. It also includes "prophylactic" treatments that may lead to a slowing of the progression of the disease or condition being treated, a delay in the onset of the disease or condition, or a reduction in the severity of onset. "Treatment" or "prevention" does not necessarily imply complete eradication, cure, or prevention of the disease or condition or its associated symptoms.

[0216] In some embodiments, treatment with one or more ASOs of the present technology, or one or more ASOs of the present technology in combination with one or more additional therapeutic agents (combination therapy), induces or increases de novo production of a functional protein encoded by a gene of interest (e.g., dystrophin in DMD), slows disease progression, slows or alleviates disease symptoms (e.g., in the case of DMD, loss of walking ability, reduced muscle inflammation, reduced muscle damage, improved muscle function, reduced loss of lung function, and / or enhanced muscle regeneration), or any combination thereof that would be expected in the absence of treatment. In some embodiments, treatment maintains or slows disease progression.

[0217] In some embodiments, if the disease is DMD, the treatment maintains ambulatory ability or reduces loss of ambulation. In some embodiments, the treatment maintains pulmonary function or reduces loss of pulmonary function. In some embodiments, the treatment maintains or increases the patient's stable walking distance, e.g., as measured by a 6-minute walk test (6MWT). In some embodiments, the treatment maintains, improves, or reduces the time to walk / run 10 meters (i.e., 10-meter walk / run test). In some embodiments, the treatment maintains, improves, or reduces the time to stand up from a supine position (i.e., time to stand test). In some embodiments, the treatment maintains, improves, or reduces the time to climb four standard stairs (i.e., 4-step stair climbing test). In some embodiments, the treatment maintains, improves, or reduces the patient's muscle inflammation, e.g., as measured by MRI (e.g., MRI of leg muscles). In some embodiments, the MRI measures changes in lower limb muscles. In some embodiments, the MRI measures T2 and / or fat fraction to identify muscle degeneration. MRI can identify changes in muscle structure and composition caused by inflammation, edema, muscle damage, and fatty infiltration. In some embodiments, muscle strength is measured by the North Star Ambulatory Assessment. In some embodiments, muscle strength is measured by the Pediatric Outcomes Data Collection Instrument (PODCI).

[0218] In some embodiments, treatment is with one or more ASOs of the present technology, or one or more ASOs of the present technology in combination with one or more additional therapeutic agents (combination therapy).

[0219] In some embodiments, when the disease is DMD, such treatment reduces muscle inflammation, reduces muscle damage, improves muscle function, and / or enhances muscle regeneration. For example, the treatment may stabilize, maintain, improve, or reduce inflammation in a subject. The treatment may also stabilize, maintain, improve, or reduce muscle damage in a subject. The treatment may also stabilize, maintain, improve, or enhance muscle function in a subject. Additionally, for example, the treatment may stabilize, maintain, improve, or enhance muscle regeneration in a subject. In some embodiments, the treatment maintains, improves, or reduces muscle inflammation in a patient that would be expected in the absence of treatment, as measured, for example, by magnetic resonance imaging (MRI) (e.g., MRI of leg muscles). In some embodiments, treatment with one or more ASOs of the present technology, or a combination of one or more ASOs of the present technology with one or more additional therapeutic agents (combination therapy), increases new dystrophin production and delays or reduces the decline in walking ability that would be expected in the absence of treatment. For example, treatment may maintain, improve, or enhance a subject's walking ability (e.g., stabilization of walking ability). In some embodiments, treatment maintains or increases a patient's stable walking distance as measured by the 6-minute walk test (6MWT), e.g., as described in Craig M. McDonald, et al. The 6-minute walk test in Duchenne / Becker muscular dystrophy: Longitudinal observations. 2010 Oct 29. Muscle Nerve. 42:966-74. doi: 10.1002 / mus.21808 (incorporated herein by reference). Changes in 6-minute walk distance (6MWD) may be expressed as absolute values, percentage changes, or percent predicted changes. In some embodiments, treatment maintains or improves stable walking distance in the 6MWT, which is 20% deficient in subjects compared to healthy age-matched subjects. A DMD patient's performance in the 6MWT compared to the general performance of healthy age-matched subjects can be determined by calculating percent predicted values.For example, for men, the percent predicted 6MWD may be calculated as follows: 196.72 + (39.81 × age) - (1.36 × age²) + (132.28 × height (meters)). For women, the percent predicted 6MWD may be calculated as follows: 188.61 + (51.50 × age) - (1.86 × age²) + (86.10 × height (meters)) (Henricson et al. PLoS Curr., 2012, version 2, incorporated herein by reference). In some embodiments, treatment increases the patient's stable walking distance from baseline to 3, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, or 50 meters or more (including all integers therebetween). Loss of muscle function in DMD patients may occur against the backdrop of normal childhood growth and development. Indeed, young children with DMD may increase the distance walked during the 6MWT over approximately one year despite progressive muscle damage. In some embodiments, the 6MWD of DMD patients is compared to existing normative data from typically developing control subjects and age- and sex-matched subjects. In some embodiments, an age- and height-based equation fitted to the normative data can be used to account for normal growth and development. Such an equation can be used to convert the 6MWD of subjects with DMD to a percent predicted value (% predicted). In some embodiments, analysis of percent predicted 6MWD data represents a method that accounts for normal growth and development and may indicate that the performance of patients with DMD is stable rather than improving early (e.g., age 7 or younger) (Henricson et al. PLoS Curr., 2012, version 2, incorporated herein by reference). Pharmaceutical Formulation (Composition) and Delivery

[0220] In some embodiments, the present technology provides formulations or compositions suitable for therapeutic delivery of ASOs, as described herein.Thus, in some embodiments, the present technology provides pharmaceutically acceptable compositions comprising a therapeutically effective amount of one or more of the oligomers described herein, formulated with one or more pharmaceutically acceptable carriers (additives) and / or diluents.Although the oligomers of the present technology can be administered alone, it is preferable to administer the compound as a pharmaceutical formulation (composition).

[0221] Methods for delivering nucleic acid molecules are described, for example, in Akhtar, et al. Cellular uptake and intracellular fate of antisense oligonucleotides. 1992 May. Trends in Cell Bio. 2:139-144. doi: 10.1016 / 0962-8924(92)90100-2; and Delivery Strategies for ASO Therapeutics, ed. Akhtar; Sullivan et al., PCT WO94 / 02595. These and other protocols can be used to deliver virtually any nucleic acid molecule, including the isolated oligomers of the present technology.

[0222] As described in more detail below, the pharmaceutical compositions of the present technology may be specially formulated for administration in solid or liquid form, including those adapted for (1) oral administration, e.g., via drench (aqueous or non-aqueous solution or suspension), tablet (e.g., intended for buccal, sublingual, and systemic absorption), bolus, powder, granule, or paste to be applied to the tongue; (2) parenteral administration, e.g., via subcutaneous, intramuscular, intravenous, or epidural injection, such as in a sterile solution or suspension or sustained-release formulation; (3) topical application, e.g., via a cream, ointment, or controlled-release patch or spray applied to the skin; (4) vaginal or rectal administration, e.g., via a pessary, cream, or foam; (5) sublingual administration; (6) ophthalmic administration; (7) transdermal administration; or (8) intranasal administration.

[0223] Some examples of substances that can function as pharmaceutically acceptable carriers include, but are not limited to, (1) sugars such as lactose, glucose, and sucrose; (2) starches such as corn starch and potato starch; (3) cellulose and its derivatives such as sodium carboxymethylcellulose, ethyl cellulose, and cellulose acetate; (4) tragacanth powder; (5) malt; (6) gelatin; (7) talc; (8) excipients such as cocoa butter and suppository wax; (9) oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; and (10) propylene glycol. (11) polyols such as glycerin, sorbitol, mannitol, polyethylene glycol, (12) esters such as ethyl oleate and ethyl laurate, (13) agar, (14) buffers such as magnesium hydroxide and aluminum hydroxide, (15) alginic acid, (16) pyrogen-free water, (17) isotonic saline, (18) Ringer's solution, (19) ethyl alcohol, (20) pH buffers, (21) polyesters, polycarbonates, and / or polyanhydrides, and (22) other non-toxic compatible materials used in pharmaceutical formulations.

[0224] Additional non-limiting examples of drugs suitable for formulation with the ASOs of the present technology include PEG-conjugated nucleic acids, phospholipid-conjugated nucleic acids, nucleic acids containing lipophilic moieties, phosphorothioates, P-glycoprotein inhibitors (such as Pluronic P85) that can enhance drug entry into various tissues, biodegradable polymers such as poly(DL-lactide-co-glycolide) microspheres for sustained release delivery after implantation (D.F. Emerich, et al. Biocompatibility of Poly (DL-Lactide-co-Glycolide) Microspheres Implanted into the Brain. 1999 Jan. Cell Transplant. 8, 47-58. doi:10.1177 / 096368979900800114, Alkermes, Inc. Cambridge, Mass.), and loaded nanoparticles such as those composed of polybutylcyanoacrylate that can deliver drugs across the blood-brain barrier and modify neuronal uptake mechanisms (U. Schroeder, et al. Diffusion enhancement of drugs). by loaded nanoparticles in vitro. July 1, 1999. Prog Neuropsychopharmacol Biol Psychiatry. 23, 941-949. doi: 10.1016 / s0278-5846(99)00037-8).

[0225] The present technology also features the use of compositions containing surface-modified liposomes containing poly(ethylene glycol) lipids (PEG-modified, branched and unbranched, or a combination thereof, or long-circulating liposomes or stealth liposomes). The oligomers of the present technology can also contain covalently attached PEG molecules of various molecular weights. These formulations provide a method for increasing drug accumulation in target tissues. This class of drug carriers allows for longer blood circulation times and enhanced tissue exposure of encapsulated drugs by resisting opsonization and elimination by the mononuclear phagocytic system (MPS or RES) (Danilo D. Lasic, et al. The “Stealth” Liposome: A Prototypical Biomaterial. 1995 Dec 1. Chem. Rev. 95, 2601-2627. doi: 10.1021 / cr00040a001; H. Ishiwata, et al. Physical-Chemistry Characteristics and Biodistribution of Poly(ethylene glycol)-Coated Liposomes Using Poly(oxyethylene) Cholesteryl Ether. 1995 June. Chem. Pharm. Bull. 43, 1005-1011. doi: 10.1248 / cpb.43.1005).Such liposomes have been shown to selectively accumulate in tumors, likely through extravasation and entrapment in neovascularized target tissues (Danilo D. Lasic, et al. Liposomes Revisited. 1995 Mar 3. Science. 267, 1275-1276. doi: 10.1126 / science.7871422; Naoto Oku, et al. Real-time analysis of liposomal trafficking in tumor-bearing mice by use of positron emission tomography. 1995 Aug 23. Biochimica et Biophysica Acta (BBA) - Biomembranes. 1238, 86-90. doi: 10.1016 / 0005-2736(95)00106-D). Long-circulating liposomes enhance the pharmacokinetics and pharmacodynamics of DNA and RNA compared with conventional cationic liposomes, which are known to accumulate in particular MPS tissues (Y. Liu, et al. Cationic liposome-mediated intravenous gene delivery. 1995 Oct 20. J. Biol. Chem. 42, 24864-24870. doi: 10.1074 / jbc.270.42.24864; Choi et al., International PCT Publication No. WO 96 / 10391; Ansell et al., International PCT Publication No. WO 96 / 10390; Holland et al., International PCT Publication No. WO 96 / 10392). Long-circulating liposomes also tend to better protect drugs from degradation by nucleases compared with cationic liposomes, based on their ability to avoid accumulation in metabolically aggressive MPS tissues such as the liver and spleen.

[0226] In some embodiments, the present technology includes oligomer compositions prepared for delivery as described in U.S. Patent Nos. 6,692,911, 7,163,695, and 7,070,807. In this regard, in one embodiment, the present technology provides oligomers of the present technology in compositions comprising a copolymer of lysine and histidine (HK) (as described in U.S. Patent Nos. 7,163,695, 7,070,807, and 6,692,911), alone or in combination with PEG (e.g., branched or unbranched PEG, or a mixture of both), in combination with PEG and a targeting moiety or any of the foregoing and a crosslinker. In some embodiments, the present technology provides ASOs in compositions comprising gluconate-modified polyhistidine or gluconylated polyhistidine / transferrin polylysine. Those skilled in the art will also recognize that amino acids with similar properties to His and Lys may be substituted within the compositions.

[0227] Some embodiments of the oligomers described herein may contain a basic functional group, such as amino or alkylamino, and thus can form pharmaceutically acceptable salts with pharmaceutically acceptable acids. These salts can be prepared in situ during the administration vehicle or dosage form manufacturing process, or by separately reacting the purified compound of the present technology in its free base form with an appropriate organic or inorganic acid and then isolating the salt thus formed during purification. Representative salts include hydrobromide, hydrochloride, sulfate, bisulfate, phosphate, nitrate, acetate, valerate, oleate, palmitate, stearate, laurate, benzoate, lactate, phosphate, tosylate, citrate, maleate, fumarate, succinate, tartrate, naphthylate, mesylate, glucoheptonate, lactobionate, laurylsulfonate, and the like. (See, e.g., SM Berge, et al. Pharmaceutical Salts. 1977 Jan. J. Pharm. Sci. 66:1-19. doi: 10.1002 / jps.2600660104)

[0228] Pharmaceutically acceptable salts of the subject oligomers include the conventional non-toxic salts or quaternary ammonium salts of the compounds (e.g., salts from non-toxic organic or inorganic acids). For example, such conventional non-toxic salts include those derived from inorganic acids such as hydrochloride, hydrobromic acid, sulfuric acid, sulfamic acid, phosphoric acid, nitric acid, and the like, and those prepared from organic acids such as acetic acid, propionic acid, succinic acid, glycolic acid, stearic acid, lactic acid, malic acid, tartaric acid, citric acid, ascorbic acid, palmitic acid, maleic acid, hydroxymaleic acid, phenylacetic acid, glutamic acid, benzoic acid, salicylic acid, sulfanilic acid, 2-acetoxybenzoic acid, fumaric acid, toluenesulfonic acid, methanesulfonic acid, ethanedisulfonic acid, oxalic acid, isothioic acid, and the like.

[0229] In some embodiments, the oligomers of the present technology may contain one or more acidic functional groups and thus can form pharmaceutically acceptable salts with pharmaceutically acceptable bases. These salts can be prepared in situ during the administration vehicle or dosage form manufacturing process, or by separately reacting the purified compound in free acid form with a suitable base, such as a hydroxide, carbonate, or bicarbonate of a pharmaceutically acceptable metal cation, ammonia, or a pharmaceutically acceptable organic primary, secondary, or tertiary amine. Representative alkali or alkaline earth salts include lithium, sodium, potassium, calcium, magnesium, aluminum salts, and the like. Representative organic amines useful for forming base addition salts include ethylamine, diethylamine, ethylenediamine, ethanolamine, diethanolamine, piperazine, and the like. (See, e.g., SM Berge, et al., supra.)

[0230] Wetting agents, emulsifiers and lubricants (such as sodium lauryl sulfate and magnesium stearate), as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the composition.

[0231] Examples of pharmaceutically acceptable antioxidants include: (1) water-soluble antioxidants (such as ascorbic acid, cysteine ​​hydrochloride, sodium bisulfite, sodium metabisulfite, and sodium sulfite); (2) oil-soluble antioxidants (such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, and α-tocopherol); and (3) metal chelating agents (such as citric acid, ethylenediaminetetraacetic acid (EDTA), sorbitol, tartaric acid, and phosphoric acid).

[0232] Formulations of the present technology include those suitable for oral, nasal, topical (including buccal and sublingual), rectal, vaginal, and / or parenteral administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any method well known in the art of pharmacy. The amount of active ingredient that can be combined with a carrier material to produce a single dosage form will vary depending on the host being treated and the particular mode of administration. The amount of active ingredient that can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound that produces a therapeutic effect. Generally, out of one hundred percent, this amount will range from about 0.1 percent to about 99 percent of the active ingredient, or from about 5 percent to about 70 percent, or from about 10 percent to about 30 percent.

[0233] In some embodiments, the formulations of the present technology comprise an excipient selected from cyclodextrins, celluloses, liposomes, micelle-forming agents (e.g., bile acids), and polymeric carriers (e.g., polyesters and polyanhydrides), and an oligomer of the present technology. In some embodiments, the formulations make the oligomer of the present technology orally bioavailable.

[0234] Methods of preparing these formulations or compositions include the step of bringing into association the oligomer of the present technology with the carrier and, optionally, one or more accessory ingredients. In general, the formulations are prepared by uniformly and intimately bringing into association the compounds of the present technology with liquid carriers, or finely divided solid carriers, or both, and then, if necessary, shaping the product.

[0235] Formulations of the present technology suitable for oral administration may be in the form of capsules, cachets, pills, tablets, lozenges (with flavored bases, usually sucrose and acacia or tragacanth), powders, granules, or solutions or suspensions in aqueous or non-aqueous liquids, or oil-in-water or water-in-oil liquid emulsions, or elixirs or syrups, or pastilles (with inert bases such as gelatin or glycerin, or sucrose or acacia), and / or mouthwashes, each containing a predetermined amount of a compound of the present technology as an active ingredient. The oligomers of the present technology may also be administered as a bolus, electuary, or paste.

[0236] In solid dosage forms of the present technology for oral administration (e.g., capsules, tablets, pills, dragees, powders, granules, lozenges), the active ingredient is incorporated into one or more pharmaceutically acceptable carriers, such as sodium citrate or dicalcium phosphate, and / or (1) fillers or extenders (e.g., starch, lactose, sucrose, glucose, mannitol, and / or silicic acid), (2) binders (e.g., carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidone, sucrose and / or acacia), (3) humectants (e.g., glycerol), (4) disintegrants (e.g., agar, calcium carbonate, potato or tapioca starch, alginic acid, some silicates, sodium carbonate), (5) disintegrants (e.g., agar, calcium carbonate, potato or tapioca starch, alginic acid, some silicates, sodium carbonate), (6) disintegrants (e.g., cereals containing glutathione ... The pharmaceutical composition may be mixed with any of the following: (5) solution retarders (such as paraffin), (6) absorption enhancers (quaternary ammonium compounds or surfactants, such as poloxamers or sodium lauryl sulfate), (7) wetting agents (such as cetyl alcohol, glycerol monostearate, or nonionic surfactants), (8) absorbents (such as kaolin or bentonite clay), (9) lubricants (such as talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate, zinc stearate, sodium stearate, stearic acid, and mixtures thereof), (10) coloring agents, and (11) release-controlling agents (such as crospovidone or ethylcellulose). For capsules, tablets, and pills, the pharmaceutical composition may also contain buffering agents. Solid compositions of a similar type may also be used as fillers in soft and hard-shell gelatin capsules, using excipients such as lactose or milk sugar and high molecular weight polyethylene glycols.

[0237] Tablets may be produced by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared using binders (e.g., gelatin or hydroxypropylmethylcellulose), lubricants, inert diluents, preservatives, disintegrants (e.g., sodium starch glycolate or cross-linked sodium carboxymethylcellulose), surfactants, or dispersing agents. Molded tablets may be produced by molding a mixture of the compound powder moistened with an inert liquid diluent in a suitable machine.

[0238] Tablets and other solid dosage forms of the pharmaceutical compositions of the present technology, such as dragees, capsules, pills, and granules, may be scored or prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical formulation art, as needed. They may also be formulated to provide sustained or controlled release of the active ingredient therein, using hydroxypropylmethylcellulose, other polymer matrices, liposomes, and / or microspheres, in various proportions to provide the desired release profile. They may also be formulated for rapid release, for example, by lyophilization. They may be sterilized, for example, by filtration through a bacteria-retaining filter, or by incorporating a sterilizing agent in the form of a sterile solid composition that can be dissolved in sterile water or other sterile injectable medium immediately before use. These compositions may also contain opacifying agents as needed, and may be composed to release the active ingredient only, or preferentially, in a part of the gastrointestinal tract, optionally with a delayed release. Examples of embedding compositions that can be used include polymeric substances and waxes. The active ingredient may also be in microencapsulated form, if appropriate, with one or more of the above-mentioned excipients.

[0239] The liquid dosage form for oral administration of the compounds of the present technology includes pharmaceutically acceptable emulsion, microemulsion, solution, suspension, syrup and elixir.In addition to active ingredient, liquid dosage form may contain inert diluents commonly used in the art, such as water or other solvents, solubilizers and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oil (especially cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil and sesame oil), glycerol, tetrahydrofuryl alcohol, polyethylene glycol and fatty acid esters of sorbitan, and their mixtures.

[0240] Besides inert diluents, the oral compositions can also include adjuvants such as wetting agents, emulsifying agents, suspending agents, sweetening agents, flavoring agents, coloring agents, perfuming agents, preservatives, and the like.

[0241] Suspensions may contain, in addition to the active compound, suspending agents such as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol or sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar, and tragacanth, and mixtures thereof.

[0242] Preparations for rectal or vaginal administration may be presented as suppositories. Suppositories may be prepared by mixing one or more compounds of the present technology with one or more suitable non-irritating excipients or carriers, including, for example, cocoa butter, polyethylene glycol, suppository wax or salicylate, which are solid at room temperature but become liquid at body temperature, and thus melt in the rectum or vaginal cavity to release the active compound.

[0243] The preparations or dosage forms for topical or transdermal administration of oligomers provided herein include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches, and inhalants.The active oligomers may be mixed under sterile conditions with a pharmaceutically acceptable carrier, and optionally with preservatives, buffers, or propellants.Ointments, pastes, creams, and gels may contain, in addition to the active compounds of the present technology, excipients such as animal and vegetable fats, oils, waxes, paraffins, starches, tragacanth, cellulose derivatives, polyethylene glycol, silicones, bentonite, silicic acid, talc, zinc oxide, or mixtures thereof.

[0244] Powders and sprays can contain, in addition to the oligomer of the present technology, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicate, polyamide powder, or mixtures of these substances. Sprays can additionally contain customary propellants such as chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane.

[0245] Transdermal patches have the additional advantage of delivering the oligomer of the present technology into the body in a controlled manner. Such dosage forms can be prepared by dissolving or dispersing the oligomer in a suitable medium. Absorption enhancers can also be used to increase the flux of the drug across the skin. The rate of such flux can be controlled by providing a rate-controlling membrane or by dispersing the drug in a polymer matrix or gel, among other methods known in the art.

[0246] Pharmaceutical compositions suitable for parenteral administration may comprise one or more oligomers of the present technology in combination with one or more pharmaceutically acceptable sterile isotonic aqueous or non-aqueous solutions, dispersions, suspensions, or emulsions, or sterile powders that may be reconstituted immediately before use into sterile injectable solutions or dispersions, which may contain sugars, alcohols, antioxidants, buffers, bactericides, solutes that adjust the formulation to be isotonic with the recipient's blood, suspending agents, or thickening agents. Examples of suitable aqueous and non-aqueous carriers that may be used in pharmaceutical compositions of the present technology include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, etc.), and suitable mixtures thereof, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by maintaining the required particle size in the case of dispersions, and by the use of surfactants.

[0247] These compositions may also contain auxiliary agents such as preservatives, wetting agents, emulsifying agents, and dispersing agents. Prevention of the action of microorganisms on the subject oligomers may be ensured by the inclusion of various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars and sodium chloride, in the compositions. Furthermore, the absorption of injectable dosage forms may be delayed by the inclusion of agents that delay absorption, such as aluminum monostearate and gelatin.

[0248] In some embodiments, it is desirable to slow the absorption of a drug from subcutaneous or intramuscular injection in order to prolong the effect of the drug. This may be accomplished, among other methods known in the art, by using a liquid suspension of crystalline or amorphous material with poor water solubility. The rate of absorption of the drug depends on its rate of dissolution, which may depend on the size and crystalline form of the crystals. Alternatively, delayed absorption of a parenterally administered drug form can be achieved by dissolving or suspending the drug in an oil vehicle.

[0249] Injectable depot dosage forms may be prepared by forming microencapsule matrices of the subject oligomer in biodegradable polymers such as polylactide-polyglycolide. The release rate of the oligomer can be controlled depending on the ratio of oligomer to polymer and the nature of the particular polymer used. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations may also be prepared by entrapping the drug in liposomes or microemulsions that are compatible with body tissues.

[0250] When the ASOs of the present technology are administered to humans or animals as pharmaceuticals, they can be administered on their own or as a pharmaceutical composition containing, for example, 0.1 to 99% (more preferably, 10 to 30%) of the active ingredient in combination with a pharmaceutically acceptable carrier.

[0251] As described above, the formulations or preparations of the present technology may be administered orally, parenterally, topically, or rectally. They are usually administered in a form suitable for each administration route. For example, they may be administered in the form of tablets or capsules, or in the form of injections, inhalations, eye drops, ointments, suppositories, etc. They may be administered by injection, infusion, or inhalation, or in the form of lotions or ointments for topical administration, or in the form of suppositories for rectal administration.

[0252] The phrases "parenteral administration" and "administered parenterally" as used herein refer to modes of administration other than enteral administration and topical administration, usually by injection, including, but not limited to, intravenous, intramuscular, intra-arterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intra-articular, subcapsular, subarachnoid, intraspinal and intrasternal injection and infusion.

[0253] The phrases "systemic administration" and "peripheral administration" as used herein mean administration of a compound, drug, or other substance by any means other than direct administration to the central nervous system, such that it enters the patient's body and undergoes metabolic and other similar processes (e.g., subcutaneous administration).

[0254] Regardless of the selected route of administration, the ASO and / or pharmaceutical composition of the present technology, which may be used in a suitable hydrated form, may be formulated into a pharmaceutically acceptable dosage form by conventional methods known to those skilled in the art. The actual dosage level of the active ingredient in the pharmaceutical composition of the present technology may be varied to provide an amount of the active ingredient effective to achieve the desired therapeutic response for a particular patient, composition, and method of administration without causing unacceptable toxicity to the patient.

[0255] The selected dosage level will depend upon a variety of factors, including the activity of the particular oligomer of the present technology or its ester, salt, or amide being used, the route of administration, the time of administration, the rate of excretion or metabolism of the particular oligomer being used, the rate and extent of absorption, the duration of treatment, other drugs, compounds and / or substances used in combination with the particular oligomer being used, the age, sex, weight, condition, general health and previous medical history of the patient being treated, and similar factors well known in the medical arts.

[0256] A physician or veterinarian of ordinary skill in the art can easily determine and prescribe the effective amount of pharmaceutical composition required. For example, a physician or veterinarian can start the dosage of the compound of the present technology used in the pharmaceutical composition at a level lower than that required to achieve the desired therapeutic effect, and gradually increase the dosage until the desired effect is achieved. In general, an appropriate daily dose of the compound of the present technology is the lowest amount of compound effective to produce a therapeutic effect. Such an effective amount generally depends on the factors described above. In general, oral, intravenous, intracerebroventricular, and subcutaneous dosages of the compound of the present technology for a patient, when used for the indicated effect, range from about 0.001 to about 1,000 mcg / g / day, about 0.01 to about 500 mcg / g / day, about 0.1 to about 200 mcg / g / day, about 1 to about 160 mcg / g / day, or about 10 to about 150 mcg / g / day.

[0257] If necessary, the effective daily dose of active compound can be administered as 2, 3, 4, 5, 6 or more sub-doses that are administered separately at appropriate intervals throughout the day, optionally in unit dosage form.In some situations, administration is once a day.In some embodiments, administration is one or more times every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days, or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 weeks, or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 months, as needed to maintain the desired expression of functional dystrophin protein.

[0258] Nucleic acid molecules can be administered to cells by a variety of methods familiar to those of skill in the art, including, but not limited to, encapsulation in liposomes, iontophoresis, or incorporation into other vehicles such as hydrogels, cyclodextrins, biodegradable nanocapsules, bioadhesive microspheres, etc., as described herein and known to those of skill in the art. In some embodiments, microemulsification technology may be utilized to improve the bioavailability of lipophilic (water-insoluble) pharmaceuticals. Examples include trimethrin (SK Dordunoo, et al. Preformulation Studies on Solid Dispersions Containing Triamterene or Temazepam in Polyethylene Glycols or Gelucire 44 / 14 for Liquid Filling of Hard Gelatin Capsules. 2008 October. Drug Development and Industrial Pharmacy. 17(12), 1685-1713. doi: 10.3109 / 03639049109057315 and REV 5901 (PC Sheen, et al. Bioavailability of a Poorly Water-Soluble Drug from Tablet and Solid Dispersion in Humans. 1991 July. J. Pharm. Sci. 80(7), 712-714. doi: 10.1002 / jps.2600800722). Among other benefits, microemulsification enhances bioavailability by directing absorption preferentially to the lymphatic system instead of the circulatory system, thereby bypassing the liver and preventing compound destruction in the hepatobiliary circulation.

[0259] In some embodiments, the formulation comprises micelles formed from oligomers as provided herein and at least one amphiphilic carrier, wherein the micelles have an average diameter of less than about 100 nm. In more preferred embodiments, micelles are provided having an average diameter of less than about 50 nm, and in even more preferred embodiments, micelles are provided having an average diameter of less than about 30 nm, or less than about 20 nm.

[0260] While any suitable amphiphilic carrier is considered, currently preferred carriers are generally those that have Generally Regarded as Safe (GRAS) status and are capable of solubilizing the compound and microemulsifying it at later stages when the solution comes into contact with complex aqueous phases (such as those found in the human gastrointestinal tract). Amphiphilic components that meet these requirements typically have an HLB (hydrophilic-lipophilic balance) value of 2 to 20 and contain linear aliphatic radicals ranging from C-6 to C-20. Examples include polyethylene glycolated fatty glycerides and polyethylene glycol.

[0261] Examples of amphiphilic carriers include saturated and monounsaturated polyethylene glycolated fatty acid glycerides (such as those obtained from various fully or partially hydrogenated vegetable oils). Such oils may advantageously consist of tri-, di-, and mono-fatty acid glycerides and the corresponding di- and mono-polyethylene glycol esters of fatty acids. A particularly preferred fatty acid composition includes 4-10% capric acid, 3-9% capric acid, 40-50% lauric acid, 14-24% myristic acid, 4-14% palmitic acid, and 5-15% stearic acid. Another useful class of amphiphilic carriers includes sorbitan and / or sorbitol partially esterified with saturated or monounsaturated fatty acids (SPAN series) or their corresponding ethoxylated analogs (TWEEN series).

[0262] Commercially available amphiphilic carriers can be particularly useful, including the Gelucire series, Labrafil, Labrasol, or Lauroglycol (all manufactured and sold by Gattefosse, Saint-Priest, France), PEG-monooleate, PEG-dioleate, PEG-monolaurate and dilaurate, lecithin, polysorbate 80, and others (manufactured and sold by numerous companies in the United States and around the world).

[0263] In some embodiments, delivery may be achieved by using liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, etc. to introduce the compositions of the present technology into suitable host cells. In particular, the compositions of the present technology may be formulated to be delivered encapsulated in lipid particles, liposomes, vesicles, nanospheres, nanoparticles, etc. The formulation and use of such delivery vehicles can be achieved using known conventional techniques.

[0264] Hydrophilic polymers suitable for use in the present technology are readily soluble in water, can be covalently attached to vesicle-forming lipids, and are tolerated in vivo (i.e., biocompatible) without toxic effects. Suitable polymers include polyethylene glycol (PEG), polylactic acid (also known as polylactide), polyglycolic acid (also known as polyglycolide), polylactic acid-polyglycolic acid copolymers, and polyvinyl alcohol. In some embodiments, the molecular weight of the polymer is from about 100 or 120 daltons to about 5,000 or 10,000 daltons, or from about 300 daltons to about 5,000 daltons. In other embodiments, the molecular weight of the polymer is polyethylene glycol with a molecular weight of about 100 to about 5,000 daltons, or polyethylene glycol with a molecular weight of about 300 to about 5,000 daltons. In some embodiments, the polymer is 750 dalton polyethylene glycol (PEG(750)). Polymers may also be defined by the number of monomers therein. A preferred embodiment of the present technology utilizes a polymer of at least about three monomers, ie, a PEG polymer consisting of three monomers (about 150 daltons).

[0265] Other hydrophilic polymers that may be suitable for use in the present technology include polyvinylpyrrolidone, polymethoxazoline, polyethyloxazoline, polyhydroxypropylmethacrylamide, polymethacrylamide, polydimethylacrylamide, and derivatized celluloses such as hydroxymethylcellulose or hydroxyethylcellulose.

[0266] In some embodiments, the formulations of the present technology comprise a biocompatible polymer selected from the group consisting of polyamides, polycarbonates, polyalkylenes, polymers of acrylic and methacrylic acid esters, polyvinyl polymers, polyglycolides, polysiloxanes, polyurethanes and copolymers thereof, cellulose, polypropylene, polyethylene, polystyrene, polymers of lactic and glycolic acid, polyanhydrides, poly(ortho)esters, poly(butyric acid), poly(valeric acid), poly(lactide-co-caprolactone), polysaccharides, proteins, polyhyaluronic acid, polycyanoacrylates, and blends, mixtures, or copolymers thereof.

[0267] Cyclodextrins are cyclic oligosaccharides consisting of six, seven, or eight glucose units, designated by the Greek letters α, β, or γ, respectively. The glucose units are linked by α-1,4-glucosidic bonds. As a result of the chair conformation of the sugar units, all secondary hydroxyl groups (C-2, C-3) are located on one side of the ring, and all primary hydroxyl groups on C-6 are located on the other side. As a result, the exterior is hydrophilic, making cyclodextrins water-soluble. In contrast, the cavity of cyclodextrins is hydrophobic because it is lined with hydrogen and ether-like oxygen atoms at atoms C-3 and C-5. These matrices allow complexation with a variety of relatively hydrophobic compounds, including steroid compounds such as 17α-estradiol (see, e.g., Wim van Uden, et al. Cyclodextrins as a useful tool for bioconversions in plant cell biotechnology. 1994 Sep. Plant Cell Tissue and Org. Cult. 38:103-113. doi: 10.1007 / BF00033867). Complexation occurs through van der Waals interactions and hydrogen bond formation. For a general overview of cyclodextrin chemistry, see Wenz, Agnew. Chem. Int. Ed. Engl., 33:803-822 (1994).

[0268] The physicochemical properties of cyclodextrin derivatives depend largely on their type and degree of substitution. For example, their solubility in water ranges from insoluble (e.g., triacetyl-β-cyclodextrin) to 147% solubility (w / v) (G-2-β-cyclodextrin). Furthermore, they are soluble in many organic solvents. The properties of cyclodextrins allow for the control of the solubility of various formulation components by increasing or decreasing their solubility.

[0269] Numerous cyclodextrins and methods for their preparation have been described. For example, Parmeter (I) et al. (U.S. Pat. No. 3,453,259) and Gramera et al. (U.S. Pat. No. 3,459,731) describe electrically neutral cyclodextrins. Other derivatives include cationic cyclodextrins (Parmeter (II), U.S. Pat. No. 3,453,257), insoluble crosslinked cyclodextrins (Solms, U.S. Pat. No. 3,420,788), and anionic cyclodextrins (Parmeter (III), U.S. Pat. No. 3,426,011). Among anionic cyclodextrin derivatives, carboxylic acids, phosphorous acids, phosphinic acids, phosphonic acids, phosphoric acids, thiophosphonic acids, thiosulfinic acids, and sulfonic acids are added to the parent cyclodextrin (see Parmeter (III) above). Additionally, sulfoalkyl ether cyclodextrin derivatives have been described by Stella et al. (US Pat. No. 5,134,127).

[0270] Liposomes consist of at least one lipid bilayer membrane surrounding an aqueous interior compartment. Liposomes may be characterized by membrane type and size. Small unilamellar vesicles (SUVs) have a single membrane and typically range in diameter from 0.02 to 0.05 μm. Large unilamellar vesicles (LUVS) are typically larger than 0.05 μm. Oligolamellar and multilamellar vesicles have multiple membrane layers, typically concentric, and typically larger than 0.1 μm. Liposomes with multiple non-concentric membranes, i.e., multiple smaller vesicles contained within a larger vesicle, are called multivesicular.

[0271] One aspect of the present technology relates to a formulation comprising liposomes containing an oligomer of the present technology, wherein the liposome membrane is formulated to enhance the loading capacity of the liposome. Alternatively or additionally, the compound of the present technology may be contained within or adsorbed onto the liposome bilayer of the liposome. The oligomer of the present technology may be aggregated with a lipid surfactant and loaded within the interior space of the liposome. In these embodiments, the liposome membrane is formulated to resist the disruptive effect of the active agent-surfactant aggregate.

[0272] According to one embodiment of the present technology, the lipid bilayer of the liposome contains lipids derivatized with polyethylene glycol (PEG), such that the PEG chains extend from the inner surface of the lipid bilayer into the interior space enclosed by the liposome and from the exterior of the lipid bilayer to the surrounding environment.

[0273] The active agent contained within the liposomes of the present technology is in a solubilized form. Aggregates of surfactant and active agent (such as emulsions or micelles containing the active agent of interest) may be entrapped within the interior space of the liposomes of the present technology. The surfactant acts to disperse and solubilize the active agent and may be selected from any suitable aliphatic, alicyclic, or aromatic surfactant, including, but not limited to, biocompatible lysophosphatidylcholines (LPGs) of various chain lengths (e.g., from about C14 to about C20). Polymer-derivatized lipids, such as PEG lipids, may also be used for micelle formation, as they act to inhibit micelle / membrane fusion and the addition of polymers to the surfactant molecule lowers the surfactant's CMC, promoting micelle formation. Surfactants with CMCs in the micromolar range are preferred. Surfactants with higher CMCs may be used to prepare micelles entrapped within the liposomes of the present technology.

[0274] Liposomes according to the present technology may be prepared by any of a variety of techniques known in the art. See, for example, U.S. Patent No. 4,235,871, published PCT application WO96 / 14057, New RRC, Liposomes: A practical approach, IRL Press, Oxford (1990), pp. 33-104; Lasic D, Liposomes from physics to applications, Elsevier Science Publishers BV, Amsterdam, 1993. For example, liposomes according to the present technology may be prepared by diffusing a lipid derivatized with a hydrophilic polymer into a preformed liposome, e.g., by exposing preformed liposomes to micelles composed of lipid-grafted polymers at a lipid concentration corresponding to the final mole percent of derivatized lipid desired in the liposome. Liposomes containing hydrophilic polymers may also be formed by homogenization, lipid field hydration, or extrusion techniques, as known in the art.

[0275] In another exemplary formulation procedure, the active agent is first dispersed in lysophosphatidylcholine or other low CMC surfactants (including polymer-grafted lipids) that readily solubilize hydrophobic molecules by sonication. The resulting micellar suspension of the active agent is then used to rehydrate a dried lipid sample containing the appropriate mole percent of polymer-grafted lipid or cholesterol. The lipid and active agent suspension is then formed into liposomes using extrusion techniques known in the art, and the resulting liposomes are separated from the non-encapsulated solution by standard column separation.

[0276] In one aspect of the present technology, liposomes are prepared to have a substantially uniform size within a selected size range. One effective method for sizing involves extruding an aqueous suspension of liposomes through a series of polycarbonate membranes with a selected, uniform pore size. The pore size of the membrane roughly corresponds to the maximum size of the liposomes produced by extrusion through that membrane. See, for example, U.S. Patent No. 4,737,323 (April 12, 1988). In some embodiments, reagents such as DharmaFECT® and Lipofectamine® may be used to introduce polynucleotides or proteins into cells.

[0277] The release characteristics of the formulations of this technology depend on the encapsulation material, the concentration of the encapsulated drug, and the presence of release modifiers. For example, release can be manipulated in a pH-dependent manner using a pH-sensitive coating that releases only at low pH, such as in the stomach, or only at high pH, ​​such as in the intestine. Enteric coatings can be used to prevent release until after passage through the stomach. Multiple coatings or mixtures of cyanamide encapsulated with different materials can be used to release first in the stomach and then in the intestine. Release can also be manipulated by including salts or pore-forming agents, thereby enhancing drug release via water uptake or diffusion from the capsule. Excipients that modify the solubility of the drug can also be used to control the release rate. Drugs that enhance matrix degradation or release from the matrix can also be incorporated. These can be added to the drug, added as a separate phase (i.e., as microparticles), or co-dissolved in the polymer phase, depending on the compound. In most embodiments, the amount should be 0.1-30% (w / w polymer). Dissolution accelerators include inorganic salts such as ammonium sulfate and ammonium chloride, organic acids such as citric acid, benzoic acid, and ascorbic acid, inorganic bases such as sodium carbonate, potassium carbonate, calcium carbonate, zinc carbonate, and zinc hydroxide, organic bases such as protamine sulfate, spermine, choline, ethanolamine, diethanolamine, and triethanolamine, and surfactants such as Tween® and Pluronic®. Pore-forming agents (i.e., water-soluble compounds such as inorganic salts and sugars) that add microstructure to the matrix are added as microparticles. Their concentration typically ranges from 1 to 30% (w / w polymer).

[0278] Uptake can also be manipulated by modifying the residence time of the particle in the intestinal tract. This can be achieved, for example, by coating the particle with a mucoadhesive polymer or by selecting a mucoadhesive polymer as the encapsulating material. Examples include most polymers with free carboxyl groups, such as chitosan, cellulose, and especially polyacrylates (as used herein, polyacrylate refers to polymers containing acrylate groups and modified acrylate groups, such as cyanoacrylate and methacrylate).

[0279] The oligomer may be formulated to be contained within or adapted for release by a surgical device, medical instrument, or implant. In some embodiments, an implant may be coated or treated with the oligomer. For example, hydrogels or other polymers, such as biocompatible and / or biodegradable polymers, may be used to coat an implant with the composition of the present technology (i.e., the composition may be adapted for use with a medical device by using hydrogels or other polymers). Polymers and copolymers for coating medical devices with drugs are well known in the art. Examples of implants include, but are not limited to, stents, drug-eluting stents, sutures, prosthetic organs, vascular catheters, dialysis catheters, vascular grafts, artificial heart valves, cardiac pacemakers, implantable cardioverter-defibrillators, IV needles, pins, screws, plates, and other devices for bone fixation and formation, and artificial tissue matrices for wound healing.

[0280] In addition to the methods provided herein, the oligomers used by the present technology, like other pharmaceuticals, can be formulated for administration in any convenient manner for use in human or veterinary medicine. ASOs and their corresponding formulations can be administered alone or in combination with other therapeutic strategies, such as myoblast transplantation, stem cell therapy, administration of aminoglycoside antibiotics, proteasome inhibitors, and upregulation therapy (e.g., upregulation of utrophin, the autosomal paralog of dystrophin), in the treatment of muscular dystrophy.

[0281] The routes of administration described are intended only as a guide, as a skilled practitioner can readily determine the optimum route of administration and dosage for a particular animal or condition. Multiple approaches for introducing functional novel genetic material into cells have been attempted, both in vitro and in vivo (Theodore Friedmann. Progress Toward Human Gene Therapy. 1989. Science. 244:1275-1280. doi: 10.1126 / science.266025). These approaches include incorporating the gene of interest into modified retroviruses (Theodore Friedmann (1989) supra; Steven A. Rosenberg. Immunotherapy and Gene Therapy of Cancer. 1991 Sep 15. Cancer Research. 51(18), suppl.: 5074S-5079S.), incorporating the gene into non-retroviral vectors (e.g., adeno-associated virus vectors) (MA Rosenfeld, et al. In vivo transfer of the human cystic fibrosis transmembrane conductance regulator gene to the airway epithelium. 1992 Jan 10. Cell. 68:143-155. doi: 10.1016 / 0092-8674(92)90213-V; MA Rosenfeld, et al. Adenovirus-Mediated Transfer of a Recombinant α1-Antitrypsin Gene to the Lung Epithelium in Vivo. 1991 April 19. Science. 252:431-434. doi: 10.1126 / science.2017680), or delivery of transgenes linked to heterologous promoter-enhancer elements via liposomes (Theodore Friedmann (1989), supra; Kenneth L. Brigham, et al.Rapid Communication: In vivo Transfection of Murine Lungs with a Functioning Prokaryotic Gene using a Liposome Vehicle. 1989 Oct. Am. J. Med. Sci. 298:278-281. doi: 10.1097 / 00000441-198910000-00013; Elizabeth G. Nabel, et al. Site-Specific Gene Expression in Vivo by Direct Gene Transfer into the Arterial Wall. 1990 Sep. Science. 249:1285-1288. doi: 10.1126 / science.211905; Thomas A. Hazinski, et al. Localization and Induced Expression of Fusion Genes in the Rat Lung. 1991 Nov. Am. J. Resp. Cell Molec. Biol. 4:206-209. doi: 10.1165 / ajrcmb / 4.3.206; and Wang and Huang. pH-sensitive immunoliposomes mediated target-cell-specific delivery and controlled expression of a foreign gene in mouse. 1987 Nov 11. Proc. Natl. Acad. Sci. USA. 84:7851-7855. doi: 10.1073 / pnas.84.22.7851), conjugation to a ligand-specific cation-based transport system (Wu and Wu. Receptor-mediated gene delivery and expression in vivo. 1988 Oct. J. Biol. Chem. 263:14621-14624. doi: 10.1016 / S0021-9258(18)68081-0), or the use of naked DNA expression vectors (Elizabeth G. Nabel, et al.(1990), supra; Jon A. Wolff, et al. Direct Gene Transfer into Mouse Muscle in Vivo. 1990 March 23. Science. 247:1465-1468. doi: 10.1126 / science.1690918). Direct injection of a transgene into tissue produces only localized expression (MA Rosenfeld (1992), supra; MA Rosenfeld, et al. (1991), supra; Kenneth L. Brigham, et al. (1989), supra; Elizabeth G. Nabel (1990), supra; and Thomas A. Hazinski, et al. (1991), supra). Brigham et al. (Rapid Communication: In vivo Transfection of Murine Lungs with a Functioning Prokaryotic Gene using a Liposome Vehicle. 1989 Oct. Am. J. Med. Sci. 298:278-281. doi: 10.1097 / 00000441-198910000-00013 and Clinical Research (1991) 39 (abstract)) reported in vivo transfection of only the lungs of mice after intravenous or intratracheal administration of DNA-liposome complexes. Examples of review articles on human gene therapy procedures include WF Anderson. Human gene therapy. 1992 May 8. Science. 256:808-813. doi: 10.1126 / science.1589762. Combination therapy

[0282] As used herein, "co-administration," "co-administering," or "combination therapy" generally refers to the administration of one or more ASOs of the present technology (e.g., bipartite ASOs) in combination with other therapeutic agents known in the art that are used to treat the same disease or complications thereof that the ASOs treat.

[0283] In one embodiment, the disease is DMD and the other therapeutic agent for treating muscular dystrophy or its complications includes, but is not limited to, corticosteroids (e.g., cortisol, hydrocortisone, prednisone, prednisolone, deflazacort, triamcinolone, methylprednisolone, dexamethasone, betamethasone, aldosterone, fludrocortisone), beta2 adrenergic agonists (e.g., albuterol, salbutamol, levosalbutamol, terbutaline, pirbuterol, procaterol, clenbuterol, metaproterenol, phenobarbital ... Anti-fibrotic drugs (e.g., pegylated interferon, IL-10, pioglitazone, pentoxifylline, atanercept), exon-skipping drugs (e.g., ASOs targeting exon 51, exon 45, or exon 53, including drisapersen, eteplirsen, golodirsen, PRO044, PRO45, PRO051, and PRO053) ), stop codon skipping drugs (e.g., gentamicin or other aminoglycoside antibiotics and ataluren (PTC124)), synthetic anabolic steroids (e.g., oxandrolone), osteoporosis medications (e.g., vitamin D and calcium), constipation medications, including laxatives, angiotensin-converting enzyme (ACE) inhibitors (e.g., benazepril, captopril, enalapril, fosinopril, lisinopril, moexipril, perindopril, quinapril, ramipril, and trandolapril), diuretics, beta-blockers (e.g., bisoprolol), Cardiomyopathy medications including antiarrhythmics (e.g., amiodarone), insulin-like growth factor I (IGF-1), myostatin inhibitors (e.g., neutralizing antibodies such as follistatin, ACE-031, and MYO-029), drugs that increase nitric oxide levels and / or nNOS protein levels or activity (e.g., L-arginine, phosphodiesterase inhibitors (including sildenafil, tadalafil, and pentoxifylline)), class II histone deacetylase (HDAC) inhibitors, small molecules that increase utrophin expression (e.g.,SMT C1100), dietary supplements (e.g., glutamine, creatine monohydrate, conjugated linoleic acid, α-lipoic acid, and β-hydroxy-β-methylbutyric acid), antihistamines (e.g., fexofenadine, loratadine, phenindamine, dexchlorpheniramine, terfenadine, cetirizine), mast cell stabilizers (e.g., sodium cromoglycate, nedocromil sodium, which may be in the form of aerosols, inhalants, eye drops, etc.), coenzymes Q10 (also known as ubiquinone or ubidecarenone), idebenone or other synthetic derivatives of ubidecarenone (e.g., RAXONE® / CATENA®), omega-3, resveratrol, plant sterols / stanols, anticoagulants (e.g., warfarin), anticholinergics (e.g., antimuscarinics (e.g., atropine, benztropine (COGENTIN®), biperiden, chlorpheniramine (CHLOR-TRIMETON), dicyclomine (dicycloverine), dimenhydrinate (DRAMAMINE®), diphenhydramine (BENADRYL®, SOMINEX®, ADVIL®, PM, etc.), doxylamine (UNISOM®), glycopyrrolate (ROBINUL®), ipratropium (ATROVENT®), orphenadose anti-nicotine drugs that may be in the form of inhalants, nebulizer solutions, or tablets and can be administered rectally, orally, transdermally, or parenterally (e.g., bupropion (ZYBAN®, WELLBUTRIN®) and ganglionic blockers including hexamethonium, cough suppressants and ganglionic blockers (e.g., dextromethorphan), non-depolarizing skeletal muscle relaxants (e.g., doxacurium and tubocurarine), ganglionic blockers and temporary smoking cessation aids (e.g., mecamylamine)). The compositions and methods of the present technology can also be used in conjunction with, for example, other gene-based therapeutic approaches (e.g., viral delivery of mini- or micro-dystrophin, mini-utrophin, or trans-splicing recombinant AAV vectors), gene editing including approaches involving zinc-finger nucleases, transcription activator-like (TAL) type III effector nucleases (TALENs), meganucleases, or clustered regularly interspaced short palindromic repeats (CRISPR), or cell-based therapies involving transplantation of various types of progenitor cells, such as ex vivo engineered muscle side population cells (a lineage of uncommitted cells), into muscle fibers.These compositions and methods are also described in Pedro Miura, et al. Utrophin upregulation for treating Duchenne or Becker muscular dystrophy: how close are we? 2006 March. Trends. Mol. Med. 12:122-129. doi: 10.1016 / j.molmed.2006.01.002; Susan Jarmin, et al. New developments in the use of gene therapy to treat Duchenne muscular dystrophy. 2013 December 06. Expert Opin. Biol. Ther. 14:209-230. doi: 10.1517 / 14712598.2014.866087; MA Scully, et al. Review of Phase II and Phase III clinical trials for Duchenne muscular dystrophy. 2012 December 17. Expert Opin. Orphan Drugs. 1:33-46. doi: 10.1517 / 21678707.2013.746939; RJ Fairclough, et al. Progress in therapy for Duchenne muscular dystrophy. 2011 Jul 29. Exp. Physiol. 96:1101-1113. doi: 10.1113 / expphysiol.2010.053025; and Michael J. Blankinship, et al. Gene Therapy Strategies for Duchenne Muscular Dystrophy Utilizing Recombinant Adeno-associated Virus Vectors. 2006 Feb. Mol. Therapy. 13:241-249. doi: 10.1016 / j.ymthe.2005.11.001.

[0284] In some embodiments, one or more ASOs of the present technology are administered in combination with one or more additional therapeutic agents in a pharmaceutically acceptable dosage form. Each therapeutic agent in the combination therapy disclosed herein may be administered alone or in a formulation (also referred to herein as a pharmaceutical composition) comprising the therapeutic agent, one or more pharmaceutically acceptable carriers, excipients, and diluents, according to standard pharmaceutical practice. Each therapeutic agent may be prepared by separately compounding the compound or a pharmaceutically acceptable salt thereof, and both may be administered simultaneously or separately. Furthermore, two formulations may be packaged together to provide a kit formulation. In some embodiments, both compounds may be included in a single formulation. In some embodiments, the therapeutic agents are in the same dosage form, e.g., the same tablet or pharmaceutical composition. In some embodiments, the therapeutic agents are in separate dosage forms with the same mode of administration, e.g., a kit comprising a first pharmaceutical composition suitable for parenteral administration comprising an ASO and a pharmaceutically acceptable carrier, and a second pharmaceutical composition suitable for parenteral administration comprising one or more additional therapeutic agents. In some embodiments, the therapeutic agents are in separate dosage forms with different modes of administration, e.g., a kit comprising a first pharmaceutical composition suitable for parenteral administration comprising the ASO and a pharmaceutically acceptable carrier, a second pharmaceutical composition suitable for oral administration comprising one or more additional therapeutic agents, and optionally a third pharmaceutical composition suitable for oral administration comprising one or more other therapeutic agents.

[0285] Each therapeutic agent in the combination therapy disclosed herein may be administered simultaneously (i.e., the same agent), concurrently (i.e., separate agents administered one after the other in any order), or sequentially in any order. Sequential administration is useful when the therapeutic agents in the combination therapy are in different dosage forms (e.g., one agent is a tablet or capsule and the other is a sterile liquid) and / or when administered on different dosing schedules (e.g., a tablet or capsule is formulated for daily administration, while a composition is formulated for parenteral administration, such as once a week, once every two weeks, or once every three weeks). Furthermore, given the benefit of this technology, those skilled in the art will understand that when multiple therapeutic agents disclosed herein are administered, the therapeutic agents need not share the same mode of administration. An administration mode can be, for example, a kit comprising a first pharmaceutical composition suitable for parenteral administration, comprising an ASO and a pharmaceutically acceptable carrier, and a second pharmaceutical composition suitable for oral administration, comprising an additional therapeutic agent disclosed herein and a pharmaceutically acceptable carrier. Those skilled in the art will understand that simultaneous administration, as referred to above in the context of "co-administer," "co-administration," or "combination therapy," means that the pharmaceutical composition comprising the DMD exon-skipping ASO and the pharmaceutical composition comprising the additional therapeutic agent can be administered on the same schedule, i.e., at the same time or day, or on different schedules, i.e., different, but not necessarily separate, schedules. Other suitable variations of "co-administer," "co-administration," or "combination therapy" will be readily apparent to those skilled in the art given the benefit of the present technology, and are part of the meaning of these terms.

[0286] The compositions and methods of the present technology can also be used in conjunction with other forms of treatment, including, but not limited to, physical exercise (e.g., physical therapy, range of motion exercises), mobility aids, supports, or orthotics (e.g., ankle splints, knee-ankle-ankle orthoses (KAFOs), spinal braces, and wheelchairs), respiratory assistance devices (e.g., ventilators), and surgical treatments (e.g., tendon surgery, scoliosis surgery, pacemaker placement, and heart transplants). The choice of specific treatment may vary and will depend on the severity of the pain, the subject's overall health, and the judgment of the attending physician. Kits containing bipartite ASOs

[0287] In some embodiments, the present technology provides an ASO (e.g., a bipartite ASO) disclosed herein, a composition (e.g., a pharmaceutical composition) comprising an ASO (e.g., a bipartite ASO) disclosed herein, and / or a kit comprising a vector encoding an ASO (e.g., a bipartite ASO) disclosed herein for use in generating or promoting exon skipping of an exon of interest. ASO-mediated exon skipping may be an approach for manipulating the expression of a gene of interest. Expression of a gene of interest can be manipulated by an ASO to inhibit splicing of an exon, intron, or specific splice site of the gene of interest, which may lead, for example, but not limited to, to restoring a defective reading frame of the gene of interest, generating a different isoform of the gene of interest (e.g., a dominant-negative isoform), skipping a toxic portion of the gene, silencing the gene, and / or altering the structure and function of the gene. Examples of exons of interest and genes of interest include, but are not limited to, those disclosed herein.

[0288] In some embodiments, the subject technology provides kits comprising an ASO (e.g., a bipartite ASO) disclosed herein, a composition (e.g., a pharmaceutical composition) comprising an ASO (e.g., a bipartite ASO) disclosed herein, and / or a vector encoding an ASO (e.g., a bipartite ASO) disclosed herein for use in treating a disease and / or its complications. Examples of diseases and / or complications thereof include, but are not limited to, those disclosed herein. Example

[0289] The following examples further illustrate the present technology for illustrative purposes only and should not be construed as limiting the scope of the present technology in any way. Example 1: Examples of bipartite ASOs

[0290] Embodiments of the present technology include bipartite ASOs containing a target sequence and a decoy sequence (see, e.g., Figures 1A and 1B). The target sequence binds with complete or partial complementarity to a sequence in the exon of interest, an adjacent intron sequence upstream of the exon of interest, an adjacent intron sequence downstream of the exon of interest, an intron-exon junction upstream of the exon of interest, or an intron-exon junction downstream of the exon of interest. The decoy sequence, consisting of all or part of an 11-nt sequence (5'-CAGGTAAGTAT-3'), is completely complementary to the free 5' end of the U1 snRNA. Thus, a decoy sequence that simulates the optimal 5' splice site may act as a 5' splice site decoy and prevent U1 snRNA from recognizing the authentic 5' splice site of the exon of interest. In certain embodiments, the decoy sequence may be 12 or 13 nt in length, as shown, for example, in Example 5. Without being bound by any particular theory, the target sequence may not only induce exon skipping to some extent by steric blocking, but also bring a decoy sequence near the 5' splice site of the exon of interest. The decoy sequence may mimic or simulate an optimal 5' splice site, potentially interfering with U1 snRNA recognition of the authentic 5' splice site by U1 snRNA, potentially directly interacting with U1 snRNA. In some instances, the target sequence and decoy sequence act in concert to induce robust exon skipping. While both ends of a bipartite ASO may contain the same or different decoy sequences, the bipartite ASOs tested in Examples 2-15 contain decoys located at either the 5' or 3' end of the bipartite ASO (see, e.g., Figure 1A). The bipartite ASO may exert its function by binding to the exon of interest, its adjacent intronic sequence, or an intron-exon junction via its targeting moiety based on Watson-Crick base pairing (see, e.g., Figure 1B). In some instances, the length of the optimal decoy sequence may vary from 6 nt to 11 nt. See Table 1 for the scientific names and sequences of all decoys tested.

[0291] In the Examples section, unless otherwise specified, an L in a decoy or ASO name means that the decoy is located at the 5' end of the bipartite ASO, and an R in a decoy or ASO name means that the decoy is located at the 3' end of the bipartite ASO. For example, L6a means that the 6a decoy sequence is located at the 5' end of the bipartite ASO, and R6a means that the 6a decoy sequence is located at the 3' end of the bipartite ASO.

[0292] All ASOs tested in Examples 2-15 were 2'-O-methoxyethyl (MOE) modified with a phosphorothioate (PS) backbone, and all cytosines were 5-methylcytosines. Similar ASOs with other uniform modifications (e.g., but not limited to, phosphorodiamidates and morpholinos, including constrained ethyls (cEt)) or mixed modifications should also work.

[0293] [Table 1-1]

[0294] [Table 1-2] Example 2: Testing the exon skipping efficiency of ASOs

[0295] To test the exon skipping efficiency of ASOs in vitro, HEK293, RD, HeLa, or A549 cells were transfected with ASOs (12.5, 25, 40, or 50 nM) as shown in Tables 2–12. Each ASO was transfected into the desired cells using Lipofectamine 2000, and buffer alone was used as a negative control. Two days after transfection, cells were harvested, and total RNA samples were isolated for splicing analysis by semiquantitative fluorescent RT-PCR.

[0296] Several ASO target sequences were used to demonstrate that bipartite ASOs containing a decoy and the corresponding target sequence are much more effective at inhibiting exon splicing than the target sequence alone. All ASOs were modified with a phosphorothioate (PS) backbone and all 5-methylcytosines (5mC) with 2'-O-methoxyethyl (MOE). Etep is the abbreviation for eteplirsen. Note that the eteplirsen used here was modified with MOE / PS / 5mC rather than the original morpholino / phosphorodiamidate modifications. Example 3: ASO-induced exon 7 skipping of the SMN1 and SMN2 genes

[0297] An 11-nt decoy sequence (e.g., 5′-CAGGTAAGTAT-3′) statistically significantly enhanced the effect of three ASO target sequences (2203, 1938, and 0120) on exon 7 skipping of the endogenous SMN1 and SMN2 genes in HEK293 cells, as shown in Figures 2A–2D. Figure 2A shows a schematic diagram of the target region of the SMN1 / 2 gene. The three ASO target sequences bind with perfect complementarity to their respective SMN1 / 2 pre-mRNA target sequences. ASO target sequence 2203 targets a 20-nt sequence from positions −22 to −3 in intron 6, ASO target sequence 1938 targets a 20-nt sequence from positions 19 to 38 in exon 7, and ASO target sequence 0120 targets a 20-nt sequence from positions 1 to 20 in intron 7. As shown in Figure 2B, when a decoy was attached to the 5′ end of ASO target sequence 2203 (2203-L11) or the 3′ end of ASO target sequence 2203 (2203-R11), it enhanced the effect of ASO target sequence 2203 in promoting exon 7 skipping. Each ASO was transfected into HEK293 cells using Lipofectamine 2000 at 12.5, 25, or 50 nM, and buffer alone was used as a negative control. Two days after transfection, cell samples were harvested, and total RNA was purified for splicing analysis by semiquantitative fluorescent RT-PCR (Y. Gao, et al. Systematic characterization of short intronic splicing-regulatory elements in SMN2 pre-mRNA. 2022 Jan 08. Nucleic Acids Research. 50: 731-749. doi: 10.1093 / nar / gkab1280). To distinguish the origin (SMN1 or SMN2), PCR products were digested with DdeI. The percentage of exon 7 excluded (%excl) in the total transcript of each gene was calculated. Quantification of the data (n = 3) is shown in Figure 2B, center panel (SMN1) and right panel (SMN2).As shown in Figure 2C, attaching a decoy to the 5' end (1938-L11) or the 3' end (1938-R11) of ASO targeting sequence 1938 enhanced the effect of ASO targeting sequence 1938 on promoting exon 7 skipping. The experimental procedure for evaluating the effect of ASOs containing targeting sequence 1938 was the same as that for ASOs containing targeting sequence 2203. As shown in Figure 2D, attaching a decoy to the 5' end (0120-L11) or the 3' end (0120-R11) of ASO0120 enhanced the effect of ASO targeting sequence 0120 on promoting exon 7 skipping. The experimental procedure for evaluating the effect of ASOs containing targeting sequence 0120 was the same as that for ASOs containing targeting sequence 2203 and 0120. Representative examples from three independent experiments for ASOs containing target sequences 2203 (2203, 2203-L11, 2203-R11), 1938 (1938, 1938-L11, 1938-R11), and 0120 (0120, 0120-L11, 0120-R11) are shown in the left panels of Figure 2B-2D, respectively (FL: full-length transcript; Δ7: transcript with exon 7 skipping). Quantification of data (n = 3) for ASOs containing target sequences 2203, 1938, or 0120 is shown as the mean ± standard deviation in the middle panels (SMN1) and right panels (SMN2) of Figure 2B-2D, respectively. *P<0.05, **P<0.01 compared to the corresponding ASO containing only the target sequence (e.g., 2203, 1938, or 0120). All ASOs have a phosphorothioate backbone and all 5-methylcytosines are modified with 2'-O-methoxyethyl. ASOs 2203-L11, 1938-L11, 1938-R11, and 0120-L11 are optimal ASOs. See Table 1 for sequence information of the decoy sequences, and see Table 2 for sequence information of the ASOs and target sequences tested in Example 3.The target sequence (5' to 3') in SMN1 / 2 mRNA complementary to ASO target sequence 2203 is ACUUCCUUUAUUUUCCUUAC (sequence number 24), the target sequence (5' to 3') in SMN1 / 2 mRNA complementary to ASO target sequence 1938 is AAAGAAGGAAGGUGCUCACA (sequence number 28), and the target sequence (5' to 3') in SMN1 / 2 mRNA complementary to ASO target sequence 0120 is GUAAGUCUGCCAGCAUUAUG (sequence number 32).

[0298] As shown in Figures 2B-2D, ASOs containing decoy sequence 11 attached to target sequences transfected at low concentrations can achieve a similar rate (% excl) of SMN1 / 2 exon 7 as ASOs consisting of target sequences transfected at high concentrations. As shown in the left panel of Figure 2B, 2203-L11 (12.5 nM) achieved a similar rate of SMN1 exon 7 exclusion as target sequence 2203 (50 nM). The exon 7 exclusion rate of SMN1 by 2203-L11 (12.5 nM) was approximately 2.3-fold higher than that of target sequence 2203 (25 nM) and 4-fold higher than that of target sequence 2203 at the same concentration. Similar results were observed with 2203-R11 and 2203. At half the doses of 2203-R11 (12.5 nM and 25 nM), the exon 7 exclusion rate of SMN1 was comparable to that of target sequence 2203 (25 nM and 50 nM), respectively. 2203-R11 (12.5 nM) demonstrated comparable performance to target sequence 2203 (25 nM) in skipping exon 7 of the SMN2 gene. As shown in the left panel of Figure 2C, at the same concentration of 12.5 nM, the exon 7 exclusion rate of SMN1 by 1938-R11 was approximately 2.18-fold higher than that of target sequence 1938 (25 nM), and comparable to that of target sequence 1938 (25 nM). Figure 2D shows that 0120-L11 (12.5 nM) achieved comparable exon 7 exclusion rate to that of target sequence 0120 (50 nM).

[0299] Three 5-nt decoy sequences (AGGTA or 5b, GTAAG or 5d, and AGTAT or 5g) attached to either side of the ASO target sequence 1938 were tested against SMN2 exon 7 splicing. ASO1938-R5b (SEQ ID NO: 354: 5′-TGTGAGCACCTTCCTTCTTTAGGTA-3′) was relatively potent and showed a skipping effect comparable to that of 1938-R11 (Figure 2C), whereas 1938-R5d (SEQ ID NO: 355: 5′-TGTGAGCACCTTCCTTCTTTGTAAG-3′) and 1938-R5g (SEQ ID NO: 356: 5′-TGTGAGCACCTTCCTTCTTTAGTAT-3′) were moderate in promoting exon 7 skipping. Example 4: ASO-induced exon 51 skipping of the DMD gene

[0300] For example, as shown in Figures 3A and 3B, an 11-nt decoy sequence (e.g., 5'-CAGGTAAGTAT-3') statistically significantly improved the effectiveness of multiple ASO target sequences in promoting exon 51 skipping of the endogenous DMD gene. RD cells were transfected with each ASO or ASO target sequence at the indicated concentrations using Lipofectamine 2000. Two days after transfection, cells were harvested, and total RNA samples were isolated for splicing analysis by semi-quantitative fluorescent RT-PCR. As shown in Figure 3A, in some embodiments, ASO target sequences with decoy sequences at the 5' end (148-L11, 155-L11, and 165-L11) exhibited higher exon skipping efficacy than the respective ASOs without decoy sequences (148, 155, and 165). ASOs with decoy sequences at the 3' end (148-R11, 155-R11, and 165-R11) exhibited minimal differences from the respective ASO target sequences without decoy sequences. The ASO target sequences 148, 155, and 165 target different regions of DMD exon 51 with perfect complementarity. As shown in Figure 3B, in some embodiments, the decoy sequence on the ASO target sequence significantly enhanced the efficacy of MOE eteplirsen (Etep) when placed at the 5' end (Etep-L11), but no effect was observed when placed at the 3' end (Etep-R11). A representative example of four independent experiments for ASOs containing target sequences 148 (148, 148-L11, and 148-R11), 155 (155, 155-L11, and 155-R11), and 165 (165, 165-L11, and 165-R11) is shown in the left panel of Figure 3A. A representative gel of four independent experiments for ASOs containing target sequences Etep (Etep, Etep-L11, Etep-R11) is shown in the left panel of Figure 3B. FL: full-length transcript; Δ51: transcript with exon 51 skipped.

[0301] Quantification of exon 51 skipping data (n = 4) for ASOs containing target sequences 148, 155, 165, or Etep is shown as mean ± standard deviation in the right panels of Figures 3A-3B. *P < 0.05 (148-L11 vs. 148), **P < 0.01 (155-L11 vs. 155, 165-L11 vs. 165, or Etep-L11 vs. Etep). ASOs 148-L11, 155-L11, 165-L11, Etep-L11, and Etep-R11 were optimal ASOs. See Table 1 for sequence information of decoy sequences, and Table 2 for sequence information of ASOs and target sequences tested in Example 4. The target sequence (5' to 3') in the DMD mRNA that is complementary to ASO target sequence 148 is AAUGCCAUCUUCCUUGAUG (sequence number 36), the target sequence (5' to 3') in the DMD mRNA that is complementary to ASO target sequence 155 is AACUAGAAAUGCCAUCUUC (sequence number 40), the target sequence (5' to 3') in the DMD mRNA that is complementary to ASO target sequence 165 is GCCAUCUCCAAACUAGAAA (sequence number 44), and the target sequence (5' to 3') in the DMD mRNA that is complementary to ASO target sequence Etep is CUAGAAAUGCCAUCUUCCUUGAUGUUGGAG (sequence number 48).

[0302] The rate of exclusion of exon 51 of DMD by Etep-L11 (12.5 nM) was comparable to that of the target sequence Etep (25 nM).

[0303] [Table 2-1]

[0304] [Table 2-2]

[0305] [Table 2-3]

[0306] Example 5: ASO-induced exon 51 skipping with decoy sequences of different lengths attached to the 5' end ("L") of the target sequence eteplirsen in the DMD gene

[0307] Bipartite ASOs with decoy sequences of different lengths may have different degrees of effect on the ASO's ability to promote exon skipping in the DMD gene, as shown in Figure 4. Twenty-three 5' splice site decoy sequences ranging from 6 to 13 nt in length were tested in the context of the target sequence eteplirsen (Etep). The 12-nt (L12) and 13-nt (L13) decoy sequences tested were complementary to the first 12 and 13 nt of the 5' end of U1 snRNA, respectively. The decoy sequences were located at the 5' end of the bipartite ASO. All tested ASOs were MOE-modified with a PS backbone. RD cells were transfected with 25 nM of each ASO using Lipofectamine 2000, and buffer alone was used as a negative control. Two days after transfection, cells were harvested, and total RNA samples were isolated for splicing analysis by semiquantitative fluorescent RT-PCR. All tested bipartite ASOs showed statistically significant stronger effects on exon 51 skipping of the DMD gene than eteplirsen alone. A representative example of three independent experiments is shown in Figure 4 (in the upper panel, FL: full-length transcript; Δ51: transcript with exon 51 skipping). Quantification of data (n = 3) is shown in the lower panel of Figure 4 as mean ± standard deviation. #P < 0.05 (all vs. Etep), *P < 0.05, **P < 0.01 (all vs. Etep-L11). ASOs Etep-L7c, Etep-L8b, Etep-L8c, Etep-L9b, and Etep-L10a were optimal ASOs (Figure 4). For sequence information of the decoy sequences, see Table 1. For sequence information of the ASOs and target sequences tested in Example 5, see Table 3. The sequence of interest (5' to 3') in DMD exon 51 is CUAGAAAUGCCAUCUUCCUUGAUGUUGGAG (SEQ ID NO: 48).

[0308] [Table 3-1]

[0309] [Table 3-2]

[0310] Example 6: ASO-induced exon 51 skipping with decoy sequences of different lengths attached to the 5' end ("L") of the target sequence 000A in the DMD gene

[0311] Bipartite ASOs with decoy sequences of different lengths may have different degrees of effect on the ASO's ability to promote exon skipping in the DMD gene, as shown in Figure 5. Fifteen decoys ranging in length from 7 to 11 nt were tested. The decoy sequences were located at the 5' end of the bipartite ASOs. The target sequence, 000A, was 21 nt long and targeted positions 50 to 70 of DMD exon 51. All tested ASOs were MOE-modified with a PS backbone, and all cytosines were 5-methylcytosines. RD cells were transfected with 25 nM of each ASO using Lipofectamine 2000. Buffer alone was used as a negative control. Two days after transfection, cells were harvested, and total RNA samples were isolated for splicing analysis by semiquantitative fluorescent RT-PCR. ASO000A slightly promoted exon 51 skipping in DMD. Bipartite ASOs containing a decoy at the 5' end ("L") statistically significantly improved the exon skipping effect of 000A. A representative gel of one of three independent experiments is shown in Figure 5 (top panel: FL: full-length transcript; Δ51: transcript with exon 51 skipped). Quantification of data (n = 3) is shown in the bottom panel of Figure 5 as mean ± standard deviation. *P < 0.05, **P < 0.01, all vs. 000A. 000A-L7c, 000A-L8c, 000A-L9a, 000A-L9b, 000A-L9c, 000A-L10a, and 000A-L10b were optimal ASOs (Figure 5). See Table 1 for sequence information of the decoy sequences, and Table 4 for sequence information of the ASOs and target sequences tested in Example 6. The sequence of interest (5' to 3') in DMD exon 51 is AACUGCCAUCUCCAAACUAGA (SEQ ID NO: 74).

[0312] [Table 4]

[0313] Example 7: ASO-induced exon 51 skipping of the DMD gene in the tibialis anterior and gastrocnemius muscles of DMD-humanized mice

[0314] We tested multiple bipartite ASOs targeting DMD exon 51 skipping in DMD humanized mice. In the mouse model, a 10,766-nt mouse genomic fragment spanning the last 9,053 nt of DMD intron 50, 233 nt of exon 51, and the first 1,480 nt of intron 51, was replaced with the corresponding human genomic fragments (800 nt of intron 50, 233 nt of exon 51, and 800 nt of intron 51). Each ASO was administered at 150 mg / kg / injection every other day to approximately 8-week-old male humanized mice. A total of three injections were administered. Three days after the last injection, mice were euthanized, and muscle samples were collected for RT-PCR analysis by semiquantitative fluorescent RT-PCR. As shown in Figure 6, all bipartite ASOs statistically significantly promoted DMD exon 51 skipping compared to eteplirsen (Etep) alone, which targets the MOE / PS type of the target sequence. The most potent, Etep-L8c, increased exon 51 skipping by more than 10-fold. A representative example of three independent experiments is shown in Figure 6 (top left panel shows tibialis anterior muscle, top right panel shows gastrocnemius muscle; FL: full-length transcript; Δ51: transcript with exon 51 skipping). Quantification of data (n = 3) is shown as mean ± standard deviation in the bottom panel of Figure 6 (bottom left panel shows tibialis anterior muscle, bottom right panel shows gastrocnemius muscle). *P < 0.05, **P < 0.01, ***P < 0.001, all vs. Etep. See Table 1 for sequence information of the decoy sequences, and see Tables 3 and 4 for sequence information of the ASO and target sequences tested in Example 7.

[0315] In one ASO containing a decoy, the exon skipping rate was increased by an average of more than 14-fold compared to an ASO containing the same target sequence but without the decoy. Example 8: ASO-induced exon 53 skipping with decoy sequences of different lengths in the DMD gene

[0316] Fifteen decoys ranging in length from 7 to 11 nt were tested in the context of the MOE / PS-type target sequence viltolarsen (Vilto) in RD cells. Viltolarsen is an FDA-approved 21-nt PMO used for DMD treatment, promoting DMD exon 53 skipping by targeting the region between positions 36 and 56 within the exon. RD cells were transfected with 25 nM of each ASO using Lipofectamine 2000. Buffer alone was used as a negative control. Two days after transfection, cells were harvested, and total RNA samples were isolated for splicing analysis by semiquantitative fluorescent RT-PCR. The bipartite ASOs tested contained decoys attached to the 5' ("L") terminus of the target sequence viltolarsen (L7a-L7e, L8a-L8d, L9a-L9c, L10a, L10b, and L11) or the 3' ("R") terminus of the target sequence viltolarsen (R7a-R7e, R8a-R8d, R9a-R9c, R10a, R10b, and R11). As shown in Figure 7, the target sequence viltolarsen (Vilto) alone slightly promoted DMD exon 53 skipping. Some bipartite ASOs, especially when the decoy was placed at the 3' end of the bipartite ASO, statistically significantly improved the exon skipping effect of viltolarsen alone. One representative example of three independent experiments is shown in Figure 7 (the upper left panel shows a bipartite ASO containing a decoy attached to the 5' end of the target sequence viltolarsen; the upper right panel shows a bipartite ASO containing a decoy attached to the 3' end of the target sequence viltolarsen; FL: full-length transcript; Δ53: transcript with exon 53 skipped). Quantification of the data (n = 3) is shown as the mean ± standard deviation in the lower panel of Figure 7 (the lower left panel shows a bipartite ASO containing a decoy attached to the 5' end of the target sequence viltolarsen; the lower right panel shows a bipartite ASO containing a decoy attached to the 3' end of the target sequence viltolarsen). *P < 0.05, **P < 0.01, ***P < 0.001, all vs. viltolarsen). ASOs Vilto-L9b, Vilto-R7b, Vilto-R7c, Vilto-R8b, Vilto-R8c, and Vilto-R8d are the optimal ASOs (Figure 7).See Table 1 for sequence information of the decoy sequence and Table 5 for sequence information of the ASO and target sequences tested in Example 8. The sequence of interest (5' to 3') in DMD exon 53 is GAACACCUUCAGAACCGGAGG (SEQ ID NO: 91).

[0317] [Table 5-1]

[0318] [Table 5-2]

[0319] [Table 5-3] Example 9: ASO-induced partial exon 45 skipping with decoy sequences of different lengths in the DMD gene

[0320] We tested 15 decoys ranging in length from 7 to 11 nt in the context of the target sequence, ASO002A. ASO002A targets the junction between DMD exon 45 and intron 45. By promoting skipping of the last 32 nt of exon 45 (hereafter referred to as partial exon skipping), it can restore the reading frame in patients harboring frameshift mutations, similar to skipping of the entire 176 nt of exon 45. As shown in Figure 8A, ASO002A can cause skipping of the last 32 nt of exon 45 by activating a cryptic 5′ splice site (indicated by an arrow) in DMD exon 45. This small 32 nt portion of DMD exon 45 is referred to as 45s. Skipping 45s, rather than the entire 176 nt of exon 45, may benefit patients.

[0321] RD cells were transfected with 25 nM of each ASO using Lipofectamine 2000. Buffer alone was used as a negative control. Two days after transfection, cells were harvested, and total RNA samples were isolated for splicing analysis by semi-quantitative fluorescent RT-PCR. The bipartite ASOs tested contained decoys attached to the 5' ("L") end of target sequence 002A (L7a-L7e, L8a-L8d, L9a-L9c, L10a, L10b, and L11 (Figure 8B, left column)) or the 3' ("R") end of target sequence 002A (R7a-R7e, R8a-R8d, R9a-R9c, R10a, R10b, and R11 (Figure 8B, right column)). The target sequence 002A alone (002A) slightly promoted the skipping of a 32-nt portion of exon 45 (Figure 8B). Some bipartite ASOs, especially when a decoy was placed at the 5′ end of the bipartite ASO, statistically significantly enhanced the partial exon skipping effect of the target sequence 002A alone. One representative example of three independent experiments is shown in Figure 8B (top left panel shows a bipartite ASO containing a decoy attached to the 5′ end of the target sequence 002A; top right panel shows a bipartite ASO containing a decoy attached to the 3′ end of the target sequence 002A; FL: full-length transcript; Δ45s: transcript skipped at 45 seconds). Quantification of the data (n = 3) is shown as the mean ± standard deviation in the bottom panels of Figure 8B (the bottom left panel shows a bipartite ASO containing a decoy attached to the 5' end of the target sequence 002A, and the bottom right panel shows a bipartite ASO containing a decoy attached to the 3' end of the target sequence 002A). *P < 0.05, **P < 0.01, all vs. 002A. ASOs 002A-L7c, 002A-L8c, and 002A-R7e are the optimal ASOs (Figure 8B). See Table 1 for sequence information of the decoy sequences, and see Table 6 for sequence information of the ASOs and target sequences tested in Example 9. The sequence of interest (5' to 3') at the junction of DMD exon 45 and intron 45 is CAGAAAAAAGAGGUAGGGCGAC (SEQ ID NO: 123).

[0322] [Table 6-1]

[0323] [Table 6-2]

[0324] [Table 6-3] Example 10: ASO-induced exon 17 skipping of the APP gene with decoy sequences of different lengths

[0325] Fifteen decoy sequences ranging in length from 7 to 11 nt were tested in the context of the target sequence, ASO014B. ASO014B targets exon 17 of the APP gene and promotes exon skipping in the endogenous APP gene. 50 nM of each ASO was transfected into HEK293T cells using Lipofectamine 2000; buffer alone was used as a negative control. Two days after transfection, cells were harvested, and total RNA samples were isolated for splicing analysis by semiquantitative fluorescent RT-PCR.

[0326] The bipartite ASOs tested contained decoys attached to the 5′ (“L”) end of target sequence 014B (014B-L7a to 014B-L7e, 014B-L8a to 014B-L8d, 014B-L9a to 014B-L9c, 014B-L10a to 014B-L10b, and 014B-L11 (Figure 9A)) or the 3′ (“R”) end of target sequence 014B (014B-R7a to 014B-R7e, 014B-R8a to 014B-R8d, 014B-R9a to 014B-R9c, 014B-R10a, 014B-R10b, and 014B-R11 (Figure 9B)).

[0327] Most bipartite ASOs, regardless of whether the decoy was attached to the 5' or 3' end of the bipartite ASO, statistically significantly enhanced the exon skipping effect of the target sequence 014B alone (014B), with the most potent being 014B-L8c. Representative examples of three independent experiments for a bipartite ASO containing a decoy attached to the 5' end of the target sequence 014B and a bipartite ASO containing a decoy attached to the 3' end of the target sequence 014B are shown in the left panels of Figures 9A and 9B, respectively (FL: full-length transcript; Δ17: transcript with exon 17 skipped). Quantification of the data (n=3) is shown as the mean ± standard deviation in the right panels of Figures 9A and 9B (the right panel of Figure 9A shows a bipartite ASO containing a decoy attached to the 5' end of the target sequence 014B, and the right panel of Figure 9B shows a bipartite ASO containing a decoy attached to the 3' end of the target sequence 014B). *P<0.05, **P<0.01, ***P<0.001 (all vs. 014B). ASO014B-L8c is the optimal ASO. See Table 1 for sequence information of the decoy, and Table 7 for sequence information of the ASO and target sequence tested in Example 10. The sequence of interest (5' to 3') at the junction of intron 16 and exon 17 of APP is UCAAGGUGUUCUUUGCAG (SEQ ID NO: 155).

[0328] [Table 7-1]

[0329] [Table 7-2] Example 11: ASO-induced exon 41 skipping of the CEP290 gene with decoy sequences of different lengths

[0330] Fifteen decoy sequences ranging in length from 7 to 11 nt were tested in the context of the target sequence, ASO017B. ASO017B targets positions 26 to 45 of CEP290 exon 41 and promotes exon skipping. HEK293 cells were transfected with 50 nM of each ASO using Lipofectamine 2000, with buffer alone used as a negative control. Two days after transfection, cells were harvested, and total RNA samples were isolated for splicing analysis by semi-quantitative fluorescent RT-PCR.

[0331] The bipartite ASOs tested contained decoys attached to the 5′ (“L”) end of target sequence 017B (017B-L7a to 017B-L7e, 017B-L8a to 017B-L8d, 017B-L9a to 017B-L9c, 017B-L10a, 017B-L10b, and 017B-L11 (Figure 10A)) or the 3′ (“R”) end of target sequence 017B (017B-R7a to 017B-R7e, 017B-R8a to 017B-R8d, 017B-R9a to 017B-R9c, 017B-R10a, 017B-R10b, and 017B-R11 (Figure 10B)).

[0332] Most bipartite ASOs, regardless of whether the decoy was attached to the 5' or 3' end of the bipartite ASO, statistically significantly enhanced the exon skipping effect of the target sequence 017B alone (017B), with the most potent being 017B-R10a. Representative examples of three independent experiments for a bipartite ASO containing a decoy attached to the 5' end of the target sequence 017B and a bipartite ASO containing a decoy attached to the 3' end of the target sequence 017B are shown in the left panels of Figures 10A and 10B, respectively (FL: full-length transcript; Δ41: transcript with exon 41 skipped). Quantification of the data (n=3) is shown as the mean ± standard deviation in the right panels of Figures 10A and 10B (the right panel of Figure 10A shows a bipartite ASO containing a decoy attached to the 5' end of the target sequence 017B, and the right panel of Figure 10B shows a bipartite ASO containing a decoy attached to the 3' end of the target sequence 017B). *P<0.05, **P<0.01, ***P<0.001 (all vs. 017B). ASOs 017B-L7a, 017B-R7b, 017B-R9a, and 017B-R10a are the optimal ASOs. See Table 1 for sequence information of the decoys, and Table 8 for sequence information of the ASOs and target sequences tested in Example 11. The sequence of interest (5' to 3') in CEP290 exon 41 is AAAGUCUAAUUGAAGAACUC (SEQ ID NO: 187).

[0333] [Table 8-1]

[0334] [Table 8-2]

[0335] [Table 8-3] Example 12: ASO-induced exon 19 skipping of the HER2 gene with decoy sequences of different lengths

[0336] Fifteen decoy sequences ranging in length from 7 to 11 nt were tested in the context of the target sequence 024B. ASO024B targets a sequence covering the last 4 nt of intron 18 and the first 11 nt of exon 19 of the HER2 (also known as ERBB2) gene and moderately promotes exon skipping. 50 nM of each ASO was transfected into HeLa cells using Lipofectamine 2000; buffer alone was used as a negative control. Two days after transfection, cells were harvested, and total RNA samples were isolated for splicing analysis by semi-quantitative fluorescent RT-PCR.

[0337] The bipartite ASOs tested contained decoys attached to the 5′ (“L”) end of target sequence 024B (024B-L7a to 024B-L7e, 024B-L8a to 024B-L8d, 024B-L9a to 024B-L9c, 024B-L10a, 024B-L10b, and 024B-L11 (Figure 11A)) or the 3′ (“R”) end of target sequence 024B (024B-R7a to 024B-R7e, 024B-R8a to 024B-R8d, 024B-R9a to 024B-R9c, 024B-R10a, 024B-R10b, and 024B-R11 (Figure 11B)).

[0338] Most bipartite ASOs, regardless of whether the decoy was attached to the 5' or 3' end of the bipartite ASO, statistically significantly enhanced the exon skipping effect of the target sequence 024B alone (024B), with the most potent being 024B-L8c. Representative examples of three independent experiments for a bipartite ASO containing a decoy attached to the 5' end of the target sequence 024B and a bipartite ASO containing a decoy attached to the 3' end of the target sequence 024B are shown in the left panels of Figures 11A and 11B, respectively (FL: full-length transcript; Δ19: transcript with exon 19 skipped). Quantification of the data (n=3) is shown as the mean ± standard deviation in the right panels of Figures 11A and 11B (the right panel of Figure 11A shows a bipartite ASO containing a decoy attached to the 5' end of the target sequence 024B, and the right panel of Figure 11B shows a bipartite ASO containing a decoy attached to the 3' end of the target sequence 024B). *P<0.05, **P<0.01, ***P<0.001 (all vs. 024B). ASO024B-L8c is the optimal ASO. See Table 1 for sequence information of the decoy, and Table 9 for sequence information of the ASO and target sequence tested in Example 12. The sequence of interest (5' to 3') at the junction of intron 18 and exon 19 of HER2 is CCAGGGCAUCUGGAU (SEQ ID NO: 219).

[0339] [Table 9-1]

[0340] [Table 9-2] Example 13: ASO-induced exon 10 skipping with decoy sequences of different lengths in the ATXN gene

[0341] Fifteen decoy sequences ranging from 7 to 11 nt in length were tested targeting the target sequence 015C (same sequence as VO659 but with different chemical modifications). ASO015C comprises seven copies of CTG and targets seven CAG repeats, allowing it to target the CAG repeat in exon 10 of the ATXN3 (also known as SCA3) gene. ASO015C promotes exon 10 skipping of the gene. A549 cells were transfected with 40 nM of each ASO using Lipofectamine 2000, and buffer alone was used as a negative control. Two days after transfection, cells were harvested, and total RNA samples were isolated for splicing analysis by semi-quantitative fluorescent RT-PCR.

[0342] The bipartite ASOs tested contained a decoy attached to the 5' ("L") terminus of target sequence 015C (015C-L7a to 015C-L7e, 015C-L8a to 015C-L8d, 015C-L9a to 015C-L9c, 015C-L10a, 015C-L10b, and 015C-L11 (Figure 12A)) or the 3' ("R") terminus of target sequence 015C (015C-R7a to 015C-R7e, 015C-R8a to 015C-R8d, 015C-R9a to 015C-R9c, 015C-R10a to 015C-R10b, and 015C-R11 (Figure 12B)).

[0343] Most bipartite ASOs, regardless of whether the decoy was attached to the 5' or 3' end of the bipartite ASO, statistically significantly enhanced the exon skipping effect of the target sequence 015C alone (015C), with the most potent being 015C-R8d. Representative examples of three independent experiments for a bipartite ASO containing a decoy attached to the 5' end of the target sequence 015C and a bipartite ASO containing a decoy attached to the 3' end of the target sequence 015C are shown in the left panels of Figures 12A and 12B, respectively (FL: full-length transcript; Δ10: transcript with exon 10 skipped). Quantification of the data (n=3) is shown as the mean ± standard deviation in the right panels of Figures 12A and 12B (the right panel of Figure 12A shows a bipartite ASO containing a decoy attached to the 5' end of the target sequence 015C, and the right panel of Figure 12B shows a bipartite ASO containing a decoy attached to the 3' end of the target sequence 015C). *P<0.05, **P<0.01, ***P<0.001 (all vs. 015C). ASOs 015C-L8c and 015C-R8d are the optimal ASOs. See Table 1 for sequence information of the decoys, and see Table 10 for sequence information of the ASOs and target sequences tested in Example 13. The sequence of interest (5' to 3') in ATXN3 exon 10 is CAGCAGCAGCAGCAGCAGCAG (SEQ ID NO: 251).

[0344] [Table 10-1]

[0345] [Table 10-2] Example 14: ASO-induced exon 10 skipping with decoy sequences of different lengths in the PKM gene

[0346] Fifteen decoy sequences ranging in length from 7 to 11 nt were tested in the context of the target sequence 027B. ASO027B targets positions 45 to 62 of PKM exon 10, promoting exon 10 skipping and exon 9 insertion in the endogenous PKM gene. RD cells were transfected with 50 nM of each ASO using Lipofectamine 2000; buffer alone was used as a negative control. Two days after transfection, cells were harvested, and total RNA samples were isolated for splicing analysis by semiquantitative fluorescent RT-PCR. To distinguish the origin (PKM1 or PKM2), PCR products were digested with Pstl.

[0347] The bipartite ASOs tested contained decoys attached to the 5' ("L") terminus of target sequence 027B (027B-L7a to 027B-L7e, 027B-L8a to 027B-L8d, 027B-L9a to 027B-L9c, 027B-L10a, 027B-L10b, and 027B-L11 (Figure 13A)) or the 3' ("R") terminus of target sequence 027B (027B-R7a to 027B-R7e, 027B-R8a to 027B-R8d, 027B-R9a to 027B-R9c, 027B-R10a, 027B-R10b, and 027B-R11 (Figure 13B)).

[0348] Most bipartite ASOs statistically significantly improved the exon 10 skipping efficiency of the target sequence 027B alone (027B), regardless of whether the decoy was attached to the 5' or 3' end of the bipartite ASO. Representative examples of three independent experiments for bipartite ASOs containing a decoy attached to the 5' end of the target sequence 027B and for bipartite ASOs containing a decoy attached to the 3' end of the target sequence 027B are shown in the left panels of Figures 13A and 13B, respectively (PKM1: transcripts skipping exon 10, PKM2: transcripts skipping exon 9, PKMds: ​​both exons skipped). Quantification of the data (n=3) is shown as the mean ± standard deviation in the right panels of Figures 13A and 13B (the right panel of Figure 13A shows a bipartite ASO containing a decoy attached to the 5' end of target sequence 027B, and the right panel of Figure 13B shows a bipartite ASO containing a decoy attached to the 3' end of target sequence 027B). *P<0.05, **P<0.01, ***P<0.001 (all vs. 027B). ASOs 027B-L8c, 027B-L9a, 027B-L10a, 027B-L10b, and 027B-R10a are the optimal ASOs. See Table 1 for sequence information of the decoys, and see Table 11 for sequence information of the ASOs and target sequences tested in Example 14. The sequence of interest (5' to 3') in PKM exon 10 is UGAGGAACUCCGCCGCCU (SEQ ID NO: 283).

[0349] [Table 11-1]

[0350] [Table 11-2] Example 15: ASO-induced exon 6 skipping with decoy sequences of different lengths in the MDM4 gene

[0351] Fifteen decoy sequences ranging in length from 7 to 11 nt were tested in the context of the target sequence, ASO029B. ASO029B targets a region covering the last 9 nt of exon 6 and the first 16 nt of intron 6 of the MDM4 gene. ASO029B alone moderately promotes exon 6 skipping of the endogenous MDM4 gene. HEK293 cells were transfected with 50 nM of each ASO using Lipofectamine 2000, and buffer alone was used as a negative control. Two days after transfection, cells were harvested, and total RNA samples were isolated for splicing analysis by semi-quantitative fluorescent RT-PCR.

[0352] The bipartite ASOs tested contained decoys attached to the 5' ("L") end of target sequence 029B (029B-L7a to 029B-L7e, 029B-L8a to 029B-L8d, 029B-L9a to 029B-L9c, 029B-L10a, 029B-L10b, and 029B-L11 (Figure 14A)) or the 3' ("R") end of target sequence 029B (029B-R7a to 029B-R7e, 029B-R8a to 029B-R8d, 029B-R9a to 029B-R9c, 029B-R10a, 029B-R10b, and 029B-R11 (Figure 14B)).

[0353] All but one bipartite ASO statistically significantly improved the exon 6 skipping efficiency of the target sequence 029B alone (029B), regardless of whether the decoy was attached to the 5' or 3' end of the bipartite ASO. Representative examples of three independent experiments for a bipartite ASO containing a decoy attached to the 5' end of target sequence 029B and a bipartite ASO containing a decoy attached to the 3' end of target sequence 029B are shown in the left panels of Figures 14A and 14B, respectively (FL: full-length transcript; Δ6: exon 6-skipped transcript). Quantification of the data (n=3) is shown as the mean ± standard deviation in the right panels of Figures 14A and 14B (the right panel of Figure 14A shows a bipartite ASO containing a decoy attached to the 5' end of target sequence 029B, and the right panel of Figure 14B shows a bipartite ASO containing a decoy attached to the 3' end of target sequence 029B). *P<0.05, **P<0.01, ***P<0.001 (all vs. 029B). ASOs 029B-L7d, 029B-L8c, 029B-L9b, 029B-L9c, and 029B-R7a are optimal ASOs. See Table 1 for sequence information of the decoys, and see Table 12 for sequence information of the ASOs and target sequences tested in Example 15. The sequence of interest (5' to 3') at the DMD4 exon 6-intron 6 junction is CAACUGAAGGUAAAAUCACCACACG (SEQ ID NO: 315).

[0354] [Table 12-1]

[0355] [Table 12-2]

[0356] [Table 12-3]

Claims

1. An oligonucleotide comprising or consisting of a target sequence and a 5' splice site decoy sequence operably linked to the 5' and / or 3' end of said target sequence, the decoy sequence comprises a nucleotide sequence of 5, 6, 7, 8, 9, 10, or 11 nucleotides complementary to the single-stranded 5' end of U1 snRNA; the target sequence hybridizes to a sequence selected from the group consisting of an exon of interest, an adjacent intron sequence upstream of the exon of interest, an adjacent intron sequence downstream of the exon of interest, an intron-exon junction upstream of the exon of interest, and an intron-exon junction downstream of the exon of interest; An oligonucleotide, wherein the decoy sequence operably linked to the 5' end of the target sequence and the decoy sequence operably linked to the 3' end of the target sequence are the same or different.

2. The oligonucleotide of claim 1, wherein the decoy sequence comprises or consists of one or more nucleotide sequences independently selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 1 to 23 and 347 to 353.

3. 3. The oligonucleotide of claim 1 or 2, wherein the target exon is selected from the group consisting of exon 7 of the endogenous SMN1 and SMN2 genes, exons 45, 51, and 52 of the endogenous DMD gene, exon 17 of the endogenous APP gene, exon 41 of the endogenous CEP290 gene, exon 19 of the endogenous HER2 gene, exon 10 of the SCA3 gene, exon 10 of the endogenous PKM gene, and exon 6 of the endogenous MDM4 gene.

4. 4. The oligonucleotide of any one of claims 1 to 3, wherein the target sequence comprises or consists of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 25, 29, 33, 37, 41, 45, 49, 75, 92, 124, 156, 188, 220, 252, 284, and 316.

5. The oligonucleotide according to any one of claims 1 to 4, wherein the target sequence is directly linked to the decoy sequence.

6. The oligonucleotide according to any one of claims 1 to 4, wherein the target sequence is linked to the decoy sequence via a linker having 1, 2, 3, 4, or 5 nucleotides.

7. The oligonucleotide according to any one of claims 1 to 6, wherein when decoy sequences are operably linked to the 5' end and 3' end of the target sequence, the linker between the target sequence and the decoy sequence at the 5' end of the target sequence and the linker between the target sequence and the decoy sequence at the 3' end of the target sequence may be the same or different.

8. 2. The oligonucleotide of claim 1, comprising or consisting of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 26-27, 30-31, 34-35, 38-39, 42-43, 46-47, 50-73, 76-90, 93-122, 125-154, 157-186, 189-218, 221-250, 253-282, 285-314, 317-346, and 354-356.

9. 2. The oligonucleotide of claim 1, wherein the oligonucleotide is selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 26, 30, 31, 34, 38, 42, 46, 50, 51, 60, 64, 65, 68, 70, 78, 83, 85, 86, 87, 88, 89, 103, 109, 110, 114, 115, 116, 127, 132, 144, 164, 189, 205, 213, 216, 228, 260, 276, 292, 294, 297, 298, 312, 320, 324, 327, 328, 332, and 354.

10. For example, but not limited to, the oligonucleotide of any one of claims 1 to 9, comprising at least one nucleotide analog selected from the group consisting of 2'-O-methoxyethyl modified oligonucleotides having phosphodiester or phosphorothioate backbones, and phosphorodamidate morpholino oligomers.

11. A composition comprising the oligonucleotide of any one of claims 1 to 10 and a pharmaceutically acceptable carrier.

12. A vector encoding the oligonucleotide according to any one of claims 1 to 10.

13. A method for generating or promoting exon skipping of a target exon during pre-mRNA splicing, comprising contacting pre-mRNA in a cell or a subject with an oligonucleotide described in any one of claims 1 to 10, a composition described in claim 11, and / or a vector described in claim 12 to restore the reading frame or generate a new splicing isoform.

14. The method of claim 13, wherein ASO-mediated exon skipping manipulates the expression of a gene of interest by inhibiting splicing of exons, introns or specific splice sites of the gene of interest, thereby restoring the reading frame of a defective gene of interest, generating different isoforms of the gene of interest (e.g., dominant-negative isoforms), skipping toxic portions of the gene, silencing the gene, and / or altering the structure and function of the gene.

15. 1. A method for improving the efficacy and / or efficiency of exon skipping of a target sequence hybridizable to a sequence selected from the group consisting of an exon of interest in a cell or a subject, an adjacent intron sequence upstream of said exon of interest, an adjacent intron sequence downstream of said exon of interest, an intron-exon junction upstream of said exon of interest, and an intron-exon junction downstream of said exon of interest, comprising: A method comprising obtaining one or more oligonucleotides comprising a target sequence and a decoy sequence according to any one of claims 1 to 10.

16. 16. The method of claim 15, further comprising screening the one or more oligonucleotides according to their exon skipping efficacy and / or efficiency of the exon of interest.

17. 17. The method of any one of claims 13 to 16, wherein the gene of interest is selected from the group consisting of SMN1, SMN2, DMD, APP, CEP290, HER2, SCA3, PKM, and MDM4 genes.

18. 18. The method of any one of claims 13 to 17, wherein the exon of the gene of interest is selected from the group consisting of exon 7 of the endogenous SMN1 and SMN2 genes, exons 45, 51, and 52 of the endogenous DMD gene, exon 17 of the endogenous APP gene, exon 41 of the endogenous CEP290 gene, exon 19 of the endogenous HER2 gene, exon 10 of the SCA3 gene, exon 10 of the endogenous PKM gene, and exon 6 of the endogenous MDM4 gene.

19. 19. The method of any one of claims 13 to 18, further comprising delivering to the cell or administering to the subject an oligonucleotide of any one of claims 1 to 10, a composition of claim 11, and / or a vector of claim 12.

20. 13. A method of treating a disease and / or its complications in a subject, comprising administering to the subject an oligonucleotide according to any one of claims 1 to 10, a composition according to claim 11, and / or a vector according to claim 12, wherein the oligonucleotide generates or promotes exon skipping of a target exon.

21. The method of claim 20, wherein the oligonucleotide restores the reading frame of a defective gene of interest by inhibiting splicing of an exon, intron, or specific splice site of the gene of interest, generates a different isoform (e.g., a dominant-negative isoform) of the gene of interest, skips a toxic portion of the gene, silences the gene, and / or alters the structure and function of the gene.

22. 22. The method of claim 20 or claim 21, wherein the disease and / or complications thereof are selected from the group consisting of diseases and / or complications thereof that may benefit from exon skipping for one or more genes selected from the group consisting of SMN1, SMN2, DMD, APP, CEP290, HER2, SCA3, PKM, and MDM4 genes.

23. 23. The method of claim 22, wherein the disease and / or complications thereof are selected from the group consisting of diseases and / or complications thereof that would benefit from exon skipping of one or more exons selected from the group consisting of exon 7 of the endogenous SMN1 and SMN2 genes, exons 45, 51, and 52 of the endogenous DMD gene, exon 17 of the endogenous APP gene, exon 41 of the endogenous CEP290 gene, exon 19 of the endogenous HER2 gene, exon 10 of the SCA3 gene, exon 10 of the endogenous PKM gene, and exon 6 of the endogenous MDM4 gene.

24. 24. The method of claim 23, wherein the disease and / or complications thereof are selected from the group consisting of Duchenne muscular dystrophy (DMD), Alzheimer's disease, Joubert syndrome, spinocerebellar ataxia 3 (SCA3), breast cancer, HER2-positive biliary tract cancer, colorectal cancer, non-small cell lung cancer, bladder cancer, prostate cancer, lung cancer, cervical cancer, kidney cancer, papillary thyroid cancer, colon cancer, colorectal cancer, glioma, ovarian cancer, gastric cancer, hepatoblastoma, fibrolamellar carcinoma, hepatocellular carcinoma, soft tissue sarcoma, osteosarcoma, chronic lymphocytic leukemia, acute myeloid leukemia, mantle cell lymphoma, childhood Burkitt's lymphoma, salivary gland cancer, liver cancer, or melanoma.

25. The method of any one of claims 20 to 24, wherein the oligonucleotide of any one of claims 1 to 10, the composition of claim 11, and / or the vector of claim 12 is administered in a therapeutically effective amount.

26. A kit comprising an oligonucleotide according to any one of claims 1 to 10, a composition according to claim 11, and / or a vector according to claim 12 for use in a method according to any one of claims 13 to 25.

Images