ATP7B gene therapy

Enhanced ATP7B expression constructs address the packaging challenge of ATP7B into AAV vectors, achieving effective treatment of Wilson's disease symptoms through optimized promoters and regulatory elements, enabling lower virus doses and improved liver function.

JP2025533994APending Publication Date: 2025-10-09MEIRAGTX UK LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025521121
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-10-11
Filing Date
2023-10-11
Publication Date
2025-10-09

AI Technical Summary

Technical Problem

The large size of the ATP7B protein makes it difficult to package into adeno-associated virus (AAV) for effective gene therapy in treating Wilson's disease, leading to challenges in ATP7B expression.

Method used

Improved expression constructs comprising specific promoters, sequences encoding ATP7B, post-transcriptional regulatory elements, and polyadenylation signals, optimized for enhanced ATP7B expression, which can be packaged into AAV vectors for therapeutic use.

Benefits of technology

The improved constructs enable higher ATP7B expression, allowing for lower virus doses, improved liver function, reduced immune responses, and effective treatment of Wilson's disease symptoms such as dystonia, bradykinesia, leukopenia, anemia, and cirrhosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025533994000001_ABST
    Figure 2025533994000001_ABST
Patent Text Reader

Abstract

Provided herein are improved expression constructs for the expression of ATP7B, vectors containing such constructs, and pharmaceutical compositions. Methods for treating diseases, including but not limited to Wilson's disease, are also provided.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit under 35 U.S.C. §119(e) of the earlier filing date of U.S. Provisional Patent Application No. 63 / 379,113, filed October 11, 2022, which is incorporated herein by reference in its entirety.

[0002] Electronic Sequence Listing Reference The contents of the electronic sequence listing (SeqList-162027.53176.xml; size: 479,210 bytes; and creation date: October 10, 2023) are incorporated herein by reference in their entirety.

[0003] The present disclosure relates generally to the fields of molecular biology and medicine. More specifically, the methods and compositions herein are useful for treating Wilson's disease. [Background technology]

[0004] Wilson disease (WD) is caused by autosomal recessive, loss-of-function mutations in the ATPase copper transporter beta (ATP7B) gene, which leads to pathological accumulation of copper in the liver, brain, and other tissues. WD symptoms include Parkinson's disease-like neurological defects (including dystonia / bradykinesia) and hepatological defects associated with cirrhosis. The prevalence of Wilson disease is approximately 1 in 30,000.

[0005] ATP7B is a transmembrane copper ion transporter. When cellular copper concentrations increase, ATP7B translocates to lysosomes and delivers copper into vesicles so that it can be excreted via the bile ducts in the liver. Due to its large size (1465 amino acids), ATP7B is too large to be effectively packaged into adeno-associated virus (AAV), making ATP7B gene therapy difficult.

[0006] Therefore, there is an urgent need for enhanced ATP7B expression constructs for the treatment of Wilson disease. Summary of the Invention

[0007] Provided herein are improved expression constructs for the expression of ATP7B, vectors and pharmaceutical compositions comprising such constructs, and methods of using such constructs, vectors, and pharmaceutical compositions.

[0008] In one aspect, (a) a promoter; (b) a sequence encoding (ATPase copper transport beta) ATP7B operably linked to a promoter; and (c) a polyadenylation signal.

[0009] In some embodiments, the promoter comprises a sequence at least 80% identical to a sequence selected from the group consisting of SEQ ID NOs: 4-33. In some embodiments, the promoter comprises a sequence at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 4-33. In some embodiments, the promoter comprises a sequence at least 95% identical to a sequence selected from the group consisting of SEQ ID NOs: 4-33. In some embodiments, the promoter comprises a sequence selected from the group consisting of SEQ ID NOs: 4-33. In some embodiments, the promoter comprises a sequence at least 80% identical to any one of SEQ ID NOs: 4, 10, or 11. In some embodiments, the promoter comprises a sequence at least 90% identical to any one of SEQ ID NOs: 4, 10, or 11. In some embodiments, the promoter comprises a sequence at least 95% identical to any one of SEQ ID NOs: 4, 10, or 11. In some embodiments, the promoter comprises any one of SEQ ID NOs: 4, 10, or 11.

[0010] In some embodiments, the sequence encoding ATP7B is codon-optimized. In some embodiments, the sequence encoding ATP7B comprises a sequence at least 80% identical to any one of SEQ ID NOs: 35-48. In some embodiments, the sequence encoding ATP7B comprises a sequence at least 90% identical to any one of SEQ ID NOs: 35-48. In some embodiments, the sequence encoding ATP7B comprises a sequence at least 95% identical to any one of SEQ ID NOs: 35-48. In some embodiments, the sequence encoding ATP7B comprises a sequence selected from the group consisting of SEQ ID NOs: 35-48. In some embodiments, the sequence encoding ATP7B comprises a sequence at least 80% identical to SEQ ID NO: 39 or SEQ ID NO: 41. In some embodiments, the sequence encoding ATP7B comprises a sequence at least 90% identical to SEQ ID NO: 39 or SEQ ID NO: 41. In some embodiments, the sequence encoding ATP7B comprises a sequence at least 95% identical to SEQ ID NO: 39 or SEQ ID NO: 41. In some embodiments, the sequence encoding ATP7B comprises SEQ ID NO: 39 or SEQ ID NO: 41.

[0011] In some embodiments, the sequence encoding ATP7B encodes a protein comprising a sequence at least 80% identical to any one of SEQ ID NOs: 118-128. In some embodiments, the sequence encoding ATP7B encodes a protein comprising a sequence at least 90% identical to any one of SEQ ID NOs: 118-128. In some embodiments, the sequence encoding ATP7B encodes a protein comprising a sequence at least 95% identical to any one of SEQ ID NOs: 118-128. In some embodiments, the sequence encoding ATP7B encodes a protein comprising any one of SEQ ID NOs: 118-128. In some embodiments, the sequence encoding ATP7B encodes a protein comprising a sequence at least 80% identical to SEQ ID NO: 118 or SEQ ID NO: 123. In some embodiments, the sequence encoding ATP7B encodes a protein comprising a sequence at least 90% identical to SEQ ID NO: 118 or SEQ ID NO: 123. In some embodiments, the sequence encoding ATP7B encodes a protein comprising a sequence at least 95% identical to SEQ ID NO: 118 or SEQ ID NO: 123. In some embodiments, the sequence encoding ATP7B encodes a protein comprising SEQ ID NO: 118 or SEQ ID NO: 123.

[0012] In some embodiments, the expression construct further comprises a post-transcriptional regulatory element. In some embodiments, the post-transcriptional regulatory element comprises a sequence that is at least 80% identical to SEQ ID NO:49 or SEQ ID NO:50. In some embodiments, the post-transcriptional regulatory element comprises a sequence that is at least 90% identical to SEQ ID NO:49 or SEQ ID NO:50. In some embodiments, the post-transcriptional regulatory element comprises a sequence that is at least 95% identical to SEQ ID NO:49 or SEQ ID NO:50. In some embodiments, the post-transcriptional regulatory element comprises SEQ ID NO:49 or SEQ ID NO:50. In some embodiments, the post-transcriptional regulatory element comprises a sequence that is at least 80% identical to SEQ ID NO:49. In some embodiments, the post-transcriptional regulatory element comprises a sequence that is at least 90% identical to SEQ ID NO:49. In some embodiments, the post-transcriptional regulatory element comprises a sequence that is at least 95% identical to SEQ ID NO:49. In one embodiment, the post-transcriptional regulatory element comprises SEQ ID NO:49.

[0013] In some embodiments, the polyadenylation signal comprises a sequence that is at least 80% identical to SEQ ID NO:51 or SEQ ID NO:52. In some embodiments, the polyadenylation signal comprises a sequence that is at least 90% identical to SEQ ID NO:51 or SEQ ID NO:52. In some embodiments, the polyadenylation signal comprises a sequence that is at least 95% identical to SEQ ID NO:51 or SEQ ID NO:52. In some embodiments, the polyadenylation signal comprises SEQ ID NO:51 or SEQ ID NO:52. In some embodiments, the polyadenylation signal comprises a sequence that is at least 80% identical to SEQ ID NO:51. In some embodiments, the polyadenylation signal comprises a sequence that is at least 90% identical to SEQ ID NO:51. In some embodiments, the polyadenylation signal comprises a sequence that is at least 95% identical to SEQ ID NO:51. In one embodiment, the polyadenylation signal comprises SEQ ID NO:51.

[0014] In some embodiments, the expression construct further comprises an miRNA (miR) binding site (miRBS). In some embodiments, the miRBS comprises a sequence that is at least 80% identical to SEQ ID NO: 53. In some embodiments, the miRBS comprises a sequence that is at least 90% identical to SEQ ID NO: 53. In some embodiments, the miRBS comprises a sequence that is at least 95% identical to SEQ ID NO: 53. In one embodiment, the miRBS comprises SEQ ID NO: 53.

[0015] In some embodiments, (a) a promoter comprising a sequence at least 80% identical to SEQ ID NO: 11; (b) a sequence encoding ATP7B operably linked to a promoter, the sequence comprising a sequence at least 80% identical to SEQ ID NO: 41; (c) a post-transcriptional regulatory element comprising a sequence at least 80% identical to SEQ ID NO: 49; and (d) a polyadenylation signal comprising a sequence that is at least 80% identical to SEQ ID NO: 51.

[0016] In some embodiments, (a) a promoter comprising a sequence at least 90% identical to SEQ ID NO: 11; (b) a sequence encoding ATP7B operably linked to a promoter, the sequence comprising a sequence at least 90% identical to SEQ ID NO: 41; (c) a post-transcriptional regulatory element comprising a sequence at least 90% identical to SEQ ID NO: 49; and (d) a polyadenylation signal comprising a sequence that is at least 90% identical to SEQ ID NO: 51.

[0017] In some embodiments, (a) a promoter comprising a sequence at least 95% identical to SEQ ID NO: 11; (b) a sequence encoding ATP7B operably linked to a promoter, the sequence comprising a sequence at least 95% identical to SEQ ID NO: 41; (c) a post-transcriptional regulatory element comprising a sequence at least 95% identical to SEQ ID NO: 49; (d) a polyadenylation signal comprising a sequence that is at least 95% identical to SEQ ID NO: 51.

[0018] In some embodiments, (a) a promoter comprising SEQ ID NO: 11; (b) a sequence encoding ATP7B operably linked to a promoter, the sequence comprising SEQ ID NO: 41; (c) a post-transcriptional regulatory element comprising SEQ ID NO: 49; and (d) a polyadenylation signal comprising SEQ ID NO: 51.

[0019] In some embodiments, (a) a promoter comprising a sequence at least 80% identical to SEQ ID NO: 10; (b) a sequence encoding ATP7B operably linked to a promoter, the sequence comprising a sequence at least 80% identical to SEQ ID NO: 39; (c) a miRBS comprising a sequence at least 80% identical to SEQ ID NO: 53; (d) a post-transcriptional regulatory element comprising a sequence at least 80% identical to SEQ ID NO: 49; and (e) a polyadenylation signal comprising a sequence that is at least 80% identical to SEQ ID NO: 51.

[0020] In some embodiments, (a) a promoter comprising a sequence at least 90% identical to SEQ ID NO: 10; (b) a sequence encoding ATP7B operably linked to a promoter, the sequence comprising a sequence at least 90% identical to SEQ ID NO: 39; (c) a miRBS comprising a sequence at least 90% identical to SEQ ID NO: 53; (d) a post-transcriptional regulatory element comprising a sequence at least 90% identical to SEQ ID NO: 49; and (e) a polyadenylation signal comprising a sequence that is at least 90% identical to SEQ ID NO: 51.

[0021] In some embodiments, (a) a promoter comprising a sequence at least 95% identical to SEQ ID NO: 10; (b) a sequence encoding ATP7B operably linked to a promoter, the sequence comprising a sequence at least 95% identical to SEQ ID NO: 39; (c) a miRBS comprising a sequence at least 95% identical to SEQ ID NO: 53; (d) a post-transcriptional regulatory element comprising a sequence at least 95% identical to SEQ ID NO: 49; and (e) a polyadenylation signal comprising a sequence that is at least 95% identical to SEQ ID NO: 51.

[0022] In some embodiments, (a) a promoter comprising SEQ ID NO: 10; (b) a sequence encoding ATP7B operably linked to a promoter, the sequence comprising SEQ ID NO: 39; and (c) a miRBS comprising SEQ ID NO: 53; and (d) a post-transcriptional regulatory element comprising SEQ ID NO: 49; and (e) a polyadenylation signal comprising SEQ ID NO: 51.

[0023] In some embodiments, (a) a promoter comprising a sequence at least 80% identical to SEQ ID NO: 4; (b) a sequence encoding ATP7B operably linked to a promoter, the sequence comprising a sequence at least 80% identical to SEQ ID NO: 41; (c) a post-transcriptional regulatory element comprising a sequence at least 80% identical to SEQ ID NO: 49; and (d) a polyadenylation signal comprising a sequence that is at least 80% identical to SEQ ID NO: 51.

[0024] In some embodiments, (a) a promoter comprising a sequence at least 90% identical to SEQ ID NO: 4; (b) a sequence encoding ATP7B operably linked to a promoter, the sequence comprising a sequence at least 90% identical to SEQ ID NO: 41; (c) a post-transcriptional regulatory element comprising a sequence at least 90% identical to SEQ ID NO: 49; and (d) a polyadenylation signal comprising a sequence that is at least 90% identical to SEQ ID NO: 51.

[0025] In some embodiments, (a) a promoter comprising a sequence at least 95% identical to SEQ ID NO: 4; (b) a sequence encoding ATP7B operably linked to a promoter, the sequence comprising a sequence at least 95% identical to SEQ ID NO: 41; (c) a post-transcriptional regulatory element comprising a sequence at least 95% identical to SEQ ID NO: 49; (d) a polyadenylation signal comprising a sequence that is at least 95% identical to SEQ ID NO: 51.

[0026] In some embodiments, (a) a promoter comprising SEQ ID NO: 4; (b) a sequence encoding ATP7B operably linked to a promoter, the sequence comprising SEQ ID NO: 41; (c) a post-transcriptional regulatory element SEQ ID NO: 49; and (d) a polyadenylation signal comprising SEQ ID NO: 51.

[0027] In one aspect, a vector is provided comprising an expression construct disclosed herein. In one embodiment, the vector is a viral vector. In one embodiment, the vector is an AAV vector. In one aspect, a vector is provided comprising a nucleic acid sequence comprising (i) an expression construct disclosed herein and (ii) one or more inverted terminal repeats (ITRs). In one embodiment, the nucleic acid sequence comprises a 5'ITR and a 3'ITR. In one embodiment, the 5'ITR and the 3'ITR are derived from adeno-associated virus (AAV) serotype AAV2. In some embodiments, the sequence of the 5'ITR is at least 80% identical to SEQ ID NO: 116. In some embodiments, the sequence of the 5'ITR is at least 90% identical to SEQ ID NO: 116. In some embodiments, the sequence of the 5'ITR is at least 95% identical to SEQ ID NO: 116. In some embodiments, the sequence of the 5'ITR comprises SEQ ID NO: 116. In some embodiments, the sequence of the 3'ITR is at least 80% identical to SEQ ID NO: 117. In some embodiments, the sequence of the 3' ITR is at least 90% identical to SEQ ID NO: 117. In some embodiments, the sequence of the 3' ITR is at least 95% identical to SEQ ID NO: 117. In some embodiments, the sequence of the 3' ITR comprises SEQ ID NO: 117.

[0028] In one aspect, a vector comprising an expression construct is provided, wherein the vector comprises a sequence at least 80% identical to any one of SEQ ID NOs: 54-115. In some embodiments, the vector comprises a sequence at least 90% identical to any one of SEQ ID NOs: 54-115. In some embodiments, the vector comprises a sequence at least 95% identical to any one of SEQ ID NOs: 54-115. In some embodiments, the vector comprises any one of SEQ ID NOs: 54-115. In some embodiments, the vector comprises a sequence at least 80% identical to any one of SEQ ID NOs: 65, 73, or 92. In some embodiments, the vector comprises a sequence at least 90% identical to any one of SEQ ID NOs: 65, 73, or 92. In some embodiments, the vector comprises a sequence at least 95% identical to SEQ ID NOs: 65, 73, or 92. In some embodiments, the vector comprises SEQ ID NO: 65, 73, or 92. In some embodiments, the vector comprises a capsid that comprises or is derived from AAV7m8, AAV9, AAV2-retro, or AAVrh.10.

[0029] In one aspect, a cell is provided comprising an expression construct or vector disclosed herein.

[0030] In one aspect, a pharmaceutical composition is provided that includes (i) an expression construct or vector disclosed herein, and (ii) a pharmaceutically acceptable carrier.

[0031] In one aspect, a method is provided for increasing ATP7B activity in a subject in need of increased ATP7B activity, the method comprising administering to the subject an expression construct, vector, or pharmaceutical composition disclosed herein. In one aspect, a method is provided for increasing copper secretion in a subject in need of increased copper secretion, the method comprising administering to the subject an expression construct, vector, or pharmaceutical composition disclosed herein. In one aspect, a method is provided for treating a condition caused by ATP7B deficiency or dysfunction in a subject in need of treatment, the method comprising administering to the subject an expression construct, vector, or pharmaceutical composition disclosed herein. In one aspect, a method is provided for treating Wilson's disease in a subject in need of treatment, the method comprising administering to the subject an expression construct, vector, or pharmaceutical composition disclosed herein. In one aspect, a method is provided for reducing dystonia or bradykinesia in a subject suffering from Wilson's disease, the method comprising administering to the subject an expression construct, vector, or pharmaceutical composition disclosed herein. In one aspect, a method is provided for reducing the incidence of leukopenia or anemia in a subject suffering from Wilson's disease, the method comprising administering to the subject an expression construct, vector, or pharmaceutical composition disclosed herein. In one aspect, a method is provided for reducing the incidence of cirrhosis in a subject suffering from Wilson's disease, the method comprising administering to the subject an expression construct, vector, or pharmaceutical composition disclosed herein. In some embodiments, the subject is a human. [Brief explanation of the drawings]

[0032] [Figure 1] The structure of ATP7B is shown. [Figure 2A]Figure 1 shows how the activity of the liver-specific promoters disclosed herein in human Huh7 cells compared to commonly used reference promoters. Plasmids used in dual reporter flow-based assays. [Figure 2B] Figure 1 shows how the activity of the liver-specific promoters disclosed herein in human Huh7 cells compares with commonly used reference promoters. Relative protein expression for different liver-specific promoters (compared to expression using the control promoter CAG). Arrows indicate that the L15 and L13 promoters drove particularly high expression of miniATP7B in vitro among the promoters tested. AAT, LP1, HLP, TBG, and HCB served as additional reference promoters. [Figure 3A] Figure 3B shows how the expression and associated copper ion efflux function of the ATP7B minigene were examined. Schematic diagram of the copper-responsive reporter construct used in the experiments shown in Figures 3B and 3C. The reporter in this construct is driven by a copper-responsive promoter. The amount of reporter expressed directly reflects the amount of copper ions found in the cell, which is then regulated by the copper pump activity of ATP7B. The ATP7B minigene was tested for copper ion efflux activity in ATP7B knockout (KO) cells using the copper reporter in combination with flow cytometry. mClover3 fluorescence increased upon treatment with copper sulfate. [Figure 3B] Figure 3 shows how the expression and associated copper ion efflux function of the ATP7B minigene were investigated. The increase in mClover3 fluorescence was attenuated by expression of either full-length (FL) ATP7B or the ATP7B minigenes (TG1-TG3). TG1 = miniATP7Bv_v2; TG2 = miniATP7B-s1co; TG3 = miniATP7AB; TG = transgene; MFI = median fluorescence intensity. Graph labels are the same as in Figure 3C. [Figure 3C]Figure 1 shows how the expression and associated copper ion efflux function of the ATP7B minigene was investigated. The potency of the transgene (TG) was assessed by measuring the copper reporter activity in different concentrations of the ATP7B transgene plasmid used for transfection. Ctrl = control. [Figure 4A] This shows that the combination of various different genetic elements, including promoter, TISU sequence, 3'UTR elements (miRNA site, WPRE, polyA), and ATP7B minigene, can increase ATP7B expression. Western blot showing ATP7B expression in HEK293 ATP7B- / - cells transfected with the indicated expression constructs (see Table 7). AAT-miniATP7B-spolyA served as the reference construct (REF). [Figure 4B] These results show that the combination of various different genetic elements, including promoters, TISU sequences, 3'UTR elements (miRNA site, WPRE, polyA), and ATP7B minigenes, can increase ATP7B expression. Western blots showing ATP7B expression in Huh7 cells (Figure 4B), primary mouse hepatocytes (Figure 4C), and primary human hepatocytes (Figure 4D), each transduced with AAV8 particles containing the indicated expression constructs. In construct A39 (labeled AAT-A12), the L15 promoter in A12 was replaced with the standard AAT promoter. Human ACTB (beta-actin) served as a control. [Figure 4C] These results show that the combination of various different genetic elements, including promoters, TISU sequences, 3'UTR elements (miRNA site, WPRE, polyA), and ATP7B minigenes, can increase ATP7B expression. Western blots showing ATP7B expression in Huh7 cells (Figure 4B), primary mouse hepatocytes (Figure 4C), and primary human hepatocytes (Figure 4D), each transduced with AAV8 particles containing the indicated expression constructs. In construct A39 (labeled AAT-A12), the L15 promoter in A12 was replaced with the standard AAT promoter. Human ACTB (beta-actin) served as a control. [Figure 4D] These results show that the combination of various different genetic elements, including promoters, TISU sequences, 3'UTR elements (miRNA site, WPRE, polyA), and ATP7B minigenes, can increase ATP7B expression. Western blots showing ATP7B expression in Huh7 cells (Figure 4B), primary mouse hepatocytes (Figure 4C), and primary human hepatocytes (Figure 4D), each transduced with AAV8 particles containing the indicated expression constructs. In construct A39 (labeled AAT-A12), the L15 promoter in A12 was replaced with the standard AAT promoter. Human ACTB (beta-actin) served as a control. [Figure 5A] We show that overexpression of the ATP7B minigene rescues the alanine aminotransferase (ALT) and splenomegaly phenotype in ATP7B- / - mice. AAV8 (5e12 GC / kg iv) was injected into 7-week-old ATP7B- / - male mice. Serum ALT activity was measured 8 weeks after injection. After 12 weeks, organs were weighed and liver expression was measured. Western blot (Figure 5A) and quantification (Figure 5B) of ATP7B protein expression in the liver of ATP7B mice after 12 weeks. [Figure 5B] We show that overexpression of the ATP7B minigene rescues the alanine aminotransferase (ALT) and splenomegaly phenotype in ATP7B- / - mice. AAV8 (5e12 GC / kg iv) was injected into 7-week-old ATP7B- / - male mice. Serum ALT activity was measured 8 weeks after injection. After 12 weeks, organs were weighed and liver expression was measured. Western blot (Figure 5A) and quantification (Figure 5B) of ATP7B protein expression in the liver of ATP7B mice after 12 weeks. [Figure 5C]This shows that overexpression of the ATP7B minigene rescues the alanine aminotransferase (ALT) and splenomegaly phenotype in ATP7B- / - mice. AAV8 (5e12 GC / kg iv) was injected into 7-week-old ATP7B- / - male mice. Serum ALT activity was measured 8 weeks after injection. After 12 weeks, organs were weighed and liver expression was measured. Serum ALT activity in ATP7B mice after 8 weeks. [Figure 5D] This shows that overexpression of the ATP7B minigene rescues the alanine aminotransferase (ALT) and splenomegaly phenotype in ATP7B- / - mice. AAV8 (5e12 GC / kg iv) was injected into 7-week-old ATP7B- / - male mice. Serum ALT activity was measured 8 weeks after injection. Organs were weighed and liver expression was measured after 12 weeks. Spleen weight of ATP7B mice after 12 weeks. DETAILED DESCRIPTION OF THE INVENTION

[0033] Provided herein are improved expression constructs for the expression of ATP7B, vectors and pharmaceutical compositions comprising such constructs, and methods of using such constructs, vectors, and pharmaceutical compositions. In some embodiments, the expression constructs disclosed herein exhibit enhanced ATP7B expression, allowing a lower MOI (multiplicity of infection) of virus to be used clinically, which in turn can improve patient safety outcomes and lower manufacturing hurdles, including costs. In embodiments, the expression constructs disclosed herein exhibit improved liver function and reduced immune responses.

[0034] Expression constructs In one aspect, (a) a promoter; (b) a sequence encoding ATP7B operably linked to a promoter; and (c) a polyadenylation signal.

[0035] As used herein, "operably linked" refers to a first molecule linked to a second molecule, the molecules being arranged so that the first molecule affects the function of the second molecule. The two molecules may or may not be part of a single, continuous molecule, and may or may not be adjacent. For example, if a promoter regulates the transcription of a transcribable polynucleotide molecule of interest in a cell, the promoter is operably linked to the transcribable polynucleotide molecule. In addition, two parts of a transcriptional regulatory element are operably linked to each other if they are linked such that the transcriptional activation function of one part is not adversely affected by the presence of the other part. Two transcriptional regulatory elements may be operably linked to each other via a linker nucleic acid (e.g., an intervening non-coding nucleic acid) or may be operably linked to each other without any intervening nucleotides.

[0036] In one aspect, (a) a promoter; (b) a sequence encoding ATP7B operably linked to a promoter; (c) miRNA binding site (miRBS), (d) post-transcriptional regulatory elements, and / or (e) a polyadenylation signal.

[0037] In one embodiment, from 5' to 3': (a) a promoter; (b) a sequence encoding ATP7B operably linked to a promoter; and (c) miRNA binding site (miRBS); (d) post-transcriptional regulatory elements; (e) a polyadenylation signal.

[0038] In one aspect, the expression construct: (a) a promoter; (b) a sequence encoding ATP7B operably linked to a promoter; (c) post-transcriptional regulatory elements, and / or (d) A polyadenylation signal is provided.

[0039] In one aspect, from 5' to 3', the expression construct: (a) a promoter; (b) a sequence encoding ATP7B operably linked to a promoter; (c) post-transcriptional regulatory elements, and (d) A polyadenylation signal is provided.

[0040] As used herein, the term "5' to 3'" refers to the order of specific genetic elements in a nucleic sequence. In some embodiments, specific genetic elements are linked to each other by linker nucleic acids (e.g., intervening non-coding nucleic acids). In some embodiments, specific genetic elements are linked to each other without any intervening nucleotides. In some embodiments, some of the specific genetic elements are linked to each other by linker nucleic acids, while other genetic elements are linked to each other without any intervening nucleotides.

[0041] In some embodiments, the expression construct comprises a promoter sequence comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 4-33. In some embodiments, the expression construct comprises a promoter sequence comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 4, 10, or 11. In some embodiments, the expression construct comprises a promoter sequence comprising any one of SEQ ID NOs: 4, 10, or 11.

[0042] In some embodiments, the expression construct comprises a promoter sequence comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 4. In some embodiments, the expression construct comprises a promoter sequence comprising SEQ ID NO:4.

[0043] In some embodiments, the expression construct comprises a promoter sequence comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 10. In some embodiments, the expression construct comprises a promoter sequence comprising SEQ ID NO: 10.

[0044] In some embodiments, the expression construct comprises a promoter sequence comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 11. In some embodiments, the expression construct comprises a promoter sequence comprising SEQ ID NO: 11.

[0045] In some embodiments, the expression construct comprises a Kozak sequence for initiating protein translation. In some embodiments, the expression construct comprises a translation initiator in the short 5' UTR (TISU) sequence for initiating protein translation. See, e.g., Elfakess et al., Nucleic Acids Res. 2011 Sep 1;39(17):7598-609.

[0046] In some embodiments, the expression construct comprises a sequence encoding ATP7B, wherein the sequence encoding ATP7B is codon-optimized.

[0047] In some embodiments, the expression construct comprises a sequence encoding ATP7B, wherein the sequence encoding ATP7B is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 35-48. In some embodiments, the expression construct comprises any one of SEQ ID NOs: 35-48.

[0048] In some embodiments, the expression construct comprises a sequence encoding ATP7B, wherein the sequence encoding ATP7B is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 39 or SEQ ID NO: 41. In some embodiments, the expression construct is directed to SEQ ID NO: 39 or SEQ ID NO: 41.

[0049] In some embodiments, the expression construct comprises a sequence encoding ATP7B, wherein the sequence encodes an ATP7B protein comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 118-128. In some embodiments, the expression construct comprises a sequence encoding ATP7B, wherein the sequence encodes an ATP7B protein comprising any one of SEQ ID NOs: 118-128.

[0050] In some embodiments, the expression construct comprises a sequence encoding ATP7B, wherein the sequence encodes an ATP7B protein comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:118 or SEQ ID NO:123. In some embodiments, the expression construct comprises a sequence encoding ATP7B, wherein the sequence encodes an ATP7B protein comprising SEQ ID NO:118 or SEQ ID NO:123.

[0051] In some embodiments, the expression construct comprises a miRNA binding site (miRBS). In embodiments, the miRBS comprises one or more (e.g., 1-6) binding sites for a microRNA. In embodiments, the miRBS comprises one or more binding sites for miR142 (TCCATAAAGTAGGAAACACTACA, SEQ ID NO: 6). In embodiments, the miRBS comprises four binding sites for miR142. In embodiments in which the miRBS comprises two or more binding sites for miR142, the binding sites for miR142 may be linked by a nucleotide linker of 1-10 nucleotides.

[0052] In some embodiments, the expression construct comprises a miRBS comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 53. In some embodiments, the expression construct comprises a miRBS comprising SEQ ID NO:53.

[0053] In some embodiments, the expression construct comprises a post-transcriptional regulatory element. In some embodiments, the expression construct comprises a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE).

[0054] In some embodiments, the expression construct comprises a post-transcriptional regulatory element comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 49 or SEQ ID NO: 50. In some embodiments, the expression construct comprises a post-transcriptional regulatory element comprising SEQ ID NO: 49 or SEQ ID NO: 50.

[0055] In some embodiments, the expression construct comprises a post-transcriptional regulatory element comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 49. In some embodiments, the expression construct comprises a post-transcriptional regulatory element comprising SEQ ID NO:49.

[0056] In some embodiments, the expression construct comprises a polyadenylation signal comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 51 or SEQ ID NO: 52. In some embodiments, the expression construct comprises a polyadenylation signal comprising SEQ ID NO: 51 or SEQ ID NO: 52.

[0057] In some embodiments, the expression construct comprises a polyadenylation signal comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 51. In some embodiments, the expression construct comprises a polyadenylation signal comprising SEQ ID NO: 51.

[0058] In one embodiment, the expression construct comprises: (a) a promoter comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 11; (b) a sequence encoding ATP7B operably linked to a promoter, the sequence comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 41; (c) a post-transcriptional regulatory element comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 49; (d) a polyadenylation signal comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 51.

[0059] In one embodiment, the expression construct comprises: (a) a promoter comprising SEQ ID NO: 11; (b) a sequence encoding ATP7B operably linked to a promoter, the sequence comprising SEQ ID NO: 41; (c) a post-transcriptional regulatory element comprising SEQ ID NO: 49; and (d) a polyadenylation signal comprising SEQ ID NO: 51.

[0060] In one embodiment, the expression construct comprises: (a) a promoter comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 10; (b) a sequence encoding ATP7B operably linked to a promoter, the sequence comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 39; (c) a miRBS comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 53; (d) a post-transcriptional regulatory element comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 49; (e) a polyadenylation signal comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 51.

[0061] In one embodiment, the expression construct comprises: (a) a promoter comprising SEQ ID NO: 10; (b) a sequence encoding ATP7B operably linked to a promoter, the sequence comprising SEQ ID NO: 39; and (c) a miRBS comprising SEQ ID NO: 53; and (d) a post-transcriptional regulatory element comprising SEQ ID NO: 49; and (e) a polyadenylation signal comprising SEQ ID NO: 51.

[0062] In one embodiment, the expression construct comprises: (a) a promoter comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:4; (b) a sequence encoding ATP7B operably linked to a promoter, the sequence comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 41; (c) a post-transcriptional regulatory element comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 49; (d) a polyadenylation signal comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 51.

[0063] In one embodiment, the expression construct comprises: (a) a promoter comprising SEQ ID NO: 4; (b) a sequence encoding ATP7B operably linked to a promoter, the sequence comprising SEQ ID NO: 41; (c) a post-transcriptional regulatory element SEQ ID NO: 49; and (d) a polyadenylation signal comprising SEQ ID NO: 51.

[0064] Provided herein are expression constructs of Table 7. Provided herein are expression constructs that include one or more of the genetic elements set forth in Table 7.

[0065] vector In one aspect, recombinant vectors for introducing transgenes or expression constructs into cells and their uses are provided. In some embodiments, the recombinant vectors comprise recombinant DNA constructs that contain additional DNA elements, including DNA segments that provide appropriate levels of DNA replication in host cells and expression of target genes in target cells. Those skilled in the art will understand that expression control sequences (promoters, enhancers, etc.) are selected based on their ability to promote expression of target genes in target cells.

[0066] As used herein, "vector" refers to a vehicle containing a polynucleotide that is delivered to a host cell either in vitro or in vivo. Non-limiting examples of vectors include a recombinant plasmid, yeast artificial chromosome (YAC), minichromosome, DNA minicircle, or virus (containing a viral-derived sequence). A vector may also refer to a virion containing a nucleic acid that is delivered to a host cell either in vitro or in vivo. In some embodiments, a vector refers to a virion containing a recombinant viral genome, where the viral genome includes one or more ITRs and a transgene.

[0067] In one embodiment, the recombinant vector is a viral vector or a combination of viral vectors. In one aspect, a vector is provided comprising any of the expression constructs disclosed herein.

[0068] viral vectors Viral vectors for expressing target genes in target cells, tissues, or organisms are known in the art and include, for example, AAV vectors, adenoviral vectors, lentiviral vectors, retroviral vectors, poxvirus vectors, baculovirus vectors, herpes simplex virus vectors, vaccinia virus vectors, or synthetic viral vectors (e.g., chimeric, mosaic, or pseudotyped viruses, and / or viruses containing foreign proteins, synthetic polymers, nanoparticles, or small molecules).

[0069] AAV vectors Adeno-associated viruses (AAVs) are small, single-stranded DNA viruses that require a helper virus to promote efficient replication. The 4.7-kb genome of AAV is characterized by two inverted terminal repeats (ITRs) and two open reading frames encoding the Rep and Cap proteins, respectively. The Rep reading frame encodes four proteins with molecular weights of 78 kD, 68 kD, 52 kD, and 40 kD. These proteins primarily function in AAV replication and rescue and in regulating AAV integration into host cell chromosomes. The Cap reading frame encodes three structural proteins with molecular weights of 85 kD (VP1), 72 kD (VP2), and 61 kD (VP3), which form the virion capsid. VP3 accounts for more than 80% of the total protein in AAV virions. Adjacent to the 5' and 3' ends of the Rep and Cap open reading frames are inverted terminal repeats (ITRs) approximately 145 bp long. The two ITRs are the only cis elements essential for AAV replication, rescue, packaging, and integration of the AAV genome. The entire rep and cap domains can be excised and replaced with therapeutic or reporter transgenes.

[0070] Recombinant adeno-associated virus "rAAV" vectors include any vector derived from any adeno-associated virus serotype. rAAV vectors can have one or more of the AAV wild-type genes, preferably the Rep and / or Cap genes, deleted in whole or in part, but retain functional flanking ITR sequences.

[0071] In some embodiments, the viral vector is a rAAV virion comprising a rAAV genome and one or more capsid proteins. In some embodiments, the rAAV genome comprises an expression construct disclosed herein.

[0072] In some embodiments, the viral vectors disclosed herein comprise a nucleic acid comprising AAV 5' and 3' ITRs located 5' and 3', respectively, to the ATP7B-encoding sequence. However, in certain embodiments, it may be desirable for the nucleic acid to contain 5' and 3' ITR sequences arranged in tandem, e.g., 5'-3', or head-to-tail, or in another alternative configuration. In still other embodiments, it may be desirable for the nucleic acid to contain multiple copies of the ITRs or to have the 5' ITR (or conversely, the 3' ITR) located both 5' and 3' to the ATP7B-encoding sequence. The ITR sequences may be located immediately upstream and / or downstream of the heterologous molecule, or intervening sequences may be present. The ITRs need not be wild-type nucleotide sequences and can be modified (e.g., by nucleotide insertion, deletion, or substitution) so long as the sequences provide functional rescue, replication, and packaging. The ITRs can be selected from AAV2 or from other AAV serotypes, as described herein.

[0073] In some embodiments, a vector is provided comprising a nucleic acid sequence comprising (i) an expression construct disclosed herein and (ii) one or more inverted terminal repeats (ITRs). In one embodiment, the nucleic acid sequence comprises a 5'ITR and a 3'ITR. In one embodiment, the 5'ITR and the 3'ITR are derived from adeno-associated virus (AAV) serotype AAV2.

[0074] In one embodiment, the 5' ITR sequence comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 116-177. In one embodiment, the 5' ITR sequence comprises any one of SEQ ID NOs: 116-177.

[0075] In one embodiment, the 3' ITR sequence comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 178-239. In one embodiment, the 3' ITR sequence comprises any one of SEQ ID NOs: 178-239.

[0076] Provided herein are vectors comprising a nucleic acid sequence comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 54-115. Provided herein are vectors comprising any one of SEQ ID NOs: 54-115.

[0077] Provided herein is a vector comprising a nucleic acid sequence comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NO: 65, SEQ ID NO: 73, or SEQ ID NO: 92. Provided herein is a vector comprising any one of SEQ ID NO: 65, SEQ ID NO: 73, or SEQ ID NO: 92.

[0078] In some embodiments, the viral vector is an AAV vector, e.g., AAV1 (i.e., AAV containing AAV1 ITRs and AAV1 capsid protein), AAV2 (i.e., AAV containing AAV2 ITRs and AAV2 capsid protein), AAV3 (i.e., AAV containing AAV3 ITRs and AAV3 capsid protein), AAV4 (i.e., AAV containing AAV4 ITRs and AAV4 capsid protein), AAV5 (i.e., AAV containing AAV5 ITRs and AAV5 capsid protein), AAV6 (i.e., AAV containing AAV6 ITRs and AAV6 capsid protein), AAV7 (i.e., AAV containing AAV7 ITRs and AAV7 capsid protein), AAV8 (i.e., AAV containing AAV8 ITRs and AAV8 capsid protein), AAV9 (i.e., AAV9 ITRs and AAV9 capsid protein), AAVrh.74 (i.e., an AAV containing AAVrh74 ITRs and AAVrh74 capsid protein), AAVrh.8 (i.e., an AAV containing AAVrh.8 ITRs and AAVrh.8 capsid protein), or AAVrh.10 (i.e., an AAV containing AAVrh.10 ITRs and AAVrh.10 capsid protein).

[0079] In some embodiments, the viral vector is a pseudotyped AAV vector comprising ITRs from one AAV serotype and capsid proteins from a different AAV serotype. In some embodiments, the pseudotyped AAV is AAV2 / 9 (i.e., an AAV containing AAV2 ITRs and AAV9 capsid proteins). In some embodiments, the pseudotyped AAV is AAV2 / 10 (i.e., an AAV containing AAV2 ITRs and AAV10 capsid proteins). In some embodiments, the pseudotyped AAV is AAV2 / 8 (i.e., an AAV containing AAV2 ITRs and AAV8 capsid proteins).

[0080] In some embodiments, the pseudotyped AAV is AAV2 / 7m8 (i.e., an AAV containing AAV2 ITRs and AAV 7m8 capsid proteins).

[0081] In some embodiments, the AAV vector contains a recombinant capsid protein, such as a capsid protein containing one or more chimeras of capsid proteins from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh74, AAVrh.8, or AAVrh.10. In embodiments, the capsid is a variant AAV capsid, such as the AAV2 variant rAAV2-retro (SEQ ID NO: 44 from WO2017 / 218842, incorporated herein by reference). In one embodiment, the capsid protein is derived from AAV8.In some embodiments, the capsid is selected from the group consisting of AAV-3B, AAV-S3, AAV3B-DE5, AAV-GT5, AAV-KP1, AAV-LK03, AAV-208 (AAVrh10 / AAV8 hybrid, see Charbel et al., Assessment of tropism and effectiveness of new primate-derived hybrid recombinant AAV serotypes in the mouse and primate retina. PLoS One. 2013 Apr 9;8(4):e60361), AAV-Anc80, AAV-CMRI_30 (AAV2 with T503A and N596D mutations, see PCT Publication WO2021 / 000,024), AAV2-N496D, AAV2-N582S, AAV-NP59 (Paulk et al., Bioengineered AAV Capsids with Combined High Human Tissue Responses, see Ref. 1). Liver Transduction In Vivo and Unique Humoral Seroreactivity. Mol Ther. 2018 Jan 3;26(1):289-303), AAV-hu.T88 (see Chen et al., Molecular characterization of adeno-associated viruses infecting children. J Virol. 2005 Dec;79(23):14781-92), AAV-hu.S17 (see Chen et al., 2005), AAV-2TT (see Tordo et al., A novel adeno-associated viral capsid with enhanced neurotropism corrects a lysosomal transmembrane enzyme deficiency. Brain. 2018 Jul 1;141(7):2014-2031), or AAV-2.htT88-MEAS (AAV2 / hu.T88 mosaic).

[0082] Other viral vectors Other viral vectors include adenovirus (AV) vectors, such as those based on human adenovirus type 2 and human adenovirus type 5, which have been rendered replication-deficient by deletion of the E1 and E3 regions. A transcription cassette can be inserted into the E1 region to obtain an E1 / E3-deleted recombinant AV vector. Adenovirus vectors also include helper-dependent, large-capacity adenovirus vectors (also known as large-capacity, "gutless" or "gutted" vectors) that do not contain viral coding sequences. These vectors contain cis-acting elements necessary for viral DNA replication and packaging, primarily inverted terminal repeats (ITRs) and packaging signals (CYs). These helper-dependent AV vector genomes have the potential to carry foreign DNA from several hundred base pairs to approximately 36 kb.

[0083] Alternatively, other systems, such as lentiviral vectors, can be used. Lentiviral-based systems can transduce not only non-dividing cells but also dividing cells, making them useful for targeting non-dividing cells in the CNS, for example. Lentiviral vectors are derived from the human immunodeficiency virus and, like that virus, integrate into the host genome, providing the potential for very long-term gene expression.

[0084] Polynucleotides, including plasmids, YACs, minichromosomes, and minicircles, carrying target genes containing expression cassettes can also be introduced into cells or organisms by non-viral vector systems, for example, using cationic lipids, polymers, or both as carriers. Conjugated poly-L-lysine (PLL) polymer and polyethyleneimine (PEI) polymer systems can also be used to deliver vectors into cells. Other methods for delivering vectors into cells include hydrodynamic injection and electroporation, as well as the use of ultrasound, for both cell cultures and organisms. For a review of viral and non-viral delivery systems for gene delivery, see Nayerossadat, N. et al. (Adv Biomed Res. 2012;1:27), which is incorporated herein by reference.

[0085] rAAV virion production The rAAV virions disclosed herein can be constructed and produced using materials and methods described herein and known to those of skill in the art. Such engineering methods used to construct any embodiment of the present disclosure are known to those skilled in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, for example, Sambrook et al., "Molecular Cloning. A Laboratory Manual," 2nd ed., Cold Spring Harbor Laboratory, New York (1989), and Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989, and International Patent Publication No. WO 95 / 13598. Additionally, suitable methods for producing rAAV cassettes within adenovirus capsids are described in U.S. Patent Nos. 5,856,152 and 5,871,982.

[0086] Briefly, to package the rAAV genome into rAAV virions, host cells containing sequences necessary for expressing AAV rep and AAV cap or functional fragments thereof, as well as helper genes essential for AAV production, are used. The AAV rep and cap sequences are obtained from AAV sources found herein. The AAV rep and cap sequences can be introduced into host cells by any method known to those skilled in the art, including, but not limited to, transfection, electroporation, liposome delivery, membrane fusion techniques, high-speed DNA-coated pellets, viral infection, and protoplast fusion. In one embodiment, the rep and cap sequences can be transfected into host cells via one or more nucleic acid molecules and stably present in the cells as episomes. In another embodiment, the rep and cap sequences are stably integrated into the cell's genome. In another embodiment, the rep and cap sequences are transiently expressed in the host cell. For example, a nucleic acid molecule useful for such transfection comprises, from 5' to 3', a promoter, an optional spacer inserted between the promoter and the start of the rep gene sequence, an AAV rep gene sequence, and an AAV cap gene sequence.

[0087] The rep and cap sequences, along with their expression control sequences, may be provided on a single vector, or each sequence may be provided on its own vector. Preferably, the rep and cap sequences are provided on the same vector. Alternatively, the rep and cap sequences may be provided on a vector containing other DNA sequences that can be introduced into host cells. Preferably, the promoter used in this construct may be any suitable constitutive, inducible, or native promoter known to those skilled in the art. The molecule providing the rep and cap proteins may be in any form that transfers these components into host cells. Desirably, this molecule is in the form of a plasmid, which may contain other non-viral sequences, such as sequences of marker genes. This molecule does not contain AAV ITRs and generally does not contain AAV packaging sequences. To avoid the occurrence of homologous recombination, other viral sequences, particularly adenoviral sequences, are avoided in this plasmid. Desirably, this plasmid is constructed so that it can be stably transfected into cells.

[0088] Although the molecules providing rep and cap can be transiently transfected into host cells, it is preferred that the host cells be stably transformed with the sequences necessary to express functional rep / cap proteins in the host cell, e.g., as an episome or by integration into the host cell chromosome. Depending on the promoter controlling expression in such stably transfected host cells, the rep / cap proteins can be transiently expressed (e.g., through the use of an inducible promoter).

[0089] The methods used to construct embodiments of the present disclosure are conventional genetic or recombinant engineering techniques, as described in the references above. For example, rAAV can be produced using a triple transfection method using either the calcium phosphate method (Clontech) or Effectene reagent (Qiagen, Valencia, Calif.), according to the manufacturer's instructions. See Herzog et al., 1999, Nature Medic., 5(1):56-63, for the method used in the following examples, which employs a plasmid carrying the transgene, a helper plasmid containing AAV rep and cap, and a plasmid supplying the adenoviral helper functions of E2A, E4Orf6, and VA. While the present specification provides illustrative examples of specific constructs using the information provided herein, those skilled in the art will be able to select and design other suitable constructs using their selection of spacers, promoters, and other elements, including at least one translational start and stop signal, and the optional addition of a polyadenylation site.

[0090] rAAV virions are then produced by culturing host cells containing the rAAV virus described herein, which contains the rAAV genome packaged in the rAAV virion, AAV rep sequence, and AAV cap sequence, under the control of regulatory sequences directing its expression. Suitable viral helper genes, such as adenovirus E2A, E4Orf6, and VA, among other possible helper genes, can be provided to the culture by various methods known in the art, preferably on separate plasmids. Recombinant AAV virions directing the expression of the ATP7B transgene are then isolated from the cells or cell culture in the absence of contaminating helper virus or wild-type AAV.

[0091] The expression of ATP7B transgene can be measured by methods known in the art. For example, target cells can be infected in vitro, and the copy number of the transgene in cells can be monitored by Southern blotting or quantitative polymerase chain reaction (PCR). RNA expression level can be monitored by Northern blotting or quantitative reverse transcriptase (RT)-PCR; and protein expression level can be monitored by Western blotting, immunohistochemistry, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), or by the specific method detailed in the following examples.

[0092] Pharmaceutical Composition Provided herein are pharmaceutical compositions comprising any of the vectors disclosed herein and a pharmaceutically acceptable excipient.

[0093] In some embodiments, the rAAV containing the gene encoding ATP7B is assessed for contamination by conventional methods and then formulated into a pharmaceutical composition suitable for storage and / or administration to a patient.

[0094] Formulation of the vectors disclosed herein involves the use of a pharmaceutically and / or physiologically acceptable vehicle or carrier, particularly buffered saline or other buffers suitable for subretinal injection, such as, for example, HEPES, to maintain pH at an appropriate physiological level.

[0095] The vectors of the present disclosure can be formulated into pharmaceutical compositions. These compositions may contain, in addition to the vector, pharmaceutically and / or physiologically acceptable excipients, carriers, buffers, stabilizers, antioxidants, preservatives, or other additives known to those skilled in the art. Such materials must be non-toxic and not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other materials can be determined by one of ordinary skill in the art according to the route of administration. Pharmaceutical compositions are typically in liquid form. Liquid pharmaceutical compositions generally contain a liquid carrier such as water, petroleum, animal or vegetable oils, mineral oil, or synthetic oil. Additional carriers are provided in International Patent Publication No. WO 00 / 15822, which is incorporated herein by reference. Physiological saline, magnesium chloride, dextrose, or other sugar solutions, or glycols such as ethylene glycol, propylene glycol, or polyethylene glycol may also be included. In some cases, surfactants, such as 0.001% pluronic acid (PF68), may be used. In some cases, Ringer's solution, lactated Ringer's solution, or Hartmann's solution is used. Preservatives, stabilizers, buffers, antioxidants and / or other additives may be included as required. For delayed release, the vector may be included in a pharmaceutical composition formulated for delayed release, such as in microcapsules formed from biocompatible polymers or liposome carrier systems, according to methods known in the art.

[0096] For long-term storage of the vector, the vector may be frozen in the presence of glycerol.

[0097] Treatment method Provided herein are methods of treating a disease in a subject in need thereof using the expression constructs, vectors, and pharmaceutical compositions disclosed herein.

[0098] In some embodiments, the subject is a mammal. As used herein, the term "mammal" is intended to include, but is not limited to, humans, laboratory animals, domestic pets, and farm animals. Mammals include, but are not limited to, humans or non-human mammals, such as cows, horses, dogs, sheep, or cats. An "individual" or "patient" is also a subject herein.

[0099] As used herein, the terms "treat," "treated," "treating," or "treatment" refer to therapeutic treatment, the purpose of which is to slow (alleviate) an undesirable physiological condition, disorder, or disease, or to obtain a beneficial or desired clinical result. For purposes of this disclosure, beneficial or desired clinical results include, but are not limited to, alleviation of symptoms; reduction in the severity of the condition, disorder, or disease; stabilization (i.e., not worsening) of the pathological condition, disorder, or disease state; delay in the onset of the condition, disorder, or disease, or delay in the progression of the condition, disorder, or disease; improvement in one or more symptoms of the condition, disorder, or disease state; and remission (partial or complete), or improvement or amelioration of the condition, disorder, or disease. Treatment includes eliciting a clinically significant response without excessive levels of side effects. Treatment also includes prolonging survival compared to the expected survival if not receiving treatment.

[0100] The terms "prevent", "preventing", and the like refer to acting before the onset of an overt disease or disorder to prevent the onset of the disease or disorder, minimize the extent of the disease or disorder, or delay the course of its development.

[0101] Provided herein is a method for increasing ATP7B activity in a subject in need thereof, the method comprising administering to the subject a vector or pharmaceutical composition disclosed herein.

[0102] Provided herein are methods for increasing copper secretion in a subject in need thereof, the method comprising administering to the subject a vector or pharmaceutical composition disclosed herein.

[0103] Provided herein is a method for treating or preventing a condition caused by ATP7B deficiency or dysfunction in a subject in need thereof, the method comprising administering to the subject a vector or pharmaceutical composition disclosed herein. Provided herein is a vector or pharmaceutical composition disclosed herein for use in treating or preventing a condition caused by ATP7B deficiency or dysfunction in a subject in need thereof. Provided herein is use of a vector in the manufacture of a medicament for treating or preventing a condition caused by ATP7B deficiency or dysfunction in a subject in need thereof.

[0104] Provided herein are methods for treating or preventing Wilson's disease in a subject in need thereof, the method comprising administering to the subject a vector or pharmaceutical composition disclosed herein. Provided herein are vectors or pharmaceutical compositions disclosed herein for use in treating or preventing Wilson's disease in a subject in need thereof. Provided herein are vectors or pharmaceutical compositions disclosed herein in the manufacture of a medicament for treating or preventing Wilson's disease in a subject in need thereof.

[0105] Provided herein are methods for treating or preventing dystonia or bradykinesia in a subject suffering from Wilson's disease in need thereof, the methods comprising administering to the subject a vector or pharmaceutical composition disclosed herein. Provided herein are vectors or pharmaceutical compositions disclosed herein for use in treating or preventing dystonia or bradykinesia in a subject suffering from Wilson's disease in need thereof. Provided herein is use of a vector in the manufacture of a medicament for treating or preventing dystonia or bradykinesia in a subject suffering from Wilson's disease in need thereof.

[0106] Provided herein are methods for reducing the incidence of leukopenia or anemia in a subject suffering from Wilson's disease in need thereof, comprising administering to the subject a vector or pharmaceutical composition disclosed herein. Provided herein are vectors or pharmaceutical compositions disclosed herein for use in reducing the incidence of leukopenia or anemia in a subject suffering from Wilson's disease in need thereof. Provided herein is use of a vector in the manufacture of a medicament for reducing the incidence of leukopenia or anemia in a subject suffering from Wilson's disease in need thereof.

[0107] Provided herein is a method for reducing the incidence of cirrhosis in a subject suffering from Wilson's disease in need thereof, comprising administering to the subject a vector or pharmaceutical composition disclosed herein. Provided herein is a vector or pharmaceutical composition disclosed herein for use in reducing the incidence of cirrhosis in a subject suffering from Wilson's disease in need thereof. Provided herein is the use of a vector in the manufacture of a medicament for reducing the incidence of cirrhosis in a subject suffering from Wilson's disease in need thereof.

[0108] In some embodiments, treatment refers to increased survival (e.g., survival time). For example, treatment can result in an increased life expectancy of a patient. In some embodiments, treatment can result in an increased life expectancy of about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about

[0013] In some embodiments, treatment results in an increase in patient life expectancy of more than 100%, about 105%, about 110%, about 115%, about 120%, about 125%, about 130%, about 135%, about 140%, about 145%, about 150%, about 155%, about 160%, about 165%, about 170%, about 175%, about 180%, about 185%, about 190%, about 195%, about 200% or more. In some embodiments, treatment results in an increase in patient life expectancy of more than about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 2 years, about 3 years, about 4 years, about 5 years, about 6 years, about 7 years, about 8 years, about 9 years, about 10 years or more compared to the life expectancy of one or more control individuals with Wilson disease who are not receiving treatment. In some embodiments, treatment results in long-term survival of the patient. As used herein, the term "long-term survival" refers to a survival time or life expectancy of greater than about 40, 45, 50, 55, 60 years or more.

[0109] Combination therapy In some embodiments, the expression constructs or vectors described herein are administered to a subject in combination with one or more additional therapies for treating Wilson's disease. In embodiments, the expression constructs or vectors are administered in combination with a chelating agent. In embodiments, the expression constructs or vectors may be administered in combination with penicillamine (Cuprimine®, Depen®, etc.), trientine (Syprine®, etc.), zinc acetate (Galzin®).

[0110] In some embodiments, the combined administration of the expression construct or vector and the second agent results in a greater degree of amelioration of Wilson's disease or its symptoms than that produced by either the expression construct or vector or the second agent alone, and the difference between the combined effect and the effect of each agent alone may be statistically significant.

[0111] In some embodiments, co-administration of the expression construct or vector with a second agent allows the second agent to be administered at a reduced dose, a reduced number of doses, and / or a reduced dosing frequency compared to the standard dosing regimen approved for the second agent.

[0112] Route and method of administration Methods of administration include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, oral, sublingual, intracerebral, intrathecal, intravaginal, transdermal, rectal, by inhalation, or topical, particularly to the ear, nose, eye, or skin. The mode of administration is left to the discretion of the practitioner.

[0113] In some cases, an expression construct or vector described herein is administered locally. This can be achieved, for example, by local infusion during surgery, by topical application (e.g., in a cream or lotion), by injection, by catheter, by suppository or enema, or by implant, which is a porous, non-porous, or gel-like material, including membranes such as silastic membranes or fibers. In some situations, an expression construct or vector described herein is introduced into the central nervous system, circulatory system, or gastrointestinal tract by any suitable route, including intraventricular injection, intrathecal injection, paraspinal injection, epidural injection, enema, and injection adjacent to a peripheral nerve.

[0114] The compositions described herein can be administered as a single dose or multiple doses. Such compositions can be administered at regular intervals depending on the nature, severity, and extent of the subject's condition. In some embodiments, a therapeutically effective amount of an expression construct or vector is administered intrathecally periodically at regular intervals (e.g., once a year, once every six months, once every five months, once every three months, every two months, every other month (once a month), every other week (once every two weeks), or every week).

[0115] The amount of the expression construct or vector described herein that is effective in treating a disease can be determined using standard clinical techniques known to those skilled in the art. In addition, in vitro or in vivo assays can optionally be used to help identify optimal dosage ranges. The precise dose employed will also depend on the route of administration, the condition, the severity of the condition being treated, and various physical factors related to the individual being treated, and can be decided according to the judgment of a medical professional.

[0116] An effective amount of rAAV carrying a nucleic acid sequence encoding ATP7B under the control of a promoter is, for example, about 1×10 9 ~1×10 13 ~Approx. 1.5×10 17The number of genome particles may range from about 1×10 to about 1×10. A "genomic particle" is defined herein as an AAV capsid containing a single-stranded DNA molecule that can be quantified by a sequence-specific method (such as real-time PCR). In some embodiments, the number of genome particles may be in the range of about 1×10 to about 1×10. 13 ~Approx. 1.5×10 17 In some embodiments, about 1 x 10 viral genomes are used for systemic delivery. 11 of viral genome is used. Still other doses within these ranges can be selected by the attending physician.

[0117] It is understood that for any particular subject, specific dosage regimens can be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the expression constructs or vectors, and that dosage ranges set forth herein are exemplary only and are not intended to limit the scope or practice of the claimed disclosure.

[0118] In some embodiments, it may be desirable to administer multiple "booster" doses of the pharmaceutical compositions disclosed herein. For example, depending on the duration of the transgene in target cells, booster doses can be delivered at 6-month intervals or annually after the initial administration. Other similar tests can be used to determine the status of treated subjects over time. The selection of appropriate tests can be made by the attending physician.

[0119] Manufactured Products and Kits Kits or articles of manufacture for use in the methods described herein are also provided. In embodiments, the kits include a composition described herein (e.g., a composition for delivering an ATP7B-encoding transgene) in suitable packaging. Suitable packaging for the compositions described herein (e.g., injectable ophthalmic compositions) is known in the art and includes, for example, vials (e.g., sealed vials), containers, ampoules, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags), and the like. These articles of manufacture may be further sterilized and / or sealed.

[0120] Kits containing the compositions described herein are also provided. These kits may further include instruction(s) regarding methods of using the compositions, such as the uses described herein. The kits described herein may further include other materials desirable from a commercial and user standpoint, including buffers, diluents, filters, needles, syringes, and package inserts with instructions for administering the compositions or performing any of the methods described herein. For example, in some embodiments, the kits include an rAAV for expressing a transgene encoding ATP7B in target cells, a pharmaceutically acceptable carrier suitable for injection, and one or more of a buffer, diluent, filter, needle, syringe, and package insert with instructions for performing the injection.

[0121] All methods described herein may be performed in any suitable order unless otherwise indicated herein or clearly contradicted by context. For any of the methods provided, the method steps may occur simultaneously or sequentially. When method steps occur sequentially, the steps may occur in any order unless otherwise specified.

[0122] Where the method includes a combination of steps, unless otherwise stated herein, each and every combination or subcombination of steps is encompassed within the scope of the present disclosure.

[0123] It is understood that this invention is not limited to the particular molecules, compositions, methodologies, or protocols described, as these may vary. Any methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of this invention. Furthermore, it should be understood that the disclosure of the invention herein includes all possible combinations of such particular features. For example, if a particular feature is disclosed in connection with a particular aspect or embodiment of the invention, or with a particular claim, that feature can also be used in combination with and / or in connection with other specific aspects and embodiments of the invention, and in the invention generally, to the extent possible.

[0124] All other referenced patents and applications are incorporated herein by reference in their entirety. Furthermore, to the extent that the definition or use of a term in a reference incorporated herein by reference is inconsistent with or contradicts the definition of that term provided herein, the definition of that term provided herein shall apply and the definition of that term in the reference shall not apply.

[0125] To facilitate a better understanding of the present invention, the following examples of specific embodiments are given, which should not be construed as limiting or defining the entire scope of the invention. [Example]

[0126] Example 1: Methods for Examples 1-5 cell culture Huh-7, AML-12, and HEK293 immortalized cell lines were maintained at 37°C in 5% CO2. Cells were transiently transfected with plasmids using BC transfection reagent. After 72 hours, cell lysates were collected for protein analysis. After 20 passages, a new aliquot of cells was thawed and passaged twice before use in subsequent experiments.

[0127] Primary hepatocyte culture Gibco-derived mouse and human hepatocyte cell lines were thawed and placed in suspension medium, then centrifuged at 100 x g for 10 minutes at 4°C. The supernatant was aspirated, and the cells were resuspended in maintenance medium (+10% FBS) and then plated at 400,000 cells per well onto a 24-well plate. Four hours after plating, the plate was gently tapped to loosen debris, and the medium was then aspirated and replaced with non-FBS containing maintenance medium. Cells were maintained at 37°C and 5% CO2. A complete medium change was performed daily to feed the cultures.

[0128] Transduction For immortalized and primary cell cultures, AAV8 particles were added to the culture medium at a multiplicity of infection (MOI) of 50,000 on days 1 and 3 in vitro, respectively. Doxorubicin-containing medium was added to the cells to accelerate transduction. The medium was replaced with non-doxorubicin-containing medium after 72 hours, according to standard protocols.

[0129] Western blotting After gently washing the cells with PBS, ice-cold lysis buffer (CST) containing nuclease, as well as protease and phosphatase inhibitors, was added. Cells were lysed on the plate for 30 minutes with agitation on ice and then collected. Liver tissue samples (approximately 30 mg) were lysed by two rounds of sonication in cold RIPA buffer containing nuclease, as well as protease and phosphatase inhibitors. The samples were vortexed vigorously to ensure complete lysis and then pelleted in a microcentrifuge at 20,000 × g for 15 minutes at 4°C. The supernatant was collected, and the protein concentration was determined by BCA (bicinchoninic acid) assay. Protein was then normalized to a standard concentration using 4x LDS, 10x DTT, and lysis buffer. The samples were denatured at 75°C for 10 minutes.

[0130] For analysis of ATP7B expression, 10 μg of protein samples were separated on a Bolt 4-12% Bis-Tris denaturing gel (Invitrogen, USA) using MOPS buffer. The gel was then transferred to a nitrocellulose membrane at a constant current of 0.4 A for 2 hours. The membrane was probed with primary antibodies (ATP7B, GAPDH, CHOP, CD11b, and beta-actin) diluted in Licor TBS blocking buffer overnight at 4°C. The membrane was then washed with TBS-T and probed with fluorescently conjugated anti-mouse or anti-rabbit IgG secondary antibodies for 1 hour at room temperature. The membrane was imaged on a Licor Odyssey imaging system. Protein amounts were normalized using either beta-actin or GAPDH control bands.

[0131] animal research ATP7B, a 7-week-old male backcrossed to C57BL / 6 - / - Mice were obtained from Baylor College of Medicine and bred by Charles River Laboratories. Mice were housed five animals per cage on a 12-hour light / dark cycle (lights on 0700-1900 h), at a constant temperature (23 °C), and with free access to food and water. All studies were reviewed by the Institutional Animal Care and Use Committee (IACUC).

[0132] Adeno-associated virus (AAV) serotype 2 / 8 (5 × 10 12 GC / kg) was delivered via tail vein injection at 7 weeks of age. Mice were restrained and placed under a warm light to increase vasodilation, and a 27G needle was used to target the tail vein. After 8 weeks, blood was collected into BD serum microtubes (#02-675-185) by cutting the lateral tail vein after dilating the vessels with a heat lamp. Samples were allowed to clot at room temperature for 30 minutes and then spun at 2,000 x g for 10 minutes in a refrigerated centrifuge. ALT activity in the resulting serum was then measured according to the manufacturer's protocol (Bioassay #EALT-100). After 12 weeks, animals were euthanized and perfused with cold PBS. Organs were harvested and flash-frozen in liquid nitrogen before preparation for molecular analysis.

[0133] Example 2: Identification of an effective promoter for the expression of ATP7B Promoters are essential components of gene therapy, affecting transgene expression levels, timing, durability, and cell-type specificity. A library of tissue-specific and constitutive promoters was developed for the expression of ATP7B. See Tables 2-12. Provided herein are promoters that confer stronger expression in immortalized hepatocytes (Huh7, HepG2, AML-12) than commonly used reference promoters, including the CAG promoter (consisting of (1) the cytomegalovirus (CMV) early enhancer element, (2) the promoter, first exon, and first intron of the chicken beta-actin gene, and (3) the splice acceptor of the rabbit beta-globin gene), the alpha-1-antitrypsin (AAT) promoter, and the human thyroxine-binding globulin (TBG) promoter, liver-specific promoter 1 (LP1), hybrid liver promoter (HLP), and liver combinatorial bundle promoter (HCB). The promoters in the promoter library were comparable in strength to, but also significantly weaker than, CAG. A subset of these liver-specific library promoters was selected to examine their use for expression of the miniATP7B minigene. Using a dual-reporter flow-based assay in transfected human Huh7 cells, the activity of the liver-specific promoters was compared with that of commonly used promoters (Figure 2A).

[0134] In both human (Huh-7) and mouse (AML-12), both the L15 and L13 promoters drove particularly high miniATP7B in vitro among the promoters tested (Figure 2B) and Table 1.

[0135] Example 3: Identification of an effective ATP7B minigene In parallel, different variants of the miniATP7B gene were developed (see Tables 6 and 9).

[0136] To assess ATP7B minigene activity, ATP7B knockout (KO) cells transfected with constructs containing different transgenes were tested for copper pump activity using a copper reporter in combination with flow cytometry (Figure 3A). mClover3 fluorescence increased upon treatment with copper sulfate. This increase was blocked by expression of either full-length ATP7B or the ATP7B minigene (Figure 3B). Transgene efficacy was assessed by measuring copper reporter activity at decreasing concentrations of the transgene (Figure 3C).

[0137] The minigenes were tested against wild-type ATP7B (full-length) in copper reporting assays via transfection with a copper-inducible mClover expression construct (Figure 3A). Functionality for each variant was assessed and found to be equivalent to full-length wild-type ATP7B at all doses of copper sulfate tested. Potency for each variant was assessed by transfecting different concentrations of ATP7B and miniATP7B transgenes and subsequently measuring copper efflux activity via the copper reporter in combination with flow cytometry (Figure 3C). The miniATP7B variant TG2 (miniATP7B-s1co) showed improved copper pump activity at lower concentrations compared to ATP7B-FL, suggesting increased potency. The transgenes miniATP7B-s1co(TG2) and miniATP7B-s1co3 encode proteins with the same amino acid sequence (SEQ ID NO: 246). For the activity assays in Figures 3B and 3C, the promoter and 3'UTR elements were kept the same to allow direct comparison of differences in transgene activity.

[0138] Example 4: ATP7B expression construct The selected promoter candidates were combined with selected miniATP7B transgene candidates and other regulatory elements (Tables 1 and 7). ATP7B expression was compared to a published reference cassette, AAT-miniATP7Bv (Murillo et al., Liver Expression of a MiniATP7B Gene Results in Long-Term Restoration of Copper Homeostasis in a Wilson Disease Model in Mice. Hepatology, 2019 July;70(1):108-126), in different cell models. This construct corresponds to construct A2 herein.

[0139] Constructs A12 and A20 showed particularly high ATP7B expression compared to the reference cassette in both AML12 and Huh-7 immortalized cell lines, as well as in primary human and mouse hepatocytes after transduction with AAV8 (Figure 4, Table 1). Comparison of constructs A12 to A39 highlights the importance of promoter elements for overall transgene expression. When the L15 promoter in A12 was replaced with the standard L1_v2 promoter (as in A39), transgene expression was significantly reduced in vitro (Figure 4B). [Table 1]

[0140] Example 5: ATP7B Expression in Vivo Selected expression constructs A12, A20, and A39 were then tested in an in vivo model (ATP7B knockout mice) to assess both function and rescue of the phenotype using AAV8-mediated transduction.

[0141] Virus was injected into each mouse via the tail vein. Blood was collected at week 8 to assess ALT function. Organs were harvested at week 12 post-injection to assess expression and spleen weight.

[0142] In vitro data showed that A12, A20, and A39 showed significantly higher protein expression than A2 in the livers of ATP7B mice (Figures 5A and 5B). A12 and A20 were expressed 100- and 200-fold higher than endogenous ATP7B expression in heterozygous (HET) mice (Figure 5B). HET mice are phenotypically identical to wild-type mice but have 50% less ATP7B expression. Notably, this expression was not accompanied by expression of the immune marker CD11b or the ER stress marker CHOP (Figure 5A). Furthermore, miniATP7B expression was associated with rescue of the Wilson disease phenotype of increased alanine aminotransferase (ALT) activity resulting from liver injury and splenomegaly (Figures 5C and 5D).

[0143] Array Overview A summary of the sequences disclosed herein can be found in Tables 2-12. [Table 2] [Table 3] [Table 4] [Table 5] [Table 6] [Table 7-1] [Table 7-2] [Table 7-3] [Table 7-4] [Table 7-5]

Table 8-1

Table 8-2

Table 8-3

Table 8-4

Table 8-5

Table 8-6

Table 8-7

Table 8-8

Table 8-9

Table 8-10

Table 8-11

Table 8-12

Table 8-13

Table 8-14

Table 8-15

Table 9-1

Table 9-2

Table 9-3

Table 9-4

Table 9-5

Table 9-6

Table 9-7

Table 9-8

Table 9-9

Table 9-10

Table 9-11

Table 9-12

Table 9-13

Table 9-14

Table 9-15

Table 9-16

Table 9-17

Table 9-18

Table 9-19

Table 9-20

Table 9-21

Table 9-22

Table 9-23

Table 9-24

Table 9-25

Table 9-26

Table 9-27

Table 9-28

Table 9-29

Table 10

Table 11-1

Table 11-2

Table 11-3

Table 11-4

Table 11-5

Table 11-6

Table 11-7

Table 11-8

Table 11-9

Table 11-10

Table 11-11

Table 11-12

Table 11-13

Table 11-14

Table 11-15

Table 11-16

Table 11-17

Table 11-18

Table 11-19

Table 11-20

Table 11-21

Table 11-22

Table 11-23

Table 11-24

Table 11-25

Table 11-26

Table 11-27

Table 11-28

Table 11-29

Table 11-30

Table 11-31

Table 11-32

Table 11-33

Table 11-34

Table 11-35

Table 11-36

Table 11-37

Table 11-38

Table 11-39

Table 11-40

Table 11-41

Table 11-42

Table 11-43

Table 11-44

Table 11-45

Table 11-46

Table 11-47

Table 11-48

Table 11-49

Table 11-50

Table 11-51

Table 11-52

Table 11-53

Table 11-54

Table 11-55

Table 11-56

Table 11-57

Table 11-58

Table 11-59

Table 11-60

Table 11-61

Table 11-62

Table 11-63

Table 11-64

Table 11-65

Table 11-66

Table 11-67

Table 11-68

Table 11-69

Table 11-70

Table 11-71

Table 11-72

Table 11-73

Table 11-74

Table 11-75

Table 11-76

Table 11-77

Table 11-78

Table 11-79

Table 11-80

Table 11-81

Table 11-82

Table 11-83

Table 11-84

Table 11-85

Table 11-86

Table 11-87

Table 11-88

Table 11-89

Table 11-90

Table 11-91

Table 11-92

Table 11-93

Table 11-94

Table 11-95

Table 11-96

Table 11-97

Table 11-98

Table 11-99

Table 11-100

Table 11-101

Table 11-102

Table 11-103

Table 11-104

Table 11-105

Table 11-106

Table 11-107

Table 11-108

Table 11-109

Table 11-110

Table 11-111

Table 11-112

Table 11-113

Table 11-114

Table 11-115

Table 11-116

Table 11-117

Table 11-118

Table 11-119

Table 11-120

Table 11-121

Table 11-122

Table 11-123

Table 11-124

Table 11-125

Table 11-126

Table 11-127

Table 11-128

Table 11-129

Table 11-130

Table 11-131

Table 11-132

Table 11-133

Table 11-134

Table 11-135

Table 11-136

Table 11-137

Table 11-138

Table 11-139

Table 11-140

Table 11-141

Table 11-142

Table 11-143

Table 11-144

Table 11-145

Table 11-146

Table 11-147

Table 11-148

Table 11-149

Table 11-150

Table 11-151

Table 11-152

Table 11-153

Table 11-154

Table 11-155

Table 11-156

Table 11-157

Table 11-158

Table 11-159

Table 11-160

Table 11-161

Table 11-162

Table 11-163

Table 11-164

Table 11-165

Table 11-166

Table 11-167

Table 11-168

Table 11-169

Table 11-170

Table 11-171

Table 11-172

Table 11-173

Table 11-174

Table 11-175

Table 11-176

Table 11-177

Table 11-178

Table 11-179

Table 11-180

Table 11-181

Table 11-182

Table 11-183

Table 11-184

Table 12-1

Table 12-2

Table 12-3

Table 12-4

Table 12-5

Table 12-6

Table 12-7

Table 12-8

Table 12-9

Table 12-10

Table 12-11

Claims

1. (a) a promoter; (b) a sequence encoding (ATPase copper transport beta) ATP7B operably linked to the promoter; and (c) a polyadenylation signal.

2. 2. The expression construct of claim 1, wherein the promoter comprises a sequence that is at least 80% identical to a sequence selected from the group consisting of SEQ ID NOs: 4-33.

3. 3. The expression construct of claim 2, wherein the promoter comprises a sequence that is at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 4-33.

4. 4. The expression construct of claim 3, wherein the promoter comprises a sequence that is at least 95% identical to a sequence selected from the group consisting of SEQ ID NOs: 4-33.

5. 5. The expression construct of claim 4, wherein the promoter comprises a sequence selected from the group consisting of SEQ ID NOs: 4-33.

6. 2. The expression construct of claim 1, wherein the promoter comprises a sequence that is at least 80% identical to any one of SEQ ID NO:4, SEQ ID NO:10, or SEQ ID NO:

11.

7. 7. The expression construct of claim 6, wherein the promoter comprises a sequence that is at least 90% identical to any one of SEQ ID NO:4, SEQ ID NO:10, or SEQ ID NO:

11.

8. 8. The expression construct of claim 7, wherein the promoter comprises a sequence that is at least 95% identical to any one of SEQ ID NO:4, SEQ ID NO:10, or SEQ ID NO:

11.

9. 9. The expression construct of claim 8, wherein the promoter comprises any one of SEQ ID NO:4, SEQ ID NO:10, or SEQ ID NO:

11.

10. 9. The expression construct of claim 1, wherein the sequence encoding ATP7B is codon-optimized.

11. 9. The expression construct of any one of claims 1 to 8, wherein the sequence encoding ATP7B comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 35 to 48.

12. 12. The expression construct of claim 11, wherein the sequence encoding ATP7B comprises a sequence that is at least 90% identical to any one of SEQ ID NOs: 35-48.

13. 13. The expression construct of claim 12, wherein the sequence encoding ATP7B comprises a sequence that is at least 95% identical to any one of SEQ ID NOs: 35-48.

14. 14. The expression construct of claim 13, wherein the sequence encoding ATP7B comprises a sequence selected from the group consisting of SEQ ID NOs: 35-48.

15. 9. The expression construct of any one of claims 1 to 8, wherein the sequence encoding ATP7B comprises a sequence that is at least 80% identical to SEQ ID NO:39 or SEQ ID NO:

41.

16. 16. The expression construct of claim 15, wherein the sequence encoding ATP7B comprises a sequence that is at least 90% identical to SEQ ID NO:39 or SEQ ID NO:

41.

17. 17. The expression construct of claim 16, wherein the sequence encoding ATP7B comprises a sequence that is at least 95% identical to SEQ ID NO:39 or SEQ ID NO:

41.

18. 18. The expression construct of claim 17, wherein the sequence encoding ATP7B comprises SEQ ID NO: 39 or SEQ ID NO:

41.

19. 10. An expression construct according to any preceding claim, wherein the ATP7B-encoding sequence encodes a protein comprising a sequence that is at least 80% identical to any one of SEQ ID NOs: 118-128.

20. 20. The expression construct of claim 19, wherein the sequence encoding ATP7B encodes a protein comprising a sequence that is at least 90% identical to any one of SEQ ID NOs: 118-128.

21. 21. The expression construct of claim 20, wherein the sequence encoding ATP7B encodes a protein comprising a sequence that is at least 95% identical to any one of SEQ ID NOs: 118-128.

22. 22. The expression construct of claim 21, wherein the sequence encoding ATP7B encodes a protein comprising any one of SEQ ID NOs: 118-128.

23. 20. The expression construct of claim 19, wherein the sequence encoding ATP7B encodes a protein comprising a sequence that is at least 80% identical to SEQ ID NO: 118 or SEQ ID NO:

123.

24. 24. The expression construct of claim 23, wherein the sequence encoding ATP7B encodes a protein comprising a sequence that is at least 90% identical to SEQ ID NO: 118 or SEQ ID NO:

123.

25. 25. The expression construct of claim 24, wherein the sequence encoding ATP7B encodes a protein comprising a sequence that is at least 95% identical to SEQ ID NO: 118 or SEQ ID NO:

123.

26. 26. The expression construct of claim 25, wherein the sequence encoding ATP7B encodes a protein comprising SEQ ID NO: 118 or SEQ ID NO:

123.

27. 10. An expression construct according to any preceding claim, wherein the expression construct further comprises a post-transcriptional regulatory element.

28. 28. The expression construct of claim 27, wherein the post-transcriptional regulatory element comprises a sequence that is at least 80% identical to SEQ ID NO:49 or SEQ ID NO:

50.

29. 29. The expression construct of claim 28, wherein the post-transcriptional regulatory element comprises a sequence that is at least 90% identical to SEQ ID NO:49 or SEQ ID NO:

50.

30. 30. The expression construct of claim 29, wherein the post-transcriptional regulatory element comprises a sequence that is at least 95% identical to SEQ ID NO:49 or SEQ ID NO:

50.

31. 31. The expression construct of claim 30, wherein the post-transcriptional regulatory element comprises SEQ ID NO:49 or SEQ ID NO:

50.

32. 28. The expression construct of claim 27, wherein the post-transcriptional regulatory element comprises a sequence that is at least 80% identical to SEQ ID NO:

49.

33. 33. The expression construct of claim 32, wherein the post-transcriptional regulatory element comprises a sequence that is at least 90% identical to SEQ ID NO:

49.

34. 34. The expression construct of claim 33, wherein the post-transcriptional regulatory element comprises a sequence that is at least 95% identical to SEQ ID NO:

49.

35. 35. The expression construct of claim 34, wherein the post-transcriptional regulatory element comprises SEQ ID NO:

49.

36. 36. The expression construct of any one of claims 1 to 35, wherein the polyadenylation signal comprises a sequence that is at least 80% identical to SEQ ID NO:51 or SEQ ID NO:

52.

37. 37. The expression construct of claim 36, wherein the polyadenylation signal comprises a sequence that is at least 90% identical to SEQ ID NO:51 or SEQ ID NO:

52.

38. 38. The expression construct of claim 37, wherein the polyadenylation signal comprises a sequence that is at least 95% identical to SEQ ID NO:51 or SEQ ID NO:

52.

39. 39. The expression construct of claim 38, wherein the polyadenylation signal comprises SEQ ID NO:51 or SEQ ID NO:

52.

40. 36. The expression construct of any one of claims 1 to 35, wherein the polyadenylation signal comprises a sequence that is at least 80% identical to SEQ ID NO:

51.

41. 41. The expression construct of claim 40, wherein the polyadenylation signal comprises a sequence that is at least 90% identical to SEQ ID NO:

51.

42. 42. The expression construct of claim 41, wherein the polyadenylation signal comprises a sequence that is at least 95% identical to SEQ ID NO:

51.

43. 43. The expression construct of claim 42, wherein the polyadenylation signal comprises SEQ ID NO:

51.

44. 10. The expression construct of any one of the preceding claims, wherein the expression construct further comprises a miRNA binding site (miRBS).

45. 45. The expression construct of claim 44, wherein the miRBS comprises a sequence that is at least 80% identical to SEQ ID NO:

53.

46. 46. ​​The expression construct of claim 45, wherein the miRBS comprises a sequence that is at least 90% identical to SEQ ID NO:

53.

47. 47. The expression construct of claim 46, wherein the miRBS comprises a sequence that is at least 95% identical to SEQ ID NO:

53.

48. 48. The expression construct of claim 47, wherein the miRBS comprises SEQ ID NO:

53.

49. the expression construct (a) a promoter comprising a sequence at least 80% identical to SEQ ID NO: 11; (b) a sequence encoding ATP7B operably linked to the promoter, the sequence comprising a sequence at least 80% identical to SEQ ID NO: 41; (c) a post-transcriptional regulatory element comprising a sequence at least 80% identical to SEQ ID NO: 49; (d) a polyadenylation signal comprising a sequence that is at least 80% identical to SEQ ID NO:

51.

50. the expression construct (a) a promoter comprising a sequence at least 90% identical to SEQ ID NO: 11; (b) a sequence encoding ATP7B operably linked to the promoter, the sequence comprising a sequence at least 90% identical to SEQ ID NO: 41; (c) a post-transcriptional regulatory element comprising a sequence at least 90% identical to SEQ ID NO: 49; 50. The expression construct of claim 49, comprising: (d) a polyadenylation signal comprising a sequence at least 90% identical to SEQ ID NO:

51.

51. the expression construct (a) a promoter comprising a sequence at least 95% identical to SEQ ID NO: 11; (b) a sequence encoding ATP7B operably linked to the promoter, the sequence comprising a sequence at least 95% identical to SEQ ID NO: 41; (c) a post-transcriptional regulatory element comprising a sequence at least 95% identical to SEQ ID NO: 49; (d) a polyadenylation signal comprising a sequence at least 95% identical to SEQ ID NO:

51.

52. the expression construct (a) a promoter comprising SEQ ID NO: 11; (b) a sequence encoding ATP7B operably linked to the promoter, the sequence comprising SEQ ID NO: 41; (c) a post-transcriptional regulatory element comprising SEQ ID NO: 49; and (d) a polyadenylation signal comprising SEQ ID NO:

51.

53. the expression construct (a) a promoter comprising a sequence at least 80% identical to SEQ ID NO: 10; (b) a sequence encoding ATP7B operably linked to the promoter, the sequence comprising a sequence at least 80% identical to SEQ ID NO: 39; (c) a miRBS comprising a sequence at least 80% identical to SEQ ID NO: 53; (d) a post-transcriptional regulatory element comprising a sequence at least 80% identical to SEQ ID NO: 49; (e) a polyadenylation signal comprising a sequence at least 80% identical to SEQ ID NO:

51.

54. the expression construct (a) a promoter comprising a sequence at least 90% identical to SEQ ID NO: 10; (b) a sequence encoding ATP7B operably linked to the promoter, the sequence comprising a sequence at least 90% identical to SEQ ID NO: 39; (c) a miRBS comprising a sequence at least 90% identical to SEQ ID NO: 53; (d) a post-transcriptional regulatory element comprising a sequence at least 90% identical to SEQ ID NO: 49; (e) a polyadenylation signal comprising a sequence at least 90% identical to SEQ ID NO:

51.

55. the expression construct (a) a promoter comprising a sequence at least 95% identical to SEQ ID NO: 10; (b) a sequence encoding ATP7B operably linked to the promoter, the sequence comprising a sequence at least 95% identical to SEQ ID NO: 39; and (c) a miRBS comprising a sequence at least 95% identical to SEQ ID NO: 53; (d) a post-transcriptional regulatory element comprising a sequence at least 95% identical to SEQ ID NO: 49; (e) a polyadenylation signal comprising a sequence at least 95% identical to SEQ ID NO:

51.

56. the expression construct (a) a promoter comprising SEQ ID NO: 10; (b) a sequence encoding ATP7B operably linked to the promoter, the sequence comprising SEQ ID NO: 39; and (c) a miRBS comprising SEQ ID NO: 53; and (d) a post-transcriptional regulatory element comprising SEQ ID NO: 49; and (e) a polyadenylation signal comprising SEQ ID NO:

51.

57. the expression construct (a) a promoter comprising a sequence at least 80% identical to SEQ ID NO: 4; (b) a sequence encoding ATP7B operably linked to the promoter, the sequence comprising a sequence at least 80% identical to SEQ ID NO: 41; (c) a post-transcriptional regulatory element comprising a sequence at least 80% identical to SEQ ID NO: 49; (d) a polyadenylation signal comprising a sequence that is at least 80% identical to SEQ ID NO:

51.

58. the expression construct (a) a promoter comprising a sequence at least 90% identical to SEQ ID NO:4; (b) a sequence encoding ATP7B operably linked to the promoter, the sequence comprising a sequence at least 90% identical to SEQ ID NO: 41; (c) a post-transcriptional regulatory element comprising a sequence at least 90% identical to SEQ ID NO: 49; (d) a polyadenylation signal comprising a sequence at least 90% identical to SEQ ID NO:

51.

59. the expression construct (a) a promoter comprising a sequence at least 95% identical to SEQ ID NO:4; (b) a sequence encoding ATP7B operably linked to the promoter, the sequence comprising a sequence at least 95% identical to SEQ ID NO: 41; (c) a post-transcriptional regulatory element comprising a sequence at least 95% identical to SEQ ID NO: 49; (d) a polyadenylation signal comprising a sequence at least 95% identical to SEQ ID NO:

51.

60. the expression construct (a) a promoter comprising SEQ ID NO: 4; (b) a sequence encoding ATP7B operably linked to the promoter, the sequence comprising SEQ ID NO: 41; (c) a post-transcriptional regulatory element SEQ ID NO: 49; and (d) a polyadenylation signal comprising SEQ ID NO:

51.

61. A vector comprising an expression construct according to any one of claims 1 to 60.

62. 58. The vector of claim 57, wherein the vector is a viral vector.

63. 63. The vector of claim 62, wherein the vector is an AAV vector.

64. 61. A vector comprising a nucleic acid sequence comprising: (i) an expression construct according to any one of claims 1 to 60; and (ii) one or more inverted terminal repeats (ITRs).

65. 65. The vector of claim 64, wherein the nucleic acid sequence comprises a 5' ITR and a 3' ITR.

66. 66. The vector of claim 65, wherein the 5' ITR and the 3' ITR are derived from adeno-associated virus (AAV) serotype AAV2.

67. 66. The vector of claim 65, wherein the sequence of the 5' ITR is at least 80% identical to SEQ ID NO:

116.

68. 67. The vector of claim 66, wherein the sequence of the 5' ITR is at least 90% identical to SEQ ID NO:

116.

69. 68. The vector of claim 67, wherein the sequence of the 5' ITR is at least 95% identical to SEQ ID NO:

116.

70. 70. The vector of claim 69, wherein the sequence of the 5' ITR comprises SEQ ID NO:

116.

71. 71. The vector of any one of claims 65 or 67 to 70, wherein the sequence of the 3' ITR is at least 80% identical to SEQ ID NO:

117.

72. 72. The vector of claim 71, wherein the sequence of the 3' ITR is at least 90% identical to SEQ ID NO:

117.

73. 73. The vector of claim 72, wherein the sequence of the 3' ITR is at least 95% identical to SEQ ID NO:

117.

74. 74. The vector of claim 73, wherein the sequence of the 3' ITR comprises SEQ ID NO:

117.

75. 2. A vector comprising the expression construct of claim 1, wherein the expression construct comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 54-115.

76. 76. The vector of claim 75, wherein the vector comprises a sequence that is at least 90% identical to any one of SEQ ID NOs: 54-115.

77. 77. The vector of claim 76, wherein the vector comprises a sequence that is at least 95% identical to any one of SEQ ID NOs: 54-115.

78. 78. The vector of claim 77, wherein the vector comprises any one of SEQ ID NOs: 54-115.

79. A vector comprising the expression construct of claim 1, wherein the vector comprises an sequence that is at least 80% identical to any one of SEQ ID NO:65, SEQ ID NO:73, or SEQ ID NO:

92.

80. 80. The vector of claim 79, wherein the vector comprises a sequence that is at least 90% identical to any one of SEQ ID NO:65, SEQ ID NO:73, or SEQ ID NO:

92.

81. 81. The vector of claim 80, wherein the vector comprises a sequence that is at least 95% identical to SEQ ID NO:65, SEQ ID NO:73, or SEQ ID NO:

92.

82. 82. The vector of claim 81 , wherein the vector comprises SEQ ID NO:65, SEQ ID NO:73, or SEQ ID NO:

92.

83. 83. The vector of any one of claims 57-82, wherein the vector comprises a capsid derived from AAV7m8, AAV9, AAV2-retro, or AAVrh.

10.

84. A cell comprising an expression construct according to any one of claims 1 to 60 or a vector according to any one of claims 61 to 82.

85. A pharmaceutical composition comprising: (i) an expression construct according to any one of claims 1 to 60, or a vector according to any one of claims 61 to 83; and (ii) a pharmaceutically acceptable carrier.

86. A method for increasing ATP7B activity in a subject in need thereof, the method comprising administering to the subject a vector described in any one of claims 61 to 82, or a pharmaceutical composition described in claim 85.

87. 85. A method of increasing copper secretion in a subject in need thereof, the method comprising administering to the subject a vector according to any one of claims 61 to 82, or a pharmaceutical composition according to claim 85.

88. A method for treating a condition caused by a deficiency or dysfunction of ATP7B in a subject in need of such treatment, the method comprising administering to the subject a vector described in any one of claims 61 to 82 or a pharmaceutical composition described in claim 85.

89. 100. A method of treating Wilson's disease in a subject in need thereof, said method comprising administering to said subject the vector of any one of claims 61 to 82, or the pharmaceutical composition of claim 85.

90. 85. A method of reducing dystonia or bradykinesia in a subject suffering from Wilson's disease, said method comprising administering to said subject a vector according to any one of claims 61 to 82, or a pharmaceutical composition according to claim 85.

91. 100. A method of reducing the incidence of leukopenia or anemia in a subject suffering from Wilson's disease, said method comprising administering to said subject a vector according to any one of claims 61 to 82, or a pharmaceutical composition according to claim 85.

92. 100. A method of reducing the incidence of cirrhosis in a subject suffering from Wilson's disease, said method comprising administering to said subject a vector according to any one of claims 61 to 82, or a pharmaceutical composition according to claim 85.

93. 93. The method of any one of claims 86 to 92, wherein the subject is a human.