snRNA nucleic acid molecules and uses thereof

SnRNA molecules with tailored recognition domains and stem-loop sequences address the inefficiencies and safety issues of existing treatments for Usher syndrome type II by achieving precise and efficient exon 13 skipping, enhancing treatment efficacy and safety.

JP2025534169APending Publication Date: 2025-10-14GUANGZHOU REFORGENE MEDICINE CO LTD
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
JP2025521159
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-10-11
Filing Date
2023-09-27
Publication Date
2025-10-14

AI Technical Summary

Technical Problem

Existing methods for treating Usher syndrome type II, particularly targeting exon 13 of the USH2A gene, suffer from low efficiency and safety concerns, including off-target effects, frameshift mutations, and high dosages of antisense oligonucleotides, leading to incomplete or double skipping of exons.

Method used

The use of small nuclear RNA (snRNA) molecules with specific recognition domains and stem-loop sequences, designed to target and induce efficient single exon skipping of USH2A exon 13, minimizing off-target effects and ensuring safety through precise splicing control.

Benefits of technology

The snRNA molecules achieve high-frequency single exon skipping of USH2A exon 13, reducing the risk of frameshift mutations and cytotoxicity, thereby providing a safer and more effective treatment for Usher syndrome.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025534169000035
    Figure 2025534169000035
  • Figure 2025534169000036
    Figure 2025534169000036
  • Figure 2025534169000037
    Figure 2025534169000037
Patent Text Reader

Abstract

The present invention provides snRNA nucleic acid molecules and uses thereof. The snRNA nucleic acid molecules comprise a recognition domain, a stem-loop sequence, and an Sm sequence, and the number of recognition domains is at least two. Each recognition domain is reverse-complementary to a target sequence segment from the 5' end to the 3' end of a pre-mRNA, from the 3' end to the 5' end, of the pre-mRNA, which corresponds to the USH2A gene. The snRNA nucleic acid molecules target USH2A exon 13 and target regions on both sides of it. The snRNA nucleic acid molecules can efficiently induce splicing skipping of USH2A exon 13 with a higher frequency of single exon skipping. In particular, the snRNA nucleic acid molecules can safely and efficiently induce single exon skipping of USH2A exon 13 at low doses, for both pathogenic and non-pathogenic USH2A exon 13. These snRNA nucleic acid molecules have significant clinical value in the prevention and / or treatment of eye and ear diseases associated with abnormal expression of Usherin protein.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention is in the field of biotechnology, and specifically relates to snRNA nucleic acid molecules and their uses. [Background technology]

[0002] Usher syndrome, also known as deafness-retinitis pigmentosa syndrome, is a genetic disorder characterized by varying degrees of congenital sensorineural hearing loss and progressive vision loss due to retinitis pigmentosa (RP). Clinically, Usher syndrome can be classified into three types: (1) Type I Usher syndrome: Patients have congenital profound sensorineural hearing loss, loss of vestibular response, and prepubertal retinitis pigmentosa, followed by gradual blindness. Genes associated with this type include MYO7A, CDH23, USH1C, and PCHD15; (2) Type II Usher syndrome: Patients have congenital moderate to severe sensorineural hearing loss, normal vestibular response, and prepubertal retinitis pigmentosa, followed by gradual blindness. Genes associated with this type include USH2A, GPR98, and WHRN; and (3) Type III Usher syndrome: Patients have progressive sensorineural hearing loss, normal vestibular response, and prepubertal retinitis pigmentosa, followed by gradual blindness. Genes associated with this type include CLRN1.

[0003] Among these, type II Usher syndrome accounts for over 50% of all Usher syndromes. USH2A gene mutations are the most common cause of type II Usher syndrome, accounting for over 50% of Usher syndrome patients. At the same time, mutations in the USH2A gene are also an important cause of nonsyndromic retinitis pigmentosa (NSRP).

[0004] The USH2A gene, located on 1q41 and spanning over 800 kb in the genome, encodes the large transmembrane protein Usherin, which is anchored to the plasma membrane of retinal photoreceptor cells and inner ear hair cells and is an essential component for cilia development and maintenance. In the retina, Usherin is an essential part of the USH2 complex and is thought to play a role in stabilizing photoreceptor outer segments. There are two subtypes of USH2A. The major subtype in retinal cells contains 72 exons, with a coding region of approximately 15.6 kb. The extracellular portion of the Usherin protein contains many repeat domains, including 10 laminin EGF-like (LE) domains and 35 fibronectin type 3 (FN3) domains. Human USH2A exon 13 is 642 bp long and encodes amino acids 723–936, which comprise four of the 10 LE domains of Usherin.

[0005] Mutations in exon 13, exon 50, and intron 40 of the USH2A gene can cause Usher syndrome. To date, over 1,000 pathogenic variants distributed throughout the USH2A gene have been identified, of which exon 13 is the most frequently mutated exon in the USH2A gene, accounting for approximately 35% of cases. Mutations in exon 13 of the USH2A gene include c.2802T>G (p.Cys934Trp, the most frequent mutation in Chinese patients), c.2299delG (p.Glu767Serfs*21, the most frequent mutation in European and American patients), c.2276G>T (p.cys759phe, the most frequent mutation site causing nonsyndromic RP), C.2522C>A (p.S841Y), c.2242C>T (p.Gln748X), and c.2541C>A (p.C84 7X), c.2761delC(Leu921fs) and C.2776C>T(p.R926C), C.2209C>T, C.2310delA, c.2391_2392deITG, c.2431A>T, C.2431_2432delAA , c.2440C>T, c.2525dup, C.2610C>A, C.2755C>T, C.2176T>C, C.2236C>G, c.2296T>C, C.2332G>T, c.2339G>T (PMID:31904091).

[0006] The coding region of USH2A is approximately 15.6 kb long, making it difficult to package such a large coding sequence using conventional gene therapy delivery methods (e.g., recombinant lentivirus, recombinant adeno-associated virus, etc.). Direct delivery of USH2A for therapeutic use has been challenging. Exon 12 of mouse USH2A is homologous to exon 13 of human USH2A, both of which are 642 bp in length. Removal of this exon did not result in subsequent frameshift mutations. Studies have shown that knockout of exon 12 of USH2A in mice still results in proper localization and normal function of Usherin. Similarly, human USH2A exon 13 containing pathogenic mutations can be treated by skipping it using a range of methods.

[0007] Previous techniques have used the CRISPR / Cas system to directly delete exon 13 or disrupt RNA splicing sites in genomic DNA editing. The use of segmental deletion carries risks such as chromosomal rearrangement, viral integration, and reverse reintegration. Furthermore, the probability of off-target effects increases when the CAS system is expressed for a long time or when double cleavage induced by two gRNAs is performed in a relatively large genomic background.

[0008] Prior art methods use single base editors to modify key bases at the splice-related sites, which may also promote exon skipping. However, existing single base editors cannot be loaded via a single AAV vector, are limited by PAM, editing window, and base conversion type, and there may be no suitable gRNA near the splice-related site.

[0009] Prior art studies have demonstrated highly efficient exon skipping by targeting pre-mRNA splicing via antisense oligonucleotides (AONs). However, while AONs promote human exon 13 skipping, they also promote human exon 12 skipping simultaneously with human exon 13. Furthermore, some AON treatments result in double skipping rather than single skipping. Human exon 12 is 196 bp long, not an integral multiple of 3. Deletion of exon 12 results in a frameshift mutation, inactivating the USH2A protein.

[0010] Catholic University grants US10131910B2 and US10745699B2 disclose antisense oligonucleotides for the treatment of Usher syndrome type 2. These patents target exon 13 (intron 12), PE40, and exon 50 of human USH2A with antisense oligonucleotides (AONs), inducing exon splicing and intron 12 retention.

[0011] In this patent, exon 12 was effectively preserved by using AON4a targeting intron 12, but the use of multiple AONs increases the risk of off-targeting, and the high demand for AON4a leads to a higher overall AON dosage, which poses a risk of cytotoxicity due to high doses of AON.

[0012] RPOQR (CN109804069A) disclosed antisense oligonucleotides for treating eye diseases. Based on US10131910B2 and US10745699B2, this patent found that three sites, Ex13-1, Ex13-2, and Ex13-3, appear to provide stronger single (exon 13) splicing signals.

[0013] However, while AONs promote human exon 13 skipping, they also promote human exon 12 skipping simultaneously with human exon 13. Furthermore, some AON treatments result in either double skipping or hybrid bands of abnormal exon 13 skipping and complete exon 13 skipping (or even single exon 12 skipping). Human exon 12 is 196 bp long, not an integral multiple of 3. Deletion of exon 12 results in a frameshift mutation, leading to inactivation of the USH2A protein after double splicing skipping. The effects of AONs are short-lived, require frequent administration, and are inefficient in inducing splicing skipping, resulting in very high AON dosages.

[0014] Small nuclear RNAs (snRNAs) exist in cells and are the main components of the RNA spliceosome during post-transcriptional processing in eukaryotes. They are involved in pre-mRNA processing by binding to snRNP proteins. In mammals, snRNAs range in length from approximately 100 to 215 nucleotides and are divided into seven classes, U1 to U7, based on their U-rich content. However, the U7 snRNP is not involved in splicing; instead, it is a key factor in the unique 3'-end processing of pre-mRNAs. Modified U7 snRNAs replace the non-canonical Sm-binding site of U7 snRNA with a consensus sequence derived from the major spliceosomal U snRNP and change the histone-binding sequence in the 5' region of U7 snRNA to the complementary sequence of the target gene, thereby targeting exons and inducing exon skipping.

[0015] However, since the development of modified U7 snRNA in 1998, its related research and applications have not been extensive, limited by the number of vectors available for U7 snRNP administration and limited to a few targets. For example, the use of modified U7 snRNA delivered using viruses such as AAV requires very high doses of virus, which can be toxic or induce immune responses, limiting the application of viral delivery of U7-snRNA. However, long-term delivery of other gene integrations poses risks to genome safety, while transient delivery has a short effect. [Prior art documents] [Patent documents]

[0016] [Patent Document 1] US10131910B2 [Patent Document 2] US10745699B2 [Patent Document 3] CN109804069A Summary of the Invention [Problem to be solved by the invention]

[0017] The technical problem to be solved by the present invention is to provide an snRNA nucleic acid molecule and its use to overcome the drawback of the prior art, namely, the low efficiency of inducing splicing skipping of USH2A exon 13. The present invention targets the impaired pre-mRNA splicing of USH2A exon 13 via snRNA, promoting the efficiency of single exon skipping and significantly improving efficiency while ensuring safety. z

[0018] The present invention solves the above technical problems through the following technical solutions:

[0019] A first aspect of the present invention provides an snRNA nucleic acid molecule comprising a recognition domain, a stem-loop sequence and an Sm sequence, wherein the number of the recognition domains is at least two.

[0020] Here, each recognition domain is reverse-complementary to a target sequence fragment from the 5' end to the 3' end of a pre-mRNA from the 3' end to the 5' end, and the pre-mRNA is a pre-mRNA corresponding to the USH2A gene.

[0021] In one embodiment of the present invention, each of the recognition domains is sequentially reverse-complementary to the target sequence fragment from the 5' end to the 3' end, from the 3' end to the 3' end of the pre-mRNA, i.e., the recognition domain sequence from the 5' end to the 3' end of the snRNA nucleic acid molecule is sequentially arranged from the 3' end to the 5' end based on the position of the target site corresponding to the recognition domain in the USH2A pre-mRNA.

[0022] In one embodiment of the present invention, each of the recognition domains is non-sequentially reverse-complementary to the target sequence fragment from the 5' end to the 3' end of the pre-mRNA, from the 3' end to the 5' end, i.e., the recognition domain sequence from the 5' end to the 3' end of the snRNA nucleic acid molecule is not arranged in order from the 3' end to the 5' end according to the position of the target site corresponding to the recognition domain in the USH2A pre-mRNA.

[0023] In one embodiment of the invention, the recognition domain is at least 16 bp in length.

[0024] In one embodiment of the present invention, the length of the recognition domain is 18 to 40 bp.

[0025] In one embodiment of the present invention, the length of the recognition domain is 20 to 27 bp.

[0026] In one embodiment of the present invention, the length of the recognition domain is 22 to 27 bp.

[0027] In one embodiment of the present invention, the number of the recognition domains is two, and preferably, the two recognition domains are adjacently distributed.

[0028] In one embodiment of the present invention, the number of the stem-loop sequences may be one or two.

[0029] In certain embodiments of the present invention, the snRNA nucleic acid molecule comprises, in order from the 5' to the 3' end, two adjacent recognition domains, an Sm sequence and a stem-loop sequence.

[0030] In one embodiment of the present invention, the pre-mRNA is all or a part of the pre-mRNA corresponding to the 12th intron to the 13th intron of the USH2A gene.

[0031] In a preferred embodiment of the present invention, the pre-mRNA is all or a part of the pre-mRNA corresponding to the 13th exon of the USH2A gene.

[0032] In one embodiment of the present invention, the genome of the pre-mRNA is located at Chr1:216246563-216247246, and the target sequence fragment is selected from the nucleotide sequence shown in SEQ ID NO: 1 and mutant sequences thereof.

[0033] In another embodiment of the present invention, the genome of the pre-mRNA is located at Chr1:216246563-216246753, and the target sequence fragment is selected from the nucleotide sequence shown in SEQ ID NO: 3 and mutant sequences thereof.

[0034] In a preferred embodiment of the present invention, the genome of the pre-mRNA is located at Chr1:216246563-216246649, and the target sequence fragment is selected from the nucleotide sequence shown in SEQ ID NO: 4 and mutant sequences thereof.

[0035] In a specific embodiment of the present invention, the genome of the pre-mRNA is located at Chr1:216246563-216246626, and the target sequence fragment is selected from the nucleotide sequence shown in SEQ ID NO: 9 and mutant sequences thereof.

[0036] In a specific embodiment of the present invention, the genome of the pre-mRNA is located at Chr1:216246616-216246649, and the target sequence fragment is selected from the nucleotide sequence set forth in SEQ ID NO: 34 and mutant sequences thereof.

[0037] In a specific embodiment of the present invention, the genome of the pre-mRNA is located at Chr1:216247130-216247246, and the target sequence fragment is selected from the nucleotide sequence shown in SEQ ID NO: 2 and mutant sequences thereof.

[0038] In a specific embodiment of the present invention, the genome of the pre-mRNA is located at Chr1:216247142-216247185, and the target sequence fragment is selected from the nucleotide sequence shown in SEQ ID NO: 32 and mutant sequences thereof.

[0039] In a specific embodiment of the present invention, the genome of the pre-mRNA is located at Chr1:216247130-216247161, and the target sequence fragment is selected from the nucleotide sequence set forth in SEQ ID NO: 33 and mutant sequences thereof.

[0040] In a specific embodiment of the present invention, the genome of the pre-mRNA is located at Chr1:216247210-216247246, and the target sequence fragment is selected from the nucleotide sequence set forth in SEQ ID NO: 36 and mutant sequences thereof.

[0041] In a specific embodiment of the present invention, the genome of the pre-mRNA is located at Chr1:216247204-216247232, and the target sequence fragment is selected from the nucleotide sequence set forth in SEQ ID NO: 37 and mutant sequences thereof.

[0042] In a specific embodiment of the present invention, the genome of the pre-mRNA is located at Chr1:216247187-216247220, and the target sequence fragment is selected from the nucleotide sequence shown in SEQ ID NO: 38 and mutant sequences thereof.

[0043] In a specific embodiment of the present invention, the genome of the pre-mRNA is located at Chr1:216247169-216247202, and the target sequence fragment is selected from the nucleotide sequence set forth in SEQ ID NO: 39 and mutant sequences thereof.

[0044] In the present invention, the two recognition domains are, from the 5' end to the 3' end, a first recognition domain and a second recognition domain, respectively, and the first recognition domain and the second recognition domain may be RNA sequences that recognize different target sites, or may be RNA sequences that recognize the same target site.

[0045] In a specific embodiment of the present invention, among the RNA sequences that recognize different target sites, the reverse complementary RNA sequence that binds to the 3' end of USH2Apre-mRNA functions as the second recognition domain of the snRNA, and the reverse complementary RNA that binds to the 5' end of USH2Apre-mRNA functions as the first recognition domain of the snRNA.

[0046] In one embodiment of the present invention, the target sequence fragment reverse complementary to the first or second recognition domain is selected from the nucleotide sequence set forth in SEQ ID NO: 34 and mutant sequences thereof and the nucleotide sequence set forth in SEQ ID NO: 9 and mutant sequences thereof; correspondingly, the target sequence fragment reverse complementary to the second or first recognition domain is selected from the nucleotide sequence set forth in SEQ ID NO: 32 and mutant sequences thereof, the nucleotide sequence set forth in SEQ ID NO: 33 and mutant sequences thereof, the nucleotide sequence set forth in SEQ ID NO: 36 and mutant sequences thereof, the nucleotide sequence set forth in SEQ ID NO: 37 and mutant sequences thereof, the nucleotide sequence set forth in SEQ ID NO: 38 and mutant sequences thereof and the nucleotide sequence set forth in SEQ ID NO: 39 and mutant sequences thereof.

[0047] In one embodiment of the present invention, the target sequence fragment reverse complementary to the first recognition domain is selected from the nucleotide sequence set forth in SEQ ID NO: 34 and mutant sequences thereof and the nucleotide sequence set forth in SEQ ID NO: 9 and mutant sequences thereof, and the target sequence fragment reverse complementary to the second recognition domain is selected from the nucleotide sequence set forth in SEQ ID NO: 32 and mutant sequences thereof, the nucleotide sequence set forth in SEQ ID NO: 33 and mutant sequences thereof, the nucleotide sequence set forth in SEQ ID NO: 36 and mutant sequences thereof, the nucleotide sequence set forth in SEQ ID NO: 37 and mutant sequences thereof, the nucleotide sequence set forth in SEQ ID NO: 38 and mutant sequences thereof and the nucleotide sequence set forth in SEQ ID NO: 39 and mutant sequences thereof.

[0048] In the present invention, the mutant sequence is a sequence obtained by substituting, adding or deleting one or more nucleotides in the starting sequence.

[0049] In a specific embodiment of the present invention, the nucleotide sequence of the first recognition domain is set forth in any one of SEQ ID NOs: 12 to 22, 59 to 61, and the nucleotide sequence of the second recognition domain is set forth in any one of SEQ ID NOs: 40 to 58.

[0050] In one embodiment of the invention, the nucleotide sequence of the first recognition domain is set forth in SEQ ID NO: 12, 13, 15 or 17, and the nucleotide sequence of the second recognition domain is set forth in SEQ ID NO: 48, 54, 56 or 58.

[0051] In certain embodiments of the invention, the nucleotide sequence of the first recognition domain is set forth in SEQ ID NO: 12, 13 or 17, and the nucleotide sequence of the second recognition domain is set forth in SEQ ID NO: 48, 54 or 58.

[0052] In one embodiment of the invention, the nucleotide sequence of the first recognition domain is set forth in SEQ ID NO:12 and the nucleotide sequence of the second recognition domain is set forth in SEQ ID NO:48.

[0053] In one embodiment of the invention, the nucleotide sequence of the first recognition domain is set forth in SEQ ID NO:12 and the nucleotide sequence of the second recognition domain is set forth in SEQ ID NO:54.

[0054] In one embodiment of the invention, the nucleotide sequence of the first recognition domain is set forth in SEQ ID NO:12 and the nucleotide sequence of the second recognition domain is set forth in SEQ ID NO:58.

[0055] In one embodiment of the invention, the nucleotide sequence of the first recognition domain is set forth in SEQ ID NO:13 and the nucleotide sequence of the second recognition domain is set forth in SEQ ID NO:48.

[0056] In one embodiment of the invention, the nucleotide sequence of the first recognition domain is set forth in SEQ ID NO:13 and the nucleotide sequence of the second recognition domain is set forth in SEQ ID NO:54.

[0057] In one embodiment of the invention, the nucleotide sequence of the first recognition domain is set forth in SEQ ID NO:13 and the nucleotide sequence of the second recognition domain is set forth in SEQ ID NO:58.

[0058] In one embodiment of the invention, the nucleotide sequence of the first recognition domain is set forth in SEQ ID NO:17 and the nucleotide sequence of the second recognition domain is set forth in SEQ ID NO:48.

[0059] In one embodiment of the invention, the nucleotide sequence of the first recognition domain is set forth in SEQ ID NO:17 and the nucleotide sequence of the second recognition domain is set forth in SEQ ID NO:54.

[0060] In one embodiment of the invention, the nucleotide sequence of the first recognition domain is set forth in SEQ ID NO:17 and the nucleotide sequence of the second recognition domain is set forth in SEQ ID NO:58.

[0061] In one embodiment of the invention, the nucleotide sequence of the first recognition domain is set forth in SEQ ID NO:16 and the nucleotide sequence of the second recognition domain is set forth in SEQ ID NO:42.

[0062] In one embodiment of the invention, the nucleotide sequence of the first recognition domain is set forth in SEQ ID NO:18 and the nucleotide sequence of the second recognition domain is set forth in SEQ ID NO:43.

[0063] In one embodiment of the invention, the nucleotide sequence of the first recognition domain is set forth in SEQ ID NO:14 and the nucleotide sequence of the second recognition domain is set forth in SEQ ID NO:55.

[0064] In the present invention, the mutant sequence is a sequence in which there is a substitution, addition or deletion of one or more nucleotides on the nucleotide sequence, preferably a substitution.

[0065] In the present invention, said mutations are selected from naturally occurring pathogenic mutations and naturally occurring non-pathogenic mutations. The naturally occurring pathogenic mutation is selected from one or more of: c.2242C>T, c.2276G>T, c.2299delG, c.2522C>A, c.2541C>A, c.2761delC, c.2776C>T, c.2802T>G, c.2209C>T, c.2310delA, c.2391_2392deITG, c.2431A>T, c.2431_2432delAA, c.2440C>T, c.2525dup, c.2610C>A, c.2755C>T, c.2176T>C, c.2236C>G, c.2296T>C and c.2332G>T.

[0066] In certain embodiments of the invention, the naturally occurring pathogenic mutation is selected from one or more of c.2802T>G, c.2299delG and c.2276G>T, for example, the nucleotide mutation is c.2802T>G.

[0067] In one embodiment of the invention, the Sm sequence may be a consensus sequence and the stem-loop sequence may be a U1, U2, U3, U4, U5, U6 or U7 stem-loop sequence.

[0068] In one particular embodiment of the invention, the stem-loop sequence is the stem-loop sequence of U7.

[0069] In one particular embodiment of the invention, the stem-loop sequence is the stem-loop sequence of U1.

[0070] In one particular embodiment of the invention, the Sm sequence is shown in SEQ ID NO:6.

[0071] In one particular embodiment of the invention, the stem-loop sequence is set forth in SEQ ID NO:7.

[0072] In one embodiment of the invention, the snRNA nucleic acid molecule comprises modified nucleotide or analogue thereof monomers.

[0073] In the present invention, the modification is selected from a 2'-O-alkyl modification, a 2'-O-methoxy modification, and a 2'-O-methoxyethyl modification.

[0074] In certain embodiments of the invention, the 2'-O alkyl modification is a 2'-O-methyl modification.

[0075] In certain embodiments of the invention, the nucleotide analog monomer is selected from a 6'-modified bicyclic nucleoside, a 5'-modified bicyclic nucleoside, a 6'-disubstituted bicyclic nucleoside, a tetrahydropyran nucleoside analog, and a 2'-deoxy 2'-fluoro-β-D-arabinose nucleotide.

[0076] In one embodiment of the present invention, the nucleotides of the snRNA nucleic acid molecule are linked by a chemical bond, and the chemical bond is selected from a phosphate bond, a methylene bond, an amide bond, a methylphosphonate bond, and a 3'-thiomethylacetal bond.

[0077] In certain embodiments of the invention, the phosphate linkage is selected from a phosphorothioate linkage, a phosphorodithioate linkage, an alkylphosphate linkage, a phosphoroamidate linkage, a boranophosphate linkage, and a chiral linkage phosphorus.

[0078] In certain embodiments of the invention, the phosphate linkage is a phosphorothioate linkage.

[0079] In one embodiment of the invention, the snRNA nucleic acid molecule comprises a modified nucleotide or analogue thereof monomer at positions 1 to 80 from the 5'-end and / or 3'-end.

[0080] In one embodiment of the present invention, the snRNA nucleic acid molecule comprises a modified nucleotide or its analog monomer at positions 3 to 40 from the 5' end and / or 3' end.

[0081] In another embodiment of the present invention, the snRNA nucleic acid molecule comprises a modified nucleotide or its analog monomer at positions 6 to 10 from the 5' end and / or 3' end.

[0082] In another embodiment of the present invention, the snRNA nucleic acid molecule comprises a modified nucleotide or its analog monomer at positions 20 to 27 from the 5' end and / or 3' end.

[0083] In certain embodiments of the invention, the snRNA nucleic acid molecule comprises at least one phosphate bond from the 5' or 3' end.

[0084] In one embodiment of the invention, the snRNA nucleic acid molecule comprises one or more of the modifications described above.

[0085] In the present invention, when the snRNA nucleic acid molecule is chemically synthesized, all nucleotides are linked to each other by phosphorothioate bonds and are all modified with 2'-O-methoxy. In one embodiment, only three nucleotides on either side of the snRNA are linked by phosphorothioate bonds and are modified with 2'-O-methoxy. In one embodiment of the chemically synthesized modified U7 snRNA, the reverse-complementary pairing of the recognition domain with the target site may contain 0 to 5 mismatched nucleotides, preferably 0 to 1 mismatched nucleotide. In one embodiment, 3 to 40 bases on either side of the chemically synthesized snRNA are modified and linked by phosphate bonds.

[0086] In certain embodiments of the present invention, the snRNA nucleic acid molecule comprises 1 to 3 phosphate bonds from the 5' end.

[0087] In certain embodiments of the present invention, the snRNA nucleic acid molecule comprises one to three phosphate bonds from the 3' end.

[0088] In one embodiment of the invention, the snRNA nucleic acid molecule further comprises a unidirectional or bidirectional extension sequence at the 5' and / or 3' terminal nucleotides of the recognition domain.

[0089] The unidirectional extension sequence is an RNA sequence that is augmented at the 5' or 3' end of the target sequence of the snRNA nucleic acid molecule, and the bidirectional extension sequence is an RNA sequence that is augmented at the 5' and 3' ends of the target sequence of the snRNA nucleic acid molecule, respectively.

[0090] In one embodiment of the present invention, the snRNA nucleic acid molecule further comprises a free tail sequence, wherein the tail sequence comprises a motif for a splicing control protein and is capable of binding to the splicing control protein.

[0091] In certain embodiments of the present invention, the splicing control protein is selected from hnRNP A1 (Heterogeneous Nuclear Ribonucleoprotein A1), SRSF1 (Serine and Arginine Rich Splicing Factor 1), RBM4 (RNA Binding Motif Protein 4), DAZAP1 (DAZ Associated Protein 1) and SR (Serine and Arginine-Rich Protein).

[0092] For example, when the splicing control protein is hnRNP A1, the tail sequence is shown in SEQ ID NO:35.

[0093] A second aspect of the invention provides a combination of snRNA nucleic acid molecules comprising one or more snRNA nucleic acid molecules according to the first aspect.

[0094] In certain embodiments of the invention, at least two recognition domains are located on the same or different snRNA nucleic acid molecules.

[0095] A third aspect of the present invention provides a DNA molecule encoding an snRNA nucleic acid molecule according to the first aspect or a combination according to the second aspect.

[0096] A fourth aspect of the present invention provides a gene expression cassette comprising a promoter and a DNA molecule according to the third aspect.

[0097] In one embodiment of the invention, the promoter is a U7 promoter.

[0098] In one particular embodiment of the invention, the promoter is the U7 promoter from mouse. In one embodiment of the present invention, the gene expression cassette comprises at its 3' end a tail sequence involved in processing the snRNA.

[0099] In the present invention, the length of the tail sequence is 28 to 131 bp, for example, 106 bp. In one embodiment of the invention, the tail sequence is the gene sequence following the 3' end of the U7 snRNA gene, for example, as shown in SEQ ID NO:8.

[0100] In one embodiment of the present invention, the gene expression cassette comprises a recognition domain and a scaffold sequence, wherein the scaffold sequence is set forth in SEQ ID NO:62.

[0101] A fifth aspect of the present invention is a recombinant expression vector comprising an snRNA nucleic acid molecule according to the first aspect, a combination according to the second aspect or a gene expression cassette according to the third aspect.

[0102] In one embodiment of the present invention, the expression vector of the recombinant expression vector is selected from a plasmid, a phage, a microcircular DNA, a linear DNA, and a virus.

[0103] In certain embodiments of the invention, the expression vector is a lentivirus or an adeno-associated virus.

[0104] In the present invention, the adeno-associated virus capsid protein is a naturally occurring capsid protein or a mutant thereof, and the adeno-associated virus plasmid is single-stranded (ssAAV, single-stranded AAV) or double-stranded (scAAV, self-complementary AAV) complementary to the single-stranded AAV.

[0105] In the present invention, the naturally occurring AAV capsid protein may be derived from an animal or a plant. The animal-derived AAV capsid protein may be derived from a human (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, etc.), a non-human primate (e.g., AAVrh.8, AAVrh.10, and AAVrh.43), a vertebrate such as a mouse or a pig, or an insect. Preferably, the AAV serotype has tropism for ocular retinal tissue, such as AAV1, AAV2, AAV4, AAV5, AAV7, AAV8, AAV9, AAVrh10, or AAV2.7m8. In the AAV plasmid system of the present invention, for example, the serotype of the AAV ITR should match the serotype of the Rep gene, but may not match the serotype of the Cap gene. The AAV may be a single-stranded AAV (ssAAV) or a self-complementary double-stranded AAV (scAAV).

[0106] In certain embodiments of the invention, the naturally occurring capsid protein is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh.8, AAVrh.10 and AAVrh.43.

[0107] The mutant is selected from AAV2.5, AAV2i8, AAV-TT, AAV9.HR and CAM130.

[0108] A sixth aspect of the invention provides a viral particle comprising capsid proteins and a nucleic acid comprising an snRNA nucleic acid molecule according to the first aspect, a combination according to the second aspect or a DNA molecule according to the third aspect.

[0109] In one embodiment of the invention, the capsid protein is a capsid protein derived from an adeno-associated virus.

[0110] In one embodiment of the invention, the capsid protein from the adeno-associated virus is as defined in the fifth aspect.

[0111] A seventh aspect of the present invention is a pharmaceutical composition comprising an snRNA nucleic acid molecule according to the first aspect, a combination according to the second aspect, a DNA molecule according to the third aspect, a gene expression cassette according to the fourth aspect, a recombinant expression vector according to the fifth aspect, or a well particle according to the sixth aspect.

[0112] In one embodiment of the invention, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

[0113] An eighth aspect of the present invention provides a method for inducing production of an exon 13-deleted Usherin protein, the method comprising introducing into a host cell an snRNA nucleic acid molecule according to the first aspect, a combination according to the second aspect, a DNA molecule according to the third aspect, a gene expression cassette according to the fourth aspect, a recombinant expression vector according to the fifth aspect, a viral particle according to the sixth aspect, or a pharmaceutical composition according to the seventh aspect, thereby causing splicing skipping of exon 13.

[0114] In one embodiment of the present invention, the host cells are selected from retinal tissue cells, inner ear cells, cells with the potential to differentiate into retinal tissue cells and / or inner ear cells, and cells capable of performing functions corresponding to retinal tissue cells and / or inner ear cells.

[0115] In certain embodiments of the invention, the retinal tissue cells are retinal photoreceptor cells and the inner ear cells are inner ear hair cells.

[0116] In the present invention, the stem cells are selected from induced pluripotent stem cells and embryonic stem cells.

[0117] In the present invention, the potential cells are selected from induced pluripotent stem cells, embryonic stem cells, neural progenitor cells, retinal progenitor cells, retinal progenitor cells and stromal stromal cells.

[0118] A ninth aspect of the present invention provides a method for inhibiting the expression and / or function of USH2A pre-mRNA exon 13, comprising administering an snRNA nucleic acid molecule according to the first aspect, a combination according to the second aspect, a DNA molecule according to the third aspect, a gene expression cassette according to the fourth aspect, a recombinant expression vector according to the fifth aspect, a viral particle according to the sixth aspect, or a pharmaceutical composition according to the seventh aspect.

[0119] A tenth aspect of the present invention provides a method for inducing splicing skipping of USH2A pre-mRNA exon 13, comprising administering an snRNA nucleic acid molecule according to the first aspect, a combination according to the second aspect, a DNA molecule according to the third aspect, a gene expression cassette according to the fourth aspect, a recombinant expression vector according to the fifth aspect, a viral particle according to the sixth aspect, or a pharmaceutical composition according to the seventh aspect.

[0120] An eleventh aspect of the present invention provides a method for reducing expression of abnormal Usherin protein, the method comprising introducing into a host cell an snRNA nucleic acid molecule according to the first aspect, a combination according to the second aspect, a DNA molecule according to the third aspect, a gene expression cassette according to the fourth aspect, a recombinant expression vector according to the fifth aspect, a viral particle according to the sixth aspect, or a pharmaceutical composition according to the seventh aspect.

[0121] In one embodiment of the invention, the host cell is as defined in the eighth aspect.

[0122] A twelfth aspect of the present invention provides a method for producing an snRNA nucleic acid molecule according to the first aspect or a combination according to the second aspect, comprising biosynthesizing or chemically synthesizing an snRNA nucleic acid molecule according to the first aspect or a combination according to the second aspect.

[0123] A thirteenth aspect of the present invention provides use of an snRNA nucleic acid molecule according to the first aspect, a composition according to the second aspect, a DNA molecule according to the third aspect, a gene expression cassette according to the fourth aspect, a recombinant expression vector according to the fifth aspect, a viral particle according to the sixth aspect, or a pharmaceutical composition according to the seventh aspect in the preparation of a medicament for treating a disease associated with a mutation in exon 13 of USH2A.

[0124] In one embodiment of the invention, the mutation in exon 13 of USH2A is a pathogenic or non-pathogenic mutation.

[0125] In one embodiment of the invention, the disease is selected from an eye disease and an ear disease.

[0126] In the present invention, the methods according to the eighth, ninth, tenth and eleventh aspects are for non-therapeutic purposes such as laboratory research for drug development, development of reagent kits and the like.

[0127] A fourteenth aspect of the present invention provides a method for treating a disease associated with a mutation in USH2A exon 13, comprising administering to a patient in need thereof an effective amount of an snRNA nucleic acid molecule according to the first aspect, a combination according to the second aspect, a DNA molecule according to the third aspect, a gene expression cassette according to the fourth aspect, a recombinant expression vector according to the fifth aspect, a viral particle according to the sixth aspect, or a pharmaceutical composition according to the seventh aspect.

[0128] In one embodiment of the present invention, the disease associated with a mutation in USH2A exon 13 is as described in the thirteenth aspect.

[0129] Based on common knowledge in this field, the above preferred conditions can be arbitrarily combined, that is, each preferred example of the present invention can be obtained.

[0130] All of the reagents and raw materials used in the present invention are commercially available.

[0131] The positive and advanced effects of the present invention are as follows:

[0132] The snRNA nucleic acid molecules provided by the present invention target USH2A exon 13 and target regions on either side of it. The snRNA nucleic acid molecules contain a recognition domain, a stem-loop sequence, and an Sm sequence. The number of recognition domains is at least two, and the at least two recognition domains form a "tandem" structure in the snRNA. The tandem U7-snRNAs targeting different target sites can efficiently induce splicing skipping of USH2A exon 13 with a higher frequency of single exon skipping. In particular, the snRNAs of the present invention can safely and efficiently induce single exon skipping of USH2A exon 13 at low doses, whether pathogenic or non-pathogenic, and have significant clinical value in the prevention and / or treatment of eye and ear diseases associated with abnormal expression of Usherin protein. [Brief explanation of the drawings]

[0133] [Figure 1] Figure 1 shows a schematic diagram illustrating the structure and effect of U7-snRNA targeting exon 13 of USH2A, using a single recognition domain as an example. [Figure 2] Figure 2 is a schematic diagram of the genomic location of U7-snRNA targeting target region 8. [Figure 3A] 3A-3B show the effect of different target sites of U7 snRNA on inducing splicing skip of USH2A pre-mRNA exon 13 in reporter gene-expressing cells. [Figure 3B] 3A-3B show the effect of different target sites of U7 snRNA on inducing splicing skip of USH2A pre-mRNA exon 13 in reporter gene-expressing cells. [Figure 4] Figure 4 is a schematic diagram showing the efficiency with which different target snRNAs efficiently induce single-exon skipping of USH2A pre-mRNA exon 13. [Figure 5]FIG. 5 is a schematic diagram of the genomic location of U7-snRNA targeting target region 1. [Figure 6] FIG. 6 shows the percentage of cells in which U7 snRNA targeting target site 1 induces splicing skip of USH2A pre-mRNA exon 13 in reporter vector cells. [Figure 7] FIG. 7 shows a histogram of the average FITC intensity of GFP-positive cells induced by U7-snRNA targeting target region 1 (USH2A pre-mRNA exon 13 splicing skip). [Figure 8] FIG. 8 is a schematic diagram of the genomic location of U7-snRNA that targets target region 2. [Figure 9] FIG. 9 shows the percentage of cells in which U7 snRNA targeting target site 2 induces splicing skip of USH2A pre-mRNA exon 13 in reporter vector cells. [Figure 10] FIG. 10 shows a histogram of the average FITC intensity of GFP-positive cells induced by U7-snRNA targeting target region 2 (USH2A pre-mRNA exon 13 splicing skip). [Figure 11] FIG. 11 is a schematic diagram of the genomic location of U7-snRNA targeting target region 3. [Figure 12] FIG. 12 shows the percentage of cells in which U7 snRNA targeting target site 3 induces splicing skip of USH2A pre-mRNA exon 13 in reporter vector cells. [Figure 13] FIG. 13 shows a histogram of the average FITC intensity of GFP-positive cells induced by U7-snRNA targeting target region 3 (USH2A pre-mRNA exon 13 splicing skip). [Figure 14] FIG. 14 is a schematic diagram of the genomic location of U7-snRNA that targets target region 4. [Figure 15]FIG. 15 shows the percentage of cells in which U7 snRNA targeting target site 4 induces splicing skip of USH2A pre-mRNA exon 13 in reporter vector cells. [Figure 16] FIG. 16 is a schematic diagram of the genomic location of U7-snRNA targeting target region 5. [Figure 17] FIG. 17 shows the results of the percentage of cells in which U7 snRNA targeting target site 5 induces splicing skip of USH2A pre-mRNA exon 13 in reporter vector cells. [Figure 18] FIG. 18 is a schematic diagram of the genomic location of U7-snRNA targeting target region 6. [Figure 19] FIG. 19 shows the results of the percentage of cells in which U7 snRNA targeting target site 6 induces splicing skip of USH2A pre-mRNA exon 13 in reporter vector cells. [Figure 20] FIG. 20 is a schematic diagram of the genomic location of U7-snRNA targeting target region 7. [Figure 21] FIG. 21 shows the results of the percentage of cells in which U7 snRNA targeting target site 7 induces splicing skip of USH2A pre-mRNA exon 13 in reporter vector cells. [Figure 22] FIG. 22 shows the average FITC intensity of cells in which U7 snRNA targeting the target site induces splicing skip of USH2A pre-mRNA exon 13 in reporter gene-expressing cells. [Figure 23] FIG. 23 is a schematic diagram of the structure of the tandem U7 snRNA of the present invention. [Figure 24A] FIG. 24A is a schematic diagram 1 of the tandem U7 snRNA and USH2A pre-mRNA targeting scheme of the present invention. [Figure 24B] Figure 24B is a schematic diagram 2 of the tandem U7 snRNA and USH2A pre-mRNA targeting scheme of the present invention. [Figure 25]FIG. 25 shows the splicing skipping efficiency of USH2A pre-mRNA exon 13 induced by the tandem pUC57-U7-snRNA of the recognition domain of Example 8-1. [Figure 26] FIG. 26 shows the splicing skipping efficiency of USH2A pre-mRNA exon 13 induced by the tandem pUC57-U7-snRNA of the recognition domain of Example 8-2. [Figure 27] Figure 27 shows the splicing skipping efficiency of USH2A pre-mRNA exon 13 induced by chemically synthesized U7 snRNA in WERI cells. In the figure, lane 1: 50 pmol of chemically synthesized and modified U7-snRNA #30 + #4; lane 2: 50 pmol of chemically synthesized and modified U7-snRNA #26 + #15; lane 3: 50 pmol AON1; lane 4: 50 pmol AON2; lane 5: EGFP; lane 6: GL DNA marker 2000. [Figure 28] Figure 28 is a bar graph showing the quantitative analysis of the RT-PCR electrophoresis bands in Example 9. In the figure, ▲E12-E13 indicates USH2A mRNA showing simultaneous splicing skipping of exon 12 and exon 13, and total ▲ indicates the total USH2A mRNA showing splicing skipping of exon 13 or simultaneous splicing skipping of exon 12 and exon 13. [Figure 29A] FIG. 29A is a schematic diagram of the structure of the tandem U7 snRNA of the present invention. [Figure 29B] Figure 29B is a diagram comparing the splicing skipping efficiency of USH2A pre-mRNA exon 13 induced by U7-hnRNP A1-snRNA and U7-snRNA tandems. [Figure 30] FIG. 30 shows the results of an in vitro dose-escalation experiment examining splicing of USH2A exon 13 induced by 3×U7 snRNA tandems. [Figure 31] Figure 31 shows that the splicing suppression effect induced by AAV-U7 snRNA tandems is significantly superior to that of AONs through in vitro dose-escalation experiments. [Figure 32] FIG. 32 shows that snRNA-induced splicing skipping of USH2A pre-mRNA exon 13 in humanized mouse retinal cells is superior to AON. [Figure 33] FIG. 33 shows that USH2A pre-mRNA exon 13 splicing skipping in rabbit eye cells induced by injection of AAV-U7 snRNA of different serotypes is superior to AON. [Figure 34] Figure 34 shows that at 22 weeks, AAV-delivered U7 snRNA can still sustain the induction of USH2A pre-mRNA exon 13 splicing skipping. [Figure 35] Figure 35 shows the ability of the combination of AAV-1 x U7 snRNA tandem and AAV-4 x U7 snRNA to maintain splicing skipping efficiency for a long period of time. DETAILED DESCRIPTION OF THE INVENTION

[0134] Hereinafter, the present invention will be further described by way of examples, but the scope of the present invention is not limited by these examples. In the following examples, experimental methods for which specific conditions are not specified are selected according to conventional methods and conditions or product instructions.

[0135] Example 1: Synthesis of U7-snRNA

[0136] 1. Synthesis of snRNA backbone Wild-type U7 snRNA contains a stem-loop structure (scaffold), a U7-specific Sm sequence (AAUUUGUCUAG, SEQ ID NO: 5), and a recognition domain (complementary to replication-dependent histone pre-mRNA). The U7 snRNA of the present application was derived from the gene sequence of mouse wild-type U7 snRNA (NCBI Reference Sequence: NR_024201.3) on NCBI. The U7-specific Sm binding site was replaced with an optimized consensus Sm sequence, i.e., SmOPT (AAUUUUUGGAG, SEQ ID NO: 6). The original recognition domain at the 5' end of the SmOPT sequence was replaced with a recognition domain that pairs in reverse complementarity with a specific target site in USH2A pre-mRNA. The original stem-loop structure sequence of U7 (CAGGUUUUCUGACUUCGG UCGGAAAACCCCU, SEQ ID NO: 7) was maintained at the 3' end of the SmOPT sequence.

[0137] As shown in Figure 1, the non-tandem U7 snRNA recognition domain sequence targeting USH2A pre-mRNA exon 13 is reverse-complementarily paired with a target sequence selected from USH2A pre-mRNA intron 12-exon 13-intron 13, and the target sequence can be selected from the 3' sequence target region of USH2A pre-mRNA exon 13.

[0138] Specific operation steps:

[0139] First, a pUC57 vector containing the gene sequence-U7-snRNA gene expression cassette backbone (5'-mouse U7 promoter-smOPT sequence-U7 snRNA scaffold-snRNA gene-specific 3' cassette-3') was synthesized by total gene synthesis. Two type II restriction enzyme recognition sites (e.g., BsaI, AarI, BsmBI, etc.) were added between the U7 promoter and smOPT to facilitate subsequent excision, replacement, and insertion of other recognition domain sequences. The snRNA gene-specific 3' cassette contains the sequence "GTCTACAATGAAA (SEQ ID NO: 8)" at the 3' end of the U7 snRNA gene in the mouse genome (GenBank: X54748.1), which is involved in pre-snRNA processing.

[0140] 2. Construction of U7 snRNA vector targeting the target region The human genome sequence corresponding to the 3' region of exon 13 of USH2A pre-mRNA of the present application (SEQ ID NO: 1) is located at Chr1:216246563-216246753 (corresponding to the NCBI database GRch38 version), and the sequence of SEQ ID NO: 1 is as follows:

[0141] 。The USH2A pre-mRNA exon 13 and its flanking target regions (pre-mRNA regions corresponding to Chr1:216246563-216247246) may be target regions containing natural pathogenic / non-pathogenic mutations in addition to the above-listed mutation-free sequences, and the mutation sites include at least one of the following target mutation sites: c.2242C>T, c.2276G>T, c.2299delG, c.2522C>A, c.2541C>A, c.2761delC, c.2776C>T, c.2802T>G, c.2209C>T, c.2310delA, c.2391_2392deITG, c.2431A>T , c.2431_2432delAA, c.2440C>T, c.2525dup, c.2610C>A, c.2755C>T, c.2176T>C, c.2236C>G, c.2296T>C, c.2332G>T.

[0142] The sequence of the 5' target region of USH2A pre-mRNA exon 13 (pre-mRNA region corresponding to chr1:216247130-216247246) (SEQ ID NO: 2) is as follows:

[0143] UAAAUAUAUUUUAUCUUUAGGGCUUAGGUGUGAUUGCAAUUUUGGAUUUAAAUUUCUCCGAAGCUUUAAUGAUGUUGGAUGUGAGCCCUGCCAGUGUAACCUCCAUGGCUCAGU

[0144] The sequence of the 3' target region of USH2A pre-mRNA exon 13 (pre-mRNA region corresponding to chr1:216246563-216246753) (SEQ ID NO: 3) is as follows:

[0145] CAGUGUGAGCCUCACAGGUACAAUUUGACCAUUGACAAUUUUCAACACUGCCAGAUGUGUGAGUGUGAUUCCUUGGGGACAUUACCUGGGACCAUUUGACCCAAUCAGUGGCCAGUGCCUGUGUGUGCCUAAUCGUCAAGGAAGAAGGUGUAAUCAGUGUCAACCAGGUAAGAAAGAAAUGUUUACAU

[0146] The sequence of the 3' target region of USH2A pre-mRNA exon 13 (pre-mRNA region corresponding to chr1:216246563-216246649) (SEQ ID NO: 4) is as follows:

[0147] AAUCAGUGGCCAGUGCCUGUGUGUGCCUAAUCGUCAAGGAAGAAGGUGUAAUCAGUGUCAACCAGGUAAGAAAGAAAUGUAUUACAU

[0148] The 3' region of USH2A pre-mRNA exon 13 (pre-mRNA region corresponding to Chr1:216246563-216246626) (region 8, SEQ ID NO: 9) sequence is UGCCUAAUCGUCAAGGAAGAAGGUGUAAUCAGUGTCAACCAGGUAAGAAAGAAAUGUAUUACAU, or a naturally mutated 3' region of USH2A pre-mRNA exon 13 sequence, such as UGCCUAAUCGUCAAGGAAGAAGGUGUAAUCAGUG G CAACCAGGUAAGAAAGAAAUGUAUUACAU (the underlined mutation is the natural pathogenic c.2802T>G, SEQ ID NO: 10).

[0149] Oligo-DNAs were synthesized according to the pretranscriptional DNA sequences corresponding to the snRNA recognition domain sequences in Table 1. The sense strand of the oligo-DNA was the DNA sequence corresponding to the recognition domain sequence, with CCGCA added to the 5' end, and the antisense strand was the antisense complementary sequence of the recognition domain sequence, with AATT added to the 5' end and T added to the 3' end. For example, if the recognition domain sequence was 5'-NNN-3', the sense strand of the synthesized oligo-DNA was 5'-CCGCANNN-3', and the antisense strand was 5'-AATTNNNT-3'.

[0150] The synthesized sense and antisense oligo DNA strands were mixed according to the annealing reaction system (total reaction volume 20 μl: 2 μl of Oligo-F (100 μM) + 2 μl of Oligo-R (100 μM) + 2 μl of 10x NEB Cutter Smart Buffer + 16 μl of deionized water), incubated at 95°C for 5 minutes, then cooled on ice and annealed to form double-stranded DNA with sticky ends. After 100-fold dilution, 1 μl of the mixture was taken and digested with 10 ng of BsaI enzyme to recover the linearized pUC57-U7 snRNA backbone plasmid, which was then ligated with T4 ligase. The ligation product was further identified by transformation of E. coli recipient cells, single cloning, PCR, and sequencing to obtain a U7 snRNA vector for inducing splicing skipping in exon 13 of USH2A. The plasmid was purified and stored at -20°C for backup.

[0151] [Table 1]

[0152] Here, snRNA#24, snRNA#25, snRNA#27 and snRNA#29 are homologous to humans and monkeys.

[0153] 3. Chemical synthesis and modification of U7-snRNA Similar to oligonucleotides, U7 snRNA can be produced by direct chemical synthesis to generate RNA containing a guide sequence, smOPT, and a U7 snRNA scaffold. In vivo synthesized U7 snRNA can be modified to resist nuclease degradation or to enhance affinity for target sequences.

[0154] In this example, U7 snRNA was chemically synthesized and modified with 2'-methoxy (2'-OME) and thiol at the 5' and 3' ends, respectively, to enhance nuclease resistance. Using snRNA#25 and snRNA#26 as examples, the sequences and modifications of the chemically synthesized snRNAs are shown below (* indicates a phosphorothioate backbone, m indicates a 2'-methoxy modification, underline indicates the recognition domain that pairs reverse-complementarily with the target sequence, and italics indicate the smOPT sequence).

[0155] The sequence of the chemically synthesized and modified U7-snRNA#25 is shown below.

[0156] TIFF2025534169000002.tif20168

[0157] The chemically synthesized and modified bidirectional extension sequence of U7-snRNA#25 is shown below.

[0158] TIFF2025534169000003.tif17168

[0159] The sequence of chemically synthesized and modified U7-snRNA#26 is shown below.

[0160] TIFF2025534169000004.tif21168

[0161] The chemically synthesized and modified unidirectional extension sequence of U7-snRNA#26 is shown below.

[0162] TIFF2025534169000005.tif22168

[0163] Example 2: Construction of a reporter vector for quantitative evaluation of splicing skip efficiency of USH2A exon 13 The RGleft-USH2A Exon13mut-RGright sequence (with AgeI and EcoRI enzyme sites at the 5' and 3' ends, respectively) was synthesized by total gene synthesis. The synthetic sequence was then digested with AgeI and EcoRI into the pX601 plasmid (Addgene, 61591), followed by electrophoresis, gel collection, and ligation. The synthesized sequence was inserted between the AgeI and EcoRI sites of the pX601 vector, replacing the SaCas9 gene sequence in the original vector. Further transformation of sensitive E. coli cells, single cloning, PCR, and sequencing confirmed the purified reporter vector plasmid, which was then stored at -20°C for backup purposes.

[0164] The reporter vector structure is pCMV-RGleft-USH2A Exon13mut-RGright, where RG represents the reporter gene, RGleft represents the first half of the 5' end of the reporter gene without reporter function, and RGright represents the second half of the 3' end of the reporter gene without reporter function. Tandem expression of RGleft and RGright ensures the complete functionality of the reporter gene. In this embodiment, when the reporter gene is the green fluorescent gene (EGFP), the vector structure is pCMV-EGFPleft-Exon13mut-EGFPright. Exon13mut represents the USH2A exon 13 containing the pathogenic mutation and its upstream and downstream intron sequences (the upstream intron sequence is a combination of the 5'-terminal 204-bp and 3'-terminal 490-bp gene sequence of intron 12 of the human USH2A gene, and the downstream intron sequence is a combination of the 5'-terminal 703-bp and 3'-terminal 216-bp gene sequence of intron 13 of the human USH2A gene). The pathogenic mutation in USH2A exon 13 described in the examples of this application may be c.2299delG or c.2802T>g, or any other mutation, and the resulting vector constructs are pCMV-EGFPleft-Exon13c.2299delG-EGFPright and pCMV-EGFPleft-Exon13c.2802T>G-EGFPright, respectively. In some examples, the mutations may be or include c.2276G>T, C.2522C>A, c.2242C>T, c.2541C>A, c.2761delC, and C.2776C>T.

[0165] RGleft, for example, EGFPleft sequence is as follows:

[0166] atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgaggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccct ggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctacccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgag (SEQ ID NO: 28)

[0167] RGright, for example, EGFPright sequence is as follows:

[0168] gtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgc agctcgccgaccactaccagcagaacaccccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaa gaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa (SEQ ID NO: 29)

[0169] Example 3: USH2A exon 13 splicing skipping effect mediated by U7-snRNA at different target sites in the 3' region (region 8) of USH2A pre-mRNA exon 13 293T cells were seeded in 24-well plates at a constant aliquot to achieve approximately 80% cell confluence after 24 hours. Using Lipofectamine 2000, 293T cells were co-transfected with pCMV-EGFPleft-Exon13mut-EGFPright and pUC57-U7 snRNA plasmid targeting USH2A pre-mRNA (vector mass ratio: 100 ng:400 ng). Two negative controls were used: 293T cells transfected with the reporter plasmid alone (reporter, reporter group), and 293T cells co-transfected with the reporter plasmid and pUC57-U7 scrambled (SC group). 293T cells without any plasmid transfection served as a blank control. After transfection, the cells were cultured for 48–72 hours and digested into single cells using trypsin. The GFP positivity rate (i.e., the percentage of cells in which USH2A exon 13 was induced to undergo splicing skipping) of the different U7 snRNA groups was then measured using a flow cytometer. In this example, the mean FITC intensity (i.e., the mean FITC fluorescence intensity of GFP-positive cells) of the different experimental groups (shown in Figure 2) was measured, as well as the GFP positivity rate and GFP protein expression level of the positive cells.

[0170] This example compared the efficiency of U7 snRNAs targeting different splicing sites to induce splicing skipping of USH2A pre-mRNA exon 13 in reporter gene-expressing cells. Table 2 and Figures 3A-3B show the efficacy of U7 snRNAs targeting different sites to induce splicing skipping of USH2A pre-mRNA exon 13 in reporter gene-expressing cells. The results showed that all U7 snRNAs (#24-#34) targeting the 3' sequence of USH2A pre-mRNA exon 13 were able to induce splicing skipping of USH2A exon 13 in reporter gene-expressing cells, with USH2A inducing splicing skipping with high efficiency.

[0171] [Table 2]

[0172] Example 4: High efficiency of inducing splicing skip of USH2A pre-mRNA exon 13 alone by chemically synthesized snRNA 6 x 10 human host cells in a 24-well plate 5 The cells were seeded at 100 μg / well. The human retinal neuronal cells selected in this example were WERI-Rb-1 cells (a retinal neuronal cell line). WERI cells were transfected with 100 pmol of in vitro synthesized U7-snRNAs #24, #25, #26, #27, #28, #29, #30, #33, and #34 using Lipofectamine 2000. After culturing the transfected cells for 72 hours, RNA was extracted from each experimental group and reverse-transcribed to obtain cDNA. RT-PCR was performed using primers AGCCTTTTCCGCCAAGGTGATC (SEQ ID NO: 30) and CACAACGTTGCCCAGCAATGG (SEQ ID NO: 31) to detect the presence of exon skipping in the mature USH2A mRNA. The electrophoresis results are shown in Figure 4. As a result, all U7-snRNAs #24-34 were able to efficiently induce splicing skipping of exon 13, with little joint splicing skipping of exon 13 and exon 12 observed. Furthermore, U7 snRNAs targeting the 3' region were found to be able to efficiently induce independent splicing skipping of USH2A pre-mRNA exon 13 and to be highly safe.

[0173] Example 5: Construction of U7-snRNAs targeting different sites in and near USH2A exon 13 In this example, 21 target sites were set for each of the seven target regions of USH2A pre-mRNA, and the seven target regions of USH2A pre-mRNA are shown below.

[0174] Exon 13 region 1 (SEQ ID NO: 32) (Chr1:216247142-216247185): CGAAGCUUUAAUGAUGUUGGAUGUGAGCCCUGCCAGUGUAACCU;

[0175] Exon 13 region 2 (SEQ ID NO: 33) (Chr1:216247130-216247161): GAGCCCUGCCAGUGUAACCUCCAUGGCUCAGU;

[0176] Exon 13 region 3 (SEQ ID NO: 34) (Chr1:216246616-216246649): AAUCAGUGGCCAGUGCCUGUGUGUGCCUAAUCGU;

[0177] Exon 13 region 4 (SEQ ID NO: 36) (Chr1:216247210-216247246): UAAAUAUAUUUUAUCUUUAGGGCUUAGGUGUGAUCAU;

[0178] Exon 13 region 5 (SEQ ID NO: 37) (Chr1:216247204-216247232): CUUUAGGGCUUAGGUGUGAUCAUUGCAAU;

[0179] Exon 13 region 6 (SEQ ID NO: 38) (Chr1:216247187-216247220): GGUGUGAUCAUUGCAAUUUUGGAUUUAAAUUUCU;

[0180] Exon 13 region 7 (SEQ ID NO: 39) (Chr1:216247169-216247202): UUGGAUUUAAAUUUCUCCGAAGCUUUAAUGAUGU.

[0181] The 21 target sites are shown in the table below.

[0182] [Table 3] TIFF2025534169000008.tif37168

[0183] Here, snRNA#9, snRNA#15, snRNA#17 and snRNA#19 are homologous to humans and monkeys.

[0184] Example 6: Detection of the splicing skipping effect of USH2A exon 13 mediated by U7-snRNAs targeting different regions Using the method described in Example 3, the GFP-positive rate and average FITC intensity of U7 snRNA groups targeting different regions were detected in the reporter cell line.

[0185] Figure 5 shows the genomic locations of U7-snRNAs targeting target region 1 (left to right corresponds to the 5' end and 3' end in the figure). The results of the U7-snRNA experiments targeting target region 1 are shown in Figures 6-7 and Table 4 below. All U7-snRNAs targeting target region 1 induced splicing skipping of USH2A exon 13 in reporter gene-expressing cells. While conventional AONs targeting region 1 were unable to induce splicing skipping of exon 13, snRNAs targeting region 1 were able to efficiently induce splicing skipping of exon 13.

[0186] [Table 4]

[0187] Figure 8 shows the genomic locations of U7-snRNAs targeting target region 2 (left to right corresponds to the 5' end and 3' end in the figure). The results of the U7-snRNA experiments targeting target region 2 are shown in Figures 9-10 and Table 5 below. All U7-snRNAs targeting target region 2 induced splicing skipping of USH2A exon 13 in reporter gene-expressing cells. While conventional AONs targeting region 2 were less effective at inducing splicing skipping of exon 13, snRNAs targeting region 2 were able to efficiently induce splicing skipping of exon 13.

[0188] [Table 5]

[0189] Figure 11 shows the genomic locations of U7-snRNAs targeting target region 3 (left to right corresponds to the 5' end and 3' end in the figure). The results of the U7-snRNA experiments targeting target region 3 are shown in Figures 12-13 and Table 6 below. All U7-snRNAs targeting target region 3 induced splicing skipping of USH2A exon 13 in reporter gene-expressing cells. While conventional AONs targeting region 3 were only slightly effective at inducing splicing skipping of exon 13, snRNAs targeting region 3 were able to efficiently induce splicing skipping of exon 13.

[0190] [Table 6]

[0191] Combining the results for target regions 1, 2, and 3, we found that target regions 1, 2, and 3 are insensitive to AON targeting using existing technologies, meaning that targeting these regions does not induce exon 13 splicing skipping or the induction efficiency is low. However, snRNA targeting these regions significantly induced exon 13 splicing skipping. Therefore, although both snRNA and AON can induce splicing skipping, their mechanisms of action are different, and the sensitivity of their target regions (the target regions of the target regions applied) is also different.

[0192] At the same time, as shown in Figures 6, 9, and 12 and Table 7 below, although the GFP% (percentage of cells in which splice skipping was induced) was close, different target snRNAs targeting the same region resulted in different levels of splice skipped mRNA and protein (average FITC intensity) in the same cells. Furthermore, target region 1 and target region 2 showed superior splice skipped mRNA and protein levels in the same cells compared to target region 3.

[0193] [Table 7]

[0194] Figure 14 shows the genomic locations of U7-snRNAs targeting target region 4 (left to right corresponds to the 5' end to the 3' end in the figure). The results of the U7-snRNA experiments targeting target region 4 are shown in Figure 15 and Table 8 below. All U7-snRNAs targeting target region 4 induced splicing skipping of USH2A exon 13 in reporter gene-expressing cells.

[0195] [Table 8]

[0196] Figure 16 shows the genomic locations of U7-snRNAs targeting target region 5 (left to right in the figure corresponds to the 5' end to the 3' end). The results of the U7-snRNA experiments targeting target region 5 are shown in Figure 17 and Table 9 below. All U7-snRNAs targeting target region 5 induced splicing skipping of USH2A exon 13 in reporter gene-expressing cells.

[0197] [Table 9]

[0198] Figure 18 shows the genomic locations of U7-snRNAs targeting target region 6 (left to right corresponds to the 5' end to the 3' end in the figure). The results of the U7-snRNA experiments targeting target region 6 are shown in Figure 19 and Table 10 below. All U7-snRNAs targeting target region 6 induced splicing skipping of USH2A exon 13 in reporter gene-expressing cells.

[0199] [Table 10]

[0200] Figure 20 shows the genomic locations of U7-snRNAs targeting target region 7 (left to right in the figure corresponds to the 5' end to the 3' end). The results of the U7-snRNA experiments targeting target region 7 are shown in Figure 21 and Table 11 below. All U7-snRNAs targeting target region 7 induced splicing skipping of USH2A exon 13 in reporter gene-expressing cells.

[0201] [Table 11]

[0202] The average FITC intensity of GFP-positive cells induced by U7-snRNA in different regions is shown in Figure 22 and Table 12 below. Although the GFP% (percentage of cells inducing splicing skips) targeting the same region was close, different target snRNAs targeting the same region resulted in different levels (average FITC intensity) of splicing skip mRNA and its protein levels induced in the same cells.

[0203] Target region 2 not only increased the percentage of cells in which splicing skipping was induced (GFP%), but also increased the levels of mRNA and its protein (average FITC intensity) that induced splicing skipping within the same cells.

[0204] In the prior art, target site #2 and its neighboring sites #1 and #3 (region 4), which showed high splicing skip induction efficiency by AONs, resulted in low mRNA levels when splicing skip was induced in the same cells in the snRNA system. In the prior art, AON efficiency at target site 7 was higher than that at site 5, but in the snRNA system, the efficiency at target site 5 was higher than that at site 7. In the prior art, AON efficiency at target site 3 was higher than that at site 2, but in the snRNA system, the efficiency at target site 2 was higher than that at site 3. Therefore, although both snRNA and AON can induce splicing skip, their mechanisms of action are different, and the sensitivity of their target sites is also different. Furthermore, combining the results of Example 8 and the analysis, if the efficiency of snRNA #24 is similar to that of snRNA #2 and AON1 (SEQ ID NO: 77), it can be inferred that the effects of snRNA #3-#11 were all superior to those of snRNA #2, snRNA #24, and AON1.

[0205] [Table 12]

[0206] The U7-snRNA of the present application that targets and induces splicing skipping of USH2A pre-mRNA exon 13 is not limited to the U7-snRNAs listed in Examples 3 and 4. The target site recognized by the U7-snRNA recognition domain of the present application is selected from USH2A pre-mRNA intron 12-exon 13-intron 13, preferably from exon 13 and the target adjacent regions on both sides (SEQ ID NO: 1).

[0207] Example 7: Splicing skip of USH2A exon 13 mediated by U7-snRNA combinations of different target sites

[0208] 1. Construction of a U7-snRNA multiple target site combination vector Using Golden Gate Assembly technology, U7 snRNA cassettes (expression cassettes) were PCR-amplified using different U7 snRNA plasmids as templates. At the same time, primers were used to introduce additional 5'-flank bases and correctly oriented BsaI restriction sites at both ends of the amplicon. The adjacent U7 snRNA cassettes were then digested with BsaI to generate specific, complementary sticky ends. The head and tail U7 snRNA cassettes were digested with BsaI to generate the same sticky ends as the linear backbone vector digested with HindIII and NotI. Finally, the PCR products and the pUC57-U7 snRNA backbone recovered from HindIII and NotI digestion were assembled using the NEB® Golden Gate Assembly Kit (BsaI-HF® v2) (NEB #E1601). The assembly method was as follows: pUC57-U7 snRNA Backbone-HindIII+NotI, 80 ng; U7 snRNA#A cassette PCR product, 20 ng; U7 snRNA#B cassette PCR product, 20 ng; U7 snRNA#C cassette PCR product, 20 ng; T4 DNA ligase buffer (10X), 2 μl; NEB Golden Gate Assembly mix, 1 μl; reaction process: (37°C, 5 min → 16°C, 5 min) × 20 → 60°C, 5 min.

[0209] The Golden Gate Assembly product was further identified by transformation of E. coli-sensitive cells, selection of single clones, PCR, and sequencing to obtain a U7 snRNA multitarget site combination vector for inducing USH2A exon 13 splicing skipping. The plasmid was purified and stored at -20°C for backup purposes.

[0210] Example 8-1: Induction of splicing skip of USH2A exon 13 in reporter gene-expressing cells by recognition domain tandem U7 snRNA

[0211] 1. Preparation of Tandem U7 snRNA Recognition Domains A recognition domain tandem U7 snRNA is a recognition domain in which two or more recognition domains are linked to one U7 snRNA stem-loop structure and one smOPT sequence. Its structure is 5'-recognition domain B-recognition domain A-smOPT sequence-stem-loop structure-3', as shown in Figure 23. Recognition domains A and B of the tandem U7 snRNA recognize RNA sequences at different target sites.

[0212] Oligo-DNAs were synthesized according to the pretranscriptional DNA sequences corresponding to the snRNA recognition domain sequences in Tables 1 and 3. The sense strand of the oligo-DNA was a DNA sequence corresponding to the recognition domain sequence, with CCGCA added to the 5' end, and the antisense strand was the antisense complementary sequence of the recognition domain sequence, with AATT added to the 5' end and T added to the 3' end.

[0213] TIFF2025534169000018.tif47168

[0214] The synthesized sense and antisense oligo DNA strands were mixed according to the annealing reaction system (total reaction volume 20 μl: 2 μl of Oligo-F (100 μM) + 2 μl of Oligo-R (100 μM) + 2 μl of 10x NEB Cutter Smart Buffer + 16 μl of deionized water), incubated at 95°C for 5 minutes, and then cooled on ice to anneal to form double-stranded DNA with sticky ends. After 100-fold dilution, 1 μl of the mixture was taken and digested with 10 ng of BsaI enzyme to recover the linearized pUC57-U7 snRNA backbone plasmid, which was then ligated with T4 ligase. The ligation product was further identified by transformation of E. coli recipient cells, single cloning, PCR, and sequencing to obtain a U7 snRNA vector for inducing splicing skipping in exon 13 of USH2A. The plasmid was purified and stored at -20°C for backup. The constructed vectors were designated pUC57-U7 snRNA#B-#A, where A and B represent the recognition domain numbers, respectively, and correspond to the recognition domain lists and sequences in Tables 1 and 3. Examples include pUC57-snRNA#25-#15, pUC57-snRNA#24-#9, pUC57-snRNA#24-#19, pUC57-snRNA#25-#9, pUC57-snRNA#25-#19, pUC57-snRNA#29-#9, and pUC57-snRNA#25-#15.

[0215] The recognition domain tandem U7 snRNA can also be chemically synthesized and modified according to the method described in Example 2, and its specific sequence and modifications are as follows (* indicates a phosphorothioate backbone, m indicates a 2'-methoxy modification, underline indicates a recognition domain that is reverse-complementary to the target sequence, and italics indicate the smOPT sequence):

[0216] Chemically synthesized and modified U7 snRNA#28-#3:

[0217] TIFF2025534169000019.tif24168

[0218] Chemically synthesized and modified U7 snRNA#30-#4:

[0219] TIFF2025534169000020.tif27168

[0220] Chemically synthesized and modified U7 snRNA#25-#15:

[0221] TIFF2025534169000021.tif27168

[0222] Chemically synthesized and modified U7snRNA#26-#16:

[0223] TIFF2025534169000022.tif25168

[0224] In the above sequences, "-" indicates only the connection order of the two sequences.

[0225] In some embodiments, the total length of the chemically synthesized snRNA sequence is preferably 96 bp or greater.

[0226] 2. Induction of splicing skip of USH2A exon 13 in reporter gene-expressing cells by the recognition domain tandem U7 snRNA 293T cells were seeded in 24-well plates at a constant aliquot to achieve approximately 80% cell confluence after 24 hours. Using Lipofectamine 2000, 293T cells were co-transfected with pCMV-EGFPleft-Exon13mut-EGFPright and either a dual-recognition domain tandem U7 snRNA plasmid or a single-recognition domain U7 snRNA plasmid (vector mass ratio: 100 ng:400 ng). 293T cells transfected with the reporter plasmid alone (Report group) and co-transfected with the reporter plasmid and pUC57-U7 scramble (SC group) served as two negative controls. 293T cells untransfected with any plasmid served as a blank control. After transfection, cells were cultured for 48–72 hours, digested with trypsin, and then analyzed for GFP positivity in the different snRNA groups using a flow cytometer. Table 13 below and Figure 25 show the splicing skip induction effect of USH2A pre-mRNA exon 13 by different target site tandem U7 snRNAs.

[0227] In this example, we found that the application of tandem U7-snRNAs targeting different target sites improved the efficiency of inducing splicing skipping of USH2A exon 13 in reporter gene-expressing cells. The efficiency of splicing skipping induced by the tandem target sites in this example was higher than that achieved by a single target site and was superior to known USH2A exon 13 splicing skipping techniques. Furthermore, combined with data from other examples, we unexpectedly found that although a single U7 snRNA #25 did not efficiently induce exon 13 splicing skipping, the efficiency of inducing exon 13 splicing skipping was significantly improved when another U7 snRNA was tandemly arranged with U7 snRNA #25. Furthermore, the present inventors constructed an AON with different target sites arranged in tandem and attempted to induce splicing skipping of USH2A pre-mRNA exon 13, but it was found that the splicing skipping efficiency was almost zero. Furthermore, it was verified that the mechanisms of action for inducing splicing jumps differ between AONs and snRNAs.

[0228] [Table 13]

[0229] In this example, RNA sequences that recognize different target sites were arranged in tandem in the recognition region of U7 snRNA to construct tandem U7 snRNAs that target different target sites. In this example, the tandem snRNAs with recognition domains contain two or more recognition domains, as shown in Figure 23, and are arranged in tandem at the 5' end of the snRNA. In one example, two tandemly arranged recognition domains can recognize the same target site. When driven by the same expression vector or the same snRNA, increasing the number of target recognition domains improved the efficiency of splicing skipping in USH2A pre-mRNA exon 13.

[0230] When the U7 snRNA is a tandem arrangement of two or more different recognition domains, the order of the recognition domains from the 5' to the 3' end of the U7 snRNA is arranged from the 3' to the 5' end based on the position of the target site in the USH2A pre-mRNA corresponding to the recognition domain.

[0231] Example 8-2: Induction of splicing skip of USH2A exon 13 in reporter gene-expressing cells by recognition domain tandem U7 snRNA

[0232] 1. Preparation of Tandem U7 snRNA Recognition Domains A recognition domain tandem U7 snRNA is a recognition domain in which two or more recognition domains are linked to one U7 snRNA stem-loop structure and one smOPT sequence. Its structure is 5'-recognition domain B-recognition domain A-smOPT sequence-stem-loop structure-3', as shown in Figure 23. Recognition domains A and B of the tandem U7 snRNA recognize RNA sequences at different target sites. The targeting strategies of the recognition domain tandem U7 snRNA and USH2A pre-mRNA are shown in Figures 24A and 24B.

[0233] Oligo-DNAs were synthesized according to the pretranscriptional DNA sequences corresponding to the snRNA recognition domain sequences in Tables 1 and 3. The sense strand of the oligo-DNA was a DNA sequence corresponding to the recognition domain sequence, with CCGCA added to the 5' end, and the antisense strand was the antisense complementary sequence of the recognition domain sequence, with AATT added to the 5' end and T added to the 3' end.

[0234] TIFF2025534169000024.tif46168

[0235] The synthesized sense and antisense oligo DNA strands were mixed according to the annealing reaction system (total reaction volume 20 μl: 2 μl of Oligo-F (100 μM) + 2 μl of Oligo-R (100 μM) + 2 μl of 10x NEB Cutter Smart Buffer + 16 μl of deionized water), incubated at 95°C for 5 minutes, and then cooled on ice to anneal to form double-stranded DNA with sticky ends. After 100-fold dilution, 1 μl of the mixture was taken and digested with 10 ng of BsaI enzyme to recover the linearized pUC57-U7 snRNA backbone plasmid, which was then ligated with T4 ligase. The ligation product was further identified by transformation of E. coli recipient cells, single cloning, PCR, and sequencing to obtain a U7 snRNA vector for inducing splicing skipping in exon 13 of USH2A. The plasmid was purified and stored at -20°C for backup. The constructed vectors were designated pUC57-U7 snRNA#B-#A, where A and B represent the recognition domain numbers, respectively, and correspond to the recognition domain lists and sequences in Tables 1 and 3. Examples include pUC57-snRNA#24-#9, pUC57-snRNA#25-#9, pUC57-snRNA#9-#24, and pUC57-snRNA#9-#25. The targeting directions of U7 snRNA and USH2A pre-mRNA in pUC57-snRNA#24-#9 and pUC57-snRNA#25-#9 are shown in Figure 24A. The targeting directions of U7 snRNA and USH2A pre-mRNA in pUC57-snRNA#9-#24 and pUC57-snRNA#9-#25 are shown in Figure 24A.

[0236] The recognition domain tandem U7 snRNA can also be chemically synthesized and modified according to the method described in Example 2. As shown in Example 8-1, for example, its specific sequence and modifications are as follows (* indicates a phosphorothioate backbone, m indicates a 2'-methoxy modification, underline indicates a recognition domain that is reverse-complementary to the target sequence, and italics indicate the smOPT sequence):

[0237] Chemically synthesized and modified U7 snRNA#28-#3:

[0238] TIFF2025534169000025.tif26168

[0239] Chemically synthesized and modified U7 snRNA#30-#4:

[0240] TIFF2025534169000026.tif24168

[0241] Chemically synthesized and modified U7 snRNA#25-#15:

[0242] TIFF2025534169000027.tif25168

[0243] Chemically synthesized and modified U7 snRNA#26-#16:

[0244] TIFF2025534169000028.tif24168

[0245] In the above sequences, "-" indicates only the connection order of the two sequences.

[0246] In some embodiments, the total length of the chemically synthesized snRNA sequence is preferably 96 bp or greater. 2. Induction of USH2A exon 13 splicing skip in reporter gene-expressing cells by U7 snRNA with tandem recognition domains

[0247] 293T cells were seeded into 24-well plates at a constant aliquot to achieve approximately 80% cell confluence after 24 hours. Using Lipofectamine 2000, 293T cells were co-transfected with pCMV-EGFPleft-Exon13mut-EGFPright and a tandem U7 snRNA plasmid expressing the dual recognition domain (vector mass ratio: 100 ng:400 ng). 293T cells transfected with the reporter plasmid alone (Report, reporter group) and co-transfected with the reporter plasmid and pUC57-U7 scramble (SC group) served as two negative controls. 293T cells untransfected with any plasmid served as a blank control. After transfection, cells were cultured for 48–72 hours, digested with trypsin, and the GFP-positive rate of the different snRNA groups was detected using a flow cytometer. Table 13 below and Figure 26 show the splicing skip induction effect of USH2A pre-mRNA exon 13 by different target site tandem U7 snRNAs. In this example, we found that the application of tandem U7-snRNAs targeting different target sites improved the efficiency of inducing splicing skipping of USH2A exon 13 in reporter gene-expressing cells. In this example, there was no significant difference in the efficiency of inducing exon 13 splicing skipping between U7 snRNA#24-#9 and U7 snRNA#9-#24, nor in the efficiency of inducing exon 13 splicing skipping between U7 snRNA#25-#9 and U7 snRNA#9-#25. This is because it is sufficient for the two or more recognition domains in the recognition domain tandem U7 snRNA to be reverse-complementary to each of their target sites in USH2A pre-mRNA. The sequence of the recognition domains from the 5' to 3' end of the U7 snRNA does not necessarily have to be aligned 3' to 5' based on the location of the target site in USH2A pre-mRNA corresponding to the recognition domain.

[0248] [Table 14]

[0249] Example 9: Induction of splicing skip of USH2A exon 13 in WERI cells by chemically synthesized U7 snRNA 6 x 10 human host cells in a 24-well plate 5The cells selected in this example were the WERI-Rb-1 cell line. Using Lipofectamine 2000, 50 pmol of in vitro synthesized snRNA combination 1 (U7-snRNA#30 and U7-snRNA#4) and combination 2 (U7-snRNA#26 and U7-snRNA#15) were transfected into WERI cells, respectively, and the same dose (50 pmol) of antisense oligonucleotide AON1 (5'-MA*MG*MC*MU*MU*MC*MG*MG*MA*MG*MA*MA*MA*MA*MU*MU*MU*MA*MA*MA*MU*MC*-3', where "M" is 2'- USH2A mRNA was analyzed using 5′-MU*MG*MA*MU*MC*MA*MC*MA*MC*MU*MA*MA*MG*MC*MC*MU*MA*MA*MA*-3′ (where “M” indicates 2′-O-methoxy modification and “*” indicates phosphorothioate; SEQ ID NO: 77) and AON2 (5′-MU*MG*MA*MU*MC*MA*MC*MA*MC*MU*MA*MA*MG*MC*MC*MC*MU*MA*MA*MA*-3′, where “M” indicates 2′-O-methoxy modification and “*” indicates phosphorothioate; SEQ ID NO: 78) as controls. 1 μg of EGFP plasmid was transfected as a negative control, and WERI cells without plasmid transfection served as a blank control. After continuous culture of the transfected cells for 72 hours, RNA was extracted from the cells in each experimental group and reverse-transcribed to obtain cDNA. RT-PCR experiments were performed using primers AGCCTTTTCCGCCAAGGTGATC (SEQ ID NO: 30) and CACAACGTTGCCCAGCAATGG (SEQ ID NO: 31) to detect the presence of exon skipping in the mature USH2A mRNA. The electrophoresis results are shown in Figure 27. Furthermore, the rt-PCR bands were quantitatively analyzed using ImageJ software, and the proportion of splicing-skipped exon 13 or splicing-skipped exons 12 and 13 in mature USH2A mRNA was statistically analyzed, as shown in Figure 28 .

[0250] In WERI cells endogenously expressing Usherin, the induction of exon 13 splicing skipping in USH2A pre-mRNA by different target U7 snRNA combinations was compared with the preferred AON technology of the prior art. RT-PCR test data and analysis results showed that snRNA combination 1 and snRNA combination 2 were significantly more effective at inducing exon 13 single splicing skipping than the best prior art AON1 and AON2. Moreover, the proportion of exon 12 and 13 double-splicing skipped mRNAs among all splicing-jumped mRNAs induced by snRNA combination 1 and snRNA combination 2 was lower than that of AON1 and AON2. Therefore, U7 snRNA significantly improved the efficiency of exon 13 single-splicing skipping while ensuring low double-splicing skipping of USH2A mRNA by-products.

[0251] Furthermore, snRNA combination 2 targets a site close to the AON, which has an extremely high probability of double splicing skipping of exons 12 and 13 in conventional technology, whereas the probability of double exon splicing skipping occurring in snRNA combination 2 was very low.

[0252] Example 10: Splicing skipping effect of U7 snRNA with a mechanism that can recruit splicing regulatory proteins Construction of U7 snRNA with hnRNP A1 binding sites. The corresponding oligos were synthesized according to the pretranscriptional DNA sequences shown in the table. The sense strand of the oligo was the reverse complement of the target sequence (recognizing the DNA sequence corresponding to the domain sequence) and had CCGCAATATGATAGGGACTTAGGGTG (SEQ ID NO: 67) added to the 5' end. The antisense strand had AATT added to the 5' end of the target sequence and CACCCTAAGTCCCTATCATATT (SEQ ID NO: 68) added to the 3' end.

[0253] TIFF2025534169000030.tif41168

[0254] The synthesized sense and antisense oligo DNA strands were mixed in an annealing reaction system (total reaction volume 20 μl: 2 μl of Oligo-F (100 μM) + 2 μl of Oligo-R (100 μM) + 2 μl of 10x NEB Cutter Smart Buffer + 16 μl of deionized water) and incubated at 95°C for 5 minutes. After cooling on ice, the mixture was annealed to form double-stranded DNA with sticky ends. After 100-fold dilution, 1 μl of the mixture was aliquoted and digested with 10 ng of BsaI enzyme to recover the linearized pUC57-U7 snRNA backbone plasmid, which was then ligated. Further transformation of E. coli recipient cells, single cloning, PCR, and sequencing identified the U7 snRNA vector for inducing splicing skipping in exon 13 of USH2A, which contains the hnRNP A1 motif. The vector was designated pUC57-U7-hnRNP A1-snRNA#A. The plasmid was purified and stored at −20° C. for backup purposes. Figure 29A is a schematic diagram of the vector for hnRNP A1-tagged snRNA. U7-hnRNP A1-snRNA can also be chemically synthesized and modified according to the methods described in the Examples of this application. Taking snRNA#15 and snRNA#25 as examples, the sequences and modifications of the chemically synthesized U7-hnRNP A1-snRNA are as follows (* indicates a phosphorothioate backbone, m indicates a 2'-methoxy modification, underline indicates a recognition domain paired with the target sequence in a reverse-complementary manner, italics indicate the smOPT sequence, and bold indicates the hnRNP A1 protein-binding motif):

[0255] U7-hnRNP A1-snRNA#15:

[0256] TIFF2025534169000031.tif24168

[0257] U7-hnRNP A1-snRNA#25:

[0258] TIFF2025534169000032.tif24168

[0259] U7 snRNA linked to the hnRNP A1 binding motif induced USH2A exon 13 splicing skipping in reporter gene-expressing cells. 293T cells were seeded in 24-well plates at a constant aliquot to achieve approximately 80% cell confluence after 24 hours. 293T cells were co-transfected with pCMV-EGFPleft-Exon13mut-EGFPright and pUC57-U7-hnRNP A1-snRNA#15 plasmid, pUC57-U7-hnRNP A1-snRNA#25 plasmid, pUC57-U7 snRNA#15 plasmid, pUC57-U7 snRNA#25 plasmid, and pUC57-U7 snRNA#25-#15 plasmid using Lipofectamine 2000 (vector mass ratio: 100 ng:400 ng). 293T cells transfected with the reporter plasmid alone (reporter group) and co-transfected with the reporter plasmid and pUC57-U7 scrambled (SC group) served as two negative controls. 293T cells without any plasmid transfection served as blank control. After transfection, the cells were cultured for 48-72 hours, digested into single cells using trypsin, and then analyzed using a flow cytometer to detect the splicing skipping efficiency induced by different snRNAs. Table 15 and Figure 29B show the splicing skipping efficiency of U7-hnRNP A1-snRNA USH2A pre-mRNA exon 13.

[0260] Our data show that introducing an hnRNP A1-binding motif into the 5' end of U7 snRNA significantly improved the induction of USH2A pre-mRNA exon 13 splicing skipping, not only increasing the proportion of cells with exon 13 splicing skipping (GFP+) but also increasing the level of spliced ​​exons (mean FITC intensity) in each cell. The effect of tandem snRNAs on inducing exon 13 splicing skipping, particularly the mean FITC intensity, was significantly greater than that of introducing an hnRNP A1-binding motif into the 5' end of U7 snRNA, suggesting that USH2A pre-mRNA exon 13 splicing skipping may be more sensitive to tandem snRNAs.

[0261] [Table 15]

[0262] In this example, a free tail is introduced into the 5' end of U7 snRNA, and the free tail sequence contains the hnRNP A1 protein binding motif "UAGGGU" or "UAGGGA." The free tail sequence may contain one, two, or more hnRNP A1 protein binding motifs, preferably two. The free tail sequence is preferably "UAUGAUAGGGACUUAGGUG" (SEQ ID NO: 35), which can recruit hnRNP A1 protein and promote splicing skipping of USH2A exon 13. This structure is not suitable for recognition domain tandem snRNAs.

[0263] In some embodiments, the free tail introduced at the 5' end of the U7 snRNA can recruit motifs of splicing regulatory proteins, such as (Heterogeneous Nuclear Ribonucleoprotein A1), SRSF1 (Serine and Arginine Rich Splicing Factor 1), RBM4 (RNA Binding Motif Protein 4), DAZAP1 (DAZ Associated Protein 1), and SR (Serine and Arginine-Rich Protein).

[0264] Example 11: Construction and viral packaging of an AAV-U7 snRNA-associated plasmid vector targeting induction of splicing skipping of USH2A pre-mRNA exon 13 In this example, the pAAV-U7 snRNA vector, an AAV packaging plasmid, was constructed by inserting a U7 snRNA gene targeting the induction of splicing skipping of USH2A pre-mRNA exon 13 into the pAAV-CMV vector, replacing the intermediate gene sequence between the two ITR domains. The serotype pRC plasmid (containing the AAV2 Rep gene and the serotype-specific Cap gene) and pHelper plasmid (a vector plasmid containing the adenovirus E2A, E4, and VA genes) were co-transfected into host cells, and the AAV-U7 snRNA virus targeting splicing skipping of USH2A pre-mRNA exon 13 was packaged. The specific procedure is as follows.

[0265] First, a gene sequence-U7-snRNA gene expression cassette backbone (excluding the recognition domain) was synthesized by total gene synthesis, followed by a 5'-mouse U7 promoter-smOPT sequence-U7 snRNA scaffold-snRNA gene-specific 3' box-3' sequence. Two type II restriction enzyme recognition sites (e.g., BsaI, AarI, BsmBI, etc.) were added between the U7 promoter and smOPT to facilitate subsequent excision, replacement, or insertion of other recognition domain sequences. The synthetic sequence was inserted into the pAAV-CMV plasmid (AAVpro® Helper Free System (AAV5) Kit, Takara Bio, Code No. 6650) to replace the gene sequence between the two AAV2-ITR domains, yielding the pAAV-U7 snRNA backbone vector.

[0266] According to the methods described in the above Examples, the sense and antisense strands of corresponding oligo DNAs were synthesized based on the pretranscriptional DNA sequence corresponding to the snRNA recognition domain sequence or tandem recognition domain sequence of the present application, and sticky ends similar to those cleaved with type II restriction enzyme recognition sites were added to both ends. Double-stranded DNAs containing the recognition domains (single / tandem) with sticky ends were annealed to form them, and then ligated with T4 ligase to a linear pAAV-U7 snRNA backbone plasmid recovered by digestion with the corresponding type II restriction enzyme recognition site to form pAAV-U7 snRNA plasmids that target a specific site in USH2A pre-mRNA exon 13 to induce splicing skipping. These plasmids were named according to the snRNA number corresponding to the recognition domain sequence, such as pAAV-U7 snRNA#25.

[0267] The target gene (a U7-snRNA gene expression cassette targeting USH2A pre-mRNA exon 13 to induce splicing skipping) was inserted into the AAV2-ITR domain of the pAAV-CMV plasmid to replace the gene sequence, and the pAAV-U7 snRNA plasmid vector was obtained. The AAV-U7 snRNA virus targeting USH2A pre-mRNA exon 13 to induce splicing skipping was packaged according to the AAVpro® Helper Free System (AAV5) kit instructions and the standard cell manipulation procedure.

[0268] 24 hours before transfection, HEK293 / 293T cells were seeded into 100 mm cell culture dishes and transfected when they reached 80%-90% confluence in DMEM medium containing 10% FBS. Three hours before transfection, the old medium was discarded and replaced with fresh medium. During transfection, the pAAV-U7 snRNA plasmid, pRC plasmid, pHelper plasmid, and PEI (polyethyleneimine) transfection reagent were simultaneously arranged in the following order and added dropwise to the culture dish. After adding the PEI transfection mixture, the culture dish was gently shaken to ensure uniform distribution of the transfection reagent, and the culture was incubated at 37°C in a 5% CO2 incubator.

[0269] PEI transfection system: 6 μL of pAAV plasmid (1 μg / μL), pRC1 / 2 / 5 / 6 plasmid (1 μg / μL), 6 μL of pRC plasmid (serotype determined by capsid gene), 6 μL of pHelper plasmid (1 μg / μL), 500 μL of serum-free DMEM medium, and 110 μL of PEI (1 mg / mL). Mix by vortexing several times and incubate at room temperature for 5 minutes.

[0270] Twenty-four hours after transfection, the medium was replaced with fresh DMEM containing 2% FBS. 48–72 hours after transfection, AAV virus-containing cells were harvested, washed, centrifuged, and the cell pellet was collected and vortexed and shaken to loosen the cell pellet. Then, 0.5 mL of AAV extract A was added to the cell pellet according to the AAVpro® Helper-Free System (AAV5) instructions, and the cells were vortexed and shaken for 15 seconds to completely suspend the cells. The mixture was left at room temperature for 5 minutes, then vortexed and shaken for an additional 15 seconds. The mixture was centrifuged at 2,000–14,000 g for 10 minutes at 4°C to remove cell debris. The supernatant was collected in a new sterile centrifuge tube, and 50 μL of AAV extract B was added. The mixture was mixed well by pipetting with a pipette gun to obtain AAV-U7 snRNA virus solutions with different recognition domains. A portion of the solution was collected for viral titer detection by qPCR and stored at 80°C for backup.

[0271] The target gene fragment inserted between the AAV2-ITR structural domains of the pAAV-U7 snRNA plasmid should be 2.5 kb or less. Inserting multiple U7-snRNA gene expression cassettes (5'-mouse U7 promoter-smOPT sequence, U7 snRNA scaffold-snRNA gene-specific 3' cassette-3') increases the amount of U7 snRNA expression per AAV virus particle. The gene sequence length is approximately 450 bp. Preferably, a pAAV-U7 snRNA plasmid carries one to five U7-snRNA gene expression cassettes. The multiple U7-snRNA gene expression cassettes in the pAAV-U7 snRNA plasmid may have the same recognition structural domain or combination of recognition structural domains, or different recognition structural domains or combinations of non-identical recognition structural domains.

[0272] This application describes the induction of splicing skip of USH2A pre-mRNA exon 13 by delivery of U7 snRNA by AAV. The coat proteins of the AAVs can be naturally derived, based on mutants of naturally derived capsid proteins, or subjected to directed evolution or rational amino acid / peptide modifications (e.g., codon optimization, chimeric functional peptides of different serotypes), which can improve tissue / organ affinity, immunogenicity, and transfection efficiency, such as AAV2.5, AAV2i8, AAV-TT, AAV9.HR, and CAM130.

[0273] Example 12: Tandem U7 snRNA induces splicing skipping more efficiently than combined U7 - in vitro dose-dependent progression Based on Example 11, AAV2 serotype AAV2-3×U7 snRNA#9-#25 (3×U7 snRNA tandem), AAV2-2×U7 snRNA#9-2×U7 snRNA#25 (4×U7 snRNA separate), and AAV2-2×U7-hnRNP A1-snRNA#9-2×U7-hnRNP A1-snRNA#25 (4×U7 snRNA separate-motif) vectors were transfected into HEK293 / 293T cells, and the packaged viruses were collected and purified to obtain the AAV2 viruses 3×U7 snRNA tandem, 4×U7 snRNA separate, and 4×U7 snRNA separate-motif, respectively.

[0274] For virus titer detection, the MOI was 3 x 10 5 , 1×10 5 , 3×10 4 , 1×10 4 , 3×10 3 , 1×10 3 , 3×10 2 (MOI = virus titer (TU / mL) × virus volume (mL) / number of cells) and inoculate WERI-Rb cells (6 × 10) in a 24-well plate. 5A volume of virus solution corresponding to the number of infected cells (per well) was added, and the infected cells were cultured for 72 hours. Then, RNA was extracted from the cells in each experimental group, and cDNA was obtained by reverse transcription. RT-PCR and qRT-PCR experiments were performed using the corresponding primers / probes in Table 16 to detect the efficiency of AAV-U7 snRNA-induced splicing skipping of USH2A pre-mRNA exon 13.

[0275] [Table 16]

[0276] As shown in Figure 30, when comparing the 3xU7 tandem and 4xU7 separate introduced by AAV2 virus, the RT-PCR results showed that the efficiency of 4xU7 separate was low, but when the hnRNP A1 binding motif was added, the efficiency was improved and comparable to that of the 3xU7 tandem. The qRT-PCR test results were consistent with the RT-PCR results.

[0277] The maximum target gene capacity of the ssAAV vector was 4.7 kb, while the maximum target gene capacity of the ScAAV vector was 2.5 kb. The size of the U7 snRNA expression cassette was approximately 450 bp. A single ScAAV vector could accommodate up to nine U7 snRNA expression cassettes, while a single ScAAV vector could accommodate up to five U7 snRNA expression cassettes. The results of Example 14 showed that the in vitro effect of the 3xU7 snRNA tandem was similar to that of the 2xU7 snRNA-hnRNP A1 combination in inducing splicing skipping, but was superior to the 2xU7 snRNA combination. The results of Examples 15 and 16 showed that the in vivo induction of splicing skipping by the 1xU7 snRNA tandem was slightly superior to that of the 2xU7 snRNA combination, but the long-lasting induction of splicing skipping by the 1xU7 snRNA tandem was more pronounced. Without the introduction of the hnRNP A1 binding motif, the effect of tandem U7 snRNAs was superior to that of the combination of U7 snRNAs.

[0278] Example 13: AAV-U7 snRNA induces splicing skipping significantly better than AON - in vitro dose-dependent progression As described in Example 11, AAV2 serotype AAV2-U7 snRNA #9 to #25 (1xU7 snRNA tandem) vectors were constructed and transfected into HEK293 / 293T cells to package the virus, which was then recovered, purified, and other procedures to obtain the AAV2 virus 1xU7 snRNA tandem, i.e., AAV2-RM-101, which was then prepared for subsequent viral titer detection.

[0279] WERI-Rb-1 cells were plated in a 24-well plate at 6 × 10 5 The AAV2-RM-101 virus was seeded at an MOI of 3 × 10 / well. 5 , 1×10 5 , 3×10 4 , 1×10 4 , 3×10 3 , 1×10 3 , 3×10 2 The experimental groups were treated with WERI-Rb-1 cells at different MOIs. 50 nM and 200 nM PROQR EX13-3 (AON1 in Example 9) were used as positive controls, and AAV2-U7-SCR (scrambled) and AAV2-U7-LUC (luciferase-recognizing) at MOIs of 3 x 10 were used as negative controls. After 72 hours of culture, WERI-Rb-1 cells were extracted from each experimental group, and cDNA was obtained by reverse transcription. RT-PCR and qRT-PCR experiments were performed using the corresponding primers / probes in Table 16 to detect the splicing skipping efficiency of USH2A pre-mRNA exon 13. As shown in Figure 31, the splicing skipping efficiency induced by AAV2-U7 snRNAs #9 to #25 was significantly higher than that of AON1.

[0280] Example 14: Induction of USH2A pre-mRNA exon 13 splicing skip in humanized mouse retinal cells by snRNA Using gene editing technology, exon 12 of the USH2A gene from C57 / BL6J mice plus partial flanking sequences [approximately 1670 bp upstream of exon 12 (the 3' end of mouse intron 11) to approximately 1600 bp downstream of exon 12 (the 5' end of mouse intron 12)] was replaced with exon 13 of the human USH2A gene plus partial flanking sequences [approximately 1611 bp upstream of exon 13 (the 3' end of human intron 12) to approximately 1599 bp downstream of exon 13 (the 5' end of human intron 13)] plus an insertion sequence. This introduced a c.2208T to G mutation into human USH2A exon 13, resulting in humanized mice with a c.2802T>G mutation in USH2A exon 13 (USH2A EXON13 c.2802T>G ).

[0281] AAV2-U7snRNA#9-#25 (AAV5-1×U7) and AAV5-2×U7snRNA#9-2×U7snRNA#25 (AAV5-4×U7 separate) viruses were injected into the subretinal space in a total volume of 1 μL (1E+10 vg / eye) to target the hUSH2A EXON13 c.2802T>GThe mice were injected into the eyes of gene knock-in humanized mice. Mice were injected with AAV5-U7-scramble virus as a negative control, and PROQR-AON (AON1 in Example 9) was injected into the vitreous at a dose of 15 μg / eye (1 μL) as a positive control. Untreated mice served as a blank group (nontreated). Three weeks after injection, the experimental mice were sacrificed, and their retinal tissues were harvested. RNA was extracted and reverse-transcribed into cDNA. RT-PCR and qRT-PCR experiments were performed using the corresponding primers / probes in Table 16 to detect the splicing jump efficiency of USH2A pre-mRNA exon 13. As shown in Figure 32, the results showed that the 1xU7 snRNA tandem was superior to the 2xU7 snRNA combination in inducing splicing skipping in the retina of the eye, and both were superior to the PROQR AON (AON1 in Example 9). (The results of the untreated group showed that there was some spontaneous skipping in human USH2 A exon 13 containing a mutation, which was consistent with previous research findings.)

[0282] Example 15: Induction of splicing skip of USH2A pre-mRNA exon 12 in rabbit ocular cells by injection of different serotypes of AAV-U7 snRNA AAV5-U7 snRNA#9-#25 (AAV5-1xU7) was injected into the subretinal space at 5 × 10 10 and 2 × 10 11 and AAV8-U7 snRNA#9 to #25 (AAV8-1xU7) at an MOI of 5 x 10 10The virus was injected into the rabbit's eyes at an MOI of 100 mg / mL. AAV5-CMV-GFP was injected into the subretinal space of the rabbit as a negative control, and 50 μg (50 μL) of AON (AON1 in Example 9) was injected into the vitreous as a positive control. Two weeks after injection, the experimental rabbits were euthanized, and their retinal tissues were collected. RNA was extracted and reverse-transcribed into cDNA. RT-PCR and qRT-PCR experiments were performed using the corresponding primers / probes in Table 16 to detect the efficiency of USH2A pre-mRNA exon 13 splicing skipping.

[0283] As shown in Figure 33, the results indicated that splicing skipping induced by U7 snRNA delivered by AAV5 was superior to that by AAV8, and the tandem effect of U7 snRNA delivered by different AAV serotypes was also superior to that of AON.

[0284] The rabbit USH2A gene is wild-type rabbit USH2A without a mutation in exon 12 (corresponding to human USH2A exon 13). Relatively speaking, splice skipping of human exon 13 containing the mutation in hUSH2A exon 13c.2802T>G gene knock-in humanized mice is easily induced, and the efficacy of AAV-U7 snRNA and AON in inducing splicing skipping of the targeted exon in rabbits was significantly lower than that in humanized mice, suggesting that the efficacy of AONs is sensitive to exon sequence and mutations.

[0285] Example 16: Long-term effect of AAV-delivered U7 snRNA inducing splicing skip of USH2A pre-mRNA exon 13 AAV5-3×U7 snRNA#9-#25 (AAV5-3×U7), AAV5-U7 snRNA#9-#25 (AAV5-1×U7), and AAV5-2×U7 snRNA#9-2×U7 snRNA#25 (AAV5-4×U7 separate) viruses were injected into the subretinal space at 1E+10vg (1μl) of the hUSH2A exon 13 region. c.2802T>GThe mice were injected into the eyes of gene knock-in humanized mice. Mice injected with AAV5-U7 scramble virus served as the negative control group, while 15 μg (1 μL) of PROQR-ASO (AON1 in Example 9) was injected into the vitreous as the positive control group. Untreated mice served as the blank group (NTC). Twenty-two weeks after injection, the experimental mice were euthanized, and retinal tissue was harvested. RNA was extracted and reverse-transcribed into cDNA. RT-PCR was performed using the corresponding primers in Table 7 to detect the efficiency of splicing skipping in USH2A pre-mRNA exon 13. Results (Figures 34-35) showed that after 22 weeks, the U7 snRNA tandem delivered by AAV still had optimal splicing skipping and long-term maintenance effects. To further compare the long-term maintenance status between the U7 snRNA tandem and the U7 snRNA combination, this example also performed qRT-PCR experiments using the corresponding probes in Table 16 to detect and compare differences in the long-term maintenance of splicing skipping efficiency of USH2A pre-mRNA exon 13 in the retina between AAV5-1×U7 and AAV5-4×U7 separates. Results (see Figure 34) showed that after 22 weeks, the AAV-1×U7 snRNA tandem configuration still had optimal splicing skipping efficiency and was improved compared to the 3-week effect, suggesting the existence of a cumulative therapeutic effect. The persistence of the AAV-1×U7 snRNA tandem was significantly superior to that of the AAV4×U7 separate.

Claims

1. a recognition domain, a stem-loop sequence, and an Sm sequence, wherein the number of the recognition domains is at least two; wherein each recognition domain is reverse-complementary to a target sequence fragment from the 5' end to the 3' end of the pre-mRNA, from the 3' end to the 5' end; The snRNA nucleic acid molecule, wherein the pre-mRNA is a pre-mRNA corresponding to the USH2A gene.

2. The snRNA nucleic acid molecule of claim 1, wherein each of the recognition domains is reverse-complementary to a target sequence fragment from the 5' end to the 3' end of the pre-mRNA in sequence from the 3' end to the 5' end.

3. The snRNA nucleic acid molecule of claim 1, wherein each of the recognition domains is non-sequentially reverse-complementary to a target sequence fragment from the 5' end to the 3' end of the pre-mRNA from the 3' end to the 5' end.

4. The snRNA nucleic acid molecule according to any one of claims 1 to 3, wherein the recognition domain is at least 16 bp in length.

5. The snRNA nucleic acid molecule according to any one of claims 1 to 4, wherein the length of the recognition domain is 18 to 40 bp.

6. The snRNA nucleic acid molecule according to any one of claims 1 to 5, wherein the length of the recognition domain is 20 to 27 bp.

7. The snRNA nucleic acid molecule according to any one of claims 1 to 6, characterized in that the number of recognition domains is two.

8. The snRNA nucleic acid molecule of claim 7, wherein the snRNA nucleic acid molecule comprises, in order from the 5' end to the 3' end, two adjacent recognition domains, an Sm sequence, and a stem-loop sequence.

9. The snRNA nucleic acid molecule according to any one of claims 1 to 8, wherein the pre-mRNA is all or a part of the pre-mRNA corresponding to the 12th intron to the 13th intron of the USH2A gene.

10. The snRNA nucleic acid molecule according to claim 9, wherein the pre-mRNA is all or a part of the pre-mRNA corresponding to the 13th exon of the USH2A gene.

11. The snRNA nucleic acid molecule of claim 9, wherein the genome of the pre-mRNA is located at Chr1:216246563-216247246, and the target sequence fragment is selected from the nucleotide sequence shown in SEQ ID NO: 1 and its mutant sequence.

12. The snRNA nucleic acid molecule of claim 11, wherein the genome of the pre-mRNA is located at Chr1:216246563-216246753, and the target sequence fragment is selected from the nucleotide sequence shown in SEQ ID NO: 3 and its mutant sequence.

13. The snRNA nucleic acid molecule of claim 12, wherein the genome of the pre-mRNA is located at Chr1:216246563-216246649, and the target sequence fragment is selected from the nucleotide sequence shown in SEQ ID NO: 4 and its mutant sequence.

14. The genome of the pre-mRNA is located at Chr1:216246563-216246626, and the target sequence fragment is selected from the nucleotide sequence set forth in SEQ ID NO:9 and mutant sequences thereof; or The snRNA nucleic acid molecule of claim 13, wherein the genome of the pre-mRNA is located at Chr1: 216246616-216246649, and the target sequence fragment is selected from the nucleotide sequence shown in SEQ ID NO: 34 and its mutant sequences.

15. The snRNA nucleic acid molecule of claim 11, wherein the genome of the pre-mRNA is located at Chr1:216247130-216247246, and the target sequence fragment is selected from the nucleotide sequence shown in SEQ ID NO: 2 and its mutant sequence.

16. The genome of the pre-mRNA is located at Chr1:216247142-216247185, and the target sequence fragment is selected from the nucleotide sequence set forth in SEQ ID NO: 32 and mutant sequences thereof; or The genome of the pre-mRNA is located at Chr1:216247130-216247161, and the target sequence fragment is selected from the nucleotide sequence set forth in SEQ ID NO: 33 and mutant sequences thereof; or The genome of the pre-mRNA is located at Chr1:216247210-216247246, and the target sequence fragment is selected from the nucleotide sequence set forth in SEQ ID NO: 36 and mutant sequences thereof; or The genome of the pre-mRNA is located at Chr1:216247204-216247232, and the target sequence fragment is selected from the nucleotide sequence set forth in SEQ ID NO: 37 and mutant sequences thereof; or The genome of the pre-mRNA is located at Chr1:216247187-216247220, and the target sequence fragment is selected from the nucleotide sequence set forth in SEQ ID NO: 38 and mutant sequences thereof; or The snRNA nucleic acid molecule of claim 15, wherein the genome of the pre-mRNA is located at Chr1: 216247169-216247202, and the target sequence fragment is selected from the nucleotide sequence set forth in SEQ ID NO: 39 and mutant sequences thereof.

17. The snRNA nucleic acid molecule according to any one of claims 1 to 16, characterized in that the number of the recognition domains is two, and the two recognition domains are distributed adjacently.

18. the two recognition domains are, from the 5' end to the 3' end, a first recognition domain and a second recognition domain, respectively; 18. The snRNA nucleic acid molecule of claim 17, wherein the target sequence fragment reverse-complementary to the first or second recognition domain is selected from the nucleotide sequence set forth in SEQ ID NO: 34 and mutant sequences thereof and the nucleotide sequence set forth in SEQ ID NO: 9 and mutant sequences thereof; and correspondingly, the target sequence fragment reverse-complementary to the second or first recognition domain is selected from the nucleotide sequence set forth in SEQ ID NO: 32 and mutant sequences thereof, the nucleotide sequence set forth in SEQ ID NO: 33 and mutant sequences thereof, the nucleotide sequence set forth in SEQ ID NO: 36 and mutant sequences thereof, the nucleotide sequence set forth in SEQ ID NO: 37 and mutant sequences thereof, the nucleotide sequence set forth in SEQ ID NO: 38 and mutant sequences thereof, and the nucleotide sequence set forth in SEQ ID NO: 39 and mutant sequences thereof.

19. 19. The snRNA nucleic acid molecule of claim 18, wherein the target sequence fragment reverse-complementary to the first recognition domain is selected from the nucleotide sequence set forth in SEQ ID NO: 34 and mutant sequences thereof and the nucleotide sequence set forth in SEQ ID NO: 9 and mutant sequences thereof, and the target sequence fragment reverse-complementary to the second recognition domain is selected from the nucleotide sequence set forth in SEQ ID NO: 32 and mutant sequences thereof, the nucleotide sequence set forth in SEQ ID NO: 33 and mutant sequences thereof, the nucleotide sequence set forth in SEQ ID NO: 36 and mutant sequences thereof, the nucleotide sequence set forth in SEQ ID NO: 37 and mutant sequences thereof, the nucleotide sequence set forth in SEQ ID NO: 38 and mutant sequences thereof and the nucleotide sequence set forth in SEQ ID NO: 39 and mutant sequences thereof.

20. The nucleotide sequence of the first recognition domain is set forth in any one of SEQ ID NOs: 12-22, 59-61, and the nucleotide sequence of the second recognition domain is set forth in any one of SEQ ID NOs: 40-58. The snRNA nucleic acid molecule of claim 19.

21. The snRNA nucleic acid molecule of claim 20, wherein the nucleotide sequence of the first recognition domain is set forth in SEQ ID NO: 12, 13, 15 or 17, and the nucleotide sequence of the second recognition domain is set forth in SEQ ID NO: 48, 54, 56 or 58.

22. The snRNA nucleic acid molecule of claim 21, wherein the nucleotide sequence of the first recognition domain is set forth in SEQ ID NO: 12, 13 or 17, and the nucleotide sequence of the second recognition domain is set forth in SEQ ID NO: 48, 54 or 58.

23. the nucleotide sequence of the first recognition domain is set forth in SEQ ID NO: 12 and the nucleotide sequence of the second recognition domain is set forth in SEQ ID NO: 48; or the nucleotide sequence of the first recognition domain is set forth in SEQ ID NO: 12 and the nucleotide sequence of the second recognition domain is set forth in SEQ ID NO: 54; or the nucleotide sequence of the first recognition domain is set forth in SEQ ID NO: 12 and the nucleotide sequence of the second recognition domain is set forth in SEQ ID NO: 58; or the nucleotide sequence of the first recognition domain is set forth in SEQ ID NO: 13 and the nucleotide sequence of the second recognition domain is set forth in SEQ ID NO: 48; or the nucleotide sequence of the first recognition domain is set forth in SEQ ID NO: 13 and the nucleotide sequence of the second recognition domain is set forth in SEQ ID NO: 54; or the nucleotide sequence of the first recognition domain is set forth in SEQ ID NO: 13 and the nucleotide sequence of the second recognition domain is set forth in SEQ ID NO: 58; or the nucleotide sequence of the first recognition domain is set forth in SEQ ID NO: 17 and the nucleotide sequence of the second recognition domain is set forth in SEQ ID NO: 48; or the nucleotide sequence of the first recognition domain is set forth in SEQ ID NO: 17 and the nucleotide sequence of the second recognition domain is set forth in SEQ ID NO: 54; or the nucleotide sequence of the first recognition domain is set forth in SEQ ID NO: 17 and the nucleotide sequence of the second recognition domain is set forth in SEQ ID NO: 58; or the nucleotide sequence of the first recognition domain is set forth in SEQ ID NO: 16 and the nucleotide sequence of the second recognition domain is set forth in SEQ ID NO: 42; or the nucleotide sequence of the first recognition domain is set forth in SEQ ID NO: 18 and the nucleotide sequence of the second recognition domain is set forth in SEQ ID NO: 43; or The snRNA nucleic acid molecule of claim 20, wherein the nucleotide sequence of the first recognition domain is set forth in SEQ ID NO: 14 and the nucleotide sequence of the second recognition domain is set forth in SEQ ID NO:

55.

24. The snRNA nucleic acid molecule according to any one of claims 11 to 23, characterized in that the mutant sequence has one or more nucleotide substitutions, additions or deletions on the nucleotide sequence.

25. The snRNA nucleic acid molecule of claim 24, wherein the mutant sequence is a sequence in which there is a substitution of one or more nucleotides on the nucleotide sequence.

26. The mutations are selected from naturally occurring pathogenic mutations and naturally occurring non-pathogenic mutations, and the naturally occurring pathogenic mutations are selected from the group consisting of c.2242C>T, c.2276G>T, c.2299delG, c.2522C>A, c.2541C>A, c.2761delC, c.2776C>T, c.2802T>G, c.2209C>T, c.2310delA, c.2391_2392deITG, c.2431A>T, c.2431_2432delAA, c.2440C>T, c.2525dup, c.2610C>A, c.2755C>T, c.2176T>C ...802T>G, c.2802T>G, c.2802T>G, c.2802T>G, c.2802T>T, c.2802T>G, c.2802T>T, c.2802T>G, c.2802T>T, c.2802T>G, c.2802T>T, c.2802T>G, c.2802T>T, c.2802T>G, c.2802T>T, c.2802T>G, c.

25. The snRNA nucleic acid molecule of claim 24, wherein the amino acid sequence is selected from one or more of: c. 2236C>G, c. 2296T>C, and c. 2332G>T.

27. 27. The snRNA nucleic acid molecule of claim 26, wherein the naturally occurring pathogenic mutation is selected from one or more of: c.2802T>G, c.2299delG, and c.2276G>T.

28. 28. The snRNA nucleic acid molecule of claim 27, wherein the naturally occurring pathogenic mutation is c.2802T>G.

29. The snRNA nucleic acid molecule of any one of claims 1 to 28, wherein the Sm sequence is a consensus sequence and the stem-loop sequence comprises a stem-loop sequence of U1, U2, U3, U4, U5, U6 or U7.

30. The snRNA nucleic acid molecule of claim 29, wherein the stem-loop sequence is a U7 stem-loop sequence.

31. The snRNA nucleic acid molecule of claim 29, wherein the stem-loop sequence is the stem-loop sequence of U1.

32. The snRNA nucleic acid molecule of claim 29, wherein the stem-loop sequence is one to two.

33. The snRNA nucleic acid molecule of claim 29, wherein the Sm sequence is set forth in SEQ ID NO:

6.

34. The snRNA nucleic acid molecule of claim 29, wherein the stem-loop sequence is set forth in SEQ ID NO:

7.

35. The snRNA nucleic acid molecule according to any one of claims 1 to 34, characterized in that the snRNA nucleic acid molecule comprises modified nucleotides or analogues thereof.

36. The snRNA nucleic acid molecule of claim 35, further comprising a unidirectional extension sequence or a bidirectional extension sequence at the 5'-end and / or 3'-end nucleotide of the recognition structure domain.

37. 36. The snRNA nucleic acid molecule of claim 35, wherein the modification is selected from a 2'-O-alkyl modification, a 2'-O-methoxy modification and a 2'-O-methoxyethyl modification, and the 2'-O-alkyl modification is preferably a 2'-O-methyl modification.

38. 38. The snRNA nucleic acid molecule of claim 37, wherein the analog monomer is selected from a 6'-modified bicyclic nucleoside, a 5'-modified bicyclic nucleoside, a 6'-disubstituted bicyclic nucleoside, a tetrahydropyran nucleoside analog, and a 2'-deoxy 2'-fluoro-β-D-arabinose nucleotide.

39. 39. The snRNA nucleic acid molecule according to any one of claims 1 to 38, wherein the nucleotides of the snRNA nucleic acid molecule are linked by chemical bonds, and the chemical bonds are selected from phosphate bonds, methylene bonds, amide bonds, methylphosphonate bonds, and 3'-thiomethylacetal bonds.

40. 40. The snRNA nucleic acid molecule of claim 39, wherein the phosphate linkage is selected from a phosphorothioate linkage, a phosphorodithioate linkage, an alkylphosphate linkage, a phosphoramidate linkage, a boranophosphate linkage, and a chiral linkage phosphorus.

41. 41. The snRNA nucleic acid molecule of claim 40, wherein the phosphate linkage is selected from phosphorothioate linkages.

42. The snRNA nucleic acid molecule according to any one of claims 35 to 41, characterized in that the snRNA nucleic acid molecule comprises a modified nucleotide or its analogue monomer at positions 1 to 80 from the 5'-end and / or 3'-end.

43. The snRNA nucleic acid molecule of claim 42, wherein the snRNA nucleic acid molecule comprises a modified nucleotide or its analog monomer at positions 3 to 40 from the 5'-end and / or 3'-end.

44. The snRNA nucleic acid molecule of claim 43, wherein the snRNA nucleic acid molecule comprises a modified nucleotide or its analog monomer at positions 6 to 10 from the 5'-end and / or 3'-end.

45. The snRNA nucleic acid molecule according to any one of claims 35 to 44, characterized in that the snRNA nucleic acid molecule comprises at least one phosphate bond from the 5'-end or 3'-end.

46. the snRNA nucleic acid molecule comprises one to three phosphate bonds from the 5' end, or The snRNA nucleic acid molecule of claim 45, wherein the snRNA nucleic acid molecule comprises one to three phosphate bonds from the 3' end.

47. A combination of snRNA nucleic acid molecules, characterized in that it comprises one or more snRNA nucleic acid molecules according to any one of claims 1 to 46.

48. 48. The combination of claim 47, wherein at least two recognition domains are located on the same or different snRNA nucleic acid molecules.

49. A DNA molecule, characterized in that it encodes an snRNA nucleic acid molecule according to any one of claims 1 to 46, or a combination according to claim 47 or 48.

50. A gene expression cassette comprising a promoter and the DNA molecule of claim 49.

51. 51. The gene expression cassette of claim 50, further comprising a cleavable site, such as a type II restriction enzyme recognition site, between the promoter and the Sm sequence of the DNA molecule.

52. 52. The gene expression cassette of claim 50 or 51, wherein the promoter is a U7 promoter.

53. 53. The gene expression cassette of claim 52, wherein the promoter is a U7 promoter derived from mouse.

54. The snRNA nucleic acid molecule of any one of claims 50 to 53, wherein the gene expression cassette comprises a recognition domain and a backbone sequence, and the backbone sequence is set forth in SEQ ID NO:

62.

55. A recombinant expression vector comprising an snRNA nucleic acid molecule according to any one of claims 1 to 46, a combination according to claim 47 or 48, or a gene expression cassette according to any one of claims 50 to 54.

56. 56. The recombinant expression vector of claim 55, wherein the expression vector of the recombinant expression vector is selected from a plasmid, a phage, a microcircular DNA, a linear DNA, and a virus.

57. 57. The recombinant expression vector of claim 56, wherein the expression vector is a lentivirus or an adeno-associated virus.

58. 58. The recombinant expression vector of claim 57, wherein the adeno-associated virus capsid protein is a naturally occurring capsid protein or a mutant thereof, and the adeno-associated virus plasmid is single-stranded or double-stranded complementary to the single-stranded plasmid.

59. the naturally occurring capsid protein is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh.8, AAVrh.10, and AAVrh.43; 59. The recombinant expression vector of claim 58, wherein the mutant is selected from AAV2.5, AAV2i8, AAV-TT, AAV9.HR, and CAM130.

60. 50. A viral particle comprising a capsid protein and a nucleic acid, wherein the nucleic acid comprises an snRNA nucleic acid molecule according to any one of claims 1 to 46, a combination according to claim 47 or 48, or a DNA molecule according to claim 49.

61. 61. The viral particle of claim 60, wherein the capsid protein is a capsid protein derived from an adeno-associated virus.

62. 62. The viral particle of claim 61, wherein the capsid protein derived from the adeno-associated virus is a naturally occurring capsid protein or a mutant thereof.

63. 63. The viral particle of claim 62, wherein the naturally occurring capsid protein is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh.8, AAVrh.10, and AAVrh.43, and the mutant is selected from AAV2.5, AAV2i8, AAV-TT, AAV9.HR, and CAM130.

64. 64. A pharmaceutical composition comprising an snRNA nucleic acid molecule according to any one of claims 1 to 46, a combination according to claim 47 or 48, a DNA molecule according to claim 49, a gene expression cassette according to any one of claims 50 to 54, a recombinant expression vector according to any one of claims 55 to 59, or a viral particle according to any one of claims 60 to 63.

65. 65. The pharmaceutical composition of claim 64, further comprising a pharmaceutically acceptable carrier.

66. A method for inducing production of an exon 13-deleted Usherin protein, comprising introducing into a host cell an snRNA nucleic acid molecule according to any one of claims 1 to 46, a combination according to claim 47 or 48, a DNA molecule according to claim 49, a gene expression cassette according to any one of claims 50 to 54, a recombinant expression vector according to any one of claims 55 to 59, a viral particle according to any one of claims 60 to 63, or a pharmaceutical composition according to claim 64 or 65, thereby causing splicing skipping of exon 13.

67. 67. The method of claim 66, wherein the host cells are selected from retinal tissue cells, inner ear cells, potential cells capable of differentiating into retinal tissue cells and / or inner ear cells, and cells capable of performing functions corresponding to retinal tissue cells and / or inner ear cells.

68. 68. The method of claim 67, wherein the retinal tissue cells are retinal photoreceptor cells and the inner ear cells are inner ear hair cells.

69. 68. The method of claim 67, wherein the potential cells are selected from induced pluripotent stem cells, embryonic stem cells, neural progenitor cells, retinal progenitor cells, retinal progenitor cells, and stromal stromal cells.

70. A method for inhibiting the expression and / or function of USH2A pre-mRNA exon 13, comprising administering an snRNA nucleic acid molecule according to any one of claims 1 to 46, a combination according to claim 47 or 48, a DNA molecule according to claim 49, a gene expression cassette according to any one of claims 50 to 54, a recombinant expression vector according to any one of claims 55 to 59, a viral particle according to any one of claims 58 to 61, or a pharmaceutical composition according to claim 64 or 65.

71. A method for inducing splicing skipping of USH2A pre-mRNA exon 13, comprising administering an snRNA nucleic acid molecule according to any one of claims 1 to 46, a combination according to claim 47 or 48, a DNA molecule according to claim 49, a gene expression cassette according to any one of claims 50 to 54, a recombinant expression vector according to any one of claims 55 to 59, a viral particle according to any one of claims 60 to 63, or a pharmaceutical composition according to claim 64 or 65.

72. A method for reducing expression of abnormal Usherin protein, comprising introducing into a host cell an snRNA nucleic acid molecule according to any one of claims 1 to 46, a combination according to claim 47 or 48, a DNA molecule according to claim 49, a gene expression cassette according to any one of claims 50 to 54, a recombinant expression vector according to any one of claims 55 to 59, a viral particle according to any one of claims 60 to 63, or a pharmaceutical composition according to claim 64 or 65.

73. 73. The method of claim 72, wherein the host cells are selected from retinal tissue cells, inner ear cells, cells capable of differentiating into retinal tissue cells and / or inner ear cells, and cells capable of performing functions corresponding to retinal tissue cells and / or inner ear cells.

74. 74. The method of claim 73, wherein the retinal tissue cells are retinal photoreceptor cells and the inner ear cells are inner ear hair cells.

75. 75. The method of claim 74, wherein the potential cells are selected from induced pluripotent stem cells, embryonic stem cells, neural progenitor cells, retinal progenitor cells, retinal progenitor cells, and stromal stromal cells.

76. A method for producing an snRNA nucleic acid molecule according to any one of claims 1 to 46, or a combination according to claim 47 or 48, comprising biosynthesizing or chemically synthesizing an snRNA nucleic acid molecule according to any one of claims 1 to 46, or a combination according to claim 47 or 48.

77. Use of an snRNA nucleic acid molecule according to any one of claims 1 to 46, a combination according to claim 47 or 48, a DNA molecule according to claim 49, a gene expression cassette according to any one of claims 50 to 54, a recombinant expression vector according to any one of claims 55 to 59, a viral particle according to any one of claims 60 to 63, or a pharmaceutical composition according to claim 64 or 65 in the manufacture of a medicament for the treatment of a disease associated with a USH2A exon 13 mutation.

78. 78. The use of claim 77, wherein the mutation in exon 13 of USH2A is a pathogenic mutation or a non-pathogenic mutation.

79. 78. The use according to claim 77, wherein the disease is selected from eye diseases and ear diseases.

Citation Information

Patent Citations

  • Adeno-associated viral vectors for exon skipping in genes encoding unnecessary domain proteins

    JP2008509695A

  • Modified U7snRNA for the treatment of neuromuscular diseases

    JP2013521791A

  • Antisense oligonucleotides for the treatment of ocular diseases

    JP2019528747A

  • CHIMERIC snRNA MOLECULES CARRYING ANTISENSE SEQUENCES AGAINST THE SPLICE JUNCTIONS OF THE DYSTROPHIN GENE AND THEIR THERAPEUTIC APPLICATIONS

    WO2003095647A2

  • Antisense oligonucleotides for the treatment of eye disease

    CN109804069A