Gene Therapy Treatment

Abstract

The present disclosure relates to a transcription cassette comprising a nucleic acid molecule comprising a nucleotide sequence encoding an AP-4 subunit; a vector comprising the transcription cassette; a pharmaceutical composition comprising the vector; and a vector or composition for use in treating AP-4 hereditary spastic paraplegia.

Description

[Technical Field]

[0001] Field of the Disclosure The present disclosure relates to a transcription cassette comprising a nucleic acid molecule comprising a nucleotide sequence encoding at least one subunit of heterotetrameric adaptor protein complex 4 (AP-4); a vector comprising the transcription cassette; a pharmaceutical composition comprising the vector; and a vector or composition for use in treating AP-4 hereditary spastic paraplegia. [Background technology]

[0002] Background of the Disclosure Hereditary spastic paraplegia (HSP) is a group of rare, inherited, progressive lower limb spastic disorders with an overall prevalence of 0.5 to 5.5 individuals per 100,000. Hereditary spastic paraplegia (HSP) in young patients is often characterized by leg weakness and spasms (stiffness), which can lead to further complications later in life and may require the assistance of a cane, walker, or wheelchair. Various genotypes of HSP exist, including autosomal dominant, autosomal recessive, X-linked, and maternally inherited (mitochondrial) forms; the autosomal dominant form is the most commonly found, affecting between 75% and 80% of HSP patients. Various diagnostic methods for identifying mutations in genes responsible for different forms of HSPs, such as autosomal recessive HSPs (AR-HSPs) caused by mutations in the genes KIAA1840 (US10519503) or ZFYVE26 (US2017152562), or autosomal-dominant HSPs caused by mutations in SPG3A, are disclosed in CN1958605.

[0003] AP-4-associated hereditary spastic paraplegia (AP-4-HSP), also known as AP-4 deficiency syndrome or adaptor protein complex 4 (AP-4) deficiency, is caused by loss-of-function mutations in one of four genes encoding protein subunits of the AP-4 adaptor complex

[10] . AP-4-HSP is autosomal recessive in nature. AP-4-HSP, caused by mutations in the AP4B1 gene, also known as spastic paraplegia type 47 (SPG47) or hereditary spastic paraplegia 47 (HSP47), results in a significant decrease in AP4B1 protein levels [2]. AP-4-HSP can also be caused by mutations in three other AP-4 subunits: AP4M1 mutations cause AP-4-HSP, also known as SPG50 or HSP50; AP4E1 mutations cause AP-4-HSP, also known as SPG51 or HSP51; and AP4S1 mutations cause AP-4-HSP, also known as SPG52 or HSP51. AP-4-HSP characteristics are very similar regardless of the gene in which the causative mutation resides. Onset of AP-4-HSP usually occurs in early childhood and results in seizures, moderate to severe intellectual disability, impaired or absent speech, microcephaly, epileptic seizures, shyness, and, in severe cases, quadriplegia.

[11] AP-4-HSP has been characterized in 199 children worldwide to date. [1] It is most likely that incident cases are underreported. AP-4-HSP is progressive, and no disease-modifying treatment exists. Therefore, there is a need to develop new treatments to improve patient outcomes for those affected by AP-4-HSP.

[0004] AP4B1 is one component of the AP-4 heterotetramer (Figure 1A). The complete AP-4 complex consists of two large adaptins (epsilon-type subunit AP4E1 and beta-type subunit AP4B1), an intermediate adaptin (mu-type subunit AP4M1), and a small adaptin (sigma-type AP4S1). The AP-4 complex forms a non-clathrin-associated coating on vesicles departing from the trans-Golgi network (TGN) and may be involved in targeting proteins from the TGN to the endosomal-lysosomal system (Figure 1B). It also plays a role in protein sorting to the basolateral membrane in epithelial cells and in the proper asymmetric localization of proteins in neurons. AP-4-positive TGN-derived vesicles are important for the precise spatial formation of autophagosomes, and thus, loss of the AP-4 complex may impair autophagosome formation in distal axons. Thus, the AP-4 complex is important for normal brain function.

[0005] Adeno-associated virus (AAV) vectors are known in the art and offer various advantages over retroviral or lentiviral vectors, such as their mild immune response, ability to infect a wide range of cells, and the ability to store desired DNA extrachromosomally in cells without integrating into the genome and potentially disrupting or knocking out other genes. AAV contains a single-stranded DNA genome of approximately 4.8 kilobases (kb) containing three genes, with coding sequences flanked by inverted repeats necessary for genome replication and packaging. The use of AAV and modified AAV vectors is known in the art and is disclosed in WO2019 / 032898, WO2020041498, or WO2019 / 028306. AAV vectors have completed various Phase I and Phase II clinical trials for gene delivery in the treatment of cystic fibrosis and congestive heart failure, and are an approved therapy for the treatment of spinal muscular atrophy.

[0006] In our co-pending application WO2021 / 205028, the contents of which are incorporated in their entirety, we disclose a transcription cassette comprising a nucleic acid molecule encoding an AP-4 polypeptide. [Prior art documents] [Patent documents]

[0007] [Patent Document 1] US10519503 [Patent Document 2] US2017152562 [Patent Document 3] CN1958605 [Patent Document 4] WO2019 / 032898 [Patent Document 5] WO2020041498 [Patent Document 6] WO2019 / 028306 [Patent Document 7] WO2021 / 205028 [Non-patent literature]

[0008] [Non-Patent Document 1] Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001) [Non-patent document 2] Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes Part I, Chapter 2 (Elsevier, New York, 1993) [Non-patent document 3] Eukaryotic Transcription Factors, David S Latchman, Academic Press Ltd, San Diego [Non-patent document 4] Feng et al. (1997) Nature Biotechnology 15:866-870 [Non-Patent Document 5] Pennisi, E. (1996) Science 274:342~343 [Non-patent document 6] Russell, SJ (1994) Eur. J. of Cancer 30A(8):1165-1171 [Non-Patent Document 7] Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA. [Non-patent document 8] Marchi P., Marrone L. and Azzouz M. Trends in Molecular Medicine(2021) Summary of the Invention

[0009] The present inventors disclose herein optimized expression vectors comprising an AP-4 nucleic acid molecule operably linked to an expression control sequence adapted for expression in mammalian neurons, e.g., motor neurons, as well as the use of modified expression vectors to deliver and functionally replace dysfunctional AP-4 protein in the prevention or treatment of conditions associated with HSPs. This disclosure relates to the development of modified vectors, e.g., AAV vectors, enhanced AAV vectors, comprising nucleic acid molecules encoding proteins of the AP-4 complex.

[0010] Description of the Invention According to an embodiment of the present invention, a 5' to 3' sequence is provided between the first inverted repeat sequence and the second inverted repeat sequence. i) a promoter adapted for expression in mammalian neurons, the promoter being associated with an enhancer nucleotide motif; ii) intron nucleotide sequences; and iii) polyadenylation signal nucleotide sequence wherein the cassette further comprises a nucleic acid molecule comprising a nucleotide sequence encoding at least one protein of the AP-4 complex.

[0011] In a preferred embodiment of the invention, said enhancer motif is a CMV enhancer.

[0012] In a preferred embodiment of the invention, said CMV enhancer motif comprises or consists of the nucleotide sequence of SEQ ID NO: 1 or a polymorphic nucleotide sequence variant thereof.

[0013] Preferably, the hybrid intron comprises or consists of the nucleotide sequence of SEQ ID NO: 2 or a polymorphic sequence variant thereof.

[0014] In a preferred embodiment of the invention, said polyadenylation signal is a growth hormone (GH) polyadenylation signal.

[0015] Preferably, said GH polyadenylation signal comprises or consists of the nucleotide sequence of SEQ ID NO: 4 or a polymorphic sequence variant thereof.

[0016] In a preferred embodiment of the invention, the promoter is the chicken beta-actin promoter.

[0017] Preferably, the chicken beta-actin promoter comprises or consists of the nucleotide sequence of SEQ ID NO:3.

[0018] Preferably, the chicken beta-actin promoter comprises or consists of the nucleotide sequence of SEQ ID NO:28.

[0019] In a preferred embodiment of the invention, said transcription cassette comprises or consists of the nucleotide sequence of SEQ ID NO:9.

[0020] A polymorphic sequence variant is a sequence that varies from a reference sequence by one or more nucleotide bases, for example, by two, three, four, five or more bases.

[0021] In a preferred embodiment of the invention, the expression cassette comprises: i) the nucleotide sequence or polymorphic sequence variant set forth in SEQ ID NO: 15 (AP4B1); ii) a nucleotide sequence that, as a result of the genetic code, is degenerate to the nucleotide sequence defined in (i); iii) a nucleic acid molecule whose complementary strand hybridizes to the sequence of SEQ ID NO: 15 (AP4B1) under stringent hybridization conditions and encodes a polypeptide that forms a complex with a polypeptide that constitutes the AP-4 complex; iv) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 16 (AP4B1); v) A nucleotide sequence encoding a polypeptide comprising an amino acid sequence modified by addition, deletion, or substitution of at least one amino acid residue as set forth in iv), wherein the polypeptide forms a complex with a polypeptide constituting the AP-4 complex. The present invention also includes a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of:

[0022] The hybridization of nucleic acid molecules occurs when two complementary nucleic acid molecules undergo a certain amount of hydrogen bonding with each other.The stringency of hybridization can vary according to the environmental conditions surrounding nucleic acid, the nature of hybridization method, and the composition and length of the nucleic acid molecules used.The calculation of the hybridization conditions required to achieve a certain degree of stringency is discussed in Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001); and Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes Part I, Chapter 2 (Elsevier, New York, 1993). m is the temperature at which 50% of a given strand of a nucleic acid molecule hybridizes to its complementary strand. The following is an exemplary, but non-limiting, set of hybridization conditions:

[0023] Very high stringency (allowing sequences sharing at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to hybridize) Hybridization: 16 hours at 65°C in 5x SSC Wash twice: 15 min each in 2x SSC at room temperature (RT) Wash twice: 20 minutes each in 0.5x SSC at 65°C

[0024] high stringency (allowing sequences sharing at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88% or 89% identity to hybridize); Hybridization: 16-20 hours at 65-70°C in 5x-6x SSC Wash twice: 2x SSC for 5-20 min each at RT Wash twice: 1x SSC at 55-70°C for 30 minutes each

[0025] low stringency (allowing sequences sharing at least 50%, 55%, 60%, 65%, 70% or 75% identity to hybridize); Hybridization: 16–20 hours in 6× SSC at RT–55°C Wash at least twice: 2x-3x SSC, 20-30 min each at RT-55°C

[0026] In a preferred embodiment of the invention, the expression cassette comprises: i) the nucleotide sequence or polymorphic sequence variant set forth in SEQ ID NO: 17 (AP4E1); ii) a nucleotide sequence that, as a result of the genetic code, is degenerate to the nucleotide sequence defined in (i); iii) a nucleic acid molecule whose complementary strand hybridizes to the sequence of SEQ ID NO: 17 (AP4E1) under stringent hybridization conditions and encodes a polypeptide that forms a complex with a polypeptide that constitutes the AP-4 complex; iv) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 18 (AP4E1); v) A nucleotide sequence encoding a polypeptide comprising an amino acid sequence modified by addition, deletion, or substitution of at least one amino acid residue as set forth in iv), wherein the polypeptide forms a complex with a polypeptide constituting the AP-4 complex. The present invention also includes a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of:

[0027] In a preferred embodiment of the invention, the expression cassette comprises: i) the nucleotide sequence or polymorphic sequence variant set forth in SEQ ID NO: 19 (AP4M1); ii) a nucleotide sequence that, as a result of the genetic code, is degenerate to the nucleotide sequence defined in (i); iii) a nucleic acid molecule whose complementary strand hybridizes to the sequence of SEQ ID NO: 19 (AP4M1) under stringent hybridization conditions and encodes a polypeptide that forms a complex with a polypeptide that constitutes the AP-4 complex; iv) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 20 (AP4M1); v) A nucleotide sequence encoding a polypeptide comprising an amino acid sequence modified by addition, deletion, or substitution of at least one amino acid residue as set forth in iv), wherein the polypeptide forms a complex with a polypeptide constituting the AP-4 complex. The present invention also includes a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of:

[0028] In a preferred embodiment of the invention, the expression cassette comprises: i) the nucleotide sequence or polymorphic sequence variant set forth in SEQ ID NO: 21 (AP4S1); ii) a nucleotide sequence that, as a result of the genetic code, is degenerate to the nucleotide sequence defined in (i); iii) a nucleic acid molecule whose complementary strand hybridizes to the sequence of SEQ ID NO: 21 (AP4S1) under stringent hybridization conditions and encodes a polypeptide that forms a complex with a polypeptide that constitutes the AP-4 complex; iv) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 22 (AP4S1); iv) A nucleotide sequence encoding a polypeptide comprising an amino acid sequence modified by addition, deletion, or substitution of at least one amino acid residue as set forth in (iv), wherein the polypeptide forms a complex with a polypeptide constituting the AP-4 complex. The present invention also includes a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of:

[0029] In a preferred embodiment of the invention, said cassette is adapted for expression in motor neurons.

[0030] In a preferred embodiment of the invention, said nucleic acid molecule comprises or consists of the nucleotide sequence shown in SEQ ID NO: 15 or a polymorphic sequence variant thereof.

[0031] In a preferred embodiment of the present invention, there is provided a nucleotide sequence encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 16 or a polymorphic sequence variant thereof.

[0032] In a preferred embodiment of the invention, said nucleic acid molecule comprises or consists of the nucleotide sequence shown in SEQ ID NO: 17 or a polymorphic sequence variant thereof.

[0033] In a preferred embodiment of the present invention, there is provided a nucleotide sequence encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 18 or a polymorphic sequence variant thereof.

[0034] In a preferred embodiment of the invention, said nucleic acid molecule comprises or consists of the nucleotide sequence shown in SEQ ID NO: 19 or a polymorphic sequence variant thereof.

[0035] In a preferred embodiment of the present invention, there is provided a nucleotide sequence encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 20 or a polymorphic sequence variant thereof.

[0036] In a preferred embodiment of the invention, said nucleic acid molecule comprises or consists of the nucleotide sequence shown in SEQ ID NO: 21 or a polymorphic sequence variant thereof.

[0037] In a preferred embodiment of the present invention, there is provided a nucleotide sequence encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 22 or a polymorphic sequence variant thereof.

[0038] The polypeptides disclosed herein may differ in amino acid sequence by one or more substitutions, additions, deletions, or truncations, which may be present in any combination. Among these, preferred variants are those that vary from the reference polypeptide by conservative amino acid substitutions. Such substitutions replace a given amino acid with another amino acid of similar characteristics. The following non-limiting list of amino acids is considered conservative substitutions (analogs): a) alanine, serine, and threonine; b) glutamic acid and aspartic acid; c) asparagine and glutamine; d) arginine and lysine; e) isoleucine, leucine, methionine, and valine; and f) phenylalanine, tyrosine, and tryptophan. Most highly preferred are variants that retain or enhance the same biological function and activity as the reference polypeptide from which they are derived. In one embodiment, these polypeptides have at least 70% identity, even more preferably at least 75% identity, still more preferably at least 80%, 85%, 90%, 95% identity, and at least 99% identity to the full-length amino acid or nucleotide sequences exemplified herein.

[0039] In an alternative preferred embodiment of the invention, said promoter is a constitutive promoter.

[0040] In a further alternative embodiment of the invention, the promoter is a regulated promoter, for example an inducible or cell-specific promoter.

[0041] In a preferred embodiment of the present invention, the promoter is selected from the group consisting of neuron- and glial-specific promoters including chicken beta-actin (CBA) promoter, chicken beta-actin hybrid (CBh) promoter, CAG promoter, JeT promoter, synapsin 1, Hb9, MeP229, and GFAP promoter sequences, and AP-4 subunit-specific promoter regions including AP4B1, AP4E1, AP4M1, and AP4S1.

[0042] In a preferred embodiment of the present invention, the promoter is the chicken beta actin hybrid (CBh) promoter shown in SEQ ID NO:9.

[0043] In an alternative preferred embodiment of the invention, the promoter is the chicken beta actin hybrid (CBh) promoter as set forth in SEQ ID NO:28.

[0044] In an alternative preferred embodiment of the invention, said promoter is a JeT promoter comprising or consisting of the nucleotide sequence of SEQ ID NO:5.

[0045] In an alternative preferred embodiment of the invention, the promoter is an hSyn promoter comprising or consisting of the nucleotide sequence of SEQ ID NO:6.

[0046] In an alternative preferred embodiment of the invention, the promoter is the MeP229 promoter comprising or consisting of the nucleotide sequence of SEQ ID NO:7.

[0047] In an alternative preferred embodiment of the invention, said promoter is an AP4B1 promoter comprising or consisting of the nucleotide sequence of SEQ ID NO:8.

[0048] The term "promoter" or "transcription promoter" is art-recognized and includes the following features, which are provided for clarity and by way of example only, and not limitation: Enhancer elements are cis-acting nucleic acid sequences that are often found 5' to the transcription start site of a gene (enhancers can also be found 3' to a gene sequence, or even located within an intron sequence). Enhancers, such as the CMV enhancer, function to increase the rate of transcription of a gene to which they are linked. Enhancer activity is responsive to trans-acting transcription factors (polypeptides) that have been shown to specifically bind to enhancer elements. Transcription factor binding / activity (see Eukaryotic Transcription Factors, David S. Latchman, Academic Press Ltd, San Diego) is responsive to several physiological / environmental cues, can be constitutive or regulatable, and can also be cell / tissue specific. Promoter elements also include so-called TATA boxes and RNA polymerase initiation selection (RIS) sequences, which function to select the site of transcription initiation. These sequences also bind polypeptides that function, among other things, to facilitate transcription initiation selection by RNA polymerase.

[0049] As used herein, a first nucleic acid comprising a promoter sequence and a second nucleotide sequence encoding a polypeptide are said to be "operably" linked when they are covalently linked in such a way that expression or transcription of the second nucleic acid molecule is under the control of the first nucleic acid molecule comprising the regulatory sequence. If it is desired that the coding sequence be translated into a functional protein, two DNA sequences are said to be operably linked if induction of the promoter in the 5' regulatory sequence results in transcription of the coding sequence and production of mRNA. Thus, a promoter region is operably linked to a coding sequence if it is capable of effecting transcription of that DNA sequence such that the resulting transcript is translated into the desired protein or polypeptide.

[0050] According to a further aspect of the present invention there is provided an expression vector comprising a transcription cassette according to the present invention.

[0051] Viruses are commonly used as vectors for the delivery of exogenous genes. Commonly used vectors include recombinantly modified enveloped or non-enveloped DNA and RNA viruses, such as baculoviridae, parvoviridae, picornoviridiae, herpesveridiae, poxviridae, adenoviridae, picornaviridae, or retroviridae, such as lentiviruses. Chimeric vectors that utilize advantageous elements of each parent vector's characteristics can also be used (see, e.g., Feng et al. (1997) Nature Biotechnology 15:866-870). Such viral vectors can be wild-type or can be modified by recombinant DNA techniques to be replication-deficient, conditionally replicating, or replication-competent. Conditionally replicating viral vectors are used to achieve selective expression in specific cell types while avoiding the troublesome broad-spectrum infection. Examples of conditionally replicating vectors are described in Pennisi, E. (1996) Science 274:342-343; Russell and SJ (1994) Eur. J. of Cancer 30A(8):1165-1171.

[0052] Preferred vectors are derived from the adenovirus, adeno-associated virus or retrovirus genomes.

[0053] In a preferred embodiment of the invention, the expression vector is a viral-based expression vector.

[0054] In a preferred embodiment of the invention, the viral-based vector is an adeno-associated virus [AAV].

[0055] In a preferred embodiment, the viral-based vector is selected from the group consisting of AAV2, AAV3, AAV6, AAV13; AAV1, AAV4, AAV5, AAV6, AAV9 and rhAAV10.

[0056] In a preferred embodiment of the invention, the viral-based vector is AAV9.

[0057] In a preferred embodiment of the invention, the viral-based vector is an enhanced AAV9 vector, such as a PHP-b vector.

[0058] In a preferred embodiment of the invention, said AAV vector is based on a single-stranded AAV virus.

[0059] In an alternative embodiment of the invention, the AAV vector is based on a self-complementary AAV virus.

[0060] Naturally occurring AAV serotypes typically contain a single-stranded genome that replicates during natural infection to form a double-stranded AAV viral genome. This is the rate-limiting step in AAV replication and expression. Recombinant forms of AAV are called self-complementary AAV, which contain both sense and antisense genomic strands adapted for immediate expression and replication. Viral-based vectors can contain a gene encoding kanamycin resistance, or for therapeutic purposes, can lack the gene encoding kanamycin resistance.

[0061] In a preferred embodiment of the invention, the viral-based vector comprises the nucleotide sequence shown in SEQ ID NO:10.

[0062] In a preferred embodiment of the invention, the viral-based vector comprises the nucleotide sequence shown in SEQ ID NO:11.

[0063] In a preferred embodiment of the invention, the viral-based vector comprises the nucleotide sequence shown in SEQ ID NO:12.

[0064] In a preferred embodiment of the invention, the viral-based vector comprises the nucleotide sequence shown in SEQ ID NO:13.

[0065] In a preferred embodiment of the invention, the viral-based vector comprises the nucleotide sequence shown in SEQ ID NO:14.

[0066] In a preferred embodiment of the invention, the viral-based vector comprises the nucleotide sequence shown in SEQ ID NO:23.

[0067] In a preferred embodiment of the invention, the viral-based vector comprises the nucleotide sequence shown in SEQ ID NO:24.

[0068] In a preferred embodiment of the invention, the viral-based vector comprises the nucleotide sequence shown in SEQ ID NO:25.

[0069] In a preferred embodiment of the invention, the viral-based vector comprises the nucleotide sequence shown in SEQ ID NO:26.

[0070] In a preferred embodiment of the invention, the viral-based vector comprises the nucleotide sequence shown in SEQ ID NO:27.

[0071] Preferably, the viral-based vector sequence selected from the group consisting of SEQ ID NOs: 10-14 and 23-27 lacks a kanamycin resistance gene and is flanked by 5' and 3' inverted terminal repeat (ITR) sequences. As known in the prior art, only the sequences between the ITRs are packaged into clinical viral vectors and delivered to patients. The ITR-flanked transgene encoded within the recombinant AAV subsequently persists as an episome in the nucleus of transduced cells, e.g., non-dividing neuronal cells, providing long-term expression.

[0072] In an alternative preferred embodiment of the invention, said viral-based vector is a lentiviral vector.

[0073] According to a further aspect of the invention there is provided a pharmaceutical composition comprising an expression vector according to the invention and an excipient or carrier.

[0074] The expression vector compositions of the present invention are administered in pharmaceutically acceptable preparations. Such preparations may routinely contain pharmaceutically acceptable concentrations of salts, buffers, preservatives, compatible carriers, and supplemental therapeutic agents. The expression vector compositions of the present invention may be administered by any conventional route, including injection, or by gradual infusion over time.

[0075] The expression vector compositions of the present invention are administered in effective amounts. An "effective amount" is that amount of expression vector that alone, or together with further doses, produces the desired response. In the case of treating a disease, the desired response is inhibition of disease progression. This may involve only slowing the progression of the disease temporarily, but more preferably involves permanently halting disease progression. This can be monitored by conventional methods. Such amounts will, of course, depend on factors within the knowledge and experience of the medical practitioner, such as the particular condition being treated, the severity of the condition, individual patient parameters including age, health, size, and weight, the duration of treatment, the nature of concurrent therapy (if any), and the specific route of administration.

[0076] These factors are well known to those skilled in the art and can be addressed with no more than routine experimentation. It is generally preferred that the maximum dose of the individual components or combinations thereof be used, i.e., the highest safe dose according to sound medical judgment. However, it will be understood by those skilled in the art that a patient may insist on a lower dose or tolerated dose for medical reasons, psychological reasons, or virtually any other reason.

[0077] The expression vector composition used in the above-described method is preferably sterile and contains an effective amount of an expression vector according to the present invention to produce the desired response, in a unit of weight or volume suitable for administration to a patient. The dose of the vector administered to a subject can be selected according to different parameters, particularly according to the mode of administration used and the condition of the subject. Other factors include the desired duration of treatment. If the response in the subject is insufficient with the initial dose applied, a higher dose (or an effectively higher dose via a different, more localized delivery route) can be used, up to the extent that the patient's tolerance allows. Other protocols for administering vector compositions, in which the dose, injection schedule, injection site, mode of administration, etc. vary from those described above, are known to those skilled in the art. Administration of the composition to mammals other than humans (e.g., for testing or veterinary therapeutic purposes) is carried out under substantially the same conditions as described above. As used herein, a subject is a mammal, preferably a human, and includes non-human primates, cows, horses, pigs, sheep, goats, dogs, cats, or rodents.

[0078] When administered, the expression vector compositions of the present invention are applied in pharmaceutically acceptable amounts and in pharmaceutically acceptable compositions. The term "pharmaceutically acceptable" refers to a non-toxic material that does not interfere with the effectiveness of the biological activity of the active agent. Such preparations may conventionally contain salts, buffers, preservatives, compatible carriers, and, optionally, other therapeutic agents (e.g., those typically used in the treatment of a particular disease indication). When used in medicine, salts must be pharmaceutically acceptable; however, non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof and are not excluded from the scope of the present invention. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, those prepared from the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, formic acid, malonic acid, succinic acid, etc. Pharmaceutically acceptable salts may also be prepared as alkali metal or alkaline earth salts, e.g., sodium, potassium, or calcium salts.

[0079] Pharmaceutical compositions containing an expression vector according to the present invention may contain suitable buffers, including acetic acid in a salt, citric acid in a salt, boric acid in a salt, and phosphoric acid in a salt. The pharmaceutical compositions may also contain suitable preservatives, as needed, such as benzalkonium chloride, chlorobutanol, parabens, and thimerosal.

[0080] The expression vector compositions may be conveniently presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. All methods include the step of bringing the active agent into association with the vector, which constitutes one or more accessory ingredients. Preparations may be formulated according to known methods using suitable dispersing or wetting agents and suspending agents. Sterile injectable preparations may also be sterile injectable solutions or suspensions in non-toxic parenterally-acceptable diluents or solvents, such as solutions in 1,3-butanediol. Among the acceptable solvents, water, Ringer's solution, and isotonic sodium chloride solution may be used. Additionally, sterile, fixed oils are conventionally employed as solvents or suspending media. For this purpose, any bland, fixed oil may be used, including synthetic mono- or diglycerides. Additionally, fatty acids, such as oleic acid, may be used in the preparation of injectables. Suitable carrier formulations for oral, subcutaneous, intravenous, intramuscular, etc. administration can be found in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA.

[0081] According to a further aspect of the invention there is provided an expression vector according to the invention for use as a medicament.

[0082] According to a further aspect of the invention there is provided an expression vector according to the invention for use in treating AP-4 hereditary spastic paraplegia in a subject.

[0083] Preferably, the subject is a pediatric subject.

[0084] Pediatric subjects include neonates (0-28 days old), infants (1-24 months old), young children (2-6 years old), and pre-adolescents (7-14 years old).

[0085] In a preferred embodiment of the present invention, the AP-4-HSP is SPG47.

[0086] In a preferred embodiment of the present invention, the AP-4-HSP is SPG50.

[0087] In a preferred embodiment of the invention, the AP-4-HSP is SPG51.

[0088] In a preferred embodiment of the present invention, the AP-4-HSP is SPG52.

[0089] Spastic paraplegia (SPG) is used interchangeably with hereditary spastic paraplegia (HSP), thus SPG47 is HSP47, SPG50 is HSP50, SPG51 is HSP51, and SPG52 is HSP52.

[0090] According to a further aspect of the invention there is provided a cell transfected with an expression vector according to the invention.

[0091] In a preferred embodiment of the invention, the cell is a neuron.

[0092] In a preferred embodiment of the invention, said neuron is a motor neuron.

[0093] According to a further aspect of the present invention there is provided a method for treating or preventing AP-4 hereditary spastic paraplegia, the method comprising the step of administering a therapeutically effective amount of an expression vector according to the present invention to prevent and / or treat hereditary spastic paraplegia.

[0094] In a preferred method of the present invention, said AP-4-HSP is spastic paraplegia type 47 (SPG47).

[0095] In a preferred method of the invention, said AP-4 HSP is spastic paraplegia type 50 (SPG50).

[0096] In a preferred method of the invention, said AP-4 HSP is spastic paraplegia type 51 (SPG51).

[0097] In a preferred method of the invention, said AP-4 HSP is spastic paraplegia type 52 (SPG52).

[0098] According to a further aspect of the invention there is provided a method for determining the effectiveness of a treatment for hereditary spastic paraplegia in a subject, wherein said subject is treated with an expression vector or a pharmaceutical composition according to the invention, a) measuring the level of neurofilament L (NFL) in a biological sample obtained from a subject suffering from hereditary spastic paraplegia before administration of an expression vector according to the invention or a pharmaceutical composition according to the invention; and b) comparing said level with the level of NFL in a biological sample obtained from a subject suffering from hereditary spastic paraplegia after administration of an expression vector or a pharmaceutical composition according to the invention. Including, i) if the NFL level is low compared to the level obtained in step a), treatment with the expression vector or composition is discontinued, or ii) if the level is substantially the same as in step a), treatment with the expression vector or composition according to the invention is continued; A method is provided.

[0099] In a preferred method of the invention, said expression vector is selected from the group consisting of SEQ ID NOs: 10, 11, 12, 13, 14, 23, 24, 25, 26 and 27.

[0100] In a preferred method of the invention, said sample under b) is obtained 1, 2, 3, 4, 5 or 6 days or 1, 2, 3 or -4 weeks after administration.

[0101] According to a further aspect of the present invention there is provided a method for determining the effectiveness of a treatment for hereditary spastic paraplegia in a subject suffering from hereditary spastic paraplegia, wherein said subject is treated with an expression vector or a pharmaceutical composition according to the present invention, a) measuring the level of neurofilament L (NFL) in a biological sample obtained from a subject suffering from hereditary spastic paraplegia and treated with the expression vector or composition; and b) comparing said levels with those of a control subject A method is provided, comprising:

[0102] In a preferred method according to the invention, said expression vector is selected from the group consisting of SEQ ID NOs: 10, 11, 12, 13, 14, 23, 24, 25, 26 and 27.

[0103] In a preferred method of the present invention, said sample under a) is obtained during 1, 2, 3, 4, 5 or 6 days or 1, 2, 3 or -4 weeks after treatment with an expression vector or a pharmaceutical composition according to the present invention.

[0104] In a preferred method of the present invention, the method further comprises the step of c) determining that the treatment is effective and discontinuing it if the level in the biological sample obtained from the subject suffering from hereditary spastic paraplegia is the same as or lower than the NFL level in the biological sample obtained from the control subject.

[0105] In a preferred method of the present invention, the method further comprises the step of: c) if the level in a biological sample obtained from a subject suffering from hereditary spastic paraplegia is higher than the NFL level in a biological sample obtained from a control subject, the treatment is ineffective and treatment with an expression vector or pharmaceutical composition according to the present invention is continued.

[0106] Throughout this description and the claims, the words "comprise" and "contain" and variations of these words, such as "comprising" and "comprises," mean "including, but not limited to," and are not intended to (and do not) exclude other moieties, additives, components, integers, or steps. "Consisting essentially of" means having the essential integers, but including integers that do not materially affect the function of the essential integers.

[0107] Throughout the description and claims of this specification, the singular encompasses the plural unless the context requires otherwise. Where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity unless the context requires otherwise.

[0108] It should be understood that any feature, integer, characteristic, compound, chemical moiety, or group described in connection with a particular aspect, embodiment, or example of the invention is applicable to any other aspect, embodiment, or example described herein, unless incompatible therewith.

[0109] Embodiments of the present invention will now be described, by way of example only, and with reference to the following drawings: [Brief explanation of the drawings]

[0110] [Figure 1]AP4 complex and function: (A) Diagram of the AP4 heterotetramer complex, composed of large beta- and epsilon-type adaptins (β4 and ε4, designated AP4B1 and AP4E1), an intermediate mu-type adaptin (APμ4, designated AP4M1), and a small sigma-adaptin (APσ4, designated AP4S1). (B) Diagram of AP4 complex function: 1) AP4 heterotetramers are recruited to the trans-Golgi network (TGN) and subsequently recruit their cargo proteins, including ATG9. 2) Clatherin-negative vesicles bud from the TGN. 3) AP4 complexes shed from the vesicles and are recycled back to the TGN for further vesicle formation. 4) The remaining vesicles are bound by kinesin motor proteins and transported anterogradely along microtubules to the cell periphery or distal neuronal compartments. 5) ATG9 vesicles assemble to promote autophagosome formation. [Figure 2]Design and validation of gene therapy vectors for AP4B1 gene replacement. (A) Schematic diagram of the designed AAV and LV already in place. (B) Representative Western blots of control (WT) or AP4B1-knockout (KO) HeLa cell lysates after transfection with plasmids expressing GFP (+GFP) or hAP4B1 (+AAV-hAP4B1). Expression of hAP4B1 in the KO cell line rescues lost AP4B1 protein expression. Rescue of AP4B1 expression also restores AP4E1 subunit protein expression levels to WT levels. (C) Validation of V5-tagged AP4B1-expressing AAV in AP4B1- / - HeLa cells. (D) Non-transgenic rat cortical neurons stained with primary antibodies for the cortical neuron markers MAP2 (red channel) and V5 (green channel), both 10 days after treatment with AAV9-V5_hAP4B1 at 300,000 vg / cell. (E) Representative Western blots of non-diseased control fibroblasts (Ctrl) and both untreated SPG47 patient fibroblasts (UT) and SPG47 patient fibroblasts treated with increasing amounts of LV-V5_hAP4B1 (left of dashed line) showing rescue of hAP4B1 expression in the patient mutant line. Representative Western blots of non-transgenic rat cortical neurons treated with 400,000 vg / cell of AAV9 viral vectors: AAV9-V5_SPG47(hAP4B1); AAV9-SPG47(hAP4B1); AAV9-GFP; non-transduced cells. [Figure 3]Use of ATG9A as a readout to assess the efficacy of AP4B1 gene replacement. (A) Schematic of ATG9A mislocalization to the trans-Golgi network (TGN) in a CRISPR-generated Hela knockout cell model. (B) Mislocalization of ATG9A in AP4B1- / - Hela cells is rescued after transfection with an AAV9 construct encoding AP4B1. (C) Representative Western blots of LV-transduced patient cells show rescue of hAP4B1 expression and detection of the V5 tag, as quantified in (D). (E) Transduced patient cells also show rescue of ATG9A expression, as quantified in (F). Data are presented as mean + / - standard error of the mean (SEM), n=3. Data analyzed by one-way ANOVA followed by a post-hoc Dunnett's multiple comparison test compared to Ctrl. Asterisks indicate: p≦0.05 (*); p<0.0001 (****); ns=not significant. (G) Lentiviral vector (LV)-mediated correction of ATG9A mislocalization in SPG47 patient primary fibroblasts. SPG47 patient cells marked with a white asterisk show rescue of mislocalized ATG9A after treatment with LV-V5_hAP4B1. [Figure 4] Proof-of-concept study 1: Biochemical and anatomical evaluation. The aim was to evaluate the impact of AAV9-CBh-AP4B1 gene replacement on the key biochemical and anatomical defects identified in Ap4b1- / - mice. (A) Study design. AAV9 injection in P1 mice followed two major paradigms of gene therapy delivery: intracisternal delivery into the CSF via the intracisternal cavity (ICM) or intravenous (IV) delivery via the facial vein. (B) Sample size used in the study. (C) Intracisternal delivery of AAV9-V5 alone and AAV9-V5-hAP4B1 is superior to intravenous delivery in transducing all areas of the CNS. Viral biodistribution determined by qPCR in the cerebrum, spinal cord, and cerebellum. N=3 for each tissue, results are shown as mean ± SEM. [Figure 5]Intracisternal delivery of AAV9-V5-hAP4B1 is superior to intravenous delivery in inducing hAP4B1 mRNA expression in all areas of the CNS. RT-qPCR of hAP4B1 cDNA in the cerebrum, spinal cord, and cerebellum. N=3 for each tissue, and results are shown as mean ± SEM. [Figure 6] AAV9-CBh-hAP4B1 gene therapy mediates rescue of brain weight deficit in the Ap4b1- / - mouse model. Mice were treated with AAV9 empty control (V5) or AAV9 virus expressing V5-tagged hAP4B1. Hom = Ap4b1- / -. [Figure 7] ICM delivery of AAV9-V5-hAP4B1 rescues mouse AP4E1 protein levels in the CNS and is superior to intravenous delivery. Western blots of protein extracts showing rescue of mouse AP4E1 levels in the cerebrum (A) and spinal cord (B) of mice treated with ICM injection of AAV9-V5-hAP4B1. Intravenous delivery induced detectable AP4E1 rescue only in the spinal cord. N=3 for each tissue, quantification data shown as mean ± SEM. [Figure 8]Mislocalized ATG9A, enlarged lateral ventricles, and reduced corpus callosum thickness in the brains of Ap4b1(- / -) mice. Immunostaining of ATG9A in cerebellar sections shows increased expression and mislocalization in the Purkinje cell layer and deep cerebellar nuclei of Ap4b1(- / -) mice (A). NeuN-stained coronal brain sections. The lateral ventricles are highlighted by a dashed line in Ap4b1(- / -) mice. The graph shows quantification of lateral ventricle area as a fold change compared to WT animals. N = 3, analyzed by Kolmogorov-Smirnov test. ***p ≤ 0.001 (B). Coronal sections stained with hematoxylin and eosin (H&E) show reduced corpus callosum thickness in Ap4b1(- / -) mice. The graph shows quantification of corpus callosum thickness normalized to slice thickness as a fold change compared to WT animals. Data shown as mean ± SEM, n = 3, analyzed by Kolmogorov-Smirnov test. *p < 0.05 (C). Scale bar: 150 μm (A); 500 μm (C). Mo = molecular layer, Pc = Purkinje cell layer, Gr = granule cell layer, DCN = deep cerebellar nuclei, H&E = hematoxylin and eosin, ATG9A = autophagy-related protein 9A, CC = corpus callosum. [Figure 9] AAV9-mediated AP4B1 gene replacement resulted in rescue of (A) corpus callosum thickness and (B) enlarged lateral ventricles in the Ap4b1 − / − mouse model. [Figure 10] AAV9 gene replacement of AP4B1 in the SPG47 mouse model restores normal localization of ATG9A in the cerebellum and brainstem. [Figure 11] Ap4b1(- / -) mice exhibit hindlimb clasping. Representative images of non-spastic (WT) and spastic (Ap4b1(- / -)) mice are shown (A). The percentage of WT and Ap4b1(- / -) mice exhibiting hindlimb clasping at 3 months of age (B). AAV9-CBh-AP4B1 treatment reduces the spasticity phenotype in Ap4b1- / - mice. [Figure 12]Pilot safety study in wild-type mice. Mice treated with AAV9-CBh-AP4B1 delivered via ICM show no signs of side effects for up to 6 months. mRNA transgene expression (A) and viral genome distribution (B) were assessed in the brain, spinal cord, and peripheral organs. AAV gene therapy had no adverse effects on body weight, and functional motor coordination in mice was measured by rotarod at 4 weeks (B) and 6 months (C) after treatment. n=5. [Figure 13] The AP4B1 endogenous promoter sequence is described. [Figure 14] GFP expression in HeLa cells under the control of MeP229, AP4, and hSyn promoters. The term "mock" indicates a control without GFP expression. As shown, expression under all three promoters was detected. Experiments were performed using three replicates for each sample. Data shown as mean + SD. [Figure 15] Age-dependent weight gain in AAV9-CBh-hAP4B1-treated mice by day 180 of treatment, approximately p60 (females only reached day 165). [Figure 16] Hindlimb spasticity in treated mice. A. Progression of spasticity severity over time in untreated and V5_-only treated SPG47 mice (ap4b1- / -). Wild-type mice show no progression in hindlimb spasticity over this period. All three treatment groups show a reduction in hindlimb severity progression. B and C are spasticity data extracted from a single time point, 120 days or 135 days of age, respectively. Both graphs clearly show a reduction in hindlimb spasticity severity with all treatments. [Figure 17] Rotarod latency to fall at 4 months after treatment (approximately p180). [Figure 18] Brain weight after brain extraction. Female (approximately P120) 2 months after injection. Male (approximately P180) 4 months after injection. [Figure 19]Preliminary corpus callosum thinning analysis (males only) 4 months after injection. A. Diagram showing the corpus callosum (CC) in relative coronal position. Every second section is taken between positions 1 and 8 for CC analysis. B shows the variation in CC width as it passes through the brain. The SPG47 V5_only cohort exhibits reduced CC thickness compared to wild-type CC thickness, suggesting that this phenotype can be rescued by high-dose treatment. CC width measurements here are normalized to each brain section. C and D are data extracted from a single position showing the same results. [Figure 20] Effect of AAV9-AP4B1 gene replacement on neurofilament L (NFL) levels in cerebrospinal fluid (CSF) and plasma. Ap4b1- / - mice were treated with AAV9-hAP4B1 vector via the cisterna magna at P1. WT: wild-type; UT: untreated Ap4b1- / -; V5: Ap4b1- / - treated with control empty vector; CBH: Ap4b1- / - treated with AAV9-CBh-AP4B1; SYN: Ap4b1- / - treated with AAV9-synapsin 1-AP4B1. DETAILED DESCRIPTION OF THE INVENTION

[0111] Sequence Number Summary Table [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka]

[0112] Materials and Methods ethics statement All in vivo animal experiments were approved by the University of Sheffield Ethical Review Sub-Committee, UK Animal Procedures Committee (London, UK) and were performed under Project License 40 / 3739 in accordance with the Animal (Scientific Procedures) Act 1986. C57BL / 6J-Ap4b1 em5Lutzy / J and non-transgenic C57BL / 6J mice were maintained in a controlled facility on a 12-hour dark / 12-hour light photocycle (on at 7 AM / off at 7 PM) with free access to food and water. The ARRIVE guidelines were followed when reporting this study.

[0113] Viral vector construction The lead clinical vector pAAV-CBh-hAP4B1-Kan (SEQ ID NO: 11) was synthesized by Genewiz. Briefly, the CBh promoter (SEQ ID NO: 9), gene of interest (hAP4B1 SEQ ID NO: 15), and human growth hormone (hGH) poly(A) signal (SEQ ID NO: 4) were cloned into the Genewiz plasmid backbone between two AAV2 inverted terminal repeats (ITRs). The CBh promoter was originally designed and described by Gray SJ et al. (2011) as a novel, enhanced hybrid form of the chicken beta-actin (CBA) promoter. CBh can provide high levels of ubiquitous neuronal expression, including in motor neurons (Gray et al., 2011). The CBh promoter consists of three parts: a CMV enhancer (SEQ ID NO: 1), a chicken beta-actin promoter (SEQ ID NO: 3), and a hybrid intron (SEQ ID NO: 2) formed from CBA intron 1 and the minute virus of mice (MVM) VP intron. The CMV enhancer detailed in SEQ ID NO: 1 contains an 18-bp deletion compared to the standard CMV enhancer. Short linker sequences exist between the 5' ITR and the CBh promoter, between the CBh promoter and hAP4B1, between the hAP4B1 and the hGH poly(A) signal, and between the hGH poly(A) signal and the 3' ITR. The plasmid backbone also contains an f1 bacteriophage origin of replication downstream of the 3' ITR, a kanamycin resistance gene downstream of this, and a high-copy-number (pUC) origin of replication immediately upstream of the 5' ITR. The complete plasmid contains 6443 bp, with a 3895-bp region that is packaged into AAV9.

[0114] Initial safety study - Cisternal delivery of viral gene therapy constructs in P1 mice. Postnatal day 1 (P1) wild-type C57Bl / 6J mice were anesthetized with isoflurane. Induction was performed in a chamber with 5% isoflurane and 3 L O2 / min. Anesthesia was maintained via a mask with 1-2% isoflurane and 0.3 L O2 / min for approximately 5 minutes during the injection. The cisterna magna was located using a Wee-Sight transilluminator vein locator (Phillips). Viral vectors were injected directly into the cisterna magna of P1 mice (n = 15 per group) using a stereotaxic apparatus containing a 33-gauge Hamilton syringe with an automated perfusion pump. The solution was administered at a flow rate of 1 μL per minute; the maximum volume of solution administered was 5 μL per animal. Each animal received 5 × 10 10 The maximum dose of total vector genome was given. The experimental timeline proceeded as follows:

[0115] Day 1 - Postnatal Day 0, Day of Birth (P0) - Footpad tattoos applied for identification purposes. Day 2 - Postnatal day 1 (P1) - Injection of up to 5 μL of viral vector or vehicle solution into the cisterna magna under isoflurane anesthesia. On day 29 (or day 170) - postnatal day 28 (P28) or P168 (6 months after injection) - animals were perfused under terminal anesthesia and tissue samples were collected for analysis.

[0116] Cisternal delivery of viral gene therapy constructs in P1 mice as proof of concept. Transgenic mice lacking endogenous Ap4b1 (KO C57BL / 6J-Ap4b1) were generated after injection via the cisterna magna. em5LutzyThis study was conducted to evaluate the ability of our therapeutic viral vector to mediate transgene expression in the central nervous system (CNS) of mice (H1N1 / J). Mice were injected via the cisterna magna as in the previously described safety study. Two viral vectors were used: AAV9 expressing a full-length copy of the human AP4B1 (SPG47) gene, and, as a viral control, AAV9 expressing a V5 tag with no additional coding sequence. Mice receiving the AAV9-hAP4B1 viral vector were administered two different doses (2 × 10 10 Low dose of vector genome and 4 x 10 10 high dose of vector genome), whereas mice receiving AAV9-V5 received a high dose (4 × 10 10 Two additional groups were included in the study: naive KO C57BL / 6J-Ap4b1 em5Lutzy / J and untreated WT C57BL / 6J-Ap4b1 em5Lutzy / J. Phenotypic rescue was assessed by improvements in the behavioral parameters detailed below in treated mice compared to untreated.

[0117] Genotyping and colony maintenance C57BL / 6J-Ap4b1 em5Lutzy / J mice were generated by Jackson Labs using CRISPR-Cas9-mediated deletion of a 76 bp region within exon 1 of the mouse Ap4b1 gene. Deletion of this region generated a frameshift mutation and a truncated mRNA transcript. WT sequence (lowercase indicates deletion): [ka]

[0118] Mouse genotyping was performed based on a protocol optimized by Charles River Laboratories. Mouse genotyping was performed on genomic DNA extracted from tail or ear tissue by adding 20 μl of QuickExtract™ DNA extraction solution (Lucigen) and incubating in a thermocycler at 65°C for 15 minutes, followed by 98°C for 2 minutes. Genotyping PCR was performed in separate 20 μl volume reactions for the WT and KO alleles. Reactions consisted of 5 μl of 5× FIREPol® Master Mix Ready to Load with 7.5 mM MgCl2 (Solis Biodyne), 500 nM of each genotyping primer—P1+P2 for WT allele amplification and P1+P3 for KO allele amplification—(P1: 5′-TCGCCCGAGGACCCAAGAA-3′ (SEQ ID NO: 29); P2: 5′-CCTATCAGCCTGAATATGAGGGTTACA-3′ (SEQ ID NO: 30); P3: 5′-GCTGGATGACATTCCGGTATATG-3′ (SEQ ID NO: 31)), and 1 μl of genomic DNA from the QuickExtract™ protocol. Touchdown PCR was performed according to the thermal profile shown in Table 1. After PCR and agarose gel electrophoresis (2% agarose gel in Tris-acetate-EDTA buffer), the WT and KO allele PCR products were visualized at approximately 254 bp and 203 bp, respectively.

[0119] Heterozygous mice were bred together to produce homozygous WT (Ap4b1+ / +), KO (Ap4b1- / -) and heterozygous (Ap4b1+ / -) littermates.

[0120] [Table 1]

[0121] RT-qPCR for human and mouse AP4B1 expression analysis. RT-qPCR was performed using 2 μl of total RNA diluted to a concentration of 10 ng / μl in nuclease-free water, 5 μl of 2× QuantiFast SYBR Green RT-PCR Master Mix (Qiagen®), hAP4B1 (forward: 5′-CTGGTGAACGATGAGAATGT-3′ (SEQ ID NO: 32); reverse: 5′-GACCCAGCAACTCTGTTAAA-3′ (SEQ ID NO: 33)), mAp4b1 (forward: 5′-CTGTGCTAGGCTCCCACATC-3′ (SEQ ID NO: 34); reverse: 5′-TGGCACTGGCCTTTACCATT-3′ (SEQ ID NO: 35)), and 18S (forward: 5′ GTAACCCGTTGAACCCCAT 3′ (SEQ ID NO: 36); reverse: 5′ CCATCCAATCGGTAGTAGCG 3′ (SEQ ID NO: 37)) primers (all at 1 μM concentration), 0.1 μl of QuantiFast RT-qPCR was performed using RT mix and HO to a final volume of 10 μl. After an initial reverse transcription step at 50°C for 10 min and a denaturation step at 95°C for 5 min, cDNA was amplified by 39 cycles of 95°C for 10 s followed by a combined annealing / extension step at 60°C for 10 s. This was followed by one cycle at 65°C for 31 s before subsequent melting curve analysis. All RT-qPCR was performed in a Bio-Rad C1000 Touch™ thermal cycler. Signal intensity was analyzed using Bio-Rad CFX Manager software, and relative gene expression values ​​were determined using the ΔΔCt method with 18S rRNA as the reference gene.

[0122] Open field Open field assays were performed on 6-, 9-, and 12-month-old mice. The protocol followed that used by Herranz-Martin and coworkers. 8Mice were placed in a translucent box measuring 60 cm x 40 cm x 25 cm. The bottom of the box was marked with permanent ink outlining a 5 x 3 grid of squares. Activity was measured as the number of grid lines crossed by each mouse over a 10-minute period. For a crossing to be recorded, all four paws of the animal had to cross a grid line. Assessments were performed under minimal lighting conditions, and the apparatus was cleaned with 70% ethanol between each animal. One run was recorded for each animal at each time point.

[0123] rotarod Motor function was measured using a Ugo Basile 7650 accelerating rotarod (set to accelerate from 3 to 37 rpm over 300 seconds). Rotarod training was performed over three consecutive days, with two trials per day. Subsequent testing was performed before noon at biweekly intervals (characterization studies) or monthly (proof-of-concept studies). For each assessment, mice were tested twice, with a minimum rest period of 5 minutes between runs. The best performance, measured as latency to fall (seconds), was used for analysis. The minimum threshold for recording rotarod activity was 3 seconds.

[0124] Gait analysis Gait parameters were assessed in Ap4b1-KO and WT mice using the CatWalk™ Gait Analysis System version 7.1. Mice were tested at 3, 6, 9, and 12 months of age. Mice were placed on the apparatus in complete darkness, and their walking patterns were recorded. Six unforced runs were recorded for each mouse, and three were selected for analysis. Runs to be analyzed were selected based on the absence of behavioral abnormalities—e.g., sniffing, exploration, and rearing—and on the condition that the mouse's spontaneous movement was consistent, with no significant acceleration, deceleration, or deviation from a straight line. Gait data were processed using Noldus software. Limbs were manually assigned, and gait parameters were calculated automatically. Parameter values ​​were imported into GraphPad Prism for statistical analysis.

[0125] antibody The primary antibodies used in this study were mouse anti-α-tubulin (1:5000; Sigma), mouse anti-GAPDH (1:10,000; Millipore), rabbit anti-V5 (1:1000; Abcam), rabbit anti-β4 (in-house non-commercial antibody provided by J. Hirst) (1:400), rabbit anti-ATG9A (1:1000; Abcam), sheep anti-TGN46 (Bio-Rad), and anti-MAP2.

[0126] Protein extraction and Western blotting for protein expression analysis. Tissues were collected from mice under terminal anesthesia and flash-frozen in liquid nitrogen. Tissues were homogenized using a Dounce homogenizer in ice-cold RIPA buffer (50 mM Tris-HCl pH 7.4; 1% v / v NP-40; 0.5% w / v sodium deoxycholate; 0.1% v / v SDS; 150 mM NaCl; 2 mM EDTA) containing 1x protease inhibitor cocktail (Sigma-Aldrich). Lysate protein concentration was determined using a BCA assay (Thermo Scientific Pierce™). 40 μg of protein lysate was denatured by heating at 100°C for 5 minutes in the presence of 4x loading buffer (10 ml of buffer contained: 240 mM Tris-HCl pH 6.8; 8% w / v SDS; 40% glycerol; 0.01% bromophenol blue; 10% β-mercaptoethanol). Because boiling results in ATG9A aggregation and loss of signal, lysates intended for quantification of ATG9A protein levels were heated to 50°C. The lysates were then loaded onto a 4-20% gradient mini-PROTEAN® TGX™ precast polyacrylamide gel (Bio-Rad). The gel was run at 180 V in running buffer (25 mM Tris, 192 mM glycine, 0.1% SDS, pH 8.3) for approximately 50 minutes or until the dye front reached the bottom of the gel. Separated proteins were electrophoretically transferred to an Immobilon-P PVDF membrane (Millipore) presoaked in methanol. Protein transfer was performed in transfer buffer (25 mM Tris, 192 mM glycine, 5% v / v methanol) at 250 mA for 1.5 hours or at 40 mA overnight. The membrane was blocked in 5% milk / TBS-T for 1 hour. Primary antibodies were diluted in 5% milk / TBS-T or 5% BSA / TBS-T and incubated with the membrane overnight at 4°C. After primary antibody incubation, the membrane was washed 3 times in TBS-T buffer for 15 minutes each.Secondary antibodies, anti-mouse HRP (1:3000) and anti-rabbit HRP (1:3000), were diluted in 5% milk / TBS-T and incubated with the membrane for 2 hours at room temperature. After secondary antibody incubation, the membrane was washed three times in TBS-T buffer for 15 minutes each, followed by a final wash in PBS for 15 minutes. Protein bands were visualized using ECL Prime Western blotting detection reagents (Amersham) and a G-Box imaging system (Syngene). Densitometric analysis of the protein bands was performed using Image J software.

[0127] Western blotting was performed using the following protocol: Cell lysates were extracted as described above. 40 μg of protein per lane was loaded onto a 10-well 4-12% Bis-Tris precast gel. The gel was run in 2-(N-morpholino)ethanesulfonic acid (MES) buffer and wet transferred to a nitrocellulose membrane (overnight at a constant amperage of 100 mA). The membrane was blocked for 1 hour in 5% milk / TBS-T. Primary antibody was added (anti-AP4B1, 1:400 in 5% BSA) for 2 hours at room temperature, followed by 4 × 15-minute washes in PBS-T. Secondary antibody was added in 5% milk-TBS-T for 30 minutes at room temperature. The membrane was washed 5 × 5 minutes in PBS-T, followed by a 15-minute longer wash in PBS. The membrane was developed using ECL Prime Western blotting detection reagent (Amersham).

[0128] cell culture Human embryonic kidney (HEK) 293T cells, HeLa-M / HeLa-AP4B1 - / -Cells (gift from Dr. J. Hirst) and human fibroblast cell lines were cultured at 37°C and 5% CO in growth medium consisting of Dulbecco's modified Eagle's medium (DMEM, Sigma) supplemented with 10% v / v fetal bovine serum (FBS, Sigma, MI, US) and 1% v / v penicillin (100 U / ml) and streptomycin (100 U / ml) (Lonza, Basel, Switzerland).

[0129] For primary cortical neuron culture, E18 non-transgenic rat embryos and E16 mouse embryos were transfected with wild-type and C57BL / 6J-Ap4b1 mice essentially as described by (Krichevsky et al., 2001). em5Lutzy Neurons were collected from pregnant / J mice. Briefly, cortices were dissected, digested in 0.25% trypsin in calcium- and magnesium-free HBSS (GIBCO) for 15 min at 37°C, and manually dissociated in trituration medium using three fire-baked Pasteur pipettes with successively smaller openings. Dissociated cortical neurons were then plated on poly-D-lysine (Sigma)-coated plates and maintained in Neurobasal medium (Life Technologies) supplemented with 2% B27 (Life Technologies), 0.5 mM GlutaMax (Life Technologies), 100 U / ml penicillin, and 100 μg / ml streptomycin (Lonza).

[0130] AP4B1 knockout HeLa cells (HeLa-AP4B1 - / - ) was provided by Dr. J. Hirst, and its production was 9 is described in.

[0131] AP4B1-deficient human fibroblasts from patient SPG47, heterozygous family members, and age-matched homozygous wild-type controls were kindly provided by Dr. Henry Houlden and Dr. Ivy Pin-Fang Chen.

[0132] Plasmid and viral construct production The AAV2-ITR transgene transfer plasmid, created as described above, was amplified in NEB Stable E. coli cells (New England Biolabs) and purified using the Qiagen Plasmid Plus kit. The adenovirus helper genes (pHelper) and Rep-Cap genes (pAAV2 / 9) were provided in trans and were commercially obtained through Plasmid Factory. The pseudotyped AAV9 viral vector was 6 It was produced in-house according to the protocol described in. [Example]

[0133] The size of the human AP4B1 cDNA open reading frame (2,800 bp) means that simple gene replacement options are technically feasible and amenable to typical viral delivery approaches, such as using single-stranded adeno-associated virus (AAV), which has an insert limit of approximately 4,000 bp. We designed an AAV vector to achieve therapeutic levels of transgene expression (Figure 2A): 1) We developed an expression cassette containing a 0.8 kb CBh promoter and a 130 bp SV40 polyA to drive human AP4B1 expression. The CBh promoter has been reported to mediate efficient transgene expression in rodents and non-human primates; 2) a vector expressing an N-terminal V5 viral epitope-tagged human AP4B1 cDNA, allowing in vitro and in vivo detection of AP4B1 restoration in the absence of an appropriate anti-AP4B1 antibody; and 3) a V5-tagged AP4B1 construct expressed from a lentiviral vector, allowing in vitro validation of efficacy in cell types not efficiently transduced by AAV9 (e.g., fibroblasts). All constructs have been shown to efficiently express their viral cargo upon transfection or transduction in HeLa cells (Figure 2B, 2C), primary rat cortical neurons (Figure 2D), and human fibroblasts (Figure 2E), as determined by Western blotting, RT-qPCR, and immunohistochemistry. The viral construct efficiently restored AP4B1 protein expression in both a CRISPR-generated AP4B1-knockout HeLa cell line and fibroblasts from SPG47 patient, which lack endogenous AP4B1 (Figures 2B, 2C, and 2E). Expression of V5-tagged AP4B1 in SPG47 patient fibroblasts also rescued both ATG9A overexpression and mislocalization (Figure 3). [Example]

[0134] AP4B1 - / -To select an appropriate delivery route for optimal efficacy of AAV9-CBh-hAP4B1 therapy in mouse models, we designed an in vivo experiment to test the two major delivery paradigms of gene therapy for central nervous system (CNS) diseases: intra-CSF versus intravenous delivery (Figure 4). Indeed, AAV9 has been shown to cross the blood-brain barrier (BBB), particularly when administered in neonates, and has been delivered intravenously in successful preclinical (Valori et al., 2010) and clinical (Mendell et al., 2017) studies of CNS diseases, achieving robust therapeutic potential from this minimally invasive delivery route. However, intracerebrospinal fluid (CSF) delivery provides immediate access to the CNS, thus increasing the likelihood of reaching disease target cells, and for that reason it has also been used to deliver gene therapy treatments in preclinical (Iannitti et al., 2018) and clinical (Miller et al., 2020; Mueller et al., 2020) studies attempting to treat neurodegenerative diseases.

[0135] Based on this, the present inventors have determined that AP4B1 - / - At P2 / P3, we set out to evaluate the therapeutic efficacy of AAV9-hAP4B1 delivered either into the CSF via injection in the cisterna magna (intracisternal, ICM) or intravenously via injection in the facial vein (intravenous, IV). As a viral control group, we injected AAV9-V5 alone (lacking the hAP4B1 transgene but containing the same CBh promoter, V5 tag, and poly-A signal) using the same delivery route. We also maintained wild-type (WT) and homozygous untreated animals. We determined that male homozygotes for AP4B1 had a stronger disease phenotype. - / -Given our in-house characterization of mouse models, we decided to focus our resources by conducting this experiment in males only. The following viral vectors used in this experiment were either produced in-house or outsourced to a CRO (VectorBuilder): AAV9-V5 only; AAV9-V5-hAP4B1; and AAV9-untagged hAP4B1. Figure 4B summarizes the number of pups recruited and sacrificed for this experiment.

[0136] By perfusion with PBS, tissues were processed for either biochemical or histological analysis.

[0137] For biochemical testing, CNS tissue was divided into cerebrum, cerebellum, and spinal cord for better understanding of the therapeutic potential of treatment in distinct, well-defined regions.

[0138] We began by tracking viral biodistribution in the CNS of treated mice by performing qPCR on tissue-extracted genomic DNA using primers that bind in poly-A sequences, and the results are summarized in Figure 4C. As determined by qPCR, cisternal delivery of AAV9-V5 alone and AAV9-V5-hAP4B1 was far superior to intravenous delivery in transducing all studied areas of the CNS, even though the injections were performed neonatally and AAV9 can cross the BBB.

[0139] Following biodistribution, we assessed hAP4B1 transgene mRNA expression in the studied tissues using RT-qPCR on tissue-extracted RNA with primers binding to the hAP4B1 transgene, and the results are summarized in Figure 5. Consistent with the results obtained from viral genome biodistribution, cisternal injection of AAV9-CBh-hAP4B1 was significantly more effective at inducing hAP4B1 mRNA expression in all CNS regions analyzed.

[0140] The loss-of-function hypothesis for SPG47 is supported by considerable evidence, as mutations in all three other subunits of the AP4 complex (AP4M1; AP4S1, and AP4E1) disrupt the normal function of the tetrameric protein and cause a clinical picture very similar to that of SPG47. Thus, loss of any of its subunits appears to cause AP4-deficiency disease, with early-onset progressive spastic paraplegia and intellectual disability as its cardinal features. To investigate whether ICM or IV delivery restored the functionality of the AP-4 complex, we extracted proteins from CNS tissues and Western blotted them to detect the protein expression level of another AP-4 subunit, AP4E1. The results are summarized in Figure 7. AP4E1 expression was significantly correlated with AP4B1. - / - Although absent in homozygous untreated mice and animals treated with AAV9-V5 alone, ICM administration of AAV9-V5-hAP4B1 successfully restored AP4E1 protein levels in all analyzed CNS regions with efficiencies of approximately 25% (cerebrum), 16% (cerebellum), and 36% (spinal cord) of WT levels. Intravenous delivery of AAV9-V5-hAP4B1 did not induce a detectable rescue of AP4E1 expression in the cerebrum and cerebellum, but induced a smaller rescue in the spinal cord than ICM injection.

[0141] Having collected considerable data from the biochemical analysis of tissues, we decided to perform some histological analysis, i.e., to identify another important feature of SPG47, AP4B1 - / - We proceeded to examine the effects of AAV9-hAP4B1 on corpus callosum thickness and lateral ventricle hypertrophy in coronal brain sections (Figure 8). The results, summarized in Figure 9, clearly demonstrate that AP4B1 gene replacement resulted in rescue of corpus callosum thickness and lateral ventricle hypertrophy.

[0142] We then proceeded to investigate whether AAV9-hAP4B1 corrects ATG9A mislocalization, a well-established molecular hallmark of AP-4 neurodegenerative disease. Immunofluorescence labeling was performed on brain sections using anti-ATG9A, and the results are summarized in Figure 10. As expected, ATG9A shows mislocalization in homozygous mice compared with WT littermates across all CNS regions analyzed. ICM delivery of AAV9-hAP4B1 successfully corrected this phenotype in the cerebellum and brainstem (Figure 10). Gene replacement approaches using the CBh and synapsin promoters were tested.

[0143] Interestingly, our gene therapy approach resulted in correction of the spasticity phenotype observed in the Ap4b1 − / − mouse model. The data are summarized in Figure 11. [Example]

[0144] Dose-response study investigating AAV9_CBh_hAP4B1 gene treatment in the SPG47 mouse model. SPG47 KO mice (ap4b1- / -) were treated with AAV9_CBh_hAP4B1 or AAV9_CBh_V5_empty vector around P60 using cisternal delivery. Three different doses of AAV9_CBh_hAP4B1 were delivered: low dose (6x10E10 vg), medium dose (8x10E10 vg), and high dose (1x10E11 vg). Mice were sacrificed at 2 and 4 months of age. Mouse weight and spasticity phenotype were assessed weekly. Tissues were obtained at 2 months for biochemical analysis, and brains were fixed at 4 months for anatomical analysis (corpus callosum and lateral vertical size) and ATG9A accumulation analysis (Table 1).

[0145] [Table 2]

[0146] Weight and spasticity Treated mice show no adverse effects on weight gain (see Figure 15). Spasticity data show progression of hindlimb spasticity severity over time in untreated and V5-ony treated (control) SPG47 mice. Wild-type mice do not exhibit an age-related spasticity phenotype. Treatment with all three doses shows a reduction in hindlimb spasticity severity progression over time (see Figure 16). Low-dose treatment resulted in 86% rescue of hindlimb spasticity severity at 120 days, 76% rescue for mid-dose treatment and 55% rescue for high-dose treatment.

[0147] Rotarod latency to fall Data on rotarod performance at 6 months of age (4 months post-injection) showing possible rescue of this phenotype by both medium and high dose treatments. See Figure 17.

[0148] Brain weight Herein, we measured brain weight immediately after the sacrifice of mice after autopsy.Two months after treatment, treated mice (V5-only) showed significantly reduced brain weight compared with wild-type mice in females.This data suggests that all three doses of treatment rescue this brain weight phenotype (see Figure 18A): 98% rescue with low-dose treatment, 85% rescue with medium-dose treatment, and 96% rescue with high-dose treatment.Brain weight measured in males four months after injection shows a similar pattern of data (see Figure 18B).

[0149] Corpus callosum thinning analysis Corpus callosum measurements were taken across eight consistent locations in the brains of treated mice. Corpus callosum thickness varies across these locations. SPG47 control-treated mice (V5-only) show reduced corpus callosum thickness (orange dataset) compared to wild-type (blue dataset). AAV9_Cbh_hAP4B1 high-dose treated mice show rescue of corpus callosum thickness to wild-type levels (see Figure 19). [Example]

[0150] Effect of AAV9-AP4B1 gene replacement on neurofilament L (NFL) levels in cerebrospinal fluid (CSF) and plasma. As shown in Figure 19, Ap4b1- / - mice treated with AAV9-CBh-AP4B1 and AAV9-synapsin1-AP4B1 vectors showed a reduction in NFL levels in both CSF and plasma to levels similar to those seen in wild-type mice. Untreated mice showed increased levels compared to wild-type mice. This indicates that this vector can effectively reduce neurofilament levels in patients lacking AP4B1.

[0151] References [Table 3] [Table 4] [Table 5]

Claims

1. in the 5' to 3' direction between the first inverted repeat sequence and the second inverted repeat sequence i) a promoter adapted for expression in a mammalian neuron, said promoter being associated with an enhancer nucleotide motif; ii) intron nucleotide sequences; and iii) polyadenylation signal nucleotide sequence 1. An isolated nucleic acid molecule comprising a transcription cassette comprising: An isolated nucleic acid molecule, wherein the cassette further comprises a nucleic acid molecule comprising a nucleotide sequence encoding at least one protein of the AP-4 complex.

2. The isolated nucleic acid molecule of claim 1, wherein the enhancer motif is a CMV enhancer.

3. 3. The isolated nucleic acid molecule of claim 2, wherein the CMV enhancer motif comprises or consists of the nucleotide sequence of SEQ ID NO: 1 or a polymorphic nucleotide sequence variant thereof.

4. 4. The isolated nucleic acid molecule of claim 1, wherein the polyadenylation signal is a growth hormone (GH) polyadenylation signal.

5. 5. The isolated nucleic acid molecule of claim 4, wherein the GH polyadenylation signal comprises or consists of the nucleotide sequence of SEQ ID NO: 4 or a polymorphic sequence variant thereof.

6. 6. The isolated nucleic acid molecule of claim 1, wherein the promoter is a chicken beta-actin promoter, a JeT promoter, an hSyn promoter, a MeP229 promoter, or an AP4B1 promoter.

7. 7. The isolated nucleic acid molecule of claim 6, wherein the chicken beta actin promoter comprises or consists of the nucleotide sequence of SEQ ID NO:

3.

8. 7. The isolated nucleic acid molecule of claim 6, wherein the chicken beta actin promoter comprises or consists of the nucleotide sequence of SEQ ID NO:

28.

9. 8. The isolated nucleic acid molecule of any one of claims 1 to 7, wherein the transcription cassette comprises or consists of the nucleotide sequence of SEQ ID NO:

9.

10. the expression cassette i) the nucleotide sequence or polymorphic sequence variant set forth in SEQ ID NO: 15 (AP4B1); ii) a nucleotide sequence, which, as a result of the genetic code, is degenerate to the nucleotide sequence defined in (i); iii) a nucleic acid molecule whose complementary strand hybridizes to the sequence of SEQ ID NO: 15 (AP4B1) under stringent hybridization conditions, wherein the nucleic acid molecule encodes a polypeptide that forms a complex with a polypeptide that constitutes the AP-4 complex; iv) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 16 (AP4B1); v) A nucleotide sequence encoding a polypeptide comprising an amino acid sequence modified by addition, deletion, or substitution of at least one amino acid residue as set forth in iv), wherein the polypeptide forms a complex with a polypeptide constituting the AP-4 complex.

10. The isolated nucleic acid molecule of any one of claims 1 to 9, comprising a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of:

11. the expression cassette i) the nucleotide sequence or polymorphic sequence variant set forth in SEQ ID NO: 17 (AP4E1); ii) a nucleotide sequence, which, as a result of the genetic code, is degenerate to the nucleotide sequence defined in (i); iii) a nucleic acid molecule whose complementary strand hybridizes to the sequence of SEQ ID NO: 17 (AP4E1) under stringent hybridization conditions, wherein the nucleic acid molecule encodes a polypeptide that forms a complex with a polypeptide that constitutes the AP-4 complex; iv) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 18 (AP4E1); v) A nucleotide sequence encoding a polypeptide comprising an amino acid sequence modified by addition, deletion, or substitution of at least one amino acid residue as set forth in iv), wherein the polypeptide forms a complex with a polypeptide constituting the AP-4 complex.

10. The isolated nucleic acid molecule of any one of claims 1 to 9, comprising a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of:

12. 10. The expression cassette of claim 9, i) the nucleotide sequence or polymorphic sequence variant set forth in SEQ ID NO: 19 (AP4M1); ii) a nucleotide sequence, which, as a result of the genetic code, is degenerate to the nucleotide sequence defined in (i); iii) a nucleic acid molecule whose complementary strand hybridizes to the sequence of SEQ ID NO: 19 (AP4M1) under stringent hybridization conditions, wherein the nucleic acid molecule encodes a polypeptide that forms a complex with a polypeptide that constitutes the AP-4 complex; iv) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 20 (AP4M1); v) A nucleotide sequence encoding a polypeptide comprising an amino acid sequence modified by addition, deletion, or substitution of at least one amino acid residue as set forth in iv), wherein the polypeptide forms a complex with a polypeptide constituting the AP-4 complex.

10. The isolated nucleic acid molecule of any one of claims 1 to 9, comprising a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of:

13. the expression cassette i) the nucleotide sequence or polymorphic sequence variant set forth in SEQ ID NO: 21 (AP4S1); ii) a nucleotide sequence, which, as a result of the genetic code, is degenerate to the nucleotide sequence defined in (i); iii) a nucleic acid molecule whose complementary strand hybridizes to the sequence of SEQ ID NO: 21 (AP4S1) under stringent hybridization conditions, wherein the nucleic acid molecule encodes a polypeptide that forms a complex with a polypeptide that constitutes the AP-4 complex; iv) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 22 (AP4S1); iv) A nucleotide sequence encoding a polypeptide comprising an amino acid sequence modified by addition, deletion, or substitution of at least one amino acid residue as set forth in (iv), wherein the polypeptide forms a complex with a polypeptide constituting the AP-4 complex.

10. The isolated nucleic acid molecule of any one of claims 1 to 9, comprising a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of:

14. 14. An expression vector comprising a transcription cassette as defined in any one of claims 1 to 13.

15. The expression vector of claim 14, wherein the expression vector is a viral-based expression vector.

16. 16. The expression vector of claim 15, wherein the viral-based vector is an adeno-associated virus [AAV].

17. 17. The expression vector of claim 16, wherein the viral-based vector is AAV9 or AAV10.

18. 17. The expression vector of claim 16, wherein the viral-based vector is an enhanced AAV9 vector, such as a PHP-b vector.

19. 19. An expression vector according to any one of claims 16 to 18, wherein the AAV vector is based on a single-stranded AAV virus.

20. 20. The expression vector of claim 19, wherein the AAV vector is based on a self-complementary AAV virus.

21. 16. The expression vector of claim 15, wherein the viral-based vector comprises the nucleotide sequence set forth in SEQ ID NO:

10.

22. 16. The expression vector of claim 15, wherein the viral-based vector comprises the nucleotide sequence set forth in SEQ ID NO:

11.

23. 16. The expression vector of claim 15, wherein the viral-based vector comprises the nucleotide sequence set forth in SEQ ID NO:

12.

24. 16. The expression vector of claim 15, wherein the viral-based vector comprises the nucleotide sequence set forth in SEQ ID NO:

13.

25. 16. The expression vector of claim 15, wherein the viral-based vector comprises the nucleotide sequence set forth in SEQ ID NO:

14.

26. 16. The expression vector of claim 15, wherein the viral-based vector comprises the nucleotide sequence set forth in SEQ ID NO:

23.

27. 16. The expression vector of claim 15, wherein the viral-based vector comprises the nucleotide sequence set forth in SEQ ID NO:

24.

28. 16. The expression vector of claim 15, wherein the viral-based vector comprises the nucleotide sequence set forth in SEQ ID NO:

25.

29. 16. The expression vector of claim 15, wherein the viral-based vector comprises the nucleotide sequence set forth in SEQ ID NO:

26.

30. 16. The expression vector of claim 15, wherein the viral-based vector comprises the nucleotide sequence set forth in SEQ ID NO:

27.

31. 31. A pharmaceutical composition comprising an expression vector according to any one of claims 14 to 30 and an excipient or carrier.

32. 32. An expression vector according to any one of claims 14 to 30 or a composition according to claim 31 for use as a medicament in a subject.

33. 32. An expression vector according to any one of claims 14 to 30 or a composition according to claim 31 for use in treating AP-4 hereditary spastic paraplegia in a subject.

34. 34. The expression vector of claim 32 or 33, wherein the subject is a pediatric subject.

35. 32. A method for determining the effectiveness of a treatment for hereditary spastic paraplegia in a subject, wherein the subject is treated with an expression vector according to claims 14 to 30 or a pharmaceutical composition according to claim 31, said method comprising: a) measuring the level of neurofilament L (NFL) in a biological sample obtained from a subject suffering from hereditary spastic paraplegia prior to administration of an expression vector according to claims 14 to 30 or a pharmaceutical composition according to claim 31; and b) comparing said level with the level of NFL in a biological sample obtained from said subject suffering from hereditary spastic paraplegia after said administration of an expression vector according to claims 14 to 30 or a pharmaceutical composition according to claim 31. Including, A method in which i) if the NFL level is lower compared to the level obtained in step a), the treatment with the expression vector or composition is discontinued, or ii) if the level is the same as the level in step a), the treatment with the expression vector described in claims 14 to 30 or the composition described in claim 31 is continued.

36. 36. The method of claim 35, wherein the expression vector is selected from the group consisting of SEQ ID NOs: 10, 11, 12, 13, 14, 23, 24, 25, 26 and 27.

37. 37. The method according to claim 35 or 36, wherein the sample under b) is obtained during a period of 1 to 6 days or 1 to 4 weeks.

38. 32. A method for determining the efficacy of hereditary spastic paraplegia in a subject suffering from hereditary spastic paraplegia, wherein the subject is treated with an expression vector according to claims 14 to 30 or a pharmaceutical composition according to claim 31, said method comprising: a) measuring the level of neurofilament L (NFL) in a biological sample obtained from the subject suffering from hereditary spastic paraplegia and treated with the expression vector or composition; and b) comparing said levels with those of a control subject A method comprising:

39. 39. The method of claim 38, wherein the expression vector is selected from the group consisting of SEQ ID NOs: 10, 11, 12, 13, 14, 23, 24, 25, 26 and 27.

40. c) if the level in the biological sample obtained from the subject suffering from hereditary spastic paraplegia is the same as or lower than the NFL level in the biological sample obtained from the control subject, the treatment is effective and is discontinued.

40. The method of any one of claims 38 to 39, further comprising:

41. c) if the level in the biological sample obtained from the subject suffering from hereditary spastic paraplegia is higher than the NFL level in the biological sample obtained from the control subject, the treatment is ineffective and the treatment with the expression vector of claims 14 to 30 or the pharmaceutical composition of claim 31 is continued.

50. The method of any one of claims 38 to 49, further comprising:

Images